Medeiros, Diane T; Sattar, Syed A; Farber, Jeffrey M; Carrillo, Catherine D
2008-10-01
The occurrence of Campylobacter spp. in a variety of foods from Ottawa, Ontario, Canada, and raw milk samples from across Canada was determined over a 2-year period. The samples consisted of 55 raw foods (chicken, pork, and beef), 126 raw milk samples from raw milk cheese manufacturers, and 135 ready-to-eat foods (meat products, salads, and raw milk cheeses). Campylobacter jejuni was detected in 4 of the 316 samples analyzed: 1 raw beef liver sample and 3 raw chicken samples. An isolation rate of 9.7% was observed among the raw chicken samples tested. This study also investigated the role of cross-contamination in disseminating Campylobacter from raw poultry within a food service operation specializing in poultry dishes. Accordingly, kitchen surfaces within a restaurant in Ottawa, Ontario, were sampled between March and August 2001. Tests of the sampling method indicated that as few as 100 Campylobacter cells could be detected if sampling was done within 45 min of inoculation; however, Campylobacter spp. were not detected in 125 swabs of surfaces within the kitchens of this food service operation. Despite the reported high prevalence of Campylobacter spp. in raw poultry, this organism was not detected on surfaces within a kitchen of a restaurant specializing in poultry dishes.
... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...
Basic Thermal Parameters of Selected Foods and Food Raw Materials
Directory of Open Access Journals (Sweden)
Monika Božiková
2017-01-01
Full Text Available In general, processing and manipulation with foods and food raw materials have significant influence on their physical properties. The article is focused on thermophysical parameters measurement of selected foods and food raw materials. There were examined thermal conductivity and thermal diffusivity of selected materials. For detection of thermal parameters was used instrument Isomet 2104, which principle of measurement is based on transient methods. In text are presented summary results of thermal parameters measurement for various foods and food raw materials as: granular materials – corn flour and wheat flour; fruits, vegetables and fruit products – grated apple, dried apple and apple juice; liquid materials – milk, beer etc. Measurements were performed in two temperature ranges according to the character of examined material. From graphical relations of thermophysical parameter is evident, that thermal conductivity and diffusivity increases with temperature and moisture content linearly, only for granular materials were obtained non‑linear dependencies. Results shows, that foods and food raw materials have different thermal properties, which are influenced by their type, structure, chemical and physical properties. From presented results is evident, that basic thermal parameters are important for material quality detection in food industry.
Basic Thermal Parameters of Selected Foods and Food Raw Materials
Monika Božiková; Ľubomír Híreš; Michal Valach; Martin Malínek; Jan Mareček
2017-01-01
In general, processing and manipulation with foods and food raw materials have significant influence on their physical properties. The article is focused on thermophysical parameters measurement of selected foods and food raw materials. There were examined thermal conductivity and thermal diffusivity of selected materials. For detection of thermal parameters was used instrument Isomet 2104, which principle of measurement is based on transient methods. In text are presented summary results of ...
Deng, Gui-Fang; Li, Ke; Ma, Jing; Liu, Fen; Dai, Jing-Jing; Li, Hua-Bin
2011-01-01
The level of aluminium in 178 processed food samples from Shenzhen city in China was evaluated using inductively coupled plasma-mass spectrometry. Some processed foods contained a concentration of up to 1226 mg/kg, which is about 12 times the Chinese food standard. To establish the main source in these foods, Al levels in the raw materials were determined. However, aluminium concentrations in raw materials were low (0.10-451.5 mg/kg). Therefore, aluminium levels in food additives used in these foods was determined and it was found that some food additives contained a high concentration of aluminium (0.005-57.4 g/kg). The results suggested that, in the interest of public health, food additives containing high concentrations of aluminium should be replaced by those containing less. This study has provided new information on aluminium levels in Chinese processed foods, raw materials and a selection of food additives.
Bacteriophages safely reduce Salmonella contamination in pet food and raw pet food ingredients.
Soffer, Nitzan; Abuladze, Tamar; Woolston, Joelle; Li, Manrong; Hanna, Leigh Farris; Heyse, Serena; Charbonneau, Duane; Sulakvelidze, Alexander
2016-01-01
Contamination of pet food with Salmonella is a serious public health concern, and several disease outbreaks have recently occurred due to human exposure to Salmonella tainted pet food. The problem is especially challenging for raw pet foods (which include raw meats, seafood, fruits, and vegetables). These foods are becoming increasingly popular because of their nutritional qualities, but they are also more difficult to maintain Salmonella -free because they lack heat-treatment. Among various methods examined to improve the safety of pet foods (including raw pet food), one intriguing approach is to use bacteriophages to specifically kill Salmonella serotypes. At least 2 phage preparations (SalmoFresh® and Salmonelex™) targeting Salmonella are already FDA cleared for commercial applications to improve the safety of human foods. However, similar preparations are not yet available for pet food applications. Here, we report the results of evaluating one such preparation (SalmoLyse®) in reducing Salmonella levels in various raw pet food ingredients (chicken, tuna, turkey, cantaloupe, and lettuce). Application of SalmoLyse® in low (ca. 2-4×10 6 PFU/g) and standard (ca. 9×10 6 PFU/g) concentrations significantly ( P contamination in all raw foods examined compared to control treatments. When SalmoLyse®-treated (ca. 2×10 7 PFU/g) dry pet food was fed to cats and dogs, it did not trigger any deleterious side effects in the pets. Our data suggest that the bacteriophage cocktail lytic for Salmonella can significantly and safely reduce Salmonella contamination in various raw pet food ingredients.
Importance of Decision Support Systems About Food Safety in Raw Milk Production
Directory of Open Access Journals (Sweden)
Ecem Akan
2015-12-01
Full Text Available In raw milk production decision support systems for control of food safety hazards has not been developed but main points of this system are available. The decision support systems’ elements include data identification at critical points in the milk supply chain, an information management system and data exchange. Decision supports systems has been developed on the basis of these elements. In dairy sector decision support systems are significant for controlling of food safety hazards and preferred by producers. When these systems are implemented in the milk supply chain, it can be prevented unnecessary sampling and analysis. In this article it will be underlined effects of decision support system elements on food safety of raw milk.
Jogsten, Ingrid Ericson; Perelló, Gemma; Llebaria, Xavier; Bigas, Esther; Martí-Cid, Roser; Kärrman, Anna; Domingo, José L
2009-07-01
In this study, the role that some food processing and packaging might play as a source of perfluorinated compounds (PFCs) through the diet was assessed. The levels of PFCs were determined in composite samples of veal steak (raw, grilled, and fried), pork loin (raw, grilled, and fried), chicken breast (raw, grilled, and fried), black pudding (uncooked), liver lamb (raw), marinated salmon (home-made and packaged), lettuce (fresh and packaged), pate of pork liver, foie gras of duck, frankfurt, sausages, chicken nuggets (fried), and common salt. Among the 11 PFCs analyzed, only PFHxS, PFOS, PFHxA, and PFOA were detected in at least one composite sample, while the levels of the remaining PFCs (PFBuS, PFHpA, PFNA, PFDA, PFUnDA, and PFDoDA) were under their respective detection limits. PFOS was the compound most frequently detected, being found in 8 of the 20 food items analyzed, while PFHxA was detected in samples of raw veal, chicken nuggets, frankfurt, sausages, and packaged lettuce. According to the results of the present study, it is not sufficiently clear if cooking with non-stick cookware, or packaging some foods, could contribute to a higher human exposure to PFCs.
Seidel, Kathrin; Kahl, Johannes; Paoletti, Flavio; Birlouez, Ines; Busscher, Nicolaas; Kretzschmar, Ursula; Särkkä-Tirkkonen, Marjo; Seljåsen, Randi; Sinesio, Fiorella; Torp, Torfinn; Baiamonte, Irene
2015-02-01
The market for processed food is rapidly growing. The industry needs methods for "processing with care" leading to high quality products in order to meet consumers' expectations. Processing influences the quality of the finished product through various factors. In carrot baby food, these are the raw material, the pre-processing and storage treatments as well as the processing conditions. In this study, a quality assessment was performed on baby food made from different pre-processed raw materials. The experiments were carried out under industrial conditions using fresh, frozen and stored organic carrots as raw material. Statistically significant differences were found for sensory attributes among the three autoclaved puree samples (e.g. overall odour F = 90.72, p processed from frozen carrots show increased moisture content and decrease of several chemical constituents. Biocrystallization identified changes between replications of the cooking. Pre-treatment of raw material has a significant influence on the final quality of the baby food.
Directory of Open Access Journals (Sweden)
Rodrigo Vera
2016-06-01
Full Text Available The presence and/or accumulation of mycotoxins in foods intended for human and animal nutrition is a constant concern for the harmful health effects resulting from ingestion. The aims of this communication were to analyze samples of feed and raw materials for manufacturing and to determine the presence of strains of filamentous fungi with toxigenic capacity. The values of frequency in the total samples (N = 422, indicated 63% of contamination, where A. flavus represented the most common (29.8%, while in feed and raw materials separately, indicated A. flavus has the highest value in both categories. In the analysis of different type of raw materials, A. flavus contaminated all types of samples, with the bran and soybean meal substrates having higher values for this Aspergillus, and corn substrate more fungal contamination. These results would demonstrate that the presence of mycobiota with toxigenic potential in food for animal feed is a disturbing reality.
Directory of Open Access Journals (Sweden)
Paula Cristina Galati
2013-01-01
Full Text Available OBJECTIVE: This study aimed to analyze and compare the microbiological profile and vitamin C content of raw and cooked foods destined for neutropenic inpatients. METHODS: Three vegetables and nine fruits, raw and boiled, washed and sanitized were examined. Heat-tolerant coliforms and coagulase-positive staphylococci were counted and the presence of Salmonella spp was investigated. The vitamin C content was analyzed by a colorimetric reaction. The Statistical Package for Social Sciences (SPSS software was used for statistical analysis and the nonparametric Wilcoxon test was used to compare the mean vitamin C values of the cooked and raw foods. The Spearman correlation test was applied to determine the associations between the parameters evaluated RESULTS: Salmonella spp was absent in all samples and the populations of coagulase-positive staphylococci and heat-tolerant coliforms were below the minimum detectable limits of the methods employed (< 100 colony forming units (CFU/g and < 3 most probable number (MPN/g, respectively. There was a significant loss of vitamin C in the cooked foods, 38.9% on average, compared to the raw foods, a loss that was positively correlated with cooking time. CONCLUSION: The fresh fruits and vegetables properly sanitized in this study had a microbiological profile consistent with that required by Brazilian law. Furthermore, the nutritional value of the neutropenic diet is diminished, at least in terms of the vitamin C content.
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Directory of Open Access Journals (Sweden)
Shi Wu
Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Toxicological evaluation of some Malaysian locally processed raw food products.
Sharif, R; Ghazali, A R; Rajab, N F; Haron, H; Osman, F
2008-01-01
Malaysian locally processed raw food products are widely used as main ingredients in local cooking. Previous studies showed that these food products have a positive correlation with the incidence of cancer. The cytotoxicity effect was evaluated using MTT assay (3-(4,5-dimetil-2-thiazolil)-2,5-diphenyl-2H-tetrazolium bromide) against Chang liver cells at 2000 microg/ml following 72 h incubation. Findings showed all methanol extracts caused a tremendous drop in the percentage of cell viability at 2000 microg/ml (shrimp paste - 41.69+/-3.36%, salted fish - 37.2+/-1.06%, dried shrimp - 40.32+/-1.8%, pfood showed that shrimp paste did not comply with the protein requirement (Food Act 1983. Salt was found in every sample with the highest percentage being detected in shrimp paste which exceeded 20%. Following heavy metal analysis (arsenic, cadmium, lead and mercury), arsenic was found in every sample with dried shrimps showing the highest value as compared to the other samples (6.16 mg/kg). In conclusion, several food extracts showed cytotoxic effect but did not cause DNA damage against Chang liver cells. Salt was found as the main additive and arsenic was present in every sample, which could be the probable cause of the toxicity effects observed.
Determination of Bacterial Pathogen in Foods for Export and their Raw Material
International Nuclear Information System (INIS)
Marambio, E.; Cordano, A.M.; Insunza, M.; Fernández, M.; Astorga, J.
2005-01-01
Chile is a South American country with an important fish and shellfish production. These products are some of the most important items for the economy of the country. From 1998 to 2001, Chile exported $1 137 625 788 of fish and shellfish. Statistics also show that frozen vegetables are fast becoming high on the food export list. During recent years (1998 to 2001) $223 312 248 worth of frozen vegetables were exported to different countries. This study was performed to trace the presence of pathogens in some of these Chilean foods to be exported: 97 samples of salmon and 84 samples of different frozen vegetables (asparagus, peas and corn) were analyzed in order to determine their levels of microbial contamination. Total bacteria counts (mesophilic aerobes bacteria), Escherichia coli, Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, Salmonella spp. and Listeria monocytogenes were tested. Vibrio cholerae was tested only in salmon samples. The analysis of salmon samples showed that the raw material presented a very good quality. However, during the filleting process the fish was contaminated, presenting higher total bacteria counts. Only one of the 48 final product samples presented contamination with a pathogenic bacteria (Listeria monocytogenes (<100 cfu/g)). Frozen vegetable samples (raw material and final products) did not present any of the pathogen bacteria studied. The mesophilic aerobes bacteria counts were reduced during processing due to the effectiveness of the good manufacturing practices and the technological process used. (author)
Determination of Bacterial Pathogen in Foods for Export and their Raw Material
Energy Technology Data Exchange (ETDEWEB)
Marambio, E.; Cordano, A. M.; Insunza, M.; Fernández, M.; Astorga, J. [Sección Microbiología de Alimentos, Instituto de Salud Pública de Chile (Chile)
2005-01-15
Chile is a South American country with an important fish and shellfish production. These products are some of the most important items for the economy of the country. From 1998 to 2001, Chile exported $1 137 625 788 of fish and shellfish. Statistics also show that frozen vegetables are fast becoming high on the food export list. During recent years (1998 to 2001) $223 312 248 worth of frozen vegetables were exported to different countries. This study was performed to trace the presence of pathogens in some of these Chilean foods to be exported: 97 samples of salmon and 84 samples of different frozen vegetables (asparagus, peas and corn) were analyzed in order to determine their levels of microbial contamination. Total bacteria counts (mesophilic aerobes bacteria), Escherichia coli, Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, Salmonella spp. and Listeria monocytogenes were tested. Vibrio cholerae was tested only in salmon samples. The analysis of salmon samples showed that the raw material presented a very good quality. However, during the filleting process the fish was contaminated, presenting higher total bacteria counts. Only one of the 48 final product samples presented contamination with a pathogenic bacteria (Listeria monocytogenes (<100 cfu/g)). Frozen vegetable samples (raw material and final products) did not present any of the pathogen bacteria studied. The mesophilic aerobes bacteria counts were reduced during processing due to the effectiveness of the good manufacturing practices and the technological process used. (author)
Lahou, Evy; Jacxsens, Liesbeth; Van Landeghem, Filip; Uyttendaele, Mieke
2014-08-01
Food service operations are confronted with a diverse range of raw materials and served meals. The implementation of a microbial sampling plan in the framework of verification of suppliers and their own production process (functionality of their prerequisite and HACCP program), demands selection of food products and sampling frequencies. However, these are often selected without a well described scientifically underpinned sampling plan. Therefore, an approach on how to set-up a focused sampling plan, enabled by a microbial risk categorization of food products, for both incoming raw materials and meals served to the consumers is presented. The sampling plan was implemented as a case study during a one-year period in an institutional food service operation to test the feasibility of the chosen approach. This resulted in 123 samples of raw materials and 87 samples of meal servings (focused on high risk categorized food products) which were analyzed for spoilage bacteria, hygiene indicators and food borne pathogens. Although sampling plans are intrinsically limited in assessing the quality and safety of sampled foods, it was shown to be useful to reveal major non-compliances and opportunities to improve the food safety management system in place. Points of attention deduced in the case study were control of Listeria monocytogenes in raw meat spread and raw fish as well as overall microbial quality of served sandwiches and salads. Copyright © 2014 Elsevier Ltd. All rights reserved.
Order acceptance in food processing systems with random raw material requirements
Kilic, Onur A.; van Donk, Dirk Pieter; Wijngaard, Jacob; Tarim, S. Armagan
This study considers a food production system that processes a single perishable raw material into several products having stochastic demands. In order to process an order, the amount of raw material delivery from storage needs to meet the raw material requirement of the order. However, the amount
Frequency, Antimicrobial Resistance and Genetic Diversity of Klebsiella pneumoniae in Food Samples.
Directory of Open Access Journals (Sweden)
Yumei Guo
Full Text Available This study aimed to assess the frequency of Klebsiella pneumoniae in food samples and to detect antibiotic resistance phenotypes, antimicrobial resistance genes and the molecular subtypes of the recovered isolates. A total of 998 food samples were collected, and 99 (9.9% K. pneumoniae strains were isolated; the frequencies were 8.2% (4/49 in fresh raw seafood, 13.8% (26/188 in fresh raw chicken, 11.4% (34/297 in frozen raw food and 7.5% (35/464 in cooked food samples. Antimicrobial resistance was observed against 16 antimicrobials. The highest resistance rate was observed for ampicillin (92.3%, followed by tetracycline (31.3%, trimethoprim-sulfamethoxazole (18.2%, and chloramphenicol (10.1%. Two K. pneumoniae strains were identified as extended-spectrum β-lactamase (ESBL-one strain had three beta-lactamases genes (blaSHV, blaCTX-M-1, and blaCTX-M-10 and one had only the blaSHV gene. Nineteen multidrug-resistant (MDR strains were detected; the percentage of MDR strains in fresh raw chicken samples was significantly higher than in other sample types (P<0.05. Six of the 18 trimethoprim-sulfamethoxazole-resistant strains carried the folate pathway inhibitor gene (dhfr. Four isolates were screened by PCR for quinolone resistance genes; aac(6'-Ib-cr, qnrB, qnrA and qnrS were detected. In addition, gyrA gene mutations such as T247A (Ser83Ile, C248T (Ser83Phe, and A260C (Asp87Ala and a parC C240T (Ser80Ile mutation were identified. Five isolates were screened for aminoglycosides resistance genes; aacA4, aacC2, and aadA1 were detected. Pulsed-field gel electrophoresis-based subtyping identified 91 different patterns. Our results indicate that food, especially fresh raw chicken, is a reservoir of antimicrobial-resistant K. pneumoniae, and the potential health risks posed by such strains should not be underestimated. Our results demonstrated high prevalence, antibiotic resistance rate and genetic diversity of K. pneumoniae in food in China. Improved
Directory of Open Access Journals (Sweden)
Moutong eChen
2015-09-01
Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.
Traceability of Plant Diet Contents in Raw Cow Milk Samples
Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego
2009-01-01
The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982
Food safety hazards associated with consumption of raw milk.
Oliver, Stephen P; Boor, Kathryn J; Murphy, Steven C; Murinda, Shelton E
2009-09-01
An increasing number of people are consuming raw unpasteurized milk. Enhanced nutritional qualities, taste, and health benefits have all been advocated as reasons for increased interest in raw milk consumption. However, science-based data to substantiate these claims are limited. People continue to consume raw milk even though numerous epidemiological studies have shown clearly that raw milk can be contaminated by a variety of pathogens, some of which are associated with human illness and disease. Several documented milkborne disease outbreaks occurred from 2000-2008 and were traced back to consumption of raw unpasteurized milk. Numerous people were found to have infections, some were hospitalized, and a few died. In the majority of these outbreaks, the organism associated with the milkborne outbreak was isolated from the implicated product(s) or from subsequent products made at the suspected dairy or source. In contrast, fewer milkborne disease outbreaks were associated with consumption of pasteurized milk during this same time period. Twenty nine states allow the sale of raw milk by some means. Direct purchase, cow-share or leasing programs, and the sale of raw milk as pet food have been used as means for consumers to obtain raw milk. Where raw milk is offered for sale, strategies to reduce risks associated with raw milk and products made from raw milk are needed. Developing uniform regulations including microbial standards for raw milk to be sold for human consumption, labeling of raw milk, improving sanitation during milking, and enhancing and targeting educational efforts are potential approaches to this issue. Development of pre- and postharvest control measures to effectively reduce contamination is critical to the control of pathogens in raw milk. One sure way to prevent raw milk-associated foodborne illness is for consumers to refrain from drinking raw milk and from consuming dairy products manufactured using raw milk.
Energy Technology Data Exchange (ETDEWEB)
Gracheva, A. Yu.; Zav’yalov, M. A.; Ilyukhina, N. V.; Kukhto, V. A.; Tarasyuk, V. T.; Filippovich, V. P. [All-Russia Research Institute of Preservation Technology (Russian Federation); Egorkin, A. V.; Chasovskikh, A. V. [Research Institute of Technical Physics and Automation (Russian Federation); Pavlov, Yu. S., E-mail: rad05@bk.ru [Frumkin Institute of Physical Chemistry and Electrochemistry, Russian Academy of Sciences (Russian Federation); Prokopenko, A. V., E-mail: pav14@mail.ru [National Research Nuclear University (Moscow Engineering Physics Institute) (Russian Federation); Strokova, N. E. [Moscow State University (Russian Federation); Artem’ev, S. A. [Russian Research Institute of Baking Industry (Russian Federation); Polyakova, S. P. [Russian Research Institute of Confectionery Industry (Russian Federation)
2016-12-15
The work is dedicated to improvement of efficiency of storage and processing of food raw materials using radiation technologies. International practice of radiation processing of food raw materials is presented and an increase in the consumption of irradiated food products is shown. The prospects of using radiation technologies for the processing of food products in Russia are discussed. The results of studies of radiation effects on various food products and packaging film by γ radiation and accelerated electrons are presented.
International Nuclear Information System (INIS)
Gracheva, A. Yu.; Zav’yalov, M. A.; Ilyukhina, N. V.; Kukhto, V. A.; Tarasyuk, V. T.; Filippovich, V. P.; Egorkin, A. V.; Chasovskikh, A. V.; Pavlov, Yu. S.; Prokopenko, A. V.; Strokova, N. E.; Artem’ev, S. A.; Polyakova, S. P.
2016-01-01
The work is dedicated to improvement of efficiency of storage and processing of food raw materials using radiation technologies. International practice of radiation processing of food raw materials is presented and an increase in the consumption of irradiated food products is shown. The prospects of using radiation technologies for the processing of food products in Russia are discussed. The results of studies of radiation effects on various food products and packaging film by γ radiation and accelerated electrons are presented.
Measurement of Aflatoxin M1 in Raw and Pasteurized Cow Milk Samples by HPLC
Directory of Open Access Journals (Sweden)
afshin Nazari
2007-10-01
Full Text Available Nazari A1, Noroozi H2, Movahedi M3, Khaksarian M1 1. Instructor, Department of Physiology, Faculty of Medicine, Lorestan University of Medical Sciences 2. Assistant Professor, Department of Mycology, Faculty of Medicine, Iran University of Medical Sciences 3. Assistant Professor, Department of Genetic Epidemiology, Faculty of Medicine, Lorestan University of Medical Sciences Abstract Background: Aflatoxin M1 is a hydroxylated form of aflatoxin B1 which is produced by Aspergillus flavus. This toxin is produced when cows or other ruminants eat foods contaminated with these mycotoxins and then excrete them in the milk. The toxin is a potent liver and kidney carcinogenetic agent. Materials and methods: Forty two raw cows milk samples from local sources of milk collection and forty samples of commercial pasteurized market milk from Khorramabad, Lorestan, Iran were collected in summer and winter season of 2005. Twenty-one cow milk samples and 20 pasteurized milk samples in each season were analyzed for the presence of aflatoxin M1 (AFM1 by HPLC immunoaffinity columns. Results: Four of 21 raw milk samples in summer showed AFM1 levels between 0.017-0.046 ng/ml and all samples (100% in winter showed the presence of AFM1 levels between 0.003-0.041ng/ ml. AFM1 was detected in 55% of market pasteurized cow milk samples ranging from 0.017 to 0.533 ng/ml in summer and 100% ranging from 0.005-0.0054 ng/ml in winter.,Only one of all milk samples of pasteurized milk in summer had toxin level (0.533 ng/ml more than the maximum permissive limit (0.5 ng/ml. No significant difference was observed among mean contamination level of raw and pasteurized cow milk in two seasons. Key words: Aflatoxin M1, raw milk, pasteurized milk, Khoramabad, HPLC
Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A
2010-11-01
The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.
International Nuclear Information System (INIS)
Matveeva, I.M.
1999-01-01
The issue of improvement of the people's lives quality is considered to be of the highest priority according to the U N classification. It is known that its solution lies with the quality of drinking water and foods, which is defined, to a great extent, by the ecological situation of a concrete living region. As a rule, the existing methods of food analysis are mostly meant for determination of one chemical substance in a certain food. The analysis methods developed by authors are versatile and allow determining the quantitative content of Ca, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, As, Br, Rb, Sr, Zr, Mo, Pb, Bi in the widely used basic foods and industrial raw products according to the common analytical scheme. The methods sensitivity allows determining the MCL of the toxic substances in foods and industrial raw products, specified in 'Medical and biological requirements and health-related quality standards in regards to the industrial raw products and foods
GENETIC DIVERSITY AMONG YERSINIA ENTEROCOLITICA ISOLATED FROM SEWAGE, RAW MILK AND PACKED FOODS
Directory of Open Access Journals (Sweden)
Shanmuga Priya Seshadhri
2014-12-01
Full Text Available A total of 90 isolates (40 from sewage, 30 from raw milk and 20 from packed foods collected to study the incidence of Yersinia enterocolitica. It was observed that 61 isolates (32 from sewage, 19 from raw milk and 10 from packed foods were found contaminated with the bacterium. All the isolated strains were confirmed to Yersinia enterocolitica, by using 16S rRNA PCR. Of 61 strains, only five strains (two from sewage and two from packed foods and one from raw milk were found to be the producers of haemolysin at 37 oC, while among the five strains only two strains from packed foods produced haemolysin at 28 oC. All the isolates showed resistance to amoxicillin and found sensitive to chloramphenicol. Seven strains were producer of High molecular weight proteins (HMWP. 53 strains have produced rough LPS, while the smooth LPS has been observed for 8 isolates. Eleven and six different profiles observed in outermembrane proteins and lipopolysaccaride respectively. Combined primer 1 and 2 RAPD-PCR dendogram shows eight different genotypic patterns.
Fauza, G.; Prasetyo, H.; Amanto, B. S.
2018-05-01
Studies on an integrated production-inventory model for deteriorating items have been done extensively. Most of the studies define deterioration as physical depletion of some inventories over time. This definition may not represent the deterioration characteristics of food products. The quality of food production decreases over time while the quantity remains the same. Further, in the existing models, the raw material is replenished several times (or at least once) within one production cycle. In food industries, however, a food company, for several reasons (e.g., the seasonal raw materials, discounted price, etc.) sometimes will get more benefit if it orders raw materials in a large quantity. Considering this fact, this research, therefore, is aimed at developing a more representative inventory model by (i) considering the quality losses in food and (ii) adopting a general raw material procurement policy. A mathematical model is established to represent the proposed policy in which the total profit of the system is the objective function. To evaluate the performance of the model, a numerical test was conducted. The numerical test indicates that the developed model has better performance, i.e., the total profit is 2.3% higher compared to the existing model.
Towards a decision support system for control of multiple food safety hazards in raw milk production
Spiegel, van der M.; Sterrenburg, P.; Haasnoot, W.; Fels-Klerx, van der H.J.
2013-01-01
Decision support systems (DSS) for controlling multiple food safety hazards in raw milk production have not yet been developed, but the underlying components are fragmentarily available. This article presents the state-of-the-art of essential DSS elements for judging food safety compliance of raw
Review of scientific Research results in identification of plant raw materials in food products
GOLUBTSOVA YU. V.
2016-01-01
Currently, the science-based capabilities have been generated to develop and test various identification methods of food products and reveal adulteration using advanced technique and processes. This article reviews researches and developments to identify the plant raw materials in food products based on morphological, anatomic, physical and chemical test methods and the latest DNA-technologies. Review of physical, chemical, anatomic and morphological test methods to identify raw materials bot...
Quaglia, N C; Dambrosio, A; Normanno, G; Parisi, A; Patrono, R; Ranieri, G; Rella, A; Celano, G V
2008-05-10
Helicobacter pylori is an organism widespread in humans and sometimes responsible for serious illnesses, such as gastric and duodenal ulcers, MALToma and even gastric cancer. It has been hypothesized that the infection route by H. pylori involves multiple pathways including food-borne transmission, as the microorganism has been detected from foods such as sheep and cow milk. This work reports the results of a survey conducted in order to investigate the presence of H. pylori in raw goat, sheep and cow milk produced in Southern Italy, employing a Nested Polymerase Chain Reaction (Nested-PCR) assay for the detection of the phosphoglucosamine mutase gene (glmM), as screening method followed by conventional bacteriological isolation. Out of the 400 raw milk samples examined, 139 (34.7%) resulted positive for the presence of glmM gene, but no strains were isolated. In this work H. pylori DNA has been firstly detected from 41 (25.6%) raw goat milk samples. The results deserve further investigations on the contamination source/s of the milk samples and on the major impact that it may have on consumers.
Stability of vitamin C in frozen raw fruit and vegetable homogenates
Retention of vitamin C in homogenized raw fruits and vegetables stored under laboratory conditions prior to analysis was investigated. Raw collard greens, clementines, and potatoes were chosen, to be representative of food matrices to be sampled in USDA’s National Food and Nutrient Analysis Program...
EFFICIENCY OF RAW MATERIAL INVENTORIES IN IMPROVING SUPPLY CHAIN PERFORMANCE of CV. FIVA FOOD
Directory of Open Access Journals (Sweden)
Artadi Nugraha
2016-01-01
Full Text Available The production and number of processed food industries have slightly increased; as a result, the companies must compete to maximize their profits by conducting their efficient production process. CV. Fiva Food is one of the companies in the field of processed foods, especially in processed meat that has implemented supply chain management. It is necessary for the company to take measurements of its performance and efficiency for the entire supply chain such as procurement of raw materials. The purposes of this study were to analyze the performance of the company's supply chain and determine the most efficient method of procurement for its raw materials as well as and to provide recommendations for the company to improve its performance of entire supply chain. This study used SCOR in analyzing the performance of supply chain and EOQ and POQ method to be compared with the method that the company uses to determine which method of procurement for raw materials is the most efficient one. The result showed that based on the matrix, the company's performance is unfavorable when it was compared to the benchmark performance of inventory days of supply. In addition, this study showed that the POQ method produces the lowest total inventory cost with savings of Rp6.647.015 for raw materials of MDM whereas EOQ method produced the lowest total inventory cost with savings of Rp222.153,78 for raw materials of FQ85CL. Keywords: performance suppy chain, SCOR, fiva food, EOQ, POQ
Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran
Directory of Open Access Journals (Sweden)
Mohammad Hossein Sarrafzadeh Zargar
2014-07-01
Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.
Gormley, F J; Little, C L; Murphy, N; de Pinna, E; McLauchlin, J
2010-03-01
Salmonella contamination of pooled raw shelled egg mix (RSEM) used as an ingredient in lightly cooked or uncooked foods and high-risk kitchen hygiene practices in United Kingdom food service establishments using RSEM were investigated. Samples were collected from 934 premises. Salmonella was found in 1 (0.13%) of 764 RSEM samples, 2 (0.3%) of 726 samples from surfaces where ready-to-eat foods were prepared, and 7 (1.3%) of 550 cleaning cloths. Poor RSEM storage and handling practices were highlighted. Workers in 40% of the premises sampled failed to use designated utensils when RSEM was added to other ingredients, workers in 17% of the premises did not clean surfaces and utensils thoroughly after use with RSEM and before preparing other foods, only 42% of workers washed and dried their hands after handling eggs or RSEM, workers in 41% of the premises did not store RSEM at refrigeration temperature before use, and workers in 8% of the premises added RSEM to cooked rice at the end of cooking when preparing egg fried rice. Take-away premises, especially those serving Chinese cuisine, were least likely to have a documented food safety management system and awareness of the key food safety points concerning the use of RSEM compared with other food service premises (P < 0.0001). Food service businesses using RSEM must be aware of the continuing hazard from Salmonella, must adopt appropriate control measures, and must follow advice provided by national food agencies to reduce the risk of Salmonella infection.
Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah
2018-04-01
The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.
Energy Technology Data Exchange (ETDEWEB)
Vinas, P.; Lopez-Garcia, I.; Merino-Merono, B.; Campillo, N.; Hernandez-Cordoba, M. [Murcia Univ. (Spain). Dept. of Analytical Chemistry
2003-07-01
The speciation of arsenic in different baby foods and the raw fish ingredients using the direct hybridisation of liquid chromatography (LC) and hydride generation atomic absorption spectrometry (HGAAS) is described. Good resolution of the species, arsenic(III), dimethylarsinic acid (DMAA), monomethylarsenic acid (MMAA) and arsenic(V) is achieved using an anion-exchange column with potassium phosphate as the mobile phase and gradient elution. Arsenobetaine (AsB) is determined by on-line oxidation using peroxydisulphate and hydride generation. The arsenicals were extracted by an enzymatic digestion procedure based on the action of trypsin or pancreatin. Arsenobetaine was the only arsenic species detected. The reliability of the procedure was checked by analyzing the total arsenic content of the samples by electrothermal atomic absorption spectrometry with microwave-oven digestion and by analyzing a certified reference material. The arsenic content in the baby foods comes from the raw fish ingredients and is highest when plaice is used. (orig.)
CAN BE BLUEBERRIES THE RISK FOOD AND RAW MATERIAL?
Directory of Open Access Journals (Sweden)
Michal Medvecký2
2012-02-01
Full Text Available Fruits of the highbush blueberries are popular for their beneficial effects on human health and for their excellent sweet-vine taste. Our work is focused on risk assessment of selected elements in relation to the content of bioactive compounds in wild and cultivated of highbush blueberries (Vaccinium corymbosum L.. Anthocyanins are polyphenols that are widely distributed in plants, and contribute to the brilliant blue, red or purple colour in leaves, flowers or fruits. In the samples the antioxidant capacity by the method of Brand – Williams using DPPH (2,2–difenyl-1-pikrylhydrazyl and the content of anthocyanins by the modified method Lapornik in two samples of wild blueberries from different areas of Slovakia (Čertovica and Oravské Veselé and in 6 cultivated varieties highbush blueberry (Bluejay, Bluecrop, Patriot, Berkeley, Brigitta, Nelson were determined. The contents of risky elements - Cd, Pb were assessed by AAS method. The contents of Pb were in all observed samples higher than the maximum limit given by the legislation (cultivated: 0.5612 – 0.9912 mg.kg-1, wild: 0.792 – 0.874 mg.kg-1. The measured content values of Cd were in all samples of blueberries lower than hygienic limit. The highest content of anthocyanins from analysed samples was in wild blueberries from surrouding Čertovica 4870.125 ± 22.803 mg.dm-3, but in this sample was simultaneously the lowest antioxidant capacity of 61.15 ± 1.002 %. The highest antioxidant capacity was measured in sample of cultivated variety Bluejay 87.175 ± 0.45 %. It is important to carry out monitoring of heavy metals to consumption of safe food raw materials and foodstuffs.
DEFF Research Database (Denmark)
Sørensen, Klavs Martin; Khakimov, Bekzod; Engelsen, Søren Balling
2016-01-01
with chemometrics appears to be an efficient first choice for testing incoming raw materials and ingredients in the food production. However, in order to realize its full potential, it is necessary to move away from the current thoughts at the Parnassus, namely the targeted approach. This review will focus......International trade in food commodities will continue to increase and the complex food supply chains make adulteration detection and traceability a technical, logistical and financial challenge. There is no magic solution for adulteration testing, but NIR spectroscopy in combination...... on the exploitation of the capability of NIR spectroscopy to fingerprint incoming raw materials and ingredients as an integrated part of the industry's self-monitoring program typically called process analytical technology....
Galati, Paula Cristina; Lataro, Renata Cristina; Souza, Vanessa Maciel; de Martinis, Elaine Cristina Pereira; Chiarello, Paula Garcia
2013-01-01
Objective This study aimed to analyze and compare the microbiological profile and vitamin C content of raw and cooked foods destined for neutropenic inpatients. Methods Three vegetables and nine fruits, raw and boiled, washed and sanitized were examined. Heat-tolerant coliforms and coagulase-positive staphylococci were counted and the presence of Salmonella spp was investigated. The vitamin C content was analyzed by a colorimetric reaction. The Statistical Package for Social Sciences (SPSS) s...
Galati, Paula Cristina; Lataro, Renata Cristina; Souza, Vanessa Maciel; Martinis, Elaine Cristina Pereira de; Chiarello, Paula Garcia
2013-01-01
OBJECTIVE: This study aimed to analyze and compare the microbiological profile and vitamin C content of raw and cooked foods destined for neutropenic inpatients. METHODS: Three vegetables and nine fruits, raw and boiled, washed and sanitized were examined. Heat-tolerant coliforms and coagulase-positive staphylococci were counted and the presence of Salmonella spp was investigated. The vitamin C content was analyzed by a colorimetric reaction. The Statistical Package for Social Sciences (SPSS)...
DEFF Research Database (Denmark)
Wilcks, Andrea; Andersen, Sigrid Rita; Licht, Tine Rask
2005-01-01
The prevalence of tetracycline resistance, and of specific genetic determinants for this resistance was investigated in 1003 strains of Enterococcus faecalis isolated from various raw food products originating from five categories including chicken meat, other poultry meat, beef, pork, and 'other...
Evaluation of Apple Pomace as a Raw Material for Alternative Applications in Food Industries
Directory of Open Access Journals (Sweden)
Elena Falqué
2007-01-01
Full Text Available In order to measure the potential of apple pomace as a raw material for manufacturing food-related products (such as lactic acid, fiber-rich concentrates and pectin, samples from cider industry were assayed for composition and enzymatic digestibility. Alcohol-soluble compounds (monosaccharides, oligosaccharides and malic acid accounted for 32–45 mass percent of oven-dry pomace. Glucose and fructose were the major components of this fraction. The alcohol-insoluble fraction accounted for 55–68 mass percent of oven-dry pomace and was mainly made up of neutral detergent fiber (62–69 percent of the mass fraction and pectin (16.2–19.7 percent of the mass fraction. The feedstock content of N, P and metal ions (K, Mg, Fe and Mn was favourable for further manufacture of lactic acid fermentation media. Apple pomace showed a high susceptibility to enzymatic hydrolysis: in media with a cellulase loading of 8.5 FPU/g of apple pomace and a cellobiase loading of 5 IU/FPU, about 80 % of the total glucan was converted into glucose after 15 h. Considering the low enzyme charge, liquor to solid ratio employed, reaction time needed to achieve the maximal sugars concentration and N, P and metal ion (K, Mg, Fe and Mn content of samples, it can be concluded that apple pomace is a promising raw material for lactic acid production.
DEFF Research Database (Denmark)
Andersen, S. R.; Saadbye, P.; Shukri, Naseer Mahmoud
2006-01-01
Campylobacter jejuni isolated from raw poultry meat collected at retail shops in Denmark in the period 1996-2003 were tested for susceptibility to seven antimicrobial agents. The food samples consisted of raw chicken meat and other raw poultry meat of domestic or imported origin. The highest levels...... for chloramphenicol, nalidixic acid and ciprofloxacin (P food animals....... Monitoring of the occurrence of antimicrobial resistance in C. jejuni isolated from raw uncooked poultry has been performed on a yearly basis since 1996, thus providing useful insight into consumer exposure to antimicrobial-resistant C. jejuni....
Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A
2016-05-01
Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Oscar Pablo Diaz
2015-05-01
Full Text Available The aim of this study was to estimate both the contribution of drinking water and food (raw and cooked to the total (t-As and inorganic (i-As arsenic intake and the exposure of inhabitants of Socaire, a rural village in Chile´s Antofagasta Region, by using urine as biomarker. The i-As intake from food and water was estimated using samples collected between November 2008 and September 2009. A 24-hour dietary recall questionnaire was given to 20 participants. Drinking water, food (raw and cooked and urine samples were collected directly from the homes where the interviewees lived. The percentage of i-As/t-As in the drinking water that contributed to the total intake was variable (26.8–92.9. Cereals and vegetables are the food groups that contain higher concentrations of i-As. All of the participants interviewed exceeded the reference intake FAO/OMS (149.8 µg∙i-As·day−1 by approximately nine times. The concentration of t-As in urine in each individual ranged from 78 to 459 ng·mL−1. Estimated As intake from drinking water and food was not associated with total urinary As concentration. The results show that both drinking water and food substantially contribute to i-As intake and an increased exposure risk to adult residents in contaminated areas.
Diaz, Oscar Pablo; Arcos, Rafael; Tapia, Yasna; Pastene, Rubén; Velez, Dínoraz; Devesa, Vicenta; Montoro, Rosa; Aguilera, Valeska; Becerra, Miriam
2015-01-01
The aim of this study was to estimate both the contribution of drinking water and food (raw and cooked) to the total (t-As) and inorganic (i-As) arsenic intake and the exposure of inhabitants of Socaire, a rural village in Chile´s Antofagasta Region, by using urine as biomarker. The i-As intake from food and water was estimated using samples collected between November 2008 and September 2009. A 24-hour dietary recall questionnaire was given to 20 participants. Drinking water, food (raw and cooked) and urine samples were collected directly from the homes where the interviewees lived. The percentage of i-As/t-As in the drinking water that contributed to the total intake was variable (26.8–92.9). Cereals and vegetables are the food groups that contain higher concentrations of i-As. All of the participants interviewed exceeded the reference intake FAO/OMS (149.8 µg∙i-As·day−1) by approximately nine times. The concentration of t-As in urine in each individual ranged from 78 to 459 ng·mL−1. Estimated As intake from drinking water and food was not associated with total urinary As concentration. The results show that both drinking water and food substantially contribute to i-As intake and an increased exposure risk to adult residents in contaminated areas. PMID:26006131
Directory of Open Access Journals (Sweden)
Federica Giacometti
2013-10-01
Full Text Available This study investigated the presence of Arcobacter species in two cheese factories; a total of 22 environmental samples and 10 food samples were collected from an artisanal and an industrial cheese factory; Arcobacter species were isolated after enrichment, and isolates were identified at species level by multiplex-polymerase chain reaction (PCR assay. In the artisanal cheese factory, Arcobacter spp. were isolated from several environmental samples, cow and water buffalo raw milk and ricotta cheese. In the industrial plant, Arcobacter spp. were isolated from surfaces not in contact with food and from a cleaned surface in contact with food; no Arcobacter spp. was isolated from food. All isolates were identified as A. butzleri. We report of the presence of A. butzleri in a ready-to-eat cheese produced for retail. In addition, the isolation of A. butzleri in food processing surfaces in the two cheese factories could be assessed as a source of potential contamination for cheeses
Quality and Sensorial Characteristics of Raw-Vegan Bars
Directory of Open Access Journals (Sweden)
Liana Claudia Salanţă
2015-11-01
Full Text Available Increased consumer interest in healthier food products is driven by a variety of factors including growing awareness of the link between diet and health, the desire to age ‘gracefully’ by maintaining good health, greater convenience in meeting nutritional needs and preventing chronic diseases. In raw food diet, food is consumed predominantly or exclusively as uncooked and unprocessed raw food; the main components of the diet are fruits, nuts, seeds, and sprouted grains and beans. The aim of this study was to obtain two raw-vegan bars using dry raw materials and to establish the physicochemical and sensory characteristics of the products. Raw-vegan bars were formulated using fruits and seeds (cranberries, figs, raisins, raspberries, cashew, chia seeds, etc. and binding agents (honey. Raw-vegan bars stands out among fast foods due to their balanced nutritional content and convenience.
Extrusion Processing of Raw Food Materials and by-products: A Review.
Offiah, Vivian; Kontogiorgos, Vassilis; Falade, Kolawole O
2018-05-22
Extrusion technology has rapidly transformed the food industry with its numerous advantages over other processing methods. It offers a platform for processing different products from various food groups by modifying minor or major ingredients and processing conditions. Although cereals occupy a large portion of the extruded foods market, several other types of raw materials have been used. Extrusion processing of various food groups, including cereals and pseudo cereals, roots and tubers, pulses and oilseeds, fruits and vegetables, and animal products, as well as structural and nutritional changes in these food matrices are reviewed. Value addition by extrusion to food processing wastes and by-products from fruits and vegetables, dairy, meat and seafood, cereals and residues from starch, syrup and alcohol production, and oilseed processing are also discussed. Extrusion presents an economical technology for incorporating food processing residues and by-products back into the food stream. In contemporary scenarios, rising demand for extruded products with functional ingredients, attributed to evolving lifestyles and preferences, have led to innovations in the form, texture, color and content of extruded products. Information presented in this review would be of importance to processors and researchers as they seek to enhance nutritional quality and delivery of extruded products.
[Instinct therapy--raw food with meat with exclusion of milk products. Report No. 16].
Jallut, O
1989-06-13
Instinct therapy is a diet consisting exclusively of food in its natural form, which has not been subjected to cooking, preserving or seasoning. Dairy products are forbidden. Indications are numerous and rather imprecise including especially cancer. Burger developed Instinct therapy in 1964 as a diet according to his own philosophy. 1980 he left Switzerland because the practice of "metasexuality" had caused him problems with the law. He founded a school of Instinct therapy in 1982 in France and published his book "La guerre du cru" (The Raw Food Fight) in 1985. In Switzerland, Besuchet took on the teaching of Burger in 1978 and was very active in giving lectures. He died in June 1985 of mediastinal cancer. According to Burger, man originally ate raw food and his instinct has not evolved since those pre-historic times, but has been "artificially modified" by cooked food and the consumption of non-human milk. If man could re-develop his natural instinct and eat only fresh food, which is not prepared in any way, he could solve his health problems and restore defenses against diseases such that these could become beneficial. Cooked food, milk and cereals are thought to be the cause of cancer but instinctive eating would help to avoid or to cure cancer. No preclinical or clinical trials have been carried out. The theories of Burger and Besuchet are based on unverifiable personal experiences.
An Immunoassay for Quantification of Contamination by Raw Meat Juice on Food Contact Surfaces.
Chen, Fur-Chi; Godwin, Sandria; Chambers, Edgar
2016-11-01
Raw chicken products often are contaminated with Salmonella and Campylobacter , which can be transmitted from packages to contact surfaces. Raw meat juices from these packages also provide potential media for cross-contamination. There are limited quantitative data on the levels of consumer exposure to raw meat juice during shopping for and handling of chicken products. An exposure assessment is needed to quantify the levels of transmission and to assess the risk. An enzyme-linked immunosorbent assay (ELISA) was developed and validated for quantitative detection of raw meat juice on hands and various food contact surfaces. Analytical procedures were designed to maximize the recovery of raw meat juice from various surfaces: hands, plastic, wood, stainless steel, laminated countertops, glass, and ceramics. The ELISA was based on the detection of a soluble muscle protein, troponin I (TnI), in the raw meat juice. The assay can detect levels as low as 1.25 ng of TnI, which is equivalent to less than 1 μl of the raw meat juice. The concentrations of TnI in the raw meat juices from 10 retail chicken packages, as determined by ELISA, were between 0.46 and 3.56 ng/μl, with an average of 1.69 ng/μl. The analytical procedures, which include swabbing, extraction, and concentration, enable the detection of TnI from various surfaces. The recoveries of raw meat juice from surfaces of hands were 92%, and recoveries from other tested surfaces were from 55% on plastic cutting boards to 75% on laminated countertops. The ELISA developed has been used for monitoring the transfer of raw meat juice during shopping for and handling of raw chicken products in our studies. The assay also can be applied to other raw meat products, such as pork and beef.
Bojanić, K; Midwinter, A C; Marshall, J C; Rogers, L E; Biggs, P J; Acke, E
2017-09-01
Campylobacter causes acute gastroenteritis in people worldwide and is frequently isolated from food, animals and the environment. The disease is predominately food-borne but many routes of transmission and sources of infection have been described, including contact with pets. The prevalence of Campylobacter spp. in dogs and cats varies widely, and data on New Zealand pets are limited. This study aimed to investigate the prevalence of Campylobacter spp. in dogs, cats and retail raw meat pet food products in New Zealand and to characterize Campylobacter jejuni isolates using multilocus sequence typing (MLST). Ninety dogs and 110 cats examined at the Massey University Veterinary Teaching Hospital for elective procedures, and fifty locally purchased retail raw meat pet diets were sampled. Two culture protocols combining Bolton broth enrichment and mCCDA and CAT agars in a microaerobic atmosphere at 42°C and 37°C with species identification using PCR were performed. The prevalence of Campylobacter spp., C. jejuni, Campylobacter upsaliensis and Campylobacter helveticus was 36%, 13%, 23% and 1% in dogs and 16%, 5%, 5% and 7% in cats, respectively. One dog had Campylobacter lari confirmed, and three dogs and one cat had multiple Campylobacter spp. detected. Significantly more animals tested positive using CAT than mCCDA agar (P dogs, whereas attendance for dental treatment was a risk factor for cats. Campylobacter spp. were isolated from 28%, C. jejuni 22%, C. lari 6% and Campylobacter coli 6% of food samples. Six isolates positive by Campylobacter genus PCR were identified as Arcobacter butzleri. Poultry meat was more likely to be positive than non-poultry meat (P = 0.006). Of the 13 C. jejuni pet isolates with full MLST profiles, eight were of different sequence types (ST) and all nine food isolates were of different STs. © 2016 Blackwell Verlag GmbH.
Microbiological performance of a food safety management system in a food service operation.
Lahou, E; Jacxsens, L; Daelman, J; Van Landeghem, F; Uyttendaele, M
2012-04-01
The microbiological performance of a food safety management system in a food service operation was measured using a microbiological assessment scheme as a vertical sampling plan throughout the production process, from raw materials to final product. The assessment scheme can give insight into the microbiological contamination and the variability of a production process and pinpoint bottlenecks in the food safety management system. Three production processes were evaluated: a high-risk sandwich production process (involving raw meat preparation), a medium-risk hot meal production process (starting from undercooked raw materials), and a low-risk hot meal production process (reheating in a bag). Microbial quality parameters, hygiene indicators, and relevant pathogens (Listeria monocytogenes, Salmonella, Bacillus cereus, and Escherichia coli O157) were in accordance with legal criteria and/or microbiological guidelines, suggesting that the food safety management system was effective. High levels of total aerobic bacteria (>3.9 log CFU/50 cm(2)) were noted occasionally on gloves of food handlers and on food contact surfaces, especially in high contamination areas (e.g., during handling of raw material, preparation room). Core control activities such as hand hygiene of personnel and cleaning and disinfection (especially in highly contaminated areas) were considered points of attention. The present sampling plan was used to produce an overall microbiological profile (snapshot) to validate the food safety management system in place.
Indonesian jellyfish as potential for raw materials of food and drug
Yusuf, S.; Fahmid, I. M.; Abdullah, N.; Zulhaeriah
2018-05-01
Jellyfish used to be considered as a pest of fish and a nuisance to fishing operations. Yet, forty years ago this jellyfish was found to be materials of food, medicine and cosmetics and the utilization of jellyfish is now familiar in Indonesia after being imported by China and Japan industry. This study aims to determine the potential development of jellyfish commodities as food and drugs from Indonesia with the target to improve the welfare of fishermen. This research used methods of rapid observation, limited interview, processing with immersion experiment and desiccation. In addition, various literatures were also used to enrich the knowledge about jellyfish business. Observation showed that the appearance of jellyfish in Indonesian waters varies based on the fertility of the waters affected by oceanographic conditions. Jellyfish contains low calorie and fat content, high protein and minerals as well as total collagen. Thus, jellyfish is a nutritious food source to be developed into food supplements, nutricosmetics and functional foods. Due to its large size, the jellyfish from Bunyu Island is more viable than jellyfish from Suppa Pinrang to be exported as raw material. Therefore, the manufacture of food and medicines from jellyfish materials is possible to be done in Indonesia.
Database-driven primary analysis of raw sequencing data
DEFF Research Database (Denmark)
2014-01-01
The present invention relates to methods for identifying the source of a biological sequence containing sample from raw sequencing reads. The method may be used to identify the source of unknown DNA and can be used for diagnostic, biodefense, food safety and quality, and hygiene applications...
Caffeine Extraction from Raw and Roasted Coffee Beans.
Chiang, Donyau; Lin, Chih-Yang; Hu, Chen-Ti; Lee, Sanboh
2018-04-01
Coffee is a stimulant, psychoactive, popular daily beverage, and its caffeine affects human physiological health and behavior. These important issues prompted us to study caffeine extraction from both the raw and roasted coffee beans of 3 types at different temperatures. A hemispheric model is developed to simulate the extraction process of the caffeine from the coffee beans of hemisphere is proposed. The experimental data are in good agreement with the predicted model. The effective diffusivities of caffeine in both the raw and roasted beans increase with temperature in all 3 types. An incubation period, decreasing with increasing temperature, is observed in all samples studied. Caffeine extraction in roasted beans is more rapid than that for the raw beans and the time difference is significant at low temperatures. In both the raw and roasted samples, caffeine diffusion in the raw beans and the incubation behavior are thermally activated processes. Single activation energies are obtained for diffusion within the extraction temperature range for all beans tested with the exception of one type of the coffee beans, Mandheling, which exhibits 2 activation energies in raw samples. The surface energies of the epidermis of the raw beans and roasted beans obtained from the contact angle measurements are used to interpret the difference of incubation periods. This study has a potential application to the decaffeinated coffee industry.Caffeine affects human physiological health and behavior so that caffeine extraction from coffee beans of different types at different temperatures is important for product refining and customers. © 2018 Institute of Food Technologists®.
Weese, J Scott; Rousseau, J.
2006-01-01
There are concerns regarding the safety of feeding raw meat to household pets. This study demonstrated that Salmonella persists in food bowls that are inoculated with Salmonella-containing raw meat. Standard methods of cleaning and disinfection were minimally effective at eliminating Salmonella contamination.
Ciolacu, Luminita; Stessl, Beatrix; Bolocan, Andrei Sorin; Oniciuc, Elena Alexandra; Wagner, Martin; Rychli, Kathrin; Nicolau, Anca Ioana
2016-03-01
Food illegally brought into the European Union, mainly in the personal luggage of travelers, represents a potential threat to consumers' health. The aim of this study was to investigate the presence of five pathogens in food brought into the European Union by Moldavian citizens as personal goods and illegally sold in Romania in the vicinity of the border. The occurrence of Staphylococcus aureus and Listeria monocytogenes was 7.5% and 8%, while Campylobacter spp., Escherichia coli O157:H7, and Salmonella spp. were absent in all samples. L. monocytogenes sequence type 2, 9, 121, and 155, highly prevalent among foodstuffs worldwide, was also present among isolates from ready-to-eat food illegally sold in Romania, even at the same date of sampling, indicating cross-contamination during food handling. S. aureus spa types t449, t304, and t524 were most often isolated from raw-milk cheeses contaminated with 10(3)-10(5) colony-forming units per gram, evidencing a contamination at herd level or unhygienic conditions during processing. S. aureus t011 and t3625, both included in the livestock-associated CC398, were isolated from pork lard and poultry meat. This study shows that cross-border trade from nonmember states represents a neglected route of transmission of foodborne pathogens into the European Union that could lead to sporadic or family-associated cases of disease.
40 CFR 90.414 - Raw gaseous exhaust sampling and analytical system description.
2010-07-01
... probe may not be greater than 0.10 cm. The fitting that attaches the probe to the exhaust pipe must be... the different analyzers. (2) Heat the sample transport system from the engine exhaust pipe to the HC... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...
40 CFR 89.412 - Raw gaseous exhaust sampling and analytical system description.
2010-07-01
... the exhaust pipe shall be as small as practical in order to minimize heat loss from the probe. (2) The... sample transport system from the engine exhaust pipe to the HC analyzer and the NOX analyzer must be... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...
40 CFR 91.414 - Raw gaseous exhaust sampling and analytical system description.
2010-07-01
... shall not be greater than 0.10 cm. The fitting that attaches the probe to the exhaust pipe shall be as... internally to the different analyzers. (2) Heat the sample transport system from the engine exhaust pipe to... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...
Status of food and raw milk supply and problem just after the reactor accident
International Nuclear Information System (INIS)
Hirakawa, Sachiko; Murakami, Kana; Yoshizawa, Nobuaki; Takizawa, Mari; Kawai, Masaki; Sato, Osamu; Takagi, Syunji; Nakamura, Takashi
2014-01-01
Iodine 131 was detected in the environment and the food such as vegetables, raw milk and tap water just after the reactor accident following the East Japan Great Earthquake occurred in March 11, 2011. This article investigated status of refuge of Fukushima residents, their dietary life and food distribution from March 11 to 31 just after the accident so as to reevaluate internal exposure dose with Iodine 131. Investigation results showed most of food taken by refugees was confirmed food stock or relief supplies outside from the disaster area and suggested food contaminated with Iodine 131 was not widely consumed and distributed due to limit to send designated vegetables, restriction of tap water intake, damaged distribution facilities and closing down of retail stores. Restriction of tap water intake was only applied partly, so this might cause internal exposure dose due to tap water. (T. Tanaka)
Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland
DEFF Research Database (Denmark)
Scullion, R.; Harrington, C.S.; Madden, R.H.
2006-01-01
A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....
COMPOSITIONAL EVALUATION OF RAW AND PROCESSED HARMS (Brachystegia eurycoma SEED FLOUR
Directory of Open Access Journals (Sweden)
M.O Aremu
2014-12-01
Full Text Available Brachystegia eurycoma is predominantly grown in the eastern region of Nigeria. Its seed is used in food majorly as a soup condiment, flavouring agent and soup thickener. The proximate, mineral and amino acid compositions were determined on raw and processed seeds (boiled, fermented and roasted using standard analytical techniques. The processing methods showed deviations in nutrients from the raw seeds. The crude protein was reduced by the processing methods with exception of roasting method. Crude fat was reduced in all the processing methods in this order: Raw > fermented > roasted > boiled samples. All the processing methods enhanced calcium content in this order: Raw < boiled < fermented < roasted samples. Boiling and fermenting reduced the content of magnesium by 72.6 and 30.2%, respectively while boiling, fermenting and roasting increased potassium content by 124.5, 12.2 and 120.4%, respectively. Generally, all the samples were found to be a good source of essential minerals and harmful heavy metals such as lead, chromium, arsenic and cadmium were not at detectable range of atomic absorption spectrophotometer. The amino acid profile revealed that amino acids in fermented sample were better concentrated than that of raw and other processed samples. The total essential amino acids (TEAA ranged from 28.63 g/100g crude protein in roasted sample to 34.79 g/100g crude protein in fermented sample. The limiting amino acid (LAA for all the samples was Met + Cys (TSAA.
Song, Minghui; Bai, Yalong; Xu, Jie; Carter, Michelle Qiu; Shi, Chunlei; Shi, Xianming
2015-02-16
The risk of zoonotic transmission to humans highlights the need to understand the molecular ecology of Staphylococcus aureus in foods. In this study, 142 S. aureus isolates obtained from various raw and processed foods from Shanghai, China were characterized to determine their genetic diversity and virulence gene content. A total of 16 clonal complexes (CCs), 34 staphylococcal protein A (spa) types, and 6 accessory gene regulator (agr) allelic groups were identified and analyzed among the 142 S. aureus isolates. Among these, the genotype CC188-t189-agr Ι was the most prevalent, constituting 28.2% of all isolates. The presence of virulence genes encoding 20 staphylococcal enterotoxins (se), toxic shock syndrome toxin (tsst1), exfoliative toxins (eta, etb, and etd), Panton-Valentine leukocidin (lukS-PV and lukF-PV), as well as methicillin resistance gene (mecA), was determined by PCR. Of these S. aureus isolates, 72.5% harbored toxin genes, in which the most frequent toxin gene was sep (43.7%), followed by sej (26.1%) and pvl (21.1%). In contrast, see, ses, set, tsst1, etb, and etd were not found in any of the isolates tested. Eight S. aureus isolates (5.6%, 8/142), seven from raw milk and one from frozen food, were mecA positive and resistant to oxacillin, thus were MRSA. The 142 S. aureus isolates displayed 52 different toxin gene profiles. Although no direct association was found between toxin gene profile and the S. aureus genotype, the isolates belonging to CC5, CC9, CC20, CC50, and CC72 clonal lineages in general carried more toxin genes (>5) compared with the isolates in other CCs. It was also revealed that raw milk and raw meat were the major sources of isolates containing multiple toxin genes. S. aureus isolates from food that were genetically highly related, displayed diverse toxin gene profiles, implying the significant role of horizontal gene transfer in the emergence of highly toxigenic S. aureus isolates. Copyright © 2014 Elsevier B.V. All rights
Tamme, T; Reinik, M; Roasto, M; Meremäe, K; Kiis, A
2009-08-01
The nitrate and nitrite contents were determined in canned vegetable-based infant foods of five varieties. Furthermore, changes in nitrate content during industrial processing were studied. Samples were taken from raw materials, homogenized mixtures, and final products after sterilization, and then analyzed for nitrate and nitrite content by high-pressure liquid chromatography. Processing steps preceding heat treatment, such as vegetable peeling and washing, decreased the nitrate concentrations in the range of 17 to 52%. During processing, the nitrate content in canned infant foods decreased 39 to 50%, compared with nitrate concentration in the raw-vegetable mixture. The final nitrate concentration in infant foods depends mainly on the initial nitrate content of the raw-vegetable mixture. The effect of storage time (24 and 48 h) and temperature (4 to 6 degrees C and 20 to 22 degrees C) on nitrate and nitrite content in opened canned infant-food samples was studied. After 24 h of storage at refrigerated and room temperatures, the mean nitrate content increased on average by 7 and 13%, and after 48 h of storage by 15 and 29%, respectively. The nitrite content in all analyzed samples was below the quantification limit. Storage requirements of industrial manufacturers must be followed strictly. Opened can foods, stored under refrigerated conditions, have to be consumed within 2 days, as recommended by manufacturers. The infant-food producers must pay more attention to the quality of raw materials. Nitrate content analyses should be added as compulsory tests to the quality assurance programs.
Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples.
Alasaad, Noor; Alzubi, Hussein; Kader, Ahmad Abdul
2016-06-01
Food and feed samples were randomly collected from different sources, including local and imported materials from the Syrian local market. These included maize, barley, soybean, fresh food samples and raw material. GMO detection was conducted by PCR and nested PCR-based techniques using specific primers for the most used foreign DNA commonly used in genetic transformation procedures, i.e., 35S promoter, T-nos, epsps, cryIA(b) gene and nptII gene. The results revealed for the first time in Syria the presence of GM foods and feeds with glyphosate-resistant trait of P35S promoter and NOS terminator in the imported soybean samples with high frequency (5 out of the 6 imported soybean samples). While, tests showed negative results for the local samples. Also, tests revealed existence of GMOs in two imported maize samples detecting the presence of 35S promoter and nos terminator. Nested PCR results using two sets of primers confirmed our data. The methods applied in the brief data are based on DNA analysis by Polymerase Chain Reaction (PCR). This technique is specific, practical, reproducible and sensitive enough to detect up to 0.1% GMO in food and/or feedstuffs. Furthermore, all of the techniques mentioned are economic and can be applied in Syria and other developing countries. For all these reasons, the DNA-based analysis methods were chosen and preferred over protein-based analysis.
Hygiene quality and presence of ESBL-producing Escherichia coli in raw food diets for dogs
Directory of Open Access Journals (Sweden)
Oskar Nilsson
2015-10-01
CMY-2 group and only one of them was also resistant to a non-beta-lactam antibiotic. Conclusion: The results of this study indicate that raw food diets could be a source of ESC-resistant E. coli to dogs and highlight the need for maintaining good hygiene when handling these products to prevent infection.
Enteric Viruses in Raw Vegetables and Groundwater Used for Irrigation in South Korea▿
Cheong, Sooryun; Lee, Cheonghoon; Song, Sung Won; Choi, Weon Cheon; Lee, Chan Hee; Kim, Sang-Jong
2009-01-01
Raw vegetables irrigated with groundwater that may contain enteric viruses can be associated with food-borne viral disease outbreaks. In this study, we performed reverse transcription-PCR (RT-PCR) and cell culture-PCR to monitor the occurrence of enteric viruses in groundwater samples and in raw vegetables that were cultivated using that groundwater in South Korea. Samples were collected 10 times from three farms located in Gyeonggi Province, South Korea. RT-PCR and cell culture-PCR were performed to detect adenoviruses (AdVs), enteroviruses (EVs), noroviruses (NoVs), and rotaviruses, followed by sequence analyses of the detected strains. Of the 29 groundwater samples and the 30 vegetable samples, five (17%) and three (10%) were positive for enteric viruses, respectively. AdVs were the most frequently detected viruses in four groundwater and three vegetable samples. EVs and NoVs were detected in only one groundwater sample and one spinach sample, respectively. The occurrence of enteric viruses in groundwater and vegetable samples was not correlated with the water temperature and the levels of indicator bacteria, respectively. Phylogenetic analysis indicated that most of the detected AdVs were temporally distributed, irrespective of sample type. Our results indicate that raw vegetables may be contaminated with a broad range of enteric viruses, which may originate from virus-infected farmers and virus-contaminated irrigation water, and these vegetables may act as a potential vector of food-borne viral transmission. PMID:19854919
Nonga, Hezron Emmanuel; Ngowi, Helena Aminiel; Mdegela, Robinson Hammerthon; Mutakyawa, Eliud; Nyahinga, Gabriel Busungu; William, Robert; Mwadini, Mtumwa Mohd
2015-11-26
Raw milk, raw fruit juice and raw fish are enriched with essential nutrients for human diet but are prone to microbial contamination along the value chain. This cross sectional study was conducted to assess physicochemical characteristics and microbial quality of raw milk, fruit juice and fish from food vendors in Morogoro Municipality, Tanzania. The physicochemical assessment of food samples was done by smell, colour, presence of debris, turbidity, consistence, pH and clot on alcohol test. Hygiene of food containers, personnel and the vending environment was also assessed. Qualitative and quantitative microbial assessment of food was done using standard laboratory protocols as described by Tanzania Bureau of Standards and International Systems of Standards. Raw milk sold in Morogoro was of poor quality since was adulterated with water, contained sediments and clotted on alcohol test. Up to 63 % of the milk samples were contaminated with Escherichia coli and 60 % had higher total viable count (TVC) than the recommended values. Raw fruit juice was stored in dirty containers and sold under unhygienic environment. Seventy-three percent of juice samples had TVC beyond the recommendations while E. coli contamination rate was 63.3 %. The raw fish samples had started spoiling as depicted through sensory evaluation. E. coli contamination rate was 55 % and that of Campylobacter jejuni was 0.5 %. The mean TVC of raw fish was 8.1 (Log cfu/g) and 96.2 % of the fish samples had TVC beyond the recommended limits of 5.0 Log cfu/g. The physicochemical characteristics of food vended in Morogoro Municipality were of poor quality. The food had high bacterial contaminations. This situation poses health risks to the public and losses to food vendors due to spoilage. Stakeholders in food value chain should be educated on safe production and good hygienic practices. Routine quality and safety assessment of locally vended food, inspection of selling premises and regular health check-up of
Ward, Lindsay R; Kerth, Chris R; Pillai, Suresh D
2017-07-01
Raw milk is known to contain relatively high numbers of microorganisms, some of which include microbial pathogens. Electron beam (eBeam) processing is a nonthermal pasteurization food processing technology. The underlying hypothesis was that eBeam processing will not negatively influence the composition, nutrient content, and aroma profile of raw milk. Raw milk samples were exposed to eBeam doses of 1 and 2 kGy, since our studies had shown that 2 kGy is suitable for raw milk pasteurization. The untreated and eBeam-treated raw milk samples were analyzed to detect changes in lactose, vitamin B 2 , vitamin B 12 , and calcium concentrations. The possible breakdown of casein and whey proteins and lipid oxidation were investigated along with the formation of volatile aroma compounds. Even though vitamin B 2 showed a 31.6% decrease in concentration, the B 2 content in eBeam-pasteurized raw milk met all USDA nutritional guidelines. Even though there were no indications of lipid oxidation after the 2.0-kGy eBeam treatment, there was lipid oxidation (58%) after 7 d of refrigerated storage. However, based on the GC-olfactory analysis, the lipid oxidation did not necessarily result in the development of a wide variety of off-odors. © 2017 Institute of Food Technologists®.
Commutability of food microbiology proficiency testing samples.
Abdelmassih, M; Polet, M; Goffaux, M-J; Planchon, V; Dierick, K; Mahillon, J
2014-03-01
Food microbiology proficiency testing (PT) is a useful tool to assess the analytical performances among laboratories. PT items should be close to routine samples to accurately evaluate the acceptability of the methods. However, most PT providers distribute exclusively artificial samples such as reference materials or irradiated foods. This raises the issue of the suitability of these samples because the equivalence-or 'commutability'-between results obtained on artificial vs. authentic food samples has not been demonstrated. In the clinical field, the use of noncommutable PT samples has led to erroneous evaluation of the performances when different analytical methods were used. This study aimed to provide a first assessment of the commutability of samples distributed in food microbiology PT. REQUASUD and IPH organized 13 food microbiology PTs including 10-28 participants. Three types of PT items were used: genuine food samples, sterile food samples and reference materials. The commutability of the artificial samples (reference material or sterile samples) was assessed by plotting the distribution of the results on natural and artificial PT samples. This comparison highlighted matrix-correlated issues when nonfood matrices, such as reference materials, were used. Artificially inoculated food samples, on the other hand, raised only isolated commutability issues. In the organization of a PT-scheme, authentic or artificially inoculated food samples are necessary to accurately evaluate the analytical performances. Reference materials, used as PT items because of their convenience, may present commutability issues leading to inaccurate penalizing conclusions for methods that would have provided accurate results on food samples. For the first time, the commutability of food microbiology PT samples was investigated. The nature of the samples provided by the organizer turned out to be an important factor because matrix effects can impact on the analytical results. © 2013
Quality and Sensorial Characteristics of Raw-Vegan Bars
Liana Claudia Salanţă; Maria Tofană; Sonia Socaci; Cristina Barta; Carmen Pop
2015-01-01
Increased consumer interest in healthier food products is driven by a variety of factors including growing awareness of the link between diet and health, the desire to age ‘gracefully’ by maintaining good health, greater convenience in meeting nutritional needs and preventing chronic diseases. In raw food diet, food is consumed predominantly or exclusively as uncooked and unprocessed raw food; the main components of the diet are fruits, nuts, seeds, and sprouted grains and beans. The aim of t...
Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit
2017-03-01
Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.
Gebbink, Wouter A; Ullah, Shahid; Sandblom, Oskar; Berger, Urs
2013-11-01
Polyfluoroalkyl phosphate mono-, di-, and tri-esters (mono-, di-, and triPAPs) are used to water- and grease-proof food packaging materials, and these chemicals are known precursors to perfluoroalkyl carboxylic acids (PFCAs). Existing analytical methods for PAPs lack sample clean-up steps in the sample preparation. In the present study, a method based on ultra performance liquid chromatography coupled to tandem mass spectrometry (UPLC/MS/MS) was developed and optimized for the analysis of mono-, di-, and triPAPs, including a clean-up step for the raw extracts. The method was applied to food samples and their PAP-containing packaging materials. The optimized UPLC/MS/MS method enabled the separation and identification of a total of 4 monoPAPs, 16 diPAPs, and 7 triPAPs in the technical mixture Zonyl®-RP. For sample clean-up, weak anion exchange solid phase extraction columns were tested. PAPs standard solutions spiked onto the columns were separated into a fraction containing neutral compounds (triPAPs) and a fraction with ionic compounds (mono- and diPAPs) with recoveries between 72-110%. Method limits of quantification for food samples were in the sub to low picogram per gram range. For quantitative analysis of PAPs, compound-specific labeled internal standards showed to be essential as sorption and matrix effects were observed. Mono-, di-, and/or triPAPs were detected in all food packaging materials obtained from the Swedish market. Up to nine diPAPs were detected in the food samples, with the 6:2/6:2 and 6:2/8:2 diPAPs as the dominant compounds. DiPAP concentrations in the food samples ranged from 0.9 to 36 pg/g, which was comparable to individual PFCA concentrations in the same samples. Consumption of food packed in PAP-containing materials could be an indirect source of human exposure to PFCAs.
Directory of Open Access Journals (Sweden)
A.A. Moawad
2011-10-01
Full Text Available Milk from different animal species has variable levels of antimicrobial factors against some of spoilage bacteria. For example, they are significantly present in higher concentration in she-camel’s milk than in cattle or buffalo and they are more heat-resistant than their counterparts in cattle and buffalo. Spoilage bacteria are known to communicate with each other by release of signaling molecules, a phenomenon described as quorum sensing (QS. Some food matrices inhibit these signaling compounds. In this study we screened QS inhibitory activities in raw milk of cattle and camel. Ten samples each of fresh raw cow’s milk and she-camel’s milk from apparently healthy animals were screened using the bacterial model Cromobacterium violaceum. The tested cow’s raw milk samples were able to inhibit the production of QS signalling molecules acyl-homoserine lactones (AHLs produced by C. violaceum. However, she-camel’s milk samples were less effective in inhibiting such AHLs. Thus, one of the factors which influence the inhibitory activity could be derived from variation in milk chemical composition, especially in the percentage of fat which is significantly higher in tested cow’s milk samples (2.22±0.12 than in tested she-camel’s milk samples (1.44±0.35. Natural inhibition of QS signaling by cow’s milk may offer a unique means to control foodborne pathogens and reduce microbial spoilage.
Wahini, M.; Miranti, M. G.; Lukitasari, F.; Novela, L.
2018-02-01
Rambutan (Nephelium Lappaceum L.) is a plant that identical with Southeast Asian countries, in some areas of Indonesia no exception, but rambutan seed is considered as a waste. Therefore, it needs to be optimized into raw materials of food and processed with high nutritional value and has economic value. The purpose of this research were: 1) to find the best rambutan seed immersion formula; 2) to know the nutritional value of the best immersed rambutan seed; 3) to produce raw material and various processed of rambutan seed product. The research method was quasi experiment with 6 treatments and 2 factorial design, materials for immersion was NaCl and Ca(OH)2. The results showed that: 1) the best rambutan seed immersion formula was using Ca(OH)2; 2) the best rambutan seed contains 1,6 ash, 31,2 protein, 26,9 fat; 3) the best rambutan seed produce flour and processed of seasoned nuts. This research indicates that rambutan seed is very potential to be an alternative high-value raw materials.
Prevalence of Listeria species in raw milk and traditional dairy products in Isfahan, Iran
Directory of Open Access Journals (Sweden)
Ehsan Shamloo
2015-01-01
Full Text Available Aim: The study aimed to assess the prevalence of Listeria spp. in raw milk and traditional non-pasteurized dairy products in Isfahan, Iran. Materials and Methods: A total of 292 samples of raw milk and traditional dairy were examined for the presence of Listeria spp. using a two-step selective enrichment recommended by the United States Department of Agriculture. All isolates were subjected to standard biochemical tests. L. monocytogenes strains were further confirmed by polymerase chain reaction (PCR amplification. Results: Of 292 samples, 21 (7.14% and 4 (1.47% were positive for Listeria spp. and pathogenic L. monocytogenes, respectively. The prevalence of Listeria spp. in raw milk, ice cream, cream, and freni were 5.91 (5.49%, 12.63 (19.04%, 3.27 (11.11% and 1.25 (4%, respectively. Listeria was not detected from yogurt, butter, Kashk, and cheese. Listeria innocua at 16.21 (5.44% was the most prevalent species isolated, followed by L. monocytogenes at 4.21 (19% and L. seeligeri at 1.21 (4.7%. All strains of L. monocytogenes identified by biochemical tests were also confirmed by PCR. Conclusion: The study shows the prevalence of L. monocytogenes in raw milk and traditional dairy products sold in the market. Consumption of raw milk with mild heat treatment or its usage in traditional dishes could pose serious health problems due to lack of appropriate control measures. The lack of knowledge on the risks of listeriosis transmission indicates the need for implementation of a food safety education program. In addition, the Iranian food safety authorities should urgently set up an effective standard to screen all susceptible food products for the presence of Listeria.
Directory of Open Access Journals (Sweden)
S. Gallina
2009-12-01
Full Text Available Italian consumers changed their food habits in the last period; the increase of raw milk consuming is also related to the high number of self service vending machines that have been authorized, particularly in Northern Italy. According to national rules on raw milk hygienic conditions, the most important bacteria are checked by Veterinary Services; the aim of this study was to investigate some emerging or re-emerging hazards in raw milk at vending machines. For this reason 100 raw milk samples were collected and analyzed in order to detect E. sakazakii, Coxiella burnetii and M. avium subsp paratuberculosis. One milk sample resulted to be positive with PCR method for E. sakazakii (no cultural confirmation was possible; 49% of samples resulted posivite for the presence of Coxiella burnetii specific DNA, and 5% of milk samples came out positive to the presence of M. paratuberuclosis antibodies with ELISA methods.
The prevelance of raw food diet, vegetarianism and veganism among students of vilnius university
Žibutis, Justas
2016-01-01
Individuals need to eat different groups of products. Without the use of a particular product group, body may lack of necessary materials to maintain functionality. This can lead to health problems. We need to determine students eating habits and criteria to choose a product. It allows us to evaluate the risk of not receiving sufficient quantities of substance, which are necessary for normal functioning of the human body. Objective: To evaluate the prevelance of raw food diet, vegetarianism a...
DEFF Research Database (Denmark)
Boon, Polly E.; Ruprich, Jiri; Petersen, Annette
2009-01-01
In this paper, we present an approach to format national food consumption data at raw agricultural commodity (RAC) level. In this way, the data is both formatted in a harmonised way given the comparability of RACs between countries, and suitable to assess the dietary exposure to chemicals analysed......, and the use of the FAO/WHO Codex Classification system of Foods and Animal Feeds to harmonise the classification. We demonstrate that this approach works well for pesticides and glycoalkaloids, and is an essential step forward in the harmonisation of risk assessment procedures within Europe when addressing...... chemicals analysed in RACs by all national food control systems....
O'Reilly, Ciara E; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R; Donaghy, John; Rowe, Michael; O'Mahony, Pat
2004-09-01
Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of 75 degrees C for 25 s. All analyses were undertaken at the Department of Food Science (Food Microbiology) laboratory at Queen's University Belfast. Each milk sample was subjected to two tests for M. paratuberculosis: immunomagnetic separation-PCR (IMS-PCR; to detect the presence of M. paratuberculosis cells, live or dead) and chemical decontamination and culture (to confirm the presence of viable M. paratuberculosis). Overall, M. paratuberculosis DNA was detected by IMS-PCR in 50 (12.9%; 95% confidence interval, 9.9 to 16.5%) raw-milk samples and 35 (9.8%; 95% confidence interval, 7.1 to 13.3%) pasteurized-milk samples. Confirmed M. paratuberculosis was cultured from one raw-milk sample and no pasteurized-milk samples. It is concluded that M. paratuberculosis DNA is occasionally present at low levels in both raw and commercially pasteurized cows' milk. However, since no viable M. paratuberculosis was isolated from commercially pasteurized cows' milk on retail sale in the Republic of Ireland, current pasteurization procedures are considered to be effective.
Examining trust factors in online food risk information: The case of unpasteurized or 'raw' milk.
Sillence, Elizabeth; Hardy, Claire; Medeiros, Lydia C; LeJeune, Jeffrey T
2016-04-01
The internet has become an increasingly important way of communicating with consumers about food risk information. However, relatively little is known about how consumers evaluate and come to trust the information they encounter online. Using the example of unpasteurized or raw milk this paper presents two studies exploring the trust factors associated with online information about the risks and benefits of raw milk consumption. In the first study, eye-tracking data was collected from 33 pasteurised milk consumers whilst they viewed six different milk related websites. A descriptive analysis of the eye-tracking data was conducted to explore viewing patterns. Reports revealed the importance of images as a way of capturing initial attention and foregrounding other features and highlighted the significance of introductory text within a homepage. In the second, qualitative study, 41 consumers, some of whom drank raw milk, viewed a selection of milk related websites before participating in either a group discussion or interview. Seventeen of the participants also took part in a follow up telephone interview 2 weeks later. The qualitative data supports the importance of good design whilst noting that balance, authorship agenda, the nature of evidence and personal relevance were also key factors affecting consumers trust judgements. The results of both studies provide support for a staged approach to online trust in which consumers engage in a more rapid, heuristic assessment of a site before moving on to a more in-depth evaluation of the information available. Findings are discussed in relation to the development of trustworthy online food safety resources. Copyright © 2016 Elsevier Ltd. All rights reserved.
Food safety in raw milk production: risk factors associated to bacterial DNA contamination.
Cerva, Cristine; Bremm, Carolina; Reis, Emily Marques dos; Bezerra, André Vinícius Andrade; Loiko, Márcia Regina; Cruz, Cláudio Estêvão Farias da; Cenci, Alexander; Mayer, Fabiana Quoos
2014-06-01
While human illness from milkborne pathogens may be linked to contamination of the product after pasteurization or improper pasteurization, such diseases are usually associated with consumption of raw milk or its by-products. Molecular biology tools were applied to investigate contamination by Listeria monocytogenes, Salmonella spp., some pathogenic strains of Escherichia coli, and Campylobacter jejuni in 548 raw milk samples from 125 dairy farms established in two regions from southern Brazil. Moreover, 15 variables were evaluated for their association with raw milk contamination levels, and the risk factors were determined by multiple regression analysis. Salmonella spp. were more frequently detected, followed by pathogenic E. coli. There was difference in contamination index between the regions, in which risk factors such as temporary cattle confinement, low milk production, low milking machine cleaning frequency, and milk storage area without tile walls were identified. The risk factors were specific to each region studied. Nevertheless, the data can be used to improve milk quality of dairy farms/herds with similar management practices.
Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages
Directory of Open Access Journals (Sweden)
Hristo Daskalov
2014-03-01
Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.
XENOBIOTICS AND BIOGENIC ELEMENTS IN RAW COW'S MILK
Directory of Open Access Journals (Sweden)
Agnieszka Greń
2012-12-01
Full Text Available Normal 0 21 false false false SK X-NONE X-NONE This paper presents the concentration some toxic and biogenic elements in milk from Nitra region. The aim of this investigation was to evaluate 30 samples of raw milk with fat contents 3.8% obtained from milk machine in the Nitra region. Samples were analyzed for metal contents using atomic absorption spectrophotometry (AAS. In comparison with maximum acceptable concentration for milk in the food codex of the Slovak republic, the level of contamination with cadmium was exceeded and reached the value 0.221 µg.ml-1. The copper content ranged from 1.201 µg.ml-1 to 5.810 µg.ml-1 and the average concentration reached 3.793 µg.ml-1. Iron had an average of 1.824 µg.ml-1. Overall in all milk samples high correlations were found. Between positive correlation (0.7019 and negative correlation between of nickel and potassium concentration in raw milk (-0.72 was found. doi:10.5219/246
de Oliveira, Tatiane Milão; Augusto Peres, Jayme; Lurdes Felsner, Maria; Cristiane Justi, Karin
2017-08-15
Milk is an important food in the human diet due to its physico-chemical composition; therefore, it is necessary to monitor contamination by toxic metals such as Pb. Milk sample slurries were prepared using Triton X-100 and nitric acid for direct analysis of Pb using graphite furnace atomic absorption spectrometry - GF AAS. After dilution of the slurries, 10.00µl were directly introduced into the pyrolytic graphite tube without use of a chemical modifier, which acts as an advantage considering this type of matrix. The limits of detection and quantification were 0.64 and 2.14µgl -1 , respectively. The figures of merit studied showed that the proposed methodology without pretreatment of the raw milk sample and using external standard calibration is suitable. The methodology was applied in milk samples from the Guarapuava region, in Paraná State (Brazil) and Pb concentrations ranged from 2.12 to 37.36µgl -1 . Copyright © 2017 Elsevier Ltd. All rights reserved.
On-chip sample preparation for complete blood count from raw blood.
Nguyen, John; Wei, Yuan; Zheng, Yi; Wang, Chen; Sun, Yu
2015-03-21
This paper describes a monolithic microfluidic device capable of on-chip sample preparation for both RBC and WBC measurements from whole blood. For the first time, on-chip sample processing (e.g. dilution, lysis, and filtration) and downstream single cell measurement were fully integrated to enable sample preparation and single cell analysis from whole blood on a single device. The device consists of two parallel sub-systems that perform sample processing and electrical measurements for measuring RBC and WBC parameters. The system provides a modular environment capable of handling solutions of various viscosities by adjusting the length of channels and precisely controlling mixing ratios, and features a new 'offset' filter configuration for increased duration of device operation. RBC concentration, mean corpuscular volume (MCV), cell distribution width, WBC concentration and differential are determined by electrical impedance measurement. Experimental characterization of over 100,000 cells from 10 patient blood samples validated the system's capability for performing on-chip raw blood processing and measurement.
Directory of Open Access Journals (Sweden)
Amaranta Traversa
2013-02-01
Full Text Available In the period 2006-2011 six public catering establishments (3 canteens and 3 cafeterias were monitored, trough audit and sampling, in order to verify the application of good manufacturing and hygiene practices during food production, handling and serving. The compliance to microbiological food safety criteria (Listeria monocytogenes and Salmonella spp. and process hygiene criteria were investigated using ISO standards for microbiological analyses. A total of 612 samples were collected: 192 food samples and 288 environmental swab samples from canteens; 33 food samples and 99 swab samples from cafeterias. Regarding food safety, two samples were in disagreement with criteria fixed in EU Regulation as Listeria monocytogenes was isolated from a turkey breast in a canteen and from a sandwich in a cafeteria. Regarding process hygiene criteria, as no microbiological limits are legally defined for catering services, for this study limits were fixed according to the quality standards of tender, scientific literature and laboratory experience. 23.4% foodstuffs and 8.7% swabs resulted non-compliant in canteens; 48.5% foodstuffs and 6.1% swabs resulted non-compliant in cafeterias. The count of coagulase-positive staphylococci (CPS was higher of the fixed limits in raw turkey meat and in cooked spinach: the presence among CPS of S. aureus was confirmed, strains were not able to produce enterotoxins. The most common non-compliance in hygiene criteria was represented by aerobic colony count (60.7% of total non-compliance in canteens and 75.0% in cafeterias and coliform bacteria (20.3% in canteens and 25.0% in cafeterias. Nine raw foods or raw readyto- eat food samples were non-compliant for both coliform bacteria and aerobic count; one sample (raw turkey meat was non-compliant for CPS and aerobic count but resulted to be compliant after cooking. Auditing and sampling are the most effective tools to improve food quality standard and to enhance food business
Determination of essential nutrients in raw milk
Directory of Open Access Journals (Sweden)
Penphimon Phongphanphanee
2006-03-01
Full Text Available Milk production in Thailand has gradually increased since 1961. Occasional oversupply of raw milk has become one of dairy farmers' major problems. Increasing the consumption of milk by making use of its separated nutrients may offer a solution. This study was to assess the composition of raw milk produced in Thailand, which included fat, protein, lactose, solid-not-fat (SNF and total solid (TS. A large dairy cooperatives in Saraburi Province was selected for the study. About 9% of its total members, constituting 108 farms, were randomly chosen. They consisted of small size (less than 20 cows/farm, medium size (21-100 cows/farm and large size (>100 cows/farm. The majority was medium-size. Raw milk from each farm was sampled at the delivery site of the cooperatives in the morning. Milk data of the 108 farms were compiled at 3 different periods between February and July 2003. The raw milk was analyzed by the Fourier Transform Infrared Analysis (FTIR using MilkoScan FT6000. The results showed the average fat content of 3.50±0.47%, protein of 3.13±0.16%, lactose of 4.59±0.12%, SNF of 8.42±0.20%, and TS of 11.92±0.54%. The samples were superior in all of the nutrients as compared to the standard levels set by the Department of Livestock Development, except for TS. This indicates the possibility of a local production of milk nutrients such as lactose and protein as ingredients for the pharmaceutical and health food industries.
Statistical aspects of food safety sampling
Jongenburger, I.; Besten, den H.M.W.; Zwietering, M.H.
2015-01-01
In food safety management, sampling is an important tool for verifying control. Sampling by nature is a stochastic process. However, uncertainty regarding results is made even greater by the uneven distribution of microorganisms in a batch of food. This article reviews statistical aspects of
CONCENTRATION OF SELECTED ELEMENTS IN RAW AND ULTRA HEAT TREATED COW MILK
Directory of Open Access Journals (Sweden)
Lukáčová Anetta
2012-10-01
Full Text Available The potential presence of toxic metals in food is being recognized as a priority by standards organizations and constitutes an analytical challenge. The toxic metal content of milk and dairy products is due to several factors: environmental conditions, the manufacturing process and the possible contamination during several steps of the manufacturing processes. The aim of this study was to evaluate samples of raw milk with fat contents 3.8% obtained at randomly from animal farms in around Nitra, western Slovakia region and ultra – heat treated cow milk (UHT with fat contents 1.5% commercially available from local market in Nitra. Samples of milk were analysed for metal contents using atomic absorption spectrophotometry (AAS. UHT milk showed higher levels of cadmium, nickel and iron. Higher levels of zinc, copper were detected in raw milk. Significant differences in the concentration of copper between raw and UHT cow milk were found.
Ropkins, Karl; Ferguson, Andrew; Beck, Angus J
2003-01-01
Hazard Analysis by Critical Control Points (HACCP) is a systematic approach to the identification, assessment, and control of hazards in the food chain. Effective HACCP requires the consideration of all chemical microbiological, and physical hazards. However, current procedures focus primarily on microbiological and physical hazards, while chemical aspects of HACCP have received relatively little attention. In this article we discuss the application of HACCP to organic chemical contaminants and the problems that are likely to be encountered in agriculture. We also present generic templates for the development of organic chemical contaminant HACCP procedures for selected raw food commodities, that is, cereal crops,raw meats, and milk.
Directory of Open Access Journals (Sweden)
T. V. Alekseeva
2015-01-01
Full Text Available Summary. This receiving the vegetable complex food system (VCFS on the basis of the cake of germs of wheat (CGW is presented. The review of composition of vegetable oils from low-olive raw materials is given, prospects of its application for creation of food systems of the balanced structure on PNZС are analyzed. It is established that the ratio of -6 и -3 of fatty acids in oil of germs of wheat doesn't correspond to recommendations of scientific research institute of food of the Russian Academy of Medical Science. For the purpose of establishment of necessary balance of -6 и -3 in food system, the blend with oils of an amaranth and pumpkin is carried out. The review of composition of vegetable oils from low-olive raw materials is given. The optimum ratio the entered oil of an amaranth and pumpkin according to recommendations of scientific research institute of food of the Russian Academy of Medical Science, by means of the developed software products written on in the Python 2.6 language and in the imperative, structured, object-oriented programming language – Delphi 7.0 is picked up. On the basis of the obtained data, the mass fraction of the components entering a compounding of vegetable food system is defined. The technological process of production of a product including the following stages is described: reception and preparation of raw materials and materials, dispensing and mixing of components, crushing and packing. Physical and chemical indicators of the received product, a chemical composition of RKPS and an organoleptic assessment of an innovative product are given. Calculation of satisfaction of daily need of an organism for feedstuffs and energy of vegetable food system is made. The composition of protein of an innovative product is analyzed: the amino-acid structure of food system, biological value, and also following indicators is counted: utility coefficient, coefficient of comparable redundancy, coefficient of
Colonna, A; Durham, C; Meunier-Goddik, L
2011-10-01
Eight hundred ninety consumers at a local food festival were surveyed about their specialty cheese purchasing behavior and asked to taste and rate, through nonforced choice preference, 1 of 4 cheese pairs (Cheddar and Gouda) made from pasteurized and raw milks. The purpose of the survey was to examine consumers' responses to information on the safety of raw milk cheeses. The associated consumer test provided information about specialty cheese consumers' preferences and purchasing behavior. Half of the consumers tested were provided with cheese pairs that were identified as being made from unpasteurized and pasteurized milk. The other half evaluated samples that were identified only with random 3-digit codes. Overall, more consumers preferred the raw milk cheeses than the pasteurized milk cheeses. A larger portion of consumers indicated preferences for the raw milk cheese when the cheeses were labeled and thus they knew which samples were made from raw milk. Most of the consumers tested considered the raw milk cheeses to be less safe or did not know if raw milk cheeses were less safe. After being informed that the raw milk cheeses were produced by a process approved by the FDA (i.e., 60-d ripening), most consumers with concerns stated that they believed raw milk cheeses to be safe. When marketing cheese made from raw milk, producers should inform consumers that raw milk cheese is produced by an FDA-approved process. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Raw milk consumption and health
Directory of Open Access Journals (Sweden)
Popović-Vranješ Anka
2015-01-01
Full Text Available Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39% outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%, bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79% outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market. [Projekat Ministarstva nauke Republike Srbije, br. TR31095
The hygienic quality of raw reindeer milk
Directory of Open Access Journals (Sweden)
Joanna Kurki
2004-04-01
Full Text Available The somatic cell count (SCC and total bacterial count (TBC as well as the presence of major food-borne pathogens and udder pathogens in reindeer raw milk were studied. Two groups of 4 female reindeer were milked on alternate days for six weeks. A milk sample from each quarter was taken before milking and of the bulk milk at the end of milking. Micrococcus sp. was observed in one, Staphylococcus aureus in one and coagulase-negative staphylococci in five of the quarter samples (n=318. In the bulk milk (n=19 TBC varied between 700 and 1 700 000 cfu (colony forming units/ml and SCC between 52 000 and 183 000 cells/ml. No Bacillus cereus, S. aureus or Listeria monocytogenes were detected in the bulk milk, but Escherichia coli and Enterobacteriaceae were found in 5 bulk milk samples. According to the bacteriological examination the udder health of the reindeer was good. Indicative information on the SCC of healthy reindeer was obtained. None of the common potential food-poisoning bacteria were found in raw milk. There was great variation in the bulk milk TBC and the average TBC was rather high (ca. 300 000 cfu/ml. The hygienic quality of raw reindeer milk makes it well suited for food manufacture. However, the results indicate that the milking conditions may be crucial for the quality of raw milk.Abstract in Finnish / Yhteenveto:Tutkimuksen kohteena oli poron raakamaidon solupitoisuus ja kokonaispesäkeluku sekä tärkeimpien elintarvike- ja utarepatogeenien esiintyminen raakamaidossa. Kaksi 4 vaatimen ryhmää lypsettiin vuoropäivinä 6 viikon ajan. Ennen lypsyä vaatimista otettiin vedinkohtaiset näytteet ja lypsyn päätyttyä näyte yhteismaidosta. Micrococcus sp. todettiin yhdessä, Staphylococcus aureus yhdessä ja koagulaasinegatiivisia stafylokokkeja viidessä vedinkohtaisessa näytteessä (n=318. Yhteismaitonäytteiden (n=19 kokonaispesäkeluvut vaihtelivat välillä 700-1 700 000 pmy (pesäkkeitä muodostava yksikkö/ml ja somaattisten
Polyphenols in Raw and Cooked Cereals/Pseudocereals/Legume Pasta and Couscous.
Carcea, Marina; Narducci, Valentina; Turfani, Valeria; Giannini, Vittoria
2017-09-11
Pasta and couscous are popular foods manufactured (in their traditional form) from durum wheat semolina. In recent years, the consumers' quest for novel, functional, gluten-free, wholegrain foods has prompted the industry to manufacture new pasta and couscous products in which durum wheat has been partially or totally replaced by other vegetable flours. Besides dietary fibre, these raw materials might be an interesting source of phytochemicals. In this work, 16 commercial samples of pasta and four samples of couscous representative of the new products and made of refined and wholegrain flours of different species of cereals, pseudocereals and legumes were analysed for free, hydrolysable bound and total polyphenol content by means of the Folin-Ciocalteu procedure. Analyses were repeated on cooked samples to assess the quantity of polyphenols ingested by the consumers. The raw legume and pseudocereal products had a total polyphenol content higher than most cereal products (up to 1743.4 mg of Gallic Acid Equivalent (GAE) per 100 g dry weight). Wholegrain products had higher contents than refined products. The free fraction underwent up to 46% loss with cooking, probably because of solubility in water. The water absorption of pasta and couscous during cooking was in a ratio of 2:3, resulting in higher dilution of polyphenols in the cooked couscous.
Directory of Open Access Journals (Sweden)
Geser Nadine
2012-03-01
Full Text Available Abstract Background The impact of food animals as a possible reservoir for extended-spectrum beta-lactamase (ESBL producing Enterobacteriaceae, and the dissemination of such strains into the food production chain need to be assessed. In this study 334 fecal samples from pigs, cattle, chicken and sheep were investigated at slaughter. Additionally, 100 raw milk samples, representing bulk tank milk of 100 different dairy farms, 104 minced meat (pork and beef samples and 67 E. coli isolates from cattle E. coli mastitis were analyzed. Results As many as 15.3% of the porcine, 13.7% of the bovine, 8.6% of the sheep and 63.4% of the chicken fecal samples yielded ESBL producers after an enrichment step. In contrast, none of the minced meat, none of the bulk tank milk samples and only one of the mastitis milk samples contained ESBL producing strains. Of the total of 91 isolates, 89 were E. coli, one was Citrobacter youngae and one was Enterobacter cloacae. PCR analysis revealed that 78 isolates (85.7% produced CTX-M group 1 ESBLs while six isolates (6.6% produced CTX-M group 9 enzymes. Five detected ESBLs (5.5% belonged to the SHV group and 2 isolates (2.2% contained a TEM-type enzyme. A total of 27 CTX-M producers were additionally PCR-positive for TEM-beta-lactamase. The ESBL-encoding genes of 53 isolates were sequenced of which 34 produced CTX-M-1, 6 produced CTX-M-14, 5 produced CTX-M-15 and also 5 produced SHV-12. Two isolates produced TEM-52 and one isolate expressed a novel CTX-M group 1 ESBL, CTX-M-117. One isolate--aside from a CTX-M ESBL-- contained an additional novel TEM-type broad-spectrum beta-lactamase, TEM-186. Conclusions The relatively high rates of ESBL producers in food animals and the high genetic diversity among these isolates are worrisome and indicate an established reservoir in farm animals.
Directory of Open Access Journals (Sweden)
A. N. Ostrikov
2015-01-01
Full Text Available Consumer properties of food raw material formed during the heat treatment. New physical, flavoring and aromatic properties of the products of plant origin, formed during drying due to substantial changes in the composition of the raw materia l occurring as a result of biochemical reactions. In the production of dried and roasted products is very important to follow the parameters that contribute to the passage of biochemical processes aimed at creating a product with high nutritional qualities, strong aroma and pleasant taste. We studied the basic kinetics of the drying process of food raw material (in terms of artichoke in a dense interspersed layer, which formed the basis for the rational choice of the drying regime with due consideration of changes in the moisture content of the product are studied. The nature of the effect of the dried product movement hydrodynamic conditions on a layer height and intensity of drying is established. As a result of food raw material drying process kinetics analysis (in terms of artichoke multistep drying regimes were chosen. Analysis of the artichoke particles drying by air, air-steam mixture and superheated steam intensity showed the presence of two parts: the horizontal one and gradually diminishing one. Kinetic laws of the artichoke drying process in a dense interspersed layer were the basis of engineering calculation of dryer with a transporting body in the form of a "traveling wave". Application of the dryer with the transporting body in the form of a "traveling wave" for food raw material drying allow to achieve uniform drying of the product due to the use of soft, gentle regimes of oversleeping while preserving to the utmost particles of the product; to improve the quality of the finished product through the use of interspersed layer that reduces clumping of product to be dried.
He, Qin; Xu, Xi-Hui; Zhang, Fan; Tai, Yu-Kai; Luo, Yan-Fei; He, Jian; Hong, Qing; Jiang, Jian-Dong; Yan, Xin
2017-06-01
To reduce the fermentation cost for industrialization of chlorothalonil hydrolytic dehalogenase (Chd), agro-industrial wastewaters including molasses, corn steep liquor (CSL) and fermentation wastewater were used to substitute for expensive carbon and nitrogen sources and fresh water for lab preparation. The results showed that molasses and CSL could replace 5% carbon source and 100% organic nitrogen source respectively to maintain the same fermentation level. Re-fermentation from raffinate of ultra-filtered fermentation wastewater could achieve 61.03% of initial Chd activity and reach 96.39% activity when cultured in a mixture of raffinate and 50% of original medium constituent. Typical raw foods were chosen to evaluate the chlorothalonil removal ability of Chd. After Chd treatment for 2 h at room temperature, 97.40 and 75.55% of 30 mg kg -1 chlorothalonil on cherry tomato and strawberry respectively and 60.29% of 50 mg kg -1 chlorothalonil on Chinese cabbage were removed. Furthermore, the residual activity of the enzyme remained at 78-82% after treatment, suggesting its potential for reuse. This study proved the cost-feasibility of large-scale production of Chd from agro-industrial wastewater and demonstrated the potential of Chd in raw food cleaning. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z
2013-07-01
The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.
21 CFR 161.175 - Frozen raw breaded shrimp.
2010-04-01
... additives as defined in section 201(s) of the Federal Food, Drug, and Cosmetic Act; or if they are food... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen raw breaded shrimp. 161.175 Section 161.175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD...
Investigation of Listeria, Salmonella, and toxigenic Escherichia coli in various pet foods.
Nemser, Sarah M; Doran, Tara; Grabenstein, Michael; McConnell, Terri; McGrath, Timothy; Pamboukian, Ruiqing; Smith, Angele C; Achen, Maya; Danzeisen, Gregory; Kim, Sun; Liu, Yong; Robeson, Sharon; Rosario, Grisel; McWilliams Wilson, Karen; Reimschuessel, Renate
2014-09-01
The Veterinary Laboratory Investigation and Response Network (Vet-LIRN), in collaboration with the Food Emergency Response Network (FERN) and its Microbiology Cooperative Agreement Program (MCAP) laboratories, conducted a study to evaluate the prevalence of selected microbial organisms in various types of pet foods. The goal of this blinded study was to help the Center for Veterinary Medicine prioritize potential future pet food-testing efforts. The study also increased the FERN laboratories' screening capabilities for foodborne pathogens in animal feed matrices, since such pathogens may also be a significant health risk to consumers who come into contact with pet foods. Six U.S. Food and Drug Administration FERN MCAP laboratories analyzed approximately 1056 samples over 2 years. Laboratories tested for Salmonella, Listeria, Escherichia coli O157:H7 enterohemorrhagic E. coli, and Shiga toxin-producing strains of E. coli (STEC). Dry and semimoist dog and cat foods purchased from local stores were tested during Phase 1. Raw dog and cat foods, exotic animal feed, and jerky-type treats purchased through the Internet were tested in Phase 2. Of the 480 dry and semimoist samples, only 2 tested positive: 1 for Salmonella and 1 for Listeria greyii. However, of the 576 samples analyzed during Phase 2, 66 samples were positive for Listeria (32 of those were Listeria monocytogenes) and 15 samples positive for Salmonella. These pathogens were isolated from raw foods and jerky-type treats, not the exotic animal dry feeds. This study showed that raw pet foods may harbor food safety pathogens, such as Listeria monocytogenes and Salmonella. Consumers should handle these products carefully, being mindful of the potential risks to human and animal health.
Gelbícová, T; Karpísková, R
2012-04-01
Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.
Parsing and Quantification of Raw Orbitrap Mass Spectrometer Data Using RawQuant.
Kovalchik, Kevin A; Moggridge, Sophie; Chen, David D Y; Morin, Gregg B; Hughes, Christopher S
2018-06-01
Effective analysis of protein samples by mass spectrometry (MS) requires careful selection and optimization of a range of experimental parameters. As the output from the primary detection device, the "raw" MS data file can be used to gauge the success of a given sample analysis. However, the closed-source nature of the standard raw MS file can complicate effective parsing of the data contained within. To ease and increase the range of analyses possible, the RawQuant tool was developed to enable parsing of raw MS files derived from Thermo Orbitrap instruments to yield meta and scan data in an openly readable text format. RawQuant can be commanded to export user-friendly files containing MS 1 , MS 2 , and MS 3 metadata as well as matrices of quantification values based on isobaric tagging approaches. In this study, the utility of RawQuant is demonstrated in several scenarios: (1) reanalysis of shotgun proteomics data for the identification of the human proteome, (2) reanalysis of experiments utilizing isobaric tagging for whole-proteome quantification, and (3) analysis of a novel bacterial proteome and synthetic peptide mixture for assessing quantification accuracy when using isobaric tags. Together, these analyses successfully demonstrate RawQuant for the efficient parsing and quantification of data from raw Thermo Orbitrap MS files acquired in a range of common proteomics experiments. In addition, the individual analyses using RawQuant highlights parametric considerations in the different experimental sets and suggests targetable areas to improve depth of coverage in identification-focused studies and quantification accuracy when using isobaric tags.
Interlenghi, Gabriela S; Reichenheim, Michael E; Segall-Corrêa, Ana M; Pérez-Escamilla, Rafael; Moraes, Claudia L; Salles-Costa, Rosana
2017-07-01
Background: This is the second part of a model-based approach to examine the suitability of the current cutoffs applied to the raw score of the Brazilian Household Food Insecurity Measurement Scale [Escala Brasileira de Insegurança Alimentar (EBIA)]. The approach allows identification of homogeneous groups who correspond to severity levels of food insecurity (FI) and, by extension, discriminant cutoffs able to accurately distinguish these groups. Objective: This study aims to examine whether the model-based approach for identifying optimal cutoffs first implemented in a local sample is replicated in a countrywide representative sample. Methods: Data were derived from the Brazilian National Household Sample Survey of 2013 ( n = 116,543 households). Latent class factor analysis (LCFA) models from 2 to 5 classes were applied to the scale's items to identify the number of underlying FI latent classes. Next, identification of optimal cutoffs on the overall raw score was ascertained from these identified classes. Analyses were conducted in the aggregate data and by macroregions. Finally, model-based classifications (latent classes and groupings identified thereafter) were contrasted to the traditionally used classification. Results: LCFA identified 4 homogeneous groups with a very high degree of class separation (entropy = 0.934-0.975). The following cutoffs were identified in the aggregate data: between 1 and 2 (1/2), 5 and 6 (5/6), and 10 and 11 (10/11) in households with children and/or adolescents category emerged consistently in all analyses. Conclusions: Nationwide findings corroborate previous local evidence that households with an overall score of 1 are more akin to those scoring negative on all items. These results may contribute to guide experts' and policymakers' decisions on the most appropriate EBIA cutoffs. © 2017 American Society for Nutrition.
Kunyanga, Catherine N; Imungi, Jasper K; Okoth, Michael W; Biesalski, Hans K; Vadivel, Vellingiri
2011-08-01
The present study evaluated the flavonoid content, antioxidant as well as type II diabetes-related enzyme inhibition activities of ethanolic extract of certain raw and traditionally processed indigenous food ingredients including cereals, legumes, oil seeds, tubers, vegetables and leafy vegetables, which are commonly consumed by vulnerable groups in Kenya. The vegetables exhibited higher flavonoid content (50-703 mg/100 g) when compared with the grains (47-343 mg/100 g). The ethanolic extract of presently studied food ingredients revealed 33-93% DPPH radical scavenging capacity, 486-6,389 mmol Fe(II)/g reducing power, 19-43% α-amylase inhibition activity and 14-68% α-glucosidase inhibition activity. Among the different food-stuffs, the drumstick and amaranth leaves exhibited significantly higher flavonoid content with excellent functional properties. Roasting of grains and cooking of vegetables were found to be suitable processing methods in preserving the functional properties. Hence, such viable processing techniques for respective food samples will be considered in the formulation of functional supplementary foods for vulnerable groups in Kenya.
Martin, N H; Ranieri, M L; Murphy, S C; Ralyea, R D; Wiedmann, M; Boor, K J
2011-03-01
Analytical tools that accurately predict the performance of raw milk following its manufacture into commercial food products are of economic interest to the dairy industry. To evaluate the ability of currently applied raw milk microbiological tests to predict the quality of commercially pasteurized fluid milk products, samples of raw milk and 2% fat pasteurized milk were obtained from 4 New York State fluid milk processors for a 1-yr period. Raw milk samples were examined using a variety of tests commonly applied to raw milk, including somatic cell count, standard plate count, psychrotrophic bacteria count, ropy milk test, coliform count, preliminary incubation count, laboratory pasteurization count, and spore pasteurization count. Differential and selective media were used to identify groups of bacteria present in raw milk. Pasteurized milk samples were held at 6°C for 21 d and evaluated for standard plate count, coliform count, and sensory quality throughout shelf-life. Bacterial isolates from select raw and pasteurized milk tests were identified using 16S ribosomal DNA sequencing. Linear regression analysis of raw milk test results versus results reflecting pasteurized milk quality consistently showed low R(2) values (tests and results from tests used to evaluate pasteurized milk quality. Our findings suggest the need for new raw milk tests that measure the specific biological barriers that limit shelf-life and quality of fluid milk products. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Neutron activation analysis for antimetabolites. [in food samples
1973-01-01
Determination of metal ion contaminants in food samples is studied. A weighed quantity of each sample was digested in a concentrated mixture of nitric, hydrochloric and perchloric acids to affect complete solution of the food products. The samples were diluted with water and the pH adjusted according to the specific analysis performed. The samples were analyzed by neutron activation analysis, polarography, and atomic absorption spectrophotometry. The solid food samples were also analyzed by neutron activation analysis for increased sensitivity and lower levels of detectability. The results are presented in tabular form.
Factors affecting adherence to a raw vegan diet
Link, Lilli B.; Jacobson, Judith S.
2007-01-01
The purpose of this study was to evaluate adherence and identify predictors of adherence to a raw vegan diet (i.e., uncooked plant foods) following a stay at a raw vegan institute. In this cohort study of guests at a raw vegan institute, subjects completed written questionnaires upon arrival and 12 weeks later. Of 107 eligible guests, 84 participated. Mean age was 54 years, 23 were male, and 73 white. Fifty-one completed the 12-week follow-up. Eight (16%) reported their diet to be ≥80% raw ve...
Kunyanga, Catherine Nkirote; Imungi, Jasper Kathenya; Okoth, Michael; Momanyi, Clare; Biesalski, Han Konrad; Vadivel, Vellingiri
2011-05-01
Recently, tannins have received considerable attention as health-promoting component in various plant foods and several studies have reported on its nutraceutical properties. However, no study has established the role of condensed tannins in indigenous foods of Kenya. Therefore, this study was designed to evaluate the antioxidant activity (DPPH and FRAP) and antidiabetic effects (α-amylase and α-glucosidase inhibition activities) of condensed tannins in some selected raw and traditionally processed indigenous cereals, legumes, oil seeds, and vegetables. The condensed tannin content of the grains and vegetables ranged between 2.55 and 4.35 g/100 g DM and 1.53 and 5.73 g/100 g DM, respectively. The scavenging effect of acetonic extract on DPPH radical ranged from 77% to 90% while the reducing power was found to be 31 to 574 mmol Fe(II)/g DM in all the investigated food ingredients. The condensed tannin extracts of the analyzed samples showed promising antidiabetic effects with potential α-amylase and α-glucosidase inhibition activities of 23% to 44% and 58% to 88%, respectively. Condensed tannins extracted from the amaranth grain, finger millet, field bean, sunflower seeds, drumstick, and amaranth leaves exerted significantly higher antioxidant and antidiabetic activities than other food ingredients. Among the traditional processing methods, roasting of grains and cooking of vegetables were found to be more suitable mild treatments for preserving the tannin compound and its functional properties as opposed to soaking + cooking and blanching treatments. The identified elite sources of optimally processed indigenous food ingredients with promising results could be used as health-promoting ingredients through formulation of therapeutic diets. © 2011 Institute of Food Technologists®
Directory of Open Access Journals (Sweden)
F Tajbakhsh
2014-05-01
Full Text Available Salmonella typhimurium and S. enteritidisare known as the major causes of food-borne infection throughout the world. The present study was carried out to investigate the prevalence of S. typhimurium in raw milks of Chahamaha Va Bakhteyari province. For this reason, a total of 550 raw milks (consisting of 200 cow, 175 sheep and 175 goat milk samples were collected through October 2011 to March 2012 from dairy herds around Shahrekord. The samples were cultured and the isolated colonies were confirmed by PCR using species-specific ST11 and ST15 primers. According to the results, a total of 20 samples (3.63% were found positive for Salmonellaspp.Amongst, 14 (2.54% of cow milk, 2 (0.36% of sheep milk and 4 (0.72% of goat milk samples were contaminated. Using PCR, 9 (1.63% samples were contaminated with S. typhimurium. The results indicated a relatively high occurrence of S. typhimurium in raw milks. Therefore, it is essential to maintain hygienic measures during milking and handling. Besides, it is recommended not to use raw milk for the manufacturing of dairy products such as cheese and ice-cream.
Li, Rong; He, Chunmei; Yang, Luqi; Wang, Yong; Zhang, Pengjie; Gao, Yongqing
2017-08-08
A method for the determination of 11 mycotoxins in baked foods and raw materials by ultra-high performance liquid chromatography-quadrupole/electrostatic field orbitrap high-resolution mass spectrometry (UPLC-HRMS) is reported in this paper. The samples were extracted with 20 mL 90% (v/v) acetonitrile aqueous solution containing 1% (v/v) formic acid, and the extracts were salted out by 2.0 g MgSO 4 and 0.5 g NaCl, cleaned up by 300 mg C18. The analytes were carried out on a CORTECS C18 column (100 mm×2.1 mm, 1.6 μ m) by gradient elution with 2 mmol/L ammonium acetate with 0.1% (v/v) formic acid aqueous solution and 2 mmol/L ammonium acetate methanol with 0.1% (v/v) formic acid. The results showed that the 11 mycotoxins had good linear relationships in their respective mass concentration ranges. The correlation coefficients were not less than 0.9960 and the limits of quantitation (LOQs) were from 0.15 to 20.00 μ g/kg. The recoveries of the 11 mycotoxins in bread ranged from 64.38% to 122.61% with the relative standard deviations (RSDs) from 1.52% to 12.99% at three spiked levels ( n =6). The method is demonstrated to be simple, fast, highly sensitive, reliable and it is effective to detect common mycotoxins in baked foods and raw materials.
Directory of Open Access Journals (Sweden)
Bhoomika
2016-09-01
Full Text Available Aim: To assess the prevalence of antimicrobial resistance producing extended-spectrum β-lactamases (ESBL (blaTEM, blaSHV, and blaCTX-M genes in Escherichia coli isolated from chicken meat, chevon meat, raw milk, and human urine and stool samples collected from tribal districts of Chhattisgarh, viz., Jagdalpur, Dantewada, Kondagaon, and Kanker. Materials and Methods: A total of 330 samples, comprising 98 chicken meat, 82 chevon meat, 90 raw milk, and 60 human urine and stool samples, were processed for isolation of E. coli. Isolates were confirmed biochemically and further tested against commonly used antibiotics to know their resistant pattern. The resistant isolates were tested for ESBL production by phenotypic method followed by characterization with molecular method using multiplex-polymerase chain reaction technique. Results: Overall 57.87% (191/330 samples were found positive for E. coli, which include 66.32% (65/98 chicken meat, 46.34% (38/82 chevon meat, 81.11% (73/90 raw milk, and 25% (15/60 human urine and stool samples. Isolates showed the highest resistance against cefotaxime (41.36% followed by oxytetracycline (34.03%, ampicillin (29.31%, cephalexin (24.60%, cefixime (16.75%, and ceftazidime (13.08%. Phenotypic method detected 10.99% (21/191 isolates as presumptive ESBL producers, however, molecular method detected 3.66% (7/191, 2.09% (4/191, and 0.00% (0/191 prevalence of blaTEM, blaCTX-M, and blaSHV, respectively. Conclusion: The present study indicates a high prevalence of E. coli in raw chicken meat, chevon meat, and milk due to poor hygienic practices. The antibiotic susceptibility test detected the presence of the resistance pattern against ESBL in E. coli isolated from raw chicken meat, chevon meat, milk, and also in human clinical samples is of great concern. The appearance of E. coli in the human food chain is alarming and requires adaptation of hygienic practices and stipulate use of antibiotics.
Detection by PCR of pathogenic protozoa in raw and drinkable water samples in Colombia.
Triviño-Valencia, Jessica; Lora, Fabiana; Zuluaga, Juan David; Gomez-Marin, Jorge E
2016-05-01
We evaluated the presence of DNA of Giardia, Toxoplasma, and Cryptosporidium by PCR, and of Giardia and Cryptosporidium genera by immunofluorescence antibody test (IFAT), in water samples, before, during, and after plant treatment for drinkable water. We applied this method in 38 samples of 10 l of water taken from each of the water treatment steps and in 8 samples taken at home (only for Toxoplasma PCR) in Quindio region in Colombia. There were 8 positive samples for Cryptosporidium parvum (21 %), 4 for Cryptosporidium hominis (10.5 %), 27 for Toxoplasma gondii (58.6 %), 2 for Giardia duodenalis assemblage A (5.2 %), and 5 for G. duodenalis assemblage B (13.1 %). By IFAT, 23 % were positive for Giardia and 21 % for Cryptosporidium. An almost perfect agreement was found between IFAT and combined results of PCR, by Kappa composite proportion analysis. PCR positive samples were significantly more frequent in untreated raw water for C. parvum (p = 0.02). High mean of fecal coliforms, high pH values, and low mean of chlorine residuals were strongly correlated with PCR positivity for G. duodenalis assemblage B. High pH value was correlated with PCR positivity for C. parvum. Phylogenetic analysis of DNA sequences was possible, showing water and human clinical sequences for Toxoplasma within the same phylogenetic group for B1 repeated sequence. PCR assay is complementary to IFAT assay for monitoring of protozoa in raw and drinkable water, enabling species identification and to look for phylogenetic analysis in protozoa from human and environmental sources.
Sample preparation and EFTEM of Meat Samples for Nanoparticle Analysis in Food
International Nuclear Information System (INIS)
Lari, L; Dudkiewicz, A
2014-01-01
Nanoparticles are used in industry for personal care products and the preparation of food. In the latter application, their functions include the prevention of microbes' growth, increase of the foods nutritional value and sensory quality. EU regulations require a risk assessment of the nanoparticles used in foods and food contact materials before the products can reach the market. However, availability of validated analytical methodologies for detection and characterisation of the nanoparticles in food hampers appropriate risk assessment. As part of a research on the evaluation of the methods for screening and quantification of Ag nanoparticles in meat we have tested a new TEM sample preparation alternative to resin embedding and cryo-sectioning. Energy filtered TEM analysis was applied to evaluate thickness and the uniformity of thin meat layers acquired at increasing input of the sample demonstrating that the protocols used ensured good stability under the electron beam, reliable sample concentration and reproducibility
Sample preparation and EFTEM of Meat Samples for Nanoparticle Analysis in Food
Lari, L.; Dudkiewicz, A.
2014-06-01
Nanoparticles are used in industry for personal care products and the preparation of food. In the latter application, their functions include the prevention of microbes' growth, increase of the foods nutritional value and sensory quality. EU regulations require a risk assessment of the nanoparticles used in foods and food contact materials before the products can reach the market. However, availability of validated analytical methodologies for detection and characterisation of the nanoparticles in food hampers appropriate risk assessment. As part of a research on the evaluation of the methods for screening and quantification of Ag nanoparticles in meat we have tested a new TEM sample preparation alternative to resin embedding and cryo-sectioning. Energy filtered TEM analysis was applied to evaluate thickness and the uniformity of thin meat layers acquired at increasing input of the sample demonstrating that the protocols used ensured good stability under the electron beam, reliable sample concentration and reproducibility.
Directory of Open Access Journals (Sweden)
Pınar Şanlıbaba
2018-02-01
Full Text Available The objective of this study was to determine the prevalence of Listeria species, specifically Listeria monocytogenes, in raw milk, pasteurized milk, white cheese, and homemade cheese. A total of 200 food samples were collected and analyzed to examine the presence of Listeria spp. The EN ISO 11290-1 method was used for isolation of Listeria. API Listeria test kit was used for biochemically characterization. Listeria spp. were isolated in 25 of the 200 samples (12.5%. The largest number of Listeria spp. was detected in homemade cheese (24%, followed by raw milk (18%, and white cheese (8%. Listeria spp. were not isolated from the pasteurized milk. The most common species isolated were Listeria innocua (5.5%; the remaining Listeria isolates were Listeria ivanovi (3.5%, Listeria welshimeri (3%, and Listeria monocytogenes (0.5%. Listeria monocytogenes was detected in only raw milk.
Nutrients and antinutrients composition of raw, cooked and sun ...
African Journals Online (AJOL)
Nutrients and antinutrients composition of raw, cooked and sun-dried sweet potato leaves. ... African Journal of Food, Agriculture, Nutrition and Development ... This study aimed to determine nutrient (iron, calcium, vitamin A and ascorbic acid) and anti-nutrient (oxalates and polyphenols) contents in raw, cooked and dried ...
Microbiological quality of retail cheeses made from raw, thermized or pasteurized milk in the UK.
Little, C L; Rhoades, J R; Sagoo, S K; Harris, J; Greenwood, M; Mithani, V; Grant, K; McLauchlin, J
2008-04-01
Two studies of retail fresh, ripened and semi-hard cheeses made from raw, thermized or pasteurized milk were undertaken in the UK during 2004 and 2005 to determine the microbiological quality of these products. Using microbiological criteria in European Commission Recommendations 2004/24/EC and 2005/175/EC, 2% of both raw, thermized (37/1819 samples) and pasteurized (51/2618 samples) milk cheeses were of unsatisfactory quality. Raw or thermized milk cheeses were of unsatisfactory quality due to levels of Staphylococcus aureus at 10(4)cfu g(-1), Escherichia coli at 10(5)cfu g(-1), and/or Listeria monocytogenes at 10(2)cfu g(-1), whereas pasteurized milk cheeses were of unsatisfactory quality due to S. aureus at 10(3)cfu g(-1) and/or E. coli at 10(3)cfu g(-1). Salmonella was not detected in any samples. Cheeses were of unsatisfactory quality more frequently when sampled from premises rated as having little or no confidence in management and control systems, and stored/displayed at above 8 degrees C. Raw or thermized milk cheeses were also more likely to be of unsatisfactory quality when they were unripened types, and pasteurized milk cheeses when they were: semi-hard types; from specialist cheese shops or delicatessens; cut to order. These results emphasize the need for applying and maintaining good hygiene practices throughout the food chain to prevent contamination and/or bacterial growth. Labelling of cheeses with clear information on whether the cheese was prepared from raw milk also requires improvement.
Occurrence of Staphylococcus aureus in raw milk produced in dairy farms in São Paulo state, Brazil
Directory of Open Access Journals (Sweden)
Helena Fagundes
2010-06-01
Full Text Available The objective of the present study was to evaluate the occurrence of Staphylococcus aureus in milk produced in 37 farms located in the regions of Ribeirão Preto and São Carlos, state of São Paulo, Brazil. Two-hundred and eight samples of milk from individual cows showing subclinical mastitis, and 37 samples of bulk tank milk were analyzed. S. aureus strains were detected in 18 (7.3% milk samples: 14 (6.7% from samples of individual cows, and 4 (10.8% from bulk tank milk. Two individual milk samples (14.3% and two bulk milk samples contained enterotoxigenic S. aureus. PFGE analysis revealed the genetic heterogeneity of the strains isolated from raw milk, which presented to 13 S. aureus patterns. Results confirmed the potential transmission of staphylococcal food poisoning to consumers via milk of cows affected by subclinical mastitis, mainly when raw milk is ingested.
Puri, Amrita; Joelsson, Adam C; Terkhorn, Shawn P; Brown, Ashley S; Gaudioso, Zara E; Siciliano, Nicholas A
2017-09-01
Veriflow® Salmonella species (Veriflow SS) is a molecular-based assay for the presumptive detection of Salmonella spp. from environmental surfaces (stainless steel, sealed concrete, plastic, and ceramic tile), dairy (2% milk), raw meat (20% fat ground beef), chicken carcasses, and ready-to-eat (RTE) food (hot dogs). The assay utilizes a PCR detection method coupled with a rapid, visual, flow-based assay that develops in 3 min post-PCR amplification and requires only an 18 h enrichment for maximum sensitivity. The Veriflow SS system eliminates the need for sample purification, gel electrophoresis, or fluorophore-based detection of target amplification and does not require complex data analysis. This Performance Tested MethodSM validation study demonstrated the ability of the Veriflow SS method to detect low levels of artificially inoculated or naturally occurring Salmonella spp. in eight distinct environmental and food matrixes. In each reference comparison study, probability of detection analysis indicated that there was no significant difference between the Veriflow SS method and the U.S. Department of Agriculture Food Safety and Inspection Service Microbiology Laboratory Guidebook Chapter 4.06 and the U.S. Food and Drug Administration Bacteriological Analytical Manual Chapter 5 reference methods. A total of 104 Salmonella strains were detected in the inclusivity study, and 35 nonspecific organisms went undetected in the exclusivity study. The study results show that the Veriflow SS method is a sensitive, selective, and robust assay for the presumptive detection of Salmonella spp. sampled from environmental surfaces (stainless steel, sealed concrete, plastic, and ceramic tile), dairy (2% milk), raw meat (20% fat ground beef), chicken carcasses, and RTE food (hot dogs).
Current problems of raw fish material processing while manufacturing dried products
Directory of Open Access Journals (Sweden)
Yashonkov A. A.
2017-09-01
Full Text Available The substantiation for using techniques of fish raw material canning has been presented, raw fish being caught or farmed in aquaculture. The main problems in raw fish canning have been reviewed, including significant reduction in thermolabile vitamins in the ultimate product as compared with the raw material due to the thermal processing. Promising canning technique – vacuum drying – has been proposed. This technique makes possible to reduce the temperature of thermal processing down to 50…55 °С and significantly enlarge preservation of thermolabile vitamins from the raw fish. Sampling of raw materials, semi-finished products, finished products, including preparation for analysis has been conducted by standard methods. Disadvantages of this way have been found, it is low energy efficiency of the process. The way to intensify the vacuum drying of aquatic organisms has been proposed based on the method of preliminary pore-forming due to augmenting the area of moisture evaporation. The design of the pilot plant has been proposed in order to research the process of pore forming and vacuum drying. Target species for processing have been suggested. They are as follows: Azov goby (fillet for food products and Black Sea sprat for feeds. The recipes of the feed mixture for granulated floating food for trout have been developed. The results of the first series of the pilot research have been provided. The experiments have proved that preliminary pore forming immediately before vacuum drying makes possible to enlarge the surface area of moisture evaporation by 15…25 %. By processing photomicrographs of sections by means of a special software the authors have got the results demonstrating that when manufacturing dried products by pore forming and drying under pressure 10 kPa the pore take 35...38 % of the inner volume of the product and with drying under pressure 10 kPa – only 18...21 %, and when drying under the atmospheric pressure – 11...13 %.
Enzyme sensor array for the determination of biogenic amines in food samples
Energy Technology Data Exchange (ETDEWEB)
Lange, Jana [University of Greifswald, Institute for Chemistry and Biochemistry (Germany); Wittmann, Christine [Fachhochschule Neubrandenburg, Department of Technology (Germany)
2002-01-01
An enzyme sensor array for the simultaneous determination of the three biogenic amines (histamine, tyramine and putrescine) by pattern recognition using an artificial neural network and its application to different food samples is described. A combination of a monoamine oxidase, a tyramine oxidase and a diamine oxidase (with specific activities sufficient for rapid detection) are immobilised each on a separate screen-printed thick-film electrode via transglutaminase and glutaraldehyde to compare these cross-linking reagents with regard to their suitability. To calculate the amount of a specific biogenic amine, the raw data from multichannel software were transferred to a neural network. The sensor array takes 20 min to complete (excluding statistical data analysis) with only one extraction and subsequent neutralisation step required prior to sensor measurement. The lower detection limits with the enzyme sensor were 10 mg/kg for histamine and tyramine, and 5 mg/kg for putrescine with a linear range up to 200 mg/kg for histamine and tyramine and 100 mg/kg for putrescine. The application area of the enzyme sensor array was tested from fish to meat products, sauerkraut, beer, dairy products, wine and further fermented foods and compared with the data of conventional LC analyses (mean correlation coefficient: 0.854). (orig.)
Directory of Open Access Journals (Sweden)
Austin Donner
2011-01-01
Full Text Available Food production, handling, and distribution practices pose a constant threat to the quality and safety of food products. The objective of this research is to evaluate an innovative in-package ozonation process to reduce Salmonella enteritidis on raw, shell eggs. Previous research has shown that in-package ozonation eliminates contaminants from outside sources, reduces pathogens, and extends shelf life. In this study, raw, shell eggs were inoculated with Salmonella enteritidis and exposed to ozonation treatment. Microbial recoveries were then tested to determine bacterial reductions. Measurements included: relative humidity (34 percent at 5oC, surface temperatures (oC, ozone concentrations, bacterial reductions of Salmonella enteritidis, and quality assessment of eggs (Haugh Unit [HU], color, pH, and weight. After a 24-hour storage period, all treated samples indicated 3 log10 reductions on average (previous research has achieved up to 6log10. These results show effective in-package ozonation treatment reducing Salmonella enteritidis on raw, shell eggs without significant effect on measured egg quality over time. Benefits of in-package ozonation include no heating, low power requirements (less or equal to 50 Watts, short treatment time (seconds to minutes, and adaptability into existing processes. Given its ability to ensure the safety and longevity of food products, this technology has great potential for utilization in the food processing industry.
Prevalence and quantification of Vibrio parahaemolyticus in raw salad vegetables at retail level.
Tunung, Robin; Margaret, Selina; Jeyaletchumi, Ponniah; Chai, Lay C; Tuan Zainazor, Tuan C; Ghazali, Farinazleen M; Nakaguchi, Yoshitsugu; Nishibuchi, Mitsuaki; Son, Radu
2010-02-01
The purpose of this study was to investigate the biosafety of Vibrio parahaemolyticus in raw salad vegetables at wet market and supermarket in Malaysia. A combination of Most Probable Number - Polymerase Chain Reaction (MPN-PCR) method was applied to detect the presence of V. parahaemolyticus and to enumerate their density in the food samples. The study analyzed 276 samples of common vegetables eaten raw in Malaysia (Wild cosmos = 8; Japanese parsley = 21; Cabbage = 30; Lettuce = 16; Indian pennywort = 17; Carrot = 31; Sweet potato = 29; Tomato = 38; Cucumber = 28; Four winged bean = 26; Long bean = 32). The samples were purchased from two supermarkets (A and B) and two wet markets (C and D). The occurrence of V. parahaemolyticus detected was 20.65%, with higher frequency of V. parahaemolyticus in vegetables obtained from wet markets (Wet market C = 27.27%Wet Market D = 32.05%) compared to supermarkets (Supermarket A = 1.64%; Supermarket B = 16.67%). V. parahaemolyticus was most prevalent in Indian pennywort (41.18%). The density of V. parahaemolyticus in all the samples ranged from 2400 MPN/g, mostly Malaysia.
Soto-Méndez, María José; Campos, Raquel; Hernández, Liza; Orozco, Mónica; Vossenaar, Marieke; Solomons, Noel W
2011-01-01
To compare variety and diversity patterns and dietary characteristics in Guatemalan women. Two non-consecutive 24-h recalls were conducted in convenience samples of 20 rural Mayan women and 20 urban students. Diversity scores were computed using three food-group systems.Variety and diversity scores and dietary origin and characteristics were compared between settings using independent t-test or Mann-Whitney-U-test. Dietary variety and diversity were generally greater in the urban sample when compared to the rural sample, depending on the number of days and food-group system used for evaluation.The diet was predominantly plant-based and composed of non-fortified food items in both areas.The rural diet was predominantly composed of traditional,non-processed foods. The urban diet was mostly based on non-traditional and processed items. Considerations of intervention strategies for dietary improvement and health protection for the Guatemalan countryside should still rely on promotion and preservation of traditional food selection.
Product samples stimulate choice of unfamiliar healthful food products.
Schickenberg, B; van Assema, P; Brug, J; de Vries, N K
2011-08-01
The purpose of this study was to assess whether the availability of a product sample of an unfamiliar low-fat or fruit and vegetable products stimulates choice for this product among food neophobic young adults. The study had a 2 (experimental vs. control group) by 4 (low-fat bread spread, low-fat cheese, fruit juice, fruit and vegetable juice) between subjects design with a pre-and post-experiment questionnaire. The study was conducted in restaurant rooms of several educational institutions in the Netherlands among a convenience sample of 197 food neophobic young adults aged 17-25 years. A small bite or sip-sized sample of the target product was provided as an intervention. The effect measure was choice of either an unfamiliar healthful food product or a traditional food product. Offering a sample of an unfamiliar healthful food product resulted in 51% of the participants in the experimental group choosing this product vs. 36.4% in the control group. Providing food product samples seems to be a promising strategy in healthy diet promotion programs for food neophobic young adults to increase first-time trial of unfamiliar low-fat and fruit and vegetable products. Copyright © 2011 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Sim Kheng Yuen
2016-01-01
Full Text Available The aim of the study was to investigate the raw milk hygiene and quality among the small holder dairy farmers in Tawau area. A total of 216 samples were collected from the respective dairy farmers and milk collecting centre located at Mile 15, Tawau. Preliminary results indicated that the quality of the raw milks obtained at farm level contained were inferior with high bacteria load (> than 107 CFU/ml. The total coliform (2.9-3.8 CFU/mL and Staphylococcus count (2.3-3.6 CFU/mL were relatively high in certain samples. However, none of the food borne pathogens was found. Trace back study revealed that the causes of contamination were attributed by poor hygienic handling among the dairy farmers and insufficient for immediate chilling of raw milk. A significant reduction in bacteria load was observed if the raw milk chilled immediately at farm. The implementation of modified pre-milking sanitizing practices improved the microbiology quality of the raw milks obtained from respective dairy farms. Future study will focus more on the effect of prolong storage towards the microbiological quality of raw milk.
Valorisation of food waste to produce new raw materials for animal feed.
San Martin, D; Ramos, S; Zufía, J
2016-05-01
This study assesses the suitability of vegetable waste produced by food industry for use as a raw material for animal feed. It includes safety and nutritional viability, technical feasibility and environmental evaluation. Vegetable by-products were found to be nutritionally and sanitarily appropriate for use in animal feed. The drying technologies tested for making vegetable waste suitable for use in the animal feed market were pulse combustion drying, oven and microwave. The different meal prototypes obtained were found to comply with all the requirements of the animal feed market. An action plan that takes into account all the stages of the valorisation process was subsequently defined in agreement with local stakeholders. This plan was validated in a pilot-scale demonstration trial. Finally, the technical feasibility was studied and environmental improvement was performed. This project was funded by the European LIFE+ program (LIFE09 ENV/ES/000473). Copyright © 2015 Elsevier Ltd. All rights reserved.
MICROCOMPONENTS OF FOOD SYSTEMS BASED ON ANIMAL AND OTHER RAW MATERIALS. REVIEW
Directory of Open Access Journals (Sweden)
Andrew N. Ivankin
2018-01-01
Full Text Available The problems of the microcomponent composition of modern food systems based on natural raw materials are considered. It is shown that modern methods of physical and chemical analysis make it possible to establish the presence of both useful and unsafe microimpurities with a level of their content in the production from 0.001 to 1–5 mg / kg. The effect of microquantities of free amino and fatty acids, as well as carbohydrates and vitamins, on the flavor and aromatic characteristics of systems is discussed. Some aspects of the presence of introduced microcomponents, which include pesticides, antibiotic and chemotherapeutic drugs, hormonal regulators, polyaromatic hydrocarbons and some other toxicants, as well as microingredients formed in products under the influence of biochemical processes during storage are considered. As such microingredients, biogenic amines and other products of transformation of macrocomponents are considered.
Perelló, Gemma; Martí-Cid, Roser; Llobet, Juan M; Domingo, José L
2008-12-10
The effects of cooking processes commonly used by the population of Catalonia (Spain) on total arsenic (As), cadmium (Cd), mercury (Hg), and lead (Pb) concentrations in various foodstuffs were investigated. All food samples were randomly acquired in local markets, big supermarkets, and grocery stores of Reus (Catalonia). Foods included fish (sardine, hake, and tuna), meat (veal steak, loin of pork, breast and thigh of chicken, and steak and rib of lamb), string bean, potato, rice, and olive oil. For each food item, two composite samples were prepared for metal analyses, whose levels in raw and cooked (fried, grilled, roasted, and boiled) samples were determined by inductively coupled plasma-mass spectrometry (ICP-MS). The highest concentrations of As, Hg, and Pb (raw and cooked samples) were mainly found in fish, with a clear tendency, in general, to increase metal concentrations after cooking. However, in these samples, Cd levels were very close to their detection limit. In turn, the concentrations of metals in raw and cooked meat samples were detected in all samples (As) or only in a very few samples (Cd, Hg, and Pb). A similar finding corresponded to string beans, rice, and olive oil, while in potatoes, Hg could not be detected and Pb only was detected in the raw samples. In summary, the results of the present study show that, in general terms, the cooking process is only of a very limited value as a means of reducing metal concentrations. This hypothetical reduction depends upon cooking conditions (time, temperature, and medium of cooking).
"Don't Have A Cow, Man!": Recognizing Herd Share Agreements for Raw Milk.
Mayer, Timothy J
2015-01-01
Dissatisfaction with the industrial model of food production has caused many consumers to seek out food produced on local, family-scale farms that use U.S. Department of Agriculture certified organic or other sustainable practices to grow their food and raise their livestock. While almost all of the types of food that are available at the grocery store can also be found at the local farmers market, one food that is difficult to find in many states is raw milk—that is, milk that has not undergone pasteurization (heat treatment). This difficulty lies in the fact that most states prohibit the direct retail sale of raw milk to the final consumer because public health officials and state legislators fear that raw milk may contain bacteria harmful to human health such as E. coli, Campylobacter, and Listeria. However, some consumers reject these warnings and instead believe that raw milk possesses both nutritional and medicinal qualities. Indeed, an ever-increasing body of scientific research published in peer-reviewed journals supports the claim that raw milk consumption can mitigate or prevent some allergies and infections, especially in young children. In order for consumers to obtain raw milk in states where its sale is prohibited, some consumers have entered into arrangements with farmers known as “herd sharing,” through which the consumer effectively becomes an owner of the herd of cows or goats. For the price of the share and a monthly boarding fee, the shareholder can receive a weekly distribution of the herd’s primary dividend, namely the raw milk. Several states expressly permit this practice while most are silent and still a few prohibit it outright. The three courts in the United States that have ruled on herd share agreements have split, with two courts rejecting the agreements as a circumvention of the state’s prohibition on the sale of raw milk, and the other court assuming the agreement’s validity in light of the state’s failure to adequately
Abera, Tsegalem; Legesse, Yoseph; Mummed, Behar; Urga, Befekadu
2016-05-26
The camel is a multipurpose animal with a huge productive potential. Camel milk is a key food in arid and semi-arid areas of the African and Asian countries. The quality of milk is influenced by different bacteria present in milk. This study was conducted to evaluate total bacterial content in raw camel milk along the market chain in Fafen zone, Ethiopian Somali Regional State. One hundred twenty-six raw camel milk samples were collected from Gursum (47.1 %) and Babile (52.9 %) districts. The three sampling levels included were udder (14.7 %), milking bucket (29.4 %) and market (55.9 %). Milk samples were analyzed for total bacterial counts (TBC) and coliform counts (CC). Furthermore, major pathogens were isolated and identified. 108 (85.7 %) of raw camel milk samples demonstrated bacterial contamination. The overall mean TBC and CC of contaminated raw camel milk samples was 4.75 ± 0.17 and 4.03 ± 0.26 log CFU/ml, respectively. TBC increased from udder to market level and was higher in Gursum compared to Babile district (P < 0.05). Around 38.9 % of TBCs and 88.2 % CCs in contaminated raw camel milk samples were in the range considered unsafe for human utility. Staphylococcus spp. (89.8 %), Streptococcus spp. (53.7 %), E. coli (31.5 %), Salmonella spp. (17.6 %), Klebsiella spp. (5.6 %) and Enterobacter spp. (5.6 %) were the major bacterial microorganisms isolated. The majority of the bacterial isolates in this study showed high incidence in market as compared to production level. These results indicate a lack of compliance with good production practices and hygiene at milking, transportation and market of raw camel milk.
Directory of Open Access Journals (Sweden)
ANDRA SULER
2008-10-01
Full Text Available An important faze for food quality control is verification of microbiological parameters of food products. In this way is assuring the prevention of alimentation toxicological infections to consumer, avoiding the technological and economical losses as well as increasing the products conservation period. In this paper are presents the microbiological exam results from raw milk used in Telemea cheese technological process, for 5 stations studied. The determinations were made on 2 series with 57 samples each of them, prelevated in reception fase, in summer and winter season.
Influence of audiovisuals and food samples on consumer acceptance of food irradiation
International Nuclear Information System (INIS)
Pohlman, A.J.; Wood, O.B.; Mason, A.C.
1994-01-01
The effects of audiovisual presentation on consumers' knowledge and attitudes toward food irradiation were demonstrated. Food irradiation is a method of food preservation that can destroy the microorganisms responsible for many foodborne illnesses and food spoilage. However, the food industry has been slow to adopt this method because it is unsure of consumer acceptance. One hundred and seventy-nine consumers were given a slide-tape presentation on food irradiation. Test subjects were also presented with a sample of irradiated strawberries. It was found that participants knew more about and were more positive toward food irradiation following the educational program. These findings demonstrate the value of educational materials in influencing the food preferences of consumers
Effective sampling strategy to detect food and feed contamination
Bouzembrak, Yamine; Fels, van der Ine
2018-01-01
Sampling plans for food safety hazards are aimed to be used to determine whether a lot of food is contaminated (with microbiological or chemical hazards) or not. One of the components of sampling plans is the sampling strategy. The aim of this study was to compare the performance of three
Notes on sample preparation of food: food of plant and animal origins, and daily meals
International Nuclear Information System (INIS)
Heilgeist, M.
1992-01-01
The procedure of food sample preparation to determine their specific radioactivity, analogous to chemical residue analysis, is laid down in the relevant sets of regulations. Several procedural steps of sample preparation of single food and composite food are dealt with. The sample size necessary for gamma spectroscopy and Sr-89/Sr-90 analysis, and the incineration step to enrich radionuclides are explained. Finally, enrichment by freeze drying of the high-volatile radionuclide I-131 is considered. (orig.) [de
Food and feed safety assessment: the importance of proper sampling.
Kuiper, Harry A; Paoletti, Claudia
2015-01-01
The general principles for safety and nutritional evaluation of foods and feed and the potential health risks associated with hazardous compounds are described as developed by the Food and Agriculture Organization (FAO) and the World Health Organization (WHO) and further elaborated in the European Union-funded project Safe Foods. We underline the crucial role of sampling in foods/feed safety assessment. High quality sampling should always be applied to ensure the use of adequate and representative samples as test materials for hazard identification, toxicological and nutritional characterization of identified hazards, as well as for estimating quantitative and reliable exposure levels of foods/feed or related compounds of concern for humans and animals. The importance of representative sampling is emphasized through examples of risk analyses in different areas of foods/feed production. The Theory of Sampling (TOS) is recognized as the only framework within which to ensure accuracy and precision of all sampling steps involved in the field-to-fork continuum, which is crucial to monitor foods and feed safety. Therefore, TOS must be integrated in the well-established FAO/WHO risk assessment approach in order to guarantee a transparent and correct frame for the risk assessment and decision making process.
Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe
2015-11-30
Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.
Bellio, Alberto; Traversa, Amaranta; Adriano, Daniela; Bianchi, Daniela Manila; Colzani, Alberto; Gili, Stefano; Dondo, Alessandro; Gallina, Silvia; Grattarola, Carla; Maurella, Cristiana; Zoppi, Simona; Zuccon, Fabio; Decastelli, Lucia
2014-08-28
Campylobacteriosis was the most commonly reported zoonosis for confirmed human cases in European Union during 2011. Poultry meat was very often implicated in Campylobacter infections in humans. In Italy commerce of raw poultry meat is common in open-air markets: these areas can be considered at high risk of bacterial contamination due to the high presence birds like pigeons. The aim of this study was to collect data about the contamination by thermotolerant Campylobacter of raw poultry meat commercialised in open-air markets, of work-surfaces in contact with poultry meat and of pigeon stools sampled in the market areas in Turin, Northern Italy. Between September 2011 and December 2012, 86 raw poultry meat samples, 86 environmental swabs and 108 animal samples were collected in 38 open-air markets. Analysis were carried out according to ISO10272-1:2006 standard. C.coli was detected in 2.3% (2/86) of raw poultry meat samples, whereas no swab (0/86) resulted positive. Of pigeon stool 28% (30/107) was positive for C.jejuni (83.3% C.jejuni subsp . jejuni and 16.7% C.jejuni subsp . doylei ). C.jejuni subsp. jejuni was isolated from 1 dead pigeon . Our results showed lower rates of contamination than those reported at retail in Europe. Although samples were collected in areas at high risk of contamination, raw poultry meat and work surfaces reported a low level of presence of thermotolerant Campylobacter . The high percentage of C.jejuni isolated from pigeon stools showed the importance of a continuous application of preventive measures by the food business operators and the surveillance activity by the Competent Authority.
Directory of Open Access Journals (Sweden)
Ali Dabiri
2016-03-01
Full Text Available Background & Objective: Campylobacter can be transmitted through the raw milk. The purpose of this study was to determine the prevalence of Campylobacter genus and Campylobacter jejuni (C. jejuni species in raw milk samples. Materials & Methods: In this study, 72 samples of raw milk were collected of the platforms milk in the Amol city in summer. Phenotypic identification of Campylobacter genus and C. jejuni species using microbiology laboratory methods and molecular identification of this bacterium using Multiplex- Polymerase Chain Reaction (M-PCR were performed. The data was calculated using the SPSS 16.0 software and the Fisher's exact test (p < 0.05. Results: Among the 72 samples, 13.88% of samples were contaminated with C. jejuni and 2.77% were contaminated with Campylobacter genus. The highest prevalence rate for this bacterium was in July (20.83% and the lowest prevalence rate was in September (12.5%. The significant difference between the prevalence of the Campylobacter genus and C. jejuni species in raw milk samples in various months of summer was not observed (p = 0.07. Conclusion: This study showed the raw milk contamination with Campylobacter, and thereby the sanitation in the dairy food production places and the use of fast and accurate method to identify this bacterium is important.
Langiano, E; Atrei, P; La Torre, G; De Vito, E; Ricciardi, G
2002-01-01
The presence of bacterial food pathogens was evaluated in 154 food samples collected from supermarkets and butchers in the city of Cassino (South-Central Italy). Food pathogens were identified in 17.5% of the total food samples. In the raw meat samples, 24.6% tested positives for Listeria monocytogenes, 4.3% for Salmonella and 2.9% for Escherichia coli O157. Y. enterocolitica, only investigated in pork meat, was identified in 7.4% of the samples. In poultry, L. monocytogenes was identified in 55% of the samples.
Pesavento, G; Calonico, C; Ducci, B; Magnanini, A; Lo Nostro, A
2014-08-01
Food specimens were analyzed in order to research Enterococcus spp.: 636 samples of raw meat (227 beef, 238 poultry, and 171 pork), 278 samples of cheese (110 fresh soft cheese and 168 mozzarella cheese), 214 samples of ready-to-eat salads, and 187 samples of ham. 312 strains of Enterococcus spp samples were isolated, then identified and submitted to susceptibility tests against 11 antimicrobial agents. The predominant species were Enterococcus faecalis in raw meat and Enterococcus faecium in retail products. Low percentages of microorganisms were resistant to vancomycin (3.53%), teicoplanin (2.24%), linezolid (0.32%), and amoxicillin in combination with clavulanic acid (0.32%). A high percentage of resistance was noted in E. faecalis at high level gentamicin (21.9%) and tetracycline (60.6%). In general, strains of E. faecalis were more resistant than E. faecium. Enterococci should be considered not only potential pathogens, but also a reservoir of genes encoding antibiotic resistance which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important in order to identify foods which potentially represent a real risk to the population, and to ensure effective treatment of human enterococcal infections. Copyright © 2014 Elsevier Ltd. All rights reserved.
Monitoring radioactivity in food and actions of the Ministry in charge of food
International Nuclear Information System (INIS)
Grastilleur, Ch.
2010-01-01
French ministry of food, agriculture and fisheries (general directorate for food) is involved in all aspects of food safety and food controls As such, MAAP guarantees both the quality and safety of food products radioactivity controls in food participate to this global aim. Since 1987 and following the accident on Tchernobyl nuclear plant, regulations and monitoring-control programmes have been implemented by MAPP, mainly based on Cs 134 and 137 and Sr 90 researches in raw products such as game, milk and dairy products and honey A new monitoring and control programme has been implemented as from 2009, with the help of IRSN and thanks to the work on management during post-accidental phases initiated in 2005 by ASN. Mainly the activity of Cs is determined but also other parameters are measured such as Ca, K and l 131 activities in the samples analysed by IRSN. In 2009, 812 samples were programmed and all of them have proven to be conform. During the year 2010, 725 samples will be collected, Global exposure to radioactivity in France is estimated at 4000 μSv per year, food and water contributing to 6% (that is about 250 μSv) mainly due to K and Ca (natural radioactive components of the regime). (author)
Visual illusion in mass estimation of cut food.
Wada, Yuji; Tsuzuki, Daisuke; Kobayashi, Naoki; Hayakawa, Fumiyo; Kohyama, Kaoru
2007-07-01
We investigated the effect of the appearance of cut food on visual mass estimation. In this experiment, we manipulated the shape (e.g., a block, fine strips, or small cubes) of food samples of various masses, and presented them on a CRT display as stimuli. Eleven subjects participated in tasks to choose the picture of the food sample which they felt indicated a target mass. We used raw carrots and surimi (ground fish) gel as hard and soft samples, respectively. The results clearly confirm an existence of an illusion, and this indicates that the appearance of food interferes with visual mass estimation. Specifically, participants often overestimated the mass of finely cut food, especially fine strips, whereas they could accurately estimate the mass of block samples, regardless of the physical characteristics of the foods. The overestimation of the mass of cut food increased with the food's actual mass, and was particularly obvious with increases of apparent volume when cut into fine strips. These results suggest that the apparent volume of a food sample effects the visual estimation of its mass. Hence we can conclude that there are illusions associated with the visual presentation of food that may influence various food impressions, including satisfaction and eating behaviour.
The antimicrobial effects of chopped garlic in ground beef and raw meatball (ciğ köfte).
Aydin, Ali; Bostan, Kamil; Erkan, Mehmet Emin; Bingöl, Bariş
2007-03-01
This study was carried out to investigate the antimicrobial effects of chopped garlic in ground beef and raw meatball (çig köfte), which is a traditional food product eaten raw. Fresh minced ground beef and raw meatball batter prepared with traditional methods were separated into groups. Chopped and crushed garlic was added to each batch in order to reach various concentrations from 0% to 10%. The ground beef samples were stored at refrigerator and ambient temperatures. The raw meatball samples were only stored at room temperature. All samples were analyzed in order to determine the microbial counts at the 2(nd), 6(th), 12(th), and 24(th) hours of storage. Garlic addition decreased the microbial growth in some ground beef samples kept either at room temperature or in the refrigerator. However, microbial growth increased in some ground beef samples kept in similar conditions. The difference was found in samples kept in the refrigerator for 24 hours in terms of total aerobic mesophilic bacteria and coliform bacteria when garlic used at 10%. The effects of garlic on the microbial growth of both coliforms and Staphylococcus/Micrococcus in the samples kept at room temperature were increased. The yeast and mold counts in ground beef samples kept in any condition were not affected by garlic addition. However, the addition of garlic to the raw meatball mix decreased the microbial count, in terms of total aerobic mesophilic bacteria and yeast and mold counts, when the garlic was added at 5% or 10% (P meatball caused a permanent decrease in yeast and mold count, unlike in ground beef. The results of this study indicate that the chopped garlic has a slowing-down effect on microbiological growth in ground meat depending on the garlic concentration, but this effect was not at an expected level even at the highest concentration, because potential antimicrobial agents in chopped garlic were probably insufficiently extracted.
2010-04-01
... fruits, vegetables, and fish in the United States? 101.44 Section 101.44 Food and Drugs FOOD AND DRUG... raw fruits, vegetables, and fish in the United States? (a) The 20 most frequently consumed raw fruits..., and watermelon. (b) The 20 most frequently consumed raw vegetables are: Asparagus, bell pepper...
Antibacterial efficacy of raw and commercially available honey
African Journals Online (AJOL)
Administrator
2011-09-19
Sep 19, 2011 ... Key words: Honey, antibacterial activity, raw honey, commercially available honey, minimum inhibitory ... against pathogenic bacteria, oral bacteria as well as food .... explore the possible benefits of the use of honey among.
da Conceição, Fabiano Tomazini; Antunes, Maria Lúcia Pereira; Durrant, Steven F
2012-02-01
Radionuclides from the U and Th natural series are present in alkaline rocks, which are used as feedstock in Brazil for the production of raw phosphoric acid, which can be considered as a NORM (naturally occurring radioactive material). As a result of the purification of raw phosphoric acid to food-grade phosphoric acid, two by-products are generated, i.e., solid and liquid wastes. Taking this into account, the main aim of this study was to evaluate the fluxes of natural radionuclide in the production of food-grade phosphoric acids in Brazil, to determine the radiological impact caused by ingestion of food-grade phosphoric acid, and to evaluate the solid waste environmental hazards caused by its application in crop soils. Radiological characterization of raw phosphoric acid, food-grade phosphoric acid, solid waste, and liquid waste was performed by alpha and gamma spectrometry. The (238)U, (234)U, (226)Ra, and (232)Th activity concentrations varied depending on the source of raw phosphoric acid. Decreasing radionuclides activity concentrations in raw phosphoric acids used by the producer of the purified phosphoric acid were observed as follows: Tapira (raw phosphoric acid D) > Catalão (raw phosphoric acids B and C) > Cajati (raw phosphoric acid A). The industrial purification process produces a reduction in radionuclide activity concentrations in food-grade phosphoric acid in relation to raw phosphoric acid produced in plant D and single raw phosphoric acid used in recent years. The most common use of food-grade phosphoric acid is in cola soft drinks, with an average consumption in Brazil of 72 l per person per year. Each liter of cola soft drink contains 0.5 ml of food-grade phosphoric acid, which gives an annual average intake of 36 ml of food-grade phosphoric acid per person. Under these conditions, radionuclide intake through consumption of food-grade phosphoric acid per year per person via cola soft drinks is not hazardous to human health in Brazil
International Nuclear Information System (INIS)
Moreno, Maria Margarita Torres; Rocha, Rogers Raphael da; Zanard, Antenor
2012-01-01
We studied the raw materials used in a factory building blocks, located in Cesario Lange city (SP). It extracts raw materials from various sources in the region to make the dough. The mixtures were prepared from dry milled powders based on data related to the plasticity of the raw materials. It was obtained with the apparatus Vicat-cone in order to obtain similar levels of water absorption of the samples burned at 900 deg C for all compositions. To quantify the proportion of each clay was used the Lever Rule. In this firing temperature, where sintering is mainly by diffusion from a solid state, different compositions of the same set of four raw materials resulted in similar values. (author)
Mritunjay, Sujeet K; Kumar, Vipin
2017-01-01
Consumption of ready-to-eat fresh vegetables has increased worldwide, with a consequent increase in outbreaks caused by foodborne pathogens. In the Indian subcontinent, raw fresh vegetables are usually consumed without washing or other decontamination procedures, thereby leading to new food safety threats. In this study, the microbiological quality and pathogenic profile of raw salad vegetables was evaluated through standard protocols. In total, 480 samples (60 each of eight different salad vegetables) of cucumber, tomato, carrot, coriander, cabbage, beetroot, radish, and spinach were collected from different locations in Dhanbad, a city famous for its coal fields and often called the "Coal Capital of India." The samples were analyzed for total plate count, total coliforms, Escherichia coli , E. coli O157:H7, Listeria monocytogenes , and Salmonella spp. Incidences of pathogens were detected through quantitative PCR subsequent to isolation. Results showed that 46.7% (for total plate counts) and 30% (for total coliforms) of samples were unacceptable for consumption per the Food Safety and Standards Authority of India. Pathogenic microorganisms were detected in 3.7% of total samples. E. coli O157:H7 was detected in three samples of spinach (2) and beetroot ( 1 ); L. monocytogenes was detected in 14 samples of spinach ( 8 ), tomato ( 3 ), cucumber ( 2 ), and radish ( 1 ); and Salmonella spp. were detected in 16 samples of spinach ( 7 ), tomato ( 3 ), beetroot ( 2 ), cucumber ( 2 ), carrot ( 1 ), and radish ( 1 ). Pathogens were not detected in any of the cabbage and coriander samples.
Directory of Open Access Journals (Sweden)
K. Konell
2014-12-01
Full Text Available The aim of this study was the detection of Campylobacter sp. in raw chicken sausages using the methods ISO 10272-1 and ISO 10272-2. The overall prevalence of Campylobacter sp. in the samples tested was 16.67%, representing a serious risk to the health of consumers, particularly if measures guaranteeing proper cooking of foods and prevention of cross-contamination are not adopted. Furthermore, the majority of campylobacteriosis cases in humans are caused by consumption or improper handling of contaminated raw or undercooked poultry meat, which constitute the main vehicle of this infection.
Great apes prefer cooked food.
Wobber, Victoria; Hare, Brian; Wrangham, Richard
2008-08-01
The cooking hypothesis proposes that a diet of cooked food was responsible for diverse morphological and behavioral changes in human evolution. However, it does not predict whether a preference for cooked food evolved before or after the control of fire. This question is important because the greater the preference shown by a raw-food-eating hominid for the properties present in cooked food, the more easily cooking should have been adopted following the control of fire. Here we use great apes to model food preferences by Paleolithic hominids. We conducted preference tests with various plant and animal foods to determine whether great apes prefer food items raw or cooked. We found that several populations of captive apes tended to prefer their food cooked, though with important exceptions. These results suggest that Paleolithic hominids would likewise have spontaneously preferred cooked food to raw, exapting a pre-existing preference for high-quality, easily chewed foods onto these cooked items. The results, therefore, challenge the hypothesis that the control of fire preceded cooking by a significant period.
ANTIMICROBIAL DRUG RESISTANCE IN STRAINS OF Escherichia coli ISOLATED FROM FOOD SOURCES
Directory of Open Access Journals (Sweden)
Mohammed Uddin Rasheed
2014-07-01
Full Text Available A variety of foods and environmental sources harbor bacteria that are resistant to one or more antimicrobial drugs used in medicine and agriculture. Antibiotic resistance in Escherichia coli is of particular concern because it is the most common Gram-negative pathogen in humans. Hence this study was conducted to determine the antibiotic sensitivity pattern of E. coli isolated from different types of food items collected randomly from twelve localities of Hyderabad, India. A total of 150 samples comprising; vegetable salad, raw egg-surface, raw chicken, unpasteurized milk, and raw meat were processed microbiologically to isolate E. coli and to study their antibiotic susceptibility pattern by the Kirby-Bauer method. The highest percentages of drug resistance in isolates of E. coli were detected from raw chicken (23.3% followed by vegetable salad (20%, raw meat (13.3%, raw egg-surface (10% and unpasteurized milk (6.7%. The overall incidence of drug resistant E. coli was 14.7%. A total of six (4% Extended Spectrum β-Lactamase (ESBL producers were detected, two each from vegetable salads and raw chicken, and one each from raw egg-surface and raw meat. Multidrug resistant strains of E. coli are a matter of concern as resistance genes are easily transferable to other strains. Pathogen cycling through food is very common and might pose a potential health risk to the consumer. Therefore, in order to avoid this, good hygienic practices are necessary in the abattoirs to prevent contamination of cattle and poultry products with intestinal content as well as forbidding the use of untreated sewage in irrigating vegetables.
Silbernagel, K M; Lindberg, K G
2001-01-01
A rehydratable dry-film plating method for Staphylococcus aureus in foods, the 3M Petrifilm Rapid S. aureus Count Plate method, was compared with AOAC Official Method 975.55 (Staphylococcus aureus in Foods). Nine foods-instant nonfat dried milk, dry seasoned vegetable coating, frozen hash browns, frozen cooked chicken patty, frozen ground raw pork, shredded cheddar cheese, fresh green beans, pasta filled with beef and cheese, and egg custard-were analyzed for S. aureus by 13 collaborating laboratories. For each food tested, the collaborators received 8 blind test samples consisting of a control sample and 3 levels of inoculated test sample, each in duplicate. The mean log counts for the methods were comparable for pasta filled with beef and cheese; frozen hash browns; cooked chicken patty; egg custard; frozen ground raw pork; and instant nonfat dried milk. The repeatability and reproducibility variances of the Petrifilm Rapid S. aureus Count Plate method were similar to those of the standard method.
Factors affecting adherence to a raw vegan diet.
Link, Lilli B; Jacobson, Judith S
2008-02-01
The purpose of this study was to evaluate adherence and identify predictors of adherence to a raw vegan diet (i.e., uncooked plant foods) following a stay at a raw vegan institute. In this cohort study of guests at a raw vegan institute, subjects completed written questionnaires upon arrival and 12 weeks later. Of 107 eligible guests, 84 participated. Mean age was 54 years, 23 were male, and 73 white. Fifty-one completed the 12-week follow-up. Eight (16%) reported their diet to be 80% raw vegan at baseline and 14 (28%) at follow-up. Based on a raw vegan dietary adherence score (range 0-42) created for this study, mean adherence (SD) increased from 15.1 (5.4) to 17.0 (5.8) over 12 weeks (p=0.03). Baseline predictors of adherence included: education (beta=0.95), severity of disease (beta=0.98), and self-efficacy to adhere (beta=0.72). Future interventions that evaluate this diet should address self-efficacy, an important, potentially remediable predictor of adherence.
Factors affecting adherence to a raw vegan diet
Link, Lilli B.; Jacobson, Judith S.
2008-01-01
The purpose of this study was to evaluate adherence and identify predictors of adherence to a raw vegan diet (i.e., uncooked plant foods) following a stay at a raw vegan institute. In this cohort study of guests at a raw vegan institute, subjects completed written questionnaires upon arrival and 12 weeks later. Of 107 eligible guests, 84 participated. Mean age was 54 years, 23 were male, and 73 white. Fifty-one completed the 12-week follow-up. Eight (16%) reported their diet to be ≥80% raw vegan at baseline and 14 (28%) at follow-up. Based on a raw vegan dietary adherence score (range 0-42) created for this study, mean adherence (SD) increased from 15.1 (5.4) to 17.0 (5.8) over 12 weeks (p=0.03). Baseline predictors of adherence included: education (β=0.95), severity of disease (β=0.98), and self-efficacy to adhere (β=0.72). Future interventions that evaluate this diet should address self-efficacy, an important, potentially remediable predictor of adherence. PMID:18243943
Antibiotic resistance in bacteria Staphylococcus spp. isolated from samples of raw sheep's milk
Directory of Open Access Journals (Sweden)
Milan Vasiľ
2016-12-01
Full Text Available From samples of raw sheep's milk were determined results of bacteriological examination from two herds in region of Eastern Slovakia in three years lasting study. The occurrence of Staphylococcus spp. 41.6% (124 was determined from 298 samples. The seven species of staphylococci were on a regular basis isolated: S. epidermidis (34, S. chromogenes (26, S. aureus (16. Alternately have been recorded S. warneri (16, S. schleiferi (15, S. haemolyticus (9 and S. xylosus (8. All isolated pathogens were tested by in vitro test on Mueller-Hinton agar by disc methods on resistance to 10 types of antibiotics. Highest value of resistance was determined to Penicilin 21.0%, Neomycin 10.5% and Novobiocin 9.7%. Lower resistance was in to Oxacilin 7.2% and Amoxicilin 6.5%. Minimal resistance was founded to Cefoxitin 0.8%, Linkomycin 2.4%, Erytromycin, and Streptomycin 3.2%. Was founded total resistance (21.0% to all antibiotics in S. epidermidis (34 during the three years, S. chromogenes (26 showed resistance to 8 types of antibiotics (12.9%, S. aureus (16 to 6 antibiotics (10.5% and S. warneri (16 to 4 antibiotics (5.6%. It was confirmed that sheep's milk remains a major source of staphylococci. Bacteria in comparison with isolates from cows' raw milk, showed lower values of resistance, but were resistant to more than two antibiotics. Recorded occurrence of resistance in staphylococci may be connected with a minimum use of antibiotics in the treatment of mastitis and other diseases in sheep herds. Reported resistance to the tested antibiotics became the basis for the recommendation to use preparations to treat mastitis in sheep principally by the detection of resistance to antibiotics contained.
... foods that are not stored at the proper temperature or are not reheated to the right temperature Raw fish or oysters Raw fruits or vegetables ... proper amount of fluids. Getting enough fluids and learning what to eat will help keep you comfortable. ...
Prevalence of foodborne pathogens in food from selected African countries - A meta-analysis.
Paudyal, Narayan; Anihouvi, Victor; Hounhouigan, Joseph; Matsheka, Maitshwarelo Ignatius; Sekwati-Monang, Bonno; Amoa-Awua, Wisdom; Atter, Amy; Ackah, Nina Bernice; Mbugua, Samuel; Asagbra, Agnes; Abdelgadir, Warda; Nakavuma, Jesca; Jakobsen, Mogens; Fang, Weihuan
2017-05-16
Food safety information in the African region is insufficient and fragmented due to lack of surveillance, documentation and reporting, thereby resulting in inefficient utilization of resources, duplication of activities, and lack of synergy among the countries of the region. This paper reviews the prevalence of foodborne pathogens in seven African countries (Benin, Botswana, Ghana, Kenya, Nigeria, Sudan and Uganda) from papers in regional or international journals published between January 2000 and December 2015. One hundred and sixteen publications that dealt with food microbiology were reviewed for general analysis, while 66 papers on contamination of pathogenic bacteria were used for meta-analysis of prevalence. The food items were split into two categories: raw foods and ready-to-eat (RTE) foods (including street food and beverages) for meta-analysis. Majority of the reviewed studies (67.2%, 78/116) dealt with food of animal origin: 38.8% for meat and eggs, 17.2% for dairy products and 11.2% for aquatic products. Only 8.6% examined foods of plant origin (fruits and vegetables). The remaining 24.1% was the composite RTE food and beverages. Enterobacteriaceae, Escherichia coli, Salmonella, Staphylococcus aureus and Listeria monocytogenes were the most frequently reported organisms in those studies. Although the data were highly heterogeneous, a striking feature is high prevalence of the major pathogens in RTE foods, almost as high as in raw foods. E. coli averaged at 37.6% in raw foods and 31.6% in RTE foods. The corresponding prevalence for Salmonella was 19.9% vs 21.7%; S. aureus, 27.8% vs 25.1% and L. monocytogenes, 19.5% vs 6.7%. The average prevalence of foodborne pathogens in these countries was 34.2% (29.0-39.3%). Differences in food types as well as non-uniform protocols for sampling and identification might have contributed to high heterogeneity (I 2 >97%) although some high prevalence data could be factual with extensive varieties of raw and RTE foods
Weidemaier, Kristin; Carruthers, Erin; Curry, Adam; Kuroda, Melody; Fallows, Eric; Thomas, Joseph; Sherman, Douglas; Muldoon, Mark
2015-04-02
We describe a new approach for the real-time detection and identification of pathogens in food and environmental samples undergoing culture. Surface Enhanced Raman Scattering (SERS) nanoparticles are combined with a novel homogeneous immunoassay to allow sensitive detection of pathogens in complex samples such as stomached food without the need for wash steps or extensive sample preparation. SERS-labeled immunoassay reagents are present in the cultural enrichment vessel, and the signal is monitored real-time through the wall of the vessel while culture is ongoing. This continuous monitoring of pathogen load throughout the enrichment process enables rapid, hands-free detection of food pathogens. Furthermore, the integration of the food pathogen immunoassay directly into the enrichment vessel enables fully biocontained food safety testing, thereby significantly reducing the risk of contaminating the surrounding environment with enriched pathogens. Here, we present experimental results showing the detection of E. coli, Salmonella, or Listeria in several matrices (raw ground beef, raw ground poultry, chocolate milk, tuna salad, spinach, brie cheese, hot dogs, deli turkey, orange juice, cola, and swabs and sponges used to sample a stainless steel surface) using the SERS system and demonstrate the accuracy of the approach compared to plating results. Copyright © 2014 Elsevier B.V. All rights reserved.
Microelements and heavy metals in raw cow milk from various regions in Serbia
Directory of Open Access Journals (Sweden)
Živkov-Baloš Milica
2013-01-01
Full Text Available In this study, the investigation results of raw milk and animal feed samples from farms located around industrial areas and from rural areas in Serbia are presented. Various microelements and heavy metals (Zn, Cu, Fe, Pb and Cd were determined by atomic absorption spectrophotometry (AAS. Mean concentration of Zn, Cu, Fe and Cd in raw milk were 5.94, 0.239, 2.034 and below 0.005 mg/kg, respectively. The mean lead concentration found in milk from a farm located near industrial area was 0.242±0.166 mg/kg (mean Pb concentrations for other four investigated farms were below 0.05 mg/kg. The obtained results indicate that particular attention should be paid to control of Pb residues in food, water and environment. [Projekat Ministarstva nauke Republike Srbije, br. TR 31084
Restaurant Policies and Practices for Serving Raw Fish in Minnesota.
Hedeen, Nicole
2016-10-01
The number of restaurants serving sushi within Minnesota is continuously increasing. The practices and protocols of serving raw fish are complex and require detailed planning to ensure that food served to patrons will not cause illness. Although the popularity of sushi is increasing, there is a lack of research on food safety issues pertaining to preparation of raw fish and sushi rice. To address this gap, the Minnesota Department of Health Environmental Health Specialists Network Food program collected descriptive data on restaurant practices and policies concerning the service of raw fish and sushi rice in 40 Minnesota restaurants. At each restaurant, a specialist interviewed a restaurant manager, conducted an observation of the sushi prep areas in the restaurant kitchen, and reviewed parasite destruction letters and invoices from fish supplier(s). Over half of the restaurants (59%) were missing one or more of the parasite destruction letters from their fish supplier(s) guaranteeing that fish had been properly frozen to the time and temperature requirements in the Minnesota Food Code. A total of 42 parasite destruction letters from suppliers were observed; 10% were considered "adequate" letters. The majority of the letters were missing details pertaining to the types of fish frozen, the length of time fish were frozen, or details on what temperatures fish were held frozen or a combination of all three. Most restaurants were using time as a public health control for their sushi rice. For those restaurants using time as a public health control, 26% had a written procedure on-site, and approximately 53% were keeping track of time. Bare hand contact during sushi prep was observed in 17% of restaurants, and in more than 40% of the restaurants, at least one fish was mislabeled on the menu. Findings from this study indicate that many Minnesota restaurants are not complying with the Food Code requirements pertaining to parasite destruction for the service of raw fish or
Cassava starch in the Brazilian food industry
Directory of Open Access Journals (Sweden)
Ivo Mottin Demiate
2011-06-01
Full Text Available Cassava starch is a valued raw material for producing many kinds of modified starches for food applications. Its physicochemical properties, as well as its availability, have made it an interesting and challenging ingredient for the food industry. In the present work, food grade modified cassava starches were purchased from producers and analyzed for selected physicochemical characteristics. Samples of sour cassava starch were included, as well as one sample of native cassava starch. Results showed that almost all modified starches were resistant to syneresis, produced pastes more stable to stirred cooking, and some of them were difficult to cook. The sour cassava starches presented high acidity and resulted in clear and unstable pastes during stirred cooking, susceptible to syneresis.
21 CFR 101.42 - Nutrition labeling of raw fruit, vegetables, and fish.
2010-04-01
... fish. 101.42 Section 101.42 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... Guidelines § 101.42 Nutrition labeling of raw fruit, vegetables, and fish. (a) The Food and Drug... fruit, vegetables, and fish at the point-of-purchase. If retailers choose to provide such information...
Measurement of Radiocesium Decreasing Ratios in Some Crops after Food Processing
Energy Technology Data Exchange (ETDEWEB)
Uchida, Shigeo; Tagami, Keiko [National Institute of Radiological Sciences, Anagawa 4-9-1, Inage-ku, Chiba 263-7444 (Japan)
2014-07-01
Radiocesium concentrations in foods are of great concern after the Fukushima Daiichi nuclear power plant (FDNPP) accident to avoid receiving additional dose. Food monitoring has been carried out and, if there is any food exceeding the standard limit of 100 Bq/kg of radiocesium ({sup 134}Cs+{sup 137}Cs), the food name together with the producing district has been reported immediately by the Ministry of Health, Labor and Welfare. Every month, about 20,000 samples have been measured their radioactivities, and the most recent data of August 2013 showed that only foods from wild sometimes exceeds the standard limits. However, public people worry about the radiocesium concentrations in foods, although the value were lower than 100 Bq/kg; and thus, one of their concerns is still how to remove radiocesium from foods. Unfortunately, however, there were not so many data for crops common in Japan before the FDNPP accident. To provide more data, we've been collecting data. Samples were obtained from wild, that is, mugwort, giant butter-bur, young bamboo shoot and chestnut, collected in Chiba or Fukushima Prefectures in Japan in 2013. Mugwort and giant butter-bur samples were separated into three portions to make raw, washed and boiled (2.5 min) samples. Young bamboo shoot and chestnut samples were separated into two portions to make raw and boiled sub-samples. All samples were oven-dried at 80 deg. C and each sample was pulverized and mixed well. After transfer the sample to a plastic container, the radioactivity concentration was measured by a Ge detecting system. The results showed that radiocesium concentrations after boiling decreased by 50-60% for mugwort (n=3), 15-40% for petioles of giant butter-bur (n=3), 20-35% for young bamboo shoot (n=7), and 0-20% for chestnut (n=3). These data were compared with recently reported values collected in Japan complied by Radioactive Waste management Funding and Research Center (2013), and our data were within the range of
MICROBIOLOGY OF RAW MATERIALS USED FOR CONFECTIONARY PRODUCTION
Directory of Open Access Journals (Sweden)
Jana Petrová
2015-02-01
Full Text Available The aim of our study was to evaluate the microbiological quality of raw materials used for preparation of confectionery products. For microbiological evaluation total count of bacteria, mesophilic aerobic bacteria, coliform bacteria, yeast and microscopic filamentous fungi in samples of raw materials used in the manufacture and creams of confectionery products were detected. In addition to these groups of microorganisms the presence of pathogenic microorganisms Salmonella spp. and Staphylococcus aureus in creams was monitored. Products are assessed according to the limit values of the number of microorganisms defined in the Codex Alimentary of the Slovak Republic. For microbiological analysis of confectionery products, sampling of components of confectionary products and cream was carried out according to current health regulations and altogether 65 samples of components and creams were collected: 10 samples of raw materials sugar, 10 samples of flour, 10 samples of butter and 10 samples of eggs, 5 samples of butter yolk from cream-filled disposable bag without rum addition, 5 samples of butter yolk from cream-filled disposable bag with rum addition, 5 samples of cream-filled multiple use paid bag, 5 samples of cream-filled newly purchased paid bag, 5 samples of Venček corpus and 5 samples of the French cubes corpus. From raw material the highest TBC (2.65log CFU was in flour, but the lowest in sugar (1.35 log CFU, the highest years counts was found on flour (2.42, but lowest in butter (1.18, while wasn’t in egg. In samples of creams and corpus were increased occurrence of yeast, coliform bacteria. Salmonella spp. and Staphylococcus aureus weren’t isolated from any tested sample.
Colilert® applied to food analysis
Directory of Open Access Journals (Sweden)
Maria José Rodrigues
2014-06-01
Full Text Available Colilert® (IDEXX was originally developed for the simultaneous enumeration of coliforms and E. coli in water samples and has been used for the quality control routine of drinking, swimming pools, fresh, coastal and waste waters (Grossi et al., 2013. The Colilert® culture medium contains the indicator nutrient 4-Methylumbelliferyl-β-D-Glucuronide (MUG. MUG acts as a substrate for the E. coli enzyme β-glucuronidase, from which a fluorescent compound is produced. A positive MUG result produces fluorescence when viewed under an ultraviolet lamp. If the test fluorescence is equal to or greater than that of the control, the presence of E. coli has been confirmed (Lopez-Roldan et al., 2013. The present work aimed to apply Colilert® to the enumeration of E. coli in different foods, through the comparison of results against the reference method (ISO 16649-2, 2001 for E. coli food analysis. The study was divided in two stages. During the first stage ten different types of foods were analyzed with Colilert®, these included pastry, raw meat, ready to eat meals, yogurt, raw seabream and salmon, and cooked shrimp. From these it were approved the following: pastry with custard; raw minced pork; soup "caldo-verde"; raw vegetable salad (lettuce and carrots and solid yogurt. The approved foods presented a better insertion in the tray, the colour of the wells was lighter and the UV reading was easier. In the second stage the foods were artificially contaminated with 2 log/g of E. coli (ATCC 25922 and analyzed. Colilert® proved to be an accurate method and the counts were similar to the ones obtained with the reference method. In the present study, the Colilert® method did not reveal neither false-positive or false-negative results, however sometimes the results were difficult to read due to the presence of green fluorescence in some wells. Generally Colilert® was an easy and rapid method, but less objective and more expensive than the reference method.
Affective evaluation of food images according to stimulus and subject characteristics.
Padulo, C; Carlucci, L; Marzoli, D; Manippa, V; Tommasi, L; Saggino, A; Puglisi-Allegra, S; Brancucci, A
2018-04-17
The food-rich environment in which we live makes the regulation of food choices a very complex phenomenon determined by many factors, as well as their interactions. Much evidence suggests that the sensory perception of food can be considered as a central factor affecting individual food choices. Despite this, the approaches used to study the various food aspects usually do not distinguish between different types of food. In the present study, a large and heterogeneous sample of 1149 participants aged 7-90 years was asked to judge food images that were labelled differently (i.e. Raw versus Cooked, Natural versus Transformed and Simple versus Complex) with respect to arousal, valence, typicality and familiarity. We observed that, across food dimensions (i.e., Raw versus Cooked, Natural versus Transformed and Simple versus Complex), arousal, valence and typicality judgments were principally affected by a subjective hunger level and gender (and their interaction) and, to a lesser extent, by age. As a whole, our findings suggest that the level of transformation (which includes cooking) and the complexity of a foodstuff could at least partially affect food processing, entailing that future research should also address these features. © 2018 The British Dietetic Association Ltd.
Directory of Open Access Journals (Sweden)
Piotr Minkiewicz
2008-01-01
Full Text Available The aim of this review is to discuss the definition of food peptidomics and highlight the role of this approach in food and nutrition sciences. Similar to living organisms, food peptidome may be defined as the whole peptide pool present in a food product or raw material. This definition also covers peptides obtained during technological processes and/or storage. The area of interest of food peptidomics covers research concerning the origin of peptidome, its dynamic changes during processing and/or storage, the influence of its presence, the composition and changes in the pool of peptides on the properties of food products or raw materials as well as the methods applied in research into this group of compounds. The area of interests of food peptidomics would include biological activity, functional properties, allergenicity, sensory properties and information on the product or resource authenticity and origin as well as its history and relationships. Research methods applied in food peptidomics, with special emphasis on computational methods, are also summarized.
Determination of the concentrations of lead in raw milk in the Valley of Toluca
International Nuclear Information System (INIS)
Rosas Vilchis, E.
1991-01-01
The object of the present work, undertaken under the program of Regional and Cooperative Agreement for Nuclear Science and Technology in Latin America (ARCAL IV), was to determine the amounts of lead found in raw milk using the analytic techniques of Atomic Absorption Spectrophotometry (AAS), Inductively Coupled Plasma Atomic Emission Spectrometry (ICP-AES) and X-ray Fluorescence (FRX); so as to aid in solving problems of public health originating from elevated amounts of heavy metals in foods of animal origin. A total of thirty samples of raw milk were collected in the Valley of Toluca in Mexico, where heavy metal contaminants in the environment due to effects of rapid industrialization and urbanization, are known to have entered the food chain. The methodology, consisting in destroying organic matter in the samples by calcination, and included, in the case of AAS and ICP-AES, acid digestion. In the case of FRX, lead was extracted by ammonium 1-pyrrolidine carboditioate (APDC). The equipment to be used was calibrated and both blank and working solutions prepared in order to perform quantitative analysis. The concentrations of lead which were found in all the milk samples ranged from <0.03 to 0.31 μg/ml milk. These amounts within the maximum permissible limits, 0.5 μg/ml for all types of milk, established by the FDA. In the analysis ICP-AES gave best results as to sensitivity, precision and accuracy, followed by AAS which gave reliable results. FRX failed to detect lower limits and was, therefore, less reliable. (Author)
19 CFR 151.22 - Estimated duties on raw sugar.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Estimated duties on raw sugar. 151.22 Section 151... THE TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Sugars, Sirups, and Molasses § 151.22 Estimated duties on raw sugar. Estimated duties shall be taken on raw sugar, as defined...
Occurrence and quantification of Shiga toxin-producing Escherichia coli from food matrices
Directory of Open Access Journals (Sweden)
C. Sethulekshmi
2018-02-01
Full Text Available Aim: The objective of the study was to detect Shiga toxin-producing Escherichia coli (STEC and develop a quantitative polymerase chain reaction (qPCR assay to quantify the bacterial DNA present in different food matrices. Materials and Methods: A total of 758 samples were collected during a period from January 2015 to December 2016 from Kozhikode, Thrissur, and Alappuzha districts of Kerala. The samples consisted of raw milk (135, pasteurized milk (100, beef (132, buffalo meat (130, chevon (104, beef kheema (115, and beef sausage (42. All the samples collected were subjected to isolation and identification of STEC by conventional culture technique. Confirmation of virulence genes was carried out using PCR. For the quantification of STEC in different food matrices, a qPCR was standardized against stx1 gene of STEC by the construction of standard curve using SYBR green chemistry. Results: The overall occurrence of STEC in raw milk (n=135, beef (n=132, buffalo meat (n=130, chevon (n=104, and beef kheema (n=115 samples collected from Kozhikode, Thrissur, and Alappuzha districts of Kerala was 19.26%, 41.6%, 16.92%, 28.85%, and 41.74%, respectively. PCR revealed the presence of stx1 and stx2 genes in 88.46 and 83.64 and 30.77 and 40.00% of STEC isolates from raw milk and beef samples, respectively, while 100% of the STEC isolates from buffalo beef and beef kheema samples carried stx1 gene. Real-time qPCR assay was used to quantify the bacterial cells present in different food matrices. The standard curve was developed, and the slopes, intercept, and R2 of linear regression curves were -3.10, 34.24, and 0.99, respectively. Conclusion: The considerably high occurrence of STEC in the study confirms the importance of foods of animal origin as a vehicle of infection to humans. In the present study, on comparing the overall occurrence of STEC, the highest percentage of occurrence was reported in beef kheema samples. The study shows the need for rigid food
Martín-Fernández, Begoña; de-los-Santos-Álvarez, Noemí; Martín-Clemente, Juan Pedro; Lobo-Castañón, María Jesús; López-Ruiz, Beatriz
2016-01-01
Electrochemical genosensors have undergone an enormous development in the last decades, but only very few have achieved a quantification of target content in highly processed food samples. The detection of allergens, and particularly gluten, is challenging because legislation establishes a threshold of 20 ppm for labeling as gluten-free but most genosensors expresses the results in DNA concentration or DNA copies. This paper describes the first attempt to correlate the genosensor response and the wheat content in real samples, even in the case of highly processed food samples. A sandwich-based format, comprising a capture probe immobilized onto the screen-printed gold electrode, and a signaling probe functionalized with fluorescein isothiocyanate (FITC), both hybridizing with the target was used. The hybridization event was electrochemically monitored by adding an anti-FITC peroxidase (antiFITC-HRP) and its substrate, tetramethylbenzidine. Binary model mixtures, as a reference material, and real samples have been analyzed. DNA from food was extracted and a fragment encoding the immunodominant peptide of α2-gliadin amplified by a tailored PCR. The sensor was able to selectively detect toxic cereals for celiac patients, such as different varieties of wheat, barley, rye and oats, from non-toxic plants. As low as 0.001% (10 mg/kg) of wheat flour in an inert matrix was reliably detected, which directly compete with the current method of choice for DNA detection, the real-time PCR. A good correlation with the official immunoassay was found in highly processed food samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Brožková, Iveta; Dvořáková, Veronika; Michálková, Kateřina; Červenka, Libor; Velichová, Helena
2016-12-01
Buckwheat cookies with various ingredients for raw food vegan diet are usually prepared by soaking them in water at ambient temperature followed by drying at moderate temperature. The aim of this study was to examine the temperature effect on the microbiological quality, antioxidant properties and oxidative stability of lipids of final dried samples. The mixture of ingredients was soaked for 20 h in distilled water, and then cookies were formed and dried in air-forced oven at constant temperature in the range from 40 to 60 °C. Total viable counts, fungi, yeasts, coliform and aerobic spore-forming bacteria counts were evaluated in dried samples and were found to decrease during drying at 50 and 60 °C. Antioxidant activity was determined by DPPH and ABTS assays, and the former showed the highest value at 40 °C. Superoxide dismutase activity was also higher at 40 °C in comparison with that at 60 °C. The percentage of lipid peroxidation inhibition increased with the increase in drying temperature until 4th day of incubation. While peroxide value was significantly higher in samples dried at 40 °C, TBARS values did not show significant changes during the drying process. The results of this study suggest that drying buckwheat-based cookies at 40 °C retained their good antioxidant properties but represent a potentially serious microbial hazard.
21 CFR Appendix C to Part 101 - Nutrition Facts for Raw Fruits and Vegetables
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Nutrition Facts for Raw Fruits and Vegetables C Appendix C to Part 101 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FOOD LABELING Pt. 101, App. C Appendix C to Part 101—Nutrition Facts...
Detection of horse meat contamination in raw and heat-processed meat products.
Hsieh, Yun-Hwa P; Ofori, Jack A
2014-12-31
Europe's recent problems with the adulteration of beef products with horse meat highlight the need for a reliable method for detecting horse meat in food for human consumption. The objective of this study was therefore to develop a reliable monoclonal antibody (mAb) based enzyme-linked immunosorbent assay (ELISA) for horse meat detection. Two mAbs, H3E3 (IgG2b) and H4E7 (IgG2a), were characterized as horse-selective, and competitive ELISAs (cELISAs) employing these mAbs were developed. The cELISAs were found to be capable of detecting levels as low as 1% of horse meat in raw, cooked, and autoclaved ground beef or pork, being useful analytical tools for addressing the health, economic, and ethical concerns associated with adulterating meat products with horse meat. However, due to cross-reaction with raw poultry meat, it is recommended that samples be heated (100 °C for 15 min) prior to analysis to eliminate possible false-positive results.
Plasticizers in total diet samples, baby food and infant formulae
DEFF Research Database (Denmark)
Petersen, Jens Højslev; Breindahl, T.
2000-01-01
The plasticizers di-n-butylphthalate (DBP), butylbenzylphthalate (BBP), di-2-(ethylhexyl)phthalate (DEHP) and di-2-(ethylhexyl)adipate (DEHA) were analysed in 29 total diet samples, in 11 samples of baby food and in 11 samples of infant formulae. In all of the total diet samples the presence of one...... as in infant formulae. The calculated mean maximum intakes of the individual compounds from the total diet samples were below 10% of the restrictions proposed by the EU Scientific Committee for Food (SCF), and the spread in individual intakes was considerable. DEHP was the plasticizer determined most...
Food Applications and Regulation
Gálvez, Antonio; Abriouel, Hikmate; Omar, Nabil Ben; Lucas, Rosario
This chapter deals with food applications of bacteriocins. Regulatory issues on the different possibilities for incorporating bacteriocins as bioprotectants are discussed. Specific applications of bacteriocins or bacteriocin-producing strains are described for main food categories, including milk and dairy products, raw meats, ready-to-eat meat and poultry products, fermented meats, fish and fish products or fermented fish. The last section of the chapter deals with applications in foods and beverages derived from plant materials, such as raw vegetable foods, fruits and fruit juices, cooked food products, fermented vegetable foods and fermented beverages. Results obtained for application of bacteriocins in combination with other hurdles are also discussed for each specific case, with a special emphasis on novel food packaging and food-processing technologies, such as irradiation, pulsed electric field treatments or high hydrostatic pressure treatment.
Castillo-Ayala, A; Salas-Ubiarco, M G; Márquez-Padilla, M L; Osorio-Hernández, M D
1993-01-01
The presence of Campylobacter spp. and Salmonella was studied in 70 samples of fresh retail chicken pieces and in 40 samples of roast chicken. Total plate count was performed in every sample as well. Most of the samples of fresh chicken yielded total plate counts > 10(8)/piece (thigh), while in roast chicken these counts ranged from 10(3) to 10(5)/piece (leg and thigh). Campylobacter was isolated from 33% of fresh chicken and from no sample of roast chicken. Salmonella was isolated from 69% of fresh chicken and 2.5% of roast chicken. There was no relationship between total plate counts in fresh chicken and isolation of either Campylobacter or Salmonella. Sixty percent of the Salmonella isolates belonged to serotype S. anatum, and about 50% of the isolates of Campylobacter were identified as being C. coli. The only Salmonella-positive sample of roast chicken yielded three serotypes: S. give, S. muenster, and S. manhattan. Presence of Campylobacter and Salmonella in chicken is of concern, due to the risk of spreading from the raw food to other cooked foods. The isolation of pathogens from roast chicken indicates mishandling during processing and/or storage of the product.
Globalization determinants of raw materials markets development
Directory of Open Access Journals (Sweden)
Olga Yatsenko
2013-02-01
Full Text Available The determinants of development of raw materials markets and the peculiarities of their formation in the terms of world economy globalization have been researched. The empirical base of research is the agricultural food market as one of the most important bases in the sphere of material production and provision of food security of the country. The important social and economic mission of the agricultural sector has been highlighted, along with the export competitiveness and import dependence of agricultural food products in the international trade. The imperative norms have been substantiated and conclusions have been drawn regarding the establishment of respective conditions for the operation of globally integrated markets in Ukraine.
IMPROVING THE SYSTEM OF RAW MATERIAL SUPPLY OF THE MEAT INDUSTRY
Directory of Open Access Journals (Sweden)
A. M. Bukreev
2013-01-01
Full Text Available The article describes the characteristics of the process of improving the system raw materials supply of meat industry and presents the main factors, criteria, principles and algorithm rational distribution of the meat industry. The relevance of the research topic, in a globalized economy and Russia's accession to the WTO, caused by necessity to improve the system of raw material supply domestic enterprises and enhancing food security.
... is processed food? The Dietary Guidelines for Americans define the term "processed food" includes "any raw agricultural ... of foods , ranging from the number 1 source—breads and rolls—to eggs and omelets, which are ...
The Evaluation of Aflatoxin M1 Level in Collected Raw Milk for Pasteurized Dairy
Directory of Open Access Journals (Sweden)
Ehsan Sadeghi
2013-03-01
Full Text Available Background: Aflatoxins are fungal toxins that have carcinogenic, cellular mutations and malformation effects. Aflatoxin M1 resists pasteurization, autoclave and the other methods that make foodstuff healthy. This study aims to determine the contents of aflatoxin M1 in raw milk of milk factories in Kermanshah province.Materials and Methods: This research is carried out through the descriptive-cross sectional method. Among the raw milk received by four pasteurized milk factories in Kermanshah, coded by (A, B, C, D labels, six samples, totally 320 samples (80 samples from each factory, were taken within four seasons. The concentration of aflatoxin M1 was examined by Enzyme-Linked Immunosorbent Assay (ELISA. The mean difference was analyzed statistically through t-test using SPSS software. Results: The content of aflatoxin was higher than Codex standard (0.5 µg/l in 295 samples. The total mean was 1.21, which exceeds two times the Codex standard. The highest and lowest contents of aflatoxin M1 were observed in “Factory D” in spring and in “Factory A” in autumn, respectively. There was a significant difference between contamination of aflatoxin M1 and different seasons (p< 0.05.Conclusion: High content of aflatoxin M1 in raw milk is worrying. Measuring the content of aflatoxin M1 is essential to reduce the toxin entering the daily food of animals and the other related factors. The considerable difference of aflatoxin M1 content between Factory D and Factory A can be attributed to the amount of the local milk and the industrial milk received by the factories.
Lasekan, Ola; Muniady, Megala; Lin, Mee; Dabaj, Fatma
2018-04-24
Food flavor appreciation is one of the first signals along with food appearance and texture encountered by consumers during eating of food. Also, it is well known that flavor can strongly influence consumer's acceptability judgment. The increase in the consumption of snail meat across the world calls for the need to research into the aroma compounds responsible for the distinctive aroma notes of processed snail meat. The odorants responsible for the unique aroma notes in thermally processed giant African snail meats were evaluated by means of aroma extract dilution analysis (AEDA), gas chromatography-olfactometry (GC-O) and odor activity values (OAVs) respectively. Results revealed significant differences in the aroma profiles of the raw and thermally processed snail meats. Whilst the aroma profile of the raw snail meat was dominated with the floral-like β-ionone and β-iso-methyl ionone, sweaty/cheesy-like butanoic acid, and the mushroom-like 1-octen-3-one, the boiled and fried samples were dominated with the thermally generated odorants like 2-methylpyrazine, 2,5-dimethylpyrazine, 2-acetylthiazole and 2-acetylpyridine. Finally, results have shown that sotolon, 2-acetyl-1-pyrroline, 2-furanmethanethiol, 2-methylbutanal, 1-octen-3-one, octanal, furanone, 2-methoxyphenol, 2-acetylpyridine, 2-acetylthiazole, and 2-methylpyrazine contributed to the overall aroma of the thermally processed snail meat.
Determination of Heavy Metals in Raw Milk Produced in Tangshan City, China
Directory of Open Access Journals (Sweden)
Li Aijun
2016-01-01
Full Text Available The objective of this study was to investigate the content of heavy metals (Arsenic, Lead, Chromium and Mercury in raw milk of Tangshan. Samples were obtained directly from dairy farms in Tangshan City. A total of 55 raw milk samples were collected in 2012, a total of 150 raw milk samples and 150 in 2013 and 2014 respectively. All the samples were analyzed by ICP-MS (Inductively Coupled Plasma Mass Spectrometry method-based on China National Standard. In general, heavy metals (Arsenic, Lead, Chromium and Mercury of raw milk in Tangshan were relatively safe for people’s health because none of those heavy metals (Arsenic, Lead, Chromium and Mercury contents exceeded the Maximum Limit set by China.
Ridder, de M.; Jong, de S.; Selleslaghs, J.; Achterbosch, T.J.; Jongeneel, R.A.; Berkhout, P.; Heide, van der M.
2013-01-01
Interdependencies in the field of food, agriculture, and raw materials are growing. Global population growth, rising prosperity, and changing consumption patterns in emerging economies have increased the demand for all three. Geopolitical trends shape global markets for food, agriculture, and raw
Concentrations of radiocesium in foods imported from Russia (1996-1998)
International Nuclear Information System (INIS)
Sugiyama, Hideo; Terada, Hiroshi; Izumo, Yoshiro; Miyata, Masahiro; Watanabe, Yoshinori; Tsuchiya, Tetsu; Endo, Taigo; Yoshida, Akio; Maeda, Kenji
2000-01-01
The concentrations of radiocesium, 137 Cs and 134 Cs, were determined in foods imported from Russia between 1996 and 1998. A total of 143 samples, including cod roe (47 samples), crab (44), fish, including flatfish and halibut (18), ground fish meat (11), and shrimp (8), were collected in quarantine stations throughout Japan and measured with a high-purity Ge semiconductor detector and spectrometer. The concentrations of both 137 Cs and 134 Cs were determined in 115 of the samples, but only 137 Cs was measured in the other 28 samples. 137 Cs was detected in 24 samples, and the mean concentration was 0.06 Bq/kg in the raw samples and 36.7 Bq/kg in the dry samples. Japanese tsubugai shellfish had the highest concentration (0.50 Bq/kg) among the non-dried foods. Radiocesium was most frequently detected in cod roe (15 raw samples, 0.06 - 0.14 Bq/kg), followed by fish and shellfish, including ground fish meat (7 samples), dried bracken (1 sample), and dried kabanoanatake (a species of mushrooms) (1 sample). The radiocesium concentration in kabanoanatake was the highest in this survey. The concentrations of 134 Cs in all samples was below the limit of detection. The concentrations of radiocesium in foods imported from Russia did not change between 1996 and 1998, and they appeared to be low, the same as in food distributed in Japanese markets. The annual effective dose equivalents in adults were estimated based on the assumption that all of the imported food from Russia was consumed by Japanese people. It was assumed that the amount of intake of each food was 0.5% and that the 137 Cs dose conversion factor was 1.4 x 10 - 5 mSv/Bq. The intake of 134 Cs was assumed to be zero. The results of the estimations were an annual effective dose equivalent of 0.28 x 10-3 μSv for fish/shellfish, of 2.8 x 10-3 μSv for dried bracken, and of 11.9 x 10-3 μSv for dried kabanoanatake. These results overestimated actual intake, and these annual effective dose equivalents appeared to be
Toman, Jakub; Malir, Frantisek; Ostry, Vladimir; Kilic, Mehmet Akif; Roubal, Tomas; Grosse, Yann; Pfohl-Leszkowicz, Annie
2018-01-01
Ochratoxin A (OTA) is a natural contaminant of food including tea with multiple toxic effects, which poses a threat to human health. In terms of lifestyle, the Turkish population is a frequent visitor of tearooms, and the traditional Turkish tea preparation is one of the most popular ways of preparing tea infusion. The aim of this study was to investigate OTA transfer from raw black tea to the tea infusion prepared according to the Turkish tradition. A high-performance liquid chromatography method with a limit of quantification of 0.35 ng g -1 was used for OTA determination. The OTA amount in raw black teas from Turkey ranged from ≤0.35 ng g -1 up to 56.7 ng g -1 . An homogenised sample of black tea naturally contaminated with 55.0 ng g -1 was used to prepare infusions. The OTA transfer from the black tea to the infusion was found to be 41.5% ± 7%. These data are important for the realisation of a 'Total Diet study' (TDS). The TDS can be a complementary tool to estimate the population dietary exposure to OTA across the entire diet by analysing main foods prepared 'as consumed' (tea infusions) and not 'as purchased' (raw tea). © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Oat raw materials and bakery products - amino acid composition and celiac immunoreactivity.
Mickowska, Barbara; Litwinek, Dorota; Gambuś, Halina
2016-01-01
The aim of this study was to compare the biochemical and immunochemical properties of avenins in some special oat raw materials and additionally the possibility of using them as a raw material for the gluten-free bakery products. The compared oat raw materials were - oat flakes, commercial oat flours (including gluten-free oat flour) and residual oat flour, which is by-product of β-glucan preparation. Biochemical characteristic included amino acid compositions and SDS-PAGE profiles of extracted avenins. The immunochemical reactivity with polyclonal anti-gluten and monoclonal anti-gliadin antibodies was evaluated qualitatively and quantitatively by immunoblotting and ELISA methods. Additionally, experimental bakery products made of examined raw materials were assessed according to their suitability for the celiac patients' diet. The highest protein content was measured in the β-glucan preparation "Betaven" and gluten-free oat flour. Proteins of all materials are rich in glutamic and aspartic acid, leucine and arginine. Proportions of amino acids in avenins extracted from most of oat raw materials are similar, excluding gluten-free oat flour, which has a very low avenin content and proportions of individual amino acids are different. The SDS-PAGE protein pattern consisted of proteins with molecular weight of about 25-35 kDa. Polyclonal anti-gluten anti-body recognized all protein fractions of molecular weight higher than 20 kDa. Quantitative ELISA analysis shows that the majority of samples has a gliadin-like protein content within the range of 80-260 mg/kg, excluding gluten-free flours and corresponding bakery products. Altogether, β-glucan preparation has extremely high level of gliadin-like proteins. In the examined oat raw materials and foods the contents of immunoreactive amino acid sequences exceeded the limit of 20 mg/kg (considered as gluten-free) except for gluten-free flours (oat and the prepared mixture) and the bakery products based on gluten
da Silva, Wesley Pereira; de Oliveira, Luiz Henrique; Santos, André Luiz Dos; Ferreira, Valdir Souza; Trindade, Magno Aparecido Gonçalves
2018-06-01
A procedure based on liquid-liquid extraction (LLE) and phase separation using magnetically stirred salt-induced high-temperature liquid-liquid extraction (PS-MSSI-HT-LLE) was developed to extract and pre-concentrate ciprofloxacin (CIPRO) and enrofloxacin (ENRO) from animal food samples before electroanalysis. Firstly, simple LLE was used to extract the fluoroquinolones (FQs) from animal food samples, in which dilution was performed to reduce interference effects to below a tolerable threshold. Then, adapted PS-MSSI-HT-LLE protocols allowed re-extraction and further pre-concentration of target analytes in the diluted acid samples for simultaneous electrochemical quantification at low concentration levels. To improve the peak separation, in simultaneous detection, a baseline-corrected second-order derivative approach was processed. These approaches allowed quantification of target FQs from animal food samples spiked at levels of 0.80 to 2.00 µmol L -1 in chicken meat, with recovery values always higher than 80.5%, as well as in milk samples spiked at 4.00 µmol L -1 , with recovery values close to 70.0%. Copyright © 2018 Elsevier Ltd. All rights reserved.
O'Reilly, Ciara E.; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R.; Donaghy, John; Rowe, Michael; O'Mahony, Pat
2004-01-01
Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of ...
Nutritional and amino acid analysis of raw, partially fermented and ...
African Journals Online (AJOL)
African Journal of Food, Agriculture, Nutrition and Development ... The nutritional and amino acid analysis of raw and fermented seeds of Parkia ... between 4.27 and 8.33 % for the fully fermented and the partially fermented seeds, respectively.
Raw materials in the manufacture of biotechnology products: regulatory considerations.
Cordoba-Rodriguez, Ruth
2010-01-01
The Food and Drug Administration's Pharmaceutical cGMPs for the 21st Century initiative emphasizes science and risk-based approaches in the manufacture of drugs. These approaches are reflected in the International Conference on Harmonization (ICH) guidances ICH Q8, Q9, and Q10 and encourage a comprehensive assessment of the manufacture of a biologic, including all aspects of manufacture that have the potential to affect the finished drug product. Appropriate assessment and management of raw materials are an important part of this initiative. Ideally, a raw materials program should strive to assess and minimize the risk to product quality. With this in mind, risk-assessment concepts and control strategies will be discussed and illustrated by examples, with an emphasis on the impact of raw materials on cell substrates. Finally, the life cycle of the raw material will be considered, including its potential to affect the drug product life cycle. In this framework, the supply chain and the vendor-manufacturer relationship will be explored as important parts of an adequate raw materials control strategy.
Radiation hygienization of raw sewage sludge
International Nuclear Information System (INIS)
Shah, M.R.; Lavale, D.S.; Rawat, P.; Benny, P.G.; Sharma, A.K.; Dey, G.R.; Bhave, V.
2001-01-01
'Radiation treatment of municipal sewage sludge can achieve resource conservation and recovery objectives. The liquid sludge irradiator of Sludge Hygienization Research Irradiator at Baroda (India) was operated for generating data on treatment of raw sludge containing 3-4 % solids. The plant system was modified for irradiating raw sludge without affecting basic irradiator initially designed to treat digested sludge. Hourly samples were analysed for estimation of disinfection dose requirement. Sand separated from the sludge was used as in-situ dosimeter by making use of its thermoluminescence property. Investigations are being carried out for regrowth of Total Coliforms in the sludge samples from this irradiator. Possibility of inadequate treatment due to geometric configuration of irradiator is being checked. (author)
Know the Risks of Feeding Raw Food to Your Pets
... diet for their pets often point out that feral dogs and cats catch prey and eat it raw. “That’s true,” he adds, “but we don’t know how many of these animals get sick or die as a result of doing that. Since sick feral animals are rarely taken to a veterinarian when ...
Effects of home-made boiling of bovine raw milk on its microbiological quality
Directory of Open Access Journals (Sweden)
Giampaolo Colavita
2012-10-01
Full Text Available The consumption of raw milk in Italy is allowed only “after boiling”. The aim of this research was to bet-ter understand how the heat treatment of raw milk performed at home by consumers assures their mi-crobiological safety. 50 samples of raw milk (each sample 500 ml provided to consumers who regularly buy raw milk from self-service automatic vending machines were followed from delivery till to after do-mestic heat treatment. Heating was performed by consumers according to their habits. The 50 samples were exposed to different heat treatments of which the mildest was at 68.5 °C and the most intense was at 97.8 °C before switching off. The average of temperatures used was 89.5 °C and the mode was 93.2 °C. According to the different parameters of heat treatment observed, 35 samples of raw milk and 35 samples of heated milk were selected for microbiological and process indicator analyses. Total Microbial Count (TMC, total and fecal coliforms, Escherichia coli, Staphylococcus aureus and Bacillus cereus loads were determined. E. coli was isolated only from one sample of raw milk. No B. cereus nor S. aure-us were found in all samples. After heat treatment, 4 samples showed a residual TMC ranging between 1,7 CFU/ml and 3,2 CFU/ml, whilst the count of total and fecal coliforms were irrelevant. The test for alkaline phosphatase has showed negative in all samples of heated milk, while the test of lactoperoxi-dase was positive in 3 samples. Results indicated that the microbiological risk attributable to the consumption of home heated raw milk is low, if the consumer applies regularly a good heating process.
Strontium-90 and cesium-137 in raw milk
International Nuclear Information System (INIS)
1979-01-01
Under the commission of Science and Technology Agency, prefectural public health laboratories and institutes and Japan Chemical Analysis Center have measured the levels of 90 Sr and 137 Cs in milk samples. Sampling was done as follows: 4 times of raw milk samples a year in 10 prefectures for the report to WHO, 2 times of raw milk samples a year in 4 prefectures; and 2 times of city milk samples a year in 29 prefectures. Three litters of fresh milk were collected and carbonated in the prefectural public health laboratories and institutes of each prefecture, and the carbonated samples were collected at Japan Chemical Analysis Center. At Japan Chemical Analysis Center, these collected samples were radiochemically analysed for 90 Sr and 137 Cs using the method applied for the analysis of the radionuclides contents in total diet materials. (author)
Supplement: Why Colour Foods? Colouring Food Products with ...
African Journals Online (AJOL)
Today, the food industry is the kitchen of the world. It has revolutionised nutrition. Never before have standards of purity, stability, and physiological harmlessness been as high as they are today. New raw materials and new methods of refining and preserving, however, often alter the natural appearance of fresh foods.
Meglio, Paolo; Giampietro, Paolo G; Carello, Rossella; Gabriele, Ida; Avitabile, Simona; Galli, Elena
2013-02-01
Hen's egg allergy affects young children and can cause severe allergic reactions. Avoidance results in dietary limitations and can affect the quality of life, especially in cases where potentially life-threatening reactions exist. Our objective was to desensitize children with moderate-severe IgE-mediated hen's egg allergy over a 6-month period, by introducing increasing and very gradual daily doses of raw hen's egg in order to enable the children to assume 25ml of this food, or to induce tolerance to the highest possible dose. The protocol foresaw the egg reintroduction in the home setting. In this randomized, controlled open study, 20 hen's egg allergic children (10 in the active group) were admitted. A convincing history or a positive double-blind placebo-controlled food challenge confirmed the diagnosis. Oral desensitization was performed with increasing doses starting from 0.27 mg of hen's egg proteins (1 drop of raw hen's egg diluted 1:100). We adopted an original, mathematically calculated protocol in order to ensure a constant, daily increment of doses. 8/10 children (80%) in the active group achieved the daily intake of 25ml over a 6-month period. One child (10%) could tolerate up to 2ml/day while another child (10%) failed the desensitization. Six months after enrolment only 2 children in the control group (20%) could tolerate hen's egg. We successfully desensitized 8/10 children with IgE-mediated hen's egg allergy in a 6-month period. The partial outcome in the child who could tolerate 2ml/day reduced the risk of severe reactions after unnoticed introduction of egg. A regular protocol that ensures a daily constant increase of doses helps to reduce possible adverse events, thus improving safety and effectiveness. © 2012 John Wiley & Sons A/S.
Identification of Particles in Parenteral Drug Raw Materials.
Lee, Kathryn; Lankers, Markus; Valet, Oliver
2018-04-18
Particles in drug products are not good and are therefore regulated. These particles can come from the very beginning of the manufacturing process, from the raw materials. To prevent particles, it is important to understand what they are and where they come from so the raw material quality, processing, and shipping can be improved. Thus, it is important to correctly identify particles seen in raw materials. Raw materials need to be of a certain quality with respect to physical and chemical composition, and need to have no contaminants in the form of particles which could contaminate the product or indicate the raw materials are not pure enough to make a good quality product. Particles are often seen when handling raw materials due to color, size, or shape characteristics different from those in the raw materials. Particles may appear to the eye to be very different things than they actually are, so microscope, chemical, and elemental analyses are required for accuracy in proper identification. This paper shows how using three different spectroscopy tools correctly and together can be used to identify particles from extrinsic, intrinsic, and inherent particles. Sources of materials can be humans and the environment (extrinsic), from within the process (intrinsic), and part of the formulation (inherent). Microscope versions of Raman spectroscopy, laser-induced breakdown spectroscopy (LIBS), and IR spectroscopy are excellent tools for identifying particles because they are fast and accurate techniques needing minimal sample preparation that can provide chemical composition as well as images that can be used for identification. The micro analysis capabilities allow for easy analysis of different portions of samples so multiple components can be identified and sample preparation can be reduced. Using just one of these techniques may not be sufficient to give adequate identification results so that the source of contamination can be adequately identified. The
Ngamsom, Bongkot; Lopez-Martinez, Maria J; Raymond, Jean-Claude; Broyer, Patrick; Patel, Pradip; Pamme, Nicole
2016-04-01
Pathogen analysis in food samples routinely involves lengthy growth-based pre-enrichment and selective enrichment of food matrices to increase the ratio of pathogen to background flora. Similarly, for blood culture analysis, pathogens must be isolated and enriched from a large excess of blood cells to allow further analysis. Conventional techniques of centrifugation and filtration are cumbersome, suffer from low sample throughput, are not readily amenable to automation and carry a risk of damaging biological samples. We report on-chip acoustophoresis as a pre-analytical technique for the resolution of total microbial flora from food and blood samples. The resulting 'clarified' sample is expected to increase the performance of downstream systems for the specific detection of the pathogens. A microfluidic chip with three inlets, a central separation channel and three outlets was utilized. Samples were introduced through the side inlets, and buffer solution through the central inlet. Upon ultrasound actuation, large debris particles (10-100 μm) from meat samples were continuously partitioned into the central buffer channel, leaving the 'clarified' outer sample streams containing both, the pathogenic cells and the background flora (ca. 1 μm) to be collected over a 30 min operation cycle before further analysis. The system was successfully tested with Salmonella typhimurium-spiked (ca. 10(3)CFU mL(-1)) samples of chicken and minced beef, demonstrating a high level of the pathogen recovery (60-90%). When applied to S. typhimurium contaminated blood samples (10(7)CFU mL(-1)), acoustophoresis resulted in a high depletion (99.8%) of the red blood cells (RBC) which partitioned in the buffer stream, whilst sufficient numbers of the viable S. typhimurium remained in the outer channels for further analysis. These results indicate that the technology may provide a generic approach for pre-analytical sample preparation prior to integrated and automated downstream detection of
Andrews, W H; Wilson, C R; Poelma, P L; Bullock, L K; McClure, F D; Gentile, D E
1981-09-01
An interlaboratory evaluation was made of the 96 h AOAC method and the 24 h A-1 procedure for the enumeration of fecal coliforms in samples of yellow corn meal, rye flour, mung beans, raw ground beef, and raw oyster homogenate. Results indicated that the efficiency of the A-1 procedure, measured in terms of recovery of fecal coliforms, and the reproducibility of that recovery were dependent on the particular food being analyzed. Accordingly, until its efficiency can be more fully demonstrated, the A-1 procedure is recommended only as a screening procedure for fecal coliforms in foods.
Microbiological quality of raw and roasted African palm weevil ...
African Journals Online (AJOL)
Microbiological quality of raw and roasted African palm weevil ( Rhynchophorus phoenicis ) consumed in the south eastern Nigeria. ... Rhynchophorus phoenicis though reported to be highly nutritious in terms of amino acid profile and presence of unsaturated fatty acid can be a source of food poison if not properly handled ...
DEFF Research Database (Denmark)
Pineiro, C.; Barros-Velazquez, J.; Perez-Martin, R.I.
1999-01-01
A collaborative study was carried out in seven European labs with the aim of achieving a sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) standard operation procedure to identify fish species in raw and cooked samples. Urea and SDS-containing solutions were evaluated...... silver stained, yielded good results and afforded higher reproducibility, thus allowing a better matching of results among the laboratories participating in this collaborative study. Under the optimized technical conditions described above, all the fish species tested, either raw and cooked, yielded...... seemed not to be influenced so much by the state of the sample (raw, cooked at 60 degrees C, cooked at 85 degrees C). Desalting, ultrafiltration or treatment with RNase/DNase did not improve the discriminatory power of the protein patterns. Commercial homogeneous 15% ExcelGels, especially when they were...
[Analysis on contamination of aflatoxins in food samples in Shaanxi Province from 2012-2015].
Hu, Jiawei; Tian, Li; Wang, Caixia; Qiao, Haiou; Wang, Minjuan
2016-09-01
To investigate the contamination of aflatoxins in food in Shaanxi Province, and provide the basic data of dietary intakes of aflatoxins for food safety assessment. In year 2012- 2015, 1007 food samples of eight kinds of food including grains, beans, vegetable oil, nuts and seeds, condiment, liquor, tea and infants' food were collected randomly from ten cities, and determined with UPLC. 1007 samples were detected aflatoxins and the total detection rate was 10. 7%. The detection range was 0. 070- 323 μg / kg, with the mean value of 2. 34 μg / kg. Among all food samples, only peanut products were more seriously polluted than other kinds of foods. The overall level of aflatoxins contamination in market food is low, but peanut products might be the contaminated foods with aflatoxins in Shaanxi Province, and should be given more attention.
Directory of Open Access Journals (Sweden)
Manzoor Khan
2014-01-01
Full Text Available This paper presents new classes of estimators in estimating the finite population mean under double sampling in the presence of nonresponse when using information on fractional raw moments. The expressions for mean square error of the proposed classes of estimators are derived up to the first degree of approximation. It is shown that a proposed class of estimators performs better than the usual mean estimator, ratio type estimators, and Singh and Kumar (2009 estimator. An empirical study is carried out to demonstrate the performance of a proposed class of estimators.
Intake of minerals, trace elements and vitamins in bone and raw food rations in adult dogs.
Dillitzer, Natalie; Becker, Nicola; Kienzle, Ellen
2011-10-01
The aim of the present study was to evaluate the vitamin and mineral content of bone and raw food rations fed to adult dogs in Germany. Pet owners completed a standardised feeding questionnaire. The composition of 95 rations was calculated from mean data for foodstuffs using nutrition balancing software. Typical ration ingredients were meats, fish, offal, dairy products, eggs, oil, nuts, cod liver oil and natural and commercial supplements. The supply of nutrients was compared with the recommended allowance (RA). Of the rations that were used, 10 % supplied vitamin D was below RA. About half of the rations supplied less iodine than the minimum requirement. Many of the rations had low Zn and Cu supply, and 25 % of the rations supplied only 70 % of RA for vitamin A or less. A total of 60 % of the rations had one or more of the above-mentioned imbalance. The remaining 40 % of rations either had minor problems like Ca excess from bones or they were balanced.
Survey of Veterinary Drug Residues in Raw Milk in Hebei Province, China.
Han, Rong-Wei; Yu, Zhong-Na; Zhen, Tian-Yuan; Wang, Jun
2017-10-17
The objective of this study was to investigate the occurrence of veterinary drug residues in raw milk from Hebei, the second-largest dairy production province in the People's Republic of China. A total of 192 raw milk samples were collected from 64 milk stations in seven districts. Twenty-eight veterinary drug residues were analyzed by ultraperformance liquid chromatography with tandem mass spectrometry based on a China National Standard. Raw milk samples with multiple residues of veterinary drugs were not found in the present study. Residues of four veterinary drugs, penicillin G, sulfacetamide, trimethoprim, and lincomycin, were detected in 12 (6.25%) raw milk samples, with detection ratios of 1.04, 0.52, 3.13, and 1.56%, respectively. All veterinary drug residues detected were under the maximum residue levels as regulated by China, the European Union, the United States, and the Codex Alimentarius Commission. In general, raw milk from Hebei province was considered relatively safe for human consumption because of the low prevalence of veterinary drug residues. However, stringent control measurements for veterinary drug residues in raw milk are required because some veterinary drugs were detected in milk from some areas of Hebei province.
A survey of traditional Iranian food products for contamination with toxigenic Clostridium botulinum
Directory of Open Access Journals (Sweden)
H.R. Tavakoli
Full Text Available Summary: This study aimed to determine the rate of Clostridium botulinum contamination in some traditional Iranian food products (cheese, kashk and salted fish and evaluate the efficacy of the mouse bioassay method in detection of C. botulinum toxins in these foods. A total of 131 samples (57 cheese, 11 kashk and 63 salted fish were collected and examined to determine the rate of contamination by C. botulinum. Standard monovalent anti-toxins were used to determine the types of toxin. C. botulinum bacteria were detected in 4.58% of the examined samples (1.52% of cheese and 3.06% of salted fish samples. While no contamination was detected in the kashk samples, C. botulinum types A and E were found to be dominant in cheese and salted fish samples, respectively. These results indicate—some traditional Iranian foods may be contaminated with different types of C. botulinum, and the consumption of these products, either raw or cooked, may contribute to food-borne intoxications. Keywords: Clostridium botulinum, Botulinum toxin, Traditional foods
Monitoring of foodborne pathogens in raw cow milk in Tuscany
Directory of Open Access Journals (Sweden)
Laura Gasperetti
2014-03-01
Full Text Available Raw milk consumption in Italy has increased over the last few years and although raw milk is characterised by cold chain, short shelf-life and the duty of boiling before domestic consumption, it is still considered a hazard. From 2010 to 2013 a monitoring survey of raw milk sold through vending machines was carried out to investigate the occurrence of several foodborne pathogens stipulated in the national legal requirements, i.e. Listeria monocytogenes, Campylobacter spp., Salmonella spp., Escherichia coli O:157 and coagulase-positive Staphylococci. A total of 127 raw milk samples were collected from 19 dairy herds in Tuscany Region, Italy. In addition, the milk samples were tested for the presence and count of Yersinia genus. Results shown that only one sample was positive for non verocytotoxin- producing E. coli O:157, whereas a total of 38 samples (29.9% were postive for Yersinia genus; of the total 39 isolated bacteria, 23.6% were Y. enterocolitica, 2.4% Y. kristenseni and 4.7% Y. frederiksenii. None isolate was enteropathogenic; serotypes O:5 and O:8 were found in 16.6 and 13.3% of the isolates respectively, whereas none of the serotypes tested was detected in 70% of the isolates. The most probable number method revealed a count value between 0.03 and 24 MPN/mL. Based on these data a general assurance on health safety of raw milk produced and sold in Tuscany could be assessed.
Directory of Open Access Journals (Sweden)
S. Rindi
2010-03-01
Full Text Available Authors show the results about the effectiveness verification of prevention measures adopted in raw milk directly selling at “E. Avanzi” Centre of Pisa University. The good hygienic practices applied during production, storage and selling phases demonstrated to guarantee, in raw milk, conditions complying to hygienic criteria provided for the current regulation in Tuscany. The effectiveness verification about risk communication, carried out interviewing a sample of buyers, shows as, beside a predominant attitude towards attention to potential hygienic risks, overstay areas of reduced awareness about food risk and the ways to manage prevention. Authors hope for, in this context, such as in other similar productions, the approach yet launched towards continuous improvement of good hygienic practices adopted by businesses, could be extended to risk communication, with the aim to promote conscious and responsable choices of consumer.
Ranieri, Matthew L; Ivy, Reid A; Mitchell, W Robert; Call, Emma; Masiello, Stephanie N; Wiedmann, Martin; Boor, Kathryn J
2012-08-01
Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect Paenibacillus spp. in fluid milk and to discriminate between Paenibacillus and other closely related spore-forming bacteria. Specificity was confirmed using 16 Paenibacillus and 17 Bacillus isolates. All 16 Paenibacillus isolates were detected with a mean cycle threshold (C(T)) of 19.14 ± 0.54. While 14/17 Bacillus isolates showed no signal (C(T) > 40), 3 Bacillus isolates showed very weak positive signals (C(T) = 38.66 ± 0.65). The assay provided a detection limit of approximately 3.25 × 10(1) CFU/ml using total genomic DNA extracted from raw milk samples inoculated with Paenibacillus. Application of the TaqMan PCR to colony lysates obtained from heat-treated and enriched raw milk provided fast and accurate detection of Paenibacillus. Heat-treated milk samples where Paenibacillus (≥1 CFU/ml) was detected by this colony TaqMan PCR showed high bacterial counts (>4.30 log CFU/ml) after refrigerated storage (6°C) for 21 days. We thus developed a tool for rapid detection of Paenibacillus that has the potential to identify raw milk with microbial spoilage potential as a pasteurized product.
Determination of histamine in milkfish stick implicated in food-borne poisoning
Directory of Open Access Journals (Sweden)
Yi-Chen Lee
2016-01-01
Full Text Available An incident of food-borne poisoning causing illness in 37 victims due to ingestion of fried fish sticks occurred in September 2014, in Tainan city, southern Taiwan. Leftovers of the victims' fried fish sticks and 16 other raw fish stick samples from retail stores were collected and tested to determine the occurrence of histamine and histamine-forming bacteria. Two suspected fried fish samples contained 86.6 mg/100 g and 235.0 mg/100 g histamine; levels that are greater than the potential hazard action level (50 mg/100 g in most illness cases. Given the allergy-like symptoms of the victims and the high histamine content in the suspected fried fish samples, this food-borne poisoning was strongly suspected to be caused by histamine intoxication. Moreover, the fish species of suspected samples was identified as milkfish (Chanos chanos, using polymerase chain reaction direct sequence analysis. In addition, four of the 16 commercial raw milkfish stick samples (25% had histamine levels greater than the US Food & Drug Administration guideline of 5.0 mg/100 g for scombroid fish and/or products. Ten histamine-producing bacterial strains, capable of producing 373–1261 ppm of histamine in trypticase soy broth supplemented with 1.0% L-histidine, were identified as Enterobacter aerogenes (4 strains, Enterobacter cloacae (1 strain, Morganella morganii (2 strains, Serratia marcescens (1 strain, Hafnia alvei (1 strain, and Raoultella orithinolytica (1 strain, by 16S ribosomal DNA sequencing with polymerase chain reaction amplification.
Rahimi, Ebrahim; Ameri, Mehrdad; Kazemeini, Hamid Reza
2010-04-01
Campylobacter spp. are one of the most common causes of acute bacterial gastroenteritis in human beings which are transmitted mostly via food originating from animals. This study was conducted to determine the prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail raw meats in Iran. From June 2008 to June 2009, a total of 722 raw meat samples from camel (n = 107), beef (n = 190), lamb (n = 225), and goat (n = 180) were purchased from randomly selected retail outlets in Isfahan and Yazd, Iran, and were evaluated for the presence of Campylobacter spp. In this study, 50 of the 722 meat samples (6.9%) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in lamb meat (12.0%), followed by goat meat (9.4%), beef meat (2.4%), and camel meat (0.9%). The most prevalent Campylobacter spp. isolated from the meat samples was Campylobacter jejuni (84.0%); the remaining isolates were Campylobacter coli (16.0%). Susceptibilities of 50 Campylobacter isolates were determined for 10 antimicrobial drugs using the disk-diffusion assay. Resistance to tetracycline was the most common finding (68.0%), followed by resistance to ciprofloxacin (46.0%) and nalidixic acid (40.0%). All of the isolates were susceptible to erythromycin, gentamicin, and chloramphenicol. Significantly higher prevalence rates of Campylobacter spp. (p meat samples taken in spring (20.0%) and summer (18.9%). To our knowledge, this study is the first report of the isolation of Campylobacter spp. from raw camel, lamb, and goat meat in Iran.
Acrylamide exposure among Turkish toddlers from selected cereal-based baby food samples.
Cengiz, Mehmet Fatih; Gündüz, Cennet Pelin Boyacı
2013-10-01
In this study, acrylamide exposure from selected cereal-based baby food samples was investigated among toddlers aged 1-3 years in Turkey. The study contained three steps. The first step was collecting food consumption data and toddlers' physical properties, such as gender, age and body weight, using a questionnaire given to parents by a trained interviewer between January and March 2012. The second step was determining the acrylamide levels in food samples that were reported on by the parents in the questionnaire, using a gas chromatography-mass spectrometry (GC-MS) method. The last step was combining the determined acrylamide levels in selected food samples with individual food consumption and body weight data using a deterministic approach to estimate the acrylamide exposure levels. The mean acrylamide levels of baby biscuits, breads, baby bread-rusks, crackers, biscuits, breakfast cereals and powdered cereal-based baby foods were 153, 225, 121, 604, 495, 290 and 36 μg/kg, respectively. The minimum, mean and maximum acrylamide exposures were estimated to be 0.06, 1.43 and 6.41 μg/kg BW per day, respectively. The foods that contributed to acrylamide exposure were aligned from high to low as bread, crackers, biscuits, baby biscuits, powdered cereal-based baby foods, baby bread-rusks and breakfast cereals. Copyright © 2013 Elsevier Ltd. All rights reserved.
Osmotic dehydration of fruit and berry raw materials in the food industry
Directory of Open Access Journals (Sweden)
N. A. Gribova
2017-01-01
Full Text Available Osmotic dehydration has recently received more attention as an effective method of preserving fruits and berries. Osmosis is a simple process that facilitates the processing of fruits and berries in order to preserve the original characteristics, namely nutritional value and organoleptic properties: color, aroma and texture. Osmotic dehydration has found wide application in the preservation of food products, as the activity of water in fruits and berries decreases, in some of them up to 90% of water is contained. The process of osmotic dehydration with the help of various agents is less energy-intensive than the process of drying or freezing, since it can be processed at ambient temperature. Osmotic dehydration has potential advantages in preserving the quality of food and in maintaining healthy food for the food industry. Treatment includes dehydration of fruits and berries by an osmotic agent followed by dehydration in dry or frozen apparatus where the moisture content decreases and the product becomes more stable. This process is a partial dewatering process to provide improved product quality compared to conventional drying processes or freezing. The purpose of studying osmotic dehydration is to identify the advantages and disadvantages in the treatment of osmotic agents. Various aspects of osmotic dehydration technology are considered, namely the solutions used, the characteristics of solutions, the effect of variable processes and the qualitative characteristics of osmo-dehydrated products. Factors of osmotic dehydration that depend on the osmotic agent, concentration of solute, temperature, time, size, shape and compactness of the material, mixing and the ratio of the solution to the samples.
Inactivation of Staphylococcus aureus in raw salmon with supercritical CO2 using experimental design
Directory of Open Access Journals (Sweden)
Mônica CUPPINI
2016-01-01
Full Text Available Abstract Considering the microbial safety of consumption of raw foods (Asian food, this study aimed to explore the inactivation S. aureus in raw salmon by supercritical CO2 treatment (SC-CO2. For this purpose, experimental design methodology was employed as a tool to evaluate the effects of pressure (120-220 bar, the depressurization rate (10 to 100 bar.min–1 and the salmon:CO2 mass relation (1:0.2 to 1:1.0. It was observed that the pressure and the depressurization rate was statistically significant, i.e. the higher the system pressure and depressurization rate, the greater the microbial inactivation. The salmon: CO2 mass relation did not influence the S. aureus inactivation in raw salmon. There was a total reduction in S. aureus with 225 bar, a depressurizing rate of 100 bar.min–1, a salmon: CO2 mass relation of 1:0.6, for 2 hours at 33 °C.
Public health investigations of Salmonella Enteritidis in catering raw shell eggs, 2002-2004.
Little, C L; Surman-Lee, S; Greenwood, M; Bolton, F J; Elson, R; Mitchell, R T; Nichols, G N; Sagoo, S K; Threlfall, E J; Ward, L R; Gillespie, I A; O'Brien, S
2007-06-01
In response to a dramatic change in the epidemiology of Salmonella Enteritidis in England and Wales thought to be associated with raw shell eggs, the Health Protection Agency initiated public health investigations to establish the incidence of Salmonella contamination and origin of eggs used by catering premises implicated in outbreaks of Salm. Enteritidis. Between October 2002 and November 2004, 16 971 eggs were sampled and Salmonella were recovered from 3.4%. Salmonella was isolated from 5.5% and 6.3% of Spanish and eggs of unknown origin, respectively, used in catering premises linked to outbreaks, a level significantly higher than that (1.1%) found in nonLion Quality UK eggs sampled. The small sample of UK Lion Quality eggs tested (reflecting their lack of use in premises visited) did not contain Salmonella. Several phage types of Salm. Enteritidis other than phage type 4 (PT 4) were identified with nonUK eggs. Eggs from Spain were implicated as a major source of infection. Eggs were contaminated more frequently with Salmonella when shells were dirty and/or cracked, and stored at above 8 degrees C. The use of Spanish eggs by the catering sector has been identified as a consistent significant factor in many of the outbreaks caused by Salm. Enteritidis nonPT4 in England and Wales during 2002-2004. Advice to caterers and hospitals that raw shell eggs should not be used in food that will either not be cooked or only lightly cooked should be reinforced.
Food hygiene control in school canteens of La Spezia municipality: years 2003-2012
Directory of Open Access Journals (Sweden)
Carlo Ercolini
2013-04-01
Full Text Available The school canteens are public catering services of great interest as they provide meals to a high number of consumers who are particularly susceptible to health risks, therefore surveillance and health control are very important to ensure food safety. To this purpose, a convention between the Istituto Zooprofilattico Sperimentale of Piemonte Liguria e Valle d’Aosta, and La Spezia municipality was established for the health control of school canteens. In this article we report the results of analysis performed on food and swab surfaces samples collected during the period 2003-2012 in 22 school canteens and 3 cooking centers. From a total of 1187 samples: 313 raw foods were analyzed for chemical and microbiological parameters to verify compliance with legislation, 71 food preparations were analyzed for bacteria indicators to assess the good manufacturing practices, and 803 surface swabs were tested for total mesophilic count (TMC, Salmonella spp. and Listeria spp. to control cleaning/disinfection conditions. The results show that only 1.3% of raw food samples did not respect the limits imposed by legislation, and 1.4% of food preparations was positive for pathogens. In environmental swabs, pathogenic microorganisms were never isolated and TMC exceeded the limits of acceptability in no more than 27% of cases. The most contaminated surfaces were those in contact with food and the equipment difficult to clean. The results demonstrate that potential hazards are kept to acceptable levels in school canteens and cooking centers investigated. In fact, during the period considered no foodborne diseases were reported among users. However, data obtained may be useful to better define control measures to be adopted to improve the hygienic level production in these structures and to prevent foodborne infections.
Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine
2016-01-01
ABSTRACT Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). IMPORTANCE Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in
Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine; Chaillou, Stéphane
2016-07-01
Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in dietary salt intake
REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-02-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
Effects of storage on the major constituents of raw milk
Directory of Open Access Journals (Sweden)
Peter Zajác
2015-10-01
Full Text Available Milk testing and quality control should be carried out at all stages of the dairy chain. Milk can be tested for quantity, organoleptic characteristic, compositional characteristic, physical and chemical characteristics, hygienic characteristics, adulteration or drug residues. The content of the major constituents of raw milk is important for milk payment system. Enzymes naturally present in the milk can change the chemical composition of raw milk. Also, enzymes secreted by bacteria or enzymes from somatic cells can degrade the raw milk composition. Products of these degradation reactions can have undesirable effects on milk structure, smell and taste. It is very important that farm-fresh raw milk be cooled immediately to not more than 8 °C in the case of daily collection, or not more than 6 °C if collection is not daily. During transport the cold chain must be maintained. An authorized person, properly trained in the appropriate technique, shall perform sampling of bulk milk in farm. Laboratory samples should be dispatched immediately after sampling to the dairy company and consequently to the testing laboratory. The time for dispatch of the samples to the testing laboratory should be as short as possible, preferably within 24 h. Laboratory samples shall be transported and stored at temperature 1 to 5 °C. Higher temperatures may adversely affect the composition of the laboratory sample and may cause disputes between the farmer, the dairy company and the laboratory. The effect of refrigerated storage at temperature 4 °C during 24 h on the composition of raw milk were investigated in this work, because we wanted to know how the milk composition will be changed and how the laboratory results will be affected. In many cases, the samples are not preserved with chemical preservants like azidiol, bronopol, potassium dichromate or Microtabs. We found, that the composition of raw cows' milk after 24 was changed significantly (p >0.005. We found an
Iodine content in commonly consumed food in Hong Kong and its changes due to cooking.
Chung, Stephen; Chan, Andy; Xiao, Ying; Lin, Violette; Ho, Y Y
2013-01-01
Levels of iodine of foods found in Hong Kong were analysed in 271 samples from 11 groups, including (i) cereals and grain products, (ii) legumes and vegetables, (iii) meat and poultry, (iv) egg and egg products, (v) milk and milk products, (vi) fish, (vii) crustaceans and mollusks, (viii) non-alcoholic beverages, (ix) condiments and sauces, (x) sashimi and (xi) seaweeds. All food samples were analysed individually as purchased. The iodine in all samples ranged from undetectable to 2.9 g kg(-1). Seaweeds, iodised salt, seafood, milk and milk products as well as egg and egg products were rich sources of iodine. To estimate the influence of cooking on iodine levels in foods, a total of 15 individual samples were analysed as raw and respective cooked food. The influence of cooking on the iodine level was minimal, except for boiling, as iodine dissolved into the soup.
Symes, Sally; Goldsmith, Paul; Haines, Heather
2015-07-01
Seed sprouts have been implicated as vehicles for numerous foodborne outbreaks worldwide. Seed sprouts pose a unique food safety concern because of the ease of microbiological seed contamination, the inherent ability of the sprouting process to support microbial growth, and their consumption either raw or lightly cooked. To examine seed sprout safety in the Australian state of Victoria, a survey was conducted to detect specific microbes in seed sprout samples and to investigate food handling practices relating to seed sprouts. A total of 298 seed sprout samples were collected from across 33 local council areas. Escherichia coli was detected in 14.8%, Listeria spp. in 12.3%, and Listeria monocytogenes in 1.3% of samples analyzed. Salmonella spp. were not detected in any of the samples. A range of seed sprout handling practices were identified as potential food safety issues in some food businesses, including temperature control, washing practices, length of storage, and storage in proximity to unpackaged ready-to-eat potentially hazardous foods.
Microbial safety of raw mixed-vegetable salad sold as an ...
African Journals Online (AJOL)
A survey of 90 randomly selected subjects indicated raw mixed-vegetable salad as a popular accompaniment to cooked rice sold by street-food vendors in the Kokomlemle municipality of Accra, Ghana, but the salad was generally considered unwholesome and a potential cause of diarrhoea. A survey of 15 vendors of ...
Price promotions for food and beverage products in a nationwide sample of food stores.
Powell, Lisa M; Kumanyika, Shiriki K; Isgor, Zeynep; Rimkus, Leah; Zenk, Shannon N; Chaloupka, Frank J
2016-05-01
Food and beverage price promotions may be potential targets for public health initiatives but have not been well documented. We assessed prevalence and patterns of price promotions for food and beverage products in a nationwide sample of food stores by store type, product package size, and product healthfulness. We also assessed associations of price promotions with community characteristics and product prices. In-store data collected in 2010-2012 from 8959 food stores in 468 communities spanning 46 U.S. states were used. Differences in the prevalence of price promotions were tested across stores types, product varieties, and product package sizes. Multivariable regression analyses examined associations of presence of price promotions with community racial/ethnic and socioeconomic characteristics and with product prices. The prevalence of price promotions across all 44 products sampled was, on average, 13.4% in supermarkets (ranging from 9.1% for fresh fruits and vegetables to 18.2% for sugar-sweetened beverages), 4.5% in grocery stores (ranging from 2.5% for milk to 6.6% for breads and cereals), and 2.6% in limited service stores (ranging from 1.2% for fresh fruits and vegetables to 4.1% for breads and cereals). No differences were observed by community characteristics. Less-healthy versus more-healthy product varieties and larger versus smaller product package sizes generally had a higher prevalence of price promotion, particularly in supermarkets. On average, in supermarkets, price promotions were associated with 15.2% lower prices. The observed patterns of price promotions warrant more attention in public health food environment research and intervention. Copyright © 2016 Elsevier Inc. All rights reserved.
Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran.
Rahimi, Ebrahim; Jalali, Mohammad; Weese, J Scott
2014-02-05
Clostridium difficile has been shown to be a nosocomial pathogen associated with diarrhoea and pseudomembranous colitis in hospitalised patients and the infection is believed to be acquired nosocomially. Recent studies have shown the occurrence of C. difficile in food animals which may act as a source of infection to humans.The aim of this study was to determine the occurrence of C. difficile in retail raw beef, cow, sheep, goat, camel and buffalo meat in Iran. From April to October 2012, a total of 660 raw meat samples from beef, cow, sheep, goat, camel and buffalo were purchased from 49 butcheries in Isfahan and Khuzestan provinces, Iran, and were evaluated for the presence of C. difficile using a method including selective enrichment in C. difficile broth, subsequent alcohol shock-treatment and plating onto C. difficile selective medium. C. difficile isolates were tested for the presence of toxin genes and were typed using PCR ribotyping. In this study, 13 of 660 meat samples (2%) were contaminated with C. difficile. The highest prevalence of C. difficile was found in buffalo meat (9%), followed by goat meat (3.3%), beef meat (1.7%), cow (0.94%) and sheep meat (0.9%). Seven of the 13C. difficile strains (53.9%) were positive for tcdA, tcdB and cdtB toxin genes and were classified as ribotype 078. Four strains (30.8%) were positive tcdA, and tcdB, and one strain (7.7%) was possessed only tcdB. The remaining isolate was non-toxigenic. Susceptibilities of 13C. difficile isolates were determined for 11 antimicrobial drugs using the disk diffusion assay. Resistance to clindamycin, gentamycin, and nalidixic acid was the most common finding. To our knowledge, the present study is the first report of the isolation of C. difficile from raw buffalo meat. This study indicates the potential importance of food, including buffalo meat, as a source of transmission of C. difficile to humans.
Survey to determine why people drink raw milk.
Mullin, Gerard E; Belkoff, Stephen M
2014-11-01
Fragility fractures associated with osteoporosis extract a large financial and personal toll on society. Pharmaceutical or dietary calcium intake is needed to increase bone mineral density to prevent fragility fractures. Although dairy products are a good source of calcium, patients who are unable to digest lactose tend to avoid them and are put at a greater risk for fracture than the general population. Anecdotal reports suggest that lactose maldigesters, when consuming raw milk, have a dramatic reduction in symptoms relative to pasteurized milk. The mechanism of the reported reduction in symptoms, if true, is unknown. The purpose of the current study was to survey raw milk drinkers to ascertain their health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. An online survey regarding raw milk was completed by 153 of 1527 members of a raw milk-buying community. The primary reason the respondents cited for drinking raw milk was that they believed it was more healthful; 30% reported some gastrointestinal discomfort when drinking pasteurized milk, yet almost all (99%) reported consuming raw milk without discomfort. Despite the reports of gastrointestinal discomfort, only 5% of respondents had been diagnosed as lactose intolerant by a medical professional, and only 1% had been diagnosed as lactose intolerant via the gold-standard hydrogen breath test. The primary motivation for drinking raw milk is its perceived health value, not its digestibility. Although raw milk appears to be more easily digested than pasteurized milk in our survey sample, the mechanism of digestibility remains unknown.
Validation of method in instrumental NAA for food products sample
International Nuclear Information System (INIS)
Alfian; Siti Suprapti; Setyo Purwanto
2010-01-01
NAA is a method of testing that has not been standardized. To affirm and confirm that this method is valid. it must be done validation of the method with various sample standard reference materials. In this work. the validation is carried for food product samples using NIST SRM 1567a (wheat flour) and NIST SRM 1568a (rice flour). The results show that the validation method for testing nine elements (Al, K, Mg, Mn, Na, Ca, Fe, Se and Zn) in SRM 1567a and eight elements (Al, K, Mg, Mn, Na, Ca, Se and Zn ) in SRM 1568a pass the test of accuracy and precision. It can be conclude that this method has power to give valid result in determination element of the food products samples. (author)
Real Deal or No Deal? A Comparative Analysis of Raw Milk Cheese Regulation in Australia and France
William van Caenegem; Madeline Elizabeth Taylor
2017-01-01
Australia’s regulatory framework has resulted in the standardisation of cheese production based on pasteurisation. Up until early 2015, regulations effectively prohibited raw milk cheese-making in Australia and thus stifled artisanal on-farm production. Although the introduction of Food Standards Australia New Zealand Standard 4.2.4 has allowed the production of certain hard, low-moisture raw milk cheeses, the new standard is rigid and does not encourage new entrants into the emerging raw mil...
Food safety assurance systems: Microbiological testing, sampling plans, and microbiological criteria
Zwietering, M.H.; Ross, T.; Gorris, L.G.M.
2014-01-01
Microbiological criteria give information about the quality or safety of foods. A key component of a microbiological criterion is the sampling plan. Considering: (1) the generally low level of pathogens that are deemed tolerable in foods, (2) large batch sizes, and (3) potentially substantial
Bird, Patrick; Fisher, Kiel; Boyle, Megan; Huffman, Travis; Benzinger, M Joseph; Bedinghaus, Paige; Flannery, Jonathan; Crowley, Erin; Agin, James; Goins, David; Benesh, DeAnn; David, John
2013-01-01
The 3M Molecular Detection Assay (MDA) Salmonella is used with the 3M Molecular Detection System for the detection of Salmonella spp. in food, food-related, and environmental samples after enrichment. The assay utilizes loop-mediated isothermal amplification to rapidly amplify Salmonella target DNA with high specificity and sensitivity, combined with bioluminescence to detect the amplification. The 3M MDA Salmonella method was compared using an unpaired study design in a multilaboratory collaborative study to the U.S. Department of Agriculture/Food Safety and Inspection Service-Microbiology Laboratory Guidebook (USDA/FSIS-MLG 4.05), Isolation and Identification of Salmonella from Meat, Poultry, Pasteurized Egg and Catfish Products for raw ground beef and the U.S. Food and Drug Administration/Bacteriological Analytical Manual (FDA/BAM) Chapter 5 Salmonella reference method for wet dog food following the current AOAC guidelines. A total of 20 laboratories participated. For the 3M MDA Salmonella method, raw ground beef was analyzed using 25 g test portions, and wet dog food was analyzed using 375 g test portions. For the reference methods, 25 g test portions of each matrix were analyzed. Each matrix was artificially contaminated with Salmonella at three inoculation levels: an uninoculated control level (0 CFU/test portion), a low inoculum level (0.2-2 CFU/test portion), and a high inoculum level (2-5 CFU/test portion). In this study, 1512 unpaired replicate samples were analyzed. Statistical analysis was conducted according to the probability of detection (POD). For the low-level raw ground beef test portions, the following dLPOD (difference between the POD of the reference and candidate method) values with 95% confidence intervals were obtained: -0.01 (-0.14, +0.12). For the low-level wet dog food test portions, the following dLPOD with 95% confidence intervals were obtained: -0.04 (-0.16, +0.09). No significant differences were observed in the number of positive
Be Food Safe: Protect Yourself from Food Poisoning
... and surfaces thoroughly, raw meat, poultry, seafood, and eggs can still spread germs to ready-to-eat foods—unless you keep them separate. Watch the SEPARATE video! COOK Cook to the right temperature . Use a food ...
THE MONITORING OF MERCURY CONTENT IN BABY FOODS
Directory of Open Access Journals (Sweden)
Tomáš Tóth
2014-02-01
Full Text Available Children's nutrition is very important for the healthy growth and development of the child, but it affects the health of the individual as well later in adulthood. For the production of baby food, commonly available on the market are used raw materials consistently grown under very strict supervision of specially designated for children's nutrition. It shall also apply to the more stringent standards on fertilizer, soil treatment during growth, harvesting, storage and process for the production of baby food. At work, we have focused on monitoring the content of Hg in the 12 samples of baby food, available in the sales network of the Slovak Republic and comparing it with the Highest permissible quantity (0.05 mg.kg-1. On the basis of the findings shows that the content of Hg in the one sample exceeded the HPQ, the content of Hg was in the range 0.6 - 20.4% of the HPQ.
Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Radji, M.
2010-01-01
Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.
Mead, G.; Lammerding, A.M.; Cox, N.; Doyle, M.P.; Humbert, F.; Kulikovskiy, A.; Panin, A.; Pinheiro do Nascimento, V.; Wierup, M.; Zwietering, M.H.
2010-01-01
Concerns about foodborne salmonellosis have led many countries to introduce microbiological criteria for certain food products. If such criteria are not well-grounded in science, they could be an unjustified obstacle to trade. Raw poultry products are an important part of the global food market.
Photoshop CS3 RAW Transforming your RAW data into works of art
Aaland, Mikkel
2008-01-01
Because RAW files remain virtually untouched by in-camera processing, working with them has given digital photographers greater flexibility and control during the editing process -- for those who are familiar enough with the format. Camera RAW, the plug in for Adobe Photoshop CS3, has emerged as one of the best and most familiar tools for editing RAW images, and the best way to master this workflow is with Photoshop CS3 RAW. Award-winning author Mikkel Aaland explores the entire RAW process, from the practical reasons to shoot RAW, to managing the images with the new features of Bridge 2.0 n
National outbreak of Salmonella Give linked to a local food manufacturer in Malta, October 2016.
Donachie, A; Melillo, T; Bubba, L; Hartman, H; Borg, M-L
2018-06-26
Salmonella Give is a rare serotype across Europe. In October 2016, a national outbreak of S. Give occurred in Malta. We describe the epidemiological, environmental, microbiological and veterinary investigations. Whole-genome sequencing (WGS) was performed on human, food, environmental and veterinary isolates. Thirty-six human cases were reported between October and November 2016, 10 (28%) of whom required hospitalisation. Twenty-six (72%) cases were linked to four restaurants. S. Give was isolated from ready-to-eat antipasti served by three restaurants which were all supplied by the same local food manufacturer. Food-trace-back investigations identified S. Give in packaged bean dips, ham, pork and an asymptomatic food handler at the manufacturer; inspections found inadequate separation between raw and ready-to-eat food during processing. WGS indicated two genetically distinguishable strains of S. Give with two distinct clusters identified; one cluster linked to the local food manufacturer and a second linked to veterinary samples. Epidemiological, environmental and WGS evidence pointed towards cross-contamination of raw and ready-to-eat foods at the local manufacturer as the likely source of one cluster. Severity of illness indicates a high virulence of this specific serotype. To prevent future cases and outbreaks, adherence to food safety practices at manufacturing level need to be reinforced.
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Directory of Open Access Journals (Sweden)
Edith Burbano
2006-05-01
Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses
Directory of Open Access Journals (Sweden)
khadijeh bahrami
2014-03-01
Full Text Available Background &Objective: The present study aims at studying two forms of raw and cooked garlic to identify the effect of this plant on the amount of change in histopatological of spermatogenesis of wistar rat.Materials & Methods: 40 male rats were divided into five equal groups (4 treatment 1 control group the first and second treatment were received palete food consisted of 5% and 15% of raw garlic every day. The third and fourth reatment were received palete food consisted of 5%and 15% of cooked garlic as a food . The control group received standard palete food every day in a month. Finally,the testis were taken out of stomach and after preparing tissue and coloring, they were gone under microscopic studies. Thence, the data were analyzed using SPSS and Duncan test.Results: The study indicated that the amount of sexual cells in the group having cook garlic for 15% compared with that of controlled group had a significant increase and the amount of sexual cells in the group using raw garlic as a food had a significant decrease compared with that of the controlled group.Conclusion: Prescription of cooked garlic has an influence on Proliferation of sexual cells in testicular tubules and epidydymes and so increased spermatogenesis in this group in caparison with the control group. However, prescribing raw garlic has harmful effects on tissue of testis and process of spermatogenes in empric compared with the control group.
Zarzycki, Paweł K; Zarzycka, Magdalena B; Clifton, Vicki L; Adamski, Jerzy; Głód, Bronisław K
2011-08-19
The goal of this paper is to demonstrate the separation and detection capability of eco-friendly micro-TLC technique for the classification of spirulina and selected herbs from pharmaceutical and food products. Target compounds were extracted using relatively low-parachor liquids. A number of the spirulina samples which originated from pharmaceutical formulations and food products, were isolated using a simple one step extraction with small volume of methanol, acetone or tetrahydrofuran. Herb samples rich in chlorophyll dyes were analyzed as reference materials. Quantitative data derived from micro-plates under visible light conditions and after iodine staining were explored using chemometrics tools including cluster analysis and principal components analysis. Using this method we could easily distinguish genuine spirulina and non-spirulina samples as well as fresh from expired commercial products and furthermore, we could identify some biodegradation peaks appearing on micro-TLC profiles. This methodology can be applied as a fast screening or fingerprinting tool for the classification of genuine spirulina and herb samples and in particular may be used commercially for the rapid quality control screening of products. Furthermore, this approach allows low-cost fractionation of target substances including cyanobacteria pigments in raw biological or environmental samples for preliminary chemotaxonomic investigations. Due to the low consumption of the mobile phase (usually less than 1 mL per run), this method can be considered as environmentally friendly analytical tool, which may be an alternative for fingerprinting protocols based on HPLC machines and simple separation systems involving planar micro-fluidic or micro-chip devices. Copyright © 2011 Elsevier B.V. All rights reserved.
Prevalence of the pathogen microorganisms in raw cow milk
Directory of Open Access Journals (Sweden)
Angelovski Ljupco
2009-11-01
Full Text Available The aim of this study was to study the prevalence of Salmonella spp., Listeria spp., Staphylococcus spp. and E. coli in the raw cow milk. In this study 133 milk-tank samples from several milk collecting points were analysed. After the tests the following prevalence was detected: for Listeria spp. 13 positive samples (9.77%, with 9 Listeria monocytogenes samples confirmed (6.76%. Salmonella spp. was not detected in any of the the samples. The biggest presence was detected for Staphylococcus spp. with 113 positive samples (85.0%. Further testes has shown prevalence of coagulase-positive staphylococci of 73% (97 positive samples. Escherichia coli was confirmed in 57 samples (46.0%. The results from this study clearly indicate that pathogen microorganisms which are important for the human health can be found in the raw cow milk and their presence can be potential hazard for contamination of the milk-processing establishments.
Contamination levels of aflatoxin M1 in bulk raw milk of Chaloos and Ramsar
Directory of Open Access Journals (Sweden)
A.R Barami
2012-02-01
Full Text Available Aflatoxin M1 (AFM1 appears in milk as a direct result of the ingestion of feed contaminated with aflatoxin B1 by cattle. This study was conducted to investigate the contamination rate of raw milk whit aflatoxin M1 in Chaloos and Ramsar raw milk collection centers. Two hundred bulk raw milk samples were collected during winter (January and February and summer (June and July seasons. The milk samples were analyzed by ELISA method for the presence of AFM1. During the winter, AFM1 was detected in 100% and 59/79% of the bulk raw milk samples in Ramsar and Chaloos, respectively; however, during summer 83/52% and 50/1 of the samples was found as positive in Ramsar and Chaloos, respectively. Furthermore, 45% of Ramsar and 30% of Chaloos bulk milk samples showed higher contamination level of AFM1 than maximum tolerance limit (50 ng/l accepted by National Standard as well as European Union. Although, the difference between the contamination rate in samples obtained during summer and winter seasons was not statistically significantly, (p
Sevenier, V; Delannoy, S; André, S; Fach, P; Remize, F
2012-04-16
Two categories of vegetables (carrots and green beans) that are widely used in the manufacture of canned food were surveyed for their spore contamination. Samples were recovered from 10 manufactures spread over all producing areas in France. Two samples over 316 raw vegetables collected were found positive for botulinum neurotoxin producing Clostridia spores as tested by PCR-based GeneDisc assay. Both positive samplestested positive for the type B neurotoxin gene (bont/B). In parallel, heat-resistant spores of thermophilic bacteria that are likely to be associated with canned food spoilage after prolonged incubation at 55 °C were surveyed after specific enrichment. Prevalence varied between 1.6% for Moorella thermoacetica/thermoautotrophica in green bean samples and 8.6% for either Geobacillus stearothermophilus or Thermoanaerobacterium spp. in carrot samples. Vegetable preparation, e.g. washing and edge cutting, considerably reduced spore contamination levels. These data constitute the first wide examination of vegetables specifically cultivated for industrialpurposes for their contamination by spores of thermophilic bacterial species. Copyright © 2012 Elsevier B.V. All rights reserved.
Yucel, Nihal; Aslim, Belma; Ozdoğan, Hakan
2009-08-01
In this study a total of 30 raw meat samples obtained from Ankara, Turkey were screened for the presence of Bacillus species. Among the meat samples analyzed, the predominant species isolated was Bacillus circulans; other Bacillus species were identified as Bacillus firmus, Bacillus lentus, Bacillus megaterium, Bacillus licheniformis, Bacillus mycoides, Bacillus sphaericus, and Bacillus cereus. Minced meat samples were more contaminated with Bacillus species than sliced beef sample. From these samples, 242 Bacillus species isolates were obtained, which were investigated for proteolytic and lipolytic activity, associated with meat spoilage. Interestingly, some Bacillus strains produced the highest values of proteolytic/lipolytic activities. Nineteen Bacillus strains were selected among the 242 isolates according to their proteolytic/lipolytic activity with a clear zone diameter of > or =6 mm. The essential oil of Satureja wiedemanniana (Lalem) Velen was also tested against these 19 Bacillus species that had proteolytic and lipolytic activity. The essential oil yield obtained from the aerial parts of the plant was 0.35% (vol/wt). The inhibition zones of the essential oil obtained against all the Bacillus species were in the range of 5.0-12.0 mm. The oil showed high antimicrobial activities against B. licheniformis M 6(26), M 11(16), and M 12(1) strains. B. licheniformis 12(1) showed high lipolytic activity (18.0 mm). Also, B. licheniformis M 6(26) and M 11(16) showed high proteolytic activity (16.0 and 14.0 mm). These results may suggest that an essential oil of S. wiedemanniana can be used as a natural preservative in meat against spoilage bacteria.
Whey as a raw material for the production of functional beverages
Directory of Open Access Journals (Sweden)
Bulatović Maja Lj.
2012-01-01
Full Text Available One of the least utilized by-products of food industry, despite the great potential that is described, is the whey, which is obtained as a by-product of the technological process production of cheese and casein. The excess whey, which occurs in this process in very high yields, with failure to processing is becoming a very big polluter, what is completely at odds with the potential that such materials possess. On the other hand, the modern tempo and way of life, and increasingly polluted environmental also, impose the need to produce food products that would help the human body in the fight against harmful agents which are exposed to daily. One of the more effective solution is the production of fermented functional beverages based on whey, which achieved this intention in the most natural and most comfortable way. Considering the rather untapped potential of whey as a raw material and growing food shortages in the world market, the aim of this study was to analyze the possibilities of production of functional beverages based on whey, with satisfactory sensory characteristics, in order to demonstrate the attractiveness of whey as raw material in the food industry. This paper presents an overview of the wide possibilities for the use of whey with a special emphasis on its attractiveness and the necessity of its utilizing.
19 CFR 151.23 - Allowance for moisture in raw sugar.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Allowance for moisture in raw sugar. 151.23...; DEPARTMENT OF THE TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Sugars, Sirups, and Molasses § 151.23 Allowance for moisture in raw sugar. Inasmuch as the absorption of sea water or moisture...
ISMRM Raw data format: A proposed standard for MRI raw datasets
DEFF Research Database (Denmark)
Inati, Souheil; Naegle, Joseph; R. Zwart, Nicholas
2016-01-01
programming languages (C++, MATLAB, Python). Results Images were obtained by reconstructing the raw data from all vendors. The source code, raw data, and images comprising this work are shared online, serving as an example of an image reconstruction project following a paradigm of reproducible research......Purpose This work proposes the ISMRM Raw Data format as a common MR raw data format, which promotes algorithm and data sharing. Methods A file format consisting of a flexible header and tagged frames of k-space data was designed. Application Programming Interfaces were implemented in C/C++, MATLAB......, and Python. Converters for Bruker, General Electric, Philips, and Siemens proprietary file formats were implemented in C++. Raw data were collected using magnetic resonance imaging scanners from four vendors, converted to ISMRM Raw Data format, and reconstructed using software implemented in three...
Characterization of polycyclic aromatic hydrocarbons (PAH's) present in sampled cooked food
International Nuclear Information System (INIS)
Palm Naa-Dedei, L.M.
2010-07-01
The study was conducted to determine the levels of Polycyclic Aromatic Hydrocarbons in the following traditionally prepared food: smoked and grilled Scomba japonicus, grilled meat (khebab) and bread sampled from some Ghanaian markets. By way of preparation of traditional food, some food comes into direct contact with smoke or extremely high temperature which are potential sources of Polycyclic Aromatic Hydrocarbon generation. Levels of 20 individual Polycyclic Aromatic Hydrocarbons including acenaphthene, acenaphtyelene, anthanthrene, anthracene, benz(a)anthracene, benzo(a)pyrene, benzo(b)fluoranthene, benzo(e)pyrene, benzo(ghi)perylene, benzo(j)fluoranthene, benzo(k)fluoranthene, chrysene, cyclopenta(cd)pyrene, dibenzo(ah)anthracene, fluoranthene, fluorene, indeno(1,2,3-cd)pyrene, naphthalene, phenanthrene and pyrene were determined in 11 smoked and 5 grilled fish, 4 grilled pieces of meat and 3 loaves of baked bread using gas chromatographic techniques with flame ionization detector. Benzo(a)pyrene, which is one of the few PAH for which a legal limit exists in different types of food matrices and other high molecular weight PAHs suspected to be carcinogenic have been detected in high concentrations in most samples. Bread samples gave mean polycyclic aromatic hydrocarbon concentrations of up to 20.39 μg/kg while khebab samples gave mean polycyclicaromatic hydrocarbon concentrations of up to 67.61 μg/kg. There was positive correlation of 0.987 between levels of polycyclic aromatic hydrocarbon concentrations in khebab samples from locations Osu and Atomic down. There was a positive correlation in the concentrations of the high molecular weight PAHs in all smoked fishes from four locations with values between 0.954 and 0.999 for the correlation between any two groups. The polycyclic aromatic hydrocarbon concentration determined in smoked fish samples deceased in terms of location according to the order Winneba > Madina > Chorkor > Ada.
Andrews, Philip
2007-01-01
One of the most important technologies a photographer can master is shooting and working with raw images. However, figuring out the best way to work with raw files can be confusing and overwhelming. What's the advantage to working in raw? How do you manage, organize, and store raw files? What's the best way to process your files to meet your photographic needs? How do Photoshop, Lightroom and Adobe Camera Raw work together? Is it possible to keep your photos in the raw format and still enhance them extensively? Philip Andrews answers these questions and more in his all-new essential raw workfl
Image recognition on raw and processed potato detection: a review
Qi, Yan-nan; Lü, Cheng-xu; Zhang, Jun-ning; Li, Ya-shuo; Zeng, Zhen; Mao, Wen-hua; Jiang, Han-lu; Yang, Bing-nan
2018-02-01
Objective: Chinese potato staple food strategy clearly pointed out the need to improve potato processing, while the bottleneck of this strategy is technology and equipment of selection of appropriate raw and processed potato. The purpose of this paper is to summarize the advanced raw and processed potato detection methods. Method: According to consult research literatures in the field of image recognition based potato quality detection, including the shape, weight, mechanical damage, germination, greening, black heart, scab potato etc., the development and direction of this field were summarized in this paper. Result: In order to obtain whole potato surface information, the hardware was built by the synchronous of image sensor and conveyor belt to achieve multi-angle images of a single potato. Researches on image recognition of potato shape are popular and mature, including qualitative discrimination on abnormal and sound potato, and even round and oval potato, with the recognition accuracy of more than 83%. Weight is an important indicator for potato grading, and the image classification accuracy presents more than 93%. The image recognition of potato mechanical damage focuses on qualitative identification, with the main affecting factors of damage shape and damage time. The image recognition of potato germination usually uses potato surface image and edge germination point. Both of the qualitative and quantitative detection of green potato have been researched, currently scab and blackheart image recognition need to be operated using the stable detection environment or specific device. The image recognition of processed potato mainly focuses on potato chips, slices and fries, etc. Conclusion: image recognition as a food rapid detection tool have been widely researched on the area of raw and processed potato quality analyses, its technique and equipment have the potential for commercialization in short term, to meet to the strategy demand of development potato as
Trace elements detection in whole food samples by Neutron Activation Analysis, k0-method
International Nuclear Information System (INIS)
Sathler, Márcia Maia; Menezes, Maria Ângela de Barros Correia; Salles, Paula Maria Borges de
2017-01-01
Inorganic elements, from natural and anthropogenic sources are present in foods in different concentrations. With the increase in anthropogenic activities, there was also a considerable increase in the emission of these elements in the environment, leading to the need of monitoring the elemental composition of foods available for consumption. Numerous techniques have been used to detect inorganic elements in biological and environmental matrices, always aiming at reaching lower detection limits in order to evaluate the trace element content in the sample. Neutron activation analysis (INAA), applying the k 0 -method, produces accurate and precise results without the need of chemical preparation of the samples – that could cause their contamination. This study evaluated the presence of inorganic elements in whole foods samples, mainly elements on trace levels. For this purpose, seven samples of different types of whole foods were irradiated in the TRIGA MARK I IPR-R1 research reactor - located at CDTN/CNEN, in Belo Horizonte, MG. It was possible to detect twenty two elements above the limit of detection in, at least, one of the samples analyzed. This study reaffirms the INAA, k 0 - method, as a safe and efficient technique for detecting trace elements in food samples. (author)
Nout, M.J.R.; Aidoo, K.E.
2010-01-01
In Asian countries, there is a long history of fermentation of foods and beverages. Diverse micro-organisms, including bacteria, yeasts and moulds, are used as starters, and a wide range of ingredients can be made into fermented foods. The main raw materials include cereals, leguminous seeds,
Indonesian CPO availability analysis to support food and energy security: a system dynamic approach
Rahman, T.; Arkeman, Y.; Setyaningsih, D.; Saparita, R.
2017-05-01
The development of biofuels could be a solution to overcome the energy problem. One of biofuel that has the potential to be developed, namely palm oil biodiesel that is also the raw material for food. As a provider of CPO raw materials, the production of palm biodiesel could trigger competitions, from biofuels demand growth and utilization of agricultural resources. Thus, it needs to be analyzed to determine the adequency of CPO supply to fulfill the need of food and policy recomendation which sets the development of palm oil biodiesel can be synergies with food need especially for the supply of raw material CPO. To obtain the optimal policy in the synergy between the raw material of CPO for food and energy is a need to establish some policy scenarios that allow to be applied and then chosen the best policy alternative of all scenarios. The purpose of this research were to : 1) analysis the availability of CPO to meet the needs of food and energy, 2) provide policy recommendation with regard biodiesel development of food security. The model made used system dynamic method. Several scenarios that used in the model are: 1) existing condition, 2) The scenario increase biodiesel production capacity and increase land productivity, 3) reduction scenario CPO export by 30%, 4) scenario use othe raw material for biodiesel by 20%. The simulation results showed the availability of CPO raw materials would answer all needs of both food and biodiesel when there was an increase in productivity, diversification of raw materials, and also a reduction in palm oil exports. It was needed an integrated policy from upstream to downstream along with the consistency of implementation. Policy suggestions that could be considered were increased productivity through agricultural intensification, enforcement disincentive policies of CPO to exports, and development of non-CPO biodiesel raw materials and development of renewable energy.
Incorporation of Listeria monocytogenes strains in raw milk biofilms.
Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias
2013-02-01
Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.
Bird, Patrick; Flannery, Jonathan; Crowley, Erin; Agin, James; Goins, David; Jechorek, Robert
2014-01-01
The 3M™ Petriflm™ Salmonella Express (SALX) System is a simple, ready-to-use chromogenic culture medium system for the rapid qualitative detection and biochemical confirmation of Salmonella spp. in food and food process environmental samples. The 3M Petrifilm SALX System was compared using an unpaired study design in a multilaboratory collaborative study to the U.S. Department of Agriculture/Food Safety and Inspection Service (USDA/FSIS) Microbiology Laboratory Guidebook (MLG) 4.07 (2013) Isolation and Identification of Salmonella from Meat, Poultry, Pasteurized Egg and Catfish Products and Carcass and Environmental Sponges for raw ground beef and the U.S. Food and Drug Administration Bacteriological Analytical Manual (FDA/BAM) Chapter 5, Salmonella (2011) reference method for dry dog food following the current AOAC validation guidelines. For this study, a total of 17 laboratories located throughout the continental United States evaluated 1872 test portions. For the 3M Petrifilm SALX System, raw ground beef was analyzed using 25 g test portions, and dry dog food was analyzed using 375 g test portions. For the reference methods, 25 g test portions of each inatrix were analyzed. The two matrices were artificially contaminated with Salmonella at three inoculation levels: an uninoculated control level (0 CFU/test portion), a low inoculum level (0.2-2 CFU/test portion), and a high inoculum level (2-5 CFU/test portion). Each inoculation level was statistically analyzed using the probability of detection statistical model. For the raw ground beef and dry dog food test portions, no significant differences at the 95% confidence interval were observed in the number of positive samples detected by the 3M Petrifilm SALX System versus either the USDA/FSIS-MLG or FDA/BAM methods.
BASED COMPLEMENTARY FOODS USING GERMINAT
African Journals Online (AJOL)
user
2010-08-08
Aug 8, 2010 ... Malnutrition affects physical growth, morbidity, mortality, cognitive development, reproduction, and ... malnutrition. Development of complementary foods is guided by nutritional value, acceptability, availability and affordability of raw materials, and simplicity of food processing ... (Memmert, Germany) at 55. 0.
The enzymatic determination of starch in food, feed and raw materials of the starch industry
Brunt, K.; Sanders, P.; Rozema, T.
1998-01-01
An enzymatic starch determination which can be used for the analysis of starch in a very broad range of different samples is evaluated, ranging from starch in plants, feed and food to industrial applications as starch in starch. The method is based on a complete enzymatic conversion of the starch
Occurrence of 1,4-dioxane in cosmetic raw materials and finished cosmetic products.
Black, R E; Hurley, F J; Havery, D C
2001-01-01
Surveys of cosmetic raw materials and finished products for the presence of the carcinogen 1,4-dioxane have been conducted by the U.S. Food and Drug Administration since 1979. Analytical methods are described for the determination of 1,4-dioxane in ethoxylated cosmetic raw materials and cosmetic finished products. 1,4-Dioxane was isolated by azeotropic atmospheric distillation and determined by gas chromatography using n-butanol as an internal standard. A solid-phase extraction procedure based on a previously published method for the determination of 1,4-dioxane in cosmetic finished products was also used. 1,4-Dioxane was found in ethoxylated raw materials at levels up to 1410 ppm, and at levels up to 279 ppm in cosmetic finished products. Levels of 1,4-dioxane in excess of 85 ppm in children's shampoos indicate that continued monitoring of raw materials and finished products is warranted.
Anaerobic co-digestion of food waste and landfill leachate in single-phase batch reactors
International Nuclear Information System (INIS)
Liao, Xiaofeng; Zhu, Shuangyan; Zhong, Delai; Zhu, Jingping; Liao, Li
2014-01-01
Highlights: • Anaerobic co-digestion strategy for food waste treatment at OLR 41.8 g VS/L. • A certain amount of raw leachate effectively relieved acidic inhibition. • The study showed that food waste was completely degraded. - Abstract: In order to investigate the effect of raw leachate on anaerobic digestion of food waste, co-digestions of food waste with raw leachate were carried out. A series of single-phase batch mesophilic (35 ± 1 °C) anaerobic digestions were performed at a food waste concentration of 41.8 g VS/L. The results showed that inhibition of biogas production by volatile fatty acids (VFA) occurred without raw leachate addition. A certain amount of raw leachate in the reactors effectively relieved acidic inhibition caused by VFA accumulation, and the system maintained stable with methane yield of 369–466 mL/g VS. Total ammonia nitrogen introduced into the digestion systems with initial 2000–3000 mgNH 4 –N/L not only replenished nitrogen for bacterial growth, but also formed a buffer system with VFA to maintain a delicate biochemical balance between the acidogenic and methanogenic microorganisms. UV spectroscopy and fluorescence excitation–emission matrix spectroscopy data showed that food waste was completely degraded. We concluded that using raw leachate for supplement water addition and pH modifier on anaerobic digestion of food waste was effective. An appropriate fraction of leachate could stimulate methanogenic activity and enhance biogas production
Anaerobic co-digestion of food waste and landfill leachate in single-phase batch reactors
Energy Technology Data Exchange (ETDEWEB)
Liao, Xiaofeng; Zhu, Shuangyan; Zhong, Delai; Zhu, Jingping, E-mail: jpzhuhust@163.com; Liao, Li, E-mail: liaoli2003@126.com
2014-11-15
Highlights: • Anaerobic co-digestion strategy for food waste treatment at OLR 41.8 g VS/L. • A certain amount of raw leachate effectively relieved acidic inhibition. • The study showed that food waste was completely degraded. - Abstract: In order to investigate the effect of raw leachate on anaerobic digestion of food waste, co-digestions of food waste with raw leachate were carried out. A series of single-phase batch mesophilic (35 ± 1 °C) anaerobic digestions were performed at a food waste concentration of 41.8 g VS/L. The results showed that inhibition of biogas production by volatile fatty acids (VFA) occurred without raw leachate addition. A certain amount of raw leachate in the reactors effectively relieved acidic inhibition caused by VFA accumulation, and the system maintained stable with methane yield of 369–466 mL/g VS. Total ammonia nitrogen introduced into the digestion systems with initial 2000–3000 mgNH{sub 4}–N/L not only replenished nitrogen for bacterial growth, but also formed a buffer system with VFA to maintain a delicate biochemical balance between the acidogenic and methanogenic microorganisms. UV spectroscopy and fluorescence excitation–emission matrix spectroscopy data showed that food waste was completely degraded. We concluded that using raw leachate for supplement water addition and pH modifier on anaerobic digestion of food waste was effective. An appropriate fraction of leachate could stimulate methanogenic activity and enhance biogas production.
RAW MILK IN AUTOMATIC SALE MACHINES: MONITORING PLAN IN PIEDEMONT REGION
Directory of Open Access Journals (Sweden)
S. Gallina
2010-06-01
Full Text Available Raw milk at vending machine is surging in popularity amongst consumers of Northern Italy; indeed in Piedmont Region there are more than 100 vending machines. In June 2008 Piedmont Region set out a specific monitoring plan to check the milk quality. From June to December 2008, 113 raw milk samples were collected at vending machines. Samples were analysed for Listeria monocytogenes, Salmonella spp., coagulase positive staphylococci, Staphylococcus aureus and Campylobacter. Moreover, 100 samples were analysed for the quantification of aflatoxin M1. 26 samples have been resulted Not Conform for the hygienic criteria and 1 exceeded the aflatoxin M1 limit.
Trace Metal Levels in Raw and Heat Processed Nigerian Staple ...
African Journals Online (AJOL)
The levels of some trace metals (Fe, Zn, Cu, Ni, Cd) were quantitatively determined in raw and heat processed staple food cultivars (yam, cassava, cocoyam and maize) from oil producing areas of part of the Niger Delta and compared with a non-oil producing area of Ebonyi State as control. The survey was conducted to ...
Solberg, Siri Løvsjø; Terragni, Laura; Granheim, Sabrina Ionata
2016-08-01
To identify the use of ultra-processed foods - vectors of salt, sugar and fats - in the Norwegian diet through an assessment of food sales. Sales data from a representative sample of food retailers in Norway, collected in September 2005 (n 150) and September 2013 (n 170), were analysed. Data consisted of barcode scans of individual food item purchases, reporting type of food, price, geographical region and retail concept. Foods were categorized as minimally processed, culinary ingredients, processed products and ultra-processed. Indicators were share of purchases and share of expenditure on food categories. Six geographical regions in Norway. The barcode data included 296 121 observations in 2005 and 501 938 observations in 2013. Ultra-processed products represented 58·8 % of purchases and 48·8 % of expenditure in 2013. Minimally processed foods accounted for 17·2 % of purchases and 33·0 % of expenditure. Every third purchase was a sweet ultra-processed product. Food sales changed marginally in favour of minimally processed foods and in disfavour of processed products between 2005 and 2013 (χ 2 (3)=203 195, Pprocessed products accounted for the majority of food sales in Norway, indicating a high consumption of such products. This could be contributing to rising rates of overweight, obesity and non-communicable diseases in the country, as findings from other countries indicate. Policy measures should aim at decreasing consumption of ultra-processed products and facilitating access (including economic) to minimally processed foods.
Directory of Open Access Journals (Sweden)
F. Giacometti
2011-04-01
Full Text Available While a study on the presence of foodborne pathogens in in-line milk filters of Italian dairy farms authorized for production and sale of raw milk was in progress, we fortuitously detected and isolated some Arcobacter spp. during routine analysis for thermotolerant Campylobacter. This observation suggested that extraordinary and non-standardized growth conditions for detection and identification were needed to provide more information and data on this poorly known emergent zoonotic pathogen. The presence of Arcobacter butzleri and Arcobacacter cryaerophilus in milk filters of dairy farms authorized for production and sale of raw milk poses a risk for public health and rather suggests that raw milk samples should also be examined for Arcobacter contamination. While the role of Arcobacter spp. in human disease awaits further evaluation, a precautionary approach is advisable and control measures to prevent or to eliminate the hazard of Arcobacter spp. in food and from the human food chain should be encouraged as well as more epidemiological studies. With this article, we review the literature of this organism in order to focus the relevant information to food safety.
Directory of Open Access Journals (Sweden)
Liliana Tudoreanu
2013-11-01
Full Text Available The present research was conducted to provide information on the influence of stunning methods in conjunction with refrigeration and freezing time on the textural and rheological properties of raw meat. Pork raw meat, commercially available, was analyzed for textural properties such as hardness, cohesiveness, adhesiveness and fracture force. Sample were analyzed fresh, after 3 days of refrigeration, and 15 days, 30days and 60 days freezing time in commercially available refrigerators mimicking the storing conditions used by consumers. For pork raw meat, hardness increased sharply after 3 days of refrigeration and showed no significant differences after 15days of freezing compared to 3days refrigeration time. After 30 days of freezing the raw pork meat samples’ hardness decreased significantly compared to the hardness of the samples freeze for15 days. Hardness of gas stunning raw pork meat samples compared to electrical stunning raw pork meat samples was 2.57 times higher indicating a better firmness of the gas stunning raw pork meat. The cohesiveness of the raw pork meat from gas stunned animals maintained its levels after 60 days of freezing while the meat from electrically stunned animals showed significant modificatio
Somsen, D.J.
2004-01-01
Food processors face increasing demands to improve their raw material yield efficiency. To really understand the raw material yield efficiency of food processing, mass losses need to be divided in wanted (desired) and unwanted ones. The basic approach to increase the raw material yield efficiency is
Food Hardship and Obesity in a Sample of Low-Income Immigrants.
Caspi, Caitlin E; Tucker-Seeley, Reginald D; Adamkiewicz, Gary; Roberto, Christina A; Stoddard, Anne M; Sorensen, Glorian C
2017-02-01
Very little work has examined the relationship between food hardship (having inconsistent financial resources to buy food) and obesity among immigrant groups. A cross-sectional study was conducted in a low-income, multi-racial/ethnic adult sample in greater Boston, MA (n = 828). Modified Poisson regression models estimated the association between food hardship obesity (BMI ≥ 30) among adults reporting food hardship; interactions were tested by place of birth. Body mass index (BMI) was based on anthropometric height and weight. In adjusted models, those experiencing food hardship were more likely to be obese (RR 1.17, CI 1.07, 1.29) than those not experiencing food hardship. Participants from Haiti reporting food hardship were more likely to be obese than those not reporting hardship (RR 1.58, CI 1.23, 2.04); this was not the case among other groups (US born, Puerto Rican, Latin American, Other). The relationship between food hardship and weight may vary among immigrant subgroups.
Functional foods as a way of strengthening food security
Directory of Open Access Journals (Sweden)
O. G. Stukalo
2017-01-01
Full Text Available The solution of the problem of food security in the region plays an important role in providing the population with the necessary food. The article describes ways to achieve food security. Different opinions are presented on the causes of the problem of food security, in particular the spread of genetically modified organisms, as well as low incomes of the population, the volatility of food prices and insignificant reproduction opportunities. The analysis of production and consumption of various food products in the Russian Federation (RF in recent years has been carried out. Dynamics of consumption of the main types of food in the Voronezh region is also presented. An analysis has been made of the production and consumption of various food products in the Russian Federation (RF in recent years. Dynamics of consumption of the main types of food in the Voronezh region is also presented. A solution to the problem of food security with flour culinary products using non-traditional plant raw materials, also used as functional food products, was proposed. Examples are given of improving the quality of food products and increasing the content of dietary fiber and other useful nutrients, thanks to the use of secondary raw materials, bugs and processed products of plant origin. The food security of the region has only conditional territorial localization, since the economic relations that arise between the subjects of the food sector cover all subjects of the regional economy without exception. A special role in these relations in the conditions that have developed up to now is played by organizations related to the sphere of food production, as well as organizations that supply them with the most scarce and significant resources, i.e. organization of education, research and development. That is why, we believe that the main emphasis in the study of food security should be made on the specifics of the functioning of industrial organizations occupying a
Review Paper of Radionuclide Monitoring in Food Sample
International Nuclear Information System (INIS)
Noor Fadzilah Yusof; Abdul Kadir Ishak; Wo, Y.M.; Nurrul Assyikeen Mohd Jaffary
2011-01-01
The uncontrolled release of radionuclides into the atmospheric and aquatic environments may occur as the result of a nuclear or radiological accident. Monitoring of the accidental release at its source and especially direct monitoring of the environmental contamination with radionuclides is necessary for assessment and application of public protective actions and longer term countermeasures as well as emergency workers' protection. In areas historically contaminated with long lived radionuclides monitoring it is essential to protect the public and substantiation of any radiological incidents. Also, dietary pathways can be contaminated with radioactive materials resulting from natural occurrence or man-made applications especially during routine operation, accidents and migration of radionuclides from radioactive waste disposal repositories into the biosphere. Therefore, efforts should be made to determine the presence of radionuclides in a potentially high radiation area especially in operational nuclear facilities. This paper will review the strategies for food monitoring that has been adapted in most countries to obtain baseline data for future reference. Also, this study is discussing the type of food selection commonly collected as sample for radionuclide analysis in different countries over the years. Sampling procedure and analysis also included in this review for better understanding of the analysis. Stake holders' involvement is considered as an important asset in the establishment of monitoring strategies. As a conclusion, future plans for food monitoring programme in Malaysia are recommended as a preparation to embark on the Nuclear Power Plant programme. (author)
Use of computed radiology in the food industry
International Nuclear Information System (INIS)
Kleven, S.
2004-01-01
The reliability and integrity of food products is of paramount importance and is governed in the United States by the Food and Drug Administration (FDA) and the United States Department of Agriculture (USDA). Strict laws on contamination with organic and inorganic matter are closely monitored by those companies who process food. The inadvertent introduction of metallic objects into food products by processing equipment is an area that is especially closely scrutinised. Metal detectors and other non-destructive testing (NDT) methods are frequently used during inline processing and packaging. The testing equipment is part of the conveyor system. Some food processors have taken steps above and beyond normal requirements and may sample product offline either as part of in process testing or a final test. Typical products tested include: frozen dinners in foil pans with cardboard covers for foreign objects; raw chicken to ensure thorough removal of bones; and hamburger after processing for metallic screening or foreign objects
Salmonella testing of pooled pre-enrichment broth cultures for screening multiple food samples.
Price, W R; Olsen, R A; Hunter, J E
1972-04-01
A method has been described for testing multiple food samples for Salmonella without loss in sensitivity. The method pools multiple pre-enrichment broth cultures into single enrichment broths. The subsequent stages of the Salmonella analysis are not altered. The method was found applicable to several dry food materials including nonfat dry milk, dried egg albumin, cocoa, cottonseed flour, wheat flour, and shredded coconut. As many as 25 pre-enrichment broth cultures were pooled without apparent loss in the sensitivity of Salmonella detection as compared to individual sample analysis. The procedure offers a simple, yet effective, way to increase sample capacity in the Salmonella testing of foods, particularly where a large proportion of samples ordinarily is negative. It also permits small portions of pre-enrichment broth cultures to be retained for subsequent individual analysis if positive tests are found. Salmonella testing of pooled pre-enrichment broths provides increased consumer protection for a given amount of analytical effort as compared to individual sample analysis.
Akineden, Ömer; Murata, Kristina Johanna; Gross, Madeleine; Usleber, Ewald
2015-12-01
The microbiological quality of 132 dried pasta products available on the German market, originating from 11 different countries, was studied. Sample materials included soft or durum wheat products, some of which produced with other ingredients such as eggs, spices, or vegetables. Parameters included hygiene indicators (aerobic plate count, mold count, the presence of Enterobacteriaceae) and pathogenic/toxinogenic bacterial species (Salmonella spp., Staphylococcus aureus, presumptive Bacillus cereus, and Cronobacter spp.). The overall results of hygiene parameters indicated a satisfactory quality. Salmonella was not found in any sample. Three samples were positive for S. aureus (10(2) to 10(4) colony forming unit (CFU)/g). Presumptive B. cereus at levels of 10(3) to 10(4) CFU/g were detected in 3 samples. Cronobacter spp. were isolated from 14 (10.6%) products. Of these, 9 isolates were identified as C. sakazakii, 2 each as C. turicensis and C. malonaticus, and 1 as C. muytjensii. The isolates were assigned to 9 multilocus sequence typing (MLST) sequence types and to 14 different PFGE profiles. Although pasta products are typically cooked before consumption, some consumers, and children in particular, may also eat raw pasta as nibbles. Raw pasta seems to be a relevant source of exposure to dietary Cronobacter spp., although health risks are probably restricted to vulnerable consumers. High numbers of presumptive B. cereus as found in some samples may be a risk after improper storage of cooked pasta products because toxinogenic strains are frequently found within this species. © 2015 Institute of Food Technologists®
Four-year monitoring of foodborne pathogens in raw milk sold by vending machines in Italy.
Giacometti, Federica; Bonilauri, Paolo; Serraino, Andrea; Peli, Angelo; Amatiste, Simonetta; Arrigoni, Norma; Bianchi, Manila; Bilei, Stefano; Cascone, Giuseppe; Comin, Damiano; Daminelli, Paolo; Decastelli, Lucia; Fustini, Mattia; Mion, Renzo; Petruzzelli, Annalisa; Rosmini, Roberto; Rugna, Gianluca; Tamba, Marco; Tonucci, Franco; Bolzoni, Giuseppe
2013-11-01
Prevalence data were collected from official microbiological records monitoring four selected foodborne pathogens (Salmonella, Listeria monocytogenes, Escherichia coli O157:H7, and Campylobacter jejuni) in raw milk sold by self-service vending machines in seven Italian regions (60,907 samples from 1,239 vending machines) from 2008 to 2011. Data from samples analyzed by both culture-based and real-time PCR methods were collected in one region. One hundred raw milk consumers in four regions were interviewed while purchasing raw milk from vending machines. One hundred seventy-eight of 60,907 samples were positive for one of the four foodborne pathogens investigated: 18 samples were positive for Salmonella, 83 for L. monocytogenes, 24 for E. coli O157:H7, and 53 for C. jejuni in the seven regions investigated. No significant differences in prevalence were found among regions, but a significant increase in C. jejuni prevalence was observed over the years of the study. A comparison of the two analysis methods revealed that real-time PCR was 2.71 to 9.40 times more sensitive than the culture-based method. Data on consumer habits revealed that some behaviors may enhance the risk of infection linked to raw milk consumption: 37% of consumers did not boil milk before consumption, 93% never used an insulated bag to transport raw milk home, and raw milk was consumed by children younger than 5 years of age. These results emphasize that end-product controls alone are not sufficient to guarantee an adequate level of consumer protection. The beta distribution of positive samples in this study and the data on raw milk consumer habits will be useful for the development of a national quantitative risk assessment of Salmonella, L. monocytogenes, E. coli O157, and C. jejuni infection associated with raw milk consumption.
o-TOF ICPMS analysis of environmental, food and biological samples
International Nuclear Information System (INIS)
Krejcova, A.; Cernohorsky, T.; Ludvikova, I.; Pouzar, M.; Capova, L.
2009-01-01
Full text: o-TOF ICPMS was used for inorganic analysis of environmental, food and biological samples. The method validity was proved by analysis of spiked samples, reference materials, by determination without/with internal standards and the standard addition technique. The technique was shown to be powerful, and reliable for analysis of the samples mentioned, and high sample throughput enables environmental or biological screening studies. Independent of the number of elements analyzed, complete analysis and whole mass spectra are gained from a small sample amount in a very short time. (author)
Food Safety for Warmer Weather
... fruits and vegetables. Avoid undercooked seafood, meats, and eggs. For safe cooking temperature, see Foodsafety.gov . Keep raw meat, poultry, seafood, and their juices away from other foods. Keep hot foods hot and ... pasteurized eggs and egg products. Report suspected foodborne illness to ...
Dutilh, C.; Blonk, H.; Linnemann, A.R.
2014-01-01
Nature generates the raw materials for food, fuelled by energy from the sun. However, before food can be consumed, (mineral) energy is required for cultivation, transportation, preparation and conservation purposes. This paper presents and discusses the energy requirements for various categories of
A nationwide survey of NDMA in raw and drinking water in Japan.
Asami, Mari; Oya, Masami; Kosaka, Koji
2009-05-15
A nationwide survey of N-nitrosodimethylamine (NDMA) in both raw and finished water samples from drinking water treatment plants (DWTPs) in Japan was conducted. NDMA was analyzed by solid-phase extraction (SPE) followed by ultra performance liquid chromatography (UPLC) coupled with tandem mass spectrometry (MS/MS). NDMA was detected in 15 of 31 raw water samples collected in the summer at concentrations up to 2.6 ng/L, and in 9 of 28 raw water samples collected in winter at concentrations up to 4.3 ng/L. The NDMA concentrations were higher in raw water samples collected from treatment plants with catchment areas that have high population densities. The NDMA concentrations were higher in river water samples collected from the east and west of Japan than in those collected from other areas. NDMA was detected in 10 of 31 finished samples collected in summer at reduced concentrations of up to 2.2 ng/L, while 5 of 28 finished samples collected in winter showed NDMA concentrations up to 10 ng/L. The highest NDMA levels were detected in finished water samples collected from the Yodo River basin DWTP, which uses ozonation. Furthermore, evaluation of the process water produced at six advanced water treatment plants was conducted. Influent from the Yodo River indicated that the NDMA concentration increased during ozonation to as high as 20 ng/L, and then decreased with subsequent biological activated carbon treatment. To our knowledge, this is the first nationwide evaluation of NDMA concentrations in water conducted in Japan to date.
VERAM, for a sustainable and competitive future for EU Raw Materials
Mobili, A.; Tittarelli, F.; Revel, G. M.; Wall, P.
2018-03-01
The project, VERAM “Vision and Roadmap for European Raw Materials”, aims to deliver a mapping of on-going initiatives on non-food, non-energy raw materials (including metals, industrial minerals, aggregates and wood) at European, Member State, and regional levels both from the Research and Innovation (R&I), industry, and policy perspectives. Moreover, based on a comprehensive gap analysis, VERAM will propose a common long term 2050 Vision and Roadmap in coordination and cooperation with all stakeholders across the value chain. For the first time, two European Technology Platforms (ETPs) together with their corresponding European Research Area Networks (ERA-NETs) are joining forces to develop a common roadmap.
Bayesian solutions for food science problems?
Boekel, van M.A.J.S.
2004-01-01
This paper starts with an overview of some typical food-science problems. In view of the development of safe and healthy food, the use of mathematical models in food science is much needed and the use of statistics is therefore indispensable. Because of the biological variability in the raw
Hermann, N; Schubert, I
2015-07-01
A notification from a laboratory concerning the detection of Campylobacter jejuni in a 6-year-old boy initiated the investigation carried out by the health authorities from Stendal district, in order to explain the morbidity rate caused by the germ. The day after the boy's pediatrician informed about a visit to a farm, which was confirmed by the head of the nursery. She told the health authorities about the consumption of raw milk during their visit at the farm.The following days more children fell sick. Within 10 days the total number of diseased children was 21. The health authorities asked for stool samples of the diseased children, nursery nurses and the head of the farm since raw milk presents a potential cause of infection. The health authorities together with the Saxony-Anhalt State Office for Consumer Protection conducted a retrospective cohort study. The aim was to explain the association between the exposure from raw milk consumption and the occurrence of the disease from C. jejuni. Based on a questionnaire data about the food and milk intake at the nursery and at home and about the trip to the farm were collected. 91% of the children's cohort and 86% of the adults' cohort were captured.The exposed group at risk showed a higher risk of falling ill than the group, which was not exposed. The risk factor raw milk explained the difference. Furthermore, the analysis of milk samples taken by the district veterinary office from 2 cows and from the farm's tank was able to detect the germs. The correlation of the illness, the consumption of raw milk, the detection of C. jejuni in the samples taken from the children and the samples taken from the cows was evident. Based on the case the health authorities recommended that heads of nurseries as well as heads of dairy farming in the district of Stendal needed to be advised on raw milk. Nurseries are still allowed to take trips to farms. However, raw animal derivates including milk must not be consumed. © Georg Thieme
Harada, Seiya; Furukawa, Masato; Tokuoka, Eisuke; Matsumoto, Kazutoshi; Yahiro, Shunsuke; Miyasaka, Jiro; Saito, Morihiro; Kamata, Yoichi; Watanabe, Maiko; Irikura, Daisuke; Matsumoto, Hiroshi; Sugita-Konishi, Yoshiko
2013-01-01
More than 27 outbreaks per year of food poisoning caused by consuming horse meat were reported in Kumamoto Prefecture (including Kumamoto City) from January 2009 to September 2011. It was found that the causative agent of the outbreaks was a protein with a molecular weight of 15 kDa that had originated from bradyzoites of Sarcocystis fayeri parasitizing the horse meat. Rabit ileal loop tests showed that pepsin treatment of homogenates of frozen horse meat containing the cysts of S. fayeri induced loss of toxicity, presumably by digestion of the proteinous causative agent(s). Slices of horse meat containing the cysts were frozen at below -20°C for various periods. The cysts were collected after thawing the slices, then treated in an artificial stomach juice containing pepsin. The bradyzoites of the cysts kept at -20°C for 48 hr or more completely disappeared. Simultaneously, the 15 kDa protein also disappeared in the frozen cysts. After notifying the public and recommending freezing treatment of horse meat, no subsequent cases of food poisoning were reported. This indicates that freezing of horse meat is effective to prevent the occurrence of food poisoning caused by consuming raw horse meat containing S. fayeri.
Molds contamination of raw milk and dairy products: Occurrence, diversity and contamination source
Directory of Open Access Journals (Sweden)
T Moshtaghi Maleki
2015-11-01
Full Text Available This study aimed to assess the occurrence and diversity of mold species in raw milk and its products along with the identification of potential contamination sources. For this reason, a total of 260 samples consisting of 80 raw milk, 100 dairy products (i.e., pasteurized milk, yoghurt, cheese and buttermilk and 80 environmental (i.e. ingredients, packaging materials, surface of processing equipments and air specimens were collected. Using culture assay and microscopic observation, the occurrence as well as the diversity of mold species was investigated. According to the results, 82.3% of the samples were identified as positive for mold contamination. The percentage of mold contamination for raw milk was estimated as 97.5%. In the case of pasteurized milk, yoghurt, buttermilk, cheese and environmental samples, it was determined as 52%, 76%, 52%, 56% and 96.25%, respectively. Mold diversity among various samples consisted of Aspergillus, Geotrichum, Penicillium, Mucor, Alternaria, Rhizopus, Stemphylium, Cladosporium, and Fusarium. Results revealed a significant (p < 0.01 correlation between kind of mold species isolated from raw milk and dairy products. Similarly, a correlation was observed between dairy products and environmental sources. Regarding the high occurrence of mold contamination in raw milk and environmental sources, it seems that in some instances heat treatment was not effective enough to inactivate all molds; whereas in some other cases, cross contamination may have resulted in mold contamination. Therefore, it is crucial to maintain hygienic conditions during raw milk handling as well as processing steps. These practices could efficiently reduce the occurrence of mold contaminations in dairy products.
Radiation sterilization of some cosmetic raw materials and preparations
International Nuclear Information System (INIS)
Achmatowicz-Szmajke, T.; Bryl-Sandelewska, T.; Galazka, M.
1979-01-01
The problem of microbiological purity of cosmetic preparations is discussed. Some results obtained on the influence of ionizing radiation on organoleptic and physicochemical properties of some cosmetic raw materials and final products are reported. The samples of raw materials and the final products were irradiated with a 10 MeV electron beam from an LAE 13/9 linear accelerator located in INR. The doses delivered to the materials were 0.5 - 2.3 Mrad (5-23 kGy). Immediately after irradiation, organoleptic estimations were made and over the next few days physicochemical investigations were performed. Non-irradiated samples were investigated together with irradiated ones. (T.I.)
[Smoked sausages and food additives: evaluation of total mutagenic activity].
Dugan, A M; Tkacheva, D L
2011-01-01
The paper deals with the evaluation of the total mutagenic activity of samples of the inorganic and organic fractions of three technology smoked sausages (boiled-smoked, semi-smoked, and raw-smoked) and some food additives used to manufacture the above sausages. Their mild and moderate mutagenic effects were recorded in a Salmonella typhimurium bacterial test system with a metabolic activation system. Physicochemical analysis of the fractions of the smoked sausages has shown that their study samples are substantially contaminated with heavy metals and representatives of polycyclic aromatic hydrocarbons, partially causing the mutagenic effects observed.
Mineralogy And Raw Material Characterization Of Esie Stone ...
African Journals Online (AJOL)
Electronprobe mineral data of samples of Esie statues is presented as a possible tool for provenance studies. Most of the samples contain talc, chlorite, cummingtonite and rarely tremolite. Other talc-bearing schists are prevalent in the Esie area. However talc-cummingtonite rocks, similar to the raw materials used for the ...
Schlegelová, J; Babák, V; Holasová, M; Dendis, M
2008-01-01
Isolates from the "farm to fork" samples (182 isolates from 2779 samples) were examined genotypically (icaAB genes) and phenotypically (in vitro biofilm formation, typical growth on Congo red agar; CRA) with the aim to assess the risk of penetration of virulent strains of Staphylococcus epidermidis into the food chain. The contamination of meat and milk products was significantly higher in comparison with raw materials. Contamination of contact surfaces in the meat-processing plants was significantly lower than that of contact surfaces in the dairy plants. The ica genes (which precondition the biofilm formation) were concurrently detected in 20 isolates that also showed a typical growth on CRA. Two ica operon-negative isolates produced biofilm in vitro but perhaps by an ica-independent mechanism. The surfaces in the dairy plants and the milk products were more frequently contaminated with ica operon-positive strains (2.3 and 1.2 % samples) than the other sample types (0-0.6 % samples).
Lobo, M L; Xiao, L; Antunes, F; Matos, O
2009-06-01
Waterborne outbreaks of diarrhoeal illness reported worldwide are mostly associated with Cryptosporidium spp. and Giardia spp. Their presence in aquatic systems makes it essential to develop preventive strategies for water and food safety. This study was undertaken to monitor the presence of Cryptosporidium and Giardia in a total of 175 water samples, including raw and treated water from both surface and ground sources in Portugal. The samples were processed according to USEPA Method 1623 for immunomagnetic separation (IMS) of Cryptosporidium oocysts and Giardia cysts, followed by detection of oocysts/cysts by immunofluorecence (IFA) microscopy, PCR-based techniques were done on all water samples collected. Out of 175 samples, 81 (46.3%) were positive for Cryptosporidium and 67 (38.3%) for Giardia by IFA. Cryptosporidium spp. and G. duodenalis genotypes were identified by PCR in 37 (21.7%) and 9 (5.1%) water samples, respectively. C. parvum was the most common species (78.9%), followed by C. hominis (13.2%), C. andersoni (5.3%), and C. muris (2.6%). Subtype IdA15 was identified in all C. hominis-positive water samples. Subtyping revealed the presence of C. parvum subtypes IIaA15G2R1, IIaA16G2R1 and IIdA17G1. Giardia duodenalis subtype A1 was identified. The results of the present study suggest that Cryptosporidium spp. and Giardia spp. were widely distributed in source water and treated water in Portugal. Moreover, the results obtained indicate a high occurrence of human-pathogenic Cryptosporidium genotypes and subtypes in raw and treated water samples. Thus, water can be a potential vehicle in the transmission of cryptosporidiosis, and giardiasis of humans and animals in Portugal.
The study of biological value of peptone derived from secondary raw fish
Directory of Open Access Journals (Sweden)
Kuranova L. K.
2016-09-01
Full Text Available The possibility of using secondary fish raw materials in particular musculoskeletal waste from filleting the cod species of fish as raw material base for production of food peptones has been studied. The content of water, fat, protein substances, chloride sodium in the raw material and the product have been determined by standard methods. Amino-acid composition has been determined by high effective liquid chromatography. The biological value of peptone and the balance of essential amino acids have been calculated. It has been established that waste from the cod filleting (the humerus with excess flesh contains 18.95 % protein and a slight (0.15 % amount of fat. The models of peptone – fermentative fish hydrolyzate obtained from cod withdrawals – have been researched. Proteolytic activity used in the hydrolysis of enzyme (protosubtilin G3X has been defined as 560.77 mmol TYR/g. Peptone is an amorphous, fine powder of a light beige color. The product is hygroscopic, readily soluble in water. The chemical and biochemical quality characteristics of enzymatic peptone have been defined. Mass fraction of protein in the derived product is 92.27 %, mass fraction of water – 4.7 %, sodium chloride and 2.6 %, fat – 0.3 %. The total number of amino acids in the product is 94.7 %. Peptone in protein contains all the essential amino acids, the total content of which is 40.8 %. The biological value of the product has been estimated by calculation methods. It has been established that tryptophan is the only limiting amino acid in the protein of peptone, amino-acid score is 66.8 %, the rationality coefficient of the product is 0.42, which characterizes it as a fairly balanced protein product. Peptone obtained from secondary fish raw materials by protein content and its properties corresponds to the category of protein isolates and can be recommended for use in food as complete protein food additives and as protein content in sports nutrition products.
Improving the Technology of Obtaining Technical Ethanol from Alternative Raw Materials
Directory of Open Access Journals (Sweden)
Sergіj Petrov
2018-05-01
Full Text Available The purpose of the article is to study the properties of fallen leaves as raw materials for the production of bioethanol; Improvement of the technology of recycling cellulosic raw materials into bioethanol in the most energy-efficient and ecological way. As a result of the study, it has been found out that the production of biofuels from renewable raw materials is characterized by features of innovative technology: the rapid growth of this sector of economy is accompanied by a significant increase in market share. The use of fallen leaves as raw material will eliminate the current conflict of interests associated with the use of food raw materials for the production of bioethanol, will prevent the withdrawal of resources from the sphere of food production. Significant positive factors in the production and use of biofuels are improvement of environmental conditions, reduction of the harmful effects of exhaust gases on the human body, reducing environmental pollution and, consequently, reducing morbidity and associated costs of medical care. The use of bioethanol as an ecobiopilot makes it possible to increase the octane number of fuel, and, accordingly, increase the efficiency of the engine. Thus, the use of bioethanol leads to a qualitative improvement of technical and economic indicators, which is also an indicator of innovation. The threat of reducing (exhausting non-renewable sources of energy is also the factor that necessitates the development and improvement of biofuel production technology. The relatively low profitability of biofuel production is due to the low yield of the target product and the high cost of pre-treatment of cellulose raw materials. The method of obtaining bioethanol from renewable non-demanded raw materials - fallen leaves - was improved. The technique allows to increase the bioethanol yield due to more effective hydrolysis of hard-hydrolysable polysaccharides. Further development of the study of the differences in
Directory of Open Access Journals (Sweden)
Duggan Sharon
2012-09-01
Full Text Available Abstract Food Business Operators (FBO are responsible for the safety of the food they produce and in Ireland those under the regulatory control of the Department of Agriculture, Food and Marine are required to provide summary data on microbiological tests undertaken as part of their food safety controls. These data are provided to the National Reference Laboratory through the 25 private laboratories undertaking the testing. Results Over the five-year period Salmonella sp. was isolated from 0.7% of the 254,000 raw meat or raw meat products tested with the annual prevalence ranging from 0.5 to 1.1%. Poultry meats were consistently more contaminated than other meats with higher recovery rates in turkey (3.3%, duck (3.3%, and chicken (2.5% compared with meats of porcine (1.6%, ovine (0.2% and bovine origin (0.1%. Salmonella sp. was also isolated from 58 (0.06% of the 96,115 cooked or partially cooked meat and meat products tested during the reporting period with the annual percentage positive samples ranging from 0.01 to 0.16%. A total of 50 different serotypes were recovered from raw meats over this period with the greatest diversity found in poultry samples (n = 36. Four serotypes, Kentucky, Typhimurium, Agona and Derby accounted for over 70% of all isolates detected on FBO testing over the period 2005 to 2009. Conclusions Capturing microbiological data generated by Food Business Operators allows the regulatory sector access to a substantial amount of valuable data with the minimum financial outlay.
Virgilio, Antonella; Sinisi, Annamaria; Russo, Valeria; Gerardo, Salvatore; Santoro, Adriano; Galeone, Aldo; Taglialatela-Scafati, Orazio; Roperto, Franco
2015-05-20
Bracken fern (Pteridium aquilinum) is a worldwide plant containing toxic substances, which represent an important chemical hazard for animals, including humans. Ptaquiloside, 1, a norsesquiterpenoid glucoside, is the major carcinogen of bracken detected in the food chain, particularly in the milk from farm animals. To date, ptaquiloside has been shown in the milk of cows feeding on a diet containing bracken fern. This is the first study that shows the systematic detection of ptaquiloside, 1, and reports its direct quantitation in pooled raw milk of healthy sheep and goats grazing on bracken. Ptaquiloside, 1, was detected by a sensitive method based on the chemical conversion of ptaquiloside, 1, into bromopterosine, 4, following gas chromatography-mass spectrometry (GC-MS) analysis. The presence of ptaquiloside, 1, possibly carcinogenic to humans, in the milk of healthy animals is an unknown potential health risk, thus representing a harmful and potential global concern of food safety.
Monitoring of psychrotrophic microorganisms in raw milk
Directory of Open Access Journals (Sweden)
Radka Burdychová
2008-01-01
Full Text Available The group of psychrotrophic microorganisms belongs to the microorganisms representing a risk for human health as well as a risk of milk and milk products spoilage. Some genus are considered to be significant producers of proteolytic and lipolytic enzymes. In this work, we analysed raw milk samples (n = 109 originated from 26 different suppliers from the area of North and Middle Moravia. The screening was performed from March 2007 to February 2008. The total bacterial counts (TBC ranged between 3.2 × 103 to 8.3 × 106 CFU/ml. The psychrotrophic bacterial counts (PBC ranged between 1.0 × 103 to 8.2 × 106 CFU/ml. Total of 48.62 % and 48.62 % of samples exceeded the hygienic limit in raw milk for TBC and PBC, respectively. The correlation between TBC and PBC was highly significant (r = 0.87.Significantly higher (P < 0.05 numbers of psychrotrophic microorganisms were detected in summer months. The identification of isolates was carried out and all strains were sreened for ability to produce proteolytic and lipolytic enzymes. The most commonly identified genus in raw milk was of the genus Pseudomonas. The ability to produce proteases or lipases was found at 76 % identified bacterial strains.
Levels of essential and non-essential metals in the raw seeds and ...
African Journals Online (AJOL)
The levels of metals in raw maize seeds and its processed foods (roasted seed and bread) collected from Shendi, Finote Selam and Debre Tabor (Ethiopia) were determined by flame atomic absorption spectrometry (major metals) and graphite furnace atomic absorption spectrometry (trace and heavy metals) after wet ...
Kim, H W; Hong, Y J; Jo, J I; Ha, S D; Kim, S H; Lee, H J; Rhee, M S
2017-01-01
Microbiological quality of 206 raw ready-to-eat seafood samples was investigated according to species (gizzard shad, halibut, rockfish, tuna, oyster and squid) and distribution channels (fishery, hyper and online market). Enumeration of aerobic plate count and total coliforms (TC) and pathogenic bacteria (Bacillus cereus, Staphylococcus aureus and Vibrio parahaemolyticus) was performed, and level of microbiological quality was classified into four groups: satisfactory, acceptable, unsatisfactory and unacceptable. Qualitative analysis was also performed for Escherichia coli and eight foodborne pathogens (B. cereus, E. coli O157:H7, Listeria monocytogenes, Salmonella spp., S. aureus, Vibrio cholerae, V. parahaemolyticus, and Vibrio vulnificus). Raw ready-to-eat seafood products revealed 0·5% at an unsatisfactory level and 4·9% at an unacceptable level due to ≥4 log CFU g -1 of TC in squid and ≥3 log CFU g -1 of V. parahaemolyticus in gizzard shad respectively. Gizzard shad was shown to be potentially hazardous, as its sashimi is eaten with its skin attached. Bacillus cereus, E. coli, S. aureus, V. parahaemolyticus and V. vulnificus were qualitatively detected. Samples from the fishery market showed higher detection rate especially in V. parahaemolyticus (21·6%) and V. vulnificus (1·7%) which indicates the need to improve microbiological safety of raw ready-to-eat seafood products in fishery market. Raw ready-to-eat seafood products like sashimi can be easily contaminated with various bacteria from aquatic environments and human reservoirs, which subsequently bring about a risk in food poisoning due to no heating process before consumption. The results of this study provide comprehensive microbiological data on various species of raw ready-to-eat seafood from various distribution channels. It may contribute to establish reasonable standard and effective strategies to ensure a good microbiological quality of raw ready-to-eat seafood for the
Analysis of polonium-210 in food samples
International Nuclear Information System (INIS)
Bueno, Luciana; Cunha, Ieda Irma Lamas
1999-01-01
This paper presents the polonium levels in food products. The analysis procedure consisted of acid leaching of the samples, solution evaporation, addition of hydrochloric acid, spontaneous deposition of polonium on a silver disk counting by alpha spectroscopy. The method was applied in reference materials and in foodstuffs, resulting in the following values: tea samples 0.4 to 1.7 Bq/unit; fish = 0.17 to 0.40 Bq/Kg, fruits = 0.048 to 0.067 Bq/kg, vegetables = 0.12 to 0.31 Bq/kg, cereal = 0.036 to 0.042 Bq/kg and legumes = 0.024 to 0.51 Bq/kg. The results are very important for public health due to the possible effects to the human organism by the ingestion of contaminated foodstuffs. (author)
Directory of Open Access Journals (Sweden)
F. Tonucci
2009-09-01
Full Text Available In the last years, direct sale of raw milk by vending machines has largely increased in several European Countries and Italy. As a consequence, adequate hygienic measures and correct consumer’s information is required in order to reduce any potential risk linked to this product. In the present study, the occurrence of pathogens (Salmonella spp., verocytotoxigenic E.coli, Campylobacter spp., Listeria monocytogenes, S.aureus in raw milk and bovine faeces collected in 4 farms in the province of Pesaro-Urbino (Italy, between January 2007 and March 2009 has been investigated; 99.5% of milk samples resulted negative for the pathogens considered and complying with the regulation S. aureus limits. Campylobacter has been found in 0.44% of the samples, collected during summer, while only one sample resulted positive to a non-verocytotoxigenic E.coli O157. In respect to faeces, 62.6% of the samples resulted negative, 33.6% were contaminated by Campylobacter spp. (68% Campylobacter coli and 32% Campylobacter jejuni and 3.8% by E.coli O157. No samples resulted positive for Salmonella spp. or Listeria monocytogenes. The results highlight the necessity of a strict plan of hygienic and sanitary controls, with particular attention to milking process hygiene and raw milk storage, to reduce the risk of contamination of the product.
Directory of Open Access Journals (Sweden)
Syahrul Syahrul
2017-02-01
Full Text Available AbstractThe utilization of microalgae as a food ingredient considered effective, because in addition to alternative food sources also contains nutrients chlorella microalgae in particular is very good for health. This microalgae rich in protein (60.5%, fat (11%, carbohydrates (20.1%, water, dietary fiber, vitamins and minerals Besides these microalgae contain pigments (chlorophyll, tocopherol and the active component (antimicrobial and antioxidants. This is what underlies microalgae is very useful to be used as a source of raw materials of health food supplements. Currently the health food supplements have become a necessity for people to maintain their health in order to remain vibrant. This study aims to produce high nutritious health food supplements from raw material chlorella enriched with fish protein concentrate and oil catfish. The method used in the manufacture of high nutritious health food supplement is a method of microencapsulation with different formulations. The results showed that the best formulations based on the profile of amino acids, fatty acids and standards AAE per day especially essential fatty acids oleic and linoleic is formulation B (chlorella 2%, 1% fish oil and fish protein concentrate 1%.
Raw Milk Hygiene at Local Markets and Automatic Milk Dispenser Machines
Directory of Open Access Journals (Sweden)
Gheorghe Şteţca
2014-11-01
Full Text Available In Romania, direct sales of raw milk to the final consumer is developed based on the local regulations. These are in accordance to European Regulation that must meet some quality requirements for the total number of germs, somatic cells, without antibiotics, coming from healthy animals who did not suffer from diseases that can be transmitted to humans through milk. Raw milk is sold in Romania in local markets and by automatic milk dispenser machines. Based on these regulations, a study regarding the quality and security to human health of raw milk was conducted on the commercialized milk in local markets and automatic milk dispensers. During May-June 2014 samples of raw milk were collected from Cluj-Napoca local markets and automatic milk dispensers. All samples were kept to refrigeration conditions until the moment of analyze which took place at the sampling day. The following parameters were taken into account: fat content, protein, casein, lactose, nonfat dry matter, pH, milk freezing point, added water, antibiotics residues, milk urea, number of germ cells and somatic cells. All obtained results were verified by the validated methods applied. Our research can be forward conducted in order to verify the hygiene and composition of milk from the whole dairy chain.
V Soares Maciel, Edvaldo; de Toffoli, Ana Lúcia; Lanças, Fernando Mauro
2018-04-20
The accelerated rising of the world's population increased the consumption of food, thus demanding more rigors in the control of residue and contaminants in food-based products marketed for human consumption. In view of the complexity of most food matrices, including fruits, vegetables, different types of meat, beverages, among others, a sample preparation step is important to provide more reliable results when combined with HPLC separations. An adequate sample preparation step before the chromatographic analysis is mandatory in obtaining higher precision and accuracy in order to improve the extraction of the target analytes, one of the priorities in analytical chemistry. The recent discovery of new materials such as ionic liquids, graphene-derived materials, molecularly imprinted polymers, restricted access media, magnetic nanoparticles, and carbonaceous nanomaterials, provided high sensitivity and selectivity results in an extensive variety of applications. These materials, as well as their several possible combinations, have been demonstrated to be highly appropriate for the extraction of different analytes in complex samples such as food products. The main characteristics and application of these new materials in food analysis will be presented and discussed in this paper. Another topic discussed in this review covers the main advantages and limitations of sample preparation microtechniques, as well as their off-line and on-line combination with HPLC for food analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ashley, Jon; Shahbazi, Mohammad-Ali; Kant, Krishna; Chidambara, Vinayaka Aaydha; Wolff, Anders; Bang, Dang Duong; Sun, Yi
2017-05-15
Molecularly imprinted polymers (MIPs) are biomimetics which can selectively bind to analytes of interest. One of the most interesting areas where MIPs have shown the biggest potential is food analysis. MIPs have found use as sorbents in sample preparation attributed to the high selectivity and high loading capacity. MIPs have been intensively employed in classical solid-phase extraction and solid-phase microextraction. More recently, MIPs have been combined with magnetic bead extraction, which greatly simplifies sample handling procedures. Studies have consistently shown that MIPs can effectively minimize complex food matrix effects, and improve recoveries and detection limits. In addition to sample preparation, MIPs have also been viewed as promising alternatives to bio-receptors due to the inherent molecular recognition abilities and the high stability in harsh chemical and physical conditions. MIPs have been utilized as receptors in biosensing platforms such as electrochemical, optical and mass biosensors to detect various analytes in food. In this review, we will discuss the current state-of-the-art of MIP synthesis and applications in the context of food analysis. We will highlight the imprinting methods which are applicable for imprinting food templates, summarize the recent progress in using MIPs for preparing and analysing food samples, and discuss the current limitations in the commercialisation of MIPs technology. Finally, future perspectives will be given. Copyright © 2017 Elsevier B.V. All rights reserved.
Association between time perspective and organic food consumption in a large sample of adults.
Bénard, Marc; Baudry, Julia; Méjean, Caroline; Lairon, Denis; Giudici, Kelly Virecoulon; Etilé, Fabrice; Reach, Gérard; Hercberg, Serge; Kesse-Guyot, Emmanuelle; Péneau, Sandrine
2018-01-05
Organic food intake has risen in many countries during the past decades. Even though motivations associated with such choice have been studied, psychological traits preceding these motivations have rarely been explored. Consideration of future consequences (CFC) represents the extent to which individuals consider future versus immediate consequences of their current behaviors. Consequently, a future oriented personality may be an important characteristic of organic food consumers. The objective was to analyze the association between CFC and organic food consumption in a large sample of the adult general population. In 2014, a sample of 27,634 participants from the NutriNet-Santé cohort study completed the CFC questionnaire and an Organic-Food Frequency questionnaire. For each food group (17 groups), non-organic food consumers were compared to organic food consumers across quartiles of the CFC using multiple logistic regressions. Moreover, adjusted means of proportions of organic food intakes out of total food intakes were compared between quartiles of the CFC. Analyses were adjusted for socio-demographic, lifestyle and dietary characteristics. Participants with higher CFC were more likely to consume organic food (OR quartile 4 (Q4) vs. Q1 = 1.88, 95% CI: 1.62, 2.20). Overall, future oriented participants were more likely to consume 14 food groups. The strongest associations were observed for starchy refined foods (OR = 1.78, 95% CI: 1.63, 1.94), and fruits and vegetables (OR = 1.74, 95% CI: 1.58, 1.92). The contribution of organic food intake out of total food intake was 33% higher in the Q4 compared to Q1. More precisely, the contribution of organic food consumed was higher in the Q4 for 16 food groups. The highest relative differences between Q4 and Q1 were observed for starchy refined foods (22%) and non-alcoholic beverages (21%). Seafood was the only food group without a significant difference. This study provides information on the personality of
Trace elements detection in whole food samples by Neutron Activation Analysis, k{sub 0}-method
Energy Technology Data Exchange (ETDEWEB)
Sathler, Márcia Maia; Menezes, Maria Ângela de Barros Correia, E-mail: maia.sathler@gmail.com, E-mail: menezes@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Salles, Paula Maria Borges de, E-mail: pauladesalles@yahoo.com.br [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear
2017-07-01
Inorganic elements, from natural and anthropogenic sources are present in foods in different concentrations. With the increase in anthropogenic activities, there was also a considerable increase in the emission of these elements in the environment, leading to the need of monitoring the elemental composition of foods available for consumption. Numerous techniques have been used to detect inorganic elements in biological and environmental matrices, always aiming at reaching lower detection limits in order to evaluate the trace element content in the sample. Neutron activation analysis (INAA), applying the k{sub 0}-method, produces accurate and precise results without the need of chemical preparation of the samples – that could cause their contamination. This study evaluated the presence of inorganic elements in whole foods samples, mainly elements on trace levels. For this purpose, seven samples of different types of whole foods were irradiated in the TRIGA MARK I IPR-R1 research reactor - located at CDTN/CNEN, in Belo Horizonte, MG. It was possible to detect twenty two elements above the limit of detection in, at least, one of the samples analyzed. This study reaffirms the INAA, k{sub 0} - method, as a safe and efficient technique for detecting trace elements in food samples. (author)
Evaluation of physical, chemical and heavy metal concentration of food waste composting
Directory of Open Access Journals (Sweden)
Abdul Kadir Aeslina
2017-01-01
Full Text Available In this study, food waste composting with rice husk and coconut fibre as compost medium were carried out. Two types of different fermentation liquids were prepared which were fermented liquid (banana peel and fermented liquid from fermented soybeans. During the composting process, a compost samples for a twenty week duration at an interval time of two weeks. Among the physico-chemical parameters that were tested were temperature, moisture content, pH value, Total Nitrogen, Total Phosphorous, Potassium and Total Organic Carbon and Carbon Nitrogen ratio. Heavy metals such as copper, cadmium, lead, nickel and arsenic were observed and analysed. From this study, it was found that, the temperature increased during the thermophilic phase while there was gradually increase of Total Nitrogen, Total Phosphorous and Potassium from the beginning till the end of the composting process. It was also found that the total organic carbon (TOC and the carbon nitrogen ratio decreased significantly during the decomposition process. Traces amounts of heavy metals were also detected and remains below the standard Malaysian Environmental regulations. It was concluded that, the composting process was faster with processed food waste followed by combination of processed food waste and raw. Raw food waste were demonstrated the lowest degradation rate.
Effect of processing on iodine content of some selected plants food ...
African Journals Online (AJOL)
Effect of processing on iodine content of some selected plants food was investigated. Results show significant reduction (p < 0.05) in the iodine content of the processed food compared with the raw forms. The iodine value of 658.60 ± 17.2 ìg/100g observed in raw edible portion of Discorea rotundata was significantly higher ...
Microbial Contamination of Raw Vegetables in Ahvaz, Iran during 2014-2015
Directory of Open Access Journals (Sweden)
Abdol Kazem Neisi
2016-07-01
Full Text Available Background & Aims of the Study: Vegetables are useful for humans as they contain minerals, vitamins, fiber and other nutrients. Eating raw vegetables are a nutritional habit in Iranian families. Raw eating vegetables is the main source of parasitic infections. The aim of this study was to determine microbial contamination of raw vegetables in Ahvaz, Iran during 2014-2015. Materials and Methods: In this study, 20 samples collected from markets of Ahvaz. Average weight of collecting raw vegetables was 1 to 2 kilograms. Then, raw vegetables were washed by 4 to 5 liter tap water. For parasitic ova washed water leaved for 24 hours for sedimentation and then the supernatant poured and about 50 to 100 milliliter of settled water transferred to 15 ml centrifugal tubes. After centrifugation, pellet floated and finally parasitic ova were observed microscopically (corrected Bailenger method. The multiple tube method used for Coliform bacteria (Total & Faecal examination. Results: Maximum Coliform bacteria was in Kootabdullah samples (total Coliform was 25893319.52 MPN/100ml and Fecal Coliform was 15054572.83 MPN/100ml. Maximum Ascaris ova in Hamidieh was 43.3 per liter and Sheiban 36.66 per litter. Conclusion: Microbial contamination of raw vegetables, especially in Kootabdullah, possibly was due to Karoon river water pollution by sewage discharge of Ahvaz city, and also in Hamidieh possibly due to Karkheh river water pollution by sewage discharge of Hamidieh city. Thus, sewage treatment of these cities before discharging in rivers is necessary.
Mohamed, Rayane; Guy, Philippe A
2011-01-01
During recent years, a rising interest from consumers and various governmental organizations towards the quality of food has continuously been observed. Human intervention across the different stages of the food supply chain can lead to the presence of several types of chemical contaminants in food-based products. On a normal daily consumption basis, some of these chemicals are not harmful; however, for those that present a risk to consumers, legislation rules were established to specify tolerance levels or in some cases the total forbiddance of these specific contaminants. Hence, the use of appropriate analytical tools is recommended to properly identify chemical contaminants. In that context, mass spectrometry (MS)-based techniques coupled or not to chromatography offer a vast panel of features such as sensitivity, selectivity, quantification at trace levels, and/or structural elucidation. Because of the complexity of food-based matrices, sample preparation is a crucial step before final detection. In the present manuscript, we review the contribution and the potentialities of MS-based techniques to ensure the absence of chemical contaminants in food-based products. Copyright © 2011 Wiley Periodicals, Inc.
Raw and Heat-Treated Milk: From Public Health Risks to Nutritional Quality
Directory of Open Access Journals (Sweden)
Francesca Melini
2017-11-01
Full Text Available Consumers have recently shown a preference for natural food products and ingredients and within that framework, their interest in consuming raw drinking milk has been highlighted, claiming nutritional, organoleptic and health benefits. However, a public debate has simultaneously emerged about the actual risks and benefits of direct human consumption of raw milk. This paper compares the microbiological, nutritional and sensory profile of raw and heat-treated milk, to evaluate the real risks and benefits of its consumption. In detail, it provides an updated overview of the main microbiological risks of raw milk consumption, especially related to the presence of pathogens and the main outputs of risk assessment models are reported. After introducing the key aspects of most commonly used milk heat-treatments, the paper also discusses the effects such technologies have on the microbiological, nutritional and sensory profile of milk. An insight into the scientific evidence behind the claimed protective effects of raw milk consumption in lactose-intolerant subjects and against the onset of asthma and allergy disorders in children is provided. The emergence of novel milk processing technologies, such as ohmic heating, microwave heating, high pressure processing, pulsed electric fields, ultrasound and microfiltration is also presented as an alternative to common thermal treatments.
Naugle, Alecia Larew; Barlow, Kristina E; Eblen, Denise R; Teter, Vanessa; Umholtz, Robert
2006-11-01
The U.S. Food Safety and Inspection Service (FSIS) tests sets of samples of selected raw meat and poultry products for Salmonella to ensure that federally inspected establishments meet performance standards defined in the pathogen reduction-hazard analysis and critical control point system (PR-HACCP) final rule. In the present report, sample set results are described and associations between set failure and set and establishment characteristics are identified for 4,607 sample sets collected from 1998 through 2003. Sample sets were obtained from seven product classes: broiler chicken carcasses (n = 1,010), cow and bull carcasses (n = 240), market hog carcasses (n = 560), steer and heifer carcasses (n = 123), ground beef (n = 2,527), ground chicken (n = 31), and ground turkey (n = 116). Of these 4,607 sample sets, 92% (4,255) were collected as part of random testing efforts (A sets), and 93% (4,166) passed. However, the percentage of positive samples relative to the maximum number of positive results allowable in a set increased over time for broilers but decreased or stayed the same for the other product classes. Three factors associated with set failure were identified: establishment size, product class, and year. Set failures were more likely early in the testing program (relative to 2003). Small and very small establishments were more likely to fail than large ones. Set failure was less likely in ground beef than in other product classes. Despite an overall decline in set failures through 2003, these results highlight the need for continued vigilance to reduce Salmonella contamination in broiler chicken and continued implementation of programs designed to assist small and very small establishments with PR-HACCP compliance issues.
DEFF Research Database (Denmark)
Ashley, Jon; Shahbazi, Mohammad-Ali; Kant, Krishna
2017-01-01
Molecularly imprinted polymers (MIPs) are biomimetics which can selectively bind to analytes of interest. One of the most interesting areas where MIPs have shown the biggest potential is food analysis. MIPs have found use as sorbents in sample preparation attributed to the high selectivity and high...... the imprinting methods which are applicable for imprinting food templates, summarize the recent progress in using MIPs for preparing and analysing food samples, and discuss the current limitations in the commercialisation of MIPs technology. Finally, future perspectives will be given....
Food technology in space habitats
Karel, M.
1979-01-01
The research required to develop a system that will provide for acceptable, nutritious, and safe diets for man during extended space missions is discussed. The development of a food technology system for space habitats capable of converting raw materials produced in the space habitats into acceptable food is examined.
Strategic raw materials. Risk management
International Nuclear Information System (INIS)
Bertau, Martin; Matschullat, Joerg; Kausch, Peter
2014-01-01
This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [de
Directory of Open Access Journals (Sweden)
Luciane Mie KAWASHIMA
2009-07-01
Full Text Available
Five samplings of leaf vegetables widely consumed in Southern Brazil (lettuce, rucola, watercress, kale, chicory, Chinese cabbage, and cabbage were taken during the period of a year in food markets of the city of Campinas, Brazil. A selective extraction of potassium, sodium, calcium, magnesium, iron, manganese, copper, and zinc was conducted on the raw vegetables and four of the vegetables (kale, chicory, Chinese cabbage, and cabbage were also cooked briefly under dry heat for three minutes and submitted to the selective extraction. The extraction separated the minerals into fractions containing mineral elements bound to soluble complexes, bound to ligands solubilized by mild acidic oxidizing conditions, and bound to insoluble ligands under mild acidic oxidizing conditions. The minerals concentrations in each fraction were determined by flame atomic absorption spectrometry. The amount of K, Na, Ca, and Mg extractable at pH 7.0 (soluble fraction from raw vegetables varied between 22 to 75 % of the total content of the mineral present. The soluble fractions of minor elements such as Mn, Zn, and Fe varied from 0 to 100% in the raw vegetables. The brief cooking used besides causing negligible losses of the minerals also increased the solubility of the minerals by 44% to 200%. KEYWORDS: Leaf vegetables; soluble mineral elements in vegetables.
Directory of Open Access Journals (Sweden)
Ursula Konietzny
2006-01-01
Full Text Available Phytase [myo-inositol(1,2,3,4,5,6hexakisphosphate phosphohydrolase], a phytate-specific phosphatase, is already used as a supplement in diets for monogastric animals to improvephosphate utilisation from phytate[myoinositol(1,2,3,4,5,6hexakisphosphate], the major storage form of phosphate in plant seeds. In recent years, this class of enzymes has also been found increasingly interesting for use in processing and manufacturing of food for human consumption, particularly because the decline in food phytate results in an enhancement of mineral bioavailability. Different strategies could be applied to optimise phytate degradation during food processing and digestion in the human alimentary tract such as adjustment of more favourable conditions during food processing for the phytases naturally occurring in the raw material, addition of isolated phytases to the production process, use of raw material with a high intrinsic phytate-degrading activity either naturally present or introduced by genetic engineering and the use of recombinant food-grade microorganisms as carriers for phytate-degrading activity in the human gastrointestinal tract. Furthermore, phytases may find application in the production of functional foods or food supplements with health benefits. Last but not least, technological improvements are expected to occur due to phytate degradation during processing as shown for breadmaking, production of plant protein isolates, corn wet milling and the fractionation of cereal bran.
Directory of Open Access Journals (Sweden)
Mojtaba Arslani
2017-05-01
Full Text Available Background: Foodborne diseases are one of the serious problems in the world. Every year, more than 100 million people are affected by foodborne and waterborne diseases particularly immunocompromised diseases. Objectives: The aim of the present study was to evaluate bacterial load and antibiotic resistance pattern in bacterial isolates from food samples of meat, dairy, and pastry products from west of Tehran, Iran, during April 2007 to March 2008. Materials and Methods: A total of 1625 different food samples including dairy products, meat and pastries were collected randomly from different parts of the west of Tehran. All samples were kept at 4°C. The samples were first cultured according to the standard bacteriological methods and then Staphylococcus aureus and Escherichia coli isolates were identified using standard bacteriological tests. Antimicrobial susceptibility test was performed by disk diffusion method according to Clinical & Laboratory Standards Institute (CLSI guidelines. Results: During 2007 and 2008, 2.8% and 3% of the food samples were contaminated with S. aureus. Similarly, 3.5% and 6.4% of the food samples were contaminated with E. coli. E. coli isolates were highly resistant to amikacin and cephotaxime and this resistance was increased in 2008. Similarly S. aureus isolates were resistant to ciprofloxacin, cephotaxime, gentamicin, and tetracyclin. There was no significant difference during 2007-2008. Conclusion: The rate of contamination during 2007 was 2.8% and during 2008 was 3% for S. aureus. This strain was isolated from the food samples. Further studies should be done to determine the changes of bacterial resistance pattern for various food samples. Thus, the baseline for comparison with future prospective studies should be established, enabling the determination of trends over time.
Safety aspects of the production of foods and food ingredients from insects.
Schlüter, Oliver; Rumpold, Birgit; Holzhauser, Thomas; Roth, Angelika; Vogel, Rudi F; Quasigroch, Walter; Vogel, Stephanie; Heinz, Volker; Jäger, Henry; Bandick, Nils; Kulling, Sabine; Knorr, Dietrich; Steinberg, Pablo; Engel, Karl-Heinz
2017-06-01
At present, insects are rarely used by the European food industry, but they are a subject of growing interest as an alternative source of raw materials. The risks associated with the use of insects in the production of foods and food ingredients have not been sufficiently investigated. There is a lack of scientifically based knowledge of insect processing to ensure food safety, especially when these processes are carried out on an industrial scale. This review focuses on the safety aspects that need to be considered regarding the fractionation of insects for the production of foods and food ingredients. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Dilbone, Megan; Turner, Nancy J; von Aderkas, Patrick
2013-01-01
Lodgepole pine (Pinus contorta var. latifolia) is a tree species utilized for succulent edible cambium and secondary phloem in the spring by Interior First Peoples of the Pacific Northwest. In this article we present a nutritional analysis of this food based on a pooled sample of 17 trees harvested in the Chilcotin region of British Columbia. We also present enzymatic sugar analysis of raw, dried, and cooked lodgepole pine cambium harvested from the Chilcotin and Okanagan regions in British Columbia. In the discussion we interpret the nutrient values of raw lodgepole pine cambium in comparison to dried and cooked cambium, results from other nutritional studies of pine cambium, and nutrients in some other traditional and nontraditional foods.
International Nuclear Information System (INIS)
Beishon, J.
1991-01-01
Food irradiation has been the subject of concern and controversy for many years. The advantages of food irradiation include the reduction or elimination of dangerous bacterial organisms, the control of pests and insects which destroy certain foods, the extension of the shelf-life of many products, for example fruit, and its ability to treat products such as seafood which may be eaten raw. It can also replace existing methods of treatment which are believed to have hazardous side-effects. However, after examining the evidence produced by the proponents of food irradiation, the author questions whether it has any major contribution to make to the problems of foodborne diseases or world food shortages. More acceptable solutions, he suggests, may be found in educating food handlers to ensure that hygienic conditions prevail in the production, storage and serving of food. (author)
Food processing as an agricultural countermeasure after an accidental contamination event
International Nuclear Information System (INIS)
Igreja, Eduardo; Rochedo, Elaine R.R.; Prado, Nadya M.P.D.; Silva, Diogo N.G.
2013-01-01
Food processing allows significant reduction in the radionuclide contamination of foodstuffs. The effects of processing on contaminated food depend on the radionuclide, the type of foodstuff and the method of processing. The effectiveness of radionuclide removal from raw material during processing can vary widely; however, processing of raw materials of vegetable and animal origin is often considered one of the most effective countermeasures for reducing the radioactive contamination of the foodstuff to or below permissible levels, and can be applied both domestically and in industrial processing of food. The food processing retention factor, Fr, is the fraction of radionuclide activity that is retained in the food after processing; it is obtained by the product of two quantities, the processing efficiency, Pe, that is the ratio of the fresh weight of the processed food to the weight of the original raw material, and the processing factor, Pf, that is the ratio of the radionuclide activity concentrations in the processed and in the raw material. The objective of this work was to investigate the effect of the reduction in dose due to food processing after a nuclear or radiological accident. Radionuclides considered were Cs-137, Sr-90 and I-131. The effect on total diet of individuals was investigating for a typical diet of the Southeast region, where the Brazilian Nuclear Power Plants are located. The effect was analyzed considering the use of the processing technologies after contamination events occurring in different seasons of the year. (author)
Solvent extraction method for rapid separation of strontium-90 in milk and food samples
International Nuclear Information System (INIS)
Hingorani, S.B.; Sathe, A.P.
1991-01-01
A solvent extraction method, using tributyl phosphate, for rapid separation of strontium-90 in milk and other food samples has been presented in this report in view of large number of samples recieved after Chernobyl accident for checking radioactive contamination. The earlier nitration method in use for the determination of 90 Sr through its daughter 90 Y takes over two weeks for analysis of a sample. While by this extraction method it takes only 4 to 5 hours for sample analysis. Complete estimation including initial counting can be done in a single day. The chemical recovery varies between 80-90% compared to nitration method which is 65-80%. The purity of the method has been established by following the decay of yttrium-90 separated. Some of the results obtained by adopