WorldWideScience

Sample records for raw food samples

  1. Food Safety and Raw Milk

    Science.gov (United States)

    ... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...

  2. Basic Thermal Parameters of Selected Foods and Food Raw Materials

    OpenAIRE

    Monika Božiková; Ľubomír Híreš; Michal Valach; Martin Malínek; Jan Mareček

    2017-01-01

    In general, processing and manipulation with foods and food raw materials have significant influence on their physical properties. The article is focused on thermophysical parameters measurement of selected foods and food raw materials. There were examined thermal conductivity and thermal diffusivity of selected materials. For detection of thermal parameters was used instrument Isomet 2104, which principle of measurement is based on transient methods. In text are presented summary results of ...

  3. Basic Thermal Parameters of Selected Foods and Food Raw Materials

    Directory of Open Access Journals (Sweden)

    Monika Božiková

    2017-01-01

    Full Text Available In general, processing and manipulation with foods and food raw materials have significant influence on their physical properties. The article is focused on thermophysical parameters measurement of selected foods and food raw materials. There were examined thermal conductivity and thermal diffusivity of selected materials. For detection of thermal parameters was used instrument Isomet 2104, which principle of measurement is based on transient methods. In text are presented summary results of thermal parameters measurement for various foods and food raw materials as: granular materials – corn flour and wheat flour; fruits, vegetables and fruit products – grated apple, dried apple and apple juice; liquid materials – milk, beer etc. Measurements were performed in two temperature ranges according to the character of examined material. From graphical relations of thermophysical parameter is evident, that thermal conductivity and diffusivity increases with temperature and moisture content linearly, only for granular materials were obtained non‑linear dependencies. Results shows, that foods and food raw materials have different thermal properties, which are influenced by their type, structure, chemical and physical properties. From presented results is evident, that basic thermal parameters are important for material quality detection in food industry.

  4. Occurrence of Campylobacter spp. in raw and ready-to-eat foods and in a Canadian food service operation.

    Science.gov (United States)

    Medeiros, Diane T; Sattar, Syed A; Farber, Jeffrey M; Carrillo, Catherine D

    2008-10-01

    The occurrence of Campylobacter spp. in a variety of foods from Ottawa, Ontario, Canada, and raw milk samples from across Canada was determined over a 2-year period. The samples consisted of 55 raw foods (chicken, pork, and beef), 126 raw milk samples from raw milk cheese manufacturers, and 135 ready-to-eat foods (meat products, salads, and raw milk cheeses). Campylobacter jejuni was detected in 4 of the 316 samples analyzed: 1 raw beef liver sample and 3 raw chicken samples. An isolation rate of 9.7% was observed among the raw chicken samples tested. This study also investigated the role of cross-contamination in disseminating Campylobacter from raw poultry within a food service operation specializing in poultry dishes. Accordingly, kitchen surfaces within a restaurant in Ottawa, Ontario, were sampled between March and August 2001. Tests of the sampling method indicated that as few as 100 Campylobacter cells could be detected if sampling was done within 45 min of inoculation; however, Campylobacter spp. were not detected in 125 swabs of surfaces within the kitchens of this food service operation. Despite the reported high prevalence of Campylobacter spp. in raw poultry, this organism was not detected on surfaces within a kitchen of a restaurant specializing in poultry dishes.

  5. Traceability of Plant Diet Contents in Raw Cow Milk Samples

    Science.gov (United States)

    Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego

    2009-01-01

    The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982

  6. Aluminium content of some processed foods, raw materials and food additives in China by inductively coupled plasma-mass spectrometry.

    Science.gov (United States)

    Deng, Gui-Fang; Li, Ke; Ma, Jing; Liu, Fen; Dai, Jing-Jing; Li, Hua-Bin

    2011-01-01

    The level of aluminium in 178 processed food samples from Shenzhen city in China was evaluated using inductively coupled plasma-mass spectrometry. Some processed foods contained a concentration of up to 1226 mg/kg, which is about 12 times the Chinese food standard. To establish the main source in these foods, Al levels in the raw materials were determined. However, aluminium concentrations in raw materials were low (0.10-451.5 mg/kg). Therefore, aluminium levels in food additives used in these foods was determined and it was found that some food additives contained a high concentration of aluminium (0.005-57.4 g/kg). The results suggested that, in the interest of public health, food additives containing high concentrations of aluminium should be replaced by those containing less. This study has provided new information on aluminium levels in Chinese processed foods, raw materials and a selection of food additives.

  7. Food safety hazards associated with consumption of raw milk.

    Science.gov (United States)

    Oliver, Stephen P; Boor, Kathryn J; Murphy, Steven C; Murinda, Shelton E

    2009-09-01

    An increasing number of people are consuming raw unpasteurized milk. Enhanced nutritional qualities, taste, and health benefits have all been advocated as reasons for increased interest in raw milk consumption. However, science-based data to substantiate these claims are limited. People continue to consume raw milk even though numerous epidemiological studies have shown clearly that raw milk can be contaminated by a variety of pathogens, some of which are associated with human illness and disease. Several documented milkborne disease outbreaks occurred from 2000-2008 and were traced back to consumption of raw unpasteurized milk. Numerous people were found to have infections, some were hospitalized, and a few died. In the majority of these outbreaks, the organism associated with the milkborne outbreak was isolated from the implicated product(s) or from subsequent products made at the suspected dairy or source. In contrast, fewer milkborne disease outbreaks were associated with consumption of pasteurized milk during this same time period. Twenty nine states allow the sale of raw milk by some means. Direct purchase, cow-share or leasing programs, and the sale of raw milk as pet food have been used as means for consumers to obtain raw milk. Where raw milk is offered for sale, strategies to reduce risks associated with raw milk and products made from raw milk are needed. Developing uniform regulations including microbial standards for raw milk to be sold for human consumption, labeling of raw milk, improving sanitation during milking, and enhancing and targeting educational efforts are potential approaches to this issue. Development of pre- and postharvest control measures to effectively reduce contamination is critical to the control of pathogens in raw milk. One sure way to prevent raw milk-associated foodborne illness is for consumers to refrain from drinking raw milk and from consuming dairy products manufactured using raw milk.

  8. Toxicological evaluation of some Malaysian locally processed raw food products.

    Science.gov (United States)

    Sharif, R; Ghazali, A R; Rajab, N F; Haron, H; Osman, F

    2008-01-01

    Malaysian locally processed raw food products are widely used as main ingredients in local cooking. Previous studies showed that these food products have a positive correlation with the incidence of cancer. The cytotoxicity effect was evaluated using MTT assay (3-(4,5-dimetil-2-thiazolil)-2,5-diphenyl-2H-tetrazolium bromide) against Chang liver cells at 2000 microg/ml following 72 h incubation. Findings showed all methanol extracts caused a tremendous drop in the percentage of cell viability at 2000 microg/ml (shrimp paste - 41.69+/-3.36%, salted fish - 37.2+/-1.06%, dried shrimp - 40.32+/-1.8%, pfood showed that shrimp paste did not comply with the protein requirement (Food Act 1983. Salt was found in every sample with the highest percentage being detected in shrimp paste which exceeded 20%. Following heavy metal analysis (arsenic, cadmium, lead and mercury), arsenic was found in every sample with dried shrimps showing the highest value as compared to the other samples (6.16 mg/kg). In conclusion, several food extracts showed cytotoxic effect but did not cause DNA damage against Chang liver cells. Salt was found as the main additive and arsenic was present in every sample, which could be the probable cause of the toxicity effects observed.

  9. CAN BE BLUEBERRIES THE RISK FOOD AND RAW MATERIAL?

    Directory of Open Access Journals (Sweden)

    Michal Medvecký2

    2012-02-01

    Full Text Available Fruits of the highbush blueberries are popular for their beneficial effects on human health and for their excellent sweet-vine taste. Our work is focused on risk assessment of selected elements in relation to the content of bioactive compounds in wild and cultivated of highbush blueberries (Vaccinium corymbosum L.. Anthocyanins are polyphenols that are widely distributed in plants, and contribute to the brilliant blue, red or purple colour in leaves, flowers or fruits. In the samples the antioxidant capacity by the method of Brand – Williams using DPPH (2,2–difenyl-1-pikrylhydrazyl and the content of anthocyanins by the modified method Lapornik in two samples of wild blueberries from different areas of Slovakia (Čertovica and Oravské Veselé and in 6 cultivated varieties highbush blueberry (Bluejay, Bluecrop, Patriot, Berkeley, Brigitta, Nelson were determined. The contents of risky elements - Cd, Pb were assessed by AAS method. The contents of Pb were in all observed samples higher than the maximum limit given by the legislation (cultivated: 0.5612 – 0.9912 mg.kg-1, wild: 0.792 – 0.874 mg.kg-1. The measured content values of Cd were in all samples of blueberries lower than hygienic limit. The highest content of anthocyanins from analysed samples was in wild blueberries from surrouding Čertovica 4870.125 ± 22.803 mg.dm-3, but in this sample was simultaneously the lowest antioxidant capacity of 61.15 ± 1.002 %. The highest antioxidant capacity was measured in sample of cultivated variety Bluejay 87.175 ± 0.45 %. It is important to carry out monitoring of heavy metals to consumption of safe food raw materials and foodstuffs.

  10. Bacteriophages safely reduce Salmonella contamination in pet food and raw pet food ingredients.

    Science.gov (United States)

    Soffer, Nitzan; Abuladze, Tamar; Woolston, Joelle; Li, Manrong; Hanna, Leigh Farris; Heyse, Serena; Charbonneau, Duane; Sulakvelidze, Alexander

    2016-01-01

    Contamination of pet food with Salmonella is a serious public health concern, and several disease outbreaks have recently occurred due to human exposure to Salmonella tainted pet food. The problem is especially challenging for raw pet foods (which include raw meats, seafood, fruits, and vegetables). These foods are becoming increasingly popular because of their nutritional qualities, but they are also more difficult to maintain Salmonella -free because they lack heat-treatment. Among various methods examined to improve the safety of pet foods (including raw pet food), one intriguing approach is to use bacteriophages to specifically kill Salmonella serotypes. At least 2 phage preparations (SalmoFresh® and Salmonelex™) targeting Salmonella are already FDA cleared for commercial applications to improve the safety of human foods. However, similar preparations are not yet available for pet food applications. Here, we report the results of evaluating one such preparation (SalmoLyse®) in reducing Salmonella levels in various raw pet food ingredients (chicken, tuna, turkey, cantaloupe, and lettuce). Application of SalmoLyse® in low (ca. 2-4×10 6 PFU/g) and standard (ca. 9×10 6 PFU/g) concentrations significantly ( P contamination in all raw foods examined compared to control treatments. When SalmoLyse®-treated (ca. 2×10 7 PFU/g) dry pet food was fed to cats and dogs, it did not trigger any deleterious side effects in the pets. Our data suggest that the bacteriophage cocktail lytic for Salmonella can significantly and safely reduce Salmonella contamination in various raw pet food ingredients.

  11. Microbiological profile and nutritional quality of raw foods for neutropenic patients under hospital care

    Directory of Open Access Journals (Sweden)

    Paula Cristina Galati

    2013-01-01

    Full Text Available OBJECTIVE: This study aimed to analyze and compare the microbiological profile and vitamin C content of raw and cooked foods destined for neutropenic inpatients. METHODS: Three vegetables and nine fruits, raw and boiled, washed and sanitized were examined. Heat-tolerant coliforms and coagulase-positive staphylococci were counted and the presence of Salmonella spp was investigated. The vitamin C content was analyzed by a colorimetric reaction. The Statistical Package for Social Sciences (SPSS software was used for statistical analysis and the nonparametric Wilcoxon test was used to compare the mean vitamin C values of the cooked and raw foods. The Spearman correlation test was applied to determine the associations between the parameters evaluated RESULTS: Salmonella spp was absent in all samples and the populations of coagulase-positive staphylococci and heat-tolerant coliforms were below the minimum detectable limits of the methods employed (< 100 colony forming units (CFU/g and < 3 most probable number (MPN/g, respectively. There was a significant loss of vitamin C in the cooked foods, 38.9% on average, compared to the raw foods, a loss that was positively correlated with cooking time. CONCLUSION: The fresh fruits and vegetables properly sanitized in this study had a microbiological profile consistent with that required by Brazilian law. Furthermore, the nutritional value of the neutropenic diet is diminished, at least in terms of the vitamin C content.

  12. Importance of Decision Support Systems About Food Safety in Raw Milk Production

    Directory of Open Access Journals (Sweden)

    Ecem Akan

    2015-12-01

    Full Text Available In raw milk production decision support systems for control of food safety hazards has not been developed but main points of this system are available. The decision support systems’ elements include data identification at critical points in the milk supply chain, an information management system and data exchange. Decision supports systems has been developed on the basis of these elements. In dairy sector decision support systems are significant for controlling of food safety hazards and preferred by producers. When these systems are implemented in the milk supply chain, it can be prevented unnecessary sampling and analysis. In this article it will be underlined effects of decision support system elements on food safety of raw milk.

  13. Enhancement of efficiency of storage and processing of food raw materials using radiation technologies

    Energy Technology Data Exchange (ETDEWEB)

    Gracheva, A. Yu.; Zav’yalov, M. A.; Ilyukhina, N. V.; Kukhto, V. A.; Tarasyuk, V. T.; Filippovich, V. P. [All-Russia Research Institute of Preservation Technology (Russian Federation); Egorkin, A. V.; Chasovskikh, A. V. [Research Institute of Technical Physics and Automation (Russian Federation); Pavlov, Yu. S., E-mail: rad05@bk.ru [Frumkin Institute of Physical Chemistry and Electrochemistry, Russian Academy of Sciences (Russian Federation); Prokopenko, A. V., E-mail: pav14@mail.ru [National Research Nuclear University (Moscow Engineering Physics Institute) (Russian Federation); Strokova, N. E. [Moscow State University (Russian Federation); Artem’ev, S. A. [Russian Research Institute of Baking Industry (Russian Federation); Polyakova, S. P. [Russian Research Institute of Confectionery Industry (Russian Federation)

    2016-12-15

    The work is dedicated to improvement of efficiency of storage and processing of food raw materials using radiation technologies. International practice of radiation processing of food raw materials is presented and an increase in the consumption of irradiated food products is shown. The prospects of using radiation technologies for the processing of food products in Russia are discussed. The results of studies of radiation effects on various food products and packaging film by γ radiation and accelerated electrons are presented.

  14. Enhancement of efficiency of storage and processing of food raw materials using radiation technologies

    International Nuclear Information System (INIS)

    Gracheva, A. Yu.; Zav’yalov, M. A.; Ilyukhina, N. V.; Kukhto, V. A.; Tarasyuk, V. T.; Filippovich, V. P.; Egorkin, A. V.; Chasovskikh, A. V.; Pavlov, Yu. S.; Prokopenko, A. V.; Strokova, N. E.; Artem’ev, S. A.; Polyakova, S. P.

    2016-01-01

    The work is dedicated to improvement of efficiency of storage and processing of food raw materials using radiation technologies. International practice of radiation processing of food raw materials is presented and an increase in the consumption of irradiated food products is shown. The prospects of using radiation technologies for the processing of food products in Russia are discussed. The results of studies of radiation effects on various food products and packaging film by γ radiation and accelerated electrons are presented.

  15. Measurement of Aflatoxin M1 in Raw and Pasteurized Cow Milk Samples by HPLC

    Directory of Open Access Journals (Sweden)

    afshin Nazari

    2007-10-01

    Full Text Available Nazari A1, Noroozi H2, Movahedi M3, Khaksarian M1 1. Instructor, Department of Physiology, Faculty of Medicine, Lorestan University of Medical Sciences 2. Assistant Professor, Department of Mycology, Faculty of Medicine, Iran University of Medical Sciences 3. Assistant Professor, Department of Genetic Epidemiology, Faculty of Medicine, Lorestan University of Medical Sciences Abstract Background: Aflatoxin M1 is a hydroxylated form of aflatoxin B1 which is produced by Aspergillus flavus. This toxin is produced when cows or other ruminants eat foods contaminated with these mycotoxins and then excrete them in the milk. The toxin is a potent liver and kidney carcinogenetic agent. Materials and methods: Forty two raw cows milk samples from local sources of milk collection and forty samples of commercial pasteurized market milk from Khorramabad, Lorestan, Iran were collected in summer and winter season of 2005. Twenty-one cow milk samples and 20 pasteurized milk samples in each season were analyzed for the presence of aflatoxin M1 (AFM1 by HPLC immunoaffinity columns. Results: Four of 21 raw milk samples in summer showed AFM1 levels between 0.017-0.046 ng/ml and all samples (100% in winter showed the presence of AFM1 levels between 0.003-0.041ng/ ml. AFM1 was detected in 55% of market pasteurized cow milk samples ranging from 0.017 to 0.533 ng/ml in summer and 100% ranging from 0.005-0.0054 ng/ml in winter.,Only one of all milk samples of pasteurized milk in summer had toxin level (0.533 ng/ml more than the maximum permissive limit (0.5 ng/ml. No significant difference was observed among mean contamination level of raw and pasteurized cow milk in two seasons. Key words: Aflatoxin M1, raw milk, pasteurized milk, Khoramabad, HPLC

  16. Order acceptance in food processing systems with random raw material requirements

    NARCIS (Netherlands)

    Kilic, Onur A.; van Donk, Dirk Pieter; Wijngaard, Jacob; Tarim, S. Armagan

    This study considers a food production system that processes a single perishable raw material into several products having stochastic demands. In order to process an order, the amount of raw material delivery from storage needs to meet the raw material requirement of the order. However, the amount

  17. Determination of Bacterial Pathogen in Foods for Export and their Raw Material

    Energy Technology Data Exchange (ETDEWEB)

    Marambio, E.; Cordano, A. M.; Insunza, M.; Fernández, M.; Astorga, J. [Sección Microbiología de Alimentos, Instituto de Salud Pública de Chile (Chile)

    2005-01-15

    Chile is a South American country with an important fish and shellfish production. These products are some of the most important items for the economy of the country. From 1998 to 2001, Chile exported $1 137 625 788 of fish and shellfish. Statistics also show that frozen vegetables are fast becoming high on the food export list. During recent years (1998 to 2001) $223 312 248 worth of frozen vegetables were exported to different countries. This study was performed to trace the presence of pathogens in some of these Chilean foods to be exported: 97 samples of salmon and 84 samples of different frozen vegetables (asparagus, peas and corn) were analyzed in order to determine their levels of microbial contamination. Total bacteria counts (mesophilic aerobes bacteria), Escherichia coli, Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, Salmonella spp. and Listeria monocytogenes were tested. Vibrio cholerae was tested only in salmon samples. The analysis of salmon samples showed that the raw material presented a very good quality. However, during the filleting process the fish was contaminated, presenting higher total bacteria counts. Only one of the 48 final product samples presented contamination with a pathogenic bacteria (Listeria monocytogenes (<100 cfu/g)). Frozen vegetable samples (raw material and final products) did not present any of the pathogen bacteria studied. The mesophilic aerobes bacteria counts were reduced during processing due to the effectiveness of the good manufacturing practices and the technological process used. (author)

  18. Determination of Bacterial Pathogen in Foods for Export and their Raw Material

    International Nuclear Information System (INIS)

    Marambio, E.; Cordano, A.M.; Insunza, M.; Fernández, M.; Astorga, J.

    2005-01-01

    Chile is a South American country with an important fish and shellfish production. These products are some of the most important items for the economy of the country. From 1998 to 2001, Chile exported $1 137 625 788 of fish and shellfish. Statistics also show that frozen vegetables are fast becoming high on the food export list. During recent years (1998 to 2001) $223 312 248 worth of frozen vegetables were exported to different countries. This study was performed to trace the presence of pathogens in some of these Chilean foods to be exported: 97 samples of salmon and 84 samples of different frozen vegetables (asparagus, peas and corn) were analyzed in order to determine their levels of microbial contamination. Total bacteria counts (mesophilic aerobes bacteria), Escherichia coli, Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, Salmonella spp. and Listeria monocytogenes were tested. Vibrio cholerae was tested only in salmon samples. The analysis of salmon samples showed that the raw material presented a very good quality. However, during the filleting process the fish was contaminated, presenting higher total bacteria counts. Only one of the 48 final product samples presented contamination with a pathogenic bacteria (Listeria monocytogenes (<100 cfu/g)). Frozen vegetable samples (raw material and final products) did not present any of the pathogen bacteria studied. The mesophilic aerobes bacteria counts were reduced during processing due to the effectiveness of the good manufacturing practices and the technological process used. (author)

  19. Towards a decision support system for control of multiple food safety hazards in raw milk production

    NARCIS (Netherlands)

    Spiegel, van der M.; Sterrenburg, P.; Haasnoot, W.; Fels-Klerx, van der H.J.

    2013-01-01

    Decision support systems (DSS) for controlling multiple food safety hazards in raw milk production have not yet been developed, but the underlying components are fragmentarily available. This article presents the state-of-the-art of essential DSS elements for judging food safety compliance of raw

  20. INCIDENCE OF FILAMENTOUS FUNGI WITH TOXIGENIC POTENTIAL ON SAMPLES OF FEED AND RAW MATERIALS FOR THEIR MANUFACTURE

    Directory of Open Access Journals (Sweden)

    Rodrigo Vera

    2016-06-01

    Full Text Available The presence and/or accumulation of mycotoxins in foods intended for human and animal nutrition is a constant concern for the harmful health effects resulting from ingestion. The aims of this communication were to analyze samples of feed and raw materials for manufacturing and to determine the presence of strains of filamentous fungi with toxigenic capacity. The values of frequency in the total samples (N = 422, indicated 63% of contamination, where A. flavus represented the most common (29.8%, while in feed and raw materials separately, indicated A. flavus has the highest value in both categories. In the analysis of different type of raw materials, A. flavus contaminated all types of samples, with the bran and soybean meal substrates having higher values for this Aspergillus, and corn substrate more fungal contamination. These results would demonstrate that the presence of mycobiota with toxigenic potential in food for animal feed is a disturbing reality.

  1. Exposure to perfluorinated compounds in Catalonia, Spain, through consumption of various raw and cooked foodstuffs, including packaged food.

    Science.gov (United States)

    Jogsten, Ingrid Ericson; Perelló, Gemma; Llebaria, Xavier; Bigas, Esther; Martí-Cid, Roser; Kärrman, Anna; Domingo, José L

    2009-07-01

    In this study, the role that some food processing and packaging might play as a source of perfluorinated compounds (PFCs) through the diet was assessed. The levels of PFCs were determined in composite samples of veal steak (raw, grilled, and fried), pork loin (raw, grilled, and fried), chicken breast (raw, grilled, and fried), black pudding (uncooked), liver lamb (raw), marinated salmon (home-made and packaged), lettuce (fresh and packaged), pate of pork liver, foie gras of duck, frankfurt, sausages, chicken nuggets (fried), and common salt. Among the 11 PFCs analyzed, only PFHxS, PFOS, PFHxA, and PFOA were detected in at least one composite sample, while the levels of the remaining PFCs (PFBuS, PFHpA, PFNA, PFDA, PFUnDA, and PFDoDA) were under their respective detection limits. PFOS was the compound most frequently detected, being found in 8 of the 20 food items analyzed, while PFHxA was detected in samples of raw veal, chicken nuggets, frankfurt, sausages, and packaged lettuce. According to the results of the present study, it is not sufficiently clear if cooking with non-stick cookware, or packaging some foods, could contribute to a higher human exposure to PFCs.

  2. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan

    2015-01-01

    The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  3. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

    Directory of Open Access Journals (Sweden)

    Shi Wu

    Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  4. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan

    2015-01-01

    The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  5. Rfa method application for determination of heavy metals content in foods and industrial raw products

    International Nuclear Information System (INIS)

    Matveeva, I.M.

    1999-01-01

    The issue of improvement of the people's lives quality is considered to be of the highest priority according to the U N classification. It is known that its solution lies with the quality of drinking water and foods, which is defined, to a great extent, by the ecological situation of a concrete living region. As a rule, the existing methods of food analysis are mostly meant for determination of one chemical substance in a certain food. The analysis methods developed by authors are versatile and allow determining the quantitative content of Ca, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, As, Br, Rb, Sr, Zr, Mo, Pb, Bi in the widely used basic foods and industrial raw products according to the common analytical scheme. The methods sensitivity allows determining the MCL of the toxic substances in foods and industrial raw products, specified in 'Medical and biological requirements and health-related quality standards in regards to the industrial raw products and foods

  6. Know the Risks of Feeding Raw Food to Your Pets

    Science.gov (United States)

    ... diet for their pets often point out that feral dogs and cats catch prey and eat it raw. “That’s true,” he adds, “but we don’t know how many of these animals get sick or die as a result of doing that. Since sick feral animals are rarely taken to a veterinarian when ...

  7. Review of scientific Research results in identification of plant raw materials in food products

    OpenAIRE

    GOLUBTSOVA YU. V.

    2016-01-01

    Currently, the science-based capabilities have been generated to develop and test various identification methods of food products and reveal adulteration using advanced technique and processes. This article reviews researches and developments to identify the plant raw materials in food products based on morphological, anatomic, physical and chemical test methods and the latest DNA-technologies. Review of physical, chemical, anatomic and morphological test methods to identify raw materials bot...

  8. Quality assessment of baby food made of different pre-processed organic raw materials under industrial processing conditions.

    Science.gov (United States)

    Seidel, Kathrin; Kahl, Johannes; Paoletti, Flavio; Birlouez, Ines; Busscher, Nicolaas; Kretzschmar, Ursula; Särkkä-Tirkkonen, Marjo; Seljåsen, Randi; Sinesio, Fiorella; Torp, Torfinn; Baiamonte, Irene

    2015-02-01

    The market for processed food is rapidly growing. The industry needs methods for "processing with care" leading to high quality products in order to meet consumers' expectations. Processing influences the quality of the finished product through various factors. In carrot baby food, these are the raw material, the pre-processing and storage treatments as well as the processing conditions. In this study, a quality assessment was performed on baby food made from different pre-processed raw materials. The experiments were carried out under industrial conditions using fresh, frozen and stored organic carrots as raw material. Statistically significant differences were found for sensory attributes among the three autoclaved puree samples (e.g. overall odour F = 90.72, p processed from frozen carrots show increased moisture content and decrease of several chemical constituents. Biocrystallization identified changes between replications of the cooking. Pre-treatment of raw material has a significant influence on the final quality of the baby food.

  9. Evaluation of Apple Pomace as a Raw Material for Alternative Applications in Food Industries

    Directory of Open Access Journals (Sweden)

    Elena Falqué

    2007-01-01

    Full Text Available In order to measure the potential of apple pomace as a raw material for manufacturing food-related products (such as lactic acid, fiber-rich concentrates and pectin, samples from cider industry were assayed for composition and enzymatic digestibility. Alcohol-soluble compounds (monosaccharides, oligosaccharides and malic acid accounted for 32–45 mass percent of oven-dry pomace. Glucose and fructose were the major components of this fraction. The alcohol-insoluble fraction accounted for 55–68 mass percent of oven-dry pomace and was mainly made up of neutral detergent fiber (62–69 percent of the mass fraction and pectin (16.2–19.7 percent of the mass fraction. The feedstock content of N, P and metal ions (K, Mg, Fe and Mn was favourable for further manufacture of lactic acid fermentation media. Apple pomace showed a high susceptibility to enzymatic hydrolysis: in media with a cellulase loading of 8.5 FPU/g of apple pomace and a cellobiase loading of 5 IU/FPU, about 80 % of the total glucan was converted into glucose after 15 h. Considering the low enzyme charge, liquor to solid ratio employed, reaction time needed to achieve the maximal sugars concentration and N, P and metal ion (K, Mg, Fe and Mn content of samples, it can be concluded that apple pomace is a promising raw material for lactic acid production.

  10. Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

    Directory of Open Access Journals (Sweden)

    Moutong eChen

    2015-09-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

  11. An Immunoassay for Quantification of Contamination by Raw Meat Juice on Food Contact Surfaces.

    Science.gov (United States)

    Chen, Fur-Chi; Godwin, Sandria; Chambers, Edgar

    2016-11-01

    Raw chicken products often are contaminated with Salmonella and Campylobacter , which can be transmitted from packages to contact surfaces. Raw meat juices from these packages also provide potential media for cross-contamination. There are limited quantitative data on the levels of consumer exposure to raw meat juice during shopping for and handling of chicken products. An exposure assessment is needed to quantify the levels of transmission and to assess the risk. An enzyme-linked immunosorbent assay (ELISA) was developed and validated for quantitative detection of raw meat juice on hands and various food contact surfaces. Analytical procedures were designed to maximize the recovery of raw meat juice from various surfaces: hands, plastic, wood, stainless steel, laminated countertops, glass, and ceramics. The ELISA was based on the detection of a soluble muscle protein, troponin I (TnI), in the raw meat juice. The assay can detect levels as low as 1.25 ng of TnI, which is equivalent to less than 1 μl of the raw meat juice. The concentrations of TnI in the raw meat juices from 10 retail chicken packages, as determined by ELISA, were between 0.46 and 3.56 ng/μl, with an average of 1.69 ng/μl. The analytical procedures, which include swabbing, extraction, and concentration, enable the detection of TnI from various surfaces. The recoveries of raw meat juice from surfaces of hands were 92%, and recoveries from other tested surfaces were from 55% on plastic cutting boards to 75% on laminated countertops. The ELISA developed has been used for monitoring the transfer of raw meat juice during shopping for and handling of raw chicken products in our studies. The assay also can be applied to other raw meat products, such as pork and beef.

  12. Microbiological profile and nutritional quality of raw foods for neutropenic patients under hospital care

    OpenAIRE

    Galati, Paula Cristina; Lataro, Renata Cristina; Souza, Vanessa Maciel; de Martinis, Elaine Cristina Pereira; Chiarello, Paula Garcia

    2013-01-01

    Objective This study aimed to analyze and compare the microbiological profile and vitamin C content of raw and cooked foods destined for neutropenic inpatients. Methods Three vegetables and nine fruits, raw and boiled, washed and sanitized were examined. Heat-tolerant coliforms and coagulase-positive staphylococci were counted and the presence of Salmonella spp was investigated. The vitamin C content was analyzed by a colorimetric reaction. The Statistical Package for Social Sciences (SPSS) s...

  13. Microbiological profile and nutritional quality of raw foods for neutropenic patients under hospital care

    OpenAIRE

    Galati, Paula Cristina; Lataro, Renata Cristina; Souza, Vanessa Maciel; Martinis, Elaine Cristina Pereira de; Chiarello, Paula Garcia

    2013-01-01

    OBJECTIVE: This study aimed to analyze and compare the microbiological profile and vitamin C content of raw and cooked foods destined for neutropenic inpatients. METHODS: Three vegetables and nine fruits, raw and boiled, washed and sanitized were examined. Heat-tolerant coliforms and coagulase-positive staphylococci were counted and the presence of Salmonella spp was investigated. The vitamin C content was analyzed by a colorimetric reaction. The Statistical Package for Social Sciences (SPSS)...

  14. 40 CFR 89.413 - Raw sampling procedures.

    Science.gov (United States)

    2010-07-01

    ... of the exhaust pipe—whichever is the larger—upstream of the exit of the exhaust gas system. (b) In..., such as in a “Vee” engine configuration, it is permissible to: (1) Sample after all exhaust pipes have been connected together into a single exhaust pipe. (2) For each mode, sample from each exhaust pipe...

  15. EFFICIENCY OF RAW MATERIAL INVENTORIES IN IMPROVING SUPPLY CHAIN PERFORMANCE of CV. FIVA FOOD

    Directory of Open Access Journals (Sweden)

    Artadi Nugraha

    2016-01-01

    Full Text Available The production and number of processed food industries have slightly increased; as a result, the companies must compete to maximize their profits by conducting their efficient production process. CV. Fiva Food is one of the companies in the field of processed foods, especially in processed meat that has implemented supply chain management. It is necessary for the company to take measurements of its performance and efficiency for the entire supply chain such as procurement of raw materials. The purposes of this study were to analyze the performance of the company's supply chain and determine the most efficient  method of procurement for its raw materials as well as and to provide recommendations for the company to improve its performance of entire supply chain. This study used SCOR in analyzing the performance of supply chain and EOQ and POQ method to be compared with the method that the company uses to determine which method of procurement for raw materials is the most efficient one. The result showed that based on the matrix, the company's performance is unfavorable when it was compared to the benchmark performance of inventory days of supply. In addition, this study showed that the POQ method produces the lowest total inventory cost with savings of Rp6.647.015 for raw materials of MDM whereas EOQ method produced the lowest total inventory cost with savings of Rp222.153,78 for raw materials of FQ85CL. Keywords: performance suppy chain, SCOR, fiva food, EOQ, POQ

  16. Estimating waste disposal quantities from raw waste samples

    International Nuclear Information System (INIS)

    Negin, C.A.; Urland, C.S.; Hitz, C.G.; GPU Nuclear Corp., Middletown, PA)

    1985-01-01

    Estimating the disposal quantity of waste resulting from stabilization of radioactive sludge is complex because of the many factors relating to sample analysis results, radioactive decay, allowable disposal concentrations, and options for disposal containers. To facilitate this estimation, a microcomputer spread sheet template was created. The spread sheet has saved considerable engineering hours. 1 fig., 3 tabs

  17. An integrated production-inventory model for food products adopting a general raw material procurement policy

    Science.gov (United States)

    Fauza, G.; Prasetyo, H.; Amanto, B. S.

    2018-05-01

    Studies on an integrated production-inventory model for deteriorating items have been done extensively. Most of the studies define deterioration as physical depletion of some inventories over time. This definition may not represent the deterioration characteristics of food products. The quality of food production decreases over time while the quantity remains the same. Further, in the existing models, the raw material is replenished several times (or at least once) within one production cycle. In food industries, however, a food company, for several reasons (e.g., the seasonal raw materials, discounted price, etc.) sometimes will get more benefit if it orders raw materials in a large quantity. Considering this fact, this research, therefore, is aimed at developing a more representative inventory model by (i) considering the quality losses in food and (ii) adopting a general raw material procurement policy. A mathematical model is established to represent the proposed policy in which the total profit of the system is the objective function. To evaluate the performance of the model, a numerical test was conducted. The numerical test indicates that the developed model has better performance, i.e., the total profit is 2.3% higher compared to the existing model.

  18. Hygiene quality and presence of ESBL-producing Escherichia coli in raw food diets for dogs

    Directory of Open Access Journals (Sweden)

    Oskar Nilsson

    2015-10-01

    CMY-2 group and only one of them was also resistant to a non-beta-lactam antibiotic. Conclusion: The results of this study indicate that raw food diets could be a source of ESC-resistant E. coli to dogs and highlight the need for maintaining good hygiene when handling these products to prevent infection.

  19. Characterization of transferable tetracycline resistance genes in Enterococcus faecalis isolated from raw food

    DEFF Research Database (Denmark)

    Wilcks, Andrea; Andersen, Sigrid Rita; Licht, Tine Rask

    2005-01-01

    The prevalence of tetracycline resistance, and of specific genetic determinants for this resistance was investigated in 1003 strains of Enterococcus faecalis isolated from various raw food products originating from five categories including chicken meat, other poultry meat, beef, pork, and 'other...

  20. 40 CFR 90.414 - Raw gaseous exhaust sampling and analytical system description.

    Science.gov (United States)

    2010-07-01

    ... probe may not be greater than 0.10 cm. The fitting that attaches the probe to the exhaust pipe must be... the different analyzers. (2) Heat the sample transport system from the engine exhaust pipe to the HC... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...

  1. 40 CFR 89.412 - Raw gaseous exhaust sampling and analytical system description.

    Science.gov (United States)

    2010-07-01

    ... the exhaust pipe shall be as small as practical in order to minimize heat loss from the probe. (2) The... sample transport system from the engine exhaust pipe to the HC analyzer and the NOX analyzer must be... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...

  2. 40 CFR 91.414 - Raw gaseous exhaust sampling and analytical system description.

    Science.gov (United States)

    2010-07-01

    ... shall not be greater than 0.10 cm. The fitting that attaches the probe to the exhaust pipe shall be as... internally to the different analyzers. (2) Heat the sample transport system from the engine exhaust pipe to... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...

  3. The use of rapid spectroscopic screening methods to detect adulteration of food raw materials and ingredients

    DEFF Research Database (Denmark)

    Sørensen, Klavs Martin; Khakimov, Bekzod; Engelsen, Søren Balling

    2016-01-01

    with chemometrics appears to be an efficient first choice for testing incoming raw materials and ingredients in the food production. However, in order to realize its full potential, it is necessary to move away from the current thoughts at the Parnassus, namely the targeted approach. This review will focus......International trade in food commodities will continue to increase and the complex food supply chains make adulteration detection and traceability a technical, logistical and financial challenge. There is no magic solution for adulteration testing, but NIR spectroscopy in combination...... on the exploitation of the capability of NIR spectroscopy to fingerprint incoming raw materials and ingredients as an integrated part of the industry's self-monitoring program typically called process analytical technology....

  4. Commutability of food microbiology proficiency testing samples.

    Science.gov (United States)

    Abdelmassih, M; Polet, M; Goffaux, M-J; Planchon, V; Dierick, K; Mahillon, J

    2014-03-01

    Food microbiology proficiency testing (PT) is a useful tool to assess the analytical performances among laboratories. PT items should be close to routine samples to accurately evaluate the acceptability of the methods. However, most PT providers distribute exclusively artificial samples such as reference materials or irradiated foods. This raises the issue of the suitability of these samples because the equivalence-or 'commutability'-between results obtained on artificial vs. authentic food samples has not been demonstrated. In the clinical field, the use of noncommutable PT samples has led to erroneous evaluation of the performances when different analytical methods were used. This study aimed to provide a first assessment of the commutability of samples distributed in food microbiology PT. REQUASUD and IPH organized 13 food microbiology PTs including 10-28 participants. Three types of PT items were used: genuine food samples, sterile food samples and reference materials. The commutability of the artificial samples (reference material or sterile samples) was assessed by plotting the distribution of the results on natural and artificial PT samples. This comparison highlighted matrix-correlated issues when nonfood matrices, such as reference materials, were used. Artificially inoculated food samples, on the other hand, raised only isolated commutability issues. In the organization of a PT-scheme, authentic or artificially inoculated food samples are necessary to accurately evaluate the analytical performances. Reference materials, used as PT items because of their convenience, may present commutability issues leading to inaccurate penalizing conclusions for methods that would have provided accurate results on food samples. For the first time, the commutability of food microbiology PT samples was investigated. The nature of the samples provided by the organizer turned out to be an important factor because matrix effects can impact on the analytical results. © 2013

  5. Pooling raw shell eggs: Salmonella contamination and high risk practices in the United Kingdom food service sector.

    Science.gov (United States)

    Gormley, F J; Little, C L; Murphy, N; de Pinna, E; McLauchlin, J

    2010-03-01

    Salmonella contamination of pooled raw shelled egg mix (RSEM) used as an ingredient in lightly cooked or uncooked foods and high-risk kitchen hygiene practices in United Kingdom food service establishments using RSEM were investigated. Samples were collected from 934 premises. Salmonella was found in 1 (0.13%) of 764 RSEM samples, 2 (0.3%) of 726 samples from surfaces where ready-to-eat foods were prepared, and 7 (1.3%) of 550 cleaning cloths. Poor RSEM storage and handling practices were highlighted. Workers in 40% of the premises sampled failed to use designated utensils when RSEM was added to other ingredients, workers in 17% of the premises did not clean surfaces and utensils thoroughly after use with RSEM and before preparing other foods, only 42% of workers washed and dried their hands after handling eggs or RSEM, workers in 41% of the premises did not store RSEM at refrigeration temperature before use, and workers in 8% of the premises added RSEM to cooked rice at the end of cooking when preparing egg fried rice. Take-away premises, especially those serving Chinese cuisine, were least likely to have a documented food safety management system and awareness of the key food safety points concerning the use of RSEM compared with other food service premises (P < 0.0001). Food service businesses using RSEM must be aware of the continuing hazard from Salmonella, must adopt appropriate control measures, and must follow advice provided by national food agencies to reduce the risk of Salmonella infection.

  6. GENETIC DIVERSITY AMONG YERSINIA ENTEROCOLITICA ISOLATED FROM SEWAGE, RAW MILK AND PACKED FOODS

    Directory of Open Access Journals (Sweden)

    Shanmuga Priya Seshadhri

    2014-12-01

    Full Text Available A total of 90 isolates (40 from sewage, 30 from raw milk and 20 from packed foods collected to study the incidence of Yersinia enterocolitica. It was observed that 61 isolates (32 from sewage, 19 from raw milk and 10 from packed foods were found contaminated with the bacterium. All the isolated strains were confirmed to Yersinia enterocolitica, by using 16S rRNA PCR. Of 61 strains, only five strains (two from sewage and two from packed foods and one from raw milk were found to be the producers of haemolysin at 37 oC, while among the five strains only two strains from packed foods produced haemolysin at 28 oC. All the isolates showed resistance to amoxicillin and found sensitive to chloramphenicol. Seven strains were producer of High molecular weight proteins (HMWP. 53 strains have produced rough LPS, while the smooth LPS has been observed for 8 isolates. Eleven and six different profiles observed in outermembrane proteins and lipopolysaccaride respectively. Combined primer 1 and 2 RAPD-PCR dendogram shows eight different genotypic patterns.

  7. Status of food and raw milk supply and problem just after the reactor accident

    International Nuclear Information System (INIS)

    Hirakawa, Sachiko; Murakami, Kana; Yoshizawa, Nobuaki; Takizawa, Mari; Kawai, Masaki; Sato, Osamu; Takagi, Syunji; Nakamura, Takashi

    2014-01-01

    Iodine 131 was detected in the environment and the food such as vegetables, raw milk and tap water just after the reactor accident following the East Japan Great Earthquake occurred in March 11, 2011. This article investigated status of refuge of Fukushima residents, their dietary life and food distribution from March 11 to 31 just after the accident so as to reevaluate internal exposure dose with Iodine 131. Investigation results showed most of food taken by refugees was confirmed food stock or relief supplies outside from the disaster area and suggested food contaminated with Iodine 131 was not widely consumed and distributed due to limit to send designated vegetables, restriction of tap water intake, damaged distribution facilities and closing down of retail stores. Restriction of tap water intake was only applied partly, so this might cause internal exposure dose due to tap water. (T. Tanaka)

  8. [Instinct therapy--raw food with meat with exclusion of milk products. Report No. 16].

    Science.gov (United States)

    Jallut, O

    1989-06-13

    Instinct therapy is a diet consisting exclusively of food in its natural form, which has not been subjected to cooking, preserving or seasoning. Dairy products are forbidden. Indications are numerous and rather imprecise including especially cancer. Burger developed Instinct therapy in 1964 as a diet according to his own philosophy. 1980 he left Switzerland because the practice of "metasexuality" had caused him problems with the law. He founded a school of Instinct therapy in 1982 in France and published his book "La guerre du cru" (The Raw Food Fight) in 1985. In Switzerland, Besuchet took on the teaching of Burger in 1978 and was very active in giving lectures. He died in June 1985 of mediastinal cancer. According to Burger, man originally ate raw food and his instinct has not evolved since those pre-historic times, but has been "artificially modified" by cooked food and the consumption of non-human milk. If man could re-develop his natural instinct and eat only fresh food, which is not prepared in any way, he could solve his health problems and restore defenses against diseases such that these could become beneficial. Cooked food, milk and cereals are thought to be the cause of cancer but instinctive eating would help to avoid or to cure cancer. No preclinical or clinical trials have been carried out. The theories of Burger and Besuchet are based on unverifiable personal experiences.

  9. The prevelance of raw food diet, vegetarianism and veganism among students of vilnius university

    OpenAIRE

    Žibutis, Justas

    2016-01-01

    Individuals need to eat different groups of products. Without the use of a particular product group, body may lack of necessary materials to maintain functionality. This can lead to health problems. We need to determine students eating habits and criteria to choose a product. It allows us to evaluate the risk of not receiving sufficient quantities of substance, which are necessary for normal functioning of the human body. Objective: To evaluate the prevelance of raw food diet, vegetarianism a...

  10. Statistical aspects of food safety sampling

    NARCIS (Netherlands)

    Jongenburger, I.; Besten, den H.M.W.; Zwietering, M.H.

    2015-01-01

    In food safety management, sampling is an important tool for verifying control. Sampling by nature is a stochastic process. However, uncertainty regarding results is made even greater by the uneven distribution of microorganisms in a batch of food. This article reviews statistical aspects of

  11. Extrusion Processing of Raw Food Materials and by-products: A Review.

    Science.gov (United States)

    Offiah, Vivian; Kontogiorgos, Vassilis; Falade, Kolawole O

    2018-05-22

    Extrusion technology has rapidly transformed the food industry with its numerous advantages over other processing methods. It offers a platform for processing different products from various food groups by modifying minor or major ingredients and processing conditions. Although cereals occupy a large portion of the extruded foods market, several other types of raw materials have been used. Extrusion processing of various food groups, including cereals and pseudo cereals, roots and tubers, pulses and oilseeds, fruits and vegetables, and animal products, as well as structural and nutritional changes in these food matrices are reviewed. Value addition by extrusion to food processing wastes and by-products from fruits and vegetables, dairy, meat and seafood, cereals and residues from starch, syrup and alcohol production, and oilseed processing are also discussed. Extrusion presents an economical technology for incorporating food processing residues and by-products back into the food stream. In contemporary scenarios, rising demand for extruded products with functional ingredients, attributed to evolving lifestyles and preferences, have led to innovations in the form, texture, color and content of extruded products. Information presented in this review would be of importance to processors and researchers as they seek to enhance nutritional quality and delivery of extruded products.

  12. Survival of Salmonella Copenhagen in food bowls following contamination with experimentally inoculated raw meat: Effects of time, cleaning, and disinfection

    OpenAIRE

    Weese, J Scott; Rousseau, J.

    2006-01-01

    There are concerns regarding the safety of feeding raw meat to household pets. This study demonstrated that Salmonella persists in food bowls that are inoculated with Salmonella-containing raw meat. Standard methods of cleaning and disinfection were minimally effective at eliminating Salmonella contamination.

  13. Microbiological sampling plan based on risk classification to verify supplier selection and production of served meals in food service operation.

    Science.gov (United States)

    Lahou, Evy; Jacxsens, Liesbeth; Van Landeghem, Filip; Uyttendaele, Mieke

    2014-08-01

    Food service operations are confronted with a diverse range of raw materials and served meals. The implementation of a microbial sampling plan in the framework of verification of suppliers and their own production process (functionality of their prerequisite and HACCP program), demands selection of food products and sampling frequencies. However, these are often selected without a well described scientifically underpinned sampling plan. Therefore, an approach on how to set-up a focused sampling plan, enabled by a microbial risk categorization of food products, for both incoming raw materials and meals served to the consumers is presented. The sampling plan was implemented as a case study during a one-year period in an institutional food service operation to test the feasibility of the chosen approach. This resulted in 123 samples of raw materials and 87 samples of meal servings (focused on high risk categorized food products) which were analyzed for spoilage bacteria, hygiene indicators and food borne pathogens. Although sampling plans are intrinsically limited in assessing the quality and safety of sampled foods, it was shown to be useful to reveal major non-compliances and opportunities to improve the food safety management system in place. Points of attention deduced in the case study were control of Listeria monocytogenes in raw meat spread and raw fish as well as overall microbial quality of served sandwiches and salads. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Meat species identification and Halal authentication using PCR analysis of raw and cooked traditional Turkish foods.

    Science.gov (United States)

    Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z

    2013-07-01

    The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Tracking Foodborne Pathogenic Bacteria in Raw and Ready-to-Eat Food Illegally Sold at the Eastern EU Border.

    Science.gov (United States)

    Ciolacu, Luminita; Stessl, Beatrix; Bolocan, Andrei Sorin; Oniciuc, Elena Alexandra; Wagner, Martin; Rychli, Kathrin; Nicolau, Anca Ioana

    2016-03-01

    Food illegally brought into the European Union, mainly in the personal luggage of travelers, represents a potential threat to consumers' health. The aim of this study was to investigate the presence of five pathogens in food brought into the European Union by Moldavian citizens as personal goods and illegally sold in Romania in the vicinity of the border. The occurrence of Staphylococcus aureus and Listeria monocytogenes was 7.5% and 8%, while Campylobacter spp., Escherichia coli O157:H7, and Salmonella spp. were absent in all samples. L. monocytogenes sequence type 2, 9, 121, and 155, highly prevalent among foodstuffs worldwide, was also present among isolates from ready-to-eat food illegally sold in Romania, even at the same date of sampling, indicating cross-contamination during food handling. S. aureus spa types t449, t304, and t524 were most often isolated from raw-milk cheeses contaminated with 10(3)-10(5) colony-forming units per gram, evidencing a contamination at herd level or unhygienic conditions during processing. S. aureus t011 and t3625, both included in the livestock-associated CC398, were isolated from pork lard and poultry meat. This study shows that cross-border trade from nonmember states represents a neglected route of transmission of foodborne pathogens into the European Union that could lead to sporadic or family-associated cases of disease.

  16. Prevalence, Virulence Potential, and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan, India.

    Science.gov (United States)

    Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit

    2017-03-01

    Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

  17. Indonesian jellyfish as potential for raw materials of food and drug

    Science.gov (United States)

    Yusuf, S.; Fahmid, I. M.; Abdullah, N.; Zulhaeriah

    2018-05-01

    Jellyfish used to be considered as a pest of fish and a nuisance to fishing operations. Yet, forty years ago this jellyfish was found to be materials of food, medicine and cosmetics and the utilization of jellyfish is now familiar in Indonesia after being imported by China and Japan industry. This study aims to determine the potential development of jellyfish commodities as food and drugs from Indonesia with the target to improve the welfare of fishermen. This research used methods of rapid observation, limited interview, processing with immersion experiment and desiccation. In addition, various literatures were also used to enrich the knowledge about jellyfish business. Observation showed that the appearance of jellyfish in Indonesian waters varies based on the fertility of the waters affected by oceanographic conditions. Jellyfish contains low calorie and fat content, high protein and minerals as well as total collagen. Thus, jellyfish is a nutritious food source to be developed into food supplements, nutricosmetics and functional foods. Due to its large size, the jellyfish from Bunyu Island is more viable than jellyfish from Suppa Pinrang to be exported as raw material. Therefore, the manufacture of food and medicines from jellyfish materials is possible to be done in Indonesia.

  18. Rambutan Seed (Nephelium Lappaceum L.) Optimization as Raw Material of High Nutrition Value Processed Food

    Science.gov (United States)

    Wahini, M.; Miranti, M. G.; Lukitasari, F.; Novela, L.

    2018-02-01

    Rambutan (Nephelium Lappaceum L.) is a plant that identical with Southeast Asian countries, in some areas of Indonesia no exception, but rambutan seed is considered as a waste. Therefore, it needs to be optimized into raw materials of food and processed with high nutritional value and has economic value. The purpose of this research were: 1) to find the best rambutan seed immersion formula; 2) to know the nutritional value of the best immersed rambutan seed; 3) to produce raw material and various processed of rambutan seed product. The research method was quasi experiment with 6 treatments and 2 factorial design, materials for immersion was NaCl and Ca(OH)2. The results showed that: 1) the best rambutan seed immersion formula was using Ca(OH)2; 2) the best rambutan seed contains 1,6 ash, 31,2 protein, 26,9 fat; 3) the best rambutan seed produce flour and processed of seasoned nuts. This research indicates that rambutan seed is very potential to be an alternative high-value raw materials.

  19. Examining trust factors in online food risk information: The case of unpasteurized or 'raw' milk.

    Science.gov (United States)

    Sillence, Elizabeth; Hardy, Claire; Medeiros, Lydia C; LeJeune, Jeffrey T

    2016-04-01

    The internet has become an increasingly important way of communicating with consumers about food risk information. However, relatively little is known about how consumers evaluate and come to trust the information they encounter online. Using the example of unpasteurized or raw milk this paper presents two studies exploring the trust factors associated with online information about the risks and benefits of raw milk consumption. In the first study, eye-tracking data was collected from 33 pasteurised milk consumers whilst they viewed six different milk related websites. A descriptive analysis of the eye-tracking data was conducted to explore viewing patterns. Reports revealed the importance of images as a way of capturing initial attention and foregrounding other features and highlighted the significance of introductory text within a homepage. In the second, qualitative study, 41 consumers, some of whom drank raw milk, viewed a selection of milk related websites before participating in either a group discussion or interview. Seventeen of the participants also took part in a follow up telephone interview 2 weeks later. The qualitative data supports the importance of good design whilst noting that balance, authorship agenda, the nature of evidence and personal relevance were also key factors affecting consumers trust judgements. The results of both studies provide support for a staged approach to online trust in which consumers engage in a more rapid, heuristic assessment of a site before moving on to a more in-depth evaluation of the information available. Findings are discussed in relation to the development of trustworthy online food safety resources. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Antioxidant and antidiabetic properties of condensed tannins in acetonic extract of selected raw and processed indigenous food ingredients from Kenya.

    Science.gov (United States)

    Kunyanga, Catherine Nkirote; Imungi, Jasper Kathenya; Okoth, Michael; Momanyi, Clare; Biesalski, Han Konrad; Vadivel, Vellingiri

    2011-05-01

    Recently, tannins have received considerable attention as health-promoting component in various plant foods and several studies have reported on its nutraceutical properties. However, no study has established the role of condensed tannins in indigenous foods of Kenya. Therefore, this study was designed to evaluate the antioxidant activity (DPPH and FRAP) and antidiabetic effects (α-amylase and α-glucosidase inhibition activities) of condensed tannins in some selected raw and traditionally processed indigenous cereals, legumes, oil seeds, and vegetables. The condensed tannin content of the grains and vegetables ranged between 2.55 and 4.35 g/100 g DM and 1.53 and 5.73 g/100 g DM, respectively. The scavenging effect of acetonic extract on DPPH radical ranged from 77% to 90% while the reducing power was found to be 31 to 574 mmol Fe(II)/g DM in all the investigated food ingredients. The condensed tannin extracts of the analyzed samples showed promising antidiabetic effects with potential α-amylase and α-glucosidase inhibition activities of 23% to 44% and 58% to 88%, respectively. Condensed tannins extracted from the amaranth grain, finger millet, field bean, sunflower seeds, drumstick, and amaranth leaves exerted significantly higher antioxidant and antidiabetic activities than other food ingredients. Among the traditional processing methods, roasting of grains and cooking of vegetables were found to be more suitable mild treatments for preserving the tannin compound and its functional properties as opposed to soaking + cooking and blanching treatments. The identified elite sources of optimally processed indigenous food ingredients with promising results could be used as health-promoting ingredients through formulation of therapeutic diets. © 2011 Institute of Food Technologists®

  1. Food safety in raw milk production: risk factors associated to bacterial DNA contamination.

    Science.gov (United States)

    Cerva, Cristine; Bremm, Carolina; Reis, Emily Marques dos; Bezerra, André Vinícius Andrade; Loiko, Márcia Regina; Cruz, Cláudio Estêvão Farias da; Cenci, Alexander; Mayer, Fabiana Quoos

    2014-06-01

    While human illness from milkborne pathogens may be linked to contamination of the product after pasteurization or improper pasteurization, such diseases are usually associated with consumption of raw milk or its by-products. Molecular biology tools were applied to investigate contamination by Listeria monocytogenes, Salmonella spp., some pathogenic strains of Escherichia coli, and Campylobacter jejuni in 548 raw milk samples from 125 dairy farms established in two regions from southern Brazil. Moreover, 15 variables were evaluated for their association with raw milk contamination levels, and the risk factors were determined by multiple regression analysis. Salmonella spp. were more frequently detected, followed by pathogenic E. coli. There was difference in contamination index between the regions, in which risk factors such as temporary cattle confinement, low milk production, low milking machine cleaning frequency, and milk storage area without tile walls were identified. The risk factors were specific to each region studied. Nevertheless, the data can be used to improve milk quality of dairy farms/herds with similar management practices.

  2. Detection by PCR of pathogenic protozoa in raw and drinkable water samples in Colombia.

    Science.gov (United States)

    Triviño-Valencia, Jessica; Lora, Fabiana; Zuluaga, Juan David; Gomez-Marin, Jorge E

    2016-05-01

    We evaluated the presence of DNA of Giardia, Toxoplasma, and Cryptosporidium by PCR, and of Giardia and Cryptosporidium genera by immunofluorescence antibody test (IFAT), in water samples, before, during, and after plant treatment for drinkable water. We applied this method in 38 samples of 10 l of water taken from each of the water treatment steps and in 8 samples taken at home (only for Toxoplasma PCR) in Quindio region in Colombia. There were 8 positive samples for Cryptosporidium parvum (21 %), 4 for Cryptosporidium hominis (10.5 %), 27 for Toxoplasma gondii (58.6 %), 2 for Giardia duodenalis assemblage A (5.2 %), and 5 for G. duodenalis assemblage B (13.1 %). By IFAT, 23 % were positive for Giardia and 21 % for Cryptosporidium. An almost perfect agreement was found between IFAT and combined results of PCR, by Kappa composite proportion analysis. PCR positive samples were significantly more frequent in untreated raw water for C. parvum (p = 0.02). High mean of fecal coliforms, high pH values, and low mean of chlorine residuals were strongly correlated with PCR positivity for G. duodenalis assemblage B. High pH value was correlated with PCR positivity for C. parvum. Phylogenetic analysis of DNA sequences was possible, showing water and human clinical sequences for Toxoplasma within the same phylogenetic group for B1 repeated sequence. PCR assay is complementary to IFAT assay for monitoring of protozoa in raw and drinkable water, enabling species identification and to look for phylogenetic analysis in protozoa from human and environmental sources.

  3. Estimation of Arsenic Intake from Drinking Water and Food (Raw and Cooked in a Rural Village of Northern Chile. Urine as a Biomarker of Recent Exposure

    Directory of Open Access Journals (Sweden)

    Oscar Pablo Diaz

    2015-05-01

    Full Text Available The aim of this study was to estimate both the contribution of drinking water and food (raw and cooked to the total (t-As and inorganic (i-As arsenic intake and the exposure of inhabitants of Socaire, a rural village in Chile´s Antofagasta Region, by using urine as biomarker. The i-As intake from food and water was estimated using samples collected between November 2008 and September 2009. A 24-hour dietary recall questionnaire was given to 20 participants. Drinking water, food (raw and cooked and urine samples were collected directly from the homes where the interviewees lived. The percentage of i-As/t-As in the drinking water that contributed to the total intake was variable (26.8–92.9. Cereals and vegetables are the food groups that contain higher concentrations of i-As. All of the participants interviewed exceeded the reference intake FAO/OMS (149.8 µg∙i-As·day−1 by approximately nine times. The concentration of t-As in urine in each individual ranged from 78 to 459 ng·mL−1. Estimated As intake from drinking water and food was not associated with total urinary As concentration. The results show that both drinking water and food substantially contribute to i-As intake and an increased exposure risk to adult residents in contaminated areas.

  4. Estimation of Arsenic Intake from Drinking Water and Food (Raw and Cooked) in a Rural Village of Northern Chile. Urine as a Biomarker of Recent Exposure

    Science.gov (United States)

    Diaz, Oscar Pablo; Arcos, Rafael; Tapia, Yasna; Pastene, Rubén; Velez, Dínoraz; Devesa, Vicenta; Montoro, Rosa; Aguilera, Valeska; Becerra, Miriam

    2015-01-01

    The aim of this study was to estimate both the contribution of drinking water and food (raw and cooked) to the total (t-As) and inorganic (i-As) arsenic intake and the exposure of inhabitants of Socaire, a rural village in Chile´s Antofagasta Region, by using urine as biomarker. The i-As intake from food and water was estimated using samples collected between November 2008 and September 2009. A 24-hour dietary recall questionnaire was given to 20 participants. Drinking water, food (raw and cooked) and urine samples were collected directly from the homes where the interviewees lived. The percentage of i-As/t-As in the drinking water that contributed to the total intake was variable (26.8–92.9). Cereals and vegetables are the food groups that contain higher concentrations of i-As. All of the participants interviewed exceeded the reference intake FAO/OMS (149.8 µg∙i-As·day−1) by approximately nine times. The concentration of t-As in urine in each individual ranged from 78 to 459 ng·mL−1. Estimated As intake from drinking water and food was not associated with total urinary As concentration. The results show that both drinking water and food substantially contribute to i-As intake and an increased exposure risk to adult residents in contaminated areas. PMID:26006131

  5. Valorisation of food waste to produce new raw materials for animal feed.

    Science.gov (United States)

    San Martin, D; Ramos, S; Zufía, J

    2016-05-01

    This study assesses the suitability of vegetable waste produced by food industry for use as a raw material for animal feed. It includes safety and nutritional viability, technical feasibility and environmental evaluation. Vegetable by-products were found to be nutritionally and sanitarily appropriate for use in animal feed. The drying technologies tested for making vegetable waste suitable for use in the animal feed market were pulse combustion drying, oven and microwave. The different meal prototypes obtained were found to comply with all the requirements of the animal feed market. An action plan that takes into account all the stages of the valorisation process was subsequently defined in agreement with local stakeholders. This plan was validated in a pilot-scale demonstration trial. Finally, the technical feasibility was studied and environmental improvement was performed. This project was funded by the European LIFE+ program (LIFE09 ENV/ES/000473). Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Speciation of arsenic in baby foods and the raw fish ingredients using liquid chromatography-hydride generation-atomic absorption spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Vinas, P.; Lopez-Garcia, I.; Merino-Merono, B.; Campillo, N.; Hernandez-Cordoba, M. [Murcia Univ. (Spain). Dept. of Analytical Chemistry

    2003-07-01

    The speciation of arsenic in different baby foods and the raw fish ingredients using the direct hybridisation of liquid chromatography (LC) and hydride generation atomic absorption spectrometry (HGAAS) is described. Good resolution of the species, arsenic(III), dimethylarsinic acid (DMAA), monomethylarsenic acid (MMAA) and arsenic(V) is achieved using an anion-exchange column with potassium phosphate as the mobile phase and gradient elution. Arsenobetaine (AsB) is determined by on-line oxidation using peroxydisulphate and hydride generation. The arsenicals were extracted by an enzymatic digestion procedure based on the action of trypsin or pancreatin. Arsenobetaine was the only arsenic species detected. The reliability of the procedure was checked by analyzing the total arsenic content of the samples by electrothermal atomic absorption spectrometry with microwave-oven digestion and by analyzing a certified reference material. The arsenic content in the baby foods comes from the raw fish ingredients and is highest when plaice is used. (orig.)

  7. On-chip sample preparation for complete blood count from raw blood.

    Science.gov (United States)

    Nguyen, John; Wei, Yuan; Zheng, Yi; Wang, Chen; Sun, Yu

    2015-03-21

    This paper describes a monolithic microfluidic device capable of on-chip sample preparation for both RBC and WBC measurements from whole blood. For the first time, on-chip sample processing (e.g. dilution, lysis, and filtration) and downstream single cell measurement were fully integrated to enable sample preparation and single cell analysis from whole blood on a single device. The device consists of two parallel sub-systems that perform sample processing and electrical measurements for measuring RBC and WBC parameters. The system provides a modular environment capable of handling solutions of various viscosities by adjusting the length of channels and precisely controlling mixing ratios, and features a new 'offset' filter configuration for increased duration of device operation. RBC concentration, mean corpuscular volume (MCV), cell distribution width, WBC concentration and differential are determined by electrical impedance measurement. Experimental characterization of over 100,000 cells from 10 patient blood samples validated the system's capability for performing on-chip raw blood processing and measurement.

  8. Antibiotic resistance in bacteria Staphylococcus spp. isolated from samples of raw sheep's milk

    Directory of Open Access Journals (Sweden)

    Milan Vasiľ

    2016-12-01

    Full Text Available From samples of raw sheep's milk were determined results of bacteriological examination from two herds in region of Eastern Slovakia in three years lasting study. The occurrence of Staphylococcus spp. 41.6% (124 was determined from 298 samples. The seven species of staphylococci were on a regular basis isolated: S. epidermidis (34, S. chromogenes (26, S. aureus (16. Alternately have been recorded S. warneri (16, S. schleiferi (15, S. haemolyticus (9 and S. xylosus (8. All isolated pathogens were tested by in vitro test on Mueller-Hinton agar by disc methods on resistance to 10 types of antibiotics.  Highest value of resistance was determined to Penicilin 21.0%, Neomycin 10.5% and Novobiocin 9.7%. Lower resistance was in to Oxacilin 7.2% and Amoxicilin 6.5%. Minimal resistance was founded to Cefoxitin 0.8%, Linkomycin 2.4%, Erytromycin, and Streptomycin 3.2%. Was founded total resistance (21.0% to all antibiotics in S. epidermidis (34 during the three years, S. chromogenes (26 showed resistance to 8 types of antibiotics (12.9%, S. aureus (16 to 6 antibiotics (10.5% and S. warneri (16 to 4 antibiotics (5.6%. It was confirmed that sheep's milk remains a major source of staphylococci. Bacteria in comparison with isolates from cows' raw milk, showed lower values of resistance, but were resistant to more than two antibiotics. Recorded occurrence of resistance in staphylococci may be connected with a minimum use of antibiotics in the treatment of mastitis and other diseases in sheep herds. Reported resistance to the tested antibiotics became the basis for the recommendation to use preparations to treat mastitis in sheep principally by the detection of resistance to antibiotics contained.

  9. High occurrence of Helicobacter pylori in raw goat, sheep and cow milk inferred by glmM gene: a risk of food-borne infection?

    Science.gov (United States)

    Quaglia, N C; Dambrosio, A; Normanno, G; Parisi, A; Patrono, R; Ranieri, G; Rella, A; Celano, G V

    2008-05-10

    Helicobacter pylori is an organism widespread in humans and sometimes responsible for serious illnesses, such as gastric and duodenal ulcers, MALToma and even gastric cancer. It has been hypothesized that the infection route by H. pylori involves multiple pathways including food-borne transmission, as the microorganism has been detected from foods such as sheep and cow milk. This work reports the results of a survey conducted in order to investigate the presence of H. pylori in raw goat, sheep and cow milk produced in Southern Italy, employing a Nested Polymerase Chain Reaction (Nested-PCR) assay for the detection of the phosphoglucosamine mutase gene (glmM), as screening method followed by conventional bacteriological isolation. Out of the 400 raw milk samples examined, 139 (34.7%) resulted positive for the presence of glmM gene, but no strains were isolated. In this work H. pylori DNA has been firstly detected from 41 (25.6%) raw goat milk samples. The results deserve further investigations on the contamination source/s of the milk samples and on the major impact that it may have on consumers.

  10. The enzymatic determination of starch in food, feed and raw materials of the starch industry

    NARCIS (Netherlands)

    Brunt, K.; Sanders, P.; Rozema, T.

    1998-01-01

    An enzymatic starch determination which can be used for the analysis of starch in a very broad range of different samples is evaluated, ranging from starch in plants, feed and food to industrial applications as starch in starch. The method is based on a complete enzymatic conversion of the starch

  11. Use of a novel medium, the Polymyxin Ceftazidime Oxford Medium, for isolation of Listeria monocytogenes from raw or non-pasteurized foods.

    Science.gov (United States)

    Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A

    2016-05-01

    Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. In vitro antimicrobial effect of Satureja wiedemanniana against Bacillus species isolated from raw meat samples.

    Science.gov (United States)

    Yucel, Nihal; Aslim, Belma; Ozdoğan, Hakan

    2009-08-01

    In this study a total of 30 raw meat samples obtained from Ankara, Turkey were screened for the presence of Bacillus species. Among the meat samples analyzed, the predominant species isolated was Bacillus circulans; other Bacillus species were identified as Bacillus firmus, Bacillus lentus, Bacillus megaterium, Bacillus licheniformis, Bacillus mycoides, Bacillus sphaericus, and Bacillus cereus. Minced meat samples were more contaminated with Bacillus species than sliced beef sample. From these samples, 242 Bacillus species isolates were obtained, which were investigated for proteolytic and lipolytic activity, associated with meat spoilage. Interestingly, some Bacillus strains produced the highest values of proteolytic/lipolytic activities. Nineteen Bacillus strains were selected among the 242 isolates according to their proteolytic/lipolytic activity with a clear zone diameter of > or =6 mm. The essential oil of Satureja wiedemanniana (Lalem) Velen was also tested against these 19 Bacillus species that had proteolytic and lipolytic activity. The essential oil yield obtained from the aerial parts of the plant was 0.35% (vol/wt). The inhibition zones of the essential oil obtained against all the Bacillus species were in the range of 5.0-12.0 mm. The oil showed high antimicrobial activities against B. licheniformis M 6(26), M 11(16), and M 12(1) strains. B. licheniformis 12(1) showed high lipolytic activity (18.0 mm). Also, B. licheniformis M 6(26) and M 11(16) showed high proteolytic activity (16.0 and 14.0 mm). These results may suggest that an essential oil of S. wiedemanniana can be used as a natural preservative in meat against spoilage bacteria.

  13. MICROCOMPONENTS OF FOOD SYSTEMS BASED ON ANIMAL AND OTHER RAW MATERIALS. REVIEW

    Directory of Open Access Journals (Sweden)

    Andrew N. Ivankin

    2018-01-01

    Full Text Available The problems of the microcomponent composition of modern food systems based on natural raw materials are considered. It is shown  that modern methods of physical and chemical analysis make it  possible to establish the presence of both useful and unsafe microimpurities with a level of their content in the production  from 0.001 to 1–5 mg / kg. The effect of microquantities of free amino and fatty acids, as well as carbohydrates and vitamins,  on the flavor and aromatic characteristics of systems is discussed. Some aspects of the presence of introduced  microcomponents, which include pesticides, antibiotic and  chemotherapeutic drugs, hormonal regulators, polyaromatic  hydrocarbons and some other toxicants, as well as microingredients  formed in products under the influence of biochemical processes during storage are considered. As such microingredients, biogenic amines and other products of transformation of macrocomponents are considered.

  14. Intake of minerals, trace elements and vitamins in bone and raw food rations in adult dogs.

    Science.gov (United States)

    Dillitzer, Natalie; Becker, Nicola; Kienzle, Ellen

    2011-10-01

    The aim of the present study was to evaluate the vitamin and mineral content of bone and raw food rations fed to adult dogs in Germany. Pet owners completed a standardised feeding questionnaire. The composition of 95 rations was calculated from mean data for foodstuffs using nutrition balancing software. Typical ration ingredients were meats, fish, offal, dairy products, eggs, oil, nuts, cod liver oil and natural and commercial supplements. The supply of nutrients was compared with the recommended allowance (RA). Of the rations that were used, 10 % supplied vitamin D was below RA. About half of the rations supplied less iodine than the minimum requirement. Many of the rations had low Zn and Cu supply, and 25 % of the rations supplied only 70 % of RA for vitamin A or less. A total of 60 % of the rations had one or more of the above-mentioned imbalance. The remaining 40 % of rations either had minor problems like Ca excess from bones or they were balanced.

  15. Isolation of Arcobacter butzleri in environmental and food samples collected in industrial and artisanal dairy plants

    Directory of Open Access Journals (Sweden)

    Federica Giacometti

    2013-10-01

    Full Text Available This study investigated the presence of Arcobacter species in two cheese factories; a total of 22 environmental samples and 10 food samples were collected from an artisanal and an industrial cheese factory; Arcobacter species were isolated after enrichment, and isolates were identified at species level by multiplex-polymerase chain reaction (PCR assay. In the artisanal cheese factory, Arcobacter spp. were isolated from several environmental samples, cow and water buffalo raw milk and ricotta cheese. In the industrial plant, Arcobacter spp. were isolated from surfaces not in contact with food and from a cleaned surface in contact with food; no Arcobacter spp. was isolated from food. All isolates were identified as A. butzleri. We report of the presence of A. butzleri in a ready-to-eat cheese produced for retail. In addition, the isolation of A. butzleri in food processing surfaces in the two cheese factories could be assessed as a source of potential contamination for cheeses

  16. Harmonisation of food consumption data format for dietary exposure assessments of chemicals analysed in raw agricultural commodities

    DEFF Research Database (Denmark)

    Boon, Polly E.; Ruprich, Jiri; Petersen, Annette

    2009-01-01

    In this paper, we present an approach to format national food consumption data at raw agricultural commodity (RAC) level. In this way, the data is both formatted in a harmonised way given the comparability of RACs between countries, and suitable to assess the dietary exposure to chemicals analysed......, and the use of the FAO/WHO Codex Classification system of Foods and Animal Feeds to harmonise the classification. We demonstrate that this approach works well for pesticides and glycoalkaloids, and is an essential step forward in the harmonisation of risk assessment procedures within Europe when addressing...... chemicals analysed in RACs by all national food control systems....

  17. Analysis of polonium-210 in food samples

    International Nuclear Information System (INIS)

    Bueno, Luciana; Cunha, Ieda Irma Lamas

    1999-01-01

    This paper presents the polonium levels in food products. The analysis procedure consisted of acid leaching of the samples, solution evaporation, addition of hydrochloric acid, spontaneous deposition of polonium on a silver disk counting by alpha spectroscopy. The method was applied in reference materials and in foodstuffs, resulting in the following values: tea samples 0.4 to 1.7 Bq/unit; fish = 0.17 to 0.40 Bq/Kg, fruits = 0.048 to 0.067 Bq/kg, vegetables = 0.12 to 0.31 Bq/kg, cereal = 0.036 to 0.042 Bq/kg and legumes = 0.024 to 0.51 Bq/kg. The results are very important for public health due to the possible effects to the human organism by the ingestion of contaminated foodstuffs. (author)

  18. β-Galactosidase activity of commercial lactase samples in raw and pasteurized milk at refrigerated temperatures.

    Science.gov (United States)

    Horner, T W; Dunn, M L; Eggett, D L; Ogden, L V

    2011-07-01

    Many consumers are unable to enjoy the benefits of milk due to lactose intolerance. Lactose-free milk is available but at about 2 times the cost of regular milk or greater, it may be difficult for consumers to afford. The high cost of lactose-free milk is due in part to the added cost of the lactose hydrolysis process. Hydrolysis at refrigerated temperatures, possibly in the bulk tank or package, could increase the flexibility of the process and potentially reduce the cost. A rapid β-galactosidase assay was used to determine the relative activity of commercially available lactase samples at different temperatures. Four enzymes exhibited low-temperature activity and were added to refrigerated raw and pasteurized milk at various concentrations and allowed to react for various lengths of time. The degree of lactose hydrolysis by each of the enzymes as a function of time and enzyme concentration was determined by HPLC. The 2 most active enzymes, as determined by the β-galactosidase assay, hydrolyzed over 98% of the lactose in 24h at 2°C using the supplier's recommended dosage. The other 2 enzymes hydrolyzed over 95% of the lactose in 24h at twice the supplier's recommended dosage at 2°C. Results were consistent in all milk types tested. The results show that it is feasible to hydrolyze lactose during refrigerated storage of milk using currently available enzymes. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  19. Osmotic dehydration of fruit and berry raw materials in the food industry

    Directory of Open Access Journals (Sweden)

    N. A. Gribova

    2017-01-01

    Full Text Available Osmotic dehydration has recently received more attention as an effective method of preserving fruits and berries. Osmosis is a simple process that facilitates the processing of fruits and berries in order to preserve the original characteristics, namely nutritional value and organoleptic properties: color, aroma and texture. Osmotic dehydration has found wide application in the preservation of food products, as the activity of water in fruits and berries decreases, in some of them up to 90% of water is contained. The process of osmotic dehydration with the help of various agents is less energy-intensive than the process of drying or freezing, since it can be processed at ambient temperature. Osmotic dehydration has potential advantages in preserving the quality of food and in maintaining healthy food for the food industry. Treatment includes dehydration of fruits and berries by an osmotic agent followed by dehydration in dry or frozen apparatus where the moisture content decreases and the product becomes more stable. This process is a partial dewatering process to provide improved product quality compared to conventional drying processes or freezing. The purpose of studying osmotic dehydration is to identify the advantages and disadvantages in the treatment of osmotic agents. Various aspects of osmotic dehydration technology are considered, namely the solutions used, the characteristics of solutions, the effect of variable processes and the qualitative characteristics of osmo-dehydrated products. Factors of osmotic dehydration that depend on the osmotic agent, concentration of solute, temperature, time, size, shape and compactness of the material, mixing and the ratio of the solution to the samples.

  20. Isolation of Campylobacter spp. from Client-Owned Dogs and Cats, and Retail Raw Meat Pet Food in the Manawatu, New Zealand.

    Science.gov (United States)

    Bojanić, K; Midwinter, A C; Marshall, J C; Rogers, L E; Biggs, P J; Acke, E

    2017-09-01

    Campylobacter causes acute gastroenteritis in people worldwide and is frequently isolated from food, animals and the environment. The disease is predominately food-borne but many routes of transmission and sources of infection have been described, including contact with pets. The prevalence of Campylobacter spp. in dogs and cats varies widely, and data on New Zealand pets are limited. This study aimed to investigate the prevalence of Campylobacter spp. in dogs, cats and retail raw meat pet food products in New Zealand and to characterize Campylobacter jejuni isolates using multilocus sequence typing (MLST). Ninety dogs and 110 cats examined at the Massey University Veterinary Teaching Hospital for elective procedures, and fifty locally purchased retail raw meat pet diets were sampled. Two culture protocols combining Bolton broth enrichment and mCCDA and CAT agars in a microaerobic atmosphere at 42°C and 37°C with species identification using PCR were performed. The prevalence of Campylobacter spp., C. jejuni, Campylobacter upsaliensis and Campylobacter helveticus was 36%, 13%, 23% and 1% in dogs and 16%, 5%, 5% and 7% in cats, respectively. One dog had Campylobacter lari confirmed, and three dogs and one cat had multiple Campylobacter spp. detected. Significantly more animals tested positive using CAT than mCCDA agar (P dogs, whereas attendance for dental treatment was a risk factor for cats. Campylobacter spp. were isolated from 28%, C. jejuni 22%, C. lari 6% and Campylobacter coli 6% of food samples. Six isolates positive by Campylobacter genus PCR were identified as Arcobacter butzleri. Poultry meat was more likely to be positive than non-poultry meat (P = 0.006). Of the 13 C. jejuni pet isolates with full MLST profiles, eight were of different sequence types (ST) and all nine food isolates were of different STs. © 2016 Blackwell Verlag GmbH.

  1. Frequency, Antimicrobial Resistance and Genetic Diversity of Klebsiella pneumoniae in Food Samples.

    Directory of Open Access Journals (Sweden)

    Yumei Guo

    Full Text Available This study aimed to assess the frequency of Klebsiella pneumoniae in food samples and to detect antibiotic resistance phenotypes, antimicrobial resistance genes and the molecular subtypes of the recovered isolates. A total of 998 food samples were collected, and 99 (9.9% K. pneumoniae strains were isolated; the frequencies were 8.2% (4/49 in fresh raw seafood, 13.8% (26/188 in fresh raw chicken, 11.4% (34/297 in frozen raw food and 7.5% (35/464 in cooked food samples. Antimicrobial resistance was observed against 16 antimicrobials. The highest resistance rate was observed for ampicillin (92.3%, followed by tetracycline (31.3%, trimethoprim-sulfamethoxazole (18.2%, and chloramphenicol (10.1%. Two K. pneumoniae strains were identified as extended-spectrum β-lactamase (ESBL-one strain had three beta-lactamases genes (blaSHV, blaCTX-M-1, and blaCTX-M-10 and one had only the blaSHV gene. Nineteen multidrug-resistant (MDR strains were detected; the percentage of MDR strains in fresh raw chicken samples was significantly higher than in other sample types (P<0.05. Six of the 18 trimethoprim-sulfamethoxazole-resistant strains carried the folate pathway inhibitor gene (dhfr. Four isolates were screened by PCR for quinolone resistance genes; aac(6'-Ib-cr, qnrB, qnrA and qnrS were detected. In addition, gyrA gene mutations such as T247A (Ser83Ile, C248T (Ser83Phe, and A260C (Asp87Ala and a parC C240T (Ser80Ile mutation were identified. Five isolates were screened for aminoglycosides resistance genes; aacA4, aacC2, and aadA1 were detected. Pulsed-field gel electrophoresis-based subtyping identified 91 different patterns. Our results indicate that food, especially fresh raw chicken, is a reservoir of antimicrobial-resistant K. pneumoniae, and the potential health risks posed by such strains should not be underestimated. Our results demonstrated high prevalence, antibiotic resistance rate and genetic diversity of K. pneumoniae in food in China. Improved

  2. Flavonoid content in ethanolic extracts of selected raw and traditionally processed indigenous foods consumed by vulnerable groups of Kenya: antioxidant and type II diabetes-related functional properties.

    Science.gov (United States)

    Kunyanga, Catherine N; Imungi, Jasper K; Okoth, Michael W; Biesalski, Hans K; Vadivel, Vellingiri

    2011-08-01

    The present study evaluated the flavonoid content, antioxidant as well as type II diabetes-related enzyme inhibition activities of ethanolic extract of certain raw and traditionally processed indigenous food ingredients including cereals, legumes, oil seeds, tubers, vegetables and leafy vegetables, which are commonly consumed by vulnerable groups in Kenya. The vegetables exhibited higher flavonoid content (50-703 mg/100 g) when compared with the grains (47-343 mg/100 g). The ethanolic extract of presently studied food ingredients revealed 33-93% DPPH radical scavenging capacity, 486-6,389 mmol Fe(II)/g reducing power, 19-43% α-amylase inhibition activity and 14-68% α-glucosidase inhibition activity. Among the different food-stuffs, the drumstick and amaranth leaves exhibited significantly higher flavonoid content with excellent functional properties. Roasting of grains and cooking of vegetables were found to be suitable processing methods in preserving the functional properties. Hence, such viable processing techniques for respective food samples will be considered in the formulation of functional supplementary foods for vulnerable groups in Kenya.

  3. Enrichment of Acinetobacter spp. from food samples.

    Science.gov (United States)

    Carvalheira, Ana; Ferreira, Vânia; Silva, Joana; Teixeira, Paula

    2016-05-01

    Relatively little is known about the role of foods in the chain of transmission of acinetobacters and the occurrence of different Acinetobacter spp. in foods. Currently, there is no standard procedure to recover acinetobacters from food in order to gain insight into the food-related ecology and epidemiology of acinetobacters. This study aimed to assess whether enrichment in Dijkshoorn enrichment medium followed by plating in CHROMagar™ Acinetobacter medium is a useful method for the isolation of Acinetobacter spp. from foods. Recovery of six Acinetobacter species from food spiked with these organisms was compared for two selective enrichment media (Baumann's enrichment and Dijkshoorn's enrichment). Significantly (p enrichment. Next, the Dijkshoorn's enrichment followed by direct plating on CHROMagar™ Acinetobacter was applied to detect Acinetobacter spp. in different foods. Fourteen different presumptive acinetobacters were recovered and assumed to represent nine different strains on the basis of REP-PCR typing. Eight of these strains were identified by rpoB gene analysis as belonging to the species Acinetobacter johnsonii, Acinetobacter calcoaceticus, Acinetobacter guillouiae and Acinetobacter gandensis. It was not possible to identify the species level of one strain which may suggests that it represents a distinct species. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Genetic diversity and virulence potential of Staphylococcus aureus isolates from raw and processed food commodities in Shanghai.

    Science.gov (United States)

    Song, Minghui; Bai, Yalong; Xu, Jie; Carter, Michelle Qiu; Shi, Chunlei; Shi, Xianming

    2015-02-16

    The risk of zoonotic transmission to humans highlights the need to understand the molecular ecology of Staphylococcus aureus in foods. In this study, 142 S. aureus isolates obtained from various raw and processed foods from Shanghai, China were characterized to determine their genetic diversity and virulence gene content. A total of 16 clonal complexes (CCs), 34 staphylococcal protein A (spa) types, and 6 accessory gene regulator (agr) allelic groups were identified and analyzed among the 142 S. aureus isolates. Among these, the genotype CC188-t189-agr Ι was the most prevalent, constituting 28.2% of all isolates. The presence of virulence genes encoding 20 staphylococcal enterotoxins (se), toxic shock syndrome toxin (tsst1), exfoliative toxins (eta, etb, and etd), Panton-Valentine leukocidin (lukS-PV and lukF-PV), as well as methicillin resistance gene (mecA), was determined by PCR. Of these S. aureus isolates, 72.5% harbored toxin genes, in which the most frequent toxin gene was sep (43.7%), followed by sej (26.1%) and pvl (21.1%). In contrast, see, ses, set, tsst1, etb, and etd were not found in any of the isolates tested. Eight S. aureus isolates (5.6%, 8/142), seven from raw milk and one from frozen food, were mecA positive and resistant to oxacillin, thus were MRSA. The 142 S. aureus isolates displayed 52 different toxin gene profiles. Although no direct association was found between toxin gene profile and the S. aureus genotype, the isolates belonging to CC5, CC9, CC20, CC50, and CC72 clonal lineages in general carried more toxin genes (>5) compared with the isolates in other CCs. It was also revealed that raw milk and raw meat were the major sources of isolates containing multiple toxin genes. S. aureus isolates from food that were genetically highly related, displayed diverse toxin gene profiles, implying the significant role of horizontal gene transfer in the emergence of highly toxigenic S. aureus isolates. Copyright © 2014 Elsevier B.V. All rights

  5. Effective sampling strategy to detect food and feed contamination

    NARCIS (Netherlands)

    Bouzembrak, Yamine; Fels, van der Ine

    2018-01-01

    Sampling plans for food safety hazards are aimed to be used to determine whether a lot of food is contaminated (with microbiological or chemical hazards) or not. One of the components of sampling plans is the sampling strategy. The aim of this study was to compare the performance of three

  6. SUSTAINABILITY OF SHORT FOOD SUPPLY CHAINS: ANALYSIS OF RAW MATERIAL SUPPLY IN MILAN PUBLIC SCHOOL CATERING

    Directory of Open Access Journals (Sweden)

    G. D’Anna

    2009-09-01

    Full Text Available The demand of short food supply chains is becoming more pressing by consumers, especially in the largest school catering. The implementation of the short chain in a large catering company of Milan, is described in this practical contribution. Several aspects of short food chains sustainability: legal, commercial and economic sustainability, hygienic and gastronomic sustainability, are discussed.

  7. Plant-based raw material: Improved food quality for better nutrition via plant genomics

    NARCIS (Netherlands)

    Meer, van der I.M.; Bovy, A.G.; Bosch, H.J.

    2001-01-01

    Plants form the basis of the human food chain. Characteristics of plants are therefore crucial to the quantity and quality of human food. In this review, it is discussed how technological developments in the area of plant genomics and plant genetics help to mobilise the potential of plants to

  8. Production of chlorothalonil hydrolytic dehalogenase from agro-industrial wastewater and its application in raw food cleaning.

    Science.gov (United States)

    He, Qin; Xu, Xi-Hui; Zhang, Fan; Tai, Yu-Kai; Luo, Yan-Fei; He, Jian; Hong, Qing; Jiang, Jian-Dong; Yan, Xin

    2017-06-01

    To reduce the fermentation cost for industrialization of chlorothalonil hydrolytic dehalogenase (Chd), agro-industrial wastewaters including molasses, corn steep liquor (CSL) and fermentation wastewater were used to substitute for expensive carbon and nitrogen sources and fresh water for lab preparation. The results showed that molasses and CSL could replace 5% carbon source and 100% organic nitrogen source respectively to maintain the same fermentation level. Re-fermentation from raffinate of ultra-filtered fermentation wastewater could achieve 61.03% of initial Chd activity and reach 96.39% activity when cultured in a mixture of raffinate and 50% of original medium constituent. Typical raw foods were chosen to evaluate the chlorothalonil removal ability of Chd. After Chd treatment for 2 h at room temperature, 97.40 and 75.55% of 30 mg kg -1 chlorothalonil on cherry tomato and strawberry respectively and 60.29% of 50 mg kg -1 chlorothalonil on Chinese cabbage were removed. Furthermore, the residual activity of the enzyme remained at 78-82% after treatment, suggesting its potential for reuse. This study proved the cost-feasibility of large-scale production of Chd from agro-industrial wastewater and demonstrated the potential of Chd in raw food cleaning. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  9. Neutron activation analysis for antimetabolites. [in food samples

    Science.gov (United States)

    1973-01-01

    Determination of metal ion contaminants in food samples is studied. A weighed quantity of each sample was digested in a concentrated mixture of nitric, hydrochloric and perchloric acids to affect complete solution of the food products. The samples were diluted with water and the pH adjusted according to the specific analysis performed. The samples were analyzed by neutron activation analysis, polarography, and atomic absorption spectrophotometry. The solid food samples were also analyzed by neutron activation analysis for increased sensitivity and lower levels of detectability. The results are presented in tabular form.

  10. A Class of Estimators for Finite Population Mean in Double Sampling under Nonresponse Using Fractional Raw Moments

    Directory of Open Access Journals (Sweden)

    Manzoor Khan

    2014-01-01

    Full Text Available This paper presents new classes of estimators in estimating the finite population mean under double sampling in the presence of nonresponse when using information on fractional raw moments. The expressions for mean square error of the proposed classes of estimators are derived up to the first degree of approximation. It is shown that a proposed class of estimators performs better than the usual mean estimator, ratio type estimators, and Singh and Kumar (2009 estimator. An empirical study is carried out to demonstrate the performance of a proposed class of estimators.

  11. Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples.

    Science.gov (United States)

    Alasaad, Noor; Alzubi, Hussein; Kader, Ahmad Abdul

    2016-06-01

    Food and feed samples were randomly collected from different sources, including local and imported materials from the Syrian local market. These included maize, barley, soybean, fresh food samples and raw material. GMO detection was conducted by PCR and nested PCR-based techniques using specific primers for the most used foreign DNA commonly used in genetic transformation procedures, i.e., 35S promoter, T-nos, epsps, cryIA(b) gene and nptII gene. The results revealed for the first time in Syria the presence of GM foods and feeds with glyphosate-resistant trait of P35S promoter and NOS terminator in the imported soybean samples with high frequency (5 out of the 6 imported soybean samples). While, tests showed negative results for the local samples. Also, tests revealed existence of GMOs in two imported maize samples detecting the presence of 35S promoter and nos terminator. Nested PCR results using two sets of primers confirmed our data. The methods applied in the brief data are based on DNA analysis by Polymerase Chain Reaction (PCR). This technique is specific, practical, reproducible and sensitive enough to detect up to 0.1% GMO in food and/or feedstuffs. Furthermore, all of the techniques mentioned are economic and can be applied in Syria and other developing countries. For all these reasons, the DNA-based analysis methods were chosen and preferred over protein-based analysis.

  12. [Rapid methods for the genus Salmonella bacteria detection in food and raw materials].

    Science.gov (United States)

    Sokolov, D M; Sokolov, M S

    2013-01-01

    The article considers sanitary and epidemiological aspects and the impact of Salmonella food poisoning in Russia and abroad. The main characteristics of the agent (Salmonella enterica subsp. Enteritidis) are summarized. The main sources of human Salmonella infection are products of poultry and livestock (poultry, eggs, dairy products, meat products, etc.). Standard methods of identifying the causative agent, rapid (alternative) methods of analysis of Salmonella using differential diagnostic medium (MSRV, Salmosyst, XLT4-agar, agar-Rambach et al.), rapid tests Singlepath-Salmonella and PCR (food proof Salmonella) in real time were stated. Rapid tests provide is a substantial (at 24-48 h) reducing the time to identify Salmonella.

  13. Processing concepts for the use of green leaves as raw materials for the food industry

    NARCIS (Netherlands)

    Tamayo Tenorio, A.; Schreuders, F.K.G.; Zisopoulos, F.K.; Boom, R.M.; Goot, van der A.J.

    2017-01-01

    Large-scale processing of leaves for food applications requires quick processing or stabilisation to avoid perishability, due to the high moisture content in this biomass. Leaf perishability is compounded by the seasonal availability of crops, like sugar beet plants, of which the leaves are regarded

  14. Raw mechanically separated chicken meat and salmon protein hydrolysate as protein sources in extruded dog food

    DEFF Research Database (Denmark)

    Tjernsbekk, M. T.; Tauson, A. H.; Kraugerud, O. F.

    2017-01-01

    Protein quality was evaluated for mechanically separated chicken meat (MSC) and salmon protein hydrolysate (SPH), and for extruded dog foods where MSC or SPH partially replaced poultry meal (PM). Apparent total tract digestibility (ATTD) of crude protein (CP) and amino acids (AA) in the protein...

  15. Notes on sample preparation of food: food of plant and animal origins, and daily meals

    International Nuclear Information System (INIS)

    Heilgeist, M.

    1992-01-01

    The procedure of food sample preparation to determine their specific radioactivity, analogous to chemical residue analysis, is laid down in the relevant sets of regulations. Several procedural steps of sample preparation of single food and composite food are dealt with. The sample size necessary for gamma spectroscopy and Sr-89/Sr-90 analysis, and the incineration step to enrich radionuclides are explained. Finally, enrichment by freeze drying of the high-volatile radionuclide I-131 is considered. (orig.) [de

  16. Oral food desensitization in children with IgE-mediated hen's egg allergy: a new protocol with raw hen's egg.

    Science.gov (United States)

    Meglio, Paolo; Giampietro, Paolo G; Carello, Rossella; Gabriele, Ida; Avitabile, Simona; Galli, Elena

    2013-02-01

    Hen's egg allergy affects young children and can cause severe allergic reactions. Avoidance results in dietary limitations and can affect the quality of life, especially in cases where potentially life-threatening reactions exist. Our objective was to desensitize children with moderate-severe IgE-mediated hen's egg allergy over a 6-month period, by introducing increasing and very gradual daily doses of raw hen's egg in order to enable the children to assume 25ml of this food, or to induce tolerance to the highest possible dose. The protocol foresaw the egg reintroduction in the home setting. In this randomized, controlled open study, 20 hen's egg allergic children (10 in the active group) were admitted. A convincing history or a positive double-blind placebo-controlled food challenge confirmed the diagnosis. Oral desensitization was performed with increasing doses starting from 0.27 mg of hen's egg proteins (1 drop of raw hen's egg diluted 1:100). We adopted an original, mathematically calculated protocol in order to ensure a constant, daily increment of doses. 8/10 children (80%) in the active group achieved the daily intake of 25ml over a 6-month period. One child (10%) could tolerate up to 2ml/day while another child (10%) failed the desensitization. Six months after enrolment only 2 children in the control group (20%) could tolerate hen's egg. We successfully desensitized 8/10 children with IgE-mediated hen's egg allergy in a 6-month period. The partial outcome in the child who could tolerate 2ml/day reduced the risk of severe reactions after unnoticed introduction of egg. A regular protocol that ensures a daily constant increase of doses helps to reduce possible adverse events, thus improving safety and effectiveness. © 2012 John Wiley & Sons A/S.

  17. Natural radioactivity measurement in pumice samples used raw materials in Turkey

    International Nuclear Information System (INIS)

    Turhan, S.; Yuecel, H.; Guenduez, L.; Sahin, S.; Vural, M.; Parmaksiz, A.; Demircioglu, B.

    2007-01-01

    The activity concentrations of 232 Th, 226 Ra, and 4 K in different pumice samples have been determined by high-resolution γ-ray spectrometry using a 110% HpGe detector. The radium equivalent activities (Ra eq ), external hazard index (H ex ), and internal hazard index (H in ) associated with the natural radionuclides and representative level index (I γ r ) are calculated to assess the radiation hazard of the natural radioactivity in the pumice samples. The mean values of the measured radioactivity concentrations of 232 Th, 226 Ra, and 4 K for pumice samples from the region of lakes (ROL) are 232.4±8.0, 196.9±7.8, and 1325.8±20.4 Bq kg -1 and for pumice samples from Cukurova region (CR) 16.3±4.0, 16.1±4.9, and 479.7±170.4 Bq kg -1 , respectively. The calculated Ra eq values vary from 435.9±12.5 to 883.6±41.5 Bq kg -1 with a mean of 630.9±20.2 Bq kg -1 for the ROL samples and from 49.7±3.3 to 101.9±7.2 Bq kg -1 with a mean of 76.3±23.7 Bq kg -1 for the CR samples. For the ROL samples, Ra eq are above the limit of 370 Bq kg -1 , equivalent to external γ dose of 1.5 mSv yr -1 , recommended for the safe use of construction materials by NEA-OECD, while for the CR samples, Ra eq values are lower than the limit

  18. Osmotic dehydration of fruit and berry raw materials in the food industry

    OpenAIRE

    N. A. Gribova; L. G. Eliseeva

    2017-01-01

    Osmotic dehydration has recently received more attention as an effective method of preserving fruits and berries. Osmosis is a simple process that facilitates the processing of fruits and berries in order to preserve the original characteristics, namely nutritional value and organoleptic properties: color, aroma and texture. Osmotic dehydration has found wide application in the preservation of food products, as the activity of water in fruits and berries decreases, in some of them up to 90% o...

  19. Food and feed safety assessment: the importance of proper sampling.

    Science.gov (United States)

    Kuiper, Harry A; Paoletti, Claudia

    2015-01-01

    The general principles for safety and nutritional evaluation of foods and feed and the potential health risks associated with hazardous compounds are described as developed by the Food and Agriculture Organization (FAO) and the World Health Organization (WHO) and further elaborated in the European Union-funded project Safe Foods. We underline the crucial role of sampling in foods/feed safety assessment. High quality sampling should always be applied to ensure the use of adequate and representative samples as test materials for hazard identification, toxicological and nutritional characterization of identified hazards, as well as for estimating quantitative and reliable exposure levels of foods/feed or related compounds of concern for humans and animals. The importance of representative sampling is emphasized through examples of risk analyses in different areas of foods/feed production. The Theory of Sampling (TOS) is recognized as the only framework within which to ensure accuracy and precision of all sampling steps involved in the field-to-fork continuum, which is crucial to monitor foods and feed safety. Therefore, TOS must be integrated in the well-established FAO/WHO risk assessment approach in order to guarantee a transparent and correct frame for the risk assessment and decision making process.

  20. Plasticizers in total diet samples, baby food and infant formulae

    DEFF Research Database (Denmark)

    Petersen, Jens Højslev; Breindahl, T.

    2000-01-01

    The plasticizers di-n-butylphthalate (DBP), butylbenzylphthalate (BBP), di-2-(ethylhexyl)phthalate (DEHP) and di-2-(ethylhexyl)adipate (DEHA) were analysed in 29 total diet samples, in 11 samples of baby food and in 11 samples of infant formulae. In all of the total diet samples the presence of one...... as in infant formulae. The calculated mean maximum intakes of the individual compounds from the total diet samples were below 10% of the restrictions proposed by the EU Scientific Committee for Food (SCF), and the spread in individual intakes was considerable. DEHP was the plasticizer determined most...

  1. Development of hazard analysis by critical control points (HACCP) procedures to control organic chemical hazards in the agricultural production of raw food commodities.

    Science.gov (United States)

    Ropkins, Karl; Ferguson, Andrew; Beck, Angus J

    2003-01-01

    Hazard Analysis by Critical Control Points (HACCP) is a systematic approach to the identification, assessment, and control of hazards in the food chain. Effective HACCP requires the consideration of all chemical microbiological, and physical hazards. However, current procedures focus primarily on microbiological and physical hazards, while chemical aspects of HACCP have received relatively little attention. In this article we discuss the application of HACCP to organic chemical contaminants and the problems that are likely to be encountered in agriculture. We also present generic templates for the development of organic chemical contaminant HACCP procedures for selected raw food commodities, that is, cereal crops,raw meats, and milk.

  2. [Determination of 11 mycotoxins in baked foods and raw materials by ultra performance liquid chromatography-quadrupole/electrostatic field orbitrap high-resolution mass spectrometry].

    Science.gov (United States)

    Li, Rong; He, Chunmei; Yang, Luqi; Wang, Yong; Zhang, Pengjie; Gao, Yongqing

    2017-08-08

    A method for the determination of 11 mycotoxins in baked foods and raw materials by ultra-high performance liquid chromatography-quadrupole/electrostatic field orbitrap high-resolution mass spectrometry (UPLC-HRMS) is reported in this paper. The samples were extracted with 20 mL 90% (v/v) acetonitrile aqueous solution containing 1% (v/v) formic acid, and the extracts were salted out by 2.0 g MgSO 4 and 0.5 g NaCl, cleaned up by 300 mg C18. The analytes were carried out on a CORTECS C18 column (100 mm×2.1 mm, 1.6 μ m) by gradient elution with 2 mmol/L ammonium acetate with 0.1% (v/v) formic acid aqueous solution and 2 mmol/L ammonium acetate methanol with 0.1% (v/v) formic acid. The results showed that the 11 mycotoxins had good linear relationships in their respective mass concentration ranges. The correlation coefficients were not less than 0.9960 and the limits of quantitation (LOQs) were from 0.15 to 20.00 μ g/kg. The recoveries of the 11 mycotoxins in bread ranged from 64.38% to 122.61% with the relative standard deviations (RSDs) from 1.52% to 12.99% at three spiked levels ( n =6). The method is demonstrated to be simple, fast, highly sensitive, reliable and it is effective to detect common mycotoxins in baked foods and raw materials.

  3. Occurrence of aflatoxin M(1) in some samples of UHT, raw & pasteurized milk from Indian states of Karnataka and Tamilnadu.

    Science.gov (United States)

    Siddappa, Vinutha; Nanjegowda, Divyashree Kallenahalli; Viswanath, Prema

    2012-11-01

    Aflatoxin M(1) (AFM(1)) is a toxic metabolite found in the milk of lactating animals which have consumed feedstuffs contaminated with aflatoxin B(1). Ultra high temperature treated (UHT) milk is a product which is becoming popular in developing countries like India as there is a lack of proper cold storage or refrigeration facilities. In this study, 45 samples of UHT milk of popular brands prevalent in the market were analyzed for the presence of AFM(1) by reversed phase HPLC using fluorescent detector after cleanup of sample with immunoaffinity columns. All samples of plain UHT milk were positive for AFM(1) and 38% of these contained levels more than 0.5 μg/kg, the maximum permitted limit prescribed by the Codex Alimentarius Commission and by the mandatory regulations of the country, the FSSAI Regulations, 2011. In 62.5% of flavored UHT milk, AFM(1) was below detectable levels (0.02 μgL(-1)). However, 12.5% of these samples also contained levels exceeding the maximum permitted limits. AFM(1) was present in 61.6% of the 52 raw milk samples analyzed from the two states of Karnataka and Tamilnadu with a range of 0.1-3.8 μgL(-1). 17.3% of these samples also exceeded the regulatory limits of the country. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Antibiotic resistance profile of bacteria isolated from raw milk samples of cattle and buffaloes

    Directory of Open Access Journals (Sweden)

    Tahlina Tanzin

    2016-03-01

    Conclusion: Two different species of bacteria i.e., S. aureus and E. coli are contaminating with milk samples. The pathogenic bacteria can be controlled effectively by using Ciprofloxacin and Levofloxacin in the case of mastitis in cattle and buffaloes in Bangladesh. [J Adv Vet Anim Res 2016; 3(1.000: 62-67

  5. Product samples stimulate choice of unfamiliar healthful food products.

    Science.gov (United States)

    Schickenberg, B; van Assema, P; Brug, J; de Vries, N K

    2011-08-01

    The purpose of this study was to assess whether the availability of a product sample of an unfamiliar low-fat or fruit and vegetable products stimulates choice for this product among food neophobic young adults. The study had a 2 (experimental vs. control group) by 4 (low-fat bread spread, low-fat cheese, fruit juice, fruit and vegetable juice) between subjects design with a pre-and post-experiment questionnaire. The study was conducted in restaurant rooms of several educational institutions in the Netherlands among a convenience sample of 197 food neophobic young adults aged 17-25 years. A small bite or sip-sized sample of the target product was provided as an intervention. The effect measure was choice of either an unfamiliar healthful food product or a traditional food product. Offering a sample of an unfamiliar healthful food product resulted in 51% of the participants in the experimental group choosing this product vs. 36.4% in the control group. Providing food product samples seems to be a promising strategy in healthy diet promotion programs for food neophobic young adults to increase first-time trial of unfamiliar low-fat and fruit and vegetable products. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. On-chip acoustophoretic isolation of microflora including S. typhimurium from raw chicken, beef and blood samples.

    Science.gov (United States)

    Ngamsom, Bongkot; Lopez-Martinez, Maria J; Raymond, Jean-Claude; Broyer, Patrick; Patel, Pradip; Pamme, Nicole

    2016-04-01

    Pathogen analysis in food samples routinely involves lengthy growth-based pre-enrichment and selective enrichment of food matrices to increase the ratio of pathogen to background flora. Similarly, for blood culture analysis, pathogens must be isolated and enriched from a large excess of blood cells to allow further analysis. Conventional techniques of centrifugation and filtration are cumbersome, suffer from low sample throughput, are not readily amenable to automation and carry a risk of damaging biological samples. We report on-chip acoustophoresis as a pre-analytical technique for the resolution of total microbial flora from food and blood samples. The resulting 'clarified' sample is expected to increase the performance of downstream systems for the specific detection of the pathogens. A microfluidic chip with three inlets, a central separation channel and three outlets was utilized. Samples were introduced through the side inlets, and buffer solution through the central inlet. Upon ultrasound actuation, large debris particles (10-100 μm) from meat samples were continuously partitioned into the central buffer channel, leaving the 'clarified' outer sample streams containing both, the pathogenic cells and the background flora (ca. 1 μm) to be collected over a 30 min operation cycle before further analysis. The system was successfully tested with Salmonella typhimurium-spiked (ca. 10(3)CFU mL(-1)) samples of chicken and minced beef, demonstrating a high level of the pathogen recovery (60-90%). When applied to S. typhimurium contaminated blood samples (10(7)CFU mL(-1)), acoustophoresis resulted in a high depletion (99.8%) of the red blood cells (RBC) which partitioned in the buffer stream, whilst sufficient numbers of the viable S. typhimurium remained in the outer channels for further analysis. These results indicate that the technology may provide a generic approach for pre-analytical sample preparation prior to integrated and automated downstream detection of

  7. Direct determination of Pb in raw milk by graphite furnace atomic absorption spectrometry (GF AAS) with electrothermal atomization sampling from slurries.

    Science.gov (United States)

    de Oliveira, Tatiane Milão; Augusto Peres, Jayme; Lurdes Felsner, Maria; Cristiane Justi, Karin

    2017-08-15

    Milk is an important food in the human diet due to its physico-chemical composition; therefore, it is necessary to monitor contamination by toxic metals such as Pb. Milk sample slurries were prepared using Triton X-100 and nitric acid for direct analysis of Pb using graphite furnace atomic absorption spectrometry - GF AAS. After dilution of the slurries, 10.00µl were directly introduced into the pyrolytic graphite tube without use of a chemical modifier, which acts as an advantage considering this type of matrix. The limits of detection and quantification were 0.64 and 2.14µgl -1 , respectively. The figures of merit studied showed that the proposed methodology without pretreatment of the raw milk sample and using external standard calibration is suitable. The methodology was applied in milk samples from the Guarapuava region, in Paraná State (Brazil) and Pb concentrations ranged from 2.12 to 37.36µgl -1 . Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Quality and Antioxidant Activity of Buckwheat-Based Cookies Designed for a Raw Food Vegan Diet as Affected by Moderate Drying Temperature.

    Science.gov (United States)

    Brožková, Iveta; Dvořáková, Veronika; Michálková, Kateřina; Červenka, Libor; Velichová, Helena

    2016-12-01

    Buckwheat cookies with various ingredients for raw food vegan diet are usually prepared by soaking them in water at ambient temperature followed by drying at moderate temperature. The aim of this study was to examine the temperature effect on the microbiological quality, antioxidant properties and oxidative stability of lipids of final dried samples. The mixture of ingredients was soaked for 20 h in distilled water, and then cookies were formed and dried in air-forced oven at constant temperature in the range from 40 to 60 °C. Total viable counts, fungi, yeasts, coliform and aerobic spore-forming bacteria counts were evaluated in dried samples and were found to decrease during drying at 50 and 60 °C. Antioxidant activity was determined by DPPH and ABTS assays, and the former showed the highest value at 40 °C. Superoxide dismutase activity was also higher at 40 °C in comparison with that at 60 °C. The percentage of lipid peroxidation inhibition increased with the increase in drying temperature until 4th day of incubation. While peroxide value was significantly higher in samples dried at 40 °C, TBARS values did not show significant changes during the drying process. The results of this study suggest that drying buckwheat-based cookies at 40 °C retained their good antioxidant properties but represent a potentially serious microbial hazard.

  9. Influence of audiovisuals and food samples on consumer acceptance of food irradiation

    International Nuclear Information System (INIS)

    Pohlman, A.J.; Wood, O.B.; Mason, A.C.

    1994-01-01

    The effects of audiovisual presentation on consumers' knowledge and attitudes toward food irradiation were demonstrated. Food irradiation is a method of food preservation that can destroy the microorganisms responsible for many foodborne illnesses and food spoilage. However, the food industry has been slow to adopt this method because it is unsure of consumer acceptance. One hundred and seventy-nine consumers were given a slide-tape presentation on food irradiation. Test subjects were also presented with a sample of irradiated strawberries. It was found that participants knew more about and were more positive toward food irradiation following the educational program. These findings demonstrate the value of educational materials in influencing the food preferences of consumers

  10. Open problems in traceability: from raw materials to finished food products

    Directory of Open Access Journals (Sweden)

    Lorenzo Comba

    2013-09-01

    Full Text Available Even though the main EU regulations concerning food traceability have already entered to force since many years, we still remark very wide and impacting product recalls, which often involve simultaneously large territories and many countries. This is a clear sign that current traceability procedures and systems, when implemented with the only aim of respecting mandatory policies, are not effective, and that there are some aspects that are at present underestimated, and therefore should be attentively reconsidered. In particular, the sole adoption of the so-called “one step back-one step forward traceability” to comply the EC Regulation 178/2002, where every actor in the chain handles merely the data coming from his supplier and those sent to his client, is in fact not sufficient to control and to limit the impact of a recall action after a risk notification. Recent studies on lots dispersion and routing demonstrate that each stakeholder has to plan his activities (production, transformation or distribution according to specific criteria that allow pre-emptively estimating and limiting the range action of a possible recall. Moreover, these new and very recently proposed techniques still present some limits; first of all the problem of traceability of bulk products (e.g. liquids, powders, grains, crystals during production phases that involve mixing operations of several lots of different/same materials. In fact, current traceability practices are in most cases unable to deal efficiently with this kind of products, and, in order to compensate the lack of knowledge about lot composition, typically resort to the adoption of very large lots, based for instance on a considered production period. Aim of this paper is to present recent advances in the design of supply chain traceability systems, discussing problems that are still open and are nowadays subject of research.

  11. Application of radioactivation analysis for determination of impurities in aluminium, raw materials and in samples from aluminium production process

    International Nuclear Information System (INIS)

    Vucina, L.J.

    1977-01-01

    Trace elements in aluminium, raw materials and in the samples from different stages of aluminium production were determined by nondestructive neutron radioactivation analysis. The samples were taken from the Bayer's process of alumina production (bauxite, red sludge and alumina), from the components of the reduction cell (anode, criolyte and AlF 3 ) and of the final product - aluminium (purity 99.5-99.7%). Under given set of conditions ten trace elements (V,La,Ga,Mn,Co,Cr,Sc,Sb,Zn and Fe) were determined in aluminium and followed through the production process. It was found that the main impurities in aluminium are iron (0.15%) and zinc (0.O6%). It has been concluded that the purity of produced aluminium depends mainly on the purity of used alumina. The second important source of contamination of aluminium is anode. The results obtained by radioactivation analysis for V, Mn, Cr and Fe fall within the ranges of concentrations of these elements determined by use of other methods (volumetry, spectrophotometry, atomic absorption). Higher values for zinc were obtained by radioactivation analysis, probably due to unsatisfactory irradiation and measuring conditions for this element. The possibilities of application of radioactivation analysis to these kinds of samples are also disscused

  12. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL producing Enterobacteriaceae in food producing animals, minced meat and raw milk

    Directory of Open Access Journals (Sweden)

    Geser Nadine

    2012-03-01

    Full Text Available Abstract Background The impact of food animals as a possible reservoir for extended-spectrum beta-lactamase (ESBL producing Enterobacteriaceae, and the dissemination of such strains into the food production chain need to be assessed. In this study 334 fecal samples from pigs, cattle, chicken and sheep were investigated at slaughter. Additionally, 100 raw milk samples, representing bulk tank milk of 100 different dairy farms, 104 minced meat (pork and beef samples and 67 E. coli isolates from cattle E. coli mastitis were analyzed. Results As many as 15.3% of the porcine, 13.7% of the bovine, 8.6% of the sheep and 63.4% of the chicken fecal samples yielded ESBL producers after an enrichment step. In contrast, none of the minced meat, none of the bulk tank milk samples and only one of the mastitis milk samples contained ESBL producing strains. Of the total of 91 isolates, 89 were E. coli, one was Citrobacter youngae and one was Enterobacter cloacae. PCR analysis revealed that 78 isolates (85.7% produced CTX-M group 1 ESBLs while six isolates (6.6% produced CTX-M group 9 enzymes. Five detected ESBLs (5.5% belonged to the SHV group and 2 isolates (2.2% contained a TEM-type enzyme. A total of 27 CTX-M producers were additionally PCR-positive for TEM-beta-lactamase. The ESBL-encoding genes of 53 isolates were sequenced of which 34 produced CTX-M-1, 6 produced CTX-M-14, 5 produced CTX-M-15 and also 5 produced SHV-12. Two isolates produced TEM-52 and one isolate expressed a novel CTX-M group 1 ESBL, CTX-M-117. One isolate--aside from a CTX-M ESBL-- contained an additional novel TEM-type broad-spectrum beta-lactamase, TEM-186. Conclusions The relatively high rates of ESBL producers in food animals and the high genetic diversity among these isolates are worrisome and indicate an established reservoir in farm animals.

  13. Sample preparation and EFTEM of Meat Samples for Nanoparticle Analysis in Food

    International Nuclear Information System (INIS)

    Lari, L; Dudkiewicz, A

    2014-01-01

    Nanoparticles are used in industry for personal care products and the preparation of food. In the latter application, their functions include the prevention of microbes' growth, increase of the foods nutritional value and sensory quality. EU regulations require a risk assessment of the nanoparticles used in foods and food contact materials before the products can reach the market. However, availability of validated analytical methodologies for detection and characterisation of the nanoparticles in food hampers appropriate risk assessment. As part of a research on the evaluation of the methods for screening and quantification of Ag nanoparticles in meat we have tested a new TEM sample preparation alternative to resin embedding and cryo-sectioning. Energy filtered TEM analysis was applied to evaluate thickness and the uniformity of thin meat layers acquired at increasing input of the sample demonstrating that the protocols used ensured good stability under the electron beam, reliable sample concentration and reproducibility

  14. Sample preparation and EFTEM of Meat Samples for Nanoparticle Analysis in Food

    Science.gov (United States)

    Lari, L.; Dudkiewicz, A.

    2014-06-01

    Nanoparticles are used in industry for personal care products and the preparation of food. In the latter application, their functions include the prevention of microbes' growth, increase of the foods nutritional value and sensory quality. EU regulations require a risk assessment of the nanoparticles used in foods and food contact materials before the products can reach the market. However, availability of validated analytical methodologies for detection and characterisation of the nanoparticles in food hampers appropriate risk assessment. As part of a research on the evaluation of the methods for screening and quantification of Ag nanoparticles in meat we have tested a new TEM sample preparation alternative to resin embedding and cryo-sectioning. Energy filtered TEM analysis was applied to evaluate thickness and the uniformity of thin meat layers acquired at increasing input of the sample demonstrating that the protocols used ensured good stability under the electron beam, reliable sample concentration and reproducibility.

  15. The pivotal role of mass spectrometry in determining the presence of chemical contaminants in food raw materials.

    Science.gov (United States)

    Mohamed, Rayane; Guy, Philippe A

    2011-01-01

    During recent years, a rising interest from consumers and various governmental organizations towards the quality of food has continuously been observed. Human intervention across the different stages of the food supply chain can lead to the presence of several types of chemical contaminants in food-based products. On a normal daily consumption basis, some of these chemicals are not harmful; however, for those that present a risk to consumers, legislation rules were established to specify tolerance levels or in some cases the total forbiddance of these specific contaminants. Hence, the use of appropriate analytical tools is recommended to properly identify chemical contaminants. In that context, mass spectrometry (MS)-based techniques coupled or not to chromatography offer a vast panel of features such as sensitivity, selectivity, quantification at trace levels, and/or structural elucidation. Because of the complexity of food-based matrices, sample preparation is a crucial step before final detection. In the present manuscript, we review the contribution and the potentialities of MS-based techniques to ensure the absence of chemical contaminants in food-based products. Copyright © 2011 Wiley Periodicals, Inc.

  16. The study of the kinetics of drying food raw material of plant origin in the active hydrodynamic regimes and development of dryer engineering calculation methods

    Directory of Open Access Journals (Sweden)

    A. N. Ostrikov

    2015-01-01

    Full Text Available Consumer properties of food raw material formed during the heat treatment. New physical, flavoring and aromatic properties of the products of plant origin, formed during drying due to substantial changes in the composition of the raw materia l occurring as a result of biochemical reactions. In the production of dried and roasted products is very important to follow the parameters that contribute to the passage of biochemical processes aimed at creating a product with high nutritional qualities, strong aroma and pleasant taste. We studied the basic kinetics of the drying process of food raw material (in terms of artichoke in a dense interspersed layer, which formed the basis for the rational choice of the drying regime with due consideration of changes in the moisture content of the product are studied. The nature of the effect of the dried product movement hydrodynamic conditions on a layer height and intensity of drying is established. As a result of food raw material drying process kinetics analysis (in terms of artichoke multistep drying regimes were chosen. Analysis of the artichoke particles drying by air, air-steam mixture and superheated steam intensity showed the presence of two parts: the horizontal one and gradually diminishing one. Kinetic laws of the artichoke drying process in a dense interspersed layer were the basis of engineering calculation of dryer with a transporting body in the form of a "traveling wave". Application of the dryer with the transporting body in the form of a "traveling wave" for food raw material drying allow to achieve uniform drying of the product due to the use of soft, gentle regimes of oversleeping while preserving to the utmost particles of the product; to improve the quality of the finished product through the use of interspersed layer that reduces clumping of product to be dried.

  17. Comparing the sensitizing capacity of raw and processed cow's milk in a murine sensitization model for food allergy

    NARCIS (Netherlands)

    Abbring, S.; Diks, M.A.P.|info:eu-repo/dai/nl/372617298; Dingjan, G.M.; Baars, T.; Garssen, J.|info:eu-repo/dai/nl/086369962; Van Esch, B.C.A.M.|info:eu-repo/dai/nl/304839256

    2016-01-01

    Background: Epidemiological studies show that the consumption of raw milk early in life is protective against the development of allergies later in life. The effect was found to be limited to raw milk consumption and was not observed when this milk was boiled or when pasteurized and homogenized shop

  18. Rapid methods for measuring radionuclides in food and environmental samples

    International Nuclear Information System (INIS)

    Perkins, Richard W.

    1995-01-01

    The application of ICP/mass spectrometry for the isotopic analysis of environmental samples, the use of drum assayers for measuring radionuclides in food and a rapid procedure for the measurement of the transuranic elements and thorium, performed at the Pacific Northwest Laboratory are discussed

  19. Modeling Optimal Cutoffs for the Brazilian Household Food Insecurity Measurement Scale in a Nationwide Representative Sample.

    Science.gov (United States)

    Interlenghi, Gabriela S; Reichenheim, Michael E; Segall-Corrêa, Ana M; Pérez-Escamilla, Rafael; Moraes, Claudia L; Salles-Costa, Rosana

    2017-07-01

    Background: This is the second part of a model-based approach to examine the suitability of the current cutoffs applied to the raw score of the Brazilian Household Food Insecurity Measurement Scale [Escala Brasileira de Insegurança Alimentar (EBIA)]. The approach allows identification of homogeneous groups who correspond to severity levels of food insecurity (FI) and, by extension, discriminant cutoffs able to accurately distinguish these groups. Objective: This study aims to examine whether the model-based approach for identifying optimal cutoffs first implemented in a local sample is replicated in a countrywide representative sample. Methods: Data were derived from the Brazilian National Household Sample Survey of 2013 ( n = 116,543 households). Latent class factor analysis (LCFA) models from 2 to 5 classes were applied to the scale's items to identify the number of underlying FI latent classes. Next, identification of optimal cutoffs on the overall raw score was ascertained from these identified classes. Analyses were conducted in the aggregate data and by macroregions. Finally, model-based classifications (latent classes and groupings identified thereafter) were contrasted to the traditionally used classification. Results: LCFA identified 4 homogeneous groups with a very high degree of class separation (entropy = 0.934-0.975). The following cutoffs were identified in the aggregate data: between 1 and 2 (1/2), 5 and 6 (5/6), and 10 and 11 (10/11) in households with children and/or adolescents category emerged consistently in all analyses. Conclusions: Nationwide findings corroborate previous local evidence that households with an overall score of 1 are more akin to those scoring negative on all items. These results may contribute to guide experts' and policymakers' decisions on the most appropriate EBIA cutoffs. © 2017 American Society for Nutrition.

  20. Validation of method in instrumental NAA for food products sample

    International Nuclear Information System (INIS)

    Alfian; Siti Suprapti; Setyo Purwanto

    2010-01-01

    NAA is a method of testing that has not been standardized. To affirm and confirm that this method is valid. it must be done validation of the method with various sample standard reference materials. In this work. the validation is carried for food product samples using NIST SRM 1567a (wheat flour) and NIST SRM 1568a (rice flour). The results show that the validation method for testing nine elements (Al, K, Mg, Mn, Na, Ca, Fe, Se and Zn) in SRM 1567a and eight elements (Al, K, Mg, Mn, Na, Ca, Se and Zn ) in SRM 1568a pass the test of accuracy and precision. It can be conclude that this method has power to give valid result in determination element of the food products samples. (author)

  1. Stability of vitamin C in frozen raw fruit and vegetable homogenates

    Science.gov (United States)

    Retention of vitamin C in homogenized raw fruits and vegetables stored under laboratory conditions prior to analysis was investigated. Raw collard greens, clementines, and potatoes were chosen, to be representative of food matrices to be sampled in USDA’s National Food and Nutrient Analysis Program...

  2. A comparison of surface water natural organic matter in raw filtered water samples, XAD, and reverse osmosis isolates

    Science.gov (United States)

    Maurice, P.A.; Pullin, M.J.; Cabaniss, S.E.; Zhou, Q.; Namjesnik-Dejanovic, K.; Aiken, G.R.

    2002-01-01

    This research compared raw filtered waters (RFWs), XAD resin isolates (XAD-8 and XAD-4), and reverse osmosis (RO) isolates of several surface water samples from McDonalds Branch, a small freshwater fen in the New Jersey Pine Barrens (USA). RO and XAD-8 are two of the most common techniques used to isolate natural organic matter (NOM) for studies of composition and reactivity; therefore, it is important to understand how the isolates differ from bulk (unisolated) samples and from one another. Although, any comparison between the isolation methods needs to consider that XAD-8 is specifically designed to isolate the humic fraction, whereas RO concentrates a broad range of organic matter and is not specific to humics. The comparison included for all samples: weight average molecular weight (Mw), number average molecular weight (Mn), polydispersity (??), absorbance at 280nm normalized to moles C (??280) (RFW and isolates); and for isolates only: elemental analysis, % carbon distribution by 13C NMR, and aqueous FTIR spectra. As expected, RO isolation gave higher yield of NOM than XAD-8, but also higher ash content, especially Si and S. Mw decreased in the order: RO>XAD-8>RFW>XAD-4. The Mw differences of isolates compared with RFW may be due to selective isolation (fractionation), or possibly in the case of RO to condensation or coagulation during isolation. 13C NMR results were roughly similar for the two methods, but the XAD-8 isolate was slightly higher in 'aromatic' C and the RO isolate was slightly higher in heteroaliphatic and carbonyl C. Infrared spectra indicated a higher carboxyl content for the XAD-8 isolates and a higher ester:carboxyl ratio for the RO isolates. The spectroscopic data thus are consistent with selective isolation of more hydrophobic compounds by XAD-8, and also with potential ester hydrolysis during that process, although further study is needed to determine whether ester hydrolysis does indeed occur. Researchers choosing between XAD and RO

  3. Macro elemental analysis of food samples by nuclear analytical technique

    Science.gov (United States)

    Syahfitri, W. Y. N.; Kurniawati, S.; Adventini, N.; Damastuti, E.; Lestiani, D. D.

    2017-06-01

    Energy-dispersive X-ray fluorescence (EDXRF) spectrometry is a non-destructive, rapid, multi elemental, accurate, and environment friendly analysis compared with other detection methods. Thus, EDXRF spectrometry is applicable for food inspection. The macro elements calcium and potassium constitute important nutrients required by the human body for optimal physiological functions. Therefore, the determination of Ca and K content in various foods needs to be done. The aim of this work is to demonstrate the applicability of EDXRF for food analysis. The analytical performance of non-destructive EDXRF was compared with other analytical techniques; neutron activation analysis and atomic absorption spectrometry. Comparison of methods performed as cross checking results of the analysis and to overcome the limitations of the three methods. Analysis results showed that Ca found in food using EDXRF and AAS were not significantly different with p-value 0.9687, whereas p-value of K between EDXRF and NAA is 0.6575. The correlation between those results was also examined. The Pearson correlations for Ca and K were 0.9871 and 0.9558, respectively. Method validation using SRM NIST 1548a Typical Diet was also applied. The results showed good agreement between methods; therefore EDXRF method can be used as an alternative method for the determination of Ca and K in food samples.

  4. Control System Radioactive Contamination in Food Samples in Poland

    International Nuclear Information System (INIS)

    Grabowski, D.; Kurowski, W.; Muszynski, W.; Rubel, B.; Smagala, G.; Swietochowska, J.

    2001-01-01

    Full text: The analyses of the level of radioactive contamination in food samples are carried out by the Service for Measurements of Radioactive Contamination (SMRC) in Poland. The Service was brought into existence in 1961. The Service comprises of a network of measurement stations and the Centre of Radioactive Contamination Measurements (CRCM). The duty of the Centre is being executed by the Central Laboratory for Radiological Protection (CLRP). The uniform methods of sampling are used in measurement stations. All important foodstuff: milk, meat, vegetables, fruit, cereals are controlled in the Service stations. The radiochemical and spectrometric methods are used to determine the activity of radioactive isotopes. The standard equipment of the measurement station is the measurement system type SAPOS-90 and multichannel analyser with scintillation or germanium detector. The structure of the Service, kinds of samples tested by each station, program of sampling in normal and during accident situation are presented in this paper. (author)

  5. 78 FR 53017 - Changes to the Salmonella Verification Sampling Program: Analysis of Raw Beef for Shiga Toxin...

    Science.gov (United States)

    2013-08-28

    ... evaluated the FSIS Salmonella detection method (FSIS Microbiology Laboratory Guidebook Chapter 4.06) using... prevalence estimates, FSIS defines prevalence as the proportion of applicable product that would test... that is intended for use as raw, non-intact product tests positive for STEC, the product is adulterated...

  6. Food variety, dietary diversity, and food characteristics among convenience samples of Guatemalan women.

    Science.gov (United States)

    Soto-Méndez, María José; Campos, Raquel; Hernández, Liza; Orozco, Mónica; Vossenaar, Marieke; Solomons, Noel W

    2011-01-01

    To compare variety and diversity patterns and dietary characteristics in Guatemalan women. Two non-consecutive 24-h recalls were conducted in convenience samples of 20 rural Mayan women and 20 urban students. Diversity scores were computed using three food-group systems.Variety and diversity scores and dietary origin and characteristics were compared between settings using independent t-test or Mann-Whitney-U-test. Dietary variety and diversity were generally greater in the urban sample when compared to the rural sample, depending on the number of days and food-group system used for evaluation.The diet was predominantly plant-based and composed of non-fortified food items in both areas.The rural diet was predominantly composed of traditional,non-processed foods. The urban diet was mostly based on non-traditional and processed items. Considerations of intervention strategies for dietary improvement and health protection for the Guatemalan countryside should still rely on promotion and preservation of traditional food selection.

  7. Review Paper of Radionuclide Monitoring in Food Sample

    International Nuclear Information System (INIS)

    Noor Fadzilah Yusof; Abdul Kadir Ishak; Wo, Y.M.; Nurrul Assyikeen Mohd Jaffary

    2011-01-01

    The uncontrolled release of radionuclides into the atmospheric and aquatic environments may occur as the result of a nuclear or radiological accident. Monitoring of the accidental release at its source and especially direct monitoring of the environmental contamination with radionuclides is necessary for assessment and application of public protective actions and longer term countermeasures as well as emergency workers' protection. In areas historically contaminated with long lived radionuclides monitoring it is essential to protect the public and substantiation of any radiological incidents. Also, dietary pathways can be contaminated with radioactive materials resulting from natural occurrence or man-made applications especially during routine operation, accidents and migration of radionuclides from radioactive waste disposal repositories into the biosphere. Therefore, efforts should be made to determine the presence of radionuclides in a potentially high radiation area especially in operational nuclear facilities. This paper will review the strategies for food monitoring that has been adapted in most countries to obtain baseline data for future reference. Also, this study is discussing the type of food selection commonly collected as sample for radionuclide analysis in different countries over the years. Sampling procedure and analysis also included in this review for better understanding of the analysis. Stake holders' involvement is considered as an important asset in the establishment of monitoring strategies. As a conclusion, future plans for food monitoring programme in Malaysia are recommended as a preparation to embark on the Nuclear Power Plant programme. (author)

  8. QUALITY MANAGEMENT OF FOOD SYSTEMS WITH THE PREDICTED BIOPOTENTIAL ON THE BASIS OF PRODUCTS OF PROCESSING OF DOMESTIC LOW-OLIVE RAW MATERIALS

    Directory of Open Access Journals (Sweden)

    T. V. Alekseeva

    2015-01-01

    Full Text Available Summary. This receiving the vegetable complex food system (VCFS on the basis of the cake of germs of wheat (CGW is presented. The review of composition of vegetable oils from low-olive raw materials is given, prospects of its application for creation of food systems of the balanced structure on PNZС are analyzed. It is established that the ratio of -6 и -3 of fatty acids in oil of germs of wheat doesn't correspond to recommendations of scientific research institute of food of the Russian Academy of Medical Science. For the purpose of establishment of necessary balance of -6 и -3 in food system, the blend with oils of an amaranth and pumpkin is carried out. The review of composition of vegetable oils from low-olive raw materials is given. The optimum ratio the entered oil of an amaranth and pumpkin according to recommendations of scientific research institute of food of the Russian Academy of Medical Science, by means of the developed software products written on in the Python 2.6 language and in the imperative, structured, object-oriented programming language – Delphi 7.0 is picked up. On the basis of the obtained data, the mass fraction of the components entering a compounding of vegetable food system is defined. The technological process of production of a product including the following stages is described: reception and preparation of raw materials and materials, dispensing and mixing of components, crushing and packing. Physical and chemical indicators of the received product, a chemical composition of RKPS and an organoleptic assessment of an innovative product are given. Calculation of satisfaction of daily need of an organism for feedstuffs and energy of vegetable food system is made. The composition of protein of an innovative product is analyzed: the amino-acid structure of food system, biological value, and also following indicators is counted: utility coefficient, coefficient of comparable redundancy, coefficient of

  9. Sample preparation combined with electroanalysis to improve simultaneous determination of antibiotics in animal derived food samples.

    Science.gov (United States)

    da Silva, Wesley Pereira; de Oliveira, Luiz Henrique; Santos, André Luiz Dos; Ferreira, Valdir Souza; Trindade, Magno Aparecido Gonçalves

    2018-06-01

    A procedure based on liquid-liquid extraction (LLE) and phase separation using magnetically stirred salt-induced high-temperature liquid-liquid extraction (PS-MSSI-HT-LLE) was developed to extract and pre-concentrate ciprofloxacin (CIPRO) and enrofloxacin (ENRO) from animal food samples before electroanalysis. Firstly, simple LLE was used to extract the fluoroquinolones (FQs) from animal food samples, in which dilution was performed to reduce interference effects to below a tolerable threshold. Then, adapted PS-MSSI-HT-LLE protocols allowed re-extraction and further pre-concentration of target analytes in the diluted acid samples for simultaneous electrochemical quantification at low concentration levels. To improve the peak separation, in simultaneous detection, a baseline-corrected second-order derivative approach was processed. These approaches allowed quantification of target FQs from animal food samples spiked at levels of 0.80 to 2.00 µmol L -1 in chicken meat, with recovery values always higher than 80.5%, as well as in milk samples spiked at 4.00 µmol L -1 , with recovery values close to 70.0%. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Determination of haemolytic and non haemolytic genes profiles of Bacillus cereus strains isolated from food samples by polymerase chain reaction (pcr) technique

    Science.gov (United States)

    Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah

    2018-04-01

    The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.

  11. Challenging genosensors in food samples: The case of gluten determination in highly processed samples.

    Science.gov (United States)

    Martín-Fernández, Begoña; de-los-Santos-Álvarez, Noemí; Martín-Clemente, Juan Pedro; Lobo-Castañón, María Jesús; López-Ruiz, Beatriz

    2016-01-01

    Electrochemical genosensors have undergone an enormous development in the last decades, but only very few have achieved a quantification of target content in highly processed food samples. The detection of allergens, and particularly gluten, is challenging because legislation establishes a threshold of 20 ppm for labeling as gluten-free but most genosensors expresses the results in DNA concentration or DNA copies. This paper describes the first attempt to correlate the genosensor response and the wheat content in real samples, even in the case of highly processed food samples. A sandwich-based format, comprising a capture probe immobilized onto the screen-printed gold electrode, and a signaling probe functionalized with fluorescein isothiocyanate (FITC), both hybridizing with the target was used. The hybridization event was electrochemically monitored by adding an anti-FITC peroxidase (antiFITC-HRP) and its substrate, tetramethylbenzidine. Binary model mixtures, as a reference material, and real samples have been analyzed. DNA from food was extracted and a fragment encoding the immunodominant peptide of α2-gliadin amplified by a tailored PCR. The sensor was able to selectively detect toxic cereals for celiac patients, such as different varieties of wheat, barley, rye and oats, from non-toxic plants. As low as 0.001% (10 mg/kg) of wheat flour in an inert matrix was reliably detected, which directly compete with the current method of choice for DNA detection, the real-time PCR. A good correlation with the official immunoassay was found in highly processed food samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Enzyme sensor array for the determination of biogenic amines in food samples

    Energy Technology Data Exchange (ETDEWEB)

    Lange, Jana [University of Greifswald, Institute for Chemistry and Biochemistry (Germany); Wittmann, Christine [Fachhochschule Neubrandenburg, Department of Technology (Germany)

    2002-01-01

    An enzyme sensor array for the simultaneous determination of the three biogenic amines (histamine, tyramine and putrescine) by pattern recognition using an artificial neural network and its application to different food samples is described. A combination of a monoamine oxidase, a tyramine oxidase and a diamine oxidase (with specific activities sufficient for rapid detection) are immobilised each on a separate screen-printed thick-film electrode via transglutaminase and glutaraldehyde to compare these cross-linking reagents with regard to their suitability. To calculate the amount of a specific biogenic amine, the raw data from multichannel software were transferred to a neural network. The sensor array takes 20 min to complete (excluding statistical data analysis) with only one extraction and subsequent neutralisation step required prior to sensor measurement. The lower detection limits with the enzyme sensor were 10 mg/kg for histamine and tyramine, and 5 mg/kg for putrescine with a linear range up to 200 mg/kg for histamine and tyramine and 100 mg/kg for putrescine. The application area of the enzyme sensor array was tested from fish to meat products, sauerkraut, beer, dairy products, wine and further fermented foods and compared with the data of conventional LC analyses (mean correlation coefficient: 0.854). (orig.)

  13. Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Sarrafzadeh Zargar

    2014-07-01

    Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.

  14. Ptaquiloside, the major carcinogen of bracken fern, in the pooled raw milk of healthy sheep and goats: an underestimated, global concern of food safety.

    Science.gov (United States)

    Virgilio, Antonella; Sinisi, Annamaria; Russo, Valeria; Gerardo, Salvatore; Santoro, Adriano; Galeone, Aldo; Taglialatela-Scafati, Orazio; Roperto, Franco

    2015-05-20

    Bracken fern (Pteridium aquilinum) is a worldwide plant containing toxic substances, which represent an important chemical hazard for animals, including humans. Ptaquiloside, 1, a norsesquiterpenoid glucoside, is the major carcinogen of bracken detected in the food chain, particularly in the milk from farm animals. To date, ptaquiloside has been shown in the milk of cows feeding on a diet containing bracken fern. This is the first study that shows the systematic detection of ptaquiloside, 1, and reports its direct quantitation in pooled raw milk of healthy sheep and goats grazing on bracken. Ptaquiloside, 1, was detected by a sensitive method based on the chemical conversion of ptaquiloside, 1, into bromopterosine, 4, following gas chromatography-mass spectrometry (GC-MS) analysis. The presence of ptaquiloside, 1, possibly carcinogenic to humans, in the milk of healthy animals is an unknown potential health risk, thus representing a harmful and potential global concern of food safety.

  15. Price promotions for food and beverage products in a nationwide sample of food stores.

    Science.gov (United States)

    Powell, Lisa M; Kumanyika, Shiriki K; Isgor, Zeynep; Rimkus, Leah; Zenk, Shannon N; Chaloupka, Frank J

    2016-05-01

    Food and beverage price promotions may be potential targets for public health initiatives but have not been well documented. We assessed prevalence and patterns of price promotions for food and beverage products in a nationwide sample of food stores by store type, product package size, and product healthfulness. We also assessed associations of price promotions with community characteristics and product prices. In-store data collected in 2010-2012 from 8959 food stores in 468 communities spanning 46 U.S. states were used. Differences in the prevalence of price promotions were tested across stores types, product varieties, and product package sizes. Multivariable regression analyses examined associations of presence of price promotions with community racial/ethnic and socioeconomic characteristics and with product prices. The prevalence of price promotions across all 44 products sampled was, on average, 13.4% in supermarkets (ranging from 9.1% for fresh fruits and vegetables to 18.2% for sugar-sweetened beverages), 4.5% in grocery stores (ranging from 2.5% for milk to 6.6% for breads and cereals), and 2.6% in limited service stores (ranging from 1.2% for fresh fruits and vegetables to 4.1% for breads and cereals). No differences were observed by community characteristics. Less-healthy versus more-healthy product varieties and larger versus smaller product package sizes generally had a higher prevalence of price promotion, particularly in supermarkets. On average, in supermarkets, price promotions were associated with 15.2% lower prices. The observed patterns of price promotions warrant more attention in public health food environment research and intervention. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Nonthermal processing technologies to improve the safety of raw meat and poultry products and ready-to-eat foods

    Science.gov (United States)

    Newly emerging nonthermal and advanced thermal processing technologies are now being adopted by the food processing industry for the purpose of providing safe and high quality food products to consumers. Scientists and engineers at USDA’s Eastern Regional Research Center in Wyndmoor, PA are activel...

  17. Antimicrobial resistance among Campylobacter jejuni isolated from raw poultry meat at retail level in Denmark

    DEFF Research Database (Denmark)

    Andersen, S. R.; Saadbye, P.; Shukri, Naseer Mahmoud

    2006-01-01

    Campylobacter jejuni isolated from raw poultry meat collected at retail shops in Denmark in the period 1996-2003 were tested for susceptibility to seven antimicrobial agents. The food samples consisted of raw chicken meat and other raw poultry meat of domestic or imported origin. The highest levels...... for chloramphenicol, nalidixic acid and ciprofloxacin (P food animals....... Monitoring of the occurrence of antimicrobial resistance in C. jejuni isolated from raw uncooked poultry has been performed on a yearly basis since 1996, thus providing useful insight into consumer exposure to antimicrobial-resistant C. jejuni....

  18. Radiation traces in exportation food samples of Parana State, Brazil

    International Nuclear Information System (INIS)

    Scheibel, Viviane

    2002-02-01

    This work deals with radioactive traces measurements in foodstuffs produced at the State of Parana, with large export rate and also of nutritious products of some regional trading companies. The measured foods were: sulfite treated sugar, tea, mint candy, soy in grain, soy crumb, gross soy oil, gum free oil and commercial refined soy oil. Six samples of each lot of the analyzed material were prepared, which represent a sampling with 90% of confidence. The samples were sealed in Marinelli beaker of 2.1 L completely filled and kept during 40 days until secular equilibrium was achieved. The counting time for each measure was of 48 hours. Measurements were carried out by gamma-ray spectrometry employing a HPGe detector with 10% of relative efficiency, coupled to standard nuclear electronics and a 8 l multichannel card. The acquisition of the data was accomplished with the software Maestro TM , version 3.2. The energy resolution of the 137 Cs 661.62 keV gamma line was 1.75 keV. The larger intensity gamma lines observed in the spectra were from the following radionuclides: 228 Ac, 208 Tl, 212 Pb of the 232 Th series, 214 Bi and 214 Pb from the 238 U series, 227 Ac from the 235 U series and 40 K. Activities and lower level of detection limits were calculated according to the International Agency of Atomic Energy norms.The detector efficiency was measured using a 152 Eu certified source and IAEA-375 and IAEA-326 certified reference materials. For most of the radionuclides it was possible only the measurement of the minimum activity detectable in the foodstuffs. Self-attenuation corrections were accomplished with support literature results. The most important activity observed was that of 40 K, whose value measured for soy in natura was 745.0 + - 9 .1 Bq/kg and for the crumb soy 1473 ± 15 Bq/kg.. he measured activities of the several analyzed foods were compatible with the values expected for non contaminated normal environmental samples, except for soy crumb, whose 40 K

  19. Implementation of the Bacillus cereus microbiological plate used for the screening of tetracyclines in raw milk samples with STAR protocol - the problem with false-negative results solved.

    Science.gov (United States)

    Raspor Lainšček, P; Biasizzo, M; Henigman, U; Dolenc, J; Kirbiš, A

    2014-01-01

    In antibiotic residue analyses the first step of screening is just as important as the following steps. Screening methods need to be quick and inexpensive, but above all sensitive enough to detect the antibiotic residue at or below the maximum residue limit (MRL). In the case of a positive result, the next step is conducted and further methods are used for confirmation. MRLs stated in European Union Regulation 37/2010 for tetracyclines in raw milk are: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 100 µg kg(-1) for chlortetracycline and no limit for doxycycline because it is prohibited for use in animals from which milk is produced for human consumption. The current five-plate microbiological screening method for the detection of antibiotic residues in raw milk was found to be simple and inexpensive, but not specific, sensitive and reliable enough to detect tetracycline at MRL in routine raw milk screening procedures. Spiking samples with tetracycline at the MRL level and applying them on Bacillus cereus ATCC 11778 microbiological plates often gave false-negative results, indicating that tetracyclines may have to be inactivated or masked. Tetracyclines seem to bind to a certain component in milk. Consequently, when applying samples to the B. cereus microbiological plate the antibiotic cannot inhibit the growth of B. cereus which disables the formation of inhibition zones on the test plate. After adding the appropriate amount of citric acid into the milk samples, we solved the problem of false-negative results. During the validation 79 samples of milk were spiked with tetracyclines at different concentrations: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 80 µg kg(-1) for chlortetracycline and 30 µg kg(-1) for doxycycline. Concentrations used in the validation matched the requirements for MRLs (they were either at or below the MRLs) stated in European Union Regulation 37/2010. The sensitivity of the validation was 100%.

  20. Isolation and molecular identification of Mycobacterium from commercially available pasteurized milk and raw milk samples collected from two infected cattle farms in Alborz Province, Iran.

    Science.gov (United States)

    Eftekhari, Mohsen; Mosavari, Nader

    2016-12-01

    Mycobacterium avium subsp. paratuberculosis (MAP) is an etiological agent of Johne's disease in ruminant including cattle, sheep and goats. This disease is considered an economically important disease in cattle. Animals with paratuberculosis shed viable MAP, particularly in their milk and feces. MAP may be involved in the development of Crohn's disease in humans through the consumption of contaminated milk and dairy products. Common methods of pasteurization are not enough to kill all MAP present in the milk and the bacterium has been isolated from raw milk, pasteurized milk and cheese samples. The purpose of this study was to evaluate two different methods for detecting MAP in milk and milk products. We analyzed the commonly used methods such as culture and molecular biology for identification of MAP. For this study, 50 milk samples from cows with suspected Johne's disease located in two dairy farms and 10 commercially available pasteurized milk and cheese samples from the market in Karaj city, Iran were selected. Following Ziehl-Neelsen staining of milk samples, direct microscopic detection of MAP was performed. All milk samples were centrifuged, and the concentrated samples were decontaminated using hexadecyl pyridinium chloride. The decontaminated milk suspensions were washed three times by centrifuging, and the collected filtrates were cultivated on Herrold's egg yolk medium enriched by Mycobactin J. Finally, identification and confirmation of isolates to MAP was performed using IS900-nested polymerase chain reaction (PCR). According to the obtained results by culture and PCR methods, none of the pasteurized milk and cheese samples showed the presence of MAP. However, 10% of the tested raw milk samples collected from suspected cattle showed the presence of MAP by both culture and PCR methods. Culture and PCR methods are reliable for identification of MAP from milk samples. Copyright © 2016.

  1. Alternative raw materials in the production of food of animal origin balance between quality, safety and economy

    OpenAIRE

    Zhikov, M.

    2017-01-01

    An overview of the main substances applied in food of animal origin in order to return a certain amount of basic animal products in them. To discuss the benefits and harm to the consumer than food use of machine-deboned meat, vegetable fat, milk and blood proteins, gelatin, soy protein, starch, vegetable fiber and others. Indicated economic and technological reasons for their incorporation. Discuss possibilities for change in public opinion and future restrictions on their use. Available limi...

  2. High-pressure processing of a raw milk cheese improved its food safety maintaining the sensory quality.

    Science.gov (United States)

    Delgado, Francisco José; Delgado, Jonathan; González-Crespo, José; Cava, Ramón; Ramírez, Rosario

    2013-12-01

    The effect of high-pressure treatment (400 or 600 MPa for 7 min) on microbiology, proteolysis, texture and sensory parameters was investigated in a mature raw goat milk cheese. At day 60 of analysis, Mesophilic aerobic, Enterobacteriaceae, lactic acid bacteria and Listeria spp. were inactivated after high-pressure treatment at 400 or 600 MPa. At day 90, mesophilic aerobic, lactic acid bacteria and Micrococacceae counts were significantly lower in high-pressure-treated cheeses than in control ones. In general, nitrogen fractions were significantly modified after high-pressure treatment on day 60 at 600 MPa compared with control cheeses, but this effect was not found in cheeses after 30 days of storage (day 90). On the other hand, high-pressure treatment caused a significant increase of some texture parameters. However, sensory analysis showed that neither trained panellists nor consumers found significant differences between control and high-pressure-treated cheeses.

  3. Prevalence of Methicillin-Resistant Staphylococcus aureus and Other Staphylococcus Species in Raw Meat Samples Intended for Human Consumption in Benin City, Nigeria: Implications for Public Health.

    Science.gov (United States)

    Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O

    2016-09-24

    The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.

  4. The inhibitory effect of sodium thiocyanate and sodium percarbonate ratios on microorganism growth in raw milk samples as an effective treatment to extend milk quality during storage

    Directory of Open Access Journals (Sweden)

    Supreena Srisaikham

    2017-02-01

    Full Text Available Preservation of raw milk quality by activation of lactoperoxidase system (LPs was studied for the inhibition of microorganism growth. The antimicrobial effects of LPs were examined by measuring thiocyanate (SCN- concentration, lactoperoxidase (LP activity, milk composition, total bacterial count (TBC and coliform count (CC. All parameters were analyzed at 0 h and at 25°C and 30°C as a control. Thus, the experiment was conducted to evaluate the effect of 2 different temperatures (25°C vs 30°C and 4 ratios of NaSCN:2Na2CO3 3H2O2 (0:0, 7:15, 14:30 and 21:45 mg/L on milk samples (both uninoculated raw milk samples and Escherichia coli (E. coli inoculated milk samples with 8 replicates per run using 0-12 h incubation time in vitro assay. The runs were conducted on the same 4 NaSCN:2Na2CO3 3H2O2 ratios and different temperature and time of incubation were used. The results showed that the milk SCN- concentration and LP activity increased with increasing NaSCN:2Na2CO3 3H2O2 ratios. Milk compositions retained the quality of normal milk fat, protein, lactose, solid-not-fat (SNF and total solid (TS contents, and they were not significantly affected by the LPs activation. An obvious effect of the LP activated milk was the inhibition of TBC in uninoculated raw milk samples for 6 to 12 h both at 25°C and 30°C, and for 6 to 9 h in E. coil inoculated milk samples, whereas CC (6 h at 25°C and at least 3 h at 30°C for both uninoculated and E. coil inoculated milk samples. It is concluded that improved preservation of milk can be achieved through the addition of 14:30 and 21:45 mg/L of NaSCN:2Na2CO3 3H2O2 in uninoculated and E. coil inoculated milk samples respectively, to extend milk quality during storage.

  5. Polyfluoroalkyl phosphate esters and perfluoroalkyl carboxylic acids in target food samples and packaging--method development and screening.

    Science.gov (United States)

    Gebbink, Wouter A; Ullah, Shahid; Sandblom, Oskar; Berger, Urs

    2013-11-01

    Polyfluoroalkyl phosphate mono-, di-, and tri-esters (mono-, di-, and triPAPs) are used to water- and grease-proof food packaging materials, and these chemicals are known precursors to perfluoroalkyl carboxylic acids (PFCAs). Existing analytical methods for PAPs lack sample clean-up steps in the sample preparation. In the present study, a method based on ultra performance liquid chromatography coupled to tandem mass spectrometry (UPLC/MS/MS) was developed and optimized for the analysis of mono-, di-, and triPAPs, including a clean-up step for the raw extracts. The method was applied to food samples and their PAP-containing packaging materials. The optimized UPLC/MS/MS method enabled the separation and identification of a total of 4 monoPAPs, 16 diPAPs, and 7 triPAPs in the technical mixture Zonyl®-RP. For sample clean-up, weak anion exchange solid phase extraction columns were tested. PAPs standard solutions spiked onto the columns were separated into a fraction containing neutral compounds (triPAPs) and a fraction with ionic compounds (mono- and diPAPs) with recoveries between 72-110%. Method limits of quantification for food samples were in the sub to low picogram per gram range. For quantitative analysis of PAPs, compound-specific labeled internal standards showed to be essential as sorption and matrix effects were observed. Mono-, di-, and/or triPAPs were detected in all food packaging materials obtained from the Swedish market. Up to nine diPAPs were detected in the food samples, with the 6:2/6:2 and 6:2/8:2 diPAPs as the dominant compounds. DiPAP concentrations in the food samples ranged from 0.9 to 36 pg/g, which was comparable to individual PFCA concentrations in the same samples. Consumption of food packed in PAP-containing materials could be an indirect source of human exposure to PFCAs.

  6. [Control of toxicity of Sarcocystis fayeri in horsemeat by freezing treatment and prevention of food poisoning caused by raw consumption of horsemeat].

    Science.gov (United States)

    Harada, Seiya; Furukawa, Masato; Tokuoka, Eisuke; Matsumoto, Kazutoshi; Yahiro, Shunsuke; Miyasaka, Jiro; Saito, Morihiro; Kamata, Yoichi; Watanabe, Maiko; Irikura, Daisuke; Matsumoto, Hiroshi; Sugita-Konishi, Yoshiko

    2013-01-01

    More than 27 outbreaks per year of food poisoning caused by consuming horse meat were reported in Kumamoto Prefecture (including Kumamoto City) from January 2009 to September 2011. It was found that the causative agent of the outbreaks was a protein with a molecular weight of 15 kDa that had originated from bradyzoites of Sarcocystis fayeri parasitizing the horse meat. Rabit ileal loop tests showed that pepsin treatment of homogenates of frozen horse meat containing the cysts of S. fayeri induced loss of toxicity, presumably by digestion of the proteinous causative agent(s). Slices of horse meat containing the cysts were frozen at below -20°C for various periods. The cysts were collected after thawing the slices, then treated in an artificial stomach juice containing pepsin. The bradyzoites of the cysts kept at -20°C for 48 hr or more completely disappeared. Simultaneously, the 15 kDa protein also disappeared in the frozen cysts. After notifying the public and recommending freezing treatment of horse meat, no subsequent cases of food poisoning were reported. This indicates that freezing of horse meat is effective to prevent the occurrence of food poisoning caused by consuming raw horse meat containing S. fayeri.

  7. Rapid screening of natually occurring radioactive nuclides({sup 2}'3{sup 8}U, {sup 232}Th) in raw materials and by-products samples using XRF

    Energy Technology Data Exchange (ETDEWEB)

    Park, Ji Young; Lim, Chung Sup [Radiation Biotechnology and Applied Radioiostope Science, University of Science and Technology, Daejeon (Korea, Republic of); Lim, Jong Myoung; Ji, Young Yong; Chung, Kun Ho; Lee, Wan No; Kang, Mun Ja [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Jang, Byung Uck [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2016-12-15

    As new legislation has come into force implementing radiation safety management for the use of naturally occurring radioactive materials (NORM), it is necessary to establish a rapid and accurate measurement technique. Measurement of {sup 238}U and {sup 232}Th using conventional methods encounter the most significant difficulties for pretreatment (e.g., purification, speciation, and dilution/enrichment) or require time-consuming processes. Therefore, in this study, the applicability of ED-XRF as a non-destructive and rapid screening method was validated for raw materials and by-product samples. A series of experiments was conducted to test the applicability for rapid screening of XRF measurement to determine activity of {sup 238}U and {sup 23{sup 2}}Th based on certified reference materials (e.g., soil, rock, phosphorus rock, bauxite, zircon, and coal ash) and NORM samples commercially used in Korea. Statistical methods were used to compare the analytical results of ED-XRF to those of certified values of certified reference materials (CRM) and inductively coupled plasma mass spectrometry (ICP-MS). Results of the XRF measurement for {sup 238}U and {sup 232}Th showed under 20% relative error and standard deviation. The results of the U-test were statistically significant except for the case of U in coal fly ash samples. In addition, analytical results of {sup 238}U and {sup 232}Th in the raw material and by-product samples using XRF and the analytical results of those using ICP-MS (R{sup 2}≥0.95) were consistent with each other. Thus, the analytical results rapidly derived using ED-XRF were fairly reliable. Based on the validation results, it can be concluded that the ED-XRF analysis may be applied to rapid screening of radioactivities ({sup 238}U and {sup 232}Th) in NORM samples.

  8. [Analysis on contamination of aflatoxins in food samples in Shaanxi Province from 2012-2015].

    Science.gov (United States)

    Hu, Jiawei; Tian, Li; Wang, Caixia; Qiao, Haiou; Wang, Minjuan

    2016-09-01

    To investigate the contamination of aflatoxins in food in Shaanxi Province, and provide the basic data of dietary intakes of aflatoxins for food safety assessment. In year 2012- 2015, 1007 food samples of eight kinds of food including grains, beans, vegetable oil, nuts and seeds, condiment, liquor, tea and infants' food were collected randomly from ten cities, and determined with UPLC. 1007 samples were detected aflatoxins and the total detection rate was 10. 7%. The detection range was 0. 070- 323 μg / kg, with the mean value of 2. 34 μg / kg. Among all food samples, only peanut products were more seriously polluted than other kinds of foods. The overall level of aflatoxins contamination in market food is low, but peanut products might be the contaminated foods with aflatoxins in Shaanxi Province, and should be given more attention.

  9. Criteria definition and approaches in green supplier selection – a case study for raw material and packaging of food industry

    OpenAIRE

    Narges Banaeian; Hossein Mobli; Izabela Ewa Nielsen; Mahmoud Omid

    2015-01-01

    This paper formulates an integrated framework for deciding about the green supplier selection criteria in food supply chain and also proposes different methods that account for single and multiple sourcing of supplier selection. Green supplier selection relies on green criteria, so determination of suitable set of criteria will affect decision-maker results directly. In this research, an operational model including combination of general and environmental criteria is introduced for green supp...

  10. Raw data

    DEFF Research Database (Denmark)

    Walford, Antonia

    2017-01-01

    . Although science and technology studies (STS) makes a strong case for associating relationality with certainty, the article argues that a particular form of data, ‘raw data’, complicates this association. It further argues that scientific data is not simply composed out of relations, but is a relation......This article takes scientific ‘raw data’ as its ethnographic object in order to investigate the co-implication of nature and culture in scientific knowledge practices. The article traces out some of the activities that are involved in producing numerical climate data from the Brazilian Amazon...... itself. The article ends with a brief reflection on the possible repercussions of shifting from thinking of science as producing multiple natures and cultures to thinking of it as producing the potential for relations....

  11. Ultra-processed food purchases in Norway: a quantitative study on a representative sample of food retailers.

    Science.gov (United States)

    Solberg, Siri Løvsjø; Terragni, Laura; Granheim, Sabrina Ionata

    2016-08-01

    To identify the use of ultra-processed foods - vectors of salt, sugar and fats - in the Norwegian diet through an assessment of food sales. Sales data from a representative sample of food retailers in Norway, collected in September 2005 (n 150) and September 2013 (n 170), were analysed. Data consisted of barcode scans of individual food item purchases, reporting type of food, price, geographical region and retail concept. Foods were categorized as minimally processed, culinary ingredients, processed products and ultra-processed. Indicators were share of purchases and share of expenditure on food categories. Six geographical regions in Norway. The barcode data included 296 121 observations in 2005 and 501 938 observations in 2013. Ultra-processed products represented 58·8 % of purchases and 48·8 % of expenditure in 2013. Minimally processed foods accounted for 17·2 % of purchases and 33·0 % of expenditure. Every third purchase was a sweet ultra-processed product. Food sales changed marginally in favour of minimally processed foods and in disfavour of processed products between 2005 and 2013 (χ 2 (3)=203 195, Pprocessed products accounted for the majority of food sales in Norway, indicating a high consumption of such products. This could be contributing to rising rates of overweight, obesity and non-communicable diseases in the country, as findings from other countries indicate. Policy measures should aim at decreasing consumption of ultra-processed products and facilitating access (including economic) to minimally processed foods.

  12. Production of high docosahexaenoic acid by Schizochytrium sp. using low-cost raw materials from food industry.

    Science.gov (United States)

    Song, Xiaojin; Zang, Xiaonan; Zhang, Xuecheng

    2015-01-01

    The low-cost substrates from food industry, including maize starch hydrolysate and soybean meal hydrolysate, were used to produce docosahexaenoic acid (DHA) by Schizochytrium limacinum OUC88. Glucose derived from maize starch hydrolysate was used as the carbon source and soybean meal hydrolysate as the nitrogen sources. In 10L bioreactor fermentation, by using the soybean meal hydrolysate as the main nitrogen source, the biomass of Schizochytrium limacinum OUC88 reached 85.27 g L(-1), and the yields of DHA was 20.7g L(-1). As a comparison, when yeast extract was used as the main nitrogen source, the yields of biomass and DHA were 68.93 g L(-1) and 13.3 g L(-1), respectively. From the results of this study, these hydrolysates can provide all the nutrients required for high-density cultivation of S. limacinum OUC88 and DHA production, that will improve the economical and competitive efficiency of commercial DHA production.

  13. Database-driven primary analysis of raw sequencing data

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to methods for identifying the source of a biological sequence containing sample from raw sequencing reads. The method may be used to identify the source of unknown DNA and can be used for diagnostic, biodefense, food safety and quality, and hygiene applications...

  14. Determination of the uranium concentration in samples of raw, retorted and spent shale from Irati, Parana-Brazil, by the fission track registration technique

    International Nuclear Information System (INIS)

    Cabral, R.G.

    1981-02-01

    The feasibility of the determination of uranium in oil shale, by the fission track registration technique is studied. The wet and dry methods were employed, using a Bayer policarbonate, Makrofol KG, as detector. It was created a new variant of the dry method. The fission track registration technique was used in samples of raw, retorted and spent shale from Irati, Parana in Brazil, 16 μg U/g, 20 μg U/g and 20μg U/g were found, respectively, with a total error ranging from 19% to 20%. Some experimental results were included for illustration and comparison. The feasibility of the determination of uranium in oil shale from Irati was verified. (Author) [pt

  15. Existing drug resistance among Staphylococcus spp. from raw milk samples in Khon Kaen province, Northeastern Thailand by direct quadriplex PCR

    Directory of Open Access Journals (Sweden)

    Buppachat Trakarnchan

    2017-10-01

    Full Text Available To describe the proportion of methicillin resistant Staphylococcus aureus, and mupirocin resistant among the isolates from milk, three hundred and eighty-one samples were collected in Khon Kaen province, Thailand, during January to March, 2014. Quadriplex PCR was a method of choice. The occurrence of S. aureus and other Staphylococcus spp. were 21.26 and 34.12%, respectively. Among the 81 S. aureus isolates, 82.72 (67/81, 11.11 (9/81, and 6.17% (5/81 were S. aureus, S. aureus carrying mecA, and S. aureus harboring mupA genes, respectively. These two mutant genes may possibly be transferred to other bacteria in milk. Therefore, good hygienic practices and strict control may limit the spread.

  16. Factors affecting consumers' preferences for and purchasing decisions regarding pasteurized and raw milk specialty cheeses.

    Science.gov (United States)

    Colonna, A; Durham, C; Meunier-Goddik, L

    2011-10-01

    Eight hundred ninety consumers at a local food festival were surveyed about their specialty cheese purchasing behavior and asked to taste and rate, through nonforced choice preference, 1 of 4 cheese pairs (Cheddar and Gouda) made from pasteurized and raw milks. The purpose of the survey was to examine consumers' responses to information on the safety of raw milk cheeses. The associated consumer test provided information about specialty cheese consumers' preferences and purchasing behavior. Half of the consumers tested were provided with cheese pairs that were identified as being made from unpasteurized and pasteurized milk. The other half evaluated samples that were identified only with random 3-digit codes. Overall, more consumers preferred the raw milk cheeses than the pasteurized milk cheeses. A larger portion of consumers indicated preferences for the raw milk cheese when the cheeses were labeled and thus they knew which samples were made from raw milk. Most of the consumers tested considered the raw milk cheeses to be less safe or did not know if raw milk cheeses were less safe. After being informed that the raw milk cheeses were produced by a process approved by the FDA (i.e., 60-d ripening), most consumers with concerns stated that they believed raw milk cheeses to be safe. When marketing cheese made from raw milk, producers should inform consumers that raw milk cheese is produced by an FDA-approved process. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. Production of a high-nutritional-value functional food, the Update1 bread, with the supplementation of the wheat flour with high-protein-content raw food materials

    Directory of Open Access Journals (Sweden)

    Csapó J.

    2017-10-01

    Full Text Available During our research, we added extracted soya bean meal, egg-white powder, gluten, wheat sourdough, and bamboo fibre to wheat flour in order to increase the quantity of the essential amino acid and the biological value of the wheat protein, producing such a functional, health-protecting, health-preservative food product which is suitable to satisfy the essential amino acid requirements of humans, assuming normal nutrition. Furthermore, we could produce such a food, which, on the one hand, was suitable to confine or prevent the essential amino acid’s malnutrition symptoms, while, on the other hand, when applied alone, to meet the consumers’ needs. During our work, we determined the protein content and amino acid composition of the wheat flour, of the additives used in bread baking, and in the bread both baked with supplementation (Update1 bread and without supplementation (normal bread, as well as the quantity of the Maillard reaction products (hydroxymethylfurfural. We calculated the biological value of the protein of different breads and evaluated the sensory characteristics of the produced functional food and the fortified bread, supplemented with high essential-amino-acid-containing additives.

  18. Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Zarzycki, Pawel K., E-mail: pawel_k_z@hotmail.com [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland); Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J. [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland)

    2011-03-04

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  19. Reprint of: Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Zarzycki, Pawel K., E-mail: pawel_k_z@hotmail.com [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland); Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J. [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland)

    2012-02-24

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  20. Reprint of: Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    International Nuclear Information System (INIS)

    Zarzycki, Paweł K.; Ślączka, Magdalena M.; Zarzycka, Magdalena B.; Włodarczyk, Elżbieta; Baran, Michał J.

    2012-01-01

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds’ feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5–8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  1. Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    International Nuclear Information System (INIS)

    Zarzycki, Pawel K.; Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J.

    2011-01-01

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  2. DNA barcoding for species identification from dried and powdered plant parts: a case study with authentication of the raw drug market samples of Sida cordifolia.

    Science.gov (United States)

    Vassou, Sophie Lorraine; Kusuma, G; Parani, Madasamy

    2015-03-15

    The majority of the plant materials used in herbal medicine is procured from the markets in the form of dried or powdered plant parts. It is essential to use authentic plant materials to derive the benefits of herbal medicine. However, establishing the identity of these plant materials by conventional taxonomy is extremely difficult. Here we report a case study in which the species identification of the market samples of Sida cordifolia was done by DNA barcoding. As a prelude to species identification by DNA barcoding, 13 species of Sida were collected, and a reference DNA barcode library was developed using rbcL, matK, psbA-trnH and ITS2 markers. Based on the intra-species and inter-species divergence observed, psbA-trnH and ITS2 were found to be the best two-marker combination for species identification of the market samples. The study showed that none of the market samples belonged to the authentic species, S. cordifolia. Seventy-six per cent of the market samples belonged to other species of Sida. The predominant one was Sida acuta (36%) followed by S. spinosa (20%), S. alnifolia (12%), S. scabrida (4%) and S. ravii (4%). Such substitutions may not only fail to give the expected therapeutic effect, but may also give undesirable effects as in case of S. acuta which contains a 6-fold higher amount of ephedrine compared to the roots of S. cordifolia. The remaining 24% of the samples were from other genera such as Abutilon sp. (8%), Ixonanthes sp., Terminalia sp., Fagonia sp., and Tephrosia sp. (4% each). This observation is in contrast to the belief that medicinal plants are generally substituted or adulterated with closely related species. The current study strongly suggests that the raw drug market samples of herbal medicines need to be properly authenticated before use, and DNA barcoding has been found to be suitable for this purpose. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. U.S. Food Safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: analysis of set results.

    Science.gov (United States)

    Naugle, Alecia Larew; Barlow, Kristina E; Eblen, Denise R; Teter, Vanessa; Umholtz, Robert

    2006-11-01

    The U.S. Food Safety and Inspection Service (FSIS) tests sets of samples of selected raw meat and poultry products for Salmonella to ensure that federally inspected establishments meet performance standards defined in the pathogen reduction-hazard analysis and critical control point system (PR-HACCP) final rule. In the present report, sample set results are described and associations between set failure and set and establishment characteristics are identified for 4,607 sample sets collected from 1998 through 2003. Sample sets were obtained from seven product classes: broiler chicken carcasses (n = 1,010), cow and bull carcasses (n = 240), market hog carcasses (n = 560), steer and heifer carcasses (n = 123), ground beef (n = 2,527), ground chicken (n = 31), and ground turkey (n = 116). Of these 4,607 sample sets, 92% (4,255) were collected as part of random testing efforts (A sets), and 93% (4,166) passed. However, the percentage of positive samples relative to the maximum number of positive results allowable in a set increased over time for broilers but decreased or stayed the same for the other product classes. Three factors associated with set failure were identified: establishment size, product class, and year. Set failures were more likely early in the testing program (relative to 2003). Small and very small establishments were more likely to fail than large ones. Set failure was less likely in ground beef than in other product classes. Despite an overall decline in set failures through 2003, these results highlight the need for continued vigilance to reduce Salmonella contamination in broiler chicken and continued implementation of programs designed to assist small and very small establishments with PR-HACCP compliance issues.

  4. Prevalence of antibiotic resistant Staphylococcus aureus from raw milk samples collected from the local vendors in the region of Tirupathi, India

    Directory of Open Access Journals (Sweden)

    Sudhanthirakodi Sudhanthiramani

    2015-04-01

    Full Text Available Aim: The study was carried out with the aim to identify the suitability of the milk for consumer use with special reference to Staphylococcus aureus from milk samples collected from various local vendors and determine the antibiotic susceptibility pattern of those positive isolates. Materials and Methods: A total of 110 milk samples were collected from the local milk vendors in and around Tirupathi region of India. All the samples were enriched with buffered peptone water in 9:1 ratio and the then inoculated on baird parker agar medium with added 2% egg yolk tellurite emulsion as selective medium for S.aureus and confirmed with mannitol salt agar, Gram’s staining and biochemical tests. The typical cultural characters with coagulase-positive samples were taken as positive samples the positive samples were tested for antibiotic susceptibility with 10 different antibiotics by employing disc diffusion method. Results: Prevalence of coagulase-positive S. aureus was 39.09% (43/110 from the milk samples. The antibiotic susceptibility test of positive isolates showed high resistant toward penicillin G 37/43 (86.04% and ampicillin 32/43 (74.42%, and also showed resistant to methicillin 6/43 (13.95%, cephalothin 6/43 (13.95%, tetracycline 6/43 (13.95%, ciprofloxacin 4/43 (9.30%, enrofloxacin 3/43 (6.97%, cefoxitin 2/43 (4.65%, gentamicin 2/43 (4.65%, and co-trimoxazole 2/43 (4.65%. Many individual isolates showed resistant against two or more antibiotics in our study. Conclusion: The above study results show that the milk samples collected from local vendor having S. aureus, which can induce disease condition as well as antibiotic resistant to the humans particularly young children and old age peoples by means of consumption of raw milk and its products. This is the public health issue, which needs to be solved by educating the local vendors regarding health problems related to unhygienic milk supply and make the awareness among the consumers about this

  5. Tritium concentrations in environmental water and food samples collected around the vicinity of the PNPP-1

    International Nuclear Information System (INIS)

    Garcia, T.Y.; Enriquez, S.O.; Duran, E.B.

    1986-01-01

    The natural radioactivity levels of tritium in environmental samples collected around the vicinity and more distant environment of the first Philippine Nuclear Power Plant (PNPP-1) in Bataan were assessed. The samples analyzed consisted of water samples such as seawater, freshwater, drinking water, groundwater and rainwater; and food samples such as cereals, vegetables, fruits; meat, milk fish and crustaceans. Tritium concentrations in water samples were determined by distillation and liquid scintillation counting techniques. The food samples were analyzed for tissue-free water tritium by the freezing-drying method followed by liquid scintillation counting techniques. (Auth.) 13 refs

  6. Association between time perspective and organic food consumption in a large sample of adults.

    Science.gov (United States)

    Bénard, Marc; Baudry, Julia; Méjean, Caroline; Lairon, Denis; Giudici, Kelly Virecoulon; Etilé, Fabrice; Reach, Gérard; Hercberg, Serge; Kesse-Guyot, Emmanuelle; Péneau, Sandrine

    2018-01-05

    Organic food intake has risen in many countries during the past decades. Even though motivations associated with such choice have been studied, psychological traits preceding these motivations have rarely been explored. Consideration of future consequences (CFC) represents the extent to which individuals consider future versus immediate consequences of their current behaviors. Consequently, a future oriented personality may be an important characteristic of organic food consumers. The objective was to analyze the association between CFC and organic food consumption in a large sample of the adult general population. In 2014, a sample of 27,634 participants from the NutriNet-Santé cohort study completed the CFC questionnaire and an Organic-Food Frequency questionnaire. For each food group (17 groups), non-organic food consumers were compared to organic food consumers across quartiles of the CFC using multiple logistic regressions. Moreover, adjusted means of proportions of organic food intakes out of total food intakes were compared between quartiles of the CFC. Analyses were adjusted for socio-demographic, lifestyle and dietary characteristics. Participants with higher CFC were more likely to consume organic food (OR quartile 4 (Q4) vs. Q1 = 1.88, 95% CI: 1.62, 2.20). Overall, future oriented participants were more likely to consume 14 food groups. The strongest associations were observed for starchy refined foods (OR = 1.78, 95% CI: 1.63, 1.94), and fruits and vegetables (OR = 1.74, 95% CI: 1.58, 1.92). The contribution of organic food intake out of total food intake was 33% higher in the Q4 compared to Q1. More precisely, the contribution of organic food consumed was higher in the Q4 for 16 food groups. The highest relative differences between Q4 and Q1 were observed for starchy refined foods (22%) and non-alcoholic beverages (21%). Seafood was the only food group without a significant difference. This study provides information on the personality of

  7. Occurrence and characterization of Shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh.

    Science.gov (United States)

    Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A

    2010-11-01

    The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.

  8. Contamination of faecal coliforms in ice cubes sampled from food outlets in Kubang Kerian, Kelantan.

    Science.gov (United States)

    Noor Izani, N J; Zulaikha, A R; Mohamad Noor, M R; Amri, M A; Mahat, N A

    2012-03-01

    The use of ice cubes in beverages is common among patrons of food outlets in Malaysia although its safety for human consumption remains unclear. Hence, this study was designed to determine the presence of faecal coliforms and several useful water physicochemical parameters viz. free residual chlorine concentration, turbidity and pH in ice cubes from 30 randomly selected food outlets in Kubang Kerian, Kelantan. Faecal coliforms were found in ice cubes in 16 (53%) food outlets ranging between 1 CFU/100mL to >50 CFU/ 100mL, while in the remaining 14 (47%) food outlets, in samples of tap water as well as in commercially bottled drinking water, faecal coliforms were not detected. The highest faecal coliform counts of >50 CFU/100mL were observed in 3 (10%) food outlets followed by 11-50 CFU/100mL and 1-10 CFU/100mL in 7 (23%) and 6 (20%) food outlets, respectively. All samples recorded low free residual chlorine concentration (contamination by faecal coliforms was not detected in 47% of the samples, tap water and commercially bottled drinking water, it was concluded that (1) contamination by faecal coliforms may occur due to improper handling of ice cubes at the food outlets or (2) they may not be the water sources used for making ice cubes. Since low free residual chlorine concentrations were observed (food outlets, including that of ice cube is crucial in ensuring better food and water for human consumption.

  9. Development of a sodium dodecyl sulfate-polyacrylamide gel electrophoresis reference method for the analysis and identification of fish species in raw and heat-processed samples : A collaborative study

    DEFF Research Database (Denmark)

    Pineiro, C.; Barros-Velazquez, J.; Perez-Martin, R.I.

    1999-01-01

    A collaborative study was carried out in seven European labs with the aim of achieving a sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) standard operation procedure to identify fish species in raw and cooked samples. Urea and SDS-containing solutions were evaluated...... silver stained, yielded good results and afforded higher reproducibility, thus allowing a better matching of results among the laboratories participating in this collaborative study. Under the optimized technical conditions described above, all the fish species tested, either raw and cooked, yielded...... seemed not to be influenced so much by the state of the sample (raw, cooked at 60 degrees C, cooked at 85 degrees C). Desalting, ultrafiltration or treatment with RNase/DNase did not improve the discriminatory power of the protein patterns. Commercial homogeneous 15% ExcelGels, especially when they were...

  10. Food safety assurance systems: Microbiological testing, sampling plans, and microbiological criteria

    NARCIS (Netherlands)

    Zwietering, M.H.; Ross, T.; Gorris, L.G.M.

    2014-01-01

    Microbiological criteria give information about the quality or safety of foods. A key component of a microbiological criterion is the sampling plan. Considering: (1) the generally low level of pathogens that are deemed tolerable in foods, (2) large batch sizes, and (3) potentially substantial

  11. Comparative Evaluation of Veriflow® Salmonella Species to USDA and FDA Culture-Based Methods for the Detection of Salmonella spp. in Food and Environmental Samples.

    Science.gov (United States)

    Puri, Amrita; Joelsson, Adam C; Terkhorn, Shawn P; Brown, Ashley S; Gaudioso, Zara E; Siciliano, Nicholas A

    2017-09-01

    Veriflow® Salmonella species (Veriflow SS) is a molecular-based assay for the presumptive detection of Salmonella spp. from environmental surfaces (stainless steel, sealed concrete, plastic, and ceramic tile), dairy (2% milk), raw meat (20% fat ground beef), chicken carcasses, and ready-to-eat (RTE) food (hot dogs). The assay utilizes a PCR detection method coupled with a rapid, visual, flow-based assay that develops in 3 min post-PCR amplification and requires only an 18 h enrichment for maximum sensitivity. The Veriflow SS system eliminates the need for sample purification, gel electrophoresis, or fluorophore-based detection of target amplification and does not require complex data analysis. This Performance Tested MethodSM validation study demonstrated the ability of the Veriflow SS method to detect low levels of artificially inoculated or naturally occurring Salmonella spp. in eight distinct environmental and food matrixes. In each reference comparison study, probability of detection analysis indicated that there was no significant difference between the Veriflow SS method and the U.S. Department of Agriculture Food Safety and Inspection Service Microbiology Laboratory Guidebook Chapter 4.06 and the U.S. Food and Drug Administration Bacteriological Analytical Manual Chapter 5 reference methods. A total of 104 Salmonella strains were detected in the inclusivity study, and 35 nonspecific organisms went undetected in the exclusivity study. The study results show that the Veriflow SS method is a sensitive, selective, and robust assay for the presumptive detection of Salmonella spp. sampled from environmental surfaces (stainless steel, sealed concrete, plastic, and ceramic tile), dairy (2% milk), raw meat (20% fat ground beef), chicken carcasses, and RTE food (hot dogs).

  12. Acrylamide exposure among Turkish toddlers from selected cereal-based baby food samples.

    Science.gov (United States)

    Cengiz, Mehmet Fatih; Gündüz, Cennet Pelin Boyacı

    2013-10-01

    In this study, acrylamide exposure from selected cereal-based baby food samples was investigated among toddlers aged 1-3 years in Turkey. The study contained three steps. The first step was collecting food consumption data and toddlers' physical properties, such as gender, age and body weight, using a questionnaire given to parents by a trained interviewer between January and March 2012. The second step was determining the acrylamide levels in food samples that were reported on by the parents in the questionnaire, using a gas chromatography-mass spectrometry (GC-MS) method. The last step was combining the determined acrylamide levels in selected food samples with individual food consumption and body weight data using a deterministic approach to estimate the acrylamide exposure levels. The mean acrylamide levels of baby biscuits, breads, baby bread-rusks, crackers, biscuits, breakfast cereals and powdered cereal-based baby foods were 153, 225, 121, 604, 495, 290 and 36 μg/kg, respectively. The minimum, mean and maximum acrylamide exposures were estimated to be 0.06, 1.43 and 6.41 μg/kg BW per day, respectively. The foods that contributed to acrylamide exposure were aligned from high to low as bread, crackers, biscuits, baby biscuits, powdered cereal-based baby foods, baby bread-rusks and breakfast cereals. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Molecularly imprinted polymers for sample preparation and biosensing in food analysis: Progress and perspectives

    DEFF Research Database (Denmark)

    Ashley, Jon; Shahbazi, Mohammad-Ali; Kant, Krishna

    2017-01-01

    Molecularly imprinted polymers (MIPs) are biomimetics which can selectively bind to analytes of interest. One of the most interesting areas where MIPs have shown the biggest potential is food analysis. MIPs have found use as sorbents in sample preparation attributed to the high selectivity and high...... the imprinting methods which are applicable for imprinting food templates, summarize the recent progress in using MIPs for preparing and analysing food samples, and discuss the current limitations in the commercialisation of MIPs technology. Finally, future perspectives will be given....

  14. Occurrence and characteristics of extended-spectrum β-lactamases producing Escherichia coli in foods of animal origin and human clinical samples in Chhattisgarh, India

    Directory of Open Access Journals (Sweden)

    Bhoomika

    2016-09-01

    Full Text Available Aim: To assess the prevalence of antimicrobial resistance producing extended-spectrum β-lactamases (ESBL (blaTEM, blaSHV, and blaCTX-M genes in Escherichia coli isolated from chicken meat, chevon meat, raw milk, and human urine and stool samples collected from tribal districts of Chhattisgarh, viz., Jagdalpur, Dantewada, Kondagaon, and Kanker. Materials and Methods: A total of 330 samples, comprising 98 chicken meat, 82 chevon meat, 90 raw milk, and 60 human urine and stool samples, were processed for isolation of E. coli. Isolates were confirmed biochemically and further tested against commonly used antibiotics to know their resistant pattern. The resistant isolates were tested for ESBL production by phenotypic method followed by characterization with molecular method using multiplex-polymerase chain reaction technique. Results: Overall 57.87% (191/330 samples were found positive for E. coli, which include 66.32% (65/98 chicken meat, 46.34% (38/82 chevon meat, 81.11% (73/90 raw milk, and 25% (15/60 human urine and stool samples. Isolates showed the highest resistance against cefotaxime (41.36% followed by oxytetracycline (34.03%, ampicillin (29.31%, cephalexin (24.60%, cefixime (16.75%, and ceftazidime (13.08%. Phenotypic method detected 10.99% (21/191 isolates as presumptive ESBL producers, however, molecular method detected 3.66% (7/191, 2.09% (4/191, and 0.00% (0/191 prevalence of blaTEM, blaCTX-M, and blaSHV, respectively. Conclusion: The present study indicates a high prevalence of E. coli in raw chicken meat, chevon meat, and milk due to poor hygienic practices. The antibiotic susceptibility test detected the presence of the resistance pattern against ESBL in E. coli isolated from raw chicken meat, chevon meat, milk, and also in human clinical samples is of great concern. The appearance of E. coli in the human food chain is alarming and requires adaptation of hygienic practices and stipulate use of antibiotics.

  15. Simultaneous identification of synthetic and natural dyes in different food samples by UPLC-MS

    Science.gov (United States)

    Mandal, Badal Kumar; Mathiyalagan, Siva; Dalavai, Ramesh; Ling, Yong-Chien

    2017-11-01

    Fast foods and variety food items are populating among the food lovers. To improve the appearance of the food product in surviving gigantic competitive environment synthetic or natural food dyes are added to food items and beverages. Although regulatory bodies permit addition of natural colorants due to its safe and nontoxic nature in food, synthetic dyes are stringently controlled in all food products due to their toxicity by regulatory bodies. Artificial colors are need certification from the regulatory bodies for human consumption. To analyze food dyes in different food samples many analytical techniques are available like high pressure liquid chromatography (HPLC), thin layer chromatography (TLC), spectroscopic and gas chromatographic methods. However all these reported methods analyzed only synthetic dyes or natural dyes. Not a single method has analyzed both synthetic and natural dyes in a single run. In this study a robust ultra-performance liquid chromatographic method for simultaneous identification of 6 synthetic dyes (Tartrazine, Indigo carmine, Briliant blue, Fast green, malachite green, sunset yellow) and one natural dye (Na-Cu-Chlorophyllin) was developed using acquitic UPLC system equipped with Mass detector and acquity UPLC HSS T3 column (1.8 μm, 2.1 × 50 mm, 100Å). All the dyes were separated and their masses were determined through fragments’ masses analyses.

  16. Obesity and household food insecurity: evidence from a sample of rural households in Malaysia.

    Science.gov (United States)

    Shariff, Z Mohd; Khor, G L

    2005-09-01

    The study examined nutritional outcomes related to body fat accumulation of food insecurity among women from selected rural communities in Malaysia. Cross-sectional study. Rural communities (seven villages and two palm plantations) in a district with high percentage of welfare recipients. Malay (n = 140) and Indian (n = 60) women were interviewed and measured for demographic, socioeconomic, anthropometric, dietary and physical activity information. The women were measured for their body mass index and waist circumference (WC). Energy and nutrient intakes, food group intake and food variety score were analyzed from 24 h dietary recalls and food-frequency questionnaire. Daily physical activity of the women was examined as the number of hours spent in economic, domestic, leisure and sport activities. Using the Radimer/Cornell Hunger and Food Insecurity Instrument, 58% of the women reported some degree of food insecurity (household insecure 14%, adult insecure 9.5% and child hunger 34.5%). In general, food-insecure women had lower years of education, household income and income per capita, more children and mothers as housewives. More than 50% of food-insecure women were overweight and obese than women from food-secure households (38%). Similarly, more food-insecure women (32-47%) had at-risk WC (> or = 88 cm) than food-secure women (29%). Food-insecure women spent significantly more time in domestic and leisure activities than food-secure women. Overweight and abdominal adiposity among the women were associated with a number of independent variables, such as women as housewives, women with more children, larger household size, food insecurity, shorter time spent in economic activities, longer time spent in leisure activities and lower food variety score. After adjusting for factors that are related to both adiposity and food insecurity, women from food-insecure households were significantly more likely to have at-risk WC, but not obese. Among this sample of rural

  17. Trace elements detection in whole food samples by Neutron Activation Analysis, k0-method

    International Nuclear Information System (INIS)

    Sathler, Márcia Maia; Menezes, Maria Ângela de Barros Correia; Salles, Paula Maria Borges de

    2017-01-01

    Inorganic elements, from natural and anthropogenic sources are present in foods in different concentrations. With the increase in anthropogenic activities, there was also a considerable increase in the emission of these elements in the environment, leading to the need of monitoring the elemental composition of foods available for consumption. Numerous techniques have been used to detect inorganic elements in biological and environmental matrices, always aiming at reaching lower detection limits in order to evaluate the trace element content in the sample. Neutron activation analysis (INAA), applying the k 0 -method, produces accurate and precise results without the need of chemical preparation of the samples – that could cause their contamination. This study evaluated the presence of inorganic elements in whole foods samples, mainly elements on trace levels. For this purpose, seven samples of different types of whole foods were irradiated in the TRIGA MARK I IPR-R1 research reactor - located at CDTN/CNEN, in Belo Horizonte, MG. It was possible to detect twenty two elements above the limit of detection in, at least, one of the samples analyzed. This study reaffirms the INAA, k 0 - method, as a safe and efficient technique for detecting trace elements in food samples. (author)

  18. Trace elements detection in whole food samples by Neutron Activation Analysis, k{sub 0}-method

    Energy Technology Data Exchange (ETDEWEB)

    Sathler, Márcia Maia; Menezes, Maria Ângela de Barros Correia, E-mail: maia.sathler@gmail.com, E-mail: menezes@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Salles, Paula Maria Borges de, E-mail: pauladesalles@yahoo.com.br [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear

    2017-07-01

    Inorganic elements, from natural and anthropogenic sources are present in foods in different concentrations. With the increase in anthropogenic activities, there was also a considerable increase in the emission of these elements in the environment, leading to the need of monitoring the elemental composition of foods available for consumption. Numerous techniques have been used to detect inorganic elements in biological and environmental matrices, always aiming at reaching lower detection limits in order to evaluate the trace element content in the sample. Neutron activation analysis (INAA), applying the k{sub 0}-method, produces accurate and precise results without the need of chemical preparation of the samples – that could cause their contamination. This study evaluated the presence of inorganic elements in whole foods samples, mainly elements on trace levels. For this purpose, seven samples of different types of whole foods were irradiated in the TRIGA MARK I IPR-R1 research reactor - located at CDTN/CNEN, in Belo Horizonte, MG. It was possible to detect twenty two elements above the limit of detection in, at least, one of the samples analyzed. This study reaffirms the INAA, k{sub 0} - method, as a safe and efficient technique for detecting trace elements in food samples. (author)

  19. Random or systematic sampling to detect a localised microbial contamination within a batch of food

    NARCIS (Netherlands)

    Jongenburger, I.; Reij, M.W.; Boer, E.P.J.; Gorris, L.G.M.; Zwietering, M.H.

    2011-01-01

    Pathogenic microorganisms are known to be distributed heterogeneously in food products that are solid, semi-solid or powdered, like for instance peanut butter, cereals, or powdered milk. This complicates effective detection of the pathogens by sampling. Two-class sampling plans, which are deployed

  20. Molecularly imprinted polymers for sample preparation and biosensing in food analysis: Progress and perspectives.

    Science.gov (United States)

    Ashley, Jon; Shahbazi, Mohammad-Ali; Kant, Krishna; Chidambara, Vinayaka Aaydha; Wolff, Anders; Bang, Dang Duong; Sun, Yi

    2017-05-15

    Molecularly imprinted polymers (MIPs) are biomimetics which can selectively bind to analytes of interest. One of the most interesting areas where MIPs have shown the biggest potential is food analysis. MIPs have found use as sorbents in sample preparation attributed to the high selectivity and high loading capacity. MIPs have been intensively employed in classical solid-phase extraction and solid-phase microextraction. More recently, MIPs have been combined with magnetic bead extraction, which greatly simplifies sample handling procedures. Studies have consistently shown that MIPs can effectively minimize complex food matrix effects, and improve recoveries and detection limits. In addition to sample preparation, MIPs have also been viewed as promising alternatives to bio-receptors due to the inherent molecular recognition abilities and the high stability in harsh chemical and physical conditions. MIPs have been utilized as receptors in biosensing platforms such as electrochemical, optical and mass biosensors to detect various analytes in food. In this review, we will discuss the current state-of-the-art of MIP synthesis and applications in the context of food analysis. We will highlight the imprinting methods which are applicable for imprinting food templates, summarize the recent progress in using MIPs for preparing and analysing food samples, and discuss the current limitations in the commercialisation of MIPs technology. Finally, future perspectives will be given. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Recent trends in sorption-based sample preparation and liquid chromatography techniques for food analysis.

    Science.gov (United States)

    V Soares Maciel, Edvaldo; de Toffoli, Ana Lúcia; Lanças, Fernando Mauro

    2018-04-20

    The accelerated rising of the world's population increased the consumption of food, thus demanding more rigors in the control of residue and contaminants in food-based products marketed for human consumption. In view of the complexity of most food matrices, including fruits, vegetables, different types of meat, beverages, among others, a sample preparation step is important to provide more reliable results when combined with HPLC separations. An adequate sample preparation step before the chromatographic analysis is mandatory in obtaining higher precision and accuracy in order to improve the extraction of the target analytes, one of the priorities in analytical chemistry. The recent discovery of new materials such as ionic liquids, graphene-derived materials, molecularly imprinted polymers, restricted access media, magnetic nanoparticles, and carbonaceous nanomaterials, provided high sensitivity and selectivity results in an extensive variety of applications. These materials, as well as their several possible combinations, have been demonstrated to be highly appropriate for the extraction of different analytes in complex samples such as food products. The main characteristics and application of these new materials in food analysis will be presented and discussed in this paper. Another topic discussed in this review covers the main advantages and limitations of sample preparation microtechniques, as well as their off-line and on-line combination with HPLC for food analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Sample preparation strategies for food and biological samples prior to nanoparticle detection and imaging

    DEFF Research Database (Denmark)

    Larsen, Erik Huusfeldt; Löschner, Katrin

    2014-01-01

    microscopy (TEM) proved to be necessary for trouble shooting of results obtained from AFFF-LS-ICP-MS. Aqueous and enzymatic extraction strategies were tested for thorough sample preparation aiming at degrading the sample matrix and to liberate the AgNPs from chicken meat into liquid suspension. The resulting...... AFFF-ICP-MS fractograms, which corresponded to the enzymatic digests, showed a major nano-peak (about 80 % recovery of AgNPs spiked to the meat) plus new smaller peaks that eluted close to the void volume of the fractograms. Small, but significant shifts in retention time of AFFF peaks were observed...... for the meat sample extracts and the corresponding neat AgNP suspension, and rendered sizing by way of calibration with AgNPs as sizing standards inaccurate. In order to gain further insight into the sizes of the separated AgNPs, or their possible dissolved state, fractions of the AFFF eluate were collected...

  3. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  4. Antibiotic Resistance Among Staphylococcus aureus and Escherichia coli Isolated From Traditional and Industrial Food Samples

    Directory of Open Access Journals (Sweden)

    Mojtaba Arslani

    2017-05-01

    Full Text Available Background: Foodborne diseases are one of the serious problems in the world. Every year, more than 100 million people are affected by foodborne and waterborne diseases particularly immunocompromised diseases. Objectives: The aim of the present study was to evaluate bacterial load and antibiotic resistance pattern in bacterial isolates from food samples of meat, dairy, and pastry products from west of Tehran, Iran, during April 2007 to March 2008. Materials and Methods: A total of 1625 different food samples including dairy products, meat and pastries were collected randomly from different parts of the west of Tehran. All samples were kept at 4°C. The samples were first cultured according to the standard bacteriological methods and then Staphylococcus aureus and Escherichia coli isolates were identified using standard bacteriological tests. Antimicrobial susceptibility test was performed by disk diffusion method according to Clinical & Laboratory Standards Institute (CLSI guidelines. Results: During 2007 and 2008, 2.8% and 3% of the food samples were contaminated with S. aureus. Similarly, 3.5% and 6.4% of the food samples were contaminated with E. coli. E. coli isolates were highly resistant to amikacin and cephotaxime and this resistance was increased in 2008. Similarly S. aureus isolates were resistant to ciprofloxacin, cephotaxime, gentamicin, and tetracyclin. There was no significant difference during 2007-2008. Conclusion: The rate of contamination during 2007 was 2.8% and during 2008 was 3% for S. aureus. This strain was isolated from the food samples. Further studies should be done to determine the changes of bacterial resistance pattern for various food samples. Thus, the baseline for comparison with future prospective studies should be established, enabling the determination of trends over time.

  5. An overview of sample preparation procedures for LC-MS multiclass antibiotic determination in environmental and food samples.

    Science.gov (United States)

    Moreno-Bondi, María Cruz; Marazuela, María Dolores; Herranz, Sonia; Rodriguez, Erika

    2009-10-01

    Antibiotics are a class of pharmaceuticals that are of great interest due to the large volumes of these substances that are consumed in both human and veterinary medicine, and due to their status as the agents responsible for bacterial resistance. They can be present in foodstuffs and in environmental samples as multicomponent chemical mixtures that exhibit a wide range of mechanisms of action. Moreover, they can be transformed into different metabolites by the action of microorganisms, as well as by other physical or chemical means, resulting in mixtures with higher ecotoxicities and risks to human health than those of the individual compounds. Therefore, there is growing interest in the availability of multiclass methods for the analysis of antimicrobial mixtures in environmental and food samples at very low concentrations. Liquid chromatography (LC) has become the technique of choice for multiclass analysis, especially when coupled to mass spectrometry (LC-MS) and tandem MS (LC-MS(2)). However, due to the complexity of the matrix, in most cases an extraction step for sample clean-up and preconcentration is required before analysis in order to achieve the required sensitivities. This paper reviews the most recent developments and applications of multiclass antimicrobial determination in environmental and food matrices, emphasizing the practical aspects of sample preparation for the simultaneous extraction of antimicrobials from the selected samples. Future trends in the application of LC-MS-based techniques to multiclass antibiotic analysis are also presented.

  6. Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland

    DEFF Research Database (Denmark)

    Scullion, R.; Harrington, C.S.; Madden, R.H.

    2006-01-01

    A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....

  7. Caffeine Extraction from Raw and Roasted Coffee Beans.

    Science.gov (United States)

    Chiang, Donyau; Lin, Chih-Yang; Hu, Chen-Ti; Lee, Sanboh

    2018-04-01

    Coffee is a stimulant, psychoactive, popular daily beverage, and its caffeine affects human physiological health and behavior. These important issues prompted us to study caffeine extraction from both the raw and roasted coffee beans of 3 types at different temperatures. A hemispheric model is developed to simulate the extraction process of the caffeine from the coffee beans of hemisphere is proposed. The experimental data are in good agreement with the predicted model. The effective diffusivities of caffeine in both the raw and roasted beans increase with temperature in all 3 types. An incubation period, decreasing with increasing temperature, is observed in all samples studied. Caffeine extraction in roasted beans is more rapid than that for the raw beans and the time difference is significant at low temperatures. In both the raw and roasted samples, caffeine diffusion in the raw beans and the incubation behavior are thermally activated processes. Single activation energies are obtained for diffusion within the extraction temperature range for all beans tested with the exception of one type of the coffee beans, Mandheling, which exhibits 2 activation energies in raw samples. The surface energies of the epidermis of the raw beans and roasted beans obtained from the contact angle measurements are used to interpret the difference of incubation periods. This study has a potential application to the decaffeinated coffee industry.Caffeine affects human physiological health and behavior so that caffeine extraction from coffee beans of different types at different temperatures is important for product refining and customers. © 2018 Institute of Food Technologists®.

  8. Molecular characterization of diarrheagenic Escherichia coli strains from stools samples and food products in Colombia

    OpenAIRE

    Rúgeles, Laura Cristina; Bai, Jing; Martínez, Aída Juliana; Vanegas, María Consuelo; Gómez-Duarte, Oscar Gilberto

    2010-01-01

    The prevalence of diarrheagenic E. coli in childhood diarrhea and the role of contaminated food products in disease transmission in Colombia are largely unknown. The aim of this study is to identify E. coli pathotypes, including E. coli O157:H7, from 108 stool samples from children with acute diarrhea, 38 meat samples and 38 vegetable samples. Multiplex PCR and Bax Dupont systems were used for E. coli pathotype detection. Eighteen (9.8%) E. coli diarrheagenic pathotypes were detected among al...

  9. Determination of essential nutrients in raw milk

    Directory of Open Access Journals (Sweden)

    Penphimon Phongphanphanee

    2006-03-01

    Full Text Available Milk production in Thailand has gradually increased since 1961. Occasional oversupply of raw milk has become one of dairy farmers' major problems. Increasing the consumption of milk by making use of its separated nutrients may offer a solution. This study was to assess the composition of raw milk produced in Thailand, which included fat, protein, lactose, solid-not-fat (SNF and total solid (TS. A large dairy cooperatives in Saraburi Province was selected for the study. About 9% of its total members, constituting 108 farms, were randomly chosen. They consisted of small size (less than 20 cows/farm, medium size (21-100 cows/farm and large size (>100 cows/farm. The majority was medium-size. Raw milk from each farm was sampled at the delivery site of the cooperatives in the morning. Milk data of the 108 farms were compiled at 3 different periods between February and July 2003. The raw milk was analyzed by the Fourier Transform Infrared Analysis (FTIR using MilkoScan FT6000. The results showed the average fat content of 3.50±0.47%, protein of 3.13±0.16%, lactose of 4.59±0.12%, SNF of 8.42±0.20%, and TS of 11.92±0.54%. The samples were superior in all of the nutrients as compared to the standard levels set by the Department of Livestock Development, except for TS. This indicates the possibility of a local production of milk nutrients such as lactose and protein as ingredients for the pharmaceutical and health food industries.

  10. Food insecurity and mental health problems among a community sample of young adults.

    Science.gov (United States)

    Pryor, Laura; Lioret, Sandrine; van der Waerden, Judith; Fombonne, Éric; Falissard, Bruno; Melchior, Maria

    2016-08-01

    Food insecurity has been found to be related to anxiety and depression; however, the association with other psychiatric disorders, particularly among young adults, is not well known. We examined whether food insecurity is independently associated with four common mental health problems among a community sample of young adults in France. Data are from the TEMPO longitudinal cohort study. In 1991, participants' parents provided information on health and family socioeconomic characteristics. In 2011, participants' (18-35 years) reported food insecurity, mental health symptoms, and socioeconomic conditions (n = 1214). Mental health problems ascertained included major depressive episode, suicidal ideation, attention deficit and hyperactivity disorder, and substance abuse and/or dependence (nicotine, alcohol and cannabis). Cross-sectional associations between food insecurity and mental health problems were tested using modified Poisson regressions, weighted by inverse probability weights (IPW) of exposure. This makes food insecure and not food insecure participants comparable on all characteristics including socioeconomic factors and past mental health problems. 8.5 % of young adults were food insecure. In IPW-controlled analyses, food insecurity was associated with increased levels of depression (RR = 2.01, 95 % CI 1.01-4.02), suicidal ideation (RR = 3.23, 95 % CI 1.55-6.75) and substance use problems (RR = 1.68, 95 % CI 1.15-2.46). Food insecurity co-occurs with depression, suicidal ideation and substance use problems in young adulthood. Our findings suggest that reductions in food insecurity during this important life period may help prevent mental health problems. Policies aiming to alleviate food insecurity should also address individuals' psychiatric problems, to prevent a lifelong vicious circle of poor mental health and low socioeconomic attainment.

  11. Food Hardship and Obesity in a Sample of Low-Income Immigrants.

    Science.gov (United States)

    Caspi, Caitlin E; Tucker-Seeley, Reginald D; Adamkiewicz, Gary; Roberto, Christina A; Stoddard, Anne M; Sorensen, Glorian C

    2017-02-01

    Very little work has examined the relationship between food hardship (having inconsistent financial resources to buy food) and obesity among immigrant groups. A cross-sectional study was conducted in a low-income, multi-racial/ethnic adult sample in greater Boston, MA (n = 828). Modified Poisson regression models estimated the association between food hardship obesity (BMI ≥ 30) among adults reporting food hardship; interactions were tested by place of birth. Body mass index (BMI) was based on anthropometric height and weight. In adjusted models, those experiencing food hardship were more likely to be obese (RR 1.17, CI 1.07, 1.29) than those not experiencing food hardship. Participants from Haiti reporting food hardship were more likely to be obese than those not reporting hardship (RR 1.58, CI 1.23, 2.04); this was not the case among other groups (US born, Puerto Rican, Latin American, Other). The relationship between food hardship and weight may vary among immigrant subgroups.

  12. Radiological study of brackish and fresh water food samples in Lagos and Ondo states, southwestern Nigeria

    International Nuclear Information System (INIS)

    Ojo, T.J.; Ojo, O.C.

    2007-01-01

    Measurement of the average radioactivity concentration in brackish and fresh water food samples in Lagos and Ondo States of Nigeria was carried out using a very sensitive gamma spectroscopic system consisting of a 76 mm x 76 mm Nal (TI) scintillation detector coupled to a computerized ACCUSPEC installation. All the radionuclide detected are traceable to the naturally occurring 4 ''0K and ''2''3''2Th. The average concentrations of ''2''3''8U and ''2''3''2Th were found to be higher in brackish water food samples, 50.92±7.04 Bq/kg and 24.60± 6.47 Bq/kg respectively. The average concentration of ''4''0K was found to be higher in food samples got from freshwater, 738.94±84.81Bq/kg

  13. o-TOF ICPMS analysis of environmental, food and biological samples

    International Nuclear Information System (INIS)

    Krejcova, A.; Cernohorsky, T.; Ludvikova, I.; Pouzar, M.; Capova, L.

    2009-01-01

    Full text: o-TOF ICPMS was used for inorganic analysis of environmental, food and biological samples. The method validity was proved by analysis of spiked samples, reference materials, by determination without/with internal standards and the standard addition technique. The technique was shown to be powerful, and reliable for analysis of the samples mentioned, and high sample throughput enables environmental or biological screening studies. Independent of the number of elements analyzed, complete analysis and whole mass spectra are gained from a small sample amount in a very short time. (author)

  14. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  15. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards), 2014. Scientific Opinion on the risk posed by pathogens in food of non-animal origin. Part 2 (Salmonella and Norovirus in leafy greens eaten raw as salads)

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    Leafy greens eaten raw as salads are minimally processed and widely consumed foods. Risk factors for leafy greens contamination by Salmonella spp. and Norovirus were considered in the context of the whole food chain including agricultural production and processing. Available estimates...... combination of numerous characteristics that can influence occurrence and persistence of pathogens in leafy greens production. Appropriate implementation of food safety management systems, including Good Agricultural Practices (GAP), Good Hygiene Practices (GHP) and Good Manufacturing Practices (GMP), should...... of the prevalence of these pathogens (together with the use of Escherichia coli as an indicator organism) in leafy greens were evaluated. Specific mitigation options relating to contamination of leafy greens were considered and qualitatively assessed. It was concluded that each farm environment represents a unique...

  16. Quantification of isotope-labelled and unlabelled folates in plasma, ileostomy and food samples.

    Science.gov (United States)

    Büttner, Barbara E; Öhrvik, Veronica E; Witthöft, Cornelia M; Rychlik, Michael

    2011-01-01

    New stable isotope dilution assays were developed for the simultaneous quantitation of [(13)C(5)]-labelled and unlabelled 5-methyltetrahydrofolic acid, 5-formyltetrahydrofolic acid, folic acid along with unlabelled tetrahydrofolic acid and 10-formylfolic acid in clinical samples deriving from human bioavailability studies, i.e. plasma, ileostomy samples, and food. The methods were based on clean-up by strong anion exchange followed by LC-MS/MS detection. Deuterated analogues of the folates were applied as the internal standards in the stable isotope dilution assays. Assay sensitivity was sufficient to detect all relevant folates in the respective samples as their limits of detection were below 0.62 nmol/L in plasma and below 0.73 μg/100 g in food or ileostomy samples. Quantification of the [(13)C(5)]-label in clinical samples offers the possibility to differentiate between folate from endogenous body pools and the administered dose when executing bioavailability trials.

  17. Homogenization of food samples for gamma spectrometry using tetramethylammonium hydroxide and enzymatic digestion

    International Nuclear Information System (INIS)

    Kimi Nishikawa; Abdul Bari; Abdul Jabbar Khan; Xin Li; Traci Menia; Semkow, T.M.

    2017-01-01

    We have developed a method of food sample preparation for gamma spectrometry involving the use of tetramethylammonium hydroxide (TMAH) and/or enzymes such as α-amylase or cellulase for sample homogenization. We demonstrated the effectiveness of this method using food matrices spiked with "6"0Co, "1"3"1I, "1"3"4","1"3"7Cs, and "2"4"1Am radionuclides, homogenized with TMAH (mixed salad, parmesan cheese, and ground beef); enzymes (α-amylase for bread, and cellulase for baked beans); or α-amylase followed by TMAH (cheeseburgers). Procedures were developed which are best compromises between the degree of homogenization, accuracy, speed, and minimizing laboratory equipment contamination. Based on calculated sample biases and z-scores, our results suggest that homogenization using TMAH and enzymes would be a useful method of sample preparation for gamma spectrometry samples during radiological emergencies. (author)

  18. A validated PCR-based method to detect Listeria monocytogenes using raw milk as a food model - Towards an international standard

    DEFF Research Database (Denmark)

    D'Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.

    2004-01-01

    the accordance (repeatability) and the concordance (reproducibility) were 99.4%. The assay was incorporated within a method for the detection of L. monocytogenes in raw milk, which involves 24 It of enrichment in half-Fraser broth followed by 16 h of enrichment in a medium that can be added directly into the PCR...

  19. Carotene location in processed food samples measured by cryo In-SEM Raman.

    Science.gov (United States)

    Lopez-Sanchez, Patricia; Schumm, Stephan; Pudney, Paul D A; Hazekamp, Johan

    2011-09-21

    Cryo In-SEM Raman has been used for the first time to localise carotene compounds in a food matrix. Raman spectra of lycopene and β-carotene have been obtained from sampling oil droplets and plant cell structures visualised with cryo-SEM in tomato and carrot based emulsions containing 5% oil. It was possible to identify the carotenoids in both the oil droplets and the cell walls. Furthermore our results gave some indication that the carotenoids were in the non-crystalline state. It has been suggested that a higher amount of carotenes solubilised into the oil phase of the food matrix would lead to a higher bioaccessibility, thus understanding the effect of processing conditions on micronutrients distribution in a food matrix might help the design of plant based food products with a better nutritional quality. This shows improved structural characterisation of the cryo-SEM with the molecular sensitivity of Raman spectroscopy as a promising approach for complex biological problems.

  20. Antimicrobial and antibiofilm effects of selected food preservatives against Salmonella spp. isolated from chicken samples.

    Science.gov (United States)

    Er, Buket; Demirhan, Burak; Onurdag, Fatma Kaynak; Ozgacar, Selda Özgen; Oktem, Aysel Bayhan

    2014-03-01

    Salmonella spp. are widespread foodborne pathogens that contaminate egg and poultry meats. Attachment, colonization, as well as biofilm formation capacity of Salmonella spp. on food and contact surfaces of food may cause continuous contamination. Biofilm may play a crucial role in the survival of salmonellae under unfavorable environmental conditions, such as in animal slaughterhouses and processing plants. This could serve as a reservoir compromising food safety and human health. Addition of antimicrobial preservatives extends shelf lives of food products, but even when products are supplemented with adequate amounts of preservatives, it is not always possible to inhibit the microorganisms in a biofilm community. In this study, our aims were i) to determine the minimum inhibitory concentrations (MIC) and minimum biofilm inhibitory concentrations (MBIC) of selected preservatives against planktonic and biofilm forms of Salmonella spp. isolated from chicken samples and Salmonella Typhimurium SL1344 standard strain, ii) to show the differences in the susceptibility patterns of same strains versus the planktonic and biofilm forms to the same preservative agent, and iii) to determine and compare antimicrobial and antibiofilm effects of selected food preservatives against Salmonella spp. For this purpose, Salmonella Typhimurium SL1344 standard strain and 4 Salmonella spp. strains isolated from chicken samples were used. Investigation of antimicrobial and antibiofilm effects of selected food preservatives against Salmonella spp. was done according to Clinical and Laboratory Standards Institute M100-S18 guidelines and BioTimer assay, respectively. As preservative agents, pure ciprofloxacin, sodium nitrite, potassium sorbate, sodium benzoate, methyl paraben, and propyl paraben were selected. As a result, it was determined that MBIC values are greater than the MIC values of the preservatives. This result verified the resistance seen in a biofilm community to food

  1. Laser Scribed Graphene Biosensor for Detection of Biogenic Amines in Food Samples Using Locally Sourced Materials

    Directory of Open Access Journals (Sweden)

    Diana C. Vanegas

    2018-04-01

    Full Text Available In foods, high levels of biogenic amines (BA are the result of microbial metabolism that could be affected by temperatures and storage conditions. Thus, the level of BA is commonly used as an indicator of food safety and quality. This manuscript outlines the development of laser scribed graphene electrodes, with locally sourced materials, for reagent-free food safety biosensing. To fabricate the biosensors, the graphene surface was functionalized with copper microparticles and diamine oxidase, purchased from a local supermarket; and then compared to biosensors fabricated with analytical grade materials. The amperometric biosensor exhibits good electrochemical performance, with an average histamine sensitivity of 23.3 µA/mM, a lower detection limit of 11.6 µM, and a response time of 7.3 s, showing similar performance to biosensors constructed from analytical grade materials. We demonstrated the application of the biosensor by testing total BA concentration in fish paste samples subjected to fermentation with lactic acid bacteria. Biogenic amines concentrations prior to lactic acid fermentation were below the detection limit of the biosensor, while concentration after fermentation was 19.24 ± 8.21 mg histamine/kg, confirming that the sensor was selective in a complex food matrix. The low-cost, rapid, and accurate device is a promising tool for biogenic amine estimation in food samples, particularly in situations where standard laboratory techniques are unavailable, or are cost prohibitive. This biosensor can be used for screening food samples, potentially limiting food waste, while reducing chances of foodborne outbreaks.

  2. Interferences in radioimmunoassay of aflatoxins in food and fodder samples of plant origin

    International Nuclear Information System (INIS)

    Rauch, P.; Fukal, L.; Brezina, P.; Kas, J.

    1988-01-01

    Cross-reactions and resulting nonspecific binding of substances with structures resembling aflatoxins (derivatives of coumarin, and cinnamonic and benzoic acids, etc.) were investigated. The concentrations of these substances causing erroneously high or false positive values in radioimmunoassay were determined. One μg aflatoxin B 1 /kg sample may be simulated by the occurrence of 5 g coumarin, 10 g caffeic acid, 16 g chlorogenic acid, or 15 g vanillin/kg fodder or food sample

  3. Results from raw milk microbiological tests do not predict the shelf-life performance of commercially pasteurized fluid milk.

    Science.gov (United States)

    Martin, N H; Ranieri, M L; Murphy, S C; Ralyea, R D; Wiedmann, M; Boor, K J

    2011-03-01

    Analytical tools that accurately predict the performance of raw milk following its manufacture into commercial food products are of economic interest to the dairy industry. To evaluate the ability of currently applied raw milk microbiological tests to predict the quality of commercially pasteurized fluid milk products, samples of raw milk and 2% fat pasteurized milk were obtained from 4 New York State fluid milk processors for a 1-yr period. Raw milk samples were examined using a variety of tests commonly applied to raw milk, including somatic cell count, standard plate count, psychrotrophic bacteria count, ropy milk test, coliform count, preliminary incubation count, laboratory pasteurization count, and spore pasteurization count. Differential and selective media were used to identify groups of bacteria present in raw milk. Pasteurized milk samples were held at 6°C for 21 d and evaluated for standard plate count, coliform count, and sensory quality throughout shelf-life. Bacterial isolates from select raw and pasteurized milk tests were identified using 16S ribosomal DNA sequencing. Linear regression analysis of raw milk test results versus results reflecting pasteurized milk quality consistently showed low R(2) values (tests and results from tests used to evaluate pasteurized milk quality. Our findings suggest the need for new raw milk tests that measure the specific biological barriers that limit shelf-life and quality of fluid milk products. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. Food insecurity and mental disorders in a national sample of U.S. adolescents.

    Science.gov (United States)

    McLaughlin, Katie A; Green, Jennifer Greif; Alegría, Margarita; Jane Costello, E; Gruber, Michael J; Sampson, Nancy A; Kessler, Ronald C

    2012-12-01

    To examine whether food insecurity is associated with past-year DSM-IV mental disorders after controlling for standard indicators of family socioeconomic status (SES) in a U.S. national sample of adolescents. Data were drawn from 6,483 adolescent-parent pairs who participated in the National Comorbidity Survey Replication Adolescent Supplement, a national survey of adolescents 13 to 17 years old. Frequency and severity of food insecurity were assessed with questions based on the U.S. Department of Agriculture's Food Security Scale (standardized to a mean of 0, variance of 1). DSM-IV mental disorders were assessed with the World Health Organization Composite International Diagnostic Interview. Associations of food insecurity with DSM-IV/Composite International Diagnostic Interview diagnoses were estimated with logistic regression models controlling for family SES (parental education, household income, relative deprivation, community-level inequality, and subjective social status). Food insecurity was highest in adolescents with the lowest SES. Controlling simultaneously for other aspects of SES, standardized food insecurity was associated with an increased odds of past-year mood, anxiety, behavior, and substance disorders. A 1 standard deviation increase in food insecurity was associated with a 14% increase in the odds of past-year mental disorder, even after controlling for extreme poverty. The association between food insecurity and mood disorders was strongest in adolescents living in families with a low household income and high relative deprivation. Food insecurity is associated with a wide range of adolescent mental disorders independently of other aspects of SES. Expansion of social programs aimed at decreasing family economic strain might be one useful policy approach for improving youth mental health. Copyright © 2012 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.

  5. Food Insecurity and Mental Disorders in a National Sample of U.S. Adolescents

    Science.gov (United States)

    McLaughlin, Katie A.; Green, Jennifer Greif; Alegria, Margarita; Costello, E. Jane; Gruber, Michael J.; Sampson, Nancy A.; Kessler, Ronald C.

    2012-01-01

    Objective: To examine whether food insecurity is associated with past-year "DSM-IV" mental disorders after controlling for standard indicators of family socioeconomic status (SES) in a U.S. national sample of adolescents. Method: Data were drawn from 6,483 adolescent-parent pairs who participated in the National Comorbidity Survey Replication…

  6. Comparison of room temperature and cyrogenic sample processing in the analysis of chemical contaminants in foods

    Science.gov (United States)

    In this study, analytical results were compared when using different approaches to bulk food sample comminution, consisting of a vertical chopper (Blixer) at room temperature and at dry ice cryogenic conditions, followed by further subsample processing (20 g) using liquid nitrogen cryogenic conditio...

  7. Evaluation of ELISA tests specific for Shiga toxin 1 and 2 in food and water samples

    Science.gov (United States)

    Two enzyme-linked immunosorbent assay (ELISA) kits were evaluated for their effectiveness in detecting and differentiating between Shiga toxin 1 and 2 (Stx1 and Stx2) produced by Shiga toxin-producing E. coli (STEC) inoculated into food and water samples. Each kit incorporated monoclonal antibodies ...

  8. 21 CFR 161.175 - Frozen raw breaded shrimp.

    Science.gov (United States)

    2010-04-01

    ... additives as defined in section 201(s) of the Federal Food, Drug, and Cosmetic Act; or if they are food... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen raw breaded shrimp. 161.175 Section 161.175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD...

  9. Solvent extraction method for rapid separation of strontium-90 in milk and food samples

    International Nuclear Information System (INIS)

    Hingorani, S.B.; Sathe, A.P.

    1991-01-01

    A solvent extraction method, using tributyl phosphate, for rapid separation of strontium-90 in milk and other food samples has been presented in this report in view of large number of samples recieved after Chernobyl accident for checking radioactive contamination. The earlier nitration method in use for the determination of 90 Sr through its daughter 90 Y takes over two weeks for analysis of a sample. While by this extraction method it takes only 4 to 5 hours for sample analysis. Complete estimation including initial counting can be done in a single day. The chemical recovery varies between 80-90% compared to nitration method which is 65-80%. The purity of the method has been established by following the decay of yttrium-90 separated. Some of the results obtained by adopting this chemical method for food analysis are included. The method is, thus, found to be rapid and convenient for accurate estimation of strontium-90 in milk and food samples. (author). 2 tabs., 1 fig

  10. Salmonella testing of pooled pre-enrichment broth cultures for screening multiple food samples.

    Science.gov (United States)

    Price, W R; Olsen, R A; Hunter, J E

    1972-04-01

    A method has been described for testing multiple food samples for Salmonella without loss in sensitivity. The method pools multiple pre-enrichment broth cultures into single enrichment broths. The subsequent stages of the Salmonella analysis are not altered. The method was found applicable to several dry food materials including nonfat dry milk, dried egg albumin, cocoa, cottonseed flour, wheat flour, and shredded coconut. As many as 25 pre-enrichment broth cultures were pooled without apparent loss in the sensitivity of Salmonella detection as compared to individual sample analysis. The procedure offers a simple, yet effective, way to increase sample capacity in the Salmonella testing of foods, particularly where a large proportion of samples ordinarily is negative. It also permits small portions of pre-enrichment broth cultures to be retained for subsequent individual analysis if positive tests are found. Salmonella testing of pooled pre-enrichment broths provides increased consumer protection for a given amount of analytical effort as compared to individual sample analysis.

  11. Are great apes able to reason from multi-item samples to populations of food items?

    Science.gov (United States)

    Eckert, Johanna; Rakoczy, Hannes; Call, Josep

    2017-10-01

    Inductive learning from limited observations is a cognitive capacity of fundamental importance. In humans, it is underwritten by our intuitive statistics, the ability to draw systematic inferences from populations to randomly drawn samples and vice versa. According to recent research in cognitive development, human intuitive statistics develops early in infancy. Recent work in comparative psychology has produced first evidence for analogous cognitive capacities in great apes who flexibly drew inferences from populations to samples. In the present study, we investigated whether great apes (Pongo abelii, Pan troglodytes, Pan paniscus, Gorilla gorilla) also draw inductive inferences in the opposite direction, from samples to populations. In two experiments, apes saw an experimenter randomly drawing one multi-item sample from each of two populations of food items. The populations differed in their proportion of preferred to neutral items (24:6 vs. 6:24) but apes saw only the distribution of food items in the samples that reflected the distribution of the respective populations (e.g., 4:1 vs. 1:4). Based on this observation they were then allowed to choose between the two populations. Results show that apes seemed to make inferences from samples to populations and thus chose the population from which the more favorable (4:1) sample was drawn in Experiment 1. In this experiment, the more attractive sample not only contained proportionally but also absolutely more preferred food items than the less attractive sample. Experiment 2, however, revealed that when absolute and relative frequencies were disentangled, apes performed at chance level. Whether these limitations in apes' performance reflect true limits of cognitive competence or merely performance limitations due to accessory task demands is still an open question. © 2017 Wiley Periodicals, Inc.

  12. Microbial Safety of Low Water Activity Foods: Study of Simulated and Durban Household Samples

    Directory of Open Access Journals (Sweden)

    O. A. Ijabadeniyi

    2017-01-01

    Full Text Available Sixty household low water activity foods were examined and a simulative study was conducted in a high sugar, low aw almond and macadamia butter to determine the survival of Bacillus cereus and Staphylococcus aureus ATCC 25923. Results obtained from 60 low aw samples collected at household level had some significant differences (P≤0,05 within food categories amongst the various tests. Spices had the highest number of aerobic bacteria, aerobic spore-formers, anaerobic spore-formers, and S. aureus. Mean aerobic colony counts for nuts and spices were 2.30 log CFU/g and 4.40 log CFU/g, respectively. Pathogens such as Escherichia coli and Cronobacter sakazakii were present in nuts, whilst Salmonella spp. was present in chocolates. This implies that certain low aw foods may present a public health risk. In the simulative study, temperature and high sucrose concentrations played a significant role in the survival of B. cereus and S. aureus ATCC 25923. B. cereus was found to be more osmotolerant at both reduced and elevated temperatures (18°C and 25°C in the 12% sucrose sample in both butters, whilst S. aureus ATCC 25923 seemed to grow better in sucrose-free samples at both temperatures in both butters. This implies that certain low aw foods may present a public health risk. Also, B. cereus, being a spore-forming bacterium, can be osmotolerant at both reduced and elevated temperatures.

  13. Combined method for the fast determination of pure beta emitting radioisotopes in food samples

    International Nuclear Information System (INIS)

    Kabai, Eva; Savkin, Birgit; Mehlsam, Isabell; Poppitz-Spuhler, Angela

    2017-01-01

    Fast radioanalytical methods are essential for a rapid response of decision makers. A fast method for the simultaneous determination of the pure beta emitting radionuclides 89 Sr/ 90 Sr and 99 Tc in food samples was developed. It includes the precipitation of fat and proteins with trichloroacetic acid for milk and dairy products and microwave digestion for other food products, followed by an anion exchange step to separate strontium from technetium. The purification steps for strontium and technetium are done using Sr-resin and TEVA-resin, respectively. Typical chemical yields are around 70 % for both radionuclides. The whole determination takes only around 20 h. (author)

  14. Quantification of total aluminium concentrations in food samples at trace levels by INAA and PIGE methods

    International Nuclear Information System (INIS)

    Nanda, Braja B.; Acharya, R.

    2017-01-01

    Total aluminium contents in various food samples were determined by Instrumental Neutron Activation Analysis (INAA) and Particle Induced Gamma-ray Emission (PIGE) methods. A total of 16 rice samples, collected from the field, were analyzed by INAA using reactor neutrons from Dhruva reactor. Whereas a total 17 spices collected from market, were analyzed by both INAA and PIGE methods in conjunction with high resolution gamma-ray spectrometry. Aluminium concentration values were found to be in the range of 19-845 mg kg -1 for spices and 15-104 mg kg -1 for rice samples. The methods were validated by analyzing standard reference materials (SRMs) form NIST. (author)

  15. Quantification of uncertainty in gamma spectrometric analysis of food and environmental samples

    International Nuclear Information System (INIS)

    Yii Mei Wo; Zaharudin Ahmad; Norfaizal Mohamed

    2005-01-01

    Gamma Spectrometry is widely used to determine the activity of gamma-ray emitter radionuclide inside a sample. Reporting the activity of the measurement for a sample should not be a single value only but it shall be associated with a reasonable uncertainty value since disintegration of radionuclide is a random/spontaneous process. This paper will focus on how the uncertainty was estimated, quantified and calculated, when measuring the activity of Cs-134 and Cs-137 in food and Ra-226, Ra-228 and K-40 in the environmental samples. (Author)

  16. Separation and characterization of nanoparticles in complex food and environmental samples by field-flow fractionation

    DEFF Research Database (Denmark)

    Kammer, Frank von der; Legros, Samuel; Hofmann, Thilo

    2011-01-01

    The thorough analysis of natural nanoparticles (NPs) and engineered NPs involves the sequence of detection, identification, quantification and, if possible, detailed characterization. In a complex or heterogeneous sample, each step of this sequence is an individual challenge, and, given suitable...... has been applied for separation of various types of NP (e.g., organic macromolecules, and carbonaceous or inorganic NPs) in different types of media (e.g., natural waters, soil extracts or food samples).FFF can be coupled to different types of detectors that offer additional information...... conditions on all types of NP in the sample. A holistic methodological approach is preferable to a technique-focused one....

  17. Preparation of Environmental and Food Samples to Support the Heavy Metals Detection by Stripping Electrochemical

    International Nuclear Information System (INIS)

    Iswani S

    2002-01-01

    Preparation of environmental and food samples to support the heavy metals detection by stripping electrochemistry was done. The water samples taken directly from the ground water were acidified with 1 mL of HNO 3 acic suprapure was not digested, while the soils samples which have already dried in the oven at 105 o C, ware grinded and sieved through 150 μm, werte digested with HNO 3 acic suprapure in the digestion bomb at 150 o C for 3-4 hours. The mussels samples which have already freezed in the freezer were peeled, dried with N 2 liquid, grinded and dried again in the freeze drier at the pressure of ≅ 10 -2 mBar, and then were grinded again, weighted, digested with HNO 3 acic and HClO 4 suprapure in the digestion bomb at 150 o C for 3 hours. Food samples were homogenized by electric mixer, dried with freeze dried, homogenized again by using ZrO 2 ball mill, weighted, digested by HPA (high Pressure Asher). The heavy metals in the food samples solution of digestion product were detected by using Polarographic Analyzer EGandG of SWV and DPASV methods, while in the water, soils and the mussels solution were detected by using PDV 2000 and Polarograf E-505, DPASV method. The method validity were tested with SRM materials such as soil-5, soil-7, water W-4, and coppepoda. The heavy metals detection results in the water, soils, mussels, and food by electrochemical method were reported in this paper. (author)

  18. Characterization of polycyclic aromatic hydrocarbons (PAH's) present in sampled cooked food

    International Nuclear Information System (INIS)

    Palm Naa-Dedei, L.M.

    2010-07-01

    The study was conducted to determine the levels of Polycyclic Aromatic Hydrocarbons in the following traditionally prepared food: smoked and grilled Scomba japonicus, grilled meat (khebab) and bread sampled from some Ghanaian markets. By way of preparation of traditional food, some food comes into direct contact with smoke or extremely high temperature which are potential sources of Polycyclic Aromatic Hydrocarbon generation. Levels of 20 individual Polycyclic Aromatic Hydrocarbons including acenaphthene, acenaphtyelene, anthanthrene, anthracene, benz(a)anthracene, benzo(a)pyrene, benzo(b)fluoranthene, benzo(e)pyrene, benzo(ghi)perylene, benzo(j)fluoranthene, benzo(k)fluoranthene, chrysene, cyclopenta(cd)pyrene, dibenzo(ah)anthracene, fluoranthene, fluorene, indeno(1,2,3-cd)pyrene, naphthalene, phenanthrene and pyrene were determined in 11 smoked and 5 grilled fish, 4 grilled pieces of meat and 3 loaves of baked bread using gas chromatographic techniques with flame ionization detector. Benzo(a)pyrene, which is one of the few PAH for which a legal limit exists in different types of food matrices and other high molecular weight PAHs suspected to be carcinogenic have been detected in high concentrations in most samples. Bread samples gave mean polycyclic aromatic hydrocarbon concentrations of up to 20.39 μg/kg while khebab samples gave mean polycyclicaromatic hydrocarbon concentrations of up to 67.61 μg/kg. There was positive correlation of 0.987 between levels of polycyclic aromatic hydrocarbon concentrations in khebab samples from locations Osu and Atomic down. There was a positive correlation in the concentrations of the high molecular weight PAHs in all smoked fishes from four locations with values between 0.954 and 0.999 for the correlation between any two groups. The polycyclic aromatic hydrocarbon concentration determined in smoked fish samples deceased in terms of location according to the order Winneba > Madina > Chorkor > Ada.

  19. Quality and Sensorial Characteristics of Raw-Vegan Bars

    Directory of Open Access Journals (Sweden)

    Liana Claudia Salanţă

    2015-11-01

    Full Text Available Increased consumer interest in healthier food products is driven by a variety of factors including growing awareness of the link between diet and health, the desire to age ‘gracefully’ by maintaining good health, greater convenience in meeting nutritional needs and preventing chronic diseases. In raw food diet, food is consumed predominantly or exclusively as uncooked and unprocessed raw food; the main components of the diet are fruits, nuts, seeds, and sprouted grains and beans. The aim of this study was to obtain two raw-vegan bars using dry raw materials and to establish the physicochemical and sensory characteristics of the products. Raw-vegan bars were formulated using fruits and seeds (cranberries, figs, raisins, raspberries, cashew, chia seeds, etc. and binding agents (honey. Raw-vegan bars stands out among fast foods due to their balanced nutritional content and convenience.  

  20. Application of immunoaffinity columns for different food item samples preparation in micotoxins determination

    Directory of Open Access Journals (Sweden)

    Ćurčić Marijana

    2016-01-01

    Full Text Available In analytical methods used for monitoring of what special attention is paid to sample preparation. Therefore, the objective of this study was testing the efficiency of immunoaffinity columns (IAC that are based on solid phase extraction principles used for samples preparation in determining aflatoxins and ochratoxins. Aflatoxins and ochratoxins concentrations were determined in totally 56 samples of food items: wheat, corn, rice, barley and other grains (19 samples, flour and flour products from grain and additives for the bakery industry (7 samples, fruits and vegetables (3 samples, hazelnut, walnut, almond, coconut flour (4 samples, roasted cocoa beans, peanuts, tea, coffee (16 samples, spices (4 samples and meat and meat products (4 samples. Obtained results indicate advantage of IAC use for sample preparation based on enhanced specificity due to binding of extracted molecules to incorporated specific antibodies and rinsing the rest molecules from sample which could interfere with further analysis. Additional advantage is the usage of small amount of organic solvents and consequently decreased exposure of staff who conduct micotoxins determination. Of special interest is increase in method sensitivity since limit of quantification for aflatoxins and ochratoxins determination method is lower than maximal allowed concentration of these toxines prescribed by national rule book.

  1. Raw material versus processing

    International Nuclear Information System (INIS)

    Berg, E.A.T.

    1989-01-01

    Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt

  2. Application of the neutron activation analysis method for determing trace elements in Brazilian food sample

    International Nuclear Information System (INIS)

    Maihara, V.A.; Vasconcellos, M.B.A.

    1988-01-01

    Recently there has been an increase of consciousness about the importance of trace elements in human health and disease as well as rising concern about food contamination. The development of sensitive, accurate and price methods is one of the most important of the knowledge of trace elements contents in foods and in biological samples. Neutron activation analysis is one of the most suitable tecniques because a great number of elements can be determined in concentrations in the range of μg/g to ng/g. The present work is a part of an AIEA Co-ordinated Research Programme on the applications of nuclear techniques for toxic elements in foodstuffs. Neutron activation analysis is applied to analysis of bread, milk powder and rice that are considered essential foods in the Brazilian diet. Some aspects of the activation analysis of biological matrices are discussed. (author) [pt

  3. Long-lasting stability of vaccinia virus (orthopoxvirus) in food and environmental samples.

    Science.gov (United States)

    Essbauer, S; Meyer, H; Porsch-Ozcürümez, M; Pfeffer, M

    2007-01-01

    Poxviruses are known to remain infectious in the scabs of patients for months to years. The aim of this study was to investigate viral stability in storm water, food or gauze spiked with vaccinia virus strain Munich 1 (VACV M1). Storm water, storm water supplemented with either fetal calf serum (FCS) or potting soil was stored at two different temperatures (refrigerator, room temperature; 4 degrees C/25 degrees C). In addition, we analysed the viability of VACV M1 on the surface of bread, salad, sausages and gauze bandages stored at 4 degrees C. Samples were titrated in MA 104 cells and the presence of viral DNA was demonstrated by orthopoxvirus-specific PCRs. After 2 weeks, reisolation of VACV M1 from all kinds of food, bandage and water samples except for storm water supplemented with potting soil was possible. Viral DNA was detected in almost all samples by PCR. Prolonged experiments with VACV M1-spiked storm water and storm water supplemented with FCS revealed that samples kept at 4.5 degrees C are infectious for up to 166 days. Our data demonstrate that VACV M1 has a longlasting stability in water and food. The results obtained during this study should be taken into account for risk assessment calculations for poxvirus transmission. Implying that variola virus and vaccinia virus behave in a similar way, our data call for sophisticated countermeasures in cases of a variola release in biological warfare.

  4. Nutrient Profiles and Volatile Odorous Compounds of Raw Milk After Exposure to Electron Beam Pasteurizing Doses.

    Science.gov (United States)

    Ward, Lindsay R; Kerth, Chris R; Pillai, Suresh D

    2017-07-01

    Raw milk is known to contain relatively high numbers of microorganisms, some of which include microbial pathogens. Electron beam (eBeam) processing is a nonthermal pasteurization food processing technology. The underlying hypothesis was that eBeam processing will not negatively influence the composition, nutrient content, and aroma profile of raw milk. Raw milk samples were exposed to eBeam doses of 1 and 2 kGy, since our studies had shown that 2 kGy is suitable for raw milk pasteurization. The untreated and eBeam-treated raw milk samples were analyzed to detect changes in lactose, vitamin B 2 , vitamin B 12 , and calcium concentrations. The possible breakdown of casein and whey proteins and lipid oxidation were investigated along with the formation of volatile aroma compounds. Even though vitamin B 2 showed a 31.6% decrease in concentration, the B 2 content in eBeam-pasteurized raw milk met all USDA nutritional guidelines. Even though there were no indications of lipid oxidation after the 2.0-kGy eBeam treatment, there was lipid oxidation (58%) after 7 d of refrigerated storage. However, based on the GC-olfactory analysis, the lipid oxidation did not necessarily result in the development of a wide variety of off-odors. © 2017 Institute of Food Technologists®.

  5. Clostridium difficile from food and surface samples in a Belgian nursing home: an unlikely source of contamination.

    Science.gov (United States)

    Rodriguez, C; Korsak, N; Taminiau, B; Avesani, V; Van Broeck, J; Brach, P; Delmée, M; Daube, G

    2015-04-01

    This study investigates the contamination of foods and surfaces with Clostridium difficile in a single nursing home. C. difficile PCR-ribotype 078 was found in one food sample and in none of the tested surfaces. These results indicate that food and surfaces are an unlikely source of C. difficile infection in this setting. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. COMPOSITIONAL EVALUATION OF RAW AND PROCESSED HARMS (Brachystegia eurycoma SEED FLOUR

    Directory of Open Access Journals (Sweden)

    M.O Aremu

    2014-12-01

    Full Text Available Brachystegia eurycoma is predominantly grown in the eastern region of Nigeria. Its seed is used in food majorly as a soup condiment, flavouring agent and soup thickener. The proximate, mineral and amino acid compositions were determined on raw and processed seeds (boiled, fermented and roasted using standard analytical techniques. The processing methods showed deviations in nutrients from the raw seeds. The crude protein was reduced by the processing methods with exception of roasting method. Crude fat was reduced in all the processing methods in this order: Raw > fermented > roasted > boiled samples. All the processing methods enhanced calcium content in this order: Raw < boiled < fermented < roasted samples. Boiling and fermenting reduced the content of magnesium by 72.6 and 30.2%, respectively while boiling, fermenting and roasting increased potassium content by 124.5, 12.2 and 120.4%, respectively. Generally, all the samples were found to be a good source of essential minerals and harmful heavy metals such as lead, chromium, arsenic and cadmium were not at detectable range of atomic absorption spectrophotometer. The amino acid profile revealed that amino acids in fermented sample were better concentrated than that of raw and other processed samples. The total essential amino acids (TEAA ranged from 28.63 g/100g crude protein in roasted sample to 34.79 g/100g crude protein in fermented sample. The limiting amino acid (LAA for all the samples was Met + Cys (TSAA.

  7. Analysis of Cl, Mn, Na, Zn in Food Samples by a Neutron Activation Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Jong Hwa; Kim, Sun Ha; Chung, Yong Sam [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Lee, Ok Hee [YongIn University, Yongin (Korea, Republic of)

    2008-10-15

    Due to their westernized dietary habit, Korean children are still threatened by the increasing risks of chronic disease such as obesity, hypertension, low immunity, etc. In addition, they are often exposed to a deficiency of Ca, Mg, Fe and micro-minerals which are necessary for their growth, immunity, and prevention of anemia. Nonetheless, the nutritional adequacy of mineral intakes for children is difficult to assess because of a lack of related studies and a nutritional database with respect to Korean children's foods. In this study, ninety kinds of foods consisting of lunch meals from an elementary and a middle school and children's favorite snacks were collected and prepared for an analysis. INAA which has an advantage of a non-destructive technique was employed to determine the elements like Cl, Mn, Na, Cl in the pretreated food samples. Quality control was carried out by using certified reference materials. From the analytical results, elemental concentration range in the collected samples according to the food groups was summarized.

  8. Analysis of Cl, Mn, Na, Zn in Food Samples by a Neutron Activation Analysis

    International Nuclear Information System (INIS)

    Moon, Jong Hwa; Kim, Sun Ha; Chung, Yong Sam; Lee, Ok Hee

    2008-01-01

    Due to their westernized dietary habit, Korean children are still threatened by the increasing risks of chronic disease such as obesity, hypertension, low immunity, etc. In addition, they are often exposed to a deficiency of Ca, Mg, Fe and micro-minerals which are necessary for their growth, immunity, and prevention of anemia. Nonetheless, the nutritional adequacy of mineral intakes for children is difficult to assess because of a lack of related studies and a nutritional database with respect to Korean children's foods. In this study, ninety kinds of foods consisting of lunch meals from an elementary and a middle school and children's favorite snacks were collected and prepared for an analysis. INAA which has an advantage of a non-destructive technique was employed to determine the elements like Cl, Mn, Na, Cl in the pretreated food samples. Quality control was carried out by using certified reference materials. From the analytical results, elemental concentration range in the collected samples according to the food groups was summarized

  9. RAW MILK AT VENDING MACHINES: EVALUATION OF E. SAKAZAKII, COXIELLA BURNETII AND M. PARATUBERCULOSIS IN PIEDMONT EXPERIENCE

    Directory of Open Access Journals (Sweden)

    S. Gallina

    2009-12-01

    Full Text Available Italian consumers changed their food habits in the last period; the increase of raw milk consuming is also related to the high number of self service vending machines that have been authorized, particularly in Northern Italy. According to national rules on raw milk hygienic conditions, the most important bacteria are checked by Veterinary Services; the aim of this study was to investigate some emerging or re-emerging hazards in raw milk at vending machines. For this reason 100 raw milk samples were collected and analyzed in order to detect E. sakazakii, Coxiella burnetii and M. avium subsp paratuberculosis. One milk sample resulted to be positive with PCR method for E. sakazakii (no cultural confirmation was possible; 49% of samples resulted posivite for the presence of Coxiella burnetii specific DNA, and 5% of milk samples came out positive to the presence of M. paratuberuclosis antibodies with ELISA methods.

  10. ARCTOX: a pan-Arctic sampling network to track mercury contamination across Arctic marine food webs

    DEFF Research Database (Denmark)

    Fort, Jerome; Helgason, Halfdan; Amelineau, Francoise

    and is still a source of major environmental concerns. In that context, providing a large-scale and comprehensive understanding of the Arctic marine food-web contamination is essential to better apprehend impacts of anthropogenic activities and climate change on the exposure of Arctic species and humans to Hg....... In 2015, an international sampling network (ARCTOX) has been established, allowing the collection seabird samples all around the Arctic. Seabirds are indeed good indicators of Hg contamination of marine food webs at large spatial scale. Gathering researchers from 10 countries, ARCTOX allowed......Arctic marine ecosystems are threatened by new risks of Hg contamination under the combined effects of climate change and human activities. Rapid change of the cryosphere might for instance release large amounts of Hg trapped in sea-ice, permafrost and terrestrial glaciers over the last decades...

  11. Raw milk consumption and health

    Directory of Open Access Journals (Sweden)

    Popović-Vranješ Anka

    2015-01-01

    Full Text Available Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39% outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%, bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79% outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market. [Projekat Ministarstva nauke Republike Srbije, br. TR31095

  12. Teff (Eragrostis tef) as a raw material for malting, brewing and manufacturing of gluten-free foods and beverages: a review.

    Science.gov (United States)

    Gebremariam, Mekonnen Melaku; Zarnkow, Martin; Becker, Thomas

    2014-11-01

    The demand for gluten-free foods is certainly increasing. Interest in teff has increased noticeably due to its very attractive nutritional profile and gluten-free nature of the grain, making it a suitable substitute for wheat and other cereals in their food applications as well as foods for people with celiac disease. The main objective of this article is to review researches on teff, evaluate its suitability for different food applications, and give direction for further research on its applications for health food market. Teff is a tropical low risk cereal that grows in a wider ecology and can tolerate harsh environmental conditions where most other cereals are less viable. It has an excellent balance of amino acid composition (including all 8 essential amino acids for humans) making it an excellent material for malting and brewing. Because of its small size, teff is made into whole-grain flour (bran and germ included), resulting in a very high fiber content and high nutrient content in general. Teff is useful to improve the haemoglobin level in human body and helps to prevent malaria, incidence of anaemia and diabetes. The nutrient composition of teff grain indicates that it has a good potential to be used in foods and beverages worldwide. The high levels of simple sugars and α-amino acids as a result of breakdown of starch and protein, respectively, are essential for fermentation and beer making.

  13. A Comparative Study Between the Antibacterial Effect of Nisin and Nisin-Loaded Chitosan/Alginate Nanoparticles on the Growth of Staphylococcus aureus in Raw and Pasteurized Milk Samples.

    Science.gov (United States)

    Zohri, Maryam; Alavidjeh, Mohammad Shafiee; Haririan, Ismaeil; Ardestani, Mehdi Shafiee; Ebrahimi, Seyed Esmaeil Sadat; Sani, Hadi Tarighati; Sadjadi, Seyed Kazem

    2010-12-01

    The aim of this study was to evaluate the antibacterial effect of nisin-loaded chitosan/alginate nanoparticles as a novel antibacterial delivery vehicle. The nisin-loaded nanoparticles were prepared using colloidal dispersion of the chitosan/alginate polymers in the presence of nisin. After the preparation of the nisin-loaded nanoparticles, their physicochemical properties such as size, shape, and zeta potential of the formulations were studied using scanning electron microscope and nanosizer instruments, consecutively. FTIR and differential scanning calorimetery studies were performed to investigate polymer-polymer or polymer-protein interactions. Next, the release kinetics and entrapment efficiency of the nisin-loaded nanoparticles were examined to assess the application potential of these formulations as a candidate vector. For measuring the antibacterial activity of the nisin-loaded nanoparticles, agar diffusion and MIC methods were employed. The samples under investigation for total microbial counts were pasteurized and raw milks each of which contained the nisin-loaded nanoparticles and inoculated Staphylococcus aureus (ATCC 19117 at 10(6) CFU/mL), pasteurized and raw milks each included free nisin and S. aureus (10(6) CFU/mL), and pasteurized and raw milks each had S. aureus (10(6) CFU/mL) in as control. Total counts of S. aureus were measured after 24 and 48 h for the pasteurized milk samples and after the time intervals of 0, 6, 10, 14, 18, and 24 h for the raw milk samples, respectively. According to the results, entrapment efficiency of nisin inside of the nanoparticles was about 90-95%. The average size of the nanoparticles was 205 nm, and the average zeta potential of them was -47 mV. In agar diffusion assay, an antibacterial activity (inhibition zone diameter, at 450 IU/mL) about 2 times higher than that of free nisin was observed for the nisin-loaded nanoparticles. MIC of the nisin-loaded nanoparticles (0.5 mg/mL) was about four times less than

  14. Quality and Sensorial Characteristics of Raw-Vegan Bars

    OpenAIRE

    Liana Claudia Salanţă; Maria Tofană; Sonia Socaci; Cristina Barta; Carmen Pop

    2015-01-01

    Increased consumer interest in healthier food products is driven by a variety of factors including growing awareness of the link between diet and health, the desire to age ‘gracefully’ by maintaining good health, greater convenience in meeting nutritional needs and preventing chronic diseases. In raw food diet, food is consumed predominantly or exclusively as uncooked and unprocessed raw food; the main components of the diet are fruits, nuts, seeds, and sprouted grains and beans. The aim of t...

  15. Detection of triglycerides using immobilized enzymes in food and biological samples

    Science.gov (United States)

    Raichur, Ashish; Lesi, Abiodun; Pedersen, Henrik

    1996-04-01

    A scheme for the determination of total triglyceride (fat) content in biomedical and food samples is being developed. The primary emphasis is to minimize the reagents used, simplify sample preparation and develop a robust system that would facilitate on-line monitoring. The new detection scheme developed thus far involves extracting triglycerides into an organic solvent (cyclohexane) and performing partial least squares (PLS) analysis on the NIR (1100 - 2500 nm) absorbance spectra of the solution. A training set using 132 spectra of known triglyceride mixtures was complied. Eight PLS calibrations were generated and were used to predict the total fat extracted from commercial samples such as mayonnaise, butter, corn oil and coconut oil. The results typically gave a correlation coefficient (r) of 0.99 or better. Predictions were typically within 90% and better at higher concentrations. Experiments were also performed using an immobilized lipase reactor to hydrolyze the fat extracted into the organic solvent. Performing PLS analysis on the difference spectra of the substrate and product could enhance specificity. This is being verified experimentally. Further work with biomedical samples is to be performed. This scheme may be developed into a feasible detection method for triglycerides in the biomedical and food industries.

  16. Study of Cs/sup 137/ contamination in soil and food samples of Jhangar valley, Pakistan

    International Nuclear Information System (INIS)

    Chaudhry, Z.S.; Khan, H.M.; Aslam, M.; Iqbal, S.; Orfi, S.D.

    2001-01-01

    Chernobyl accident has been the main source of artificial radioactive contamination throughout the world and its effects have been found in Pakistan as well. In the present study, activities of an important anthropogenic radionuclide, Cs/sup 137/ in soil and food samples of Jhangar Valley of Pakistan have been determined using PC based gamma spectrometer. Soil-375 from IAEA was used as reference material. The soil samples were collected from the agricultural fields of the selected area while food samples, grown in the selected area, were collected from the fields or from local market. After proper treatment, the samples were analyzed using a high purity germanium (HPGe) detector. The following values for average specific activity of Cs/sup 137/ were found: soil (range 1.3-46.8 Bq/kg) (12.0 Bq/kg), wheat (0.9 +- 0.05 Bq/kg), millet (1.5 +- 0.06 Bq/kg), lentils (2.0 +- 0.1 Bq/kg), potato (0.6 +- 0.03 Bq/kg) and cauliflower (0.6 +- 0.03 Bq/kg). The results have been discussed and compared with other data available in the literature. (author)

  17. Financial management skills are associated with food insecurity in a sample of households with children in the United States.

    Science.gov (United States)

    Gundersen, Craig G; Garasky, Steven B

    2012-10-01

    Food insecurity is one of the leading public health challenges facing children in the United States today. Reducing food insecurity and its attendant consequences requires an understanding of the determinants of food insecurity. Although previous work has greatly advanced our understanding of these determinants, the role of one of the oft-speculated important determinants of food insecurity, household financial management skills, has not been considered. To address this research lacuna, we use a recently conducted survey, the Survey of Household Finances and Childhood Obesity, that has information on specific financial management practices, impressions of financial management skills, and households' food insecurity. The sample included 904 households with children. Within this sample, 19.3% were food insecure and, for our central financial management skill variable, the mean value was 3.55 on a 5-point scale. Probit regression models estimated the probability of a household being food insecure as conditional on financial management skills and other covariates. We found a large and significant inverse relationship between a respondent's use of specific financial management practices and food insecurity and between a respondent's confidence in his or her financial management skills and food insecurity. That is, households with greater financial management abilities are less likely to be food insecure. This finding also holds when the sample is restricted to households with incomes <200% of the poverty line. These results suggest that improving households' financial management skills has the potential to reduce food insecurity in the United States.

  18. Safety Evaluation of Oil Samples Collected from Different Food Points of Multan City of Pakistan

    Directory of Open Access Journals (Sweden)

    Saeed Akhtar

    2018-05-01

    Full Text Available Cooking oil has become a part and parcel of modern food system and therefore its safety is of prime significance for health agencies around the globe to ensure good health among the community. Current study was designed to investigate the physicochemical properties including free fatty acids, peroxide value and conjugated dienes; minerals (nickel & cobalt and heavy metals (lead and cadmium in oil samples collected from different areas of Multan city of Pakistan. The findings of this study revealed that free fatty acid percentages, conjugated dienes, cobalt and nickel concentrations were in normal ranges while the peroxide values, lead and cadmium concentrations were recorded above the norms. Strict regulatory measures need to be adopted to ensure good quality oil supply and to protect the people from health implications of physicochemical and metallic hazards prevailing in fried oils and fried foods.

  19. Healthy food choices are happy food choices: Evidence from a real life sample using smartphone based assessments.

    Science.gov (United States)

    Wahl, Deborah R; Villinger, Karoline; König, Laura M; Ziesemer, Katrin; Schupp, Harald T; Renner, Britta

    2017-12-06

    Research suggests that "healthy" food choices such as eating fruits and vegetables have not only physical but also mental health benefits and might be a long-term investment in future well-being. This view contrasts with the belief that high-caloric foods taste better, make us happy, and alleviate a negative mood. To provide a more comprehensive assessment of food choice and well-being, we investigated in-the-moment eating happiness by assessing complete, real life dietary behaviour across eight days using smartphone-based ecological momentary assessment. Three main findings emerged: First, of 14 different main food categories, vegetables consumption contributed the largest share to eating happiness measured across eight days. Second, sweets on average provided comparable induced eating happiness to "healthy" food choices such as fruits or vegetables. Third, dinner elicited comparable eating happiness to snacking. These findings are discussed within the "food as health" and "food as well-being" perspectives on eating behaviour.

  20. Electromembrane extraction of tartrazine from food samples: Effects of nano-sorbents on membrane performance.

    Science.gov (United States)

    Yaripour, Saeid; Mohammadi, Ali; Nojavan, Saeed

    2016-07-01

    In the present study, for the first time electromembrane extraction followed by high-performance liquid chromatography coupled with ultraviolet detection was developed and validated for the determination of tartrazine in some food samples. The parameters influencing electromembrane extraction were evaluated and optimized. The membrane consists of 1-octanol immobilized in the pores of a hollow fiber. As a driving force, a 30 V electrical field was applied to make the analyte migrate from sample solution with pH 3, through the supported liquid membrane into an acceptor solution with pH 10. Best preconcentration (enrichment factor >21) was obtained in extraction duration of 15 min. Effects of some solid nano-sorbents like carbon nanotubes and molecularly imprinted polymers on membrane performance and electromembrane extraction efficiency were evaluated. The method provided the linearity in the range 25-1000 ng/mL for tartrazine (R(2) > 0.9996) with repeatability range (RSD) between 3.8 and 8.5% (n = 3). The limits of detection and quantitation were 7.5 and 25 ng/mL, respectively. Finally, the method was applied to the determination and quantification of tartrazine from some food samples with relative recoveries in the range between 90 and 98%. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Low-parachor solvents extraction and thermostated micro-thin-layer chromatography separation for fast screening and classification of spirulina from pharmaceutical formulations and food samples.

    Science.gov (United States)

    Zarzycki, Paweł K; Zarzycka, Magdalena B; Clifton, Vicki L; Adamski, Jerzy; Głód, Bronisław K

    2011-08-19

    The goal of this paper is to demonstrate the separation and detection capability of eco-friendly micro-TLC technique for the classification of spirulina and selected herbs from pharmaceutical and food products. Target compounds were extracted using relatively low-parachor liquids. A number of the spirulina samples which originated from pharmaceutical formulations and food products, were isolated using a simple one step extraction with small volume of methanol, acetone or tetrahydrofuran. Herb samples rich in chlorophyll dyes were analyzed as reference materials. Quantitative data derived from micro-plates under visible light conditions and after iodine staining were explored using chemometrics tools including cluster analysis and principal components analysis. Using this method we could easily distinguish genuine spirulina and non-spirulina samples as well as fresh from expired commercial products and furthermore, we could identify some biodegradation peaks appearing on micro-TLC profiles. This methodology can be applied as a fast screening or fingerprinting tool for the classification of genuine spirulina and herb samples and in particular may be used commercially for the rapid quality control screening of products. Furthermore, this approach allows low-cost fractionation of target substances including cyanobacteria pigments in raw biological or environmental samples for preliminary chemotaxonomic investigations. Due to the low consumption of the mobile phase (usually less than 1 mL per run), this method can be considered as environmentally friendly analytical tool, which may be an alternative for fingerprinting protocols based on HPLC machines and simple separation systems involving planar micro-fluidic or micro-chip devices. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Quantitative analysis of food and feed samples with droplet digital PCR.

    Directory of Open Access Journals (Sweden)

    Dany Morisset

    Full Text Available In this study, the applicability of droplet digital PCR (ddPCR for routine analysis in food and feed samples was demonstrated with the quantification of genetically modified organisms (GMOs. Real-time quantitative polymerase chain reaction (qPCR is currently used for quantitative molecular analysis of the presence of GMOs in products. However, its use is limited for detecting and quantifying very small numbers of DNA targets, as in some complex food and feed matrices. Using ddPCR duplex assay, we have measured the absolute numbers of MON810 transgene and hmg maize reference gene copies in DNA samples. Key performance parameters of the assay were determined. The ddPCR system is shown to offer precise absolute and relative quantification of targets, without the need for calibration curves. The sensitivity (five target DNA copies of the ddPCR assay compares well with those of individual qPCR assays and of the chamber digital PCR (cdPCR approach. It offers a dynamic range over four orders of magnitude, greater than that of cdPCR. Moreover, when compared to qPCR, the ddPCR assay showed better repeatability at low target concentrations and a greater tolerance to inhibitors. Finally, ddPCR throughput and cost are advantageous relative to those of qPCR for routine GMO quantification. It is thus concluded that ddPCR technology can be applied for routine quantification of GMOs, or any other domain where quantitative analysis of food and feed samples is needed.

  3. Evaluation of growth performance, serum biochemistry and haematological parameters on broiler birds fed with raw and processed samples of Entada scandens, Canavalia gladiata and Canavalia ensiformis seed meal as an alternative protein source.

    Science.gov (United States)

    Sasipriya, Gopalakrishnan; Siddhuraju, Perumal

    2013-03-01

    The experiment was carried out to investigate the inclusion of underutilised legumes, Entada scandens, Canavalia gladiata and Canavalia ensiformis, seed meal in soybean-based diet in broilers. The utilisation of these wild legumes is limited by the presence of antinutrient compounds. Processing methods like soaking followed by autoclaving in sodium bicarbonate solution in E. scandens and C. gladiata and soaking followed by autoclaving in ash solution in C. ensiformis were adopted. The proximate composition of raw and processed samples of E. scandens, C. gladiata and C. ensiformis were determined. The protein content was enhanced in processed sample of E. scandens (46 %) and C. ensiformis (16 %). This processing method had reduced the maximum number of antinutrients such as tannins (10-100 %), trypsin inhibitor activity (99 %), chymotrypsin inhibitor activity (72-100 %), canavanine (60-62 %), amylase inhibitor activity (73-100 %), saponins (78-92 %), phytic acid (19-40 %) and lectins. Hence, the raw samples at 15 % and processed samples at 15 and 30 % were replaced with soybean protein in commercial broiler diet respectively. Birds fed with 30 % processed samples of E. scandens, C. gladiata and C. ensiformis showed significantly similar results of growth performance, carcass characteristics, organ weight, haematological parameters and serum biochemical parameters (cholesterol, protein, bilirubin, albumin, globulin and liver and kidney function parameters) without any adverse effects after 42 days of supplementation. The proper utilisation of these underutilised legumes may act as an alternative protein ingredient in poultry diets.

  4. Analysis of polonium-210 in food products and bioassay samples by isotope-dilution alpha spectrometry

    International Nuclear Information System (INIS)

    Lin Zhichao; Wu Zhongyu

    2009-01-01

    A rapid and reliable radiochemical method coupled with a simple and compact plating apparatus was developed, validated, and applied for the analysis of 210 Po in variety of food products and bioassay samples. The method performance characteristics, including accuracy, precision, robustness, and specificity, were evaluated along with a detailed measurement uncertainty analysis. With high Po recovery, improved energy resolution, and effective removal of interfering elements by chromatographic extraction, the overall method accuracy was determined to be better than 5% with measurement precision of 10%, at 95% confidence level.

  5. Analysis of polonium-210 in food products and bioassay samples by isotope-dilution alpha spectrometry.

    Science.gov (United States)

    Lin, Zhichao; Wu, Zhongyu

    2009-05-01

    A rapid and reliable radiochemical method coupled with a simple and compact plating apparatus was developed, validated, and applied for the analysis of (210)Po in variety of food products and bioassay samples. The method performance characteristics, including accuracy, precision, robustness, and specificity, were evaluated along with a detailed measurement uncertainty analysis. With high Po recovery, improved energy resolution, and effective removal of interfering elements by chromatographic extraction, the overall method accuracy was determined to be better than 5% with measurement precision of 10%, at 95% confidence level.

  6. Diversity and killer activity of yeasts in Malaysian fermented food samples.

    Science.gov (United States)

    Lim, S L; Tay, S T

    2011-08-01

    The biodiversity and the killer activity of yeasts isolated from various types of fermented food in Malaysia were investigated in this study. Of 252 yeasts isolated from 48 fermented food samples in this study, 19 yeast species were identified based on sequence analysis of the ITS1-5.8S-ITS2 partial fragments of the yeasts. A total of 29 (11.5%) of the yeast isolates demonstrated killer activity to at least one Candida species tested in this study; including 22 isolates of Trichosporon asahii, 4 isolates of Pichia anomala, and one isolate each of Pichia norvegensis, Pichia fermentans and Issatchenkia orientalis, respectively. The presence of killer yeasts reflects antagonism that occurs during microbial interaction in the fermented food, whereby certain yeasts produce killer toxins and possibly other toxic substances in competition for limited nutrients and space. The anti-Candida activity demonstrated by killer yeasts in this study should be further explored for development of alternative therapy against candidiasis.

  7. Green Synthesis of Fluorescent Carbon Dots for Selective Detection of Tartrazine in Food Samples.

    Science.gov (United States)

    Xu, Hua; Yang, Xiupei; Li, Gu; Zhao, Chuan; Liao, Xiangjun

    2015-08-05

    A simple, economical, and green method for the preparation of water-soluble, high-fluorescent carbon quantum dots (C-dots) has been developed via hydrothermal process using aloe as a carbon source. The synthesized C-dots were characterized by atomic force microscope (AFM), transmission electron microscopy (TEM), fluorescence spectrophotometer, UV-vis absorption spectra as well as Fourier transform infrared spectroscopy (FTIR). The results reveal that the as-prepared C-dots were spherical shape with an average diameter of 5 nm and emit bright yellow photoluminescence (PL) with a quantum yield of approximately 10.37%. The surface of the C-dots was rich in hydroxyl groups and presented various merits including high fluorescent quantum yield, excellent photostability, low toxicity and satisfactory solubility. Additionally, we found that one of the widely used synthetic food colorants, tartrazine, could result in a strong fluorescence quenching of the C-dots through a static quenching process. The decrease of fluorescence intensity made it possible to determine tartrazine in the linear range extending from 0.25 to 32.50 μM, This observation was further successfully applied for the determination of tartrazine in food samples collected from local markets, suggesting its great potential toward food routine analysis. Results from our study may shed light on the production of fluorescent and biocompatible nanocarbons due to our simple and environmental benign strategy to synthesize C-dots in which aloe was used as a carbon source.

  8. Cheese whey. Waste or raw material useful for foods, cosmetics and pharmaceuticals specialities?; Il siero di latte. Rifiuto o materia prima per prodotti alimentari, cosmetici e farmaceutici?

    Energy Technology Data Exchange (ETDEWEB)

    Pizzichini, M. [ENEA, Divisione Biotecnologie e Agricoltura, Centro Ricerche Casaccia, S. Maria di Galeria, Rome (Italy); Montani, R.; Russo, C. [Inteam Srl, Genoa (Italy)

    2001-07-01

    In Italy the waste whey (7 million tons/year), coming from cheese farms (2,500) is mainly employed as pigs fodder, or discharged in illegal manner into rivers or soils. It is well known that whey represents a serious environmental problem in relation with its high pollution charge (COD=70,000 O{sub 2} ppm). On the other hand, the whey's organic components as proteins, lactose, vitamins and salts, show an high commercial interest because they are used as food additives in souses, pasta, biscuits, chocolate, beverage, baby foods, etc., in cosmetics, as creams and shampoos, and also in pharmaceutical field, especially as food integrators for body builders. The application of membrane technology, as ultrafiltration (UF), nanofiltration (NF) and reverse osmosis (RO) permitted the recovery of the whey solute (proteins, lactose, mineral salts) and solvent as purified water. In this paper an industrial treatment process of 60 m{sup 3}/day, and the procedure for upgrading the biochemical properties of whey proteins, and consequently its commercial values, are discussed. It is also reported an economic process evaluation, obtained on the base of product recovery and process costs. [Italian] In Italia si producono circa 7 milioni di ton/anno di siero grezzo dagli oltre 2.500 caseifici sparsi sul territorio nazionale. Mentre al Nord il siero grezzo e' impiegato per l'alimentazione dei suini, al Centro-Sud viene smaltito illegalmente nei fiumi e sul terreno. Il siero di latte costituisce un problema importante del settore lattiero caseario poiche' ha una carica inquinante molto alta (COD 70.000 ppm di O{sub 2}). Il siero puo' rappresentare una fonte di sostanze nobili come proteine ad alto valore biologico, lattosio, vitamine sali minerali che trovano largo impiego nell'industria alimentare (salse, pasta, biscotti, cioccolato, bevande, baby foods, ecc., nell'industria cosmetica come creme idratanti o detergenti e nell

  9. The hygienic quality of raw reindeer milk

    Directory of Open Access Journals (Sweden)

    Joanna Kurki

    2004-04-01

    Full Text Available The somatic cell count (SCC and total bacterial count (TBC as well as the presence of major food-borne pathogens and udder pathogens in reindeer raw milk were studied. Two groups of 4 female reindeer were milked on alternate days for six weeks. A milk sample from each quarter was taken before milking and of the bulk milk at the end of milking. Micrococcus sp. was observed in one, Staphylococcus aureus in one and coagulase-negative staphylococci in five of the quarter samples (n=318. In the bulk milk (n=19 TBC varied between 700 and 1 700 000 cfu (colony forming units/ml and SCC between 52 000 and 183 000 cells/ml. No Bacillus cereus, S. aureus or Listeria monocytogenes were detected in the bulk milk, but Escherichia coli and Enterobacteriaceae were found in 5 bulk milk samples. According to the bacteriological examination the udder health of the reindeer was good. Indicative information on the SCC of healthy reindeer was obtained. None of the common potential food-poisoning bacteria were found in raw milk. There was great variation in the bulk milk TBC and the average TBC was rather high (ca. 300 000 cfu/ml. The hygienic quality of raw reindeer milk makes it well suited for food manufacture. However, the results indicate that the milking conditions may be crucial for the quality of raw milk.Abstract in Finnish / Yhteenveto:Tutkimuksen kohteena oli poron raakamaidon solupitoisuus ja kokonaispesäkeluku sekä tärkeimpien elintarvike- ja utarepatogeenien esiintyminen raakamaidossa. Kaksi 4 vaatimen ryhmää lypsettiin vuoropäivinä 6 viikon ajan. Ennen lypsyä vaatimista otettiin vedinkohtaiset näytteet ja lypsyn päätyttyä näyte yhteismaidosta. Micrococcus sp. todettiin yhdessä, Staphylococcus aureus yhdessä ja koagulaasinegatiivisia stafylokokkeja viidessä vedinkohtaisessa näytteessä (n=318. Yhteismaitonäytteiden (n=19 kokonaispesäkeluvut vaihtelivat välillä 700-1 700 000 pmy (pesäkkeitä muodostava yksikkö/ml ja somaattisten

  10. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  11. Colorimetric DNAzyme Biosensor for Convenience Detection of Enterotoxin B Harboring Staphylococcus aureus from Food Samples.

    Science.gov (United States)

    Mondal, Bhairab; N, Bhavanashri; Ramlal, Shylaja; Kingston, Joseph

    2018-02-14

    In the present study, a colorimetric DNAzymes biosensor strategy was devised in combination with immunomagnetic separation for rapid and easy detection of enterotoxin B harboring Staphylococcus aureus from food and clinical samples. The method employs immunocapture of S. aureus and amplification of seb gene by DNAzyme complementary sequence integrated forward primer and with specific reverse primer. The DNAzyme sequence integrated dsDNA PCR products when treated with hemin and TMB (3,3',5,5'-tetramethylbenzidine) in the presence of H 2 O 2 produce colorimetric signal. A linear relationship of optical signal with the initial template of seb was obtained which could be monitored by visually or spectrophotrometrically for qualitative and quantitative detection. The limit of detection for the assay was approximately 10 2 CFU/mL of seb gene harboring target. This method is convenient compared to gel based and ELISA systems. Further, spiking studies and analysis on natural samples emphasized the robustness and applicability of developed method. Altogether, the established assay could be a reliable alternative, low-cost, viable detection tool for the routine investigation of seb from food and clinical sources.

  12. Simultaneous determination of caffeine, theophylline and theobromine in food samples by a kinetic spectrophotometric method.

    Science.gov (United States)

    Xia, Zhenzhen; Ni, Yongnian; Kokot, Serge

    2013-12-15

    A novel kinetic spectrophotometric method was developed for the simultaneous determination of caffeine, theobromine and theophylline in food samples. This method was based on the different kinetic characteristics between the reactions of analytes with cerium sulphate in sulphuric acid and the associated change in absorbance at 320 nm. Experimental conditions, the effects of sulphuric acid, cerium sulphate and temperature, were optimised. Linear ranges (0.4-8.4 μg mL(-1)) for all three analytes were established, and the limits of detection were: 0.30 μg mL(-1) (caffeine), 0.33 μg mL(-1) (theobromine) and 0.16 μg mL(-1) (theophylline). The recorded data were processed by partial least squares and artificial neural network, and the developed mathematical models were then used for prediction. The proposed, novel method was applied to determine the analytes in commercial food samples, and there were no significant differences between the results from the proposed method and those obtained by high-performance liquid chromatography. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Molecular Characterization of Shiga Toxin-Producing Escherichia coli Isolated from Ruminant and Donkey Raw Milk Samples and Traditional Dairy Products in Iran

    Directory of Open Access Journals (Sweden)

    Hassan Momtaz

    2012-01-01

    Full Text Available The aims of the current study were to detect the virulence factors and antibiotic resistance of Shiga toxin-producing E. coli, in animal milk and dairy products in Iran. After E. coli dentification with culture method, PCR assay were developed for detection of pathogenic genes, serotypes and antibiotic resistance genes of E. coli. Results showed that out of 719 samples, 102 (14.18% were confirmed to be positive for E. coli and out of 102 positive samples, 17.64% were O26 and 13.72% were O157 and 1.96% were O91 and 1.96% were O145 serotypes. Totally, the prevalence of stx1 and papA genes were the highest while the prevalence of sfaS and fyuA were the lowest in the positive samples. PCR results showed that tetA, tetB were the highest (64.70% and aac(3-IV were the lowest (27.45% antibiotic resistant genes in E. coli positive samples. Our study indicated that the isolated E. coli trains in these regions had a highest antibiotic resistance to tetracycline (58.82% and the lowest to nitrofurantoin (3.92%. tetA gene and E. coli O157 serotype had highest and aac(3-IV gene, and E. coli O145 serotype had a lowest frequency rates of antibiotics resistance genes, in the region.

  14. [Analysis on contamination of zearalenone and dietary exposure assessment in food samples of Shaanxi Province in 2013-2016].

    Science.gov (United States)

    Hu, Jiawei; Wang, Caixia; Tian, Li; Wang, Minjuan; Guo, Rong; Qiao, Haiou

    2017-07-01

    To investigate the contamination of zearalenone in food in Shaanxi Province, and to assess the dietary zearalenone exposure and the health risk of intaking zearalenone from corn products for Shaanxi residents. In 2013-2016, samples of five kinds of food including grains, vegetable oil, liquor and infants' food were collected randomly from ten cities, and determined with ultra-performance liquid chromatography. Dietary intake assessment of human exposure to zearalenone was carried out in combination of food consumption data with concentration of zearalenone. 1193 samples were detected zearalenone and the total detection rate was 17. 27%, with the mean value of 13. 5 μg/kg. Among all food samples, oil products were more seriously polluted than other kinds of foods, its detection rate was 79. 37%. And 12 samples of grain products exceed the standard, the exceeding standard rate was 1. 64%, which were all corn products. The level of zearalenone detected in wheat flour, rice, millet, beer and bakery products was low. The overall level of zearalenone contamination inmarket food is common, but corn products may be the severely contaminated foods with zearalenone in Shaanxi Province. The risk assessmentresult suggests that the current dietary intake of zearalenone from corn products in Shaanxi Province has no appreciable effect on health, however, the concentrations of zearalenone in corn products are relatively high, and need to be monitored in the future.

  15. Enteric Viruses in Raw Vegetables and Groundwater Used for Irrigation in South Korea▿

    Science.gov (United States)

    Cheong, Sooryun; Lee, Cheonghoon; Song, Sung Won; Choi, Weon Cheon; Lee, Chan Hee; Kim, Sang-Jong

    2009-01-01

    Raw vegetables irrigated with groundwater that may contain enteric viruses can be associated with food-borne viral disease outbreaks. In this study, we performed reverse transcription-PCR (RT-PCR) and cell culture-PCR to monitor the occurrence of enteric viruses in groundwater samples and in raw vegetables that were cultivated using that groundwater in South Korea. Samples were collected 10 times from three farms located in Gyeonggi Province, South Korea. RT-PCR and cell culture-PCR were performed to detect adenoviruses (AdVs), enteroviruses (EVs), noroviruses (NoVs), and rotaviruses, followed by sequence analyses of the detected strains. Of the 29 groundwater samples and the 30 vegetable samples, five (17%) and three (10%) were positive for enteric viruses, respectively. AdVs were the most frequently detected viruses in four groundwater and three vegetable samples. EVs and NoVs were detected in only one groundwater sample and one spinach sample, respectively. The occurrence of enteric viruses in groundwater and vegetable samples was not correlated with the water temperature and the levels of indicator bacteria, respectively. Phylogenetic analysis indicated that most of the detected AdVs were temporally distributed, irrespective of sample type. Our results indicate that raw vegetables may be contaminated with a broad range of enteric viruses, which may originate from virus-infected farmers and virus-contaminated irrigation water, and these vegetables may act as a potential vector of food-borne viral transmission. PMID:19854919

  16. CONCENTRATION OF SELECTED ELEMENTS IN RAW AND ULTRA HEAT TREATED COW MILK

    Directory of Open Access Journals (Sweden)

    Lukáčová Anetta

    2012-10-01

    Full Text Available The potential presence of toxic metals in food is being recognized as a priority by standards organizations and constitutes an analytical challenge. The toxic metal content of milk and dairy products is due to several factors: environmental conditions, the manufacturing process and the possible contamination during several steps of the manufacturing processes. The aim of this study was to evaluate samples of raw milk with fat contents 3.8% obtained at randomly from animal farms in around Nitra, western Slovakia region and ultra – heat treated cow milk (UHT with fat contents 1.5% commercially available from local market in Nitra. Samples of milk were analysed for metal contents using atomic absorption spectrophotometry (AAS. UHT milk showed higher levels of cadmium, nickel and iron. Higher levels of zinc, copper were detected in raw milk. Significant differences in the concentration of copper between raw and UHT cow milk were found.

  17. Healthy food choices are happy food choices : evidence from a real life sample using smartphone based assessments

    OpenAIRE

    Wahl, Deborah R.; Villinger, Karoline; König, Laura M.; Ziesemer, Katrin; Schupp, Harald T.; Renner, Britta

    2017-01-01

    Research suggests that "healthy" food choices such as eating fruits and vegetables have not only physical but also mental health benefits and might be a long-term investment in future well-being. This view contrasts with the belief that high-caloric foods taste better, make us happy, and alleviate a negative mood. To provide a more comprehensive assessment of food choice and well-being, we investigated in-the-moment eating happiness by assessing complete, real life dietary behaviour across ei...

  18. Raw material uranium

    International Nuclear Information System (INIS)

    Arnold, O.

    1975-01-01

    In this paper some aspects are being considered, in as far as they can contribute to a better understanding of uranium as a raw material and an energy carrier, and as they can indicate the possible ways and means open to the German Federal Republic for securing this highly desirable raw material, without becoming even more dependent on the economic and political views of the producing countries, than it is the case in respect of oil. (orig.) [de

  19. 19 CFR 151.22 - Estimated duties on raw sugar.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Estimated duties on raw sugar. 151.22 Section 151... THE TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Sugars, Sirups, and Molasses § 151.22 Estimated duties on raw sugar. Estimated duties shall be taken on raw sugar, as defined...

  20. Clinical presentation and outcome of avoidant/restrictive food intake disorder in a Japanese sample.

    Science.gov (United States)

    Nakai, Yoshikatsu; Nin, Kazuko; Noma, Shun'ichi; Hamagaki, Seiji; Takagi, Ryuro; Teramukai, Satoshi; Wonderlich, Stephen A

    2017-01-01

    We conducted a study of the clinical presentation and outcome in patients with avoidant/restrictive food intake disorder (ARFID), aged 15-40years, and compared this group to an anorexia nervosa (AN) group in a Japanese sample. A retrospective chart review was completed on 245 patients with feeding and eating disorders (FEDs), analyzing prevalence, clinical presentation, psychopathological properties, and outcomes. Using the DSM-5 criteria, 27 (11.0%) out of the 245 patients with a FED met the criteria for ARFID at entry. All patients with ARFID were women. In terms of eating disorder symptoms, all patients with ARFID had restrictive eating related to emotional problems and/or gastrointestinal symptoms. However, none of the ARFID patients reported food avoidance related to sensory characteristics or functional dysphagia. Additionally, none of them exhibited binge eating or purging behaviors, and none of them reported excessive exercise. The ARFID group had a significantly shorter duration of illness, lower rates of admission history, and less severe psychopathology than the AN group. The ARFID group reported significantly better outcome results than the AN group. These results suggest that patients with ARFID in this study were clinically distinct from those with AN and somewhat different from pediatric patients with ARFID in previous studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. The major types of added sugars and non-nutritive sweeteners in a sample of Australian packaged foods.

    Science.gov (United States)

    Probst, Yasmine C; Dengate, Alexis; Jacobs, Jenny; Louie, Jimmy Cy; Dunford, Elizabeth K

    2017-12-01

    Limiting the intake of added sugars in the diet remains a key focus of global dietary recommendations. To date there has been no systematic monitoring of the major types of added sugars used in the Australian food supply. The present study aimed to identify the most common added sugars and non-nutritive sweeteners in the Australian packaged food supply. Secondary analysis of data from the Australian FoodSwitch database was undertaken. Forty-six added sugars and eight non-nutritive sweetener types were extracted from the ingredient lists of 5744 foods across seventeen food categories. Australia. Not applicable. Added sugar ingredients were found in 61 % of the sample of foods examined and non-nutritive sweetener ingredients were found in 69 %. Only 31 % of foods contained no added sugar or non-nutritive sweetener. Sugar (as an ingredient), glucose syrup, maple syrup, maltodextrin and glucose/dextrose were the most common sugar ingredient types identified. Most Australian packaged food products had at least one added sugar ingredient, the most common being 'sugar'. The study provides insight into the most common types of added sugars and non-nutritive sweeteners used in the Australian food supply and is a useful baseline to monitor changes in how added sugars are used in Australian packaged foods over time.

  2. Column preconcentration and electrothermal atomic absorption spectrometric determination of rhodium in some food and standard samples.

    Science.gov (United States)

    Taher, Mohammad Ali; Pourmohammad, Fatemeh; Fazelirad, Hamid

    2015-12-01

    In the present work, an electrothermal atomic absorption spectrometric method has been developed for the determination of ultra-trace amounts of rhodium after adsorption of its 2-(5-bromo-2-pyridylazo)-5-diethylaminophenol/tetraphenylborate ion associated complex at the surface of alumina. Several factors affecting the extraction efficiency such as the pH, type of eluent, sample and eluent flow rates, sorption capacity of alumina and sample volume were investigated and optimized. The relative standard deviation for eight measurements of 0.1 ng/mL of rhodium was ±6.3%. In this method, the detection limit was 0.003 ng/mL in the original solution. The sorption capacity of alumina and the linear range for Rh(III) were evaluated as 0.8 mg/g and 0.015-0.45 ng/mL in the original solution, respectively. The proposed method was successfully applied for the extraction and determination of rhodium content in some food and standard samples with high recovery values. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. A nanosilver-based spectrophotometry method for sensitive determination of tartrazine in food samples.

    Science.gov (United States)

    Sahraei, R; Farmany, A; Mortazavi, S S

    2013-06-01

    A new method is reported for sensitive determination of tartrazine in the food samples. The method is based on the catalytic effect of silver nanoparticle (AgNPs) on the oxidation reaction of tartrazine by potassium iodate in the acetate buffer medium. The reaction is followed spectrophotometrically by measuring the change in absorbance (ΔA) at 420 nm using a fixed time method (70 s). The reaction variables were optimised in order to achieve the highest sensitivity. The thirty six criterion detection limit was 0.3 ng/mL, and the relative standard deviation for ten replicate measurements of 30 ng/mL of tartrazine was 0.98% (n=10). The method was successfully applied to the determination of tartrazine in lemon, and papaya-flavoured gelatin, candy, and in fruit syrup. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Evaluation of Two Surface Sampling Methods for Microbiological and Chemical Analyses To Assess the Presence of Biofilms in Food Companies.

    Science.gov (United States)

    Maes, Sharon; Huu, Son Nguyen; Heyndrickx, Marc; Weyenberg, Stephanie van; Steenackers, Hans; Verplaetse, Alex; Vackier, Thijs; Sampers, Imca; Raes, Katleen; Reu, Koen De

    2017-12-01

    Biofilms are an important source of contamination in food companies, yet the composition of biofilms in practice is still mostly unknown. The chemical and microbiological characterization of surface samples taken after cleaning and disinfection is very important to distinguish free-living bacteria from the attached bacteria in biofilms. In this study, sampling methods that are potentially useful for both chemical and microbiological analyses of surface samples were evaluated. In the manufacturing facilities of eight Belgian food companies, surfaces were sampled after cleaning and disinfection using two sampling methods: the scraper-flocked swab method and the sponge stick method. Microbiological and chemical analyses were performed on these samples to evaluate the suitability of the sampling methods for the quantification of extracellular polymeric substance components and microorganisms originating from biofilms in these facilities. The scraper-flocked swab method was most suitable for chemical analyses of the samples because the material in these swabs did not interfere with determination of the chemical components. For microbiological enumerations, the sponge stick method was slightly but not significantly more effective than the scraper-flocked swab method. In all but one of the facilities, at least 20% of the sampled surfaces had more than 10 2 CFU/100 cm 2 . Proteins were found in 20% of the chemically analyzed surface samples, and carbohydrates and uronic acids were found in 15 and 8% of the samples, respectively. When chemical and microbiological results were combined, 17% of the sampled surfaces were contaminated with both microorganisms and at least one of the analyzed chemical components; thus, these surfaces were characterized as carrying biofilm. Overall, microbiological contamination in the food industry is highly variable by food sector and even within a facility at various sampling points and sampling times.

  5. A novel sample preparation method using rapid nonheated saponification method for the determination of cholesterol in emulsified foods.

    Science.gov (United States)

    Jeong, In-Seek; Kwak, Byung-Man; Ahn, Jang-Hyuk; Leem, Donggil; Yoon, Taehyung; Yoon, Changyong; Jeong, Jayoung; Park, Jung-Min; Kim, Jin-Man

    2012-10-01

    In this study, nonheated saponification was employed as a novel, rapid, and easy sample preparation method for the determination of cholesterol in emulsified foods. Cholesterol content was analyzed using gas chromatography with a flame ionization detector (GC-FID). The cholesterol extraction method was optimized for maximum recovery from baby food and infant formula. Under these conditions, the optimum extraction solvent was 10 mL ethyl ether per 1 to 2 g sample, and the saponification solution was 0.2 mL KOH in methanol. The cholesterol content in the products was determined to be within the certified range of certified reference materials (CRMs), NIST SRM 1544 and SRM 1849. The results of the recovery test performed using spiked materials were in the range of 98.24% to 99.45% with an relative standard devitation (RSD) between 0.83% and 1.61%. This method could be used to reduce sample pretreatment time and is expected to provide an accurate determination of cholesterol in emulsified food matrices such as infant formula and baby food. A novel, rapid, and easy sample preparation method using nonheated saponification was developed for cholesterol detection in emulsified foods. Recovery tests of CRMs were satisfactory, and the recoveries of spiked materials were accurate and precise. This method was effective and decreased the time required for analysis by 5-fold compared to the official method. © 2012 Institute of Food Technologists®

  6. Pre-exposure to food temptation reduces subsequent consumption: A test of the procedure with a South-African sample.

    Science.gov (United States)

    Duh, Helen Inseng; Grubliauskiene, Aiste; Dewitte, Siegfried

    2016-01-01

    It has been suggested that the consumption of unhealthy Westernized diet in a context of poverty and resultant food insecurity may have contributed to South-Africa's status of the third fattest country in the World. Considering that a number of South-Africans are reported to have experienced, or are still experiencing food insecurity, procedures which have been shown to reduce the consumption of unhealthy food in higher income countries may be ineffective in South-Africa. We thus tested the robustness of the so called pre-exposure procedure in South-Africa. We also tested the moderating role of childhood poverty in the pre-exposure procedure. With the pre-exposure procedure, a respondent is exposed to a tempting unhealthy food (e.g. candy) in a context that is designed such that eating the food interferes with a task goal. The typical result is that this procedure spills over and reduces consumption of similar tempting food later on. An experimental study conducted in a South-African laboratory showed that the pre-exposure effect is robust even with a sample, where food insecurity prevails. Childhood poverty did not moderate the effect. This study proves that behavioral procedures aimed at reducing the consumption of unhealthy food would be valuable in less rich non-Western countries. Further testing of the robustness of the pre-exposure effect is however recommended in other poorer food insecure countries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. A novel flow injection chemiluminescence method for automated and miniaturized determination of phenols in smoked food samples.

    Science.gov (United States)

    Vakh, Christina; Evdokimova, Ekaterina; Pochivalov, Aleksei; Moskvin, Leonid; Bulatov, Andrey

    2017-12-15

    An easily performed fully automated and miniaturized flow injection chemiluminescence (CL) method for determination of phenols in smoked food samples has been proposed. This method includes the ultrasound assisted solid-liquid extraction coupled with gas-diffusion separation of phenols from smoked food sample and analytes absorption into a NaOH solution in a specially designed gas-diffusion cell. The flow system was designed to focus on automation and miniaturization with minimal sample and reagent consumption by inexpensive instrumentation. The luminol - N-bromosuccinimide system in an alkaline medium was used for the CL determination of phenols. The limit of detection of the proposed procedure was 3·10 -8 ·molL -1 (0.01mgkg -1 ) in terms of phenol. The presented method demonstrated to be a good tool for easy, rapid and cost-effective point-of-need screening phenols in smoked food samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Inactivation of Geobacillus stearothermophilus in canned food and coconut milk samples by addition of enterocin AS-48.

    Science.gov (United States)

    Viedma, Pilar Martínez; Abriouel, Hikmate; Ben Omar, Nabil; López, Rosario Lucas; Valdivia, Eva; Gálvez, Antonio

    2009-05-01

    The cyclic bacteriocin enterocin AS-48 was tested on a cocktail of two Geobacillus stearothermophilus strains in canned food samples (corn and peas), and in coconut milk. AS-48 (7 microg/g) reduced viable cell counts below detection levels in samples from canned corn and peas stored at 45 degrees C for 30 days. In coconut milk, bacterial inactivation by AS-48 (1.75 microg/ml) was even faster. In all canned food and drink samples inoculated with intact G. stearothermophilus endospores, bacteriocin addition (1.75 microg per g or ml of food sample) rapidly reduced viable cell counts below detection levels and avoided regrowth during storage. After a short-time bacteriocin treatment of endospores, trypsin addition markedly increased G. stearothermophilus survival, supporting the effect of residual bacteriocin on the observed loss of viability for endospores. Results from this study support the potential of enterocin AS-48 as a biopreservative against G. stearothermophilus.

  9. Analytical Parameters of an Amperometric Glucose Biosensor for Fast Analysis in Food Samples

    Directory of Open Access Journals (Sweden)

    Margalida Artigues

    2017-11-01

    Full Text Available Amperometric biosensors based on the use of glucose oxidase (GOx are able to combine the robustness of electrochemical techniques with the specificity of biological recognition processes. However, very little information can be found in literature about the fundamental analytical parameters of these sensors. In this work, the analytical behavior of an amperometric biosensor based on the immobilization of GOx using a hydrogel (Chitosan onto highly ordered titanium dioxide nanotube arrays (TiO2NTAs has been evaluated. The GOx–Chitosan/TiO2NTAs biosensor showed a sensitivity of 5.46 μA·mM−1 with a linear range from 0.3 to 1.5 mM; its fundamental analytical parameters were studied using a commercial soft drink. The obtained results proved sufficient repeatability (RSD = 1.9%, reproducibility (RSD = 2.5%, accuracy (95–105% recovery, and robustness (RSD = 3.3%. Furthermore, no significant interferences from fructose, ascorbic acid and citric acid were obtained. In addition, the storage stability was further examined, after 30 days, the GOx–Chitosan/TiO2NTAs biosensor retained 85% of its initial current response. Finally, the glucose content of different food samples was measured using the biosensor and compared with the respective HPLC value. In the worst scenario, a deviation smaller than 10% was obtained among the 20 samples evaluated.

  10. Analytical Parameters of an Amperometric Glucose Biosensor for Fast Analysis in Food Samples

    Science.gov (United States)

    2017-01-01

    Amperometric biosensors based on the use of glucose oxidase (GOx) are able to combine the robustness of electrochemical techniques with the specificity of biological recognition processes. However, very little information can be found in literature about the fundamental analytical parameters of these sensors. In this work, the analytical behavior of an amperometric biosensor based on the immobilization of GOx using a hydrogel (Chitosan) onto highly ordered titanium dioxide nanotube arrays (TiO2NTAs) has been evaluated. The GOx–Chitosan/TiO2NTAs biosensor showed a sensitivity of 5.46 μA·mM−1 with a linear range from 0.3 to 1.5 mM; its fundamental analytical parameters were studied using a commercial soft drink. The obtained results proved sufficient repeatability (RSD = 1.9%), reproducibility (RSD = 2.5%), accuracy (95–105% recovery), and robustness (RSD = 3.3%). Furthermore, no significant interferences from fructose, ascorbic acid and citric acid were obtained. In addition, the storage stability was further examined, after 30 days, the GOx–Chitosan/TiO2NTAs biosensor retained 85% of its initial current response. Finally, the glucose content of different food samples was measured using the biosensor and compared with the respective HPLC value. In the worst scenario, a deviation smaller than 10% was obtained among the 20 samples evaluated. PMID:29135931

  11. Magnetically separable polymer (Mag-MIP) for selective analysis of biotin in food samples.

    Science.gov (United States)

    Uzuriaga-Sánchez, Rosario Josefina; Khan, Sabir; Wong, Ademar; Picasso, Gino; Pividori, Maria Isabel; Sotomayor, Maria Del Pilar Taboada

    2016-01-01

    This work presents an efficient method for the preparation of magnetic nanoparticles modified with molecularly imprinted polymers (Mag-MIP) through core-shell method for the determination of biotin in milk food samples. The functional monomer acrylic acid was selected from molecular modeling, EGDMA was used as cross-linking monomer and AIBN as radical initiator. The Mag-MIP and Mag-NIP were characterized by FTIR, magnetic hysteresis, XRD, SEM and N2-sorption measurements. The capacity of Mag-MIP for biotin adsorption, its kinetics and selectivity were studied in detail. The adsorption data was well described by Freundlich isotherm model with adsorption equilibrium constant (KF) of 1.46 mL g(-1). The selectivity experiments revealed that prepared Mag-MIP had higher selectivity toward biotin compared to other molecules with different chemical structure. The material was successfully applied for the determination of biotin in diverse milk samples using HPLC for quantification of the analyte, obtaining the mean value of 87.4% recovery. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Development of a cloud-point extraction method for copper and nickel determination in food samples

    International Nuclear Information System (INIS)

    Azevedo Lemos, Valfredo; Selis Santos, Moacy; Teixeira David, Graciete; Vasconcelos Maciel, Mardson; Almeida Bezerra, Marcos de

    2008-01-01

    A new, simple and versatile cloud-point extraction (CPE) methodology has been developed for the separation and preconcentration of copper and nickel. The metals in the initial aqueous solution were complexed with 2-(2'-benzothiazolylazo)-5-(N,N-diethyl)aminophenol (BDAP) and Triton X-114 was added as surfactant. Dilution of the surfactant-rich phase with acidified methanol was performed after phase separation, and the copper and nickel contents were measured by flame atomic absorption spectrometry. The variables affecting the cloud-point extraction were optimized using a Box-Behnken design. Under the optimum experimental conditions, enrichment factors of 29 and 25 were achieved for copper and nickel, respectively. The accuracy of the method was evaluated and confirmed by analysis of the followings certified reference materials: Apple Leaves, Spinach Leaves and Tomato Leaves. The limits of detection expressed to solid sample analysis were 0.1 μg g -1 (Cu) and 0.4 μg g -1 (Ni). The precision for 10 replicate measurements of 75 μg L -1 Cu or Ni was 6.4 and 1.0, respectively. The method has been successfully applied to the analysis of food samples

  13. Uranium analysis in some food samples collected from Bathinda area of Punjab, India

    Science.gov (United States)

    Kumar, Mukesh; Prasher, Sangeeta; Singh, Surinder

    2009-07-01

    To strengthen the radiation protection infrastructure in Bathinda, the uranium concentration in daily diet of the residents has been measured and its associated radiation risks were estimated for the adult population. Food samples were collected from major cancer prone areas of the district, from which daily diets were prepared. These diet samples were analyzed using fission track technique. The measured values of the uranium content were found to vary from 0.38 mBq/g in mustard seeds to 4.60 mBq/g in wheat. In case of milk the uranium content is found to vary from 28.57-213.36 mBq/ℓ with mean concentration of 61.35 mBq/ℓ. This leads to a daily dietary intake of 0.90 Bq/day. The measured value of 0.90 Bq d-1, contributes to 1.12 mSv to the cumulative effective dose to the population. This dose is much large than the International Commission for Radiological Protection (ICRP) annual effective dose limit of 1 mSv for the general public [1]. Therefore, it would pose significant health hazard.

  14. Determination of some metal ions in various meat and baby food samples by atomic spectrometry.

    Science.gov (United States)

    Daşbaşı, Teslima; Saçmacı, Şerife; Ülgen, Ahmet; Kartal, Şenol

    2016-04-15

    In this paper, we report a simple and rapid solid phase extraction system for the separation/preconcentration and determination of Cd(II), Co(II), Cu(II), Fe(III), Cr(III), Pb(II), and Zn(II) ions by flame atomic absorption spectrometry (FAAS). This method is based upon the retention of metal ions on a column packed with poly[N-(3-methyl-1H-indole-1-yl)]-2-methacrylamide-co-2-acrylamido-2-methyl-1-propane sulphonic acid-co divinylbenzene] (MMAD) resin as a solid-phase extraction (SPE) sorbent at pH 8. At the optimized conditions, the limits of detection (3 s/b) between 0.12 and 1.6 μg L(-1), preconcentration factor of 100, and the relative standard deviation of ⩽1.8% were achieved (n=10). The accuracy of the method was verified by analyzing certified reference materials (CRMs) and performing recovery experiments. The developed method was successfully applied to the various natural water, meat products and baby food samples. The recoveries of analyte ions were found in added real samples and CRMs from 95% to 102%. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Analytical Parameters of an Amperometric Glucose Biosensor for Fast Analysis in Food Samples.

    Science.gov (United States)

    Artigues, Margalida; Abellà, Jordi; Colominas, Sergi

    2017-11-14

    Amperometric biosensors based on the use of glucose oxidase (GOx) are able to combine the robustness of electrochemical techniques with the specificity of biological recognition processes. However, very little information can be found in literature about the fundamental analytical parameters of these sensors. In this work, the analytical behavior of an amperometric biosensor based on the immobilization of GOx using a hydrogel (Chitosan) onto highly ordered titanium dioxide nanotube arrays (TiO₂NTAs) has been evaluated. The GOx-Chitosan/TiO₂NTAs biosensor showed a sensitivity of 5.46 μA·mM -1 with a linear range from 0.3 to 1.5 mM; its fundamental analytical parameters were studied using a commercial soft drink. The obtained results proved sufficient repeatability (RSD = 1.9%), reproducibility (RSD = 2.5%), accuracy (95-105% recovery), and robustness (RSD = 3.3%). Furthermore, no significant interferences from fructose, ascorbic acid and citric acid were obtained. In addition, the storage stability was further examined, after 30 days, the GOx-Chitosan/TiO₂NTAs biosensor retained 85% of its initial current response. Finally, the glucose content of different food samples was measured using the biosensor and compared with the respective HPLC value. In the worst scenario, a deviation smaller than 10% was obtained among the 20 samples evaluated.

  16. Sodium and Food Sources

    Science.gov (United States)

    ... is processed food? The Dietary Guidelines for Americans define the term "processed food" includes "any raw agricultural ... of foods , ranging from the number 1 source—breads and rolls—to eggs and omelets, which are ...

  17. Food poisoning

    Science.gov (United States)

    ... foods that are not stored at the proper temperature or are not reheated to the right temperature Raw fish or oysters Raw fruits or vegetables ... proper amount of fluids. Getting enough fluids and learning what to eat will help keep you comfortable. ...

  18. Species-specific optical genosensors for the detection of mycotoxigenic Fusarium fungi in food samples

    International Nuclear Information System (INIS)

    Peltomaa, Riikka; Vaghini, Silvia; Patiño, Belén; Benito-Peña, Elena; Moreno-Bondi, María C.

    2016-01-01

    Plant-pathogenic Fusarium species, Fusarium verticillioides and Fusarium proliferatum, are the major producers of fumonisins which are one of the most common mycotoxins found in maize. Herein, we report the development of specific and sensitive genosensors for detecting these two closely related Fusarium species in food samples. The sensors are based on species-specific capture and detection probes, which bind to the intergenic spacer region of rDNA (IGS). Oligonucleotide functionalized magnetic microbeads are used to capture the target DNA which is then detected using biotinylated detection probes and a streptavidin-coupled label. The developed genosensors had detection limits of 1.8 pM and 3.0 pM for F. proliferatum and F. verticillioides, respectively, using synthetic DNA targets. Furthermore, the biosensors were used to analyze natural fungal contamination of commercial maize samples. After amplification of the genomic DNA the sensors detected the presence of the fungi, in accordance with previous results obtained with PCR. No cross-reactivity between F. verticillioides and F. proliferatum, or other fungi species tested, was observed. The developed biosensors can provide a valuable tool to evaluate the potential for mycotoxin contamination in conditions where detection of mycotoxins directly is challenging. - Highlights: • Optical genosensors detect fumonisin producing Fusarium species in maize samples. • Oligonucleotide probes designed on the intergenic spacer region of rDNA can distinguish between closely related species. • Sandwich hybridization assay with magnetic microbeads allows species-specific detection of Fusarium spp. directly from PCR.

  19. Species-specific optical genosensors for the detection of mycotoxigenic Fusarium fungi in food samples

    Energy Technology Data Exchange (ETDEWEB)

    Peltomaa, Riikka; Vaghini, Silvia [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Patiño, Belén [Department of Microbiology III, Faculty of Biology, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Benito-Peña, Elena, E-mail: elenabp@ucm.es [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Moreno-Bondi, María C., E-mail: mcmbondi@ucm.es [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain)

    2016-09-07

    Plant-pathogenic Fusarium species, Fusarium verticillioides and Fusarium proliferatum, are the major producers of fumonisins which are one of the most common mycotoxins found in maize. Herein, we report the development of specific and sensitive genosensors for detecting these two closely related Fusarium species in food samples. The sensors are based on species-specific capture and detection probes, which bind to the intergenic spacer region of rDNA (IGS). Oligonucleotide functionalized magnetic microbeads are used to capture the target DNA which is then detected using biotinylated detection probes and a streptavidin-coupled label. The developed genosensors had detection limits of 1.8 pM and 3.0 pM for F. proliferatum and F. verticillioides, respectively, using synthetic DNA targets. Furthermore, the biosensors were used to analyze natural fungal contamination of commercial maize samples. After amplification of the genomic DNA the sensors detected the presence of the fungi, in accordance with previous results obtained with PCR. No cross-reactivity between F. verticillioides and F. proliferatum, or other fungi species tested, was observed. The developed biosensors can provide a valuable tool to evaluate the potential for mycotoxin contamination in conditions where detection of mycotoxins directly is challenging. - Highlights: • Optical genosensors detect fumonisin producing Fusarium species in maize samples. • Oligonucleotide probes designed on the intergenic spacer region of rDNA can distinguish between closely related species. • Sandwich hybridization assay with magnetic microbeads allows species-specific detection of Fusarium spp. directly from PCR.

  20. Nutrients and antinutrients composition of raw, cooked and sun ...

    African Journals Online (AJOL)

    Nutrients and antinutrients composition of raw, cooked and sun-dried sweet potato leaves. ... African Journal of Food, Agriculture, Nutrition and Development ... This study aimed to determine nutrient (iron, calcium, vitamin A and ascorbic acid) and anti-nutrient (oxalates and polyphenols) contents in raw, cooked and dried ...

  1. Raw and renewable polymers

    CSIR Research Space (South Africa)

    Joseph, S

    2010-01-01

    Full Text Available in the permeability of the membrane and HO H3C H3C H2C H2C HO OH NH NH OH O OC C n O O O O Fig. 4 Structure of Chitin Raw and Renewable Polymers promoting internal osmotic imbalances. This results in leaching of electrolytes and proteins. 2... is often lost. In most cases this denaturation is not reversible. R-CH-COOH NH2 w Amino acid H2N COOHR a Amino acid Fig. 5 Structure of amino acid Raw and Renewable Polymers The solubilities of proteins vary considerably based on compositions...

  2. Criteria to define a more relevant reference sample of titanium dioxide in the context of food: a multiscale approach.

    Science.gov (United States)

    Dudefoi, William; Terrisse, Hélène; Richard-Plouet, Mireille; Gautron, Eric; Popa, Florin; Humbert, Bernard; Ropers, Marie-Hélène

    2017-05-01

    Titanium dioxide (TiO 2 ) is a transition metal oxide widely used as a white pigment in various applications, including food. Due to the classification of TiO 2 nanoparticles by the International Agency for Research on Cancer as potentially harmful for humans by inhalation, the presence of nanoparticles in food products needed to be confirmed by a set of independent studies. Seven samples of food-grade TiO 2 (E171) were extensively characterised for their size distribution, crystallinity and surface properties by the currently recommended methods. All investigated E171 samples contained a fraction of nanoparticles, however, below the threshold defining the labelling of nanomaterial. On the basis of these results and a statistical analysis, E171 food-grade TiO 2 totally differs from the reference material P25, confirming the few published data on this kind of particle. Therefore, the reference material P25 does not appear to be the most suitable model to study the fate of food-grade TiO 2 in the gastrointestinal tract. The criteria currently to obtain a representative food-grade sample of TiO 2 are the following: (1) crystalline-phase anatase, (2) a powder with an isoelectric point very close to 4.1, (3) a fraction of nanoparticles comprised between 15% and 45%, and (4) a low specific surface area around 10 m 2  g - 1 .

  3. [Trends and factors associated with food insecurity in Brazil: the National Household Sample Survey, 2004, 2009, and 2013].

    Science.gov (United States)

    Santos, Taíse Gama Dos; Silveira, Jonas Augusto Cardoso da; Longo-Silva, Giovana; Ramires, Elyssia Karine Nunes Mendonça; Menezes, Risia Cristina Egito de

    2018-03-29

    The aim of this study was to analyze trends and factors associated with food insecurity in Brazil in 2004, 2009, and 2013, using microdata from the National Household Sample Survey (PNAD). Food insecurity was assessed using the Brazilian Food Insecurity Scale. Independent variables were selected from a conceptual model of determination of food insecurity, which was also used in the elaboration of multiple generalized linear models. The results show a downward trend in food insecurity prevalence from 2004 to 2013, especially for moderate and severe food insecurity, from 17% in 2004 (95%CI: 15.7-18.4) to 7.9% in 2013 (95%CI: 7.2-8.7). Despite important decreases in the prevalence of moderate and severe food insecurity, regardless of the level of determination, the population strata with the lowest prevalence in 2004 showed the largest relative reduction. As for factors associated with moderate and severe food insecurity, they remained the same in the ten years covered by the PNAD survey, namely: the North and Northeast regions, urban areas with inadequate sanitation, household density > 2 persons per bedroom, ≤ 4 household durable consumer goods, and households headed by females, individuals insecurity dropped by half, but from the perspective of equity the advances occurred unequally and were lower in strata with greater social, economic, and demographic vulnerability.

  4. Antibacterial efficacy of raw and commercially available honey

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... Key words: Honey, antibacterial activity, raw honey, commercially available honey, minimum inhibitory ... against pathogenic bacteria, oral bacteria as well as food .... explore the possible benefits of the use of honey among.

  5. Nutritional and amino acid analysis of raw, partially fermented and ...

    African Journals Online (AJOL)

    African Journal of Food, Agriculture, Nutrition and Development ... The nutritional and amino acid analysis of raw and fermented seeds of Parkia ... between 4.27 and 8.33 % for the fully fermented and the partially fermented seeds, respectively.

  6. Globalization determinants of raw materials markets development

    Directory of Open Access Journals (Sweden)

    Olga Yatsenko

    2013-02-01

    Full Text Available The determinants of development of raw materials markets and the peculiarities of their formation in the terms of world economy globalization have been researched. The empirical base of research is the agricultural food market as one of the most important bases in the sphere of material production and provision of food security of the country. The important social and economic mission of the agricultural sector has been highlighted, along with the export competitiveness and import dependence of agricultural food products in the international trade. The imperative norms have been substantiated and conclusions have been drawn regarding the establishment of respective conditions for the operation of globally integrated markets in Ukraine.

  7. Dangerous Raw Oysters

    Centers for Disease Control (CDC) Podcasts

    2013-08-05

    Dr. Duc Vugia, chief of the Infectious Diseases Branch at the California Department of Public Health, discusses the dangers of eating raw oysters.  Created: 8/5/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 8/7/2013.

  8. Comparison between the efficacy of two cleanup methods for the 1H NMR analysis of food samples contaminated with Cypermethrin

    International Nuclear Information System (INIS)

    Silva, M.M.; Figueroa-Villar, J.D.; Aguiar, A.P.; Riehl, C.A.S.

    2004-01-01

    This work aimed to study the use of 1 H NMR for the identification of cypermethrin in cooked foods. 1 H NMR is not commonly used in these cases, because food samples ready for consumption have complex substances, mainly lipids, which usually interfere with the identification of cypermethrin. Thus, we drew a comparison between the most applied method for the treatment of those samples and an alternative route that made possible the use of 1 H NMR in the identification of cypermethrin in a matrix consisting of rice, bean, and chicken, which allows the Forensic work for such cases.(author)

  9. Factors affecting adherence to a raw vegan diet

    OpenAIRE

    Link, Lilli B.; Jacobson, Judith S.

    2007-01-01

    The purpose of this study was to evaluate adherence and identify predictors of adherence to a raw vegan diet (i.e., uncooked plant foods) following a stay at a raw vegan institute. In this cohort study of guests at a raw vegan institute, subjects completed written questionnaires upon arrival and 12 weeks later. Of 107 eligible guests, 84 participated. Mean age was 54 years, 23 were male, and 73 white. Fifty-one completed the 12-week follow-up. Eight (16%) reported their diet to be ≥80% raw ve...

  10. U.S. Food safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: an establishment-level analysis.

    Science.gov (United States)

    Eblen, Denise R; Barlow, Kristina E; Naugle, Alecia Larew

    2006-11-01

    The U.S. Food Safety and Inspection Service (FSIS) pathogen reduction-hazard analysis critical control point systems final rule, published in 1996, established Salmonella performance standards for broiler chicken, cow and bull, market hog, and steer and heifer carcasses and for ground beef, chicken, and turkey meat. In 1998, the FSIS began testing to verify that establishments are meeting performance standards. Samples are collected in sets in which the number of samples is defined but varies according to product class. A sample set fails when the number of positive Salmonella samples exceeds the maximum number of positive samples allowed under the performance standard. Salmonella sample sets collected at 1,584 establishments from 1998 through 2003 were examined to identify factors associated with failure of one or more sets. Overall, 1,282 (80.9%) of establishments never had failed sets. In establishments that did experience set failure(s), generally the failed sets were collected early in the establishment testing history, with the exception of broiler establishments where failure(s) occurred both early and late in the course of testing. Small establishments were more likely to have experienced a set failure than were large or very small establishments, and broiler establishments were more likely to have failed than were ground beef, market hog, or steer-heifer establishments. Agency response to failed Salmonella sample sets in the form of in-depth verification reviews and related establishment-initiated corrective actions have likely contributed to declines in the number of establishments that failed sets. A focus on food safety measures in small establishments and broiler processing establishments should further reduce the number of sample sets that fail to meet the Salmonella performance standard.

  11. Prevalence of Listeria species in raw milk and traditional dairy products in Isfahan, Iran

    Directory of Open Access Journals (Sweden)

    Ehsan Shamloo

    2015-01-01

    Full Text Available Aim: The study aimed to assess the prevalence of Listeria spp. in raw milk and traditional non-pasteurized dairy products in Isfahan, Iran. Materials and Methods: A total of 292 samples of raw milk and traditional dairy were examined for the presence of Listeria spp. using a two-step selective enrichment recommended by the United States Department of Agriculture. All isolates were subjected to standard biochemical tests. L. monocytogenes strains were further confirmed by polymerase chain reaction (PCR amplification. Results: Of 292 samples, 21 (7.14% and 4 (1.47% were positive for Listeria spp. and pathogenic L. monocytogenes, respectively. The prevalence of Listeria spp. in raw milk, ice cream, cream, and freni were 5.91 (5.49%, 12.63 (19.04%, 3.27 (11.11% and 1.25 (4%, respectively. Listeria was not detected from yogurt, butter, Kashk, and cheese. Listeria innocua at 16.21 (5.44% was the most prevalent species isolated, followed by L. monocytogenes at 4.21 (19% and L. seeligeri at 1.21 (4.7%. All strains of L. monocytogenes identified by biochemical tests were also confirmed by PCR. Conclusion: The study shows the prevalence of L. monocytogenes in raw milk and traditional dairy products sold in the market. Consumption of raw milk with mild heat treatment or its usage in traditional dishes could pose serious health problems due to lack of appropriate control measures. The lack of knowledge on the risks of listeriosis transmission indicates the need for implementation of a food safety education program. In addition, the Iranian food safety authorities should urgently set up an effective standard to screen all susceptible food products for the presence of Listeria.

  12. Microbiological performance of a food safety management system in a food service operation.

    Science.gov (United States)

    Lahou, E; Jacxsens, L; Daelman, J; Van Landeghem, F; Uyttendaele, M

    2012-04-01

    The microbiological performance of a food safety management system in a food service operation was measured using a microbiological assessment scheme as a vertical sampling plan throughout the production process, from raw materials to final product. The assessment scheme can give insight into the microbiological contamination and the variability of a production process and pinpoint bottlenecks in the food safety management system. Three production processes were evaluated: a high-risk sandwich production process (involving raw meat preparation), a medium-risk hot meal production process (starting from undercooked raw materials), and a low-risk hot meal production process (reheating in a bag). Microbial quality parameters, hygiene indicators, and relevant pathogens (Listeria monocytogenes, Salmonella, Bacillus cereus, and Escherichia coli O157) were in accordance with legal criteria and/or microbiological guidelines, suggesting that the food safety management system was effective. High levels of total aerobic bacteria (>3.9 log CFU/50 cm(2)) were noted occasionally on gloves of food handlers and on food contact surfaces, especially in high contamination areas (e.g., during handling of raw material, preparation room). Core control activities such as hand hygiene of personnel and cleaning and disinfection (especially in highly contaminated areas) were considered points of attention. The present sampling plan was used to produce an overall microbiological profile (snapshot) to validate the food safety management system in place.

  13. Active pharmaceutical ingredients detected in herbal food supplements for weight loss samples on the Dutch market

    NARCIS (Netherlands)

    Reeuwijk, N.M.; Venhuis, B.J.; Kaste, de D.; Hoogenboom, L.A.P.; Rietjens, I.; Martena, M.J.

    2014-01-01

    Herbal food supplements claiming to reduce weight may contain active pharmacological ingredients (APIs) that can be used for the treatment of overweight and obesity. The aim of this study was to determine whether herbal food supplements for weight loss on the Dutch market contain APIs with weight

  14. OCCURRENCE OF LISTERIA MONOCYTOGENES IN READY TO EAT FOOD SAMPLES COLLECTED BY LOMBARDY REGION HEALTH AUTHORITIES IN 2009-2010

    Directory of Open Access Journals (Sweden)

    E. Oliverio

    2012-08-01

    Full Text Available The study provides data on the prevalence of Listeria monocytogenes in ready-to-eat food samples collected by Lombardy region health authorities and analyzed by Department of Food Microbiology, Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna. From the total of 503 food samples analyzed, the pathogen was detected in 85 (16,9%. In particular it was highlighted in 8/152 (5,3% meat products, in 5/245 (2% dairy products and in 42/106 (39,6% fishery products. Given the considerable public health implications, the study confirms that a well-planned program of listeriosis surveillance should be enforced to suitably estimate the burden of disease and to prevent foodborne outbreaks.

  15. Reagent-Less and Robust Biosensor for Direct Determination of Lactate in Food Samples

    Directory of Open Access Journals (Sweden)

    Iria Bravo

    2017-01-01

    Full Text Available Lactic acid is a relevant analyte in the food industry, since it affects the flavor, freshness, and storage quality of several products, such as milk and dairy products, juices, or wines. It is the product of lactose or malo-lactic fermentation. In this work, we developed a lactate biosensor based on the immobilization of lactate oxidase (LOx onto N,N′-Bis(3,4-dihydroxybenzylidene -1,2-diaminobenzene Schiff base tetradentate ligand-modified gold nanoparticles (3,4DHS–AuNPs deposited onto screen-printed carbon electrodes, which exhibit a potent electrocatalytic effect towards hydrogen peroxide oxidation/reduction. 3,4DHS–AuNPs were synthesized within a unique reaction step, in which 3,4DHS acts as reducing/capping/modifier agent for the generation of stable colloidal suspensions of Schiff base ligand–AuNPs assemblies of controlled size. The ligand—in addition to its reduction action—provides a robust coating to gold nanoparticles and a catalytic function. Lactate oxidase (LOx catalyzes the conversion of l-lactate to pyruvate in the presence of oxygen, producing hydrogen peroxide, which is catalytically oxidized at 3,4DHS–AuNPs modified screen-printed carbon electrodes at +0.2 V. The measured electrocatalytic current is directly proportional to the concentration of peroxide, which is related to the amount of lactate present in the sample. The developed biosensor shows a detection limit of 2.6 μM lactate and a sensitivity of 5.1 ± 0.1 μA·mM−1. The utility of the device has been demonstrated by the determination of the lactate content in different matrixes (white wine, beer, and yogurt. The obtained results compare well to those obtained using a standard enzymatic-spectrophotometric assay kit.

  16. Reagent-Less and Robust Biosensor for Direct Determination of Lactate in Food Samples.

    Science.gov (United States)

    Bravo, Iria; Revenga-Parra, Mónica; Pariente, Félix; Lorenzo, Encarnación

    2017-01-13

    Lactic acid is a relevant analyte in the food industry, since it affects the flavor, freshness, and storage quality of several products, such as milk and dairy products, juices, or wines. It is the product of lactose or malo-lactic fermentation. In this work, we developed a lactate biosensor based on the immobilization of lactate oxidase (LOx) onto N , N '-Bis(3,4-dihydroxybenzylidene) -1,2-diaminobenzene Schiff base tetradentate ligand-modified gold nanoparticles (3,4DHS-AuNPs) deposited onto screen-printed carbon electrodes, which exhibit a potent electrocatalytic effect towards hydrogen peroxide oxidation/reduction. 3,4DHS-AuNPs were synthesized within a unique reaction step, in which 3,4DHS acts as reducing/capping/modifier agent for the generation of stable colloidal suspensions of Schiff base ligand-AuNPs assemblies of controlled size. The ligand-in addition to its reduction action-provides a robust coating to gold nanoparticles and a catalytic function. Lactate oxidase (LOx) catalyzes the conversion of l-lactate to pyruvate in the presence of oxygen, producing hydrogen peroxide, which is catalytically oxidized at 3,4DHS-AuNPs modified screen-printed carbon electrodes at +0.2 V. The measured electrocatalytic current is directly proportional to the concentration of peroxide, which is related to the amount of lactate present in the sample. The developed biosensor shows a detection limit of 2.6 μM lactate and a sensitivity of 5.1 ± 0.1 μA·mM -1 . The utility of the device has been demonstrated by the determination of the lactate content in different matrixes (white wine, beer, and yogurt). The obtained results compare well to those obtained using a standard enzymatic-spectrophotometric assay kit.

  17. RESEARCHES REGARDING THE MICROBIOLOGIC PARAMETERS VALUE FROM RAW MILK USED IN TELEMEA CHEESE TECHNOLOGICAL PROCESS

    Directory of Open Access Journals (Sweden)

    ANDRA SULER

    2008-10-01

    Full Text Available An important faze for food quality control is verification of microbiological parameters of food products. In this way is assuring the prevention of alimentation toxicological infections to consumer, avoiding the technological and economical losses as well as increasing the products conservation period. In this paper are presents the microbiological exam results from raw milk used in Telemea cheese technological process, for 5 stations studied. The determinations were made on 2 series with 57 samples each of them, prelevated in reception fase, in summer and winter season.

  18. XENOBIOTICS AND BIOGENIC ELEMENTS IN RAW COW'S MILK

    Directory of Open Access Journals (Sweden)

    Agnieszka Greń

    2012-12-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE This paper presents the concentration some toxic and biogenic elements in milk from Nitra region. The aim of this investigation was to evaluate 30 samples of raw milk with fat contents 3.8% obtained from milk machine in the Nitra region. Samples were analyzed for metal contents using atomic absorption spectrophotometry (AAS. In comparison with maximum acceptable concentration for milk in the food codex of the Slovak republic, the level of contamination with cadmium was exceeded and reached the value 0.221 µg.ml-1. The copper content ranged from 1.201 µg.ml-1 to 5.810 µg.ml-1 and the average concentration reached 3.793 µg.ml-1.  Iron had an average of 1.824 µg.ml-1. Overall in all milk samples high correlations were found. Between positive correlation (0.7019 and negative correlation between of nickel and potassium concentration in raw milk (-0.72 was found. doi:10.5219/246

  19. ELISA AND SOL-GEL BASED IMMUNOAFFINITY PURIFICATION OF THE PYRETHROID BIOALLETHRIN IN FOOD AND ENVIRONMENTAL SAMPLES

    Science.gov (United States)

    The peer-reviewed article describes the development of a new sol-gel based immunoaffinity purification procedure and an immunoassay for the pyrethroid bioallethrin. The immunoaffinity chromatography procedure was applied to food samples providing an efficient cleanup prior to im...

  20. Raw cow’s milk relatively inhibits quorum sensing activity of Cromobacterium violaceum in comparison to raw she-camel’s milk

    Directory of Open Access Journals (Sweden)

    A.A. Moawad

    2011-10-01

    Full Text Available Milk from different animal species has variable levels of antimicrobial factors against some of spoilage bacteria. For example, they are significantly present in higher concentration in she-camel’s milk than in cattle or buffalo and they are more heat-resistant than their counterparts in cattle and buffalo. Spoilage bacteria are known to communicate with each other by release of signaling molecules, a phenomenon described as quorum sensing (QS. Some food matrices inhibit these signaling compounds. In this study we screened QS inhibitory activities in raw milk of cattle and camel. Ten samples each of fresh raw cow’s milk and she-camel’s milk from apparently healthy animals were screened using the bacterial model Cromobacterium violaceum. The tested cow’s raw milk samples were able to inhibit the production of QS signalling molecules acyl-homoserine lactones (AHLs produced by C. violaceum. However, she-camel’s milk samples were less effective in inhibiting such AHLs. Thus, one of the factors which influence the inhibitory activity could be derived from variation in milk chemical composition, especially in the percentage of fat which is significantly higher in tested cow’s milk samples (2.22±0.12 than in tested she-camel’s milk samples (1.44±0.35. Natural inhibition of QS signaling by cow’s milk may offer a unique means to control foodborne pathogens and reduce microbial spoilage.

  1. A lab-on-a-chip system with integrated sample preparation and loop-mediated isothermal amplification for rapid and quantitative detection of Salmonella spp. in food samples

    DEFF Research Database (Denmark)

    Sun, Yi; Than Linh, Quyen; Hung, Tran Quang

    2015-01-01

    was capable to detect Salmonella at concentration of 50 cells per test within 40 min. The simple design, together with high level of integration, isothermal amplification, and quantitative analysis of multiple samples in short time will greatly enhance the practical applicability of the LOC system for rapid...... amplification (LAMP) for rapid and quantitative detection of Salmonella spp. in food samples. The whole diagnostic procedures including DNA isolation, isothermal amplification, and real-time detection were accomplished in a single chamber. Up to eight samples could be handled simultaneously and the system...... and usually take a few hours to days to complete. In response to the demand for rapid on line or at site detection of pathogens, in this study, we describe for the first time an eight-chamber lab-on-a-chip (LOC) system with integrated magnetic beads-based sample preparation and loop-mediated isothermal...

  2. Food insecurity, health and nutritional status among sample of palm-plantation households in Malaysia.

    Science.gov (United States)

    Mohamadpour, M; Sharif, Z Mohd; Keysami, M Avakh

    2012-09-01

    Food insecurity is a worldwide problem and has been shown to contribute to poor health and nutritional outcomes. In Malaysia, poor dietary intake, overweight and obesity, diabetes mellitus, and hypercholesterolaemia have been reported to be more prevalent in females compared to males and in Indians compared to other ethnic groups. A cross-sectional study was designed to investigate the relationship between food insecurity and health and nutritional status among 169 Indian women (19-49 years old, non-pregnant, and non-lactating) from randomly-selected palm-plantation households in Negeri Sembilan, Malaysia. Subjects were interviewed for socioeconomic and demographic data, and information on household food security and dietary intake. They were examined for weight, height, waist-circumference, blood pressure and lipids, and plasma glucose levels. For analysis of data, descriptive statistics, ANOVA, and logistic regression were used. Majority (85.2%) of the households showed food insecurity as assessed using the Radimer/Cornell Hunger and Food Insecurity Instrument. The food-secure women had significantly higher mean years of education and lower mean number of children than food-insecure groups (pdiet diversity score (11.60±4.13) than child hunger (9.23±3.36). The group of subjects with higher intake of meat/fish/poultry/legumes (crude odds ratio [OR]=0.53, confidence interval [CI]=0.29-0.95) and higher diet diversity score (crude OR=0.87, CI=0.78-0.97) was more likely to have Diet diversity score remained a significant protective factor against heath risks even after adjusting for other variables. The present study showed that food insecurity is indirectly associated with poor health and nutritional status. Therefore, appropriate community-based interventions should be designed and implemented to address the problems of food insecurity and possible health and nutritional outcomes.

  3. Current problems of raw fish material processing while manufacturing dried products

    Directory of Open Access Journals (Sweden)

    Yashonkov A. A.

    2017-09-01

    Full Text Available The substantiation for using techniques of fish raw material canning has been presented, raw fish being caught or farmed in aquaculture. The main problems in raw fish canning have been reviewed, including significant reduction in thermolabile vitamins in the ultimate product as compared with the raw material due to the thermal processing. Promising canning technique – vacuum drying – has been proposed. This technique makes possible to reduce the temperature of thermal processing down to 50…55 °С and significantly enlarge preservation of thermolabile vitamins from the raw fish. Sampling of raw materials, semi-finished products, finished products, including preparation for analysis has been conducted by standard methods. Disadvantages of this way have been found, it is low energy efficiency of the process. The way to intensify the vacuum drying of aquatic organisms has been proposed based on the method of preliminary pore-forming due to augmenting the area of moisture evaporation. The design of the pilot plant has been proposed in order to research the process of pore forming and vacuum drying. Target species for processing have been suggested. They are as follows: Azov goby (fillet for food products and Black Sea sprat for feeds. The recipes of the feed mixture for granulated floating food for trout have been developed. The results of the first series of the pilot research have been provided. The experiments have proved that preliminary pore forming immediately before vacuum drying makes possible to enlarge the surface area of moisture evaporation by 15…25 %. By processing photomicrographs of sections by means of a special software the authors have got the results demonstrating that when manufacturing dried products by pore forming and drying under pressure 10 kPa the pore take 35...38 % of the inner volume of the product and with drying under pressure 10 kPa – only 18...21 %, and when drying under the atmospheric pressure – 11...13 %.

  4. Detection of thermophilic Campylobacter sp. in raw chicken sausages by methods ISO 10272: 2006 in Curitiba - Parana State - Brazil

    Directory of Open Access Journals (Sweden)

    K. Konell

    2014-12-01

    Full Text Available The aim of this study was the detection of Campylobacter sp. in raw chicken sausages using the methods ISO 10272-1 and ISO 10272-2. The overall prevalence of Campylobacter sp. in the samples tested was 16.67%, representing a serious risk to the health of consumers, particularly if measures guaranteeing proper cooking of foods and prevention of cross-contamination are not adopted. Furthermore, the majority of campylobacteriosis cases in humans are caused by consumption or improper handling of contaminated raw or undercooked poultry meat, which constitute the main vehicle of this infection.

  5. PTSD, food addiction, and disordered eating in a sample of primarily older veterans: The mediating role of emotion regulation.

    Science.gov (United States)

    Mitchell, Karen S; Wolf, Erika J

    2016-09-30

    Posttraumatic stress disorder (PTSD) has been associated with eating disorders (EDs) and addictive behaviors, including the relatively new construct food addiction. However, few studies have investigated mechanisms that account for these associations, and men are underrepresented in studies of EDs and food addiction. We examined whether lifetime PTSD symptoms were associated with current food addiction and ED symptoms, and whether emotion regulation (expressive suppression and cognitive reappraisal), which has been associated with both PTSD and EDs, mediated these relations, in a sample of trauma-exposed, male (n=642) and female (n=55) veterans. Participants were recruited from the Knowledge Networks-GfK Research Panel and completed an online questionnaire. Structural equation modeling revealed that PTSD was directly associated with ED symptoms, food addiction, expressive suppression, and cognitive reappraisal in the full sample and with all constructs except cognitive reappraisal in the male subsample. Expressive suppression was significantly associated with ED symptoms and mediated the PTSD-ED relation. These results highlight the importance of investigating PTSD as a risk factor for food addiction and ED symptoms and the potential mediating role of emotion regulation in the development of PTSD and EDs in order to identify targets for treatments. Published by Elsevier Ireland Ltd.

  6. [Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

    Science.gov (United States)

    Gelbícová, T; Karpísková, R

    2012-04-01

    Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

  7. Prevalence and Characterization of Listeria Species from Raw Milk and Dairy Products from Çanakkale Province

    Directory of Open Access Journals (Sweden)

    Pınar Şanlıbaba

    2018-02-01

    Full Text Available The objective of this study was to determine the prevalence of Listeria species, specifically Listeria monocytogenes, in raw milk, pasteurized milk, white cheese, and homemade cheese. A total of 200 food samples were collected and analyzed to examine the presence of Listeria spp. The EN ISO 11290-1 method was used for isolation of Listeria. API Listeria test kit was used for biochemically characterization. Listeria spp. were isolated in 25 of the 200 samples (12.5%. The largest number of Listeria spp. was detected in homemade cheese (24%, followed by raw milk (18%, and white cheese (8%. Listeria spp. were not isolated from the pasteurized milk. The most common species isolated were Listeria innocua (5.5%; the remaining Listeria isolates were Listeria ivanovi (3.5%, Listeria welshimeri (3%, and Listeria monocytogenes (0.5%. Listeria monocytogenes was detected in only raw milk.

  8. Occurrence of Staphylococcus aureus in raw milk produced in dairy farms in São Paulo state, Brazil

    Directory of Open Access Journals (Sweden)

    Helena Fagundes

    2010-06-01

    Full Text Available The objective of the present study was to evaluate the occurrence of Staphylococcus aureus in milk produced in 37 farms located in the regions of Ribeirão Preto and São Carlos, state of São Paulo, Brazil. Two-hundred and eight samples of milk from individual cows showing subclinical mastitis, and 37 samples of bulk tank milk were analyzed. S. aureus strains were detected in 18 (7.3% milk samples: 14 (6.7% from samples of individual cows, and 4 (10.8% from bulk tank milk. Two individual milk samples (14.3% and two bulk milk samples contained enterotoxigenic S. aureus. PFGE analysis revealed the genetic heterogeneity of the strains isolated from raw milk, which presented to 13 S. aureus patterns. Results confirmed the potential transmission of staphylococcal food poisoning to consumers via milk of cows affected by subclinical mastitis, mainly when raw milk is ingested.

  9. Seven-hour fluorescence in situ hybridization technique for enumeration of Enterobacteriaceae in food and environmental water sample.

    Science.gov (United States)

    Ootsubo, M; Shimizu, T; Tanaka, R; Sawabe, T; Tajima, K; Ezura, Y

    2003-01-01

    A fluorescent in situ hybridization (FISH) technique using an Enterobacteriaceae-specific probe (probe D) to target 16S rRNA was improved in order to enumerate, within a single working day, Enterobacteriaceae present in food and environmental water samples. In order to minimize the time required for the FISH procedure, each step of FISH with probe D was re-evaluated using cultured Escherichia coli. Five minutes of ethanol treatment for cell fixation and hybridization were sufficient to visualize cultured E. coli, and FISH could be performed within 1 h. Because of the difficulties in detecting low levels of bacterial cells by FISH without cultivation, a FISH technique for detecting microcolonies on membrane filters was investigated to improve the bacterial detection limit. FISH with probe D following 6 h of cultivation to grow microcolonies on a 13 mm diameter membrane filter was performed, and whole Enterobacteriaceae microcolonies on the filter were then detected and enumerated by manual epifluorescence microscopic scanning at magnification of x100 in ca 5 min. The total time for FISH with probe D following cultivation (FISHFC) was reduced to within 7 h. FISHFC can be applied to enumerate cultivable Enterobacteriaceae in food (above 100 cells g-1) and environmental water samples (above 1 cell ml-1). Cultivable Enterobacteriaceae in food and water samples were enumerated accurately within 7 h using the FISHFC method. A FISHFC method capable of evaluating Enterobacteriaceae contamination in food and environmental water within a single working day was developed.

  10. Assessment of the Bacteriological Quality of Food Samples May Offer Clues the Antibiotic Resistance Pattern

    Directory of Open Access Journals (Sweden)

    Enayatollah Kalantar

    2015-02-01

    Full Text Available Background: Foodborne illnesses continue to be a leading cause of morbidity and mortality worldwide; however, the burden of diseases caused by food-borne pathogens remains largely unknown. Objectives: The aim of the present study was to culture-confirmed the bacterial profile and their antibiotic resistant pattern in Food and Drug Laboratory, Alborz University of Medical Sciences, Karaj, Iran. Patients and Methods: A total of 22 bacteria including of Staphylococcus aureus, Klebsiella spp and E. coli were presumptive isolated from the traditional ice cream, cream pastries, sausage, and salami by the Official Food Microbiology Laboratory, Deputy of Food and Drug Administration, Alborz University of Medical Sciences, Karaj, Iran, and sent to the Research Center Laboratory, Alborz University of Medical Sciences, to confirm the bacterial spp by multiplex polymerase chain reaction. These isolates were also checked for their antimicrobial resistance pattern according to CLSI guideline. Results: The highest rate of contamination was with Klebsiella spp 09 (40.9%, followed by S. aureus 07 (31.8%, E. coli 06 (27.27%, as reported by the Official Food Microbiology Laboratory of Alborz University of Medical Sciences. Gel electrophoresis of the isolates shows the 600bp bp and 80 bp gene among S. aureus and E. coli respectively. The antibiotic resistant pattern in case of Klensiella spp showed that 6 (66.6% Klensiella spp were resistant to Penicillin and Cotrimoxazole. Similarly, penicillin and amoxicillin were found the highest resistant antibiotic against 83.3% E. coli, however, ceftriaxone showed the highest sensitivity against 100% E. coli isolates. Conclusions: In conclusion, Klebsiella spp, S. aureus and E. coli are contaminants of food specimens obtained from food industries in Karaj, Iran; they constitute a serious health risk for human population. Moreover, the principal purpose of this study is to increase awareness of the antibiotic resistance of

  11. Strategic raw materials. Risk management

    International Nuclear Information System (INIS)

    Bertau, Martin; Matschullat, Joerg; Kausch, Peter

    2014-01-01

    This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [de

  12. Parsing and Quantification of Raw Orbitrap Mass Spectrometer Data Using RawQuant.

    Science.gov (United States)

    Kovalchik, Kevin A; Moggridge, Sophie; Chen, David D Y; Morin, Gregg B; Hughes, Christopher S

    2018-06-01

    Effective analysis of protein samples by mass spectrometry (MS) requires careful selection and optimization of a range of experimental parameters. As the output from the primary detection device, the "raw" MS data file can be used to gauge the success of a given sample analysis. However, the closed-source nature of the standard raw MS file can complicate effective parsing of the data contained within. To ease and increase the range of analyses possible, the RawQuant tool was developed to enable parsing of raw MS files derived from Thermo Orbitrap instruments to yield meta and scan data in an openly readable text format. RawQuant can be commanded to export user-friendly files containing MS 1 , MS 2 , and MS 3 metadata as well as matrices of quantification values based on isobaric tagging approaches. In this study, the utility of RawQuant is demonstrated in several scenarios: (1) reanalysis of shotgun proteomics data for the identification of the human proteome, (2) reanalysis of experiments utilizing isobaric tagging for whole-proteome quantification, and (3) analysis of a novel bacterial proteome and synthetic peptide mixture for assessing quantification accuracy when using isobaric tags. Together, these analyses successfully demonstrate RawQuant for the efficient parsing and quantification of data from raw Thermo Orbitrap MS files acquired in a range of common proteomics experiments. In addition, the individual analyses using RawQuant highlights parametric considerations in the different experimental sets and suggests targetable areas to improve depth of coverage in identification-focused studies and quantification accuracy when using isobaric tags.

  13. Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

    Directory of Open Access Journals (Sweden)

    Hristo Daskalov

    2014-03-01

    Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

  14. "Doing Difference" and Fast Food Consumption: Patterns Among a Sample of White and African American Emerging Adults.

    Science.gov (United States)

    Wade, Jeannette M

    2018-04-01

    Previous research has demonstrated that frequent consumption of fast food is linked to obesity and that trends in both are disparate across race and sex categories. Contextualizing race- and sex-related factors that structure fast food consumption in emerging adulthood is a much-needed contribution to social research. Specifically, this study uses the "doing difference" framework, to examine the frequency of fast food consumption in a sample of White and African American (18-25 years old). According to the framework, social inequalities are reproduced through dramaturgical performances of race, class, and gender. Results of this suggest that feminine gender orientation and education serve as protective factors, while African American race and male sex serve as risk factors. African American women emerged as especially high risk given their higher prevalence of traditionally masculine traits.

  15. Spectral and raw quasi in-situ energy dispersive X-ray data captured via a TEM analysis of an ODS austenitic stainless steel sample under 1 MeV Kr2+ high temperature irradiation.

    Science.gov (United States)

    Brooks, Adam J; Yao, Zhongwen

    2017-10-01

    The data presented in this article is related to the research experiment, titled: ' Quasi in-situ energy dispersive X-ray spectroscopy observation of matrix and solute interactions on Y-Ti-O oxide particles in an austenitic stainless steel under 1 MeV Kr 2+ high temperature irradiation' (Brooks et al., 2017) [1]. Quasi in-situ analysis during 1 MeV Kr 2+ 520 °C irradiation allowed the same microstructural area to be observed using a transmission electron microscope (TEM), on an oxide dispersion strengthened (ODS) austenitic stainless steel sample. The data presented contains two sets of energy dispersive X-ray spectroscopy (EDX) data collected before and after irradiation to 1.5 displacements-per-atom (~1.25×10 -3  dpa/s with 7.5×10 14  ions cm -2 ). The vendor software used to process and output the data is the Bruker Esprit v1.9 suite. The data includes the spectral (counts vs. keV energy) of the quasi in-situ scanned region (512×512 pixels at 56k magnification), along with the EDX scanning parameters. The.raw files from the Bruker Esprit v1.9 output are additionally included along with the.rpl data information files. Furthermore included are the two quasi in-situ HAADF images for visual comparison of the regions before and after irradiation. This in-situ experiment is deemed ' quasi' due to the thin foil irradiation taking place at an external TEM facility. We present this data for critical and/or extended analysis from the scientific community, with applications applying to: experimental data correlation, confirmation of results, and as computer based modeling inputs.

  16. Pragmatics of Raw Art

    DEFF Research Database (Denmark)

    Wilson, Alexander

    2014-01-01

    , and a contemporary zeitgeist marked by a general relativisation of aesthetic values has emerged, exploding into a plethora of parallel discourses on art. Perhaps there is no longer such a thing (if there ever was) as Culture with a capital C, which Dubuffet so vehemently opposed in his championing of art brut......’s adolescence without hypostatizing distinctions between inside and outside, or between culture and its raw or primitive origins, while nevertheless not conflating the dissolution of boundaries and hierarchies with a possible end to territoriality and control, nor promoting a resignation of thought...

  17. Validation of Cs-137 measurement in food samples using gamma spectrometry system

    International Nuclear Information System (INIS)

    Yii Mei Wo; Kamarozaman Ishak

    2005-01-01

    Cs-137 was found to be one of major radionuclide contaminant present in foods consumed by human. In some countries, regulations required consumption foods moving in international trade to be scanned for caesium (Cs-134 and Cs-137) to ensure it does not exceeding the maximum permissible level. This is to ensure that the intake of such foods will not accumulate radionuclide until the significant level inside the human body. Gamma Spectrometry System was used to perform the measurement of caesium isotopes, because it was one of the easiest methods to be performed. This measuring method must be validated for several parameters include specificity, precision (repeatability), bias (accuracy), linearity, range, detection limit, robustness and ruggedness in order to ensure it is fit for the purpose. This paper would summarise how these parameters were fulfilled for this analytical method using several types certified reference materials. The same validated method would be considered workable on Cs-134 as well. (Author)

  18. Attitudes toward health and taste of food among women with bulimia nervosa and women of a non-clinical sample.

    Science.gov (United States)

    Koritar, Priscila; Philippi, Sonia Tucunduva; Alvarenga, Marle Dos Santos

    2017-06-01

    Taste preferences and health concerns play important roles in determining eating attitudes, thus influencing food choices. Disordered eating attitudes are common among women, and can lead to the development and maintenance of eating disorders (ED). Attitudes toward health and taste of food among ED patients and its comparison with non-clinical women are not well known, and this knowledge could improve eating interventions. In this study, we compared taste preferences and health concerns in 27 women with diagnosis of bulimia nervosa (BN) and 216 women of a non-clinical sample. All participants completed the Health and Taste Attitude Scale (HTAS). Using analysis of covariance we compared the HTAS scores of the BN patients with those of the college students. Risk behaviors for ED (assessed by the Eating Attitudes Test) were identified in 54 (25%) of the non-clinical sample, all of whom were therefore excluded in comparison of BN patients. Non-clinical sample, compared to patients, scored higher on the HTAS Taste domain (p Health domain (p attitudes of women of non-clinical sample are related to taste and pleasure, whereas women with BN are concerned with adopting a diet regarded as healthy, thus increasing their interest in "light" products. Therefore, the taste and health concerns must be considered in nutrition interventions for women in general, and prevention and treatment of ED as determinants of food choice. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Diversity in fathers’ food parenting practices: A qualitative exploration within a heterogeneous sample

    Science.gov (United States)

    Khandpur, Neha; Charles, Jo; Blaine, Rachel E.; Blake, Christine; Davison, Kirsten

    2017-01-01

    Background Food parenting practices (FPPs) are important in shaping children’s dietary behaviors. However, existing FPP knowledge is largely based on research with mothers. Purpose This study (1) identified fathers’ FPPs; (2) described differences in FPP use by fathers’ education and residential status. Methods Semi-structured interviews were conducted with 40 fathers (39 ± 9.1 years; 37.5% non-residential; 40% ≥college education). Interviews were audio-recorded and transcribed. NVivo 10 was used for theme detection, categorization and classification using inductive and deductive approaches. FPPs were identified and their relative distribution was examined across education and residential status. Results Twenty FPPs were identified - 13 responsive practices and 7 unresponsive practices. Having food rules was the most common responsive FPP (81.5%), followed by feeding on schedule (60%) and making healthy food accessible (60%). Common unresponsive FPPs were letting child dictate preferences (70%), incentivizing food consumption (60%) and pressuring the child to eat (35%). Compared to fathers with a college education, more fathers without a college education reported letting child dictate preferences (92% vs. 37%), educating their children about food (37% vs 12%), fewer reported feeding on schedule (50% vs. 75%), modeling healthy practices (29% vs. 50%), and using distraction to feed (4% vs. 37%). Compared to residential fathers, more non-residential fathers monitored (60% vs. 40%) or encouraged (60% vs. 36%) child food intake and let child dictate preferences (87% vs. 60%). Conclusions Fathers used an extensive variety of FPPs, similar to those identified in mothers. Further study on the influence of fathers’ education and residential status on FPP use is warranted. PMID:26930383

  20. Diversity in fathers' food parenting practices: A qualitative exploration within a heterogeneous sample.

    Science.gov (United States)

    Khandpur, Neha; Charles, Jo; Blaine, Rachel E; Blake, Christine; Davison, Kirsten

    2016-06-01

    Food parenting practices (FPPs) are important in shaping children's dietary behaviors. However, existing FPP knowledge is largely based on research with mothers. This study (1) identified fathers' FPPs; (2) described differences in FPP use by fathers' education and residential status. Semi-structured interviews were conducted with 40 fathers (39 ± 9.1 years; 37.5% non-residential; 40% ≥college education). Interviews were audio-recorded and transcribed. NVivo 10 was used for theme detection, categorization and classification using inductive and deductive approaches. FPPs were identified and their relative distribution was examined across education and residential status. Twenty FPPs were identified - 13 responsive practices and 7 unresponsive practices. Having food rules was the most common responsive FPP (81.5%), followed by feeding on schedule (60%) and making healthy food accessible (60%). Common unresponsive FPPs were letting child dictate preferences (70%), incentivizing food consumption (60%) and pressuring the child to eat (35%). Compared to fathers with a college education, more fathers without a college education reported letting child dictate preferences (92% vs. 37%), educating their children about food (37% vs 12%), fewer reported feeding on schedule (50% vs. 75%), modeling healthy practices (29% vs. 50%), and using distraction to feed (4% vs. 37%). Compared to residential fathers, more non-residential fathers monitored (60% vs. 40%) or encouraged (60% vs. 36%) child food intake and let child dictate preferences (87% vs. 60%). Fathers used an extensive variety of FPPs, similar to those identified in mothers. Further study on the influence of fathers' education and residential status on FPP use is warranted. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Executive control resources and frequency of fatty food consumption: findings from an age-stratified community sample.

    Science.gov (United States)

    Hall, Peter A

    2012-03-01

    Fatty foods are regarded as highly appetitive, and self-control is often required to resist consumption. Executive control resources (ECRs) are potentially facilitative of self-control efforts, and therefore could predict success in the domain of dietary self-restraint. It is not currently known whether stronger ECRs facilitate resistance to fatty food consumption, and moreover, it is unknown whether such an effect would be stronger in some age groups than others. The purpose of the present study was to examine the association between ECRs and consumption of fatty foods among healthy community-dwelling adults across the adult life span. An age-stratified sample of individuals between 18 and 89 years of age attended two laboratory sessions. During the first session they completed two computer-administered tests of ECRs (Stroop and Go-NoGo) and a test of general cognitive function (Wechsler Abbreviated Scale of Intelligence); participants completed two consecutive 1-week recall measures to assess frequency of fatty and nonfatty food consumption. Regression analyses revealed that stronger ECRs were associated with lower frequency of fatty food consumption over the 2-week interval. This association was observed for both measures of ECR and a composite measure. The effect remained significant after adjustment for demographic variables (age, gender, socioeconomic status), general cognitive function, and body mass index. The observed effect of ECRs on fatty food consumption frequency was invariant across age group, and did not generalize to nonfatty food consumption. ECRs may be potentially important, though understudied, determinants of dietary behavior in adults across the life span.

  2. Sampling

    CERN Document Server

    Thompson, Steven K

    2012-01-01

    Praise for the Second Edition "This book has never had a competitor. It is the only book that takes a broad approach to sampling . . . any good personal statistics library should include a copy of this book." —Technometrics "Well-written . . . an excellent book on an important subject. Highly recommended." —Choice "An ideal reference for scientific researchers and other professionals who use sampling." —Zentralblatt Math Features new developments in the field combined with all aspects of obtaining, interpreting, and using sample data Sampling provides an up-to-date treat

  3. Method Comparison of Neutron Activation Analysis and Atomic Absorption Spectrometry for Determination of Zinc in Food Samples

    International Nuclear Information System (INIS)

    Endah Damastuti; Syukria Kurniawati; Natalia Adventini

    2009-01-01

    Zinc as a micro nutrient, has important roles in human metabolism system. It is required by the body in appropriate amount from food intake. Due to the very low concentration of Zinc in food, high selectivity and sensitivity analysis technique is required for the determination, such as Neutron Activation Analysis (NAA) and Atomic Absorption Spectrometry (AAS). In this experiment, both methods were compared in zinc analysis of food samples. The subject of this experiment is to examine of those methods conformity and improving the technique capability in zinc analysis in food sample. Those methods were validated by analyzing zinc in SRM NIST 1548a Typical Diet and were tested its accuracy and precision. The results of Zn concentration were 25.1 ± 2.14 mg/kg by NAA and 24.1 ± 1.40 mg/kg by AAS while the certificate value was 24.6 ± 1.80 mg/kg. Percentage of relative bias, %CV, μ-test score and HORRAT(Horwitz ratio) value given by NAA were 2%, 8.5%, 0.18 and 0.9 respectively, while %relative bias, %CV, μ-test score and HORRAT value given by AAS were 2%, 5.8 %, 0.20 and 0.6 respectively. The result obtained for Zn concentration in various food samples by NAA and AAS were varied from 13.7 – 29.3 mg/kg with mean value 19.8 mg/kg and 11.2 – 26.0 mg/kg with mean value 17.3 mg/kg (author)

  4. Remifentanil maintains lower initial delayed nonmatching-to-sample accuracy compared to food pellets in male rhesus monkeys.

    Science.gov (United States)

    Hutsell, Blake A; Banks, Matthew L

    2017-12-01

    Emerging human laboratory and preclinical drug self-administration data suggest that a history of contingent abused drug exposure impairs performance in operant discrimination procedures, such as delayed nonmatching-to-sample (DNMTS), that are hypothesized to assess components of executive function. However, these preclinical discrimination studies have exclusively used food as the reinforcer and the effects of drugs as reinforcers in these operant procedures are unknown. The present study determined effects of contingent intravenous remifentanil injections on DNMTS performance hypothesized to assess 1 aspect of executive function, working memory. Daily behavioral sessions consisted of 2 components with sequential intravenous remifentanil (0, 0.01-1.0 μg/kg/injection) or food (0, 1-10 pellets) availability in nonopioid dependent male rhesus monkeys (n = 3). Remifentanil functioned as a reinforcer in the DNMTS procedure. Similar delay-dependent DNMTS accuracy was observed under both remifentanil- and food-maintained components, such that higher accuracies were maintained at shorter (0.1-1.0 s) delays and lower accuracies approaching chance performance were maintained at longer (10-32 s) delays. Remifentanil maintained significantly lower initial DNMTS accuracy compared to food. Reinforcer magnitude was not an important determinant of DNMTS accuracy for either remifentanil or food. These results extend the range of experimental procedures under which drugs function as reinforcers. Furthermore, the selective remifentanil-induced decrease in initial DNMTS accuracy is consistent with a selective impairment of attentional, but not memorial, processes. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  5. The impact of acute stress on the neural processing of food cues in bulimia nervosa: Replication in two samples.

    Science.gov (United States)

    Collins, Brittany; Breithaupt, Lauren; McDowell, Jennifer E; Miller, L Stephen; Thompson, James; Fischer, Sarah

    2017-07-01

    The impact of acute stress on the neural processing of food cues in bulimia nervosa (BN) is unknown, despite theory that acute stress decreases cognitive control over food and hence increases vulnerability to environmental triggers for binge eating. Thus, the goals of this manuscript were to explore the impact of acute stress on the neural processing of food cues in BN. In Study 1, 10 women with Diagnostic and Statistical Manual of Mental Disorders (5th ed.; DSM-5; American Psychiatric Association, 2013) BN and 10 healthy controls participated in an fMRI paradigm examining the neural correlates of visual food cue processing pre and post an acute stress induction. Whole brain analysis indicated that women with BN exhibited significant decreases in activation in the precuneus, associated with self-referential processing, the paracingulate gyrus, and the anterior vermis of the cerebellum. Healthy controls exhibited increased activation in these regions in response to food cues poststress. In Study 2, 17 women with DSM-5 BN or otherwise specified feeding and eating disorder with BN symptoms participated in the same paradigm. A region of interest analysis replicated findings from Study 1. Replication of imaging findings in 2 different samples suggests the potential importance of these regions in relation to BN. Decreased activation in the precuneus, specifically, is consistent with models of BN that posit that binge eating serves as a concrete distraction from aversive internal stimuli. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  6. Field-Amplified Sample Injection-Micellar Electrokinetic Chromatography for the Determination of Benzophenones in Food Simulants

    Directory of Open Access Journals (Sweden)

    Cristina Félez

    2015-07-01

    Full Text Available A field-amplified sample injection-micellar electrokinetic chromatography (FASI-MEKC method for the determination of 14 benzophenones (BPs in a food simulant used in migration studies of food packaging materials was developed, allowing almost baseline separation in less than 21 min. The use of a 10 mM sodium dodecyl sulfate (SDS solution as sample matrix was mandatory to achieve FASI enhancement of the analyzed BPs. A 21- to 784-fold sensitivity enhancement was achieved with FASI-MEKC, obtaining limits of detection down to 5.1–68.4 µg/L, with acceptable run-to-run precisions (RSD values lower than 22.3% and accuracy (relative errors lower than 21.0%. Method performance was evaluated by quantifying BPs in the food simulant spiked at 500 µg/L (bellow the established specific migration limit for BP (600 µg/L by EU legislation. For a 95% confidence level, no statistical differences were observed between found and spiked concentrations (probability at the confidence level, p value, of 0.55, showing that the proposed FASI-MEKC method is suitable for the analysis of BPs in food packaging migration studies at the levels established by EU legislation.

  7. Detection of Listeria monocytogenes in ready-to-eat foods sampled from a catering service in Apulia, Italy.

    Science.gov (United States)

    Caggiano, Giuseppina; De Giglio, Osvalda; Lovero, Grazia; Rutigliano, Serafina; Diella, Giusy; Balbino, Stella; Napoli, Christian; Montagna, Maria Teresa

    2015-01-01

    Listeria monocytogenes is currently considered a relevant emerging food-borne pathogen. In particular, the European Centre for Disease Prevention and Control (ECDC) illustrates its widespread presence in different foods. In the present article, L. monocytogenes prevalence was estimated in cooked ready-to-eat foods sampled from a catering service in a Apulia city, southern Italy. The study was carried out from January to June 2014 in according to Regulation (EC) No. 852/2004, and ISO 11290-1:1996/Amd.1:2004 methods. Listeria spp. was isolated in 8.3% of the samples: L. monocytogenes was identified with the highest prevalence in potato gateau (66.6%), followed by rice dishes (11.1%), Listeria innocua was isolated from potato purea (11.1%) and cooked vegetables (11.1%). These preliminary results confirm the diffusion of the microorganism in ready-to-eat products; therefore, strategies aimed at protecting the consumers should be adopted. First of all, correct hygiene procedures should be followed and then microbiological tests should be implemented in order to early detect Listeria spp. (not only LM) contamination in cooked foods.

  8. Development of a non-thermal accelerated pulsed UV photolysis assisted digestion method for fresh and dried food samples

    International Nuclear Information System (INIS)

    Solis, C.; Lagunas-Solar, M.C.; Perley, B.P.; Pina, C.; Aguilar, L.F.; Flocchini, R.G.

    2002-01-01

    A simple, fast digestion procedure for fresh and dried foods, using high-power pulsed UV photolysis in the presence of hydrogen peroxide, is being developed. The homogenized food samples were mixed with H 2 O 2 or with a mixture of H 2 O 2 and HNO 3 , and irradiated for short times with a 248-nm UV excimer laser. After centrifugation, a clear, colorless solution was obtained and aliquots were deposited on Teflon filters for XRF and/or PIXE analyses. Standard reference materials (NIST Peach Leaves; Typical Diet) were also analyzed to compare recoveries and detection limits. Improvements in detection limits were observed, but a few trace elements (<1 ppm) were not reproducibly detected (Fe, Sr). This method proved to be practical for the accelerated digestion of food samples and preparing analytes in short-time intervals. In combination with PIXE and XRF, it allows high-sensitivity multi-elemental analyses for screening the nutritional elements and for food safety purposes regarding the potential presence of toxic elements. Further development to optimize and validate this procedure for a broader range of analytes is in progress

  9. A preconcentration system for determination of copper and nickel in water and food samples employing flame atomic absorption spectrometry

    OpenAIRE

    Tuzen, Mustafa; Soylak, Mustafa; Citak, Demirhan; Ferreira, Hadla S.; Korn, Maria das Graças Andrade; Bezerra, Marcos de Almeida

    2009-01-01

    Texto completo: acesso restrito. p. 1041-1045 A separation/preconcentration procedure using solid phase extraction has been proposed for the flame atomic absorption spectrometric determination of copper and nickel at trace level in food samples. The solid phase is Dowex Optipore SD-2 resin contained on a minicolumn, where analyte ions are sorbed as 5-methyl-4-(2-thiazolylazo) resorcinol chelates. After elution using 1 mol L−1 nitric acid solution, the analytes are determinate employing fla...

  10. 21 CFR Appendix C to Part 101 - Nutrition Facts for Raw Fruits and Vegetables

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Nutrition Facts for Raw Fruits and Vegetables C Appendix C to Part 101 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FOOD LABELING Pt. 101, App. C Appendix C to Part 101—Nutrition Facts...

  11. Microbiological quality of retail cheeses made from raw, thermized or pasteurized milk in the UK.

    Science.gov (United States)

    Little, C L; Rhoades, J R; Sagoo, S K; Harris, J; Greenwood, M; Mithani, V; Grant, K; McLauchlin, J

    2008-04-01

    Two studies of retail fresh, ripened and semi-hard cheeses made from raw, thermized or pasteurized milk were undertaken in the UK during 2004 and 2005 to determine the microbiological quality of these products. Using microbiological criteria in European Commission Recommendations 2004/24/EC and 2005/175/EC, 2% of both raw, thermized (37/1819 samples) and pasteurized (51/2618 samples) milk cheeses were of unsatisfactory quality. Raw or thermized milk cheeses were of unsatisfactory quality due to levels of Staphylococcus aureus at 10(4)cfu g(-1), Escherichia coli at 10(5)cfu g(-1), and/or Listeria monocytogenes at 10(2)cfu g(-1), whereas pasteurized milk cheeses were of unsatisfactory quality due to S. aureus at 10(3)cfu g(-1) and/or E. coli at 10(3)cfu g(-1). Salmonella was not detected in any samples. Cheeses were of unsatisfactory quality more frequently when sampled from premises rated as having little or no confidence in management and control systems, and stored/displayed at above 8 degrees C. Raw or thermized milk cheeses were also more likely to be of unsatisfactory quality when they were unripened types, and pasteurized milk cheeses when they were: semi-hard types; from specialist cheese shops or delicatessens; cut to order. These results emphasize the need for applying and maintaining good hygiene practices throughout the food chain to prevent contamination and/or bacterial growth. Labelling of cheeses with clear information on whether the cheese was prepared from raw milk also requires improvement.

  12. Method for selecting raw materials to preparing ceramic masses: application to raw material for red ceramic

    International Nuclear Information System (INIS)

    Moreno, Maria Margarita Torres; Rocha, Rogers Raphael da; Zanard, Antenor

    2012-01-01

    We studied the raw materials used in a factory building blocks, located in Cesario Lange city (SP). It extracts raw materials from various sources in the region to make the dough. The mixtures were prepared from dry milled powders based on data related to the plasticity of the raw materials. It was obtained with the apparatus Vicat-cone in order to obtain similar levels of water absorption of the samples burned at 900 deg C for all compositions. To quantify the proportion of each clay was used the Lever Rule. In this firing temperature, where sintering is mainly by diffusion from a solid state, different compositions of the same set of four raw materials resulted in similar values. (author)

  13. Simultaneous Detection of Four Foodborne Viruses in Food Samples Using a One-Step Multiplex Reverse Transcription PCR.

    Science.gov (United States)

    Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

    2018-02-28

    A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

  14. β-Cyclodextrin coated CdSe/ZnS quantum dots for vanillin sensoring in food samples.

    Science.gov (United States)

    Durán, Gema M; Contento, Ana M; Ríos, Ángel

    2015-01-01

    An optical sensor for vanillin in food samples using CdSe/ZnS quantum dots (QDs) modified with β-cyclodextrin (β-CD) was developed. This vanillin-sensor is based on the selective host-guest interaction between vanillin and β-cyclodextrin. The procedure for the synthesis of β-cyclodextrin-CdSe/ZnS (β-CD-CdSe/ZnS-QDs) complex was optimized, and its fluorescent characteristics are reported. It was found that the interaction between vanillin and β-CD-CdSe/ZnS-QDs complex produced the quenching of the original fluorescence of β-CD-CdSe/ZnS-QDs according to the Stern-Volmer equation. The mechanism of the interaction is discussed. The analytical potential of this sensoring system was demonstrated by the determination of vanillin in synthetic and food samples. The method was selective for vanillin, with a limit of detection of 0.99 µg mL(-1), and a reproducibility of 4.1% in terms of relative standard deviation (1.2% under repeatability conditions). Recovery values were in the 90-105% range for food samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Bacteriological quality of raw camel milk along the market value chain in Fafen zone, Ethiopian Somali regional state.

    Science.gov (United States)

    Abera, Tsegalem; Legesse, Yoseph; Mummed, Behar; Urga, Befekadu

    2016-05-26

    The camel is a multipurpose animal with a huge productive potential. Camel milk is a key food in arid and semi-arid areas of the African and Asian countries. The quality of milk is influenced by different bacteria present in milk. This study was conducted to evaluate total bacterial content in raw camel milk along the market chain in Fafen zone, Ethiopian Somali Regional State. One hundred twenty-six raw camel milk samples were collected from Gursum (47.1 %) and Babile (52.9 %) districts. The three sampling levels included were udder (14.7 %), milking bucket (29.4 %) and market (55.9 %). Milk samples were analyzed for total bacterial counts (TBC) and coliform counts (CC). Furthermore, major pathogens were isolated and identified. 108 (85.7 %) of raw camel milk samples demonstrated bacterial contamination. The overall mean TBC and CC of contaminated raw camel milk samples was 4.75 ± 0.17 and 4.03 ± 0.26 log CFU/ml, respectively. TBC increased from udder to market level and was higher in Gursum compared to Babile district (P < 0.05). Around 38.9 % of TBCs and 88.2 % CCs in contaminated raw camel milk samples were in the range considered unsafe for human utility. Staphylococcus spp. (89.8 %), Streptococcus spp. (53.7 %), E. coli (31.5 %), Salmonella spp. (17.6 %), Klebsiella spp. (5.6 %) and Enterobacter spp. (5.6 %) were the major bacterial microorganisms isolated. The majority of the bacterial isolates in this study showed high incidence in market as compared to production level. These results indicate a lack of compliance with good production practices and hygiene at milking, transportation and market of raw camel milk.

  16. Analysis of toxic trace elements in sea food samples by neutron activation

    International Nuclear Information System (INIS)

    Sarmani, S.; Majid, A.A.; Wood, A.K.; Hamzah, Z.

    1993-01-01

    The contents of toxic and essential trace element were analysed such as As, Hg, Se and Zn by neutron activation analysis in coastal fishes consumed by the general population of Malaysia. The mean values of the elements analysed expressed in mg/kg fresh weight ranged 1.42-5.61, 0.06-0.42, 4.2-20.6, 0.41-1.28 for As, Hg, Zn and Se, respectively. The maximum permissible limit for As in food was set at 1.0 mg/kg under the Malaysian Food Regulations. The results showed that consumption of coastal fishes is not permitted under the regulations, while the levels of Hg, Se and Zn were within the permissible limits. The daily dietary intake of As and Hg at 400 μg and 30 μg respectively are still within the tolerance levels. (author) 9 refs.; 2 tabs

  17. Data in support of the detection of genetically modified organisms (GMOs in food and feed samples

    Directory of Open Access Journals (Sweden)

    Noor Alasaad

    2016-06-01

    The methods applied in the brief data are based on DNA analysis by Polymerase Chain Reaction (PCR. This technique is specific, practical, reproducible and sensitive enough to detect up to 0.1% GMO in food and/or feedstuffs. Furthermore, all of the techniques mentioned are economic and can be applied in Syria and other developing countries. For all these reasons, the DNA-based analysis methods were chosen and preferred over protein-based analysis.

  18. Behavioral Contexts, Food-Choice Coping Strategies, and Dietary Quality of a Multiethnic Sample of Employed Parents

    Science.gov (United States)

    Blake, Christine E.; Wethington, Elaine; Farrell, Tracy J.; Bisogni, Carole A.; Devine, Carol M.

    2012-01-01

    Employed parents’ work and family conditions provide behavioral contexts for their food choices. Relationships between employed parents’ food-choice coping strategies, behavioral contexts, and dietary quality were evaluated. Data on work and family conditions, sociodemographic characteristics, eating behavior, and dietary intake from two 24-hour dietary recalls were collected in a random sample cross-sectional pilot telephone survey in the fall of 2006. Black, white, and Latino employed mothers (n=25) and fathers (n=25) were recruited from a low/moderate income urban area in upstate New York. Hierarchical cluster analysis (Ward’s method) identified three clusters of parents differing in use of food-choice coping strategies (ie, Individualized Eating, Missing Meals, and Home Cooking). Cluster sociodemographic, work, and family characteristics were compared using χ2 and Fisher’s exact tests. Cluster differences in dietary quality (Healthy Eating Index 2005) were analyzed using analysis of variance. Clusters differed significantly (P≤0.05) on food-choice coping strategies, dietary quality, and behavioral contexts (ie, work schedule, marital status, partner’s employment, and number of children). Individualized Eating and Missing Meals clusters were characterized by nonstandard work hours, having a working partner, single parenthood and with family meals away from home, grabbing quick food instead of a meal, using convenience entrées at home, and missing meals or individualized eating. The Home Cooking cluster included considerably more married fathers with nonemployed spouses and more home-cooked family meals. Food-choice coping strategies affecting dietary quality reflect parents’ work and family conditions. Nutritional guidance and family policy needs to consider these important behavioral contexts for family nutrition and health. PMID:21338739

  19. Accuracy of reported food intake in a sample of 7-10 year-old children in Serbia.

    Science.gov (United States)

    Šumonja, S; Jevtić, M

    2016-09-01

    Children's ability to recall and report dietary intake is affected by age and cognitive skills. Dietary intake reporting accuracy in children is associated with age, weight status, cognitive, behavioural, social factors and dietary assessment techniques. This study analysed accuracy of 7-10 year-old children's reported food intake for one day. Validation study. Sample included 94 children aged 7-10 years (median = 9 years) from two elementary schools in a local community in Serbia. 'My meals for one day' questionnaire was a combination of 24-h recall and food recognition form. It included recalls for five meals: breakfast at home; snack at home; lunch at home; snack at school and dinner at home. Parental reports were used as reference information about children's food intake for meals obtained at home and observation was used to gain reference information for school meal. Observed and reported amounts were used to calculate omission rate, intrusion rate, corresponding, over-reported and unreported amounts of energy, correspondence rate and inflation ratio. Overall omission rate (37.5%) was higher than overall intrusion rate (36.7%). The same food item (bread) has been the most often correctly reported and omitted food item for breakfast, lunch and dinner. Snack at school had the greatest mean correspondence rate (79.6%) and snack at home the highest mean inflation ratio (90.7%). Most errors in children's recalls were incorrectly reported amounts and not the food items. The questionnaire should be improved to facilitate accurate reports of the amounts. Copyright © 2016 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

  20. Impact of food processing and storage conditions on nitrate content in canned vegetable-based infant foods.

    Science.gov (United States)

    Tamme, T; Reinik, M; Roasto, M; Meremäe, K; Kiis, A

    2009-08-01

    The nitrate and nitrite contents were determined in canned vegetable-based infant foods of five varieties. Furthermore, changes in nitrate content during industrial processing were studied. Samples were taken from raw materials, homogenized mixtures, and final products after sterilization, and then analyzed for nitrate and nitrite content by high-pressure liquid chromatography. Processing steps preceding heat treatment, such as vegetable peeling and washing, decreased the nitrate concentrations in the range of 17 to 52%. During processing, the nitrate content in canned infant foods decreased 39 to 50%, compared with nitrate concentration in the raw-vegetable mixture. The final nitrate concentration in infant foods depends mainly on the initial nitrate content of the raw-vegetable mixture. The effect of storage time (24 and 48 h) and temperature (4 to 6 degrees C and 20 to 22 degrees C) on nitrate and nitrite content in opened canned infant-food samples was studied. After 24 h of storage at refrigerated and room temperatures, the mean nitrate content increased on average by 7 and 13%, and after 48 h of storage by 15 and 29%, respectively. The nitrite content in all analyzed samples was below the quantification limit. Storage requirements of industrial manufacturers must be followed strictly. Opened can foods, stored under refrigerated conditions, have to be consumed within 2 days, as recommended by manufacturers. The infant-food producers must pay more attention to the quality of raw materials. Nitrate content analyses should be added as compulsory tests to the quality assurance programs.

  1. Total arsenic in selected food samples from Argentina: Estimation of their contribution to inorganic arsenic dietary intake.

    Science.gov (United States)

    Sigrist, Mirna; Hilbe, Nandi; Brusa, Lucila; Campagnoli, Darío; Beldoménico, Horacio

    2016-11-01

    An optimized flow injection hydride generation atomic absorption spectroscopy (FI-HGAAS) method was used to determine total arsenic in selected food samples (beef, chicken, fish, milk, cheese, egg, rice, rice-based products, wheat flour, corn flour, oats, breakfast cereals, legumes and potatoes) and to estimate their contributions to inorganic arsenic dietary intake. The limit of detection (LOD) and limit of quantification (LOQ) values obtained were 6μgkg(-)(1) and 18μgkg(-)(1), respectively. The mean recovery range obtained for all food at a fortification level of 200μgkg(-)(1) was 85-110%. Accuracy was evaluated using dogfish liver certified reference material (DOLT-3 NRC) for trace metals. The highest total arsenic concentrations (in μgkg(-)(1)) were found in fish (152-439), rice (87-316) and rice-based products (52-201). The contribution to inorganic arsenic (i-As) intake was calculated from the mean i-As content of each food (calculated by applying conversion factors to total arsenic data) and the mean consumption per day. The primary contributors to inorganic arsenic intake were wheat flour, including its proportion in wheat flour-based products (breads, pasta and cookies), followed by rice; both foods account for close to 53% and 17% of the intake, respectively. The i-As dietary intake, estimated as 10.7μgday(-)(1), was significantly lower than that from drinking water in vast regions of Argentina. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Isolation and identification of Salmonella typhimurium from raw cow, sheep and goat milk in Chahamaha Va Bakhteyari Province

    Directory of Open Access Journals (Sweden)

    F Tajbakhsh

    2014-05-01

    Full Text Available Salmonella typhimurium and S. enteritidisare known as the major causes of food-borne infection throughout the world. The present study was carried out to investigate the prevalence of S. typhimurium in raw milks of Chahamaha Va Bakhteyari province. For this reason, a total of 550 raw milks (consisting of 200 cow, 175 sheep and 175 goat milk samples were collected through October 2011 to March 2012 from dairy herds around Shahrekord. The samples were cultured and the isolated colonies were confirmed by PCR using species-specific ST11 and ST15 primers. According to the results, a total of 20 samples (3.63% were found positive for Salmonellaspp.Amongst, 14 (2.54% of cow milk, 2 (0.36% of sheep milk and 4 (0.72% of goat milk samples were contaminated. Using PCR, 9 (1.63% samples were contaminated with S. typhimurium. The results indicated a relatively high occurrence of S. typhimurium in raw milks. Therefore, it is essential to maintain hygienic measures during milking and handling. Besides, it is recommended not to use raw milk for the manufacturing of dairy products such as cheese and ice-cream.

  3. Determination of selenium in food matrices by replicate sample neutron activation analysis

    International Nuclear Information System (INIS)

    Ventura, M.G.; Freitas, M.C.; Ventura, M.G.; Pacheco, A.M.G.

    2009-01-01

    The replicate sample instrumental neutron activation method was optimized and used for the determination of selenium in foodstuffs. The method was reliable, yielding accurate results. Lower detections limits were obtained after each successive irradiation. Different irradiation conditions were used depending on the type of sample. For samples with higher selenium contents (meat, fish, eggs), the measured selenium in the first replicate is in all cases larger than the detection limit, but a better accuracy was obtained with a larger number of replicates (2-3 replicates). For samples with extremely low selenium contents (vegetable samples), at least seven replicates were necessary to obtain a concentration value two times larger than the detection limit. (author)

  4. Trace determination of 10 beta-lactam antibiotics in environmental and food samples by capillary liquid chromatography.

    Science.gov (United States)

    Bailón-Pérez, M I; García-Campaña, A M; del Olmo-Iruela, M; Gámiz-Gracia, L; Cruces-Blanco, C

    2009-11-20

    A sensitive and reliable method using capillary HPLC with UV-diode array detection (DAD) has been developed and validated for the trace determination of residues of 10 beta-lactam antibiotics of human and veterinary use, in milk, chicken meat and environmental water samples. The analytes included ampicillin, amoxicillin, penicillin V, penicillin G, cloxacillin, oxacillin, dicloxacillin, nafcillin, piperacillin and clavulanic acid. Legal levels are regulated by the EU Council regulation 2377/90 in animal edible tissues for these compounds. For food analysis, a solid-phase extraction (SPE) procedure consisting in a tandem of Oasis HLB and Alumina N cartridges was applied for off-line preconcentration and cleanup. For water analysis, the first step was only necessary. The limits of detection for the studied compounds were between 0.04-0.06 microg l(-1) for water samples and 0.80-1.40 microg l(-1) (or microg kg(-1)) in the case of foods derived from animals. Average recoveries for fortified samples at different concentration levels ranged between 82.9% and 98.2%, with relative standard deviations (RSDs) lower than 9%. The method showed the advantages of capillary HPLC for the detection of these widely applied antibiotics in different samples at very low concentration levels.

  5. Cardiotoxic Effects of Raw Opium.

    Science.gov (United States)

    Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj

    2018-01-01

    While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.

  6. Cardiotoxic Effects of Raw Opium

    OpenAIRE

    Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj

    2018-01-01

    While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.

  7. Contamination of food samples from Malaysia with polychlorinated dibenzo-p-dioxins and dibenzofurans and estimation of human intake.

    Science.gov (United States)

    Leong, Yin-Hui; Chiang, Pui-Nyuk; Jaafar, Hajjaj Juharullah; Gan, Chee-Yuen; Majid, Mohamed Isa Abdul

    2014-04-01

    A total of 126 food samples, categorised into three groups (seafood and seafood products, meat and meat products, as well as milk and dairy products) from Malaysia were analysed for polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs). The concentration of PCDD/Fs that ranged from 0.16 to 0.25 pg WHO05-TEQ g(-1) fw was found in these samples. According to the food consumption data from the Global Environment Monitoring System (GEMS) of the World Health Organization (WHO), the dietary exposures to PCDD/F from seafood and seafood products, meat and meat products, as well as milk and dairy products for the general population in Malaysia were 0.064, 0.183 and 0.736 pg WHO05-TEQ kg(-1) bw day(-1), respectively. However, the exposure was higher in seafood and seafood products (0.415 pg WHO05-TEQ kg(-1) bw day(-1)) and meat and meat products (0.317 pg WHO05-TEQ kg(-1) bw day(-1)) when the data were estimated using the Malaysian food consumption statistics. The lower exposure was observed in dairy products with an estimation of 0.365 pg WHO05-TEQ kg(-1) bw day(-1). Overall, these dietary exposure estimates were much lower than the tolerable daily intake (TDI) as recommended by WHO. Thus, it is suggested that the dietary exposure to PCDD/F does not represent a risk for human health in Malaysia.

  8. Food Sample Preparation for the Determination of Sulfonamides by High-Performance Liquid Chromatography: State-of-the-Art

    Directory of Open Access Journals (Sweden)

    Dimitrios Bitas

    2018-06-01

    Full Text Available Antibiotics are a common practice in veterinary medicine, mainly for therapeutic purposes. Sectors of application include livestock farming, aquacultures, and bee-keeping, where bacterial infections are frequent and can be economically damaging. However, antibiotics are usually administered in sub-therapeutic doses as prophylactic and growth promoting agents. Due to their excessive use, antibiotic residues can be present in foods of animal origin, which include meat, fish, milk, eggs, and honey, posing health risks to consumers. For this reason, authorities have set maximum residue limits (MRLs of certain antibiotics in food matrices, while analytical methods for their determination have been developed. This work focuses on antibiotic extraction and determination, part of which was presented at the “1st Conference in Chemistry for Graduate, Postgraduate Students and PhD Candidates at the Aristotle University of Thessaloniki”. Taking a step further, this paper is a review of the most recent sample preparation protocols applied for the extraction of sulfonamide antibiotics from food samples and their determination with high-performance liquid chromatography (HPLC, covering a five-year period.

  9. Reagent-Less and Robust Biosensor for Direct Determination of Lactate in Food Samples

    OpenAIRE

    Bravo, Iria; Revenga-Parra, M?nica; Pariente, F?lix; Lorenzo, Encarnaci?n

    2017-01-01

    Lactic acid is a relevant analyte in the food industry, since it affects the flavor, freshness, and storage quality of several products, such as milk and dairy products, juices, or wines. It is the product of lactose or malo-lactic fermentation. In this work, we developed a lactate biosensor based on the immobilization of lactate oxidase (LOx) onto N,N′-Bis(3,4-dihydroxybenzylidene) -1,2-diaminobenzene Schiff base tetradentate ligand-modified gold nanoparticles (3,4DHS–AuNPs) deposited onto s...

  10. Multidimensional analysis of food-allergic children and adolescents' self-concept: A comparison with a healthy matched sample.

    Science.gov (United States)

    Polloni, Laura; Baldi, Ileana; Lazzarotto, Francesca; Bonaguro, Roberta; Toniolo, Alice; Gregori, Dario; Muraro, Antonella

    2015-06-01

    The study investigated self-concept in food-allergic youths and matched healthy controls. Global and domain-specific self-concepts were assessed in 154 participants (9-19 years) using the Multidimensional Self-Concept Scale. Statistical analysis assessed differences between the two samples and effects of asthma, dermatitis, age, and gender among patients. Significant differences were found for Total Scale score and for Competence and Physical scores. Patients showed clinically problematic self-concepts in Global, Competence, and Family domains. Age was found to be associated with the Total score. Health professionals should consider food-allergic patients' personality development. Further studies could examine disease-specific consequences and interventions. © The Author(s) 2015.

  11. Real-time sampling of reasons for hedonic food consumption: Further validation of the Palatable Eating Motives Scale

    Directory of Open Access Journals (Sweden)

    Mary M. Boggiano

    2015-06-01

    Full Text Available Highly palatable foods play a salient role in obesity and binge-eating, and if habitually eaten to deal with intrinsic and extrinsic factors unrelated to metabolic need, may compromise adaptive coping and interpersonal skills. This study used event sampling methodology (ESM to examine whether individuals who report eating palatable foods primarily to cope, to enhance reward, to be social, or to conform, as measured by the Palatable Eating Motives Scale (PEMS, actually eat these foods primarily for the motive(s they report on the PEMS. Secondly this study examined if the previously reported ability of the PEMS Coping motive to predict BMI would replicate if the real-time (ESM-reported coping motive was used to predict BMI. A total of 1691 palatable eating events were collected from 169 college students over 4 days. Each event included the day, time, and types of tasty foods or drinks consumed followed by a survey that included an abbreviated version of the PEMS, hunger as an additional possible motive, and a question assessing general perceived stress during the eating event. Two-level mixed modeling confirmed that ESM-reported motives correlated most strongly with their respective PEMS motives and that all were negatively associated with eating for hunger. While stress surrounding the eating event was strongly associated with the ESM-coping motive, its inclusion in the model as a predictor of this motive did not abolish the significant association between ESM and PEMS Coping scores. Regression models confirmed that scores on the ESM-coping motive predicted BMI. These findings provide ecological validity for the PEMS to identify true-to-life motives for consuming palatable foods. This further adds to the utility of the PEMS in individualizing, and hence improving, treatment strategies for obesity, binge-eating, dietary nutrition, coping, reward acquisition, and psychosocial skills.

  12. The antimicrobial effects of chopped garlic in ground beef and raw meatball (ciğ köfte).

    Science.gov (United States)

    Aydin, Ali; Bostan, Kamil; Erkan, Mehmet Emin; Bingöl, Bariş

    2007-03-01

    This study was carried out to investigate the antimicrobial effects of chopped garlic in ground beef and raw meatball (çig köfte), which is a traditional food product eaten raw. Fresh minced ground beef and raw meatball batter prepared with traditional methods were separated into groups. Chopped and crushed garlic was added to each batch in order to reach various concentrations from 0% to 10%. The ground beef samples were stored at refrigerator and ambient temperatures. The raw meatball samples were only stored at room temperature. All samples were analyzed in order to determine the microbial counts at the 2(nd), 6(th), 12(th), and 24(th) hours of storage. Garlic addition decreased the microbial growth in some ground beef samples kept either at room temperature or in the refrigerator. However, microbial growth increased in some ground beef samples kept in similar conditions. The difference was found in samples kept in the refrigerator for 24 hours in terms of total aerobic mesophilic bacteria and coliform bacteria when garlic used at 10%. The effects of garlic on the microbial growth of both coliforms and Staphylococcus/Micrococcus in the samples kept at room temperature were increased. The yeast and mold counts in ground beef samples kept in any condition were not affected by garlic addition. However, the addition of garlic to the raw meatball mix decreased the microbial count, in terms of total aerobic mesophilic bacteria and yeast and mold counts, when the garlic was added at 5% or 10% (P meatball caused a permanent decrease in yeast and mold count, unlike in ground beef. The results of this study indicate that the chopped garlic has a slowing-down effect on microbiological growth in ground meat depending on the garlic concentration, but this effect was not at an expected level even at the highest concentration, because potential antimicrobial agents in chopped garlic were probably insufficiently extracted.

  13. O óleo de abacate (Persea americana Mill como matéria-prima para a indústria alimentícia The avocado oil (Persea americana Mill as a raw material for the food industry

    Directory of Open Access Journals (Sweden)

    Jocelem Mastrodi Salgado

    2008-12-01

    excellent raw material for the food industry. Besides, the fatty acid composition and the sterols presents in the avocado oil are similar to the olive oil. Thus, the avocado oil can substitute the soybean oil, or it can be mixed with the olive oil offering the Brazilian consumers a product of high quality and low cost.

  14. Development of methods for the neutron activation analysis to the determination of essential and toxic trace elements of biological and environmental samples: application of enzyme activity of raw hides

    International Nuclear Information System (INIS)

    Sipos, T.; Nagy, L.G.; Toeroek, G.; Kollar, J.

    1974-01-01

    Investigations on the post mortem enzymatic processes pointed out the fact, that significant deviations can be observed in the extent and in the results of the autolytic transformations occurring during the storage of raw hide. A neutron activation analysis procedure, based on a semiautomated radiochemical separation procedure and scintillation gamma spectrometry, was selected for the determination of some trace elements. Six trace elements, Cu, Mn, Zn, Au, As, and Cr, and one minor component,Br, were detected and/or determined in the concentration region of 0,1-10 3 ppM. According to preliminary investigations evaluated at the time being, concentration differences of some orders of magnitude were obtained for some trace elements: copper, zinc and manganese, whereas the concentration of bromine remained practically constant. These findings seem to correlate with large differences in appearance due to different enzyme activities in the raw hides

  15. Ultrasensitive determination of formaldehyde in environmental waters and food samples after derivatization and using silver nanoparticle assisted SERS

    International Nuclear Information System (INIS)

    Ma, Pinyi; Wang, Di; Yang, Qingqing; Song, Daqian; Wang, Xinghua; Liang, Fanghui; Ding, Yaying; Yu, Yong; Gao, Dejiang

    2015-01-01

    A selective and ultrasensitive surface-enhanced Raman spectroscopy (SERS) method was developed for the determination of formaldehyde (HCHO) in environmental waters and food samples. It is based on derivatization of HCHO with 4-amino-5-hydrazino-3-mercapto-1,2,4-triazole (AHMT) with HCHO. One of the products of the derivative reaction, 6-mercapto-5-triazolo[4,3-b]-s-tetrazine (MTT), can be quantified by SERS at 832 cm −1 using silver nanoparticles (AgNPs) as substrates. The incubation time for derivatization, the volume of reagents and the mixing times were optimized. The peak areas of the SERS are linearly related to the concentration of HCHO in the 1 − 1,000 μg L −1 range, the limit of detection is 0.15 μg L −1 , and the limit of quantification is 0.45 μg L −1 . Recoveries obtained by analyzing two spiked samples of environmental water and two spiked food samples were in the range between 91.0 and 108.7 %. There is no significant difference between the results obtained by the present method and the liquid chromatographic method (Chinese industrial standard method, SN/T 1547-2011). (author)

  16. LAMP-based group specific detection of aflatoxin producers within Aspergillus section Flavi in food raw materials, spices, and dried fruit using neutral red for visible-light signal detection.

    Science.gov (United States)

    Niessen, Ludwig; Bechtner, Julia; Fodil, Sihem; Taniwaki, Marta H; Vogel, Rudi F

    2018-02-02

    Aflatoxins can be produced by 21 species within sections Flavi (16 species), Ochraceorosei (2), and Nidulantes (3) of the fungal genus Aspergillus. They pose risks to human and animal health due to high toxicity and carcinogenicity. Detecting aflatoxin producers can help to assess toxicological risks associated with contaminated commodities. Species specific molecular assays (PCR and LAMP) are available for detection of major producers, but fail to detect species of minor importance. To enable rapid and sensitive detection of several aflatoxin producing species in a single analysis, a nor1 gene-specific LAMP assay was developed. Specificity testing showed that among 128 fungal species from 28 genera, 15 aflatoxigenic species in section Flavi were detected, including synonyms of A. flavus and A. parasiticus. No cross reactions were found with other tested species. The detection limit of the assay was 9.03pg of A. parasiticus genomic DNA per reaction. Visual detection of positive LAMP reactions under daylight conditions was facilitated using neutral red to allow unambiguous distinction between positive and negative assay results. Application of the assay to the detection of A. parasiticus conidia revealed a detection limit of 211 conidia per reaction after minimal sample preparation. The usefulness of the assay was demonstrated in the analysis of aflatoxinogenic species in samples of rice, nuts, raisins, dried figs, as well as powdered spices. Comparison of LAMP results with presence/absence of aflatoxins and aflatoxin producing fungi in 50 rice samples showed good correlation between these parameters. Our study suggests that the developed LAMP assay is a rapid, sensitive and user-friendly tool for surveillance and quality control in our food industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Crave, like, eat: determinants of food intake in a sample of children and adolescents with a wide range in body mass

    Directory of Open Access Journals (Sweden)

    Johannes Hofmann

    2016-09-01

    Full Text Available Obesity is heterogeneous condition with obese individuals displaying different eating patterns. Growing evidence suggests that there is a subgroup of obese adults that is marked by frequent and intense food cravings and addiction-like consumption of high-calorie foods. Little is known, however, about such a subgroup of obese individuals in childhood and adolescence. In the present study, a sample of children and adolescents with a wide range in body mass was investigated and trait food craving, liking for and intake of high- and low-calorie foods was measured. One-hundred and forty-two children and adolescents (51.4% female, n = 73; Mage = 13.7 years, SD = 2.25; MBMI-SDS = 1.26, SD = 1.50 completed the Food Cravings Questionnaire - Trait, then viewed pictures of high- and low-calorie foods and rated their liking for them, and subsequently consumed some of these foods in a bogus taste test. Contrary to expectations, higher body mass was associated with lower consumption of high-calorie foods. However, there was an interaction between body mass and trait food craving when predicting food consumption: in obese participants, higher trait food craving was associated with higher consumption of high-calorie foods and this association was not found in normal-weight participants. The relationship between trait food craving and high-calorie food consumption within obese individuals was mediated by higher liking for high-calorie foods (but not by liking for low-calorie foods. Thus, similar to adults, a subgroup of obese children and adolescents - characterized by high trait food craving - seems to exist, calling for specific targeted treatment strategies.

  18. Microelements and heavy metals in raw cow milk from various regions in Serbia

    Directory of Open Access Journals (Sweden)

    Živkov-Baloš Milica

    2013-01-01

    Full Text Available In this study, the investigation results of raw milk and animal feed samples from farms located around industrial areas and from rural areas in Serbia are presented. Various microelements and heavy metals (Zn, Cu, Fe, Pb and Cd were determined by atomic absorption spectrophotometry (AAS. Mean concentration of Zn, Cu, Fe and Cd in raw milk were 5.94, 0.239, 2.034 and below 0.005 mg/kg, respectively. The mean lead concentration found in milk from a farm located near industrial area was 0.242±0.166 mg/kg (mean Pb concentrations for other four investigated farms were below 0.05 mg/kg. The obtained results indicate that particular attention should be paid to control of Pb residues in food, water and environment. [Projekat Ministarstva nauke Republike Srbije, br. TR 31084

  19. Assess the prevalence rate of Campylobacter genus and Campylobacter jejuni species in raw milk collected from the Amol City by Multiplex- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ali Dabiri

    2016-03-01

    Full Text Available Background & Objective: Campylobacter can be transmitted through the raw milk. The purpose of this study was to determine the prevalence of Campylobacter genus and Campylobacter jejuni (C. jejuni species in raw milk samples. Materials & Methods: In this study, 72 samples of raw milk were collected of the platforms milk in the Amol city in summer. Phenotypic identification of Campylobacter genus and C. jejuni species using microbiology laboratory methods and molecular identification of this bacterium using Multiplex- Polymerase Chain Reaction (M-PCR were performed. The data was calculated using the SPSS 16.0 software and the Fisher's exact test (p < 0.05. Results: Among the 72 samples, 13.88% of samples were contaminated with C. jejuni and 2.77% were contaminated with Campylobacter genus. The highest prevalence rate for this bacterium was in July (20.83% and the lowest prevalence rate was in September (12.5%. The significant difference between the prevalence of the Campylobacter genus and C. jejuni species in raw milk samples in various months of summer was not observed (p = 0.07. Conclusion: This study showed the raw milk contamination with Campylobacter, and thereby the sanitation in the dairy food production places and the use of fast and accurate method to identify this bacterium is important.

  20. Survey to determine why people drink raw milk.

    Science.gov (United States)

    Mullin, Gerard E; Belkoff, Stephen M

    2014-11-01

    Fragility fractures associated with osteoporosis extract a large financial and personal toll on society. Pharmaceutical or dietary calcium intake is needed to increase bone mineral density to prevent fragility fractures. Although dairy products are a good source of calcium, patients who are unable to digest lactose tend to avoid them and are put at a greater risk for fracture than the general population. Anecdotal reports suggest that lactose maldigesters, when consuming raw milk, have a dramatic reduction in symptoms relative to pasteurized milk. The mechanism of the reported reduction in symptoms, if true, is unknown. The purpose of the current study was to survey raw milk drinkers to ascertain their health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. An online survey regarding raw milk was completed by 153 of 1527 members of a raw milk-buying community. The primary reason the respondents cited for drinking raw milk was that they believed it was more healthful; 30% reported some gastrointestinal discomfort when drinking pasteurized milk, yet almost all (99%) reported consuming raw milk without discomfort. Despite the reports of gastrointestinal discomfort, only 5% of respondents had been diagnosed as lactose intolerant by a medical professional, and only 1% had been diagnosed as lactose intolerant via the gold-standard hydrogen breath test. The primary motivation for drinking raw milk is its perceived health value, not its digestibility. Although raw milk appears to be more easily digested than pasteurized milk in our survey sample, the mechanism of digestibility remains unknown.

  1. Surveillance of Bulk Raw and Commercially Pasteurized Cows' Milk from Approved Irish Liquid-Milk Pasteurization Plants To Determine the Incidence of Mycobacterium paratuberculosis

    OpenAIRE

    O'Reilly, Ciara E.; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R.; Donaghy, John; Rowe, Michael; O'Mahony, Pat

    2004-01-01

    Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of ...

  2. Rapid determination of strontium-89 and strontium-90 in food and environmental samples by Cerenkov counting

    International Nuclear Information System (INIS)

    Melin, Judith; Suomela, Jorma

    1995-01-01

    The method has been developed for emergency situations. Minimum detectable concentrations of 5 Bq/liter, kilogram of strontium-89 and strontium-90 respectively is achievable in the presence of nuclides considered to be released under accidental conditions. Result on the strontium-89 and strontium-90 content in a sample can be obtained within 12 hours. One technician can easily handle 8-10 samples during a working day of eight hours. The determination of the strontium isotopes is accomplished by monitoring the Cerenkov radiation from strontium-89 and yttrium-90 in a liquid scintillation counter. The latter is the daughter product of strontium-90. Prior to the Cerenkov counting the sample is separated from interfering nuclides by oxalate precipitation, chromate precipitation and HDEHP-extraction. The method has to be further improved and evaluated with respect to different soil types such as forest mineral soil layers, agricultural soils and pastures. Furthermore, the decontamination procedure should be evaluated for a sample containing freshly irradiated uranium. (author)

  3. Application of the neutron activation analysis method to the multielemental determination of food samples

    International Nuclear Information System (INIS)

    Maihara, V.A.

    1985-01-01

    The thermal neutron activation analysis method was applied to the determination of elements present at low concentrations and trace levels in samples of bread and milk powder using non-destructive analyses were based on gamma ray spectrometric measurements of samples and standards irradiated for periods which varied from some minutes to eight hours in a thermal neutron flux of about 10 12 n cm -2 s -1 . The concentrations obtained for milk powder were compared with the data obtained by other autors from different contries. For the bread, that comparison was not possible, because data about trace analysis in bread samples were not found. Besides, the results obtained for the various brands of bread and milk by means of non destructive and destructive analyses were compared using Student's t criterion. Some basic considerations about 'Detection Limit' were done, mainly in relation to its application in the technique used in the present work. The detection and determination limits of the trace elements analysed by destructive and non destructive techniques in bread and milk powder samples were determined using the Currie and Girardi methods. The precision of the analyses and the results obtained for the detection limits of the analysed trace elements are discussed. (Author) [pt

  4. Application of the neutron activation analysis method to the multielemental determination of food samples

    International Nuclear Information System (INIS)

    Maihara, V.A.

    1985-01-01

    The application of thermal neutron activation analysis method for determining elements presented at low concentration and level of traces in bread and dried milk samples, using non-destructive and chemical analyses, was studied. The non-destructive analyses were based on measurements of gamma spectrometry of samples and standards irradiated by thermal neutron flux on the order of 10 12 n cm -2 s -1 . The irradiation time varied from some minutes to 8 hours. The Na, Cl, Mn, Br, Fe, Zn, Rb, Sb, Cr and Sc elements in bread samples were determined. The Na, K, Cl, Ca, Mg, Br, Al, Zn, Rb, Sb and Cr elements in dried milk samples were determined. In destructive analysis, the 24 Na radioisotope was separeted by retention on hydrated antimony pentoxide column from 8N HCL after digestion of organic matter. The bread was dissolved in HNO 3 concentrated and 70% of HCLO 4 and the dried milk was dissolved in HNO 3 concentrated and H 2 O 2 . The 64 Cu, 69m Zn and 140 La radioisotopes determined. The concentrations obtained for dried milk were compared with data obtained by other authors from different contries. Basic considerations on detection limit related to its application on the technique used in this work, were done. The detection limits and trace elements using the Currie and Girardi methods were determined. The accuracy of results obtained for trace element detection limits is discussed. (Author) [pt

  5. Investigation of In-Package Ozonation: The Effectiveness of Ozone to Inactive Salmonella enteritidis on Raw, Shell Eggs

    Directory of Open Access Journals (Sweden)

    Austin Donner

    2011-01-01

    Full Text Available Food production, handling, and distribution practices pose a constant threat to the quality and safety of food products. The objective of this research is to evaluate an innovative in-package ozonation process to reduce Salmonella enteritidis on raw, shell eggs. Previous research has shown that in-package ozonation eliminates contaminants from outside sources, reduces pathogens, and extends shelf life. In this study, raw, shell eggs were inoculated with Salmonella enteritidis and exposed to ozonation treatment. Microbial recoveries were then tested to determine bacterial reductions. Measurements included: relative humidity (34 percent at 5oC, surface temperatures (oC, ozone concentrations, bacterial reductions of Salmonella enteritidis, and quality assessment of eggs (Haugh Unit [HU], color, pH, and weight. After a 24-hour storage period, all treated samples indicated 3 log10 reductions on average (previous research has achieved up to 6log10. These results show effective in-package ozonation treatment reducing Salmonella enteritidis on raw, shell eggs without significant effect on measured egg quality over time. Benefits of in-package ozonation include no heating, low power requirements (less or equal to 50 Watts, short treatment time (seconds to minutes, and adaptability into existing processes. Given its ability to ensure the safety and longevity of food products, this technology has great potential for utilization in the food processing industry.

  6. Microbiological criteria in public catering: sampling and auditing experiences in canteens and cafeterias in Piedmont

    Directory of Open Access Journals (Sweden)

    Amaranta Traversa

    2013-02-01

    Full Text Available In the period 2006-2011 six public catering establishments (3 canteens and 3 cafeterias were monitored, trough audit and sampling, in order to verify the application of good manufacturing and hygiene practices during food production, handling and serving. The compliance to microbiological food safety criteria (Listeria monocytogenes and Salmonella spp. and process hygiene criteria were investigated using ISO standards for microbiological analyses. A total of 612 samples were collected: 192 food samples and 288 environmental swab samples from canteens; 33 food samples and 99 swab samples from cafeterias. Regarding food safety, two samples were in disagreement with criteria fixed in EU Regulation as Listeria monocytogenes was isolated from a turkey breast in a canteen and from a sandwich in a cafeteria. Regarding process hygiene criteria, as no microbiological limits are legally defined for catering services, for this study limits were fixed according to the quality standards of tender, scientific literature and laboratory experience. 23.4% foodstuffs and 8.7% swabs resulted non-compliant in canteens; 48.5% foodstuffs and 6.1% swabs resulted non-compliant in cafeterias. The count of coagulase-positive staphylococci (CPS was higher of the fixed limits in raw turkey meat and in cooked spinach: the presence among CPS of S. aureus was confirmed, strains were not able to produce enterotoxins. The most common non-compliance in hygiene criteria was represented by aerobic colony count (60.7% of total non-compliance in canteens and 75.0% in cafeterias and coliform bacteria (20.3% in canteens and 25.0% in cafeterias. Nine raw foods or raw readyto- eat food samples were non-compliant for both coliform bacteria and aerobic count; one sample (raw turkey meat was non-compliant for CPS and aerobic count but resulted to be compliant after cooking. Auditing and sampling are the most effective tools to improve food quality standard and to enhance food business

  7. Interdigitated microelectrode based impedance biosensor for detection of salmonella enteritidis in food samples

    International Nuclear Information System (INIS)

    Kim, G; Morgan, M; Hahm, B K; Bhunia, A; Mun, J H; Om, A S

    2008-01-01

    Salmonella enteritidis outbreaks continue to occur, and S. enteritidis-related outbreaks from various food sources have increased public awareness of this pathogen. Conventional methods for pathogens detection and identification are labor-intensive and take days to complete. Some immunological rapid assays are developed, but these assays still require prolonged enrichment steps. Recently developed biosensors have shown great potential for the rapid detection of foodborne pathogens. To develop the biosensor, an interdigitated microelectrode (IME) was fabricated by using semiconductor fabrication process. Anti-Salmonella antibodies were immobilized based on avidin-biotin binding on the surface of the IME to form an active sensing layer. To increase the sensitivity of the sensor, three types of sensors that have different electrode gap sizes (2 μm, 5 μm, 10 μm) were fabricated and tested. The impedimetric biosensor could detect 10 3 CFU/mL of Salmonella in pork meat extract with an incubation time of 5 minutes. This method may provide a simple, rapid and sensitive method to detect foodborne pathogens

  8. Interdigitated microelectrode based impedance biosensor for detection of salmonella enteritidis in food samples

    Energy Technology Data Exchange (ETDEWEB)

    Kim, G [National Institute of Agricultural Engineering, 249 Seodun-dong, Suwon, Republic of Korea, 441-100 (Korea, Republic of); Morgan, M; Hahm, B K; Bhunia, A [Department of Food Science, Purdue University, West Lafayette, IN 47907 (United States); Mun, J H; Om, A S [Department of Food and Nutrient, Hanyang University, 17 Haengdang-dong, Seoul, Republic of Korea, 133-791 (Korea, Republic of)], E-mail: giyoungkim@rda.go.kr

    2008-03-15

    Salmonella enteritidis outbreaks continue to occur, and S. enteritidis-related outbreaks from various food sources have increased public awareness of this pathogen. Conventional methods for pathogens detection and identification are labor-intensive and take days to complete. Some immunological rapid assays are developed, but these assays still require prolonged enrichment steps. Recently developed biosensors have shown great potential for the rapid detection of foodborne pathogens. To develop the biosensor, an interdigitated microelectrode (IME) was fabricated by using semiconductor fabrication process. Anti-Salmonella antibodies were immobilized based on avidin-biotin binding on the surface of the IME to form an active sensing layer. To increase the sensitivity of the sensor, three types of sensors that have different electrode gap sizes (2 {mu}m, 5 {mu}m, 10 {mu}m) were fabricated and tested. The impedimetric biosensor could detect 10{sup 3} CFU/mL of Salmonella in pork meat extract with an incubation time of 5 minutes. This method may provide a simple, rapid and sensitive method to detect foodborne pathogens.

  9. Nutritional quality of raw and processed unripe Carica papaya fruit ...

    African Journals Online (AJOL)

    the unripe or green fruit is added into fresh salads (Boshra .... Copper showed the least concentration being undetectable in the raw and dried-cooked samples ..... meat. COMPETING INTERESTS. The authors declare that there is no conflict of ...

  10. Rapid instrumental and separation methods for monitoring radionuclides in food and environmental samples. Progress report

    International Nuclear Information System (INIS)

    Bhat, I.S.; Shukla, V.K.; Singh, A.N.; Nair, C.K.G.; Hingorani, S.B.; Dey, N.N.; Jha, S.K.; Rao, D.D.

    1995-01-01

    When activity levels are low, the direct gamma counting of milk and water samples take very long time, initial concentration step increases the sensitivity. 131 I in aqueous samples can be concentrated by absorption on AgCI in acidic condition. In case of milk, initial treatment with TCA, separation of precipitated casin and stirring the acidified (dil. HNO 3 ) clear solution with about 500 mg AgCI gives all the 131 I (more than 95%) picked up by AgCI which can be counted in a well crystal gamma spectrometer. In case of water samples acidification and direct stirring with AgCI all 131 I gets absorbed on to AgCI. About half an hour stirring has been found sufficient to give reproducible result. The total time required will be about 3 hrs. In case of 137 Cs, the aqueous solution should be stirred with ammonium phosphomolybdate (AMP) after acidification with HNO 3 . After an hour of AMP settling time, decantation, filtration and centrifuging one can get the AMP ready for counting in a gamma spectrometer having a well type detector. The analysis can be completed within 2 hrs. AgCI concentration of 131 I and AMP concentration of 137 Cs reduces the counting time significantly. These methods have been used for sea water and milk samples analysis. Methods are being standardised for solvent extraction separation of Pu, Am and Cm from preconcentrated environmental samples and direct counting of organic extract by liquid scintillation counting. For Pu determination, solvent extraction by TTA, back extraction and reextraction to 5% D2EHPA and direct liquid scintillation counting of Pu-alphas is planned. This will reduce the time required for Pu analysis to a significant extent. After bringing the sample to solution, this separation step can be carried out within 1 1/2 to 2 hrs. With Instagel scintillator cocktail in the packard 1550 LSS, Pu-239 counting had 70% efficiency with 5.3 cpm background. Pu-239 estimated in a few sediment sample gave results by both LSS method and Si

  11. Use of GIS-Based Sampling to Inform Food Security Assessments and Decision Making in Kenya

    Science.gov (United States)

    Wahome, A.; Ndubi, A. O.; Ndungu, L. W.; Mugo, R. M.; Flores Cordova, A. I.

    2017-12-01

    Kenya relies on agricultural production for supporting local consumption and other processing value chains. With changing climate in a rain-fed dependent agricultural production system, cropping zones are shifting and proper decision making will require updated data. Where up-to-date data is not available it is important that it is generated and passed over to relevant stakeholders to inform their decision making. The process of generating this data should be cost effective and less time consuming. The Kenyan State Department of Agriculture (SDA) runs an insurance programme for maize farmers in a number of counties in Kenya. Previously, SDA was using a list of farmers to identify the crop fields for this insurance programme. However, the process of listing of all farmers in each Unit Area of Insurance (UAI) proved to be tedious and very costly, hence need for an alternative approach, but acceptable sampling methodology. Building on the existing cropland maps, SERVIR, a joint NASA-USAID initiative that brings Earth observations (EO) for improved environmental decision making in developing countries, specifically its hub in Eastern and Soutehrn Africa developed a High Resolution Map based on 10m Sentinel satellite images from which a GIS based sampling frame for identifying maize fields was developed. Sampling points were randomly generated in each UAI and navigated to using hand-held GPS units for identification of maize farmers. In the GIS-based identification of farmers SDA uses 1 day to cover an area covered in 1 week by list identification of farmers. Similarly, SDA spends approximately 3,000 USD per sub-county to locate maize fields using GIS-based sampling as compared 10,000 USD they used to spend before. This has resulted in 70% cost reduction.

  12. Effect of Modified Pre-Milking Sanitizing Approaches on Raw Milk Quality Obtained from the Dairy Farmers of Tawau Area, Sabah

    Directory of Open Access Journals (Sweden)

    Sim Kheng Yuen

    2016-01-01

    Full Text Available The aim of the study was to investigate the raw milk hygiene and quality among the small holder dairy farmers in Tawau area. A total of 216 samples were collected from the respective dairy farmers and milk collecting centre located at Mile 15, Tawau. Preliminary results indicated that the quality of the raw milks obtained at farm level contained were inferior with high bacteria load (> than 107 CFU/ml. The total coliform (2.9-3.8 CFU/mL and Staphylococcus count (2.3-3.6 CFU/mL were relatively high in certain samples. However, none of the food borne pathogens was found. Trace back study revealed that the causes of contamination were attributed by poor hygienic handling among the dairy farmers and insufficient for immediate chilling of raw milk. A significant reduction in bacteria load was observed if the raw milk chilled immediately at farm. The implementation of modified pre-milking sanitizing practices improved the microbiology quality of the raw milks obtained from respective dairy farms. Future study will focus more on the effect of prolong storage towards the microbiological quality of raw milk.

  13. Development of a simple extraction procedure for chlorpyrifos determination in food samples by immunoassay.

    Science.gov (United States)

    Gabaldón, J A; Maquieira, A; Puchades, R

    2007-02-28

    The suitability of immunoassay methodology for rapid and accurate determination of chlorpyrifos in vegetables was tested. The optimised ELISA detection limit was 0.32ng/ml, with a working range from 0.69 to 6.21ng/ml and an immunoassay test-mid point (IC(50)) of 2.08ng/ml. A rapid sample preparation procedure considering different parameters such as the amount of sample, volume of extractant, extraction time and dilution factor was optimised. The developed direct extraction (DE) and multiresidue (ME) standard procedures were performed in different fortified fresh and processed vegetable samples (tomato, bonnet pepper, bean, pea, asparagus, broccoli, watermelon, melon, lettuce, cucumber, celery and red pepper). Recoveries were in all cases in the whole range 85.2-108.9% for both DE and ME extracts. Also, the comparison of the results obtained by both immunochemical and chromatographic methods for spiked fruits and vegetables were good with a correlation coefficient (r) of 0.97.

  14. Gas chromatographic determination of cholesterol from food samples using extraction/saponification method

    International Nuclear Information System (INIS)

    Ali, Z.M.; Soomro, A.S.A.

    2007-01-01

    A simple and fast one-step extraction/saponification with Na/OH/KOH (Ethanolic, Sodium Hydroxide/Potassium Hydroxide was compared and validated for determination of cholesterol from locally available 10 edible oil and egg samples. The importance of the use of edible oils and eggs in routine diet is unquestionable, but presence of cholesterol is considered as a risk factor for coronary heart disease and hypertension. The lowering of cholesterol level in order to reduce the risk is widely accepted. The cholesterol in the edible oil and eggs was determined by gas chromatography, through elution from the column (2x3 mm i.d) packed with 3% OV-I01, on Chromosorb G/'NAW 80-100 mesh size at 250-300C with programmed heating rate of 3 degree C/min. Nitrogen gas flow rate was 40 ml/min. The cholesterol samples were run under the conditions after selective extraction in diethyl ether. The calibration was linear within 50-500 IJg/ml concentration range. The amount of cholesterol detected were from 12.92-18.05 mg/g in edible oil and 117.54-143.42 mg/g in egg samples with RSD 1.3-2.7%. (author)

  15. Radiation hygienization of raw sewage sludge

    International Nuclear Information System (INIS)

    Shah, M.R.; Lavale, D.S.; Rawat, P.; Benny, P.G.; Sharma, A.K.; Dey, G.R.; Bhave, V.

    2001-01-01

    'Radiation treatment of municipal sewage sludge can achieve resource conservation and recovery objectives. The liquid sludge irradiator of Sludge Hygienization Research Irradiator at Baroda (India) was operated for generating data on treatment of raw sludge containing 3-4 % solids. The plant system was modified for irradiating raw sludge without affecting basic irradiator initially designed to treat digested sludge. Hourly samples were analysed for estimation of disinfection dose requirement. Sand separated from the sludge was used as in-situ dosimeter by making use of its thermoluminescence property. Investigations are being carried out for regrowth of Total Coliforms in the sludge samples from this irradiator. Possibility of inadequate treatment due to geometric configuration of irradiator is being checked. (author)

  16. Development of a mass spectrometrical isotope dilution analysis for determination of trace iodine levels and its application for food samples

    International Nuclear Information System (INIS)

    Schindlmeier, W.

    1984-01-01

    A mass spectrometrical isotope dilution procedure for the determination of trace amounts of iodine in various materials was developed using 129 I as indicator isotope, based on the determination of the 129 I/ 127 I isotope relationship. Negative thermionization was used as ionization method. The analysis procedure, which worked with a standard deviation of between 0,1 and 10% (depending on material tested), was used to determine the iodine level of table salt - both iodized and normal salt (3-6 ppm and less than 0,006 ppm respectively), and food samples with an organic matrix. For comparison the iodine levels were also measured with an iodine-selective electrode. Special preparation and separation procedures were done to suit the sample material. A comparison of the levels of iodine concentration in various powdered milks which were measured by international collaborators using varying methods shows the superior reproducibility of the MS-IDA. (RB) [de

  17. Sample preparation for arsenic speciation analysis in baby food by generation of substituted arsines with atomic absorption spectrometry detection.

    Science.gov (United States)

    Huber, Charles S; Vale, Maria Goreti R; Dessuy, Morgana B; Svoboda, Milan; Musil, Stanislav; Dědina, Jiři

    2017-12-01

    A slurry sampling procedure for arsenic speciation analysis in baby food by arsane generation, cryogenic trapping and detection with atomic absorption spectrometry is presented. Several procedures were tested for slurry preparation, including different reagents (HNO 3 , HCl and tetramethylammonium hydroxide - TMAH) and their concentrations, water bath heating and ultrasound-assisted agitation. The best results for inorganic arsenic (iAs) and dimethylarsinate (DMA) were reached when using 3molL -1 HCl under heating and ultrasound-assisted agitation. The developed method was applied for the analysis of five porridge powder and six baby meal samples. The trueness of the method was checked with a certified reference material (CRM) of total arsenic (tAs), iAs and DMA in rice (ERM-BC211). Arsenic recoveries (mass balance) for all samples and CRM were performed by the determination of the tAs by inductively coupled plasma mass spectrometry (ICP-MS) after microwave-assisted digestion and its comparison against the sum of the results from the speciation analysis. The relative limits of detection were 0.44, 0.24 and 0.16µgkg -1 for iAs, methylarsonate and DMA, respectively. The concentrations of the most toxic arsenic species (iAs) in the analyzed baby food samples ranged between 4.2 and 99µgkg -1 which were below the limits of 300, 200 and 100µgkg -1 set by the Brazilian, Chinese and European legislation, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

    Science.gov (United States)

    Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

    2016-01-01

    Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

  19. A simple method for determination of carmine in food samples based on cloud point extraction and spectrophotometric detection.

    Science.gov (United States)

    Heydari, Rouhollah; Hosseini, Mohammad; Zarabi, Sanaz

    2015-01-01

    In this paper, a simple and cost effective method was developed for extraction and pre-concentration of carmine in food samples by using cloud point extraction (CPE) prior to its spectrophotometric determination. Carmine was extracted from aqueous solution using Triton X-100 as extracting solvent. The effects of main parameters such as solution pH, surfactant and salt concentrations, incubation time and temperature were investigated and optimized. Calibration graph was linear in the range of 0.04-5.0 μg mL(-1) of carmine in the initial solution with regression coefficient of 0.9995. The limit of detection (LOD) and limit of quantification were 0.012 and 0.04 μg mL(-1), respectively. Relative standard deviation (RSD) at low concentration level (0.05 μg mL(-1)) of carmine was 4.8% (n=7). Recovery values in different concentration levels were in the range of 93.7-105.8%. The obtained results demonstrate the proposed method can be applied satisfactory to determine the carmine in food samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Effective Enrichment and Detection of Trace Polycyclic Aromatic Hydrocarbons in Food Samples based on Magnetic Covalent Organic Framework Hybrid Microspheres.

    Science.gov (United States)

    Li, Ning; Wu, Di; Hu, Na; Fan, Guangsen; Li, Xiuting; Sun, Jing; Chen, Xuefeng; Suo, Yourui; Li, Guoliang; Wu, Yongning

    2018-04-04

    The present study reported a facile, sensitive, and efficient method for enrichment and determination of trace polycyclic aromatic hydrocarbons (PAHs) in food samples by employing new core-shell nanostructure magnetic covalent organic framework hybrid microspheres (Fe 3 O 4 @COF-(TpBD)) as the sorbent followed by HPLC-DAD. Under mild synthetic conditions, the Fe 3 O 4 @COF-(TpBD) were prepared with the retention of colloidal nanosize, larger specific surface area, higher porosity, uniform morphology, and supermagnetism. The as-prepared materials showed an excellent adsorption ability for PAHs, and the enrichment efficiency of the Fe 3 O 4 @COF-(TpBD) could reach 99.95%. The obtained materials also had fast adsorption kinetics and realized adsorption equilibrium within 12 min. The eluent was further analyzed by HPLC-DAD, and good linearity was observed in the range of 1-100 ng/mL with the linear correlation being above 0.9990. The limits of detection (S/N = 3) and limits of quantitation (S/N = 10) for 15 PAHs were in the range of 0.83-11.7 ng/L and 2.76-39.0 ng/L, respectively. For the application, the obtained materials were employed for the enrichment of trace PAHs in food samples and exhibited superior enrichment capacity and excellent applicability.

  1. Effective sampling range of food-based attractants for female Anastrepha suspensa (Diptera: Tephritidae).

    Science.gov (United States)

    Kendra, Paul E; Epsky, Nancy D; Heath, Robert R

    2010-04-01

    Release-recapture studies were conducted with both feral and sterile females of the Caribbean fruit fly, Anastrepha suspensa (Loew) (Diptera: Tephritidae), to determine sampling range for a liquid protein bait (torula yeast/borax) and for a two-component synthetic lure (ammonium acetate and putrescine). Tests were done in a guava, Psidium guajava L., grove and involved releasing flies at a central point and recording the numbers captured after 7 h and 1, 2, 3, and 6 d in an array of 25 Multilure traps located 9-46 m from the release point. In all tests, highest rate of recapture occurred within the first day of release, so estimations of sampling range were based on a 24-h period. Trap distances were grouped into four categories (30 m from release point) and relative trapping efficiency (percentage of capture) was determined for each distance group. Effective sampling range was defined as the maximum distance at which relative trapping efficiency was > or = 25%. This corresponded to the area in which 90% of the recaptures occured. Contour analysis was also performed to document spatial distribution of fly dispersal. In tests with sterile flies, immature females dispersed farther and were recovered in higher numbers than mature females, regardless of attractant, and recapture of both cohorts was higher with torula yeast. For mature feral flies, range of the synthetic lure was determined to be 30 m. With sterile females, effective range of both attractants was 20 m. Contour maps indicated that wind direction had a strong influence on the active space of attractants, as reflected by distribution of captured flies.

  2. Comparative research of effectiveness of cellulose and fiberglass porous membrane carriers for bio sampling in veterinary and food industry monitoring

    Science.gov (United States)

    Gusev, Alexander; Vasyukova, Inna; Zakharova, Olga; Altabaeva, Yuliya; Saushkin, Nikolai; Samsonova, Jeanne; Kondakov, Sergey; Osipov, Alexander; Snegin, Eduard

    2017-11-01

    The aim of proposed research is to study the applicability of fiberglass porous membrane materials in a new strip format for dried blood storage in food industry monitoring. A comparative analysis of cellulosic and fiberglass porous membrane materials was carried out to obtain dried samples of serum or blood and the possibility of further species-specific analysis. Blood samples of Sus scrofa were used to study the comparative effectiveness of cellulose and fiberglass porous membrane carriers for long-term biomaterial storage allowing for further DNA detection by real-time polymerase chain reaction (PCR) method. Scanning electron microscopy of various membranes - native and with blood samples - indicate a fundamental difference in the form of dried samples. Membranes based on cellulosic materials sorb the components of the biological fluid on the surface of the fibers of their structure, partially penetrating the cellulose fibers, while in the case of glass fiber membranes the components of the biological fluid dry out as films in the pores of the membrane between the structural filaments. This fundamental difference in the retention mechanisms affects the rate of dissolution of the components of dry samples and contributes to an increase in the efficiency of the desorption process of the sample before subsequent analysis. Detecting of pig DNA in every analyzed sample under the performed Real-time PCR as well as good state of the biomaterial preservation on the glass fiber membranes was clearly demonstrated. Good biomaterials preservation has been revealed on the test cards for 4 days as well as for 1 hour.

  3. Uncertainty Estimation of Neutron Activation Analysis in Zinc Elemental Determination in Food Samples

    International Nuclear Information System (INIS)

    Endah Damastuti; Muhayatun; Diah Dwiana L

    2009-01-01

    Beside to complished the requirements of international standard of ISO/IEC 17025:2005, uncertainty estimation should be done to increase quality and confidence of analysis results and also to establish traceability of the analysis results to SI unit. Neutron activation analysis is a major technique used by Radiometry technique analysis laboratory and is included as scope of accreditation under ISO/IEC 17025:2005, therefore uncertainty estimation of neutron activation analysis is needed to be carried out. Sample and standard preparation as well as, irradiation and measurement using gamma spectrometry were the main activities which could give contribution to uncertainty. The components of uncertainty sources were specifically explained. The result of expanded uncertainty was 4,0 mg/kg with level of confidence 95% (coverage factor=2) and Zn concentration was 25,1 mg/kg. Counting statistic of cuplikan and standard were the major contribution of combined uncertainty. The uncertainty estimation was expected to increase the quality of the analysis results and could be applied further to other kind of samples. (author)

  4. Food neophobia and its association with intake of fish and other selected foods in a Norwegian sample of toddlers: A cross-sectional study.

    Science.gov (United States)

    Helland, Sissel H; Bere, Elling; Bjørnarå, Helga Birgit; Øverby, Nina Cecilie

    2017-07-01

    Reluctance to try novel foods (food neophobia) prevents toddlers from accepting healthy foods such as fish and vegetables, which are important for child development and health. Eating habits established between ages 2 and 3 years normally track into adulthood and are therefore highly influential; even so, there are few studies addressing food neophobia in this age group. This cross-sectional study investigated the relationship between the level of food neophobia and the frequency of toddlers' intake of fish, meat, berries, fruit, vegetables, and sweet and salty snacks. Parents of 505 toddlers completed a questionnaire assessing the degree of food neophobia in their toddlers (mean age 28 months, SD ± 3.5), and frequency of intake of various foods. Food neophobia was rated by the Children's Food Neophobia Scale (CFNS, score range 6-42). Associations between CFNS score and food frequency were examined using hierarchical multiple regression models, adjusting for significant covariates. Toddlers with higher CFNS scores had less frequent intake of vegetables (β = -0.28, p food neophobia in toddlers is associated with lower diet quality, and indicate a need for intervention studies to address the food neophobia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. [Survey of the presence of bacterial pathogens in foods sold at retail stores in the city of Cassino].

    Science.gov (United States)

    Langiano, E; Atrei, P; La Torre, G; De Vito, E; Ricciardi, G

    2002-01-01

    The presence of bacterial food pathogens was evaluated in 154 food samples collected from supermarkets and butchers in the city of Cassino (South-Central Italy). Food pathogens were identified in 17.5% of the total food samples. In the raw meat samples, 24.6% tested positives for Listeria monocytogenes, 4.3% for Salmonella and 2.9% for Escherichia coli O157. Y. enterocolitica, only investigated in pork meat, was identified in 7.4% of the samples. In poultry, L. monocytogenes was identified in 55% of the samples.

  6. Utility of solid phase spectrophotometry for the modified determination of trace amounts of cadmium in food samples.

    Science.gov (United States)

    Amin, Alaa S; Gouda, Ayman A

    2012-05-01

    A modified selective, highly sensitive and accurate procedure for the determination of trace amounts of cadmium which reacts with 1-(2-benzothiazolylazo)-2-hydroxy-3-naphthoic acid (BTAHNA) to give a deep violet complex with high molar absorptivity (7.05×10(6)Lmol(-1) cm(-1), 3.92×10(7)Lmol(-1)cm(-1), 1.78×10(8)Lmol(-1)cm(-1), and 4.10×10(8)Lmol(-1)cm(-1)), fixed on a Dowex 1-X8 type anion-exchange resin for 10mL, 100mL, 500mL, and 1000mL, respectively. Calibration is linear over the range 0.2-3.5μgL(-1) with RSD of ⩽1.14% (n=10). The detection and quantification limits were calculated. Increasing the sample volume can enhance the sensitivity. The method has been successfully applied for the determination of Cd(II) in food samples, water samples and some salts samples without interfering effect of various cations and anions. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. A multifunctional molecularly imprinted polymer-based biosensor for direct detection of doxycycline in food samples

    DEFF Research Database (Denmark)

    Ashley, Jon; Feng, Xiaotong; Sun, Yi

    2018-01-01

    In this study, we developed a new type of multifunctional molecularly imprinted polymer (MIP) composite as an all-in-one biosensor for the low-cost, rapid and sensitive detection of doxycycline in pig plasma. The MIP composite consisted of a magnetic core for ease of manipulation, and a shell...... of fluorescent MIPs for selective recognition of doxycycline. By simply incorporating a small amount of fluorescent monomer (fluorescein-Oacrylate), the fluorescent MIP layer was successfully grafted onto the magnetic core via a surface imprinting technique. The resultant MIP composites showed significant....... The multifunctional MIP composites were used to directly extract doxycycline from spiked pig plasma samples and quantify the antibiotics based on the quenched fluorescence signals. Recoveries of doxycycline were found in the range of 88–107%....

  8. Polar bear use of a persistent food subsidy: insights from non-invasive genetic sampling in Alaska

    Science.gov (United States)

    Peacock, Elizabeth; Herreman, Jason

    2013-01-01

    Remains of bowhead whales (Balaena mysticetus) harvested by Iñupiat whalers are deposited in bone piles along the coast of Alaska and have become persistent and reliable food sources for polar bears (Ursus maritimus). The importance of bone piles to individuals and the population, the patterns of use, and the number, sex, and age of bears using these resources are poorly understood. We implemented barbed-wire hair snaring to obtain genetic identities from bears using the Point Barrow bone pile in winter 2010–11. Eighty-three percent of genotyped samples produced individual and sex identification. We identified 97 bears from 200 samples. Using genetic mark–recapture techniques, we estimated that 228 bears used the bone pile during November to February, which would represent approximately 15% of the Southern Beaufort Sea polar bear subpopulation, if all bears were from this subpopulation. We found that polar bears of all age and sex classes simultaneously used the bone pile. More males than females used the bone pile, and males predominated in February, likely because 1/3 of adult females would be denning during this period. On average, bears spent 10 days at the bone pile (median  =  5 days); the probability that an individual bear remained at the bone pile from week to week was 63% for females and 45% for males. Most bears in the sample were detected visiting the bone pile once or twice. We found some evidence of matrilineal fidelity to the bone pile, but the group of animals visiting the bone pile did not differ genetically from the Southern Beaufort Sea subpopulation, nor did patterns of relatedness. We demonstrate that bowhead whale bone piles may be an influential food subsidy for polar bears in the Barrow region in autumn and winter for all sex and age classes.

  9. Microbial Quality, Safety, and Pathogen Detection by Using Quantitative PCR of Raw Salad Vegetables Sold in Dhanbad City, India.

    Science.gov (United States)

    Mritunjay, Sujeet K; Kumar, Vipin

    2017-01-01

    Consumption of ready-to-eat fresh vegetables has increased worldwide, with a consequent increase in outbreaks caused by foodborne pathogens. In the Indian subcontinent, raw fresh vegetables are usually consumed without washing or other decontamination procedures, thereby leading to new food safety threats. In this study, the microbiological quality and pathogenic profile of raw salad vegetables was evaluated through standard protocols. In total, 480 samples (60 each of eight different salad vegetables) of cucumber, tomato, carrot, coriander, cabbage, beetroot, radish, and spinach were collected from different locations in Dhanbad, a city famous for its coal fields and often called the "Coal Capital of India." The samples were analyzed for total plate count, total coliforms, Escherichia coli , E. coli O157:H7, Listeria monocytogenes , and Salmonella spp. Incidences of pathogens were detected through quantitative PCR subsequent to isolation. Results showed that 46.7% (for total plate counts) and 30% (for total coliforms) of samples were unacceptable for consumption per the Food Safety and Standards Authority of India. Pathogenic microorganisms were detected in 3.7% of total samples. E. coli O157:H7 was detected in three samples of spinach (2) and beetroot ( 1 ); L. monocytogenes was detected in 14 samples of spinach ( 8 ), tomato ( 3 ), cucumber ( 2 ), and radish ( 1 ); and Salmonella spp. were detected in 16 samples of spinach ( 7 ), tomato ( 3 ), beetroot ( 2 ), cucumber ( 2 ), carrot ( 1 ), and radish ( 1 ). Pathogens were not detected in any of the cabbage and coriander samples.

  10. Extraordinary tunable dynamic range of electrochemical aptasensor for accurate detection of ochratoxin A in food samples

    Directory of Open Access Journals (Sweden)

    Lin Cheng

    2017-06-01

    Full Text Available We report the design of a sensitive, electrochemical aptasensor for detection of ochratoxin A (OTA with an extraordinary tunable dynamic sensing range. This electrochemical aptasensor is constructed based on the target induced aptamer-folding detection mechanism and the recognition between OTA and its aptamers results in the conformational change of the aptamer probe and thus signal changes for measurement. The dynamic sensing range of the electrochemical aptasensor is successfully tuned by introduction of free assistant aptamer probes in the sensing system. Our electrochemical aptasensor shows an extraordinary dynamic sensing range of 11-order magnitude of OTA concentration from 10−8 to 102 ng/g. Of great significance, the signal response in all OTA concentration ranges is at the same current scale, demonstrating that our sensing protocol in this research could be applied for accurate detections of OTA in a broad range without using any complicated treatment of signal amplification. Finally, OTA spiked red wine and maize samples in different dynamic sensing ranges are determined with the electrochemical aptasensor under optimized sensing conditions. This tuning strategy of dynamic sensing range may offer a promising platform for electrochemical aptasensor optimizations in practical applications.

  11. Raw materials for aluminium production

    International Nuclear Information System (INIS)

    Galushkin, N.V.

    1995-01-01

    This chapter of monograph is devoted to to raw materials which used in aluminium production. Therefore, the using of alumina, and fluoride salts in aluminium production was considered. The physical properties of alumina were studied.

  12. Concentrations of bisphenol A in the composite food samples from the 2008 Canadian total diet study in Quebec City and dietary intake estimates

    OpenAIRE

    Cao, X.-L.; Perez-Locas, C.; Dufresne, G.; Clement, G.; Popovic, S.; Beraldin, F.; Dabeka, R.W.; Feeley, M.

    2011-01-01

    A total of 154 food composite samples from the 2008 total diet study in Quebec City were analysed for bisphenol A (BPA), and BPA was detected in less than half (36%, or 55 samples) of the samples tested. High concentrations of BPA were found mostly in the composite samples containing canned foods, with the highest BPA level being observed in canned fish (106 ng g−1), followed by canned corn (83.7 ng g−1), canned soups (22.2–44.4 ng g−1), canned baked beans (23.5 ng g−1), canned peas (16.8 ng ...

  13. Polyphenols in Raw and Cooked Cereals/Pseudocereals/Legume Pasta and Couscous.

    Science.gov (United States)

    Carcea, Marina; Narducci, Valentina; Turfani, Valeria; Giannini, Vittoria

    2017-09-11

    Pasta and couscous are popular foods manufactured (in their traditional form) from durum wheat semolina. In recent years, the consumers' quest for novel, functional, gluten-free, wholegrain foods has prompted the industry to manufacture new pasta and couscous products in which durum wheat has been partially or totally replaced by other vegetable flours. Besides dietary fibre, these raw materials might be an interesting source of phytochemicals. In this work, 16 commercial samples of pasta and four samples of couscous representative of the new products and made of refined and wholegrain flours of different species of cereals, pseudocereals and legumes were analysed for free, hydrolysable bound and total polyphenol content by means of the Folin-Ciocalteu procedure. Analyses were repeated on cooked samples to assess the quantity of polyphenols ingested by the consumers. The raw legume and pseudocereal products had a total polyphenol content higher than most cereal products (up to 1743.4 mg of Gallic Acid Equivalent (GAE) per 100 g dry weight). Wholegrain products had higher contents than refined products. The free fraction underwent up to 46% loss with cooking, probably because of solubility in water. The water absorption of pasta and couscous during cooking was in a ratio of 2:3, resulting in higher dilution of polyphenols in the cooked couscous.

  14. 21 CFR 101.44 - What are the 20 most frequently consumed raw fruits, vegetables, and fish in the United States?

    Science.gov (United States)

    2010-04-01

    ... fruits, vegetables, and fish in the United States? 101.44 Section 101.44 Food and Drugs FOOD AND DRUG... raw fruits, vegetables, and fish in the United States? (a) The 20 most frequently consumed raw fruits..., and watermelon. (b) The 20 most frequently consumed raw vegetables are: Asparagus, bell pepper...

  15. OZONE ABSORPTION IN RAW WATERS

    Directory of Open Access Journals (Sweden)

    LJILJANA TAKIĆ

    2008-03-01

    Full Text Available The ozone absorption in raw water entering the main ozonization step at the Belgrade drinking water supply plant was investigated in a continuous stirred tank reactor (CSTR. A slow chemical reaction rate of dissolved ozone and pollutants present in raw water have been experimentally determined. The modified Hatta number was defined and calculated as a criterion which determines whether and to which extent the reactions of ozone and pollutants influence the rate of the pure physical ozone absorption.

  16. Occurrence of Thermotolerant Campylobacter in Raw Poultry Meat, Environmental and Pigeon Stools Collected in Open-Air Markets.

    Science.gov (United States)

    Bellio, Alberto; Traversa, Amaranta; Adriano, Daniela; Bianchi, Daniela Manila; Colzani, Alberto; Gili, Stefano; Dondo, Alessandro; Gallina, Silvia; Grattarola, Carla; Maurella, Cristiana; Zoppi, Simona; Zuccon, Fabio; Decastelli, Lucia

    2014-08-28

    Campylobacteriosis was the most commonly reported zoonosis for confirmed human cases in European Union during 2011. Poultry meat was very often implicated in Campylobacter infections in humans. In Italy commerce of raw poultry meat is common in open-air markets: these areas can be considered at high risk of bacterial contamination due to the high presence birds like pigeons. The aim of this study was to collect data about the contamination by thermotolerant Campylobacter of raw poultry meat commercialised in open-air markets, of work-surfaces in contact with poultry meat and of pigeon stools sampled in the market areas in Turin, Northern Italy. Between September 2011 and December 2012, 86 raw poultry meat samples, 86 environmental swabs and 108 animal samples were collected in 38 open-air markets. Analysis were carried out according to ISO10272-1:2006 standard. C.coli was detected in 2.3% (2/86) of raw poultry meat samples, whereas no swab (0/86) resulted positive. Of pigeon stool 28% (30/107) was positive for C.jejuni (83.3% C.jejuni subsp . jejuni and 16.7% C.jejuni subsp . doylei ). C.jejuni subsp. jejuni was isolated from 1 dead pigeon . Our results showed lower rates of contamination than those reported at retail in Europe. Although samples were collected in areas at high risk of contamination, raw poultry meat and work surfaces reported a low level of presence of thermotolerant Campylobacter . The high percentage of C.jejuni isolated from pigeon stools showed the importance of a continuous application of preventive measures by the food business operators and the surveillance activity by the Competent Authority.

  17. Raw Materials Market of China

    Directory of Open Access Journals (Sweden)

    Dmitry Alexandrovich Izotov

    2013-12-01

    Full Text Available Deficit of raw materials is becoming an important concern for the Chinese economy as it continues to grow. This deficit is amended with imports, which – in their own turn – are limited by the high level of global prices. The build-up issue of raw materials imports is going to solve by the measures of monetary policy (RMB’s revaluation against the USD. Analysis of China’s market of raw materials reveals that the largest increase in the physical volume of imports is concentrated in crude oil, LNG, iron ore and coal. As for Russia, its supplies and share in total Chinese imports of raw materials tend to increase. Author employs regression equations based on international statistics data to show that RMB’s revaluation, ceteris paribus, increases physical volumes of raw materials imports. However, the main factor of coal and LNG imports growth is energy consumption by Chinese heavy industry; imports of oil products – producers’ prices; meanwhile imports of steel products tend to decrease with the growth of steel exports. RMB’s revaluation increases physical volumes of imports of low value added raw materials from Russia (coal, crude oil, iron ore

  18. Monitoring of psychrotrophic microorganisms in raw milk

    Directory of Open Access Journals (Sweden)

    Radka Burdychová

    2008-01-01

    Full Text Available The group of psychrotrophic microorganisms belongs to the microorganisms representing a risk for human health as well as a risk of milk and milk products spoilage. Some genus are considered to be significant producers of proteolytic and lipolytic enzymes. In this work, we analysed raw milk samples (n = 109 originated from 26 different suppliers from the area of North and Middle Moravia. The screening was performed from March 2007 to February 2008. The total bacterial counts (TBC ranged between 3.2 × 103 to 8.3 × 106 CFU/ml. The psychrotrophic bacterial counts (PBC ranged between 1.0 × 103 to 8.2 × 106 CFU/ml. Total of 48.62 % and 48.62 % of samples exceeded the hygienic limit in raw milk for TBC and PBC, respectively. The correlation between TBC and PBC was highly significant (r = 0.87.Significantly higher (P < 0.05 numbers of psychrotrophic microorganisms were detected in summer months. The identification of isolates was carried out and all strains were sreened for ability to produce proteolytic and lipolytic enzymes. The most commonly identified genus in raw milk was of the genus Pseudomonas. The ability to produce proteases or lipases was found at 76 % identified bacterial strains.

  19. A simple and sensitive vortex-assisted ionic liquid-dispersive microextraction and spectrophotometric determination of selenium in food samples.

    Science.gov (United States)

    Bağda, Esra; Tüzen, Mustafa

    2017-10-01

    In the present study, a novel and eco-friendly vortex-assisted ionic liquid-based microextraction method was developed for the determination of selenium in food. The microextraction method is based on the liberation of iodine in the presence of selenium; the liberated iodine reacts with I - to form I 3 - . Anionic I 3 - reacts with cationic crystal violet dye, and the product is extracted into 1-hexyl-3-methylimidazolium hexafluorophosphate phase in the presence of Triton X-114. The proposed method is linear in the range of 2.0-70µgL -1 and has a detection limit of 9.8×10 -2 µgL -1 . Relative standard deviations were 3.67% and 2.89% for the five replicate measurements of 14 and 35µgL -1 Se(IV), respectively. The proposed method was successfully applied to different food samples (NIST SRM 2976 mussel tissue, pepper, ginger, wheat flour, red lentil, traditional soup, cornflour, cornstarch, and garlic) after microwave digestion. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Monitoring of Radionuclide Contamination in Food Samples in Malaysia due to Daiichi Reactor Accident in Fukushima, Japan

    International Nuclear Information System (INIS)

    Nurrul Assyikeen Mohd Jaffary; Wo, Y.M.; Abdul Kadir Ishak

    2015-01-01

    On March 11, 2011, a serious accident occurred in Daiichi nuclear reactor plant, Fukushima, Japan which caused radioactive materials been released into the atmosphere in the form of aerosols and dust particles. Sea water around the plant was also found contaminated with high radioactivity readings. These radioactive materials could be transported by the winds and ocean current across international borders and cannot be controlled by human. Thus, a continuous monitoring activity of radionuclide content in the air and sea water needs to be conducted by the authorities. In addition to radioactivity monitoring, Malaysia should also control the entry of contaminated food in order to prevent radionuclide ingestion by human. The radionuclide 131 I, 134 Cs and 137 Cs were used as a measure of pollution levels and counted with gamma spectrometry using standard analysis method suggested by AOAC International. In this paper, details description of the role of Radiochemical and Environment Group, Nuclear Malaysia who is responsible in analyzing the radioactivity in the food samples due to Fukushima Daiichi, Japan accident was included. The radioactivity limit adopted and analysis results from this monitoring were discussed. (author)

  1. Monitoring of Radionuclide Contamination in Food Samples in Malaysia due to Daiichi Reactor Accident in Fukushima, Japan

    International Nuclear Information System (INIS)

    Nurrul Assyikeen Mohd Jaffary; Abdul Kadir Ishak; Wo, Y.M.

    2011-01-01

    On March 11, 2011, a serious accident occurred in Daiichi nuclear reactor plant, Fukushima, Japan which caused radioactive materials been released into the atmosphere in the form of aerosols and dust particles. Sea water around the plant was also found contaminated with high radioactivity readings. These radioactive materials could be transported by the winds and ocean current across international borders and cannot be controlled by human. Besides a continuous monitoring activity of radionuclide content in the air and sea water that need to be conducted by the authorities, Malaysia should also control the entry of radionuclide through contaminated food ingestion by human. Radionuclide I-131, Cs-134 and Cs-137 were used as a counter-measure of pollution levels and counted with gamma spectrometry using standard analysis method suggested by AOAC International. In this paper, details description of the role of Radiochemical and Environment Group, Nuclear Malaysia who's responsible in analyzing the radioactivity in the food samples due to Fukushima Daiichi, Japan accident was included. Also discussed are the radioactivity limit adopted and analysis results from this monitoring. (author)

  2. Worry or craving? A selective review of evidence for food-related attention biases in obese individuals, eating-disorder patients, restrained eaters and healthy samples.

    Science.gov (United States)

    Werthmann, Jessica; Jansen, Anita; Roefs, Anne

    2015-05-01

    Living in an 'obesogenic' environment poses a serious challenge for weight maintenance. However, many people are able to maintain a healthy weight indicating that not everybody is equally susceptible to the temptations of this food environment. The way in which someone perceives and reacts to food cues, that is, cognitive processes, could underlie differences in susceptibility. An attention bias for food could be such a cognitive factor that contributes to overeating. However, an attention bias for food has also been implicated with restrained eating and eating-disorder symptomatology. The primary aim of the present review was to determine whether an attention bias for food is specifically related to obesity while also reviewing evidence for attention biases in eating-disorder patients, restrained eaters and healthy-weight individuals. Another aim was to systematically examine how selective attention for food relates (causally) to eating behaviour. Current empirical evidence on attention bias for food within obese samples, eating-disorder patients, and, even though to a lesser extent, in restrained eaters is contradictory. However, present experimental studies provide relatively consistent evidence that an attention bias for food contributes to subsequent food intake. This review highlights the need to distinguish not only between different (temporal) attention bias components, but also to take different motivations (craving v. worry) and their impact on attentional processing into account. Overall, the current state of research suggests that biased attention could be one important cognitive mechanism by which the food environment tempts us into overeating.

  3. Trace Metal Levels in Raw and Heat Processed Nigerian Staple ...

    African Journals Online (AJOL)

    The levels of some trace metals (Fe, Zn, Cu, Ni, Cd) were quantitatively determined in raw and heat processed staple food cultivars (yam, cassava, cocoyam and maize) from oil producing areas of part of the Niger Delta and compared with a non-oil producing area of Ebonyi State as control. The survey was conducted to ...

  4. Microbiological quality of raw and roasted African palm weevil ...

    African Journals Online (AJOL)

    Microbiological quality of raw and roasted African palm weevil ( Rhynchophorus phoenicis ) consumed in the south eastern Nigeria. ... Rhynchophorus phoenicis though reported to be highly nutritious in terms of amino acid profile and presence of unsaturated fatty acid can be a source of food poison if not properly handled ...

  5. Aqueous Two-Phase Systems: A New Approach for the Determination of Brilliant Blue FCF in Water and Food Samples

    Directory of Open Access Journals (Sweden)

    Sabah Shiri

    2013-01-01

    Full Text Available A novel, simple, and more sensitive spectrophotometric procedure has been developed for the determination of brilliant blue FCF in water and food samples by an aqueous two-phase system (ATPS. In this method, adequate amount of polyethylene glycol/ sodium carbonate (PEG-4000/Na2CO3 was added to aqueous solution for formation of a homogeneous solution. To the mixture solution, suitable amount of Na2CO3 was added, the mixture solution was shaken until the salt was dissolved, and then it was separated into two clear phases easily and rapidly. The target analyte in the water sample was extracted into the polyethylene glycol phase. After extraction, measuring the absorbance at 634 nm was done. The effects of different parameters such as polyethylene glycol (type and concentration, pH, salt (type and amount, centrifuge time, and temperature on the ATPS of dye was investigated and optimum conditions were established. Linear calibration curves were obtained in the range of 0.25–750 ng/mL for brilliant blue FCF under optimum conditions. Detection limit based on three times the standard deviation of the blank (3Sb was 0.12 ng/mL. The relative standard deviation (RSD for 400 ng/mL was 3.14%. The method was successfully applied to the determination of brilliant blue FCF in spiked samples with satisfactory results. The relative recovery was between 96.0 and 102.2%.

  6. Preconcentration of Zn2+ and Cu2+ ions from food and vegetable samples using modified activated carbon.

    Science.gov (United States)

    Ghaedi, M; Tavallali, H; Montazerozohori, M; Zahedi, E; Amirineko, M; Khodadoust, S; Karimipour, G

    2012-11-01

    In this work, two N/S-containing chelating agents 2-(4-methoxybenzylideneamino)thiophenol (2-4-MBAT) and 2-(4-chlorobenzylideneamino) benzenethiol (2-4-CBABT) were synthesized as new sorbents and were used for preconcentration of Zn(2+) and Cu(2+) ions in food and vegetable samples. In the proposed procedure, the trace amount of Zn(2+) and Cu(2+) ions from 250 mL of sample solution at pH = 5.0 was preconcentrated by 1 g of activated carbon (AC) loaded with 15 mg of 2-4-MBAT and 2-4-CBABT separately. The breakthrough volumes (maximum sample volume that their metal ions quantitatively can be enriched) for solid-phase extraction (SPE) procedure based on the AC modified with 2-4-MBAT and 2-4-CBABT were 800 and 750 mL, respectively. The sorbed Zn(2+) and Cu(2+) ions were efficiently eluted by 8 mL of 4 mol L(-1) HNO(3) and preconcentration factor of 112.5 and 93.7 and experimental enhancement factor of 30 and 35 ions were obtained for Zn(2+) and Cu(2+), respectively. The application of this enrichment procedure allowed the extraction of trace metal ions with recoveries exceeding of 90%.

  7. Food irradiation

    International Nuclear Information System (INIS)

    Beishon, J.

    1991-01-01

    Food irradiation has been the subject of concern and controversy for many years. The advantages of food irradiation include the reduction or elimination of dangerous bacterial organisms, the control of pests and insects which destroy certain foods, the extension of the shelf-life of many products, for example fruit, and its ability to treat products such as seafood which may be eaten raw. It can also replace existing methods of treatment which are believed to have hazardous side-effects. However, after examining the evidence produced by the proponents of food irradiation, the author questions whether it has any major contribution to make to the problems of foodborne diseases or world food shortages. More acceptable solutions, he suggests, may be found in educating food handlers to ensure that hygienic conditions prevail in the production, storage and serving of food. (author)

  8. Halloysite Nanotubes as a New Adsorbent for Solid Phase Extraction and Spectrophotometric Determination of Iron in Water and Food Samples

    Science.gov (United States)

    Samadi, A.; Amjadi, M.

    2016-07-01

    Halloysite nanotubes (HNTs) have been introduced as a new solid phase extraction adsorbent for preconcentration of iron(II) as a complex with 2,2-bipyridine. The cationic complex is effectively adsorbed on the sorbent in the pH range of 3.5-6.0 and efficiently desorbed by trichloroacetic acid. The eluted complex has a strong absorption around 520 nm, which was used for determination of Fe(II). After optimizing extraction conditions, the linear range of the calibration graph was 5.0-500 μg/L with a detection limit of 1.3 μg/L. The proposed method was successfully applied for the determination of trace iron in various water and food samples, and the accuracy was assessed through the recovery experiments and analysis of a certified reference material (NIST 1643e).

  9. Carbon dots based dual-emission silica nanoparticles as ratiometric fluorescent probe for nitrite determination in food samples.

    Science.gov (United States)

    Xiang, Guoqiang; Wang, Yule; Zhang, Heng; Fan, Huanhuan; Fan, Lu; He, Lijun; Jiang, Xiuming; Zhao, Wenjie

    2018-09-15

    In this work, a simple and effective strategy for designing a ratiometric fluorescent nanosensor was described. A carbon dots (CDs) based dual-emission nanosensor for nitrite was prepared by coating the CDs on to dye-doped silica nanoparticles. Dual-emission silica nanoparticles fluorescence was quenched in sulfuric acid using potassium bromate (KBrO 3 ). The nitrite present catalyzed the KBrO 3 oxidation, resulting in ratiometric fluorescence response of the dual-emission silica nanoparticles. Several important parameters affecting the performance of the nanosensor were investigated. Under optimized conditions, the limit of detection was 1.0 ng mL -1 and the linear range 10-160 ng mL -1 . Furthermore, the sensor was suitable for nitrite determination in different food samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Survey of physicochemical characteristics and microbial contamination in selected food locally vended in Morogoro Municipality, Tanzania.

    Science.gov (United States)

    Nonga, Hezron Emmanuel; Ngowi, Helena Aminiel; Mdegela, Robinson Hammerthon; Mutakyawa, Eliud; Nyahinga, Gabriel Busungu; William, Robert; Mwadini, Mtumwa Mohd

    2015-11-26

    Raw milk, raw fruit juice and raw fish are enriched with essential nutrients for human diet but are prone to microbial contamination along the value chain. This cross sectional study was conducted to assess physicochemical characteristics and microbial quality of raw milk, fruit juice and fish from food vendors in Morogoro Municipality, Tanzania. The physicochemical assessment of food samples was done by smell, colour, presence of debris, turbidity, consistence, pH and clot on alcohol test. Hygiene of food containers, personnel and the vending environment was also assessed. Qualitative and quantitative microbial assessment of food was done using standard laboratory protocols as described by Tanzania Bureau of Standards and International Systems of Standards. Raw milk sold in Morogoro was of poor quality since was adulterated with water, contained sediments and clotted on alcohol test. Up to 63 % of the milk samples were contaminated with Escherichia coli and 60 % had higher total viable count (TVC) than the recommended values. Raw fruit juice was stored in dirty containers and sold under unhygienic environment. Seventy-three percent of juice samples had TVC beyond the recommendations while E. coli contamination rate was 63.3 %. The raw fish samples had started spoiling as depicted through sensory evaluation. E. coli contamination rate was 55 % and that of Campylobacter jejuni was 0.5 %. The mean TVC of raw fish was 8.1 (Log cfu/g) and 96.2 % of the fish samples had TVC beyond the recommended limits of 5.0 Log cfu/g. The physicochemical characteristics of food vended in Morogoro Municipality were of poor quality. The food had high bacterial contaminations. This situation poses health risks to the public and losses to food vendors due to spoilage. Stakeholders in food value chain should be educated on safe production and good hygienic practices. Routine quality and safety assessment of locally vended food, inspection of selling premises and regular health check-up of

  11. Radiation traces in exportation food samples of Parana State, Brazil; Tracos radioativos em amostras alimentares de exportacao do Parana

    Energy Technology Data Exchange (ETDEWEB)

    Scheibel, Viviane

    2002-02-01

    This work deals with radioactive traces measurements in foodstuffs produced at the State of Parana, with large export rate and also of nutritious products of some regional trading companies. The measured foods were: sulfite treated sugar, tea, mint candy, soy in grain, soy crumb, gross soy oil, gum free oil and commercial refined soy oil. Six samples of each lot of the analyzed material were prepared, which represent a sampling with 90% of confidence. The samples were sealed in Marinelli beaker of 2.1 L completely filled and kept during 40 days until secular equilibrium was achieved. The counting time for each measure was of 48 hours. Measurements were carried out by gamma-ray spectrometry employing a HPGe detector with 10% of relative efficiency, coupled to standard nuclear electronics and a 8 l multichannel card. The acquisition of the data was accomplished with the software Maestro{sup TM}, version 3.2. The energy resolution of the {sup 137} Cs 661.62 keV gamma line was 1.75 keV. The larger intensity gamma lines observed in the spectra were from the following radionuclides: {sup 228} Ac, {sup 208} Tl, {sup 212} Pb of the {sup 232} Th series, {sup 214} Bi and {sup 214} Pb from the {sup 238} U series, {sup 227} Ac from the {sup 235} U series and {sup 40} K. Activities and lower level of detection limits were calculated according to the International Agency of Atomic Energy norms.The detector efficiency was measured using a {sup 152} Eu certified source and IAEA-375 and IAEA-326 certified reference materials. For most of the radionuclides it was possible only the measurement of the minimum activity detectable in the foodstuffs. Self-attenuation corrections were accomplished with support literature results. The most important activity observed was that of {sup 40} K, whose value measured for soy in natura was 745.0 {sup +}-{sup 9}.1 Bq/kg and for the crumb soy 1473 {+-} 15 Bq/kg.. he measured activities of the several analyzed foods were compatible with the values

  12. Identification of characteristic aroma compounds in raw and thermally processed African giant snail (Achatina fulica).

    Science.gov (United States)

    Lasekan, Ola; Muniady, Megala; Lin, Mee; Dabaj, Fatma

    2018-04-24

    Food flavor appreciation is one of the first signals along with food appearance and texture encountered by consumers during eating of food. Also, it is well known that flavor can strongly influence consumer's acceptability judgment. The increase in the consumption of snail meat across the world calls for the need to research into the aroma compounds responsible for the distinctive aroma notes of processed snail meat. The odorants responsible for the unique aroma notes in thermally processed giant African snail meats were evaluated by means of aroma extract dilution analysis (AEDA), gas chromatography-olfactometry (GC-O) and odor activity values (OAVs) respectively. Results revealed significant differences in the aroma profiles of the raw and thermally processed snail meats. Whilst the aroma profile of the raw snail meat was dominated with the floral-like β-ionone and β-iso-methyl ionone, sweaty/cheesy-like butanoic acid, and the mushroom-like 1-octen-3-one, the boiled and fried samples were dominated with the thermally generated odorants like 2-methylpyrazine, 2,5-dimethylpyrazine, 2-acetylthiazole and 2-acetylpyridine. Finally, results have shown that sotolon, 2-acetyl-1-pyrroline, 2-furanmethanethiol, 2-methylbutanal, 1-octen-3-one, octanal, furanone, 2-methoxyphenol, 2-acetylpyridine, 2-acetylthiazole, and 2-methylpyrazine contributed to the overall aroma of the thermally processed snail meat.

  13. BASED COMPLEMENTARY FOODS USING GERMINAT

    African Journals Online (AJOL)

    user

    2010-08-08

    Aug 8, 2010 ... Malnutrition affects physical growth, morbidity, mortality, cognitive development, reproduction, and ... malnutrition. Development of complementary foods is guided by nutritional value, acceptability, availability and affordability of raw materials, and simplicity of food processing ... (Memmert, Germany) at 55. 0.

  14. Surveillance of bulk raw and commercially pasteurized cows' milk from approved Irish liquid-milk pasteurization plants to determine the incidence of Mycobacterium paratuberculosis.

    Science.gov (United States)

    O'Reilly, Ciara E; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R; Donaghy, John; Rowe, Michael; O'Mahony, Pat

    2004-09-01

    Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of 75 degrees C for 25 s. All analyses were undertaken at the Department of Food Science (Food Microbiology) laboratory at Queen's University Belfast. Each milk sample was subjected to two tests for M. paratuberculosis: immunomagnetic separation-PCR (IMS-PCR; to detect the presence of M. paratuberculosis cells, live or dead) and chemical decontamination and culture (to confirm the presence of viable M. paratuberculosis). Overall, M. paratuberculosis DNA was detected by IMS-PCR in 50 (12.9%; 95% confidence interval, 9.9 to 16.5%) raw-milk samples and 35 (9.8%; 95% confidence interval, 7.1 to 13.3%) pasteurized-milk samples. Confirmed M. paratuberculosis was cultured from one raw-milk sample and no pasteurized-milk samples. It is concluded that M. paratuberculosis DNA is occasionally present at low levels in both raw and commercially pasteurized cows' milk. However, since no viable M. paratuberculosis was isolated from commercially pasteurized cows' milk on retail sale in the Republic of Ireland, current pasteurization procedures are considered to be effective.

  15. Concentrations of bisphenol A in the composite food samples from the 2008 Canadian total diet study in Quebec City and dietary intake estimates.

    Science.gov (United States)

    Cao, X-L; Perez-Locas, C; Dufresne, G; Clement, G; Popovic, S; Beraldin, F; Dabeka, R W; Feeley, M

    2011-06-01

    A total of 154 food composite samples from the 2008 total diet study in Quebec City were analysed for bisphenol A (BPA), and BPA was detected in less than half (36%, or 55 samples) of the samples tested. High concentrations of BPA were found mostly in the composite samples containing canned foods, with the highest BPA level being observed in canned fish (106 ng g(-1)), followed by canned corn (83.7 ng g(-1)), canned soups (22.2-44.4 ng g(-1)), canned baked beans (23.5 ng g(-1)), canned peas (16.8 ng g(-1)), canned evaporated milk (15.3 ng g(-1)), and canned luncheon meats (10.5 ng g(-1)). BPA levels in baby food composite samples were low, with 2.75 ng g(-1) in canned liquid infant formula, and 0.84-2.46 ng g(-1) in jarred baby foods. BPA was also detected in some foods that are not canned or in jars, such as yeast (8.52 ng g(-1)), baking powder (0.64 ng g(-1)), some cheeses (0.68-2.24 ng g(-1)), breads and some cereals (0.40-1.73 ng g(-1)), and fast foods (1.1-10.9 ng g(-1)). Dietary intakes of BPA were low for all age-sex groups, with 0.17-0.33 µg kg(-1) body weight day(-1) for infants, 0.082-0.23 µg kg(-1) body weight day(-1) for children aged from 1 to 19 years, and 0.052-0.081 µg kg(-1) body weight day(-1) for adults, well below the established regulatory limits. BPA intakes from 19 of the 55 samples account for more than 95% of the total dietary intakes, and most of the 19 samples were either canned or in jars. Intakes of BPA from non-canned foods are low.

  16. The relationships between sixteen perfluorinated compound concentrations in blood serum and food, and other parameters, in the general population of South Korea with proportionate stratified sampling method.

    Science.gov (United States)

    Kim, Hee-Young; Kim, Seung-Kyu; Kang, Dong-Mug; Hwang, Yong-Sik; Oh, Jeong-Eun

    2014-02-01

    Serum samples were collected from volunteers of various ages and both genders using a proportionate stratified sampling method, to assess the exposure of the general population in Busan, South Korea to perfluorinated compounds (PFCs). 16 PFCs were investigated in serum samples from 306 adults (124 males and 182 females) and one day composite diet samples (breakfast, lunch, and dinner) from 20 of the serum donors, to investigate the relationship between food and serum PFC concentrations. Perfluorooctanoic acid and perfluorooctanesulfonic acid were the dominant PFCs in the serum samples, with mean concentrations of 8.4 and 13 ng/mL, respectively. Perfluorotridecanoic acid was the dominant PFC in the composite food samples, ranging from studies. We confirmed from the relationships between questionnaire results and the PFC concentrations in the serum samples, that food is one of the important contribution factors of human exposure to PFCs. However, there were no correlations between the PFC concentrations in the one day composite diet samples and the serum samples, because a one day composite diet sample is not necessarily representative of a person's long-term diet and because of the small number of samples taken. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Comparison of green sample preparation techniques in the analysis of pyrethrins and pyrethroids in baby food by liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Petrarca, Mateus Henrique; Ccanccapa-Cartagena, Alexander; Masiá, Ana; Godoy, Helena Teixeira; Picó, Yolanda

    2017-05-12

    A new selective and sensitive liquid chromatography triple quadrupole mass spectrometry method was developed for simultaneous analysis of natural pyrethrins and synthetic pyrethroids residues in baby food. In this study, two sample preparation methods based on ultrasound-assisted dispersive liquid-liquid microextraction (UA-DLLME) and salting-out assisted liquid-liquid extraction (SALLE) were optimized, and then, compared regarding the performance criteria. Appropriate linearity in solvent and matrix-based calibrations, and suitable recoveries (75-120%) and precision (RSD values≤16%) were achieved for selected analytes by any of the sample preparation procedures. Both methods provided the analytical selectivity required for the monitoring of the insecticides in fruit-, cereal- and milk-based baby foods. SALLE, recognized by cost-effectiveness, and simple and fast execution, provided a lower enrichment factor, consequently, higher limits of quantification (LOQs) were obtained. Some of them too high to meet the strict legislation regarding baby food. Nonetheless, the combination of ultrasound and DLLME also resulted in a high sample throughput and environmental-friendly method, whose LOQs were lower than the default maximum residue limit (MRL) of 10μgkg -1 set by European Community for baby foods. In the commercial baby foods analyzed, cyhalothrin and etofenprox were detected in different samples, demonstrating the suitability of proposed method for baby food control. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. A preconcentration system for determination of copper and nickel in water and food samples employing flame atomic absorption spectrometry.

    Science.gov (United States)

    Tuzen, Mustafa; Soylak, Mustafa; Citak, Demirhan; Ferreira, Hadla S; Korn, Maria G A; Bezerra, Marcos A

    2009-03-15

    A separation/preconcentration procedure using solid phase extraction has been proposed for the flame atomic absorption spectrometric determination of copper and nickel at trace level in food samples. The solid phase is Dowex Optipore SD-2 resin contained on a minicolumn, where analyte ions are sorbed as 5-methyl-4-(2-thiazolylazo) resorcinol chelates. After elution using 1 mol L(-1) nitric acid solution, the analytes are determinate employing flame atomic absorption spectrometry. The optimization step was performed using a full two-level factorial design and the variables studied were: pH, reagent concentration (RC) and amount of resin on the column (AR). Under the experimental conditions established in the optimization step, the procedure allows the determination of copper and nickel with limit of detection of 1.03 and 1.90 microg L(-1), respectively and precision of 7 and 8%, for concentrations of copper and nickel of 200 microg L(-1). The effect of matrix ions was also evaluated. The accuracy was confirmed by analyzing of the followings certified reference materials: NIST SRM 1515 Apple leaves and GBW 07603 Aquatic and Terrestrial Biological Products. The developed method was successfully applied for the determination of copper and nickel in real samples including human hair, chicken meat, black tea and canned fish.

  19. A preconcentration system for determination of copper and nickel in water and food samples employing flame atomic absorption spectrometry

    International Nuclear Information System (INIS)

    Tuzen, Mustafa; Soylak, Mustafa; Citak, Demirhan; Ferreira, Hadla S.; Korn, Maria G.A.; Bezerra, Marcos A.

    2009-01-01

    A separation/preconcentration procedure using solid phase extraction has been proposed for the flame atomic absorption spectrometric determination of copper and nickel at trace level in food samples. The solid phase is Dowex Optipore SD-2 resin contained on a minicolumn, where analyte ions are sorbed as 5-methyl-4-(2-thiazolylazo) resorcinol chelates. After elution using 1 mol L -1 nitric acid solution, the analytes are determinate employing flame atomic absorption spectrometry. The optimization step was performed using a full two-level factorial design and the variables studied were: pH, reagent concentration (RC) and amount of resin on the column (AR). Under the experimental conditions established in the optimization step, the procedure allows the determination of copper and nickel with limit of detection of 1.03 and 1.90 μg L -1 , respectively and precision of 7 and 8%, for concentrations of copper and nickel of 200 μg L -1 . The effect of matrix ions was also evaluated. The accuracy was confirmed by analyzing of the followings certified reference materials: NIST SRM 1515 Apple leaves and GBW 07603 Aquatic and Terrestrial Biological Products. The developed method was successfully applied for the determination of copper and nickel in real samples including human hair, chicken meat, black tea and canned fish

  20. A preconcentration system for determination of copper and nickel in water and food samples employing flame atomic absorption spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Tuzen, Mustafa [Department of Chemistry, Gaziosmanpasa University, 60250 Tokat (Turkey); Soylak, Mustafa [Department of Chemistry, Erciyes University, 38039 Kayseri (Turkey)], E-mail: soylak@erciyes.edu.tr; Citak, Demirhan [Department of Chemistry, Gaziosmanpasa University, 60250 Tokat (Turkey); Ferreira, Hadla S.; Korn, Maria G.A. [Universidade Federal da Bahia, Instituto de Quimica, 40170-290 Salvador (Brazil); Bezerra, Marcos A. [Universidade Estadual do Sudoeste da Bahia, 45200-190 Jequie (Brazil)

    2009-03-15

    A separation/preconcentration procedure using solid phase extraction has been proposed for the flame atomic absorption spectrometric determination of copper and nickel at trace level in food samples. The solid phase is Dowex Optipore SD-2 resin contained on a minicolumn, where analyte ions are sorbed as 5-methyl-4-(2-thiazolylazo) resorcinol chelates. After elution using 1 mol L{sup -1} nitric acid solution, the analytes are determinate employing flame atomic absorption spectrometry. The optimization step was performed using a full two-level factorial design and the variables studied were: pH, reagent concentration (RC) and amount of resin on the column (AR). Under the experimental conditions established in the optimization step, the procedure allows the determination of copper and nickel with limit of detection of 1.03 and 1.90 {mu}g L{sup -1}, respectively and precision of 7 and 8%, for concentrations of copper and nickel of 200 {mu}g L{sup -1}. The effect of matrix ions was also evaluated. The accuracy was confirmed by analyzing of the followings certified reference materials: NIST SRM 1515 Apple leaves and GBW 07603 Aquatic and Terrestrial Biological Products. The developed method was successfully applied for the determination of copper and nickel in real samples including human hair, chicken meat, black tea and canned fish.

  1. Determination of soy proteins in food samples by dispersive solid-phase immunoextraction and dynamic long-wavelength fluorometry

    International Nuclear Information System (INIS)

    Molina-Delgado, María Ángeles; Aguilar-Caballos, María Paz; Gomez-Hens, Agustina

    2013-01-01

    We report on a method for the determination of soy proteins in food samples via dispersive solid-phase immunoextraction using gold-coated magnetic nanoparticles (NPs) as a support. Soy proteins were first extracted using anti-soy protein antibodies immobilized on the NPs, and then quantified by measuring the increase in fluorescence of the long-wavelength fluorophore cresyl violet in the presence of the anionic surfactant sodium dodecyl sulfate at neutral pH in a flow system. The method involves the use of two standard or sample aliquots. The fluorescence intensity of one aliquot is directly measured whereas that of the other aliquot is measured after immunoextraction. The difference between the peak heights of both aliquots serves as the analytical information that is directly proportional to the protein concentration. The limit of detection is 0.35 mg L −1 , the linear range is from 1 to 15 mg L −1 , and the relative standard deviation is < 5 %. Proteins such as bovine serum albumin and globulins do not interfere at the same concentration level. The method was applied to the analysis of soy-based beverages and gave recoveries in the range between 80.0 and 107.3 %. (author)

  2. Food Peptidomics

    Directory of Open Access Journals (Sweden)

    Piotr Minkiewicz

    2008-01-01

    Full Text Available The aim of this review is to discuss the definition of food peptidomics and highlight the role of this approach in food and nutrition sciences. Similar to living organisms, food peptidome may be defined as the whole peptide pool present in a food product or raw material. This definition also covers peptides obtained during technological processes and/or storage. The area of interest of food peptidomics covers research concerning the origin of peptidome, its dynamic changes during processing and/or storage, the influence of its presence, the composition and changes in the pool of peptides on the properties of food products or raw materials as well as the methods applied in research into this group of compounds. The area of interests of food peptidomics would include biological activity, functional properties, allergenicity, sensory properties and information on the product or resource authenticity and origin as well as its history and relationships. Research methods applied in food peptidomics, with special emphasis on computational methods, are also summarized.

  3. Oat raw materials and bakery products - amino acid composition and celiac immunoreactivity.

    Science.gov (United States)

    Mickowska, Barbara; Litwinek, Dorota; Gambuś, Halina

    2016-01-01

    The aim of this study was to compare the biochemical and immunochemical properties of avenins in some special oat raw materials and additionally the possibility of using them as a raw material for the gluten-free bakery products. The compared oat raw materials were - oat flakes, commercial oat flours (including gluten-free oat flour) and residual oat flour, which is by-product of β-glucan preparation. Biochemical characteristic included amino acid compositions and SDS-PAGE profiles of extracted avenins. The immunochemical reactivity with polyclonal anti-gluten and monoclonal anti-gliadin antibodies was evaluated qualitatively and quantitatively by immunoblotting and ELISA methods. Additionally, experimental bakery products made of examined raw materials were assessed according to their suitability for the celiac patients' diet. The highest protein content was measured in the β-glucan preparation "Betaven" and gluten-free oat flour. Proteins of all materials are rich in glutamic and aspartic acid, leucine and arginine. Proportions of amino acids in avenins extracted from most of oat raw materials are similar, excluding gluten-free oat flour, which has a very low avenin content and proportions of individual amino acids are different. The SDS-PAGE protein pattern consisted of proteins with molecular weight of about 25-35 kDa. Polyclonal anti-gluten anti-body recognized all protein fractions of molecular weight higher than 20 kDa. Quantitative ELISA analysis shows that the majority of samples has a gliadin-like protein content within the range of 80-260 mg/kg, excluding gluten-free flours and corresponding bakery products. Altogether, β-glucan preparation has extremely high level of gliadin-like proteins. In the examined oat raw materials and foods the contents of immunoreactive amino acid sequences exceeded the limit of 20 mg/kg (considered as gluten-free) except for gluten-free flours (oat and  the prepared mixture) and the bakery products based on gluten

  4. Shape of snack foods does not predict snack intake in a sample of preschoolers: a cross-over study

    OpenAIRE

    Boyer Lauren E; Laurentz Sara; McCabe George P; Kranz Sibylle

    2012-01-01

    Abstract Background In the past decade, the proportion snacking has increased. Snack foods consumed are predominantly not nutritious foods. One potential venue to increase children’s diet quality is to offer healthy snack foods and we explored if shaped snack foods would lead to increased consumption. Methods We investigated the consumption of high-fiber snacks (banana bread, pancakes, and sandwiches) served either in normal (round, square) or shaped (heart, hands, animals) form to preschoole...

  5. The use of inductively coupled plasma mass spectrometry (ICP-MS) for the determination of toxic and essential elements in different types of food samples

    Science.gov (United States)

    Voica, C.; Dehelean, A.; Kovacs, M. H.

    2012-02-01

    Food is the primary source of essential elements for humans and it is an important source of exposure to toxic elements. In this context, levels of essential and toxic elements must be determined routinely in consumed food products. The content of trace elements (As, Pb, Cu, Cd, Zn, Sn, Hg) in different types of food samples (e.g. rice, bread, sugar, cheese, milk, butter, wheat, coffee, chocolate, biscuits pasta, etc.) was determined, using inductively coupled plasma mass spectrometry (ICP-MS). Trace element contents in some foods were higher than maximum permissible levels of toxic metals in human food (Cd in bread, Zn in cheese, Cu in coffee, Hg in carrots and peppers).

  6. Dietary patterns, nutrition knowledge and lifestyle: associations with blood pressure in a sample of Australian adults (the Food BP study).

    Science.gov (United States)

    Khalesi, S; Sharma, S; Irwin, C; Sun, J

    2016-10-01

    This study examined the association between dietary patterns, nutrition knowledge and lifestyle with blood pressure (BP) in a sample of Australian adults. Adults with normal and high BP were included in a cross-sectional study. Dietary intake data was collected using a Food Frequency Questionnaire. Nutrition knowledge and lifestyle surveys were included in the questionnaire. Dietary patterns were extracted using factor analysis followed by cluster analysis. Associations were analysed using logistic regression. Four hundred and seven participants were included. Three dietary patterns were identified: Western; Snack and alcohol; and Balanced. Participants with high BP had a higher intake of Western and a lower intake of Balanced dietary pattern. A significant and higher frequency of discretionary foods and oils consumption, as well as lower nutrition knowledge score and activity frequency, were observed in the high BP group. Regression analysis indicated that the intake of Western and Snack and alcohol dietary patterns increases the likelihood of having high BP by 2.40 (95% confidence interval (CI): 1.28-4.49) and 2.76 (95% CI: 1.52-5.00), respectively, when nutrition knowledge and lifestyle were controlled for as moderator variables. The likelihood of high BP was not associated with nutrition knowledge, but increased with physical inactivity. This study indicates that poor dietary patterns and inactivity are associated with increases in the likelihood of high BP, and the association is not influenced by nutrition knowledge. These findings indicate the importance of developing public health strategies with an emphasis on improving the dietary patterns of individuals to prevent and control high BP in Australian adults.

  7. Effects of various cooking processes on the concentrations of arsenic, cadmium, mercury, and lead in foods.

    Science.gov (United States)

    Perelló, Gemma; Martí-Cid, Roser; Llobet, Juan M; Domingo, José L

    2008-12-10

    The effects of cooking processes commonly used by the population of Catalonia (Spain) on total arsenic (As), cadmium (Cd), mercury (Hg), and lead (Pb) concentrations in various foodstuffs were investigated. All food samples were randomly acquired in local markets, big supermarkets, and grocery stores of Reus (Catalonia). Foods included fish (sardine, hake, and tuna), meat (veal steak, loin of pork, breast and thigh of chicken, and steak and rib of lamb), string bean, potato, rice, and olive oil. For each food item, two composite samples were prepared for metal analyses, whose levels in raw and cooked (fried, grilled, roasted, and boiled) samples were determined by inductively coupled plasma-mass spectrometry (ICP-MS). The highest concentrations of As, Hg, and Pb (raw and cooked samples) were mainly found in fish, with a clear tendency, in general, to increase metal concentrations after cooking. However, in these samples, Cd levels were very close to their detection limit. In turn, the concentrations of metals in raw and cooked meat samples were detected in all samples (As) or only in a very few samples (Cd, Hg, and Pb). A similar finding corresponded to string beans, rice, and olive oil, while in potatoes, Hg could not be detected and Pb only was detected in the raw samples. In summary, the results of the present study show that, in general terms, the cooking process is only of a very limited value as a means of reducing metal concentrations. This hypothetical reduction depends upon cooking conditions (time, temperature, and medium of cooking).

  8. Detection of Small Numbers of Campylobacter jejuni and Campylobacter coli Cells in Environmental Water, Sewage, and Food Samples by a Seminested PCR Assay

    Science.gov (United States)

    Waage, Astrid S.; Vardund, Traute; Lund, Vidar; Kapperud, Georg

    1999-01-01

    A rapid and sensitive assay was developed for detection of small numbers of Campylobacter jejuni and Campylobacter coli cells in environmental water, sewage, and food samples. Water and sewage samples were filtered, and the filters were enriched overnight in a nonselective medium. The enrichment cultures were prepared for PCR by a rapid and simple procedure consisting of centrifugation, proteinase K treatment, and boiling. A seminested PCR based on specific amplification of the intergenic sequence between the two Campylobacter flagellin genes, flaA and flaB, was performed, and the PCR products were visualized by agarose gel electrophoresis. The assay allowed us to detect 3 to 15 CFU of C. jejuni per 100 ml in water samples containing a background flora consisting of up to 8,700 heterotrophic organisms per ml and 10,000 CFU of coliform bacteria per 100 ml. Dilution of the enriched cultures 1:10 with sterile broth prior to the PCR was sometimes necessary to obtain positive results. The assay was also conducted with food samples analyzed with or without overnight enrichment. As few as ≤3 CFU per g of food could be detected with samples subjected to overnight enrichment, while variable results were obtained for samples analyzed without prior enrichment. This rapid and sensitive nested PCR assay provides a useful tool for specific detection of C. jejuni or C. coli in drinking water, as well as environmental water, sewage, and food samples containing high levels of background organisms. PMID:10103261

  9. 21 CFR 101.42 - Nutrition labeling of raw fruit, vegetables, and fish.

    Science.gov (United States)

    2010-04-01

    ... fish. 101.42 Section 101.42 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... Guidelines § 101.42 Nutrition labeling of raw fruit, vegetables, and fish. (a) The Food and Drug... fruit, vegetables, and fish at the point-of-purchase. If retailers choose to provide such information...

  10. A new approach for the determination of sulphur in food samples by high-resolution continuum source flame atomic absorption spectrometer.

    Science.gov (United States)

    Ozbek, N; Baysal, A

    2015-02-01

    The new approach for the determination of sulphur in foods was developed, and the sulphur concentrations of various fresh and dried food samples determined using a high-resolution continuum source flame atomic absorption spectrometer with an air/acetylene flame. The proposed method was optimised and the validated using standard reference materials, and certified values were found to be within the 95% confidence interval. The sulphur content of foods ranged from less than the LOD to 1.5mgg(-1). The method is accurate, fast, simple and sensitive. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Prevalence of 'Food Addiction' as Measured with the Yale Food Addiction Scale 2.0 in a Representative German Sample and Its Association with Sex, Age and Weight Categories.

    Science.gov (United States)

    Hauck, Carolin; Weiß, Annegret; Schulte, Erica Marla; Meule, Adrian; Ellrott, Thomas

    2017-01-01

    To assess the prevalence and correlates of addictive-like eating behavior in Germany. The German version of the Yale Food Addiction Scale (YFAS) 2.0 was used to investigate, for the first time, the prevalence of 'food addiction' in a representative sample aged 18-65 years (N = 1,034). The prevalence of 'food addiction' measured by the YFAS 2.0 was 7.9%. Individuals meeting criteria for 'food addiction' had higher BMI and were younger than individuals not meeting the threshold. Underweight (15.0%) and obese (17.2%) individuals exhibited the highest prevalence rate of 'food addiction'. Addictive-like eating was not associated with sex, education level, or place of residence. YFAS 2.0 'food addiction' was met by nearly 8% of the population. There is a non-linear relationship between addictive-like eating and BMI, with the highest prevalence among underweight and obese persons. These findings suggest that 'food addiction' may be a contributor to overeating but may also reflect a distinct phenotype of problematic eating behavior not synonymous with obesity. Further, the elevated prevalence of YFAS 2.0 'food addiction' among underweight individuals may reflect an overlap with eating disorders and warrants attention in future research. © 2017 The Author(s) Published by S. Karger GmbH, Freiburg.

  12. A FRACTIONATION STUDY OF MINERAL ELEMENTS IN RAW AND COOKED LEAF VEGETABLES CONSUMED IN SOUTHERN BRAZIL

    Directory of Open Access Journals (Sweden)

    Luciane Mie KAWASHIMA

    2009-07-01

    Full Text Available

    Five samplings of leaf vegetables widely consumed in Southern Brazil (lettuce, rucola, watercress, kale, chicory, Chinese cabbage, and cabbage were taken during the period of a year in food markets of the city of Campinas, Brazil. A selective extraction of potassium, sodium, calcium, magnesium, iron, manganese, copper, and zinc was conducted on the raw vegetables and four of the vegetables (kale, chicory, Chinese cabbage, and cabbage were also cooked briefly under dry heat for three minutes and submitted to the selective extraction. The extraction separated the minerals into fractions containing mineral elements bound to soluble complexes, bound to ligands solubilized by mild acidic oxidizing conditions, and bound to insoluble ligands under mild acidic oxidizing conditions. The minerals concentrations in each fraction were determined by flame atomic absorption spectrometry. The amount of K, Na, Ca, and Mg extractable at pH 7.0 (soluble fraction from raw vegetables varied between 22 to 75 % of the total content of the mineral present. The soluble fractions of minor elements such as Mn, Zn, and Fe varied from 0 to 100% in the raw vegetables. The brief cooking used besides causing negligible losses of the minerals also increased the solubility of the minerals by 44% to 200%. KEYWORDS: Leaf vegetables; soluble mineral elements in vegetables.

  13. Prevalence and quantification of Vibrio parahaemolyticus in raw salad vegetables at retail level.

    Science.gov (United States)

    Tunung, Robin; Margaret, Selina; Jeyaletchumi, Ponniah; Chai, Lay C; Tuan Zainazor, Tuan C; Ghazali, Farinazleen M; Nakaguchi, Yoshitsugu; Nishibuchi, Mitsuaki; Son, Radu

    2010-02-01

    The purpose of this study was to investigate the biosafety of Vibrio parahaemolyticus in raw salad vegetables at wet market and supermarket in Malaysia. A combination of Most Probable Number - Polymerase Chain Reaction (MPN-PCR) method was applied to detect the presence of V. parahaemolyticus and to enumerate their density in the food samples. The study analyzed 276 samples of common vegetables eaten raw in Malaysia (Wild cosmos = 8; Japanese parsley = 21; Cabbage = 30; Lettuce = 16; Indian pennywort = 17; Carrot = 31; Sweet potato = 29; Tomato = 38; Cucumber = 28; Four winged bean = 26; Long bean = 32). The samples were purchased from two supermarkets (A and B) and two wet markets (C and D). The occurrence of V. parahaemolyticus detected was 20.65%, with higher frequency of V. parahaemolyticus in vegetables obtained from wet markets (Wet market C = 27.27%Wet Market D = 32.05%) compared to supermarkets (Supermarket A = 1.64%; Supermarket B = 16.67%). V. parahaemolyticus was most prevalent in Indian pennywort (41.18%). The density of V. parahaemolyticus in all the samples ranged from 2400 MPN/g, mostly Malaysia.

  14. "On-off" switchable tool for food sample preparation: merging molecularly imprinting technology with stimuli-responsive blocks. Current status, challenges and highlighted applications.

    Science.gov (United States)

    Garcia, Raquel; Gomes da Silva, Marco D R; Cabrita, Maria João

    2018-01-01

    Sample preparation still remains a great challenge in the analytical workflow representing the most time-consuming and laborious step in analytical procedures. Ideally, sample pre-treatment procedures must be more selective, cheap, quick and environmental friendly. Molecular imprinting technology is a powerful tool in the development of highly selective sample preparation methodologies enabling to preconcentrate the analytes from a complex food matrix. Actually, the design and development of molecularly imprinted polymers-based functional materials that merge an enhancement of selectivity with a controllable and switchable mode of action by means of specific stimulus constitutes a hot research topic in the field of food analysis. Thus, combining the stimuli responsive mechanism and imprinting technology a new generation of materials are emerging. The application of these smart materials in sample preparation is in early stage of development, nevertheless new improvements will promote a new driven in the demanding field of food sample preparation. The new trends in the advancement of food sample preparation using these smart materials will be presented in this review and highlighted the most relevant applications in this particular area of knowledge. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Visual illusion in mass estimation of cut food.

    Science.gov (United States)

    Wada, Yuji; Tsuzuki, Daisuke; Kobayashi, Naoki; Hayakawa, Fumiyo; Kohyama, Kaoru

    2007-07-01

    We investigated the effect of the appearance of cut food on visual mass estimation. In this experiment, we manipulated the shape (e.g., a block, fine strips, or small cubes) of food samples of various masses, and presented them on a CRT display as stimuli. Eleven subjects participated in tasks to choose the picture of the food sample which they felt indicated a target mass. We used raw carrots and surimi (ground fish) gel as hard and soft samples, respectively. The results clearly confirm an existence of an illusion, and this indicates that the appearance of food interferes with visual mass estimation. Specifically, participants often overestimated the mass of finely cut food, especially fine strips, whereas they could accurately estimate the mass of block samples, regardless of the physical characteristics of the foods. The overestimation of the mass of cut food increased with the food's actual mass, and was particularly obvious with increases of apparent volume when cut into fine strips. These results suggest that the apparent volume of a food sample effects the visual estimation of its mass. Hence we can conclude that there are illusions associated with the visual presentation of food that may influence various food impressions, including satisfaction and eating behaviour.

  16. Topical papers on raw materials

    International Nuclear Information System (INIS)

    1978-01-01

    In the papers of this working group, the availability of uranium and the long-term supply situation for this raw material are discussed. A problem closely connected with uranium supply are the commercial contracts and their particularities. The points of view of the reporting countries of Great Britain, South Africa, Switzerland, Australia, Japan, and Korea are made clear

  17. Prevalence and antibiotic resistance of Enterococcus spp. isolated from retail cheese, ready-to-eat salads, ham, and raw meat.

    Science.gov (United States)

    Pesavento, G; Calonico, C; Ducci, B; Magnanini, A; Lo Nostro, A

    2014-08-01

    Food specimens were analyzed in order to research Enterococcus spp.: 636 samples of raw meat (227 beef, 238 poultry, and 171 pork), 278 samples of cheese (110 fresh soft cheese and 168 mozzarella cheese), 214 samples of ready-to-eat salads, and 187 samples of ham. 312 strains of Enterococcus spp samples were isolated, then identified and submitted to susceptibility tests against 11 antimicrobial agents. The predominant species were Enterococcus faecalis in raw meat and Enterococcus faecium in retail products. Low percentages of microorganisms were resistant to vancomycin (3.53%), teicoplanin (2.24%), linezolid (0.32%), and amoxicillin in combination with clavulanic acid (0.32%). A high percentage of resistance was noted in E. faecalis at high level gentamicin (21.9%) and tetracycline (60.6%). In general, strains of E. faecalis were more resistant than E. faecium. Enterococci should be considered not only potential pathogens, but also a reservoir of genes encoding antibiotic resistance which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important in order to identify foods which potentially represent a real risk to the population, and to ensure effective treatment of human enterococcal infections. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Implementation of Competitive Food and Beverage Standards in a Sample of Massachusetts Schools: The NOURISH Study (Nutrition Opportunities to Understand Reforms Involving Student Health).

    Science.gov (United States)

    Hoffman, Jessica A; Rosenfeld, Lindsay; Schmidt, Nicole; Cohen, Juliana F W; Gorski, Mary; Chaffee, Ruth; Smith, Lauren; Rimm, Eric B

    2015-08-01

    During 2012, Massachusetts adopted comprehensive school competitive food and beverage standards that closely align with Institute of Medicine recommendations and Smart Snacks in School national standards. We examined the extent to which a sample of Massachusetts middle schools and high schools sold foods and beverages that were compliant with the state competitive food and beverage standards after the first year of implementation, and complied with four additional aspects of the regulations. Observational cohort study with data collected before implementation (Spring 2012) and 1 year after implementation (Spring 2013). School districts (N=37) with at least one middle school and one high school participated. Percent of competitive foods and beverages that were compliant with Massachusetts standards and compliance with four additional aspects of the regulations. Data were collected via school site visits and a foodservice director questionnaire. Multilevel models were used to examine change in food and beverage compliance over time. More products were available in high schools than middle schools at both time points. The number of competitive beverages and several categories of competitive food products sold in the sample of Massachusetts schools decreased following the implementation of the standards. Multilevel models demonstrated a 47-percentage-point increase in food and 46-percentage-point increase in beverage compliance in Massachusetts schools from 2012 to 2013. Overall, total compliance was higher for beverages than foods. This study of a group of Massachusetts schools demonstrated the feasibility of schools making substantial changes in response to requirements for healthier competitive foods, even in the first year of implementation. Copyright © 2015 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

  19. Comparison between the efficacy of two cleanup methods for the {sup 1}H NMR analysis of food samples contaminated with Cypermethrin

    Energy Technology Data Exchange (ETDEWEB)

    Silva, M.M.; Figueroa-Villar, J.D.; Aguiar, A.P. [Instituto Militar de Engenharia (IME), Rio de Janeiro, RJ (Brazil). Dept. de Quimica; Riehl, C.A.S. [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Inst. de Quimica. Dept. de Quimica Analitica]. E-mail: riehl@iq.ufrj

    2004-07-01

    This work aimed to study the use of {sup 1}H NMR for the identification of cypermethrin in cooked foods. {sup 1}H NMR is not commonly used in these cases, because food samples ready for consumption have complex substances, mainly lipids, which usually interfere with the identification of cypermethrin. Thus, we drew a comparison between the most applied method for the treatment of those samples and an alternative route that made possible the use of {sup 1}H NMR in the identification of cypermethrin in a matrix consisting of rice, bean, and chicken, which allows the Forensic work for such cases.(author)

  20. Mineralogy And Raw Material Characterization Of Esie Stone ...

    African Journals Online (AJOL)

    Electronprobe mineral data of samples of Esie statues is presented as a possible tool for provenance studies. Most of the samples contain talc, chlorite, cummingtonite and rarely tremolite. Other talc-bearing schists are prevalent in the Esie area. However talc-cummingtonite rocks, similar to the raw materials used for the ...

  1. The Evaluation of Aflatoxin M1 Level in Collected Raw Milk for Pasteurized Dairy

    Directory of Open Access Journals (Sweden)

    Ehsan Sadeghi

    2013-03-01

    Full Text Available Background: Aflatoxins are fungal toxins that have carcinogenic, cellular mutations and malformation effects. Aflatoxin M1 resists pasteurization, autoclave and the other methods that make foodstuff healthy. This study aims to determine the contents of aflatoxin M1 in raw milk of milk factories in Kermanshah province.Materials and Methods: This research is carried out through the descriptive-cross sectional method. Among the raw milk received by four pasteurized milk factories in Kermanshah, coded by (A, B, C, D labels, six samples, totally 320 samples (80 samples from each factory, were taken within four seasons. The concentration of aflatoxin M1 was examined by Enzyme-Linked Immunosorbent Assay (ELISA. The mean difference was analyzed statistically through t-test using SPSS software. Results: The content of aflatoxin was higher than Codex standard (0.5 µg/l in 295 samples. The total mean was 1.21, which exceeds two times the Codex standard. The highest and lowest contents of aflatoxin M1 were observed in “Factory D” in spring and in “Factory A” in autumn, respectively. There was a significant difference between contamination of aflatoxin M1 and different seasons (p< 0.05.Conclusion: High content of aflatoxin M1 in raw milk is worrying. Measuring the content of aflatoxin M1 is essential to reduce the toxin entering the daily food of animals and the other related factors. The considerable difference of aflatoxin M1 content between Factory D and Factory A can be attributed to the amount of the local milk and the industrial milk received by the factories.

  2. Monitoring of foodborne pathogens in raw cow milk in Tuscany

    Directory of Open Access Journals (Sweden)

    Laura Gasperetti

    2014-03-01

    Full Text Available Raw milk consumption in Italy has increased over the last few years and although raw milk is characterised by cold chain, short shelf-life and the duty of boiling before domestic consumption, it is still considered a hazard. From 2010 to 2013 a monitoring survey of raw milk sold through vending machines was carried out to investigate the occurrence of several foodborne pathogens stipulated in the national legal requirements, i.e. Listeria monocytogenes, Campylobacter spp., Salmonella spp., Escherichia coli O:157 and coagulase-positive Staphylococci. A total of 127 raw milk samples were collected from 19 dairy herds in Tuscany Region, Italy. In addition, the milk samples were tested for the presence and count of Yersinia genus. Results shown that only one sample was positive for non verocytotoxin- producing E. coli O:157, whereas a total of 38 samples (29.9% were postive for Yersinia genus; of the total 39 isolated bacteria, 23.6% were Y. enterocolitica, 2.4% Y. kristenseni and 4.7% Y. frederiksenii. None isolate was enteropathogenic; serotypes O:5 and O:8 were found in 16.6 and 13.3% of the isolates respectively, whereas none of the serotypes tested was detected in 70% of the isolates. The most probable number method revealed a count value between 0.03 and 24 MPN/mL. Based on these data a general assurance on health safety of raw milk produced and sold in Tuscany could be assessed.

  3. Food addiction in a Spanish sample of eating disorders: DSM-5 diagnostic subtype differentiation and validation data.

    Science.gov (United States)

    Granero, Roser; Hilker, Ines; Agüera, Zaida; Jiménez-Murcia, Susana; Sauchelli, Sarah; Islam, Mohammed A; Fagundo, Ana B; Sánchez, Isabel; Riesco, Nadine; Dieguez, Carlos; Soriano, José; Salcedo-Sánchez, Cristina; Casanueva, Felipe F; De la Torre, Rafael; Menchón, José M; Gearhardt, Ashley N; Fernández-Aranda, Fernando

    2014-11-01

    Although the concept of 'food addiction' (FA) has raised growing interest because of evidence for similarities between substance dependence and excessive food intake, there is a lack of studies that explore this construct among the wide spectrum of eating disorders (EDs). Besides providing validation scores of a Spanish version of the Yale FA Scale (YFAS-S), this study examined the prevalence of 'FA' among ED subtypes compared with healthy-eating controls (HCs) and the association between 'FA' scores, eating symptomatology and general psychopathology. A sample of 125 adult women with ED, diagnosed according to Diagnostic and Statistical Manual of Mental Disorders 5 criteria, and 82 healthy-eating women participated in the study. All participants were assessed with the YFAS-S, the ED Inventory-2 and the Symptom Checklist-Revised. Results showed that the internal structure of the one-dimensional solution for the YFAS-S was very good (α = 0.95). The YFAS-S has a good discriminative capacity to differentiate between ED and controls (specificity = 97.6% and sensitivity (Se) = 72.8%; area under receiver operating characteristic curve = 0.90) and a good Se to screen for specific ED subtypes. YFAS-S scores were associated with higher levels of negative affect and depression, higher general psychopathology, more severe eating pathology and greater body mass index. When comparing the prevalence of 'FA' between ED subtypes, the lowest prevalence of 'FA', measured with the YFAS-S, was for the anorexia nervosa (AN) restrictive subtype with 50%, and the highest was for the AN binge-purging subtype (85.7%), followed by bulimia nervosa (81.5%) and binge eating disorder (76.9%). In conclusion, higher YFAS-S scores are associated with bingeing ED-subtype patients and with more eating severity and psychopathology. Although the 'FA' construct is able to differentiate between ED and HC, it needs to be further explored. Copyright © 2014 John Wiley & Sons, Ltd and

  4. [Incidence of Campylobacter spp. and Salmonella spp. in raw and roasted chicken in Guadalajara, Mexico].

    Science.gov (United States)

    Castillo-Ayala, A; Salas-Ubiarco, M G; Márquez-Padilla, M L; Osorio-Hernández, M D

    1993-01-01

    The presence of Campylobacter spp. and Salmonella was studied in 70 samples of fresh retail chicken pieces and in 40 samples of roast chicken. Total plate count was performed in every sample as well. Most of the samples of fresh chicken yielded total plate counts > 10(8)/piece (thigh), while in roast chicken these counts ranged from 10(3) to 10(5)/piece (leg and thigh). Campylobacter was isolated from 33% of fresh chicken and from no sample of roast chicken. Salmonella was isolated from 69% of fresh chicken and 2.5% of roast chicken. There was no relationship between total plate counts in fresh chicken and isolation of either Campylobacter or Salmonella. Sixty percent of the Salmonella isolates belonged to serotype S. anatum, and about 50% of the isolates of Campylobacter were identified as being C. coli. The only Salmonella-positive sample of roast chicken yielded three serotypes: S. give, S. muenster, and S. manhattan. Presence of Campylobacter and Salmonella in chicken is of concern, due to the risk of spreading from the raw food to other cooked foods. The isolation of pathogens from roast chicken indicates mishandling during processing and/or storage of the product.

  5. EFFECTIVENESS OF RISK MANAGEMENT IN DIRECTLY RAW MILK SELLING AT “E. AVANZI” CENTER OF PISA UNIVERSITY

    Directory of Open Access Journals (Sweden)

    S. Rindi

    2010-03-01

    Full Text Available Authors show the results about the effectiveness verification of prevention measures adopted in raw milk directly selling at “E. Avanzi” Centre of Pisa University. The good hygienic practices applied during production, storage and selling phases demonstrated to guarantee, in raw milk, conditions complying to hygienic criteria provided for the current regulation in Tuscany. The effectiveness verification about risk communication, carried out interviewing a sample of buyers, shows as, beside a predominant attitude towards attention to potential hygienic risks, overstay areas of reduced awareness about food risk and the ways to manage prevention. Authors hope for, in this context, such as in other similar productions, the approach yet launched towards continuous improvement of good hygienic practices adopted by businesses, could be extended to risk communication, with the aim to promote conscious and responsable choices of consumer.

  6. Restaurant Policies and Practices for Serving Raw Fish in Minnesota.

    Science.gov (United States)

    Hedeen, Nicole

    2016-10-01

    The number of restaurants serving sushi within Minnesota is continuously increasing. The practices and protocols of serving raw fish are complex and require detailed planning to ensure that food served to patrons will not cause illness. Although the popularity of sushi is increasing, there is a lack of research on food safety issues pertaining to preparation of raw fish and sushi rice. To address this gap, the Minnesota Department of Health Environmental Health Specialists Network Food program collected descriptive data on restaurant practices and policies concerning the service of raw fish and sushi rice in 40 Minnesota restaurants. At each restaurant, a specialist interviewed a restaurant manager, conducted an observation of the sushi prep areas in the restaurant kitchen, and reviewed parasite destruction letters and invoices from fish supplier(s). Over half of the restaurants (59%) were missing one or more of the parasite destruction letters from their fish supplier(s) guaranteeing that fish had been properly frozen to the time and temperature requirements in the Minnesota Food Code. A total of 42 parasite destruction letters from suppliers were observed; 10% were considered "adequate" letters. The majority of the letters were missing details pertaining to the types of fish frozen, the length of time fish were frozen, or details on what temperatures fish were held frozen or a combination of all three. Most restaurants were using time as a public health control for their sushi rice. For those restaurants using time as a public health control, 26% had a written procedure on-site, and approximately 53% were keeping track of time. Bare hand contact during sushi prep was observed in 17% of restaurants, and in more than 40% of the restaurants, at least one fish was mislabeled on the menu. Findings from this study indicate that many Minnesota restaurants are not complying with the Food Code requirements pertaining to parasite destruction for the service of raw fish or

  7. An exploration and comparison of food and drink availability in homes in a sample of families of White and Pakistani origin within the UK.

    Science.gov (United States)

    Bryant, Maria; Sahota, Pinki; Santorelli, Gillian; Hill, Andrew

    2015-05-01

    Knowledge of the types and quantities of foods and drinks available in family homes supports the development of targeted intervention programmes for obesity prevention or management, or for overall diet improvement. In the UK, contemporary data on foods that are available within family homes are lacking. The present study aimed to explore home food and drink availability in UK homes. An exploratory study using researcher-conducted home food availability inventories, measuring all foods and drinks within the categories of fruits, vegetables, snack foods and beverages. Bradford, a town in the north of the UK. Opportunistic sample of mixed ethnicity families with infants approximately 18 months old from the Born in Bradford birth cohort. All homes had at least one type of fruit, vegetable and snack available. Fresh fruits commonly available were oranges, bananas, apples, satsumas and grapes. Commonly available fresh vegetables included potatoes, cucumber, tomatoes and carrots. The single greatest non-fresh fruit available in homes was raisins. Non-fresh vegetables contributing the most were frozen mixed vegetables, tinned tomatoes and tinned peas. Ethnic differences were found for the availability of fresh fruits and sugar-sweetened beverages, which were both found in higher amounts in Pakistani homes compared with White homes. These data contribute to international data on availability and provide an insight into food availability within family homes in the UK. They have also supported a needs assessment of the development of a culturally specific obesity prevention intervention in which fruits and vegetables and sugar-sweetened beverages are targeted.

  8. Direct determination of cadmium in foods by solid sampling electrothermal vaporization inductively coupled plasma mass spectrometry using a tungsten coil trap

    Science.gov (United States)

    Zhang, Ying; Mao, Xuefei; Liu, Jixin; Wang, Min; Qian, Yongzhong; Gao, Chengling; Qi, Yuehan

    2016-04-01

    In this work, a solid sampling device consisting of a tungsten coil trap, porous carbon vaporizer and on-line ashing furnace of a Ni-Cr coil was interfaced with inductively coupled plasma mass spectrometry (ICP-MS). A modified double gas circuit system was employed that was composed of carrier and supplemental gas lines controlled by separate gas mass flow controllers. For Cd determination in food samples using the assembled solid sampling ICP-MS, the optimal ashing and vaporization conditions, flow rate of the argon-hydrogen (Ar/H2) (v:v = 24:1) carrier gas and supplemental gas, and minimum sampling mass were investigated. Under the optimized conditions, the limit of quantification was 0.5 pg and the relative standard deviation was within a 10.0% error range (n = 10). Furthermore, the mean spiked recoveries for various food samples were 99.4%-105.9% (n = 6). The Cd concentrations measured by the proposed method were all within the certified values of the reference materials or were not significantly different (P > 0.05) from those of the microwave digestion ICP-MS method, demonstrating the good accuracy and precision of the solid sampling ICP-MS method for Cd determination in food samples.

  9. Effect of sample preparation method on sensory quality of cooked chicken breast fillets processed for food service

    Science.gov (United States)

    Chicken fillets (Pectoralis major) are one of popular items for food service. In the store, especially in fast food service stores, ready-to-cook meat products are commonly stored in freezers before use. The frozen meat can be cooked either directly from a frozen stage or after thawing. However, the...

  10. Sildenafil and analogous phosphodiesterase type 5 (PDE-5) inhibitors in herbal food supplements sampled on the Dutch market

    NARCIS (Netherlands)

    Reeuwijk, N.M.; Venhuis, B.J.; Kaste, de D.; Hoogenboom, L.A.P.; Rietjens, I.; Martena, M.J.

    2013-01-01

    Herbal food supplements, claiming to enhance sexual potency, may contain deliberately added active pharmacological ingredients (APIs) that can be used for the treatment of erectile dysfunction (ED). The aim of this study was to determine whether herbal food supplements on the Dutch market indeed

  11. Transfer of ochratoxin A from raw black tea to tea infusions prepared according to the Turkish tradition.

    Science.gov (United States)

    Toman, Jakub; Malir, Frantisek; Ostry, Vladimir; Kilic, Mehmet Akif; Roubal, Tomas; Grosse, Yann; Pfohl-Leszkowicz, Annie

    2018-01-01

    Ochratoxin A (OTA) is a natural contaminant of food including tea with multiple toxic effects, which poses a threat to human health. In terms of lifestyle, the Turkish population is a frequent visitor of tearooms, and the traditional Turkish tea preparation is one of the most popular ways of preparing tea infusion. The aim of this study was to investigate OTA transfer from raw black tea to the tea infusion prepared according to the Turkish tradition. A high-performance liquid chromatography method with a limit of quantification of 0.35 ng g -1 was used for OTA determination. The OTA amount in raw black teas from Turkey ranged from ≤0.35 ng g -1 up to 56.7 ng g -1 . An homogenised sample of black tea naturally contaminated with 55.0 ng g -1 was used to prepare infusions. The OTA transfer from the black tea to the infusion was found to be 41.5% ± 7%. These data are important for the realisation of a 'Total Diet study' (TDS). The TDS can be a complementary tool to estimate the population dietary exposure to OTA across the entire diet by analysing main foods prepared 'as consumed' (tea infusions) and not 'as purchased' (raw tea). © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  12. Association between junk food consumption and mental health in a national sample of Iranian children and adolescents: the CASPIAN-IV study.

    Science.gov (United States)

    Zahedi, Hoda; Kelishadi, Roya; Heshmat, Ramin; Motlagh, Mohammad Esmaeil; Ranjbar, Shirin Hasani; Ardalan, Gelayol; Payab, Moloud; Chinian, Mohammad; Asayesh, Hamid; Larijani, Bagher; Qorbani, Mostafa

    2014-01-01

    The consumption of high energy and low nutritional content foods, which are known as junk foods, has increased. The aim of this study was to evaluate the association between junk food intake and mental health in a national sample of Iranian children and adolescents. Data were obtained from a surveillance system entitled CASPIAN-IV (Childhood and Adolescence Surveillance and Prevention of Adult Non communicable Disease) study of school students, ages 6 to 18 y in Iran. The students and their parents completed two sets of reliable questionnaires obtained from Global School Health Survey translated to Persian. The student questionnaire comprised several questions such as psychiatric distress (worry, depression, confusion, insomnia, anxiety, aggression, and worthless) and violent behaviors (physical fighting, being a victim, and bullying). The junk foods consisted of sweets, sweetened beverages, fast foods, and salty snacks. In the sample of 13 486 children and adolescents, the frequency of junk food consumption was significantly associated with psychiatric distress (P junk foods (P 0.05). Additionally, the results of logistic regression showed that daily consumption of sweetened beverages and snacks significantly increased the odds of self-reported psychiatric distress. Also, daily consumption of salty snacks was significantly associated with violent behavior, including physical fighting (odds ratio [OR], 1.39; 95% confidence interval [CI], 1.21-1.60), being a victim (OR, 1.19; 95% CI, 1.04-1.37), and bullying (OR, 1.55; 95% CI, 1.32-1.82). Junk food consumption may increase the risk for psychiatric distress and violent behaviors in children and adolescents. Improvement of eating habits toward healthier diets may be an effective approach for improving mental health. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Public health investigations of Salmonella Enteritidis in catering raw shell eggs, 2002-2004.

    Science.gov (United States)

    Little, C L; Surman-Lee, S; Greenwood, M; Bolton, F J; Elson, R; Mitchell, R T; Nichols, G N; Sagoo, S K; Threlfall, E J; Ward, L R; Gillespie, I A; O'Brien, S

    2007-06-01

    In response to a dramatic change in the epidemiology of Salmonella Enteritidis in England and Wales thought to be associated with raw shell eggs, the Health Protection Agency initiated public health investigations to establish the incidence of Salmonella contamination and origin of eggs used by catering premises implicated in outbreaks of Salm. Enteritidis. Between October 2002 and November 2004, 16 971 eggs were sampled and Salmonella were recovered from 3.4%. Salmonella was isolated from 5.5% and 6.3% of Spanish and eggs of unknown origin, respectively, used in catering premises linked to outbreaks, a level significantly higher than that (1.1%) found in nonLion Quality UK eggs sampled. The small sample of UK Lion Quality eggs tested (reflecting their lack of use in premises visited) did not contain Salmonella. Several phage types of Salm. Enteritidis other than phage type 4 (PT 4) were identified with nonUK eggs. Eggs from Spain were implicated as a major source of infection. Eggs were contaminated more frequently with Salmonella when shells were dirty and/or cracked, and stored at above 8 degrees C. The use of Spanish eggs by the catering sector has been identified as a consistent significant factor in many of the outbreaks caused by Salm. Enteritidis nonPT4 in England and Wales during 2002-2004. Advice to caterers and hospitals that raw shell eggs should not be used in food that will either not be cooked or only lightly cooked should be reinforced.

  14. Factors affecting adherence to a raw vegan diet.

    Science.gov (United States)

    Link, Lilli B; Jacobson, Judith S

    2008-02-01

    The purpose of this study was to evaluate adherence and identify predictors of adherence to a raw vegan diet (i.e., uncooked plant foods) following a stay at a raw vegan institute. In this cohort study of guests at a raw vegan institute, subjects completed written questionnaires upon arrival and 12 weeks later. Of 107 eligible guests, 84 participated. Mean age was 54 years, 23 were male, and 73 white. Fifty-one completed the 12-week follow-up. Eight (16%) reported their diet to be 80% raw vegan at baseline and 14 (28%) at follow-up. Based on a raw vegan dietary adherence score (range 0-42) created for this study, mean adherence (SD) increased from 15.1 (5.4) to 17.0 (5.8) over 12 weeks (p=0.03). Baseline predictors of adherence included: education (beta=0.95), severity of disease (beta=0.98), and self-efficacy to adhere (beta=0.72). Future interventions that evaluate this diet should address self-efficacy, an important, potentially remediable predictor of adherence.

  15. Factors affecting adherence to a raw vegan diet

    Science.gov (United States)

    Link, Lilli B.; Jacobson, Judith S.

    2008-01-01

    The purpose of this study was to evaluate adherence and identify predictors of adherence to a raw vegan diet (i.e., uncooked plant foods) following a stay at a raw vegan institute. In this cohort study of guests at a raw vegan institute, subjects completed written questionnaires upon arrival and 12 weeks later. Of 107 eligible guests, 84 participated. Mean age was 54 years, 23 were male, and 73 white. Fifty-one completed the 12-week follow-up. Eight (16%) reported their diet to be ≥80% raw vegan at baseline and 14 (28%) at follow-up. Based on a raw vegan dietary adherence score (range 0-42) created for this study, mean adherence (SD) increased from 15.1 (5.4) to 17.0 (5.8) over 12 weeks (p=0.03). Baseline predictors of adherence included: education (β=0.95), severity of disease (β=0.98), and self-efficacy to adhere (β=0.72). Future interventions that evaluate this diet should address self-efficacy, an important, potentially remediable predictor of adherence. PMID:18243943

  16. Raw materials in the manufacture of biotechnology products: regulatory considerations.

    Science.gov (United States)

    Cordoba-Rodriguez, Ruth

    2010-01-01

    The Food and Drug Administration's Pharmaceutical cGMPs for the 21st Century initiative emphasizes science and risk-based approaches in the manufacture of drugs. These approaches are reflected in the International Conference on Harmonization (ICH) guidances ICH Q8, Q9, and Q10 and encourage a comprehensive assessment of the manufacture of a biologic, including all aspects of manufacture that have the potential to affect the finished drug product. Appropriate assessment and management of raw materials are an important part of this initiative. Ideally, a raw materials program should strive to assess and minimize the risk to product quality. With this in mind, risk-assessment concepts and control strategies will be discussed and illustrated by examples, with an emphasis on the impact of raw materials on cell substrates. Finally, the life cycle of the raw material will be considered, including its potential to affect the drug product life cycle. In this framework, the supply chain and the vendor-manufacturer relationship will be explored as important parts of an adequate raw materials control strategy.

  17. Food Applications and Regulation

    Science.gov (United States)

    Gálvez, Antonio; Abriouel, Hikmate; Omar, Nabil Ben; Lucas, Rosario

    This chapter deals with food applications of bacteriocins. Regulatory issues on the different possibilities for incorporating bacteriocins as bioprotectants are discussed. Specific applications of bacteriocins or bacteriocin-producing strains are described for main food categories, including milk and dairy products, raw meats, ready-to-eat meat and poultry products, fermented meats, fish and fish products or fermented fish. The last section of the chapter deals with applications in foods and beverages derived from plant materials, such as raw vegetable foods, fruits and fruit juices, cooked food products, fermented vegetable foods and ­fermented beverages. Results obtained for application of bacteriocins in combination with other hurdles are also discussed for each specific case, with a special emphasis on novel food packaging and food-processing technologies, such as irradiation, pulsed electric field treatments or high hydrostatic pressure treatment.

  18. MICROBIOLOGY OF RAW MATERIALS USED FOR CONFECTIONARY PRODUCTION

    Directory of Open Access Journals (Sweden)

    Jana Petrová

    2015-02-01

    Full Text Available The aim of our study was to evaluate the microbiological quality of raw materials used for preparation of confectionery products. For microbiological evaluation total count of bacteria, mesophilic aerobic bacteria, coliform bacteria, yeast and microscopic filamentous fungi in samples of raw materials used in the manufacture and creams of confectionery products were detected. In addition to these groups of microorganisms the presence of pathogenic microorganisms Salmonella spp. and Staphylococcus aureus in creams was monitored. Products are assessed according to the limit values of the number of microorganisms defined in the Codex Alimentary of the Slovak Republic. For microbiological analysis of confectionery products, sampling of components of confectionary products and cream was carried out according to current health regulations and altogether 65 samples of components and creams were collected: 10 samples of raw materials sugar, 10 samples of flour, 10 samples of butter and 10 samples of eggs, 5 samples of butter yolk from cream-filled disposable bag without rum addition, 5 samples of butter yolk from cream-filled disposable bag with rum addition, 5 samples of cream-filled multiple use paid bag, 5 samples of cream-filled newly purchased paid bag, 5 samples of Venček corpus and 5 samples of the French cubes corpus. From raw material the highest TBC (2.65log CFU was in flour, but the lowest in sugar (1.35 log CFU, the highest years counts was found on flour (2.42, but lowest in butter (1.18, while wasn’t in egg. In samples of creams and corpus were increased occurrence of yeast, coliform bacteria. Salmonella spp. and Staphylococcus aureus weren’t isolated from any tested sample.

  19. Strontium-90 and cesium-137 in raw milk

    International Nuclear Information System (INIS)

    1979-01-01

    Under the commission of Science and Technology Agency, prefectural public health laboratories and institutes and Japan Chemical Analysis Center have measured the levels of 90 Sr and 137 Cs in milk samples. Sampling was done as follows: 4 times of raw milk samples a year in 10 prefectures for the report to WHO, 2 times of raw milk samples a year in 4 prefectures; and 2 times of city milk samples a year in 29 prefectures. Three litters of fresh milk were collected and carbonated in the prefectural public health laboratories and institutes of each prefecture, and the carbonated samples were collected at Japan Chemical Analysis Center. At Japan Chemical Analysis Center, these collected samples were radiochemically analysed for 90 Sr and 137 Cs using the method applied for the analysis of the radionuclides contents in total diet materials. (author)

  20. Prevalence of the pathogen microorganisms in raw cow milk

    Directory of Open Access Journals (Sweden)

    Angelovski Ljupco

    2009-11-01

    Full Text Available The aim of this study was to study the prevalence of Salmonella spp., Listeria spp., Staphylococcus spp. and E. coli in the raw cow milk. In this study 133 milk-tank samples from several milk collecting points were analysed. After the tests the following prevalence was detected: for Listeria spp. 13 positive samples (9.77%, with 9 Listeria monocytogenes samples confirmed (6.76%. Salmonella spp. was not detected in any of the the samples. The biggest presence was detected for Staphylococcus spp. with 113 positive samples (85.0%. Further testes has shown prevalence of coagulase-positive staphylococci of 73% (97 positive samples. Escherichia coli was confirmed in 57 samples (46.0%. The results from this study clearly indicate that pathogen microorganisms which are important for the human health can be found in the raw cow milk and their presence can be potential hazard for contamination of the milk-processing establishments.

  1. Diazonium-based impedimetric aptasensor for the rapid label-free detection of Salmonella typhimurium in food sample.

    Science.gov (United States)

    Bagheryan, Zahra; Raoof, Jahan-Bakhsh; Golabi, Mohsen; Turner, Anthony P F; Beni, Valerio

    2016-06-15

    Fast and accurate detection of microorganisms is of key importance in clinical analysis and in food and water quality monitoring. Salmonella typhimurium is responsible for about a third of all cases of foodborne diseases and consequently, its fast detection is of great importance for ensuring the safety of foodstuffs. We report the development of a label-free impedimetric aptamer-based biosensor for S. typhimurium detection. The aptamer biosensor was fabricated by grafting a diazonium-supporting layer onto screen-printed carbon electrodes (SPEs), via electrochemical or chemical approaches, followed by chemical immobilisation of aminated-aptamer. FTIR-ATR, contact angle and electrochemical measurements were used to monitor the fabrication process. Results showed that electrochemical immobilisation of the diazonium-grafting layer allowed the formation of a denser aptamer layer, which resulted in higher sensitivity. The developed aptamer-biosensor responded linearly, on a logarithm scale, over the concentration range 1 × 10(1) to 1 × 10(8)CFU mL(-1), with a limit of quantification (LOQ) of 1 × 10(1) CFU mL(-1) and a limit of detection (LOD) of 6 CFU mL(-1). Selectivity studies showed that the aptamer biosensor could discriminate S. typhimurium from 6 other model bacteria strains. Finally, recovery studies demonstrated its suitability for the detection of S. typhimurium in spiked (1 × 10(2), 1 × 10(4) and 1 × 10(6) CFU mL(-1)) apple juice samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Raw material uranium; Rohstoff Uran

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2017-03-15

    Uranium is an important raw material in human life. Mostly using nuclear fission uranium is used in nuclear medicine, industry and research. The most important application is the generation of electricity in nuclear power plants. Due to the global availability the worldwide uranium supply is guaranties for a long time. The contribution covers the issues medicine, neutron research, energy generation, occurrence, mining, processing, recycling and disposal.

  3. Rapid Analysis of U isotopic ratios in Food Stuff samples using Fusion and ICP-MS measurement: For radiation monitoring program in the vicinity of nuclear facilities

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Jong Myoung; Park, Ji Young; Jung, Yoon Hee; Kim, Hyun Cheol; Kim, Won Young; Chung, Gun Ho; Kang, Mun Ja [KAERI, Daejeon (Korea, Republic of)

    2016-05-15

    In this study, a rapid digestion and separation method for U isotopes was developed in food stuff matrix such as cabbage and rice. As an attempt to reduce social costs and apprehension arising from the radioactivity in food, an accurate and rapid assessment of radioactivity is highly desirable. Hence, it is very important to develop a series of evaluation of rapid procedures for efficient radioactivity management in food. Contrary to the α-spectrometry method, a measurement technique using ICP-MS with an advanced sample introduction and mass counting system allows radioactivity in many samples to be measured with a short time period with a high degree of accuracy and precision. In order to satisfy the method detectable activity (MDA) for the regulation of radioactivity monitoring program the analysis of U isotopes always require the extremely large sample amount. These procedures make usually the food stuff sample to carbonize during dry ashing process. The ashed residues have been especially complicated into a liquid phase because of their carbonization. This process are very time consuming and not fully recovered target isotopes.

  4. ANTIMICROBIAL DRUG RESISTANCE IN STRAINS OF Escherichia coli ISOLATED FROM FOOD SOURCES

    Directory of Open Access Journals (Sweden)

    Mohammed Uddin Rasheed

    2014-07-01

    Full Text Available A variety of foods and environmental sources harbor bacteria that are resistant to one or more antimicrobial drugs used in medicine and agriculture. Antibiotic resistance in Escherichia coli is of particular concern because it is the most common Gram-negative pathogen in humans. Hence this study was conducted to determine the antibiotic sensitivity pattern of E. coli isolated from different types of food items collected randomly from twelve localities of Hyderabad, India. A total of 150 samples comprising; vegetable salad, raw egg-surface, raw chicken, unpasteurized milk, and raw meat were processed microbiologically to isolate E. coli and to study their antibiotic susceptibility pattern by the Kirby-Bauer method. The highest percentages of drug resistance in isolates of E. coli were detected from raw chicken (23.3% followed by vegetable salad (20%, raw meat (13.3%, raw egg-surface (10% and unpasteurized milk (6.7%. The overall incidence of drug resistant E. coli was 14.7%. A total of six (4% Extended Spectrum β-Lactamase (ESBL producers were detected, two each from vegetable salads and raw chicken, and one each from raw egg-surface and raw meat. Multidrug resistant strains of E. coli are a matter of concern as resistance genes are easily transferable to other strains. Pathogen cycling through food is very common and might pose a potential health risk to the consumer. Therefore, in order to avoid this, good hygienic practices are necessary in the abattoirs to prevent contamination of cattle and poultry products with intestinal content as well as forbidding the use of untreated sewage in irrigating vegetables.

  5. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  6. Multiplex real-time PCR assays for detection of eight Shiga toxin-producing Escherichia coli in food samples by melting curve analysis.

    Science.gov (United States)

    Singh, Prashant; Mustapha, Azlin

    2015-12-23

    Shiga toxin-producing Escherichia coli (STEC) are pathogenic strains of E. coli that can cause bloody diarrhea and kidney failure. Seven STEC serogroups, O157, O26, O45, O103, O111, O121 and O145 are responsible for more than 71% of the total infections caused by this group of pathogens. All seven serogroups are currently considered as adulterants in non-intact beef products in the U.S. In this study, two multiplex melt curve real-time PCR assays with internal amplification controls (IACs) were standardized for the detection of eight STEC serogroups. The first multiplex assay targeted E. coli serogroups O145, O121, O104, and O157; while the second set detected E. coli serogroups O26, O45, O103 and O111. The applicability of the assays was tested using 11 different meat and produce samples. For food samples spiked with a cocktail of four STEC serogroups with a combined count of 10 CFU/25 g food, all targets of the multiplex assays were detected after an enrichment period of 6h. The assays also worked efficiently when 325 g of food samples were spiked with 10 CFU of STECs. The assays are not dependent on fluorescent-labeled probes or immunomagnetic beads, and can be used for the detection of eight STEC serogroups in less than 11h. Routine preliminary screening of STECs in food samples is performed by testing for the presence of STEC virulence genes. The assays developed in this study can be useful as a first- or second-tier test for the identification of the eight O serogroup-specific genes in suspected food samples. Copyright © 2015. Published by Elsevier B.V.

  7. The French national survey on food consumption of children under 3 years of age - Nutri-Bébé 2013: design, methodology, population sampling and feeding practices.

    Science.gov (United States)

    Chouraqui, Jean-Pierre; Tavoularis, Gabriel; Emery, Yves; Francou, Aurée; Hébel, Pascale; Bocquet, Magali; Hankard, Régis; Turck, Dominique

    2018-02-01

    To update the data on food consumption and practices in children under 3 years of age in metropolitan France. The Nutri-Bébé 2013 cross-sectional study selected a random sample, according to the quota sampling method. After giving their informed consent, parents had to record the food consumption during three non-consecutive days framed by two face-to-face interviews, using for quantitative information different portion size measurement aids. One thousand one hundred and eighty-four children were enrolled. Mothers' mean age was 30·8 (sd 5·4) years; 38 % were primiparous; 89 % lived with a partner; 60 % had an occupation. Of the infants younger than 4 months, 31 % were breast-fed. One thousand and thirty-five children consumed infant formula followed by growing-up milk in 63 % of them; solid foods were introduced at a mean age of 5·4 (sd 2·13) months. From 8 months onwards, 25 % of children consumed the same foods as their parents on a more or less regular basis; 29 % ate in front of a screen, with a daily average screen time of 43·0 (sd 40·4) min. This robust survey highlights the low prevalence and duration of breast-feeding in France and shows a modest improvement since the previous survey of 2005 in the observance of recommendations concerning other feeding practices. The frequent consumption of adult foods and the screen time are of concern.

  8. DETERMINATION OF THE INFLUENCING FACTORS TO MENU PLANNING IN BIG SIZED FOOD&BEVERAGE FIRMS (SAMPLE OF TURKEY)

    OpenAIRE

    SARIOĞLAN, Mehmet

    2016-01-01

    AbstractIndividuals who spend their time in destinations far away from their home because of the facts such as business, education, health, vacation and meeting has brought about eating habit in locations (outdoors). Since that increasing rate of eating habits outdoors of the individuals day by day, bigsized Food&Beverage firms has been showed up. Big sized Food&Beverage firms become influential as a supportive role on producing factors of the public, private or corporate ente...

  9. Fear of food prospectively predicts drive for thinness in an eating disorder sample recently discharged from intensive treatment.

    Science.gov (United States)

    Levinson, Cheri A; Brosof, Leigh C; Ma, Jackie; Fewell, Laura; Lenze, Eric J

    2017-12-01

    Fears of food are common in individuals with eating disorders and contribute to the high relapse rates. However, it is unknown how fears of food contribute to eating disorder symptoms across time, potentially contributing to an increased likelihood of relapse. Participants diagnosed with an eating disorder (N=168) who had recently completed intensive treatment were assessed after discharge and one month later regarding fear of food, eating disorder symptoms, anxiety sensitivity, and negative affect. Cross lagged path analysis was utilized to determine if fear of food predicted subsequent eating disorder symptoms one month later. Fear of food-specifically, anxiety about eating and feared concerns about eating-predicted drive for thinness, a core symptom domain of eating disorders. These relationships held while accounting for anxiety sensitivity and negative affect. There is a specific, direct relationship between anxiety about eating and feared concerns about eating and drive for thinness. Future research should test if interventions designed to target fear of food can decrease drive for thinness and thereby prevent relapse. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Typing and Evaluation of the Genetic Relatedness of Listeria monocytogenes Strains Isolated from Food Samples by the Multiple-Locus Variable number Tandem Repeat Analysis (MLVA

    Directory of Open Access Journals (Sweden)

    Behrooz Sadeghi kalani

    2014-12-01

    Full Text Available Background and Aim:Listeria monocytogenes cause listeriosis and fatal infections in humans. The aim of this study was typing and evaluation of the genetic relatedness of L. monocytogenes strains from food samples using MLVA technique. Materials and Methods: 317 food samples were collected from 2009 to 2013 in Tehran,Iran. After final diagnosis of L. monocytogenes DNA was extracted to perform of MLVA technique, and also PCR products were analyzed by Gene Tools software. The number of tandem repeats was determined by using special equation for each selected locus. Also typing of strains was done. Results: 24 samples of 317 food samples were positive for L. monocytogenes using standard laboratory techniques. A total 13 different types were determined by MLVA technique that type 2 and type 3 were the most abundant types by 6 and 4 strains, respectively. Conclusions: The results of this study showed the presence of L. monocytogenes in dairy products and meat samples, therefore all people, especially pregnant women should observe health tips when using these products. The results of typing showed that L. monocytogenes strains from different sources can have the same origin. MLVA technique is easy with high accuracy and this method can be used in typing and evaluation of the genetic relatedness of L. monocytogenes for determination the source of contamination.

  11. Reducing Salt in Raw Pork Sausages Increases Spoilage and Correlates with Reduced Bacterial Diversity.

    Science.gov (United States)

    Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine; Chaillou, Stéphane

    2016-07-01

    Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in dietary salt intake

  12. Reducing Salt in Raw Pork Sausages Increases Spoilage and Correlates with Reduced Bacterial Diversity

    Science.gov (United States)

    Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine

    2016-01-01

    ABSTRACT Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). IMPORTANCE Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in

  13. Occurrence of Cryptosporidium and Giardia genotypes and subtypes in raw and treated water in Portugal.

    Science.gov (United States)

    Lobo, M L; Xiao, L; Antunes, F; Matos, O

    2009-06-01

    Waterborne outbreaks of diarrhoeal illness reported worldwide are mostly associated with Cryptosporidium spp. and Giardia spp. Their presence in aquatic systems makes it essential to develop preventive strategies for water and food safety. This study was undertaken to monitor the presence of Cryptosporidium and Giardia in a total of 175 water samples, including raw and treated water from both surface and ground sources in Portugal. The samples were processed according to USEPA Method 1623 for immunomagnetic separation (IMS) of Cryptosporidium oocysts and Giardia cysts, followed by detection of oocysts/cysts by immunofluorecence (IFA) microscopy, PCR-based techniques were done on all water samples collected. Out of 175 samples, 81 (46.3%) were positive for Cryptosporidium and 67 (38.3%) for Giardia by IFA. Cryptosporidium spp. and G. duodenalis genotypes were identified by PCR in 37 (21.7%) and 9 (5.1%) water samples, respectively. C. parvum was the most common species (78.9%), followed by C. hominis (13.2%), C. andersoni (5.3%), and C. muris (2.6%). Subtype IdA15 was identified in all C. hominis-positive water samples. Subtyping revealed the presence of C. parvum subtypes IIaA15G2R1, IIaA16G2R1 and IIdA17G1. Giardia duodenalis subtype A1 was identified. The results of the present study suggest that Cryptosporidium spp. and Giardia spp. were widely distributed in source water and treated water in Portugal. Moreover, the results obtained indicate a high occurrence of human-pathogenic Cryptosporidium genotypes and subtypes in raw and treated water samples. Thus, water can be a potential vehicle in the transmission of cryptosporidiosis, and giardiasis of humans and animals in Portugal.

  14. Method Validation for the Gamma-ray Spectrometric Determination of Natural Radioactive Nuclides in NORM Samples - Method Validation for the Gamma-ray Spectrometric Determination of Natural Radionuclides in raw materials and by-products

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Young-Yong; Lim, Jong-Myoung; Jang, Mee; Kim, Chang-Jong; Chung, Kun Ho; Kang, Mun Ja; Choi, Geun-Sik [Environmental Radioactivity Assessment Team, Korea Atomic Energy Research Institute, 111, Daedeok-daero 989, Yuseong, Daejeon, 305-353 (Korea, Republic of)

    2014-07-01

    It has established the 'Act on safety control of radioactive rays around living environment' in Korea, since 2011, to protect the public from natural occurring radioactive materials (NORM) and their by-products. The increasing concerns regarding the radioactivity of those materials therefore dictate many demands for the radioactive analysis for them. There are several methods to determine the concentration of natural radionuclides, such as {sup 235}U, {sup 238}U, {sup 226}Ra, {sup 232}Th, and so on, through a radiochemical analysis using an alpha spectrometer, mass spectrometer and liquid scintillation counter. However, gamma-ray spectroscopy still has an effect on the assessment of radioactive concentration for these nuclides and their progenies. To adapt a gamma spectrometer to the determination of natural radionuclides, the feasibility of their analysis methods should be first verified and validated with respect to accuracy and time and cost constraints. In general, one of the well-known processes in analyzing uranium with a gamma spectrometer is an indirect measurement using the secular equilibrium state with their progenies in a sample. This method, however, demands the time elapsed about 3 weeks to reach the equilibrium state between {sup 226}Ra and {sup 222}Rn and the sufficient integrity of a sample bottle to prevent the leakage of radon isotopes which is a form of noble gas. The simple and quick method is to directly measure a full energy absorption peak of 186.2 keV from {sup 226}Ra without the secular equilibrium state between {sup 226}Ra and {sup 222}Rn in the common sample bottle. However, this direct measurement also has difficulties about the interference with a full energy absorption peak of 185.7 keV from {sup 235}U. In this study, direct measurement with the interference correction technique, which uses several reference peaks for gamma-rays from {sup 235}U and {sup 234}Th, and indirect measurement, which means the identification of {sup

  15. Determination of Antimicrobial Activity of Sorrel (Hibiscus sabdariffa) on Esherichia coli O157:H7 Isolated from Food, Veterinary, and Clinical Samples

    Science.gov (United States)

    Fullerton, Marjorie; Khatiwada, Janak; Johnson, Jacqueline U.; Davis, Shurrita

    2011-01-01

    Abstract The use of medicinal plants as natural antimicrobial agents is gaining popularity. Sorrel (Hibiscus sabdariffa) is widely used for the treatment of diseases. The objective of this study was to investigate the antimicrobial activity of sorrel on Escherichia coli O157:H7 isolates from food, veterinary, and clinical samples. Phenolics of the calyces were extracted from 10 g of ground, freeze-dried samples using 100 mL of 80% aqueous methanol. Concentrations of 10%, 5%, and 2.5% methanol extract of sorrel were investigated for its antimicrobial activity. Inhibition zones were indicated by a lack of microbial growth due to inhibitory concentrations of sorrel diffused into semisolid culture medium beneath the sorrel-impregnated disk. The results of this experiment showed that the most potent sorrel concentration was 10%, then 5%, and finally 2.5%. The overall mean zone of inhibition for the sorrel extract was 12.66 mm for 10%, 10.75 mm for 5%, and 8.9 mm for 2.5%. The highest inhibition zones (11.16 mm) were observed in veterinary samples, and the lowest (10.57 mm) in the food samples. There were significant (P<.05) differences among mean zones of inhibition found in the food, veterinary, and clinical sources. Based on the source of samples and concentration of sorrel extract, the lowest mean inhibition was 7.00±0.04 mm from clinical samples, and the highest was 15.37±0.61 mm from a food source. These findings indicated that sorrel was effective at all levels in inhibiting E. coli O157:H7; thus it possesses antimicrobial activity and hold great promise as an antimicrobial agent. PMID:21548802

  16. Petrifilm rapid S. aureus Count Plate method for rapid enumeration of Staphylococcus aureus in selected foods: collaborative study.

    Science.gov (United States)

    Silbernagel, K M; Lindberg, K G

    2001-01-01

    A rehydratable dry-film plating method for Staphylococcus aureus in foods, the 3M Petrifilm Rapid S. aureus Count Plate method, was compared with AOAC Official Method 975.55 (Staphylococcus aureus in Foods). Nine foods-instant nonfat dried milk, dry seasoned vegetable coating, frozen hash browns, frozen cooked chicken patty, frozen ground raw pork, shredded cheddar cheese, fresh green beans, pasta filled with beef and cheese, and egg custard-were analyzed for S. aureus by 13 collaborating laboratories. For each food tested, the collaborators received 8 blind test samples consisting of a control sample and 3 levels of inoculated test sample, each in duplicate. The mean log counts for the methods were comparable for pasta filled with beef and cheese; frozen hash browns; cooked chicken patty; egg custard; frozen ground raw pork; and instant nonfat dried milk. The repeatability and reproducibility variances of the Petrifilm Rapid S. aureus Count Plate method were similar to those of the standard method.

  17. Asian fungal fermented food

    NARCIS (Netherlands)

    Nout, M.J.R.; Aidoo, K.E.

    2010-01-01

    In Asian countries, there is a long history of fermentation of foods and beverages. Diverse micro-organisms, including bacteria, yeasts and moulds, are used as starters, and a wide range of ingredients can be made into fermented foods. The main raw materials include cereals, leguminous seeds,

  18. Measurements of natural and artificial radionuclides in food samples and water for human consumption in Austria for the calculation of the ingestion dose

    International Nuclear Information System (INIS)

    Claudia Landstetter; Michael Zapletal; Merita Sinojmeri; Christian Katzlberger

    2013-01-01

    A new report on food habits of the Austrian population in the year 2006/2007 was released in 2008. Mixed diets and foodstuffs are measured within a monitoring program according to the Austrian radiation protection law, food law, and the Commission Recommendation 2000/473/Euratom on the application of Article 36 of the Euratom Treaty concerning the monitoring of the levels of radioactivity in the environment for the purpose of assessing the exposure of the population as a whole. In addition, drinking and mineral water samples are measured for natural and artificial radionuclides. The ingestion dose for the Austrian population is recalculated based on the results of these measurements, literature data, and the data of the new report on food habits. In general, the major part of the ingestion dose is caused by natural radionuclides, especially 40 K. (author)

  19. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Determination of the concentrations of lead in raw milk in the Valley of Toluca

    International Nuclear Information System (INIS)

    Rosas Vilchis, E.

    1991-01-01

    The object of the present work, undertaken under the program of Regional and Cooperative Agreement for Nuclear Science and Technology in Latin America (ARCAL IV), was to determine the amounts of lead found in raw milk using the analytic techniques of Atomic Absorption Spectrophotometry (AAS), Inductively Coupled Plasma Atomic Emission Spectrometry (ICP-AES) and X-ray Fluorescence (FRX); so as to aid in solving problems of public health originating from elevated amounts of heavy metals in foods of animal origin. A total of thirty samples of raw milk were collected in the Valley of Toluca in Mexico, where heavy metal contaminants in the environment due to effects of rapid industrialization and urbanization, are known to have entered the food chain. The methodology, consisting in destroying organic matter in the samples by calcination, and included, in the case of AAS and ICP-AES, acid digestion. In the case of FRX, lead was extracted by ammonium 1-pyrrolidine carboditioate (APDC). The equipment to be used was calibrated and both blank and working solutions prepared in order to perform quantitative analysis. The concentrations of lead which were found in all the milk samples ranged from <0.03 to 0.31 μg/ml milk. These amounts within the maximum permissible limits, 0.5 μg/ml for all types of milk, established by the FDA. In the analysis ICP-AES gave best results as to sensitivity, precision and accuracy, followed by AAS which gave reliable results. FRX failed to detect lower limits and was, therefore, less reliable. (Author)

  1. Study of chemisrty and hydrolysates drying parameters of feather-downy raw material

    OpenAIRE

    LISITSYN A.B.; KRIGER O.V.; MITROKHIN P.V.

    2016-01-01

    The article describes chemical and amino acid composition of feather-downy raw material. It determines the mass fraction of crude protein, crude fiber, ash, calcium, phosphorus, sodium in the samples of feather-downy raw material. It is stated that the waste from poultry processing obtained from hens of all the studied species are characterized by a high content of crude protein and low in crude fiber and ash. The most valuable feather-downy raw material regarding protein is waste containing ...

  2. Comparison of R5 and G12 Antibody-Based ELISA Used for the Determination of the Gluten Content in Official Food Samples

    Directory of Open Access Journals (Sweden)

    Rupert Hochegger

    2015-11-01

    Full Text Available Celiac Disease (CD is one of the most common food intolerances. It comes along with serious damage of the mucosa in the small intestine and is caused by the storage proteins—termed “gluten”—of wheat, rye, barley and possibly oats. Sensitive individuals need to stick to a strict gluten-free diet. The gluten level in food products labeled as “gluten-free”, must not exceed 20 mg/kg. It is obvious that effective test methods are needed to accurately determine the gluten concentration in foods. The determination of the presence of gluten in foodstuffs is mainly done by means of an immunochemical method called ELISA (enzyme-linked immunosorbent assay. To check the suitability of a G12 antibody-based gluten detection kit for its use in official control systems a number of routine samples were tested in parallel with two different test kits, as would be done in a routine lab. The determination of the gluten content was performed on samples entering the official laboratory including samples from official control plans, commercially available and private samples to request gluten-free labels. The results obtained with the G12 antibody ELISA assay were comparable to the official R5 method. A validation of the two different methods was not part of this study.

  3. Ultra-high performance liquid chromatography tandem mass spectrometry for the determination of five glycopeptide antibiotics in food and biological samples using solid-phase extraction.

    Science.gov (United States)

    Deng, Fenfang; Yu, Hong; Pan, Xinhong; Hu, Guoyuan; Wang, Qiqin; Peng, Rongfei; Tan, Lei; Yang, Zhicong

    2018-02-23

    This paper demonstrated the development and validation of an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method for simultaneous determination of five glycopeptide antibiotics in food and biological samples. The target glycopeptide antibiotics were isolated from the samples by solvent extraction, and the extracts were cleaned with a tandem solid-phase extraction step using mixed strong cation exchange and hydrophilic/lipophilic balance cartridges. Subsequently, the analytes were eluted with different solvents, and then quantified by UHPLC-MS/MS in the positive ionization mode with multiple reaction monitoring. Under optimal conditions, good linear correlations were obtained for the five glycopeptide antibiotics in the concentration range of 1.0 μg/L to 20.0 μg/L, and with linear correlation coefficients >0.998. Employing this method, the target glycopeptide antibiotics in food and biological samples were identified with a recovery of 83.0-102%, and a low quantitation limit of 1.0 μg/kg in food and 2.0 μg/L in biological samples with low matrix effects. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Magnetic stirrer induced dispersive ionic-liquid microextraction for the determination of vanadium in water and food samples prior to graphite furnace atomic absorption spectrometry.

    Science.gov (United States)

    Naeemullah; Kazi, Tasneem Gul; Tuzen, Mustafa

    2015-04-01

    A new dispersive liquid-liquid microextraction, magnetic stirrer induced dispersive ionic-liquid microextraction (MS-IL-DLLME) was developed to quantify the trace level of vanadium in real water and food samples by graphite furnace atomic absorption spectrometry (GFAAS). In this extraction method magnetic stirrer was applied to obtained a dispersive medium of 1-butyl-3-methylimidazolium hexafluorophosphate [C4MIM][PF6] in aqueous solution of (real water samples and digested food samples) to increase phase transfer ratio, which significantly enhance the recovery of vanadium - 4-(2-pyridylazo) resorcinol (PAR) chelate. Variables having vital role on desired microextraction methods were optimised to obtain the maximum recovery of study analyte. Under the optimised experimental variables, enhancement factor (EF) and limit of detection (LOD) were achieved to be 125 and 18 ng L(-1), respectively. Validity and accuracy of the desired method was checked by analysis of certified reference materials (SLRS-4 Riverine water and NIST SRM 1515 Apple leaves). The relative standard deviation (RSD) for 10 replicate determinations at 0.5 μg L(-1) of vanadium level was found to be <5.0%. This method was successfully applied to real water and acid digested food samples. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Investigation of Listeria, Salmonella, and toxigenic Escherichia coli in various pet foods.

    Science.gov (United States)

    Nemser, Sarah M; Doran, Tara; Grabenstein, Michael; McConnell, Terri; McGrath, Timothy; Pamboukian, Ruiqing; Smith, Angele C; Achen, Maya; Danzeisen, Gregory; Kim, Sun; Liu, Yong; Robeson, Sharon; Rosario, Grisel; McWilliams Wilson, Karen; Reimschuessel, Renate

    2014-09-01

    The Veterinary Laboratory Investigation and Response Network (Vet-LIRN), in collaboration with the Food Emergency Response Network (FERN) and its Microbiology Cooperative Agreement Program (MCAP) laboratories, conducted a study to evaluate the prevalence of selected microbial organisms in various types of pet foods. The goal of this blinded study was to help the Center for Veterinary Medicine prioritize potential future pet food-testing efforts. The study also increased the FERN laboratories' screening capabilities for foodborne pathogens in animal feed matrices, since such pathogens may also be a significant health risk to consumers who come into contact with pet foods. Six U.S. Food and Drug Administration FERN MCAP laboratories analyzed approximately 1056 samples over 2 years. Laboratories tested for Salmonella, Listeria, Escherichia coli O157:H7 enterohemorrhagic E. coli, and Shiga toxin-producing strains of E. coli (STEC). Dry and semimoist dog and cat foods purchased from local stores were tested during Phase 1. Raw dog and cat foods, exotic animal feed, and jerky-type treats purchased through the Internet were tested in Phase 2. Of the 480 dry and semimoist samples, only 2 tested positive: 1 for Salmonella and 1 for Listeria greyii. However, of the 576 samples analyzed during Phase 2, 66 samples were positive for Listeria (32 of those were Listeria monocytogenes) and 15 samples positive for Salmonella. These pathogens were isolated from raw foods and jerky-type treats, not the exotic animal dry feeds. This study showed that raw pet foods may harbor food safety pathogens, such as Listeria monocytogenes and Salmonella. Consumers should handle these products carefully, being mindful of the potential risks to human and animal health.

  6. Whole genome sequencing analysis of Salmonella enterica serovar Weltevreden isolated from human stool and contaminated food samples collected from the Southern coastal area of China.

    Science.gov (United States)

    Li, Baisheng; Yang, Xingfen; Tan, Hailing; Ke, Bixia; He, Dongmei; Wang, Haiyan; Chen, Qiuxia; Ke, Changwen; Zhang, Yonghui

    2018-02-02

    Salmonella enterica serovar Weltevreden is the most common non-typhoid Salmonella found in South and Southeast Asia. It causes zoonoses worldwide through the consumption of contaminated foods and seafood, and is considered as an important food-borne pathogen in China, especially in the Southern coastal area. We compared the whole genomes of 44 S. Weltevreden strains isolated from human stool and contaminated food samples from Southern Coastal China, in order to investigate their phylogenetic relationships and establish their genetic relatedness to known international strains. ResFinder analysis of the draft genomes of isolated strains detected antimicrobial resistance (AMR) genes in only eight isolates, equivalent to minimum inhibitory concentration assay, and only a few isolates showed resistance to tetracycline, ciprofloxacin or ampicillin. In silico MLST analysis revealed that 43 out of 44 S. Weltevreden strains belonged to sequence type 365 (CC205), the most common sequence type of the serovars. Phylogenetic analysis of the 44 domestic and 26 international isolates suggested that the population of S. Weltevreden could be segregated into six phylogenetic clusters. Cluster I included two strains from food and strains of the "Island Cluster", indicating potential inter-transmission between different countries and regions through foods. The predominant S. Weltevreden isolates obtained from the samples from Southern coastal China were found to be phylogenetically related to strains from Southern East Asia, and formed clusters II-VI. The study has demonstrated that WGS-based analysis may be used to improve our understanding of the epidemiology of this bacterium as part of a food-borne disease surveillance program. The methods used are also more widely applicable to other geographical regions and areas and could therefore be useful for improving our understanding of the international spread of S. Weltevreden on a global scale. Copyright © 2017. Published by Elsevier

  7. Scientific and technical factors affecting the setting of Salmonella criteria for raw poultry: a global perspective

    NARCIS (Netherlands)

    Mead, G.; Lammerding, A.M.; Cox, N.; Doyle, M.P.; Humbert, F.; Kulikovskiy, A.; Panin, A.; Pinheiro do Nascimento, V.; Wierup, M.; Zwietering, M.H.

    2010-01-01

    Concerns about foodborne salmonellosis have led many countries to introduce microbiological criteria for certain food products. If such criteria are not well-grounded in science, they could be an unjustified obstacle to trade. Raw poultry products are an important part of the global food market.

  8. Seasonal variation in the Dutch bovine raw milk composition

    NARCIS (Netherlands)

    Heck, J.M.L.; Valenberg, van H.J.F.; Dijkstra, J.; Hooijdonk, van A.C.M.

    2009-01-01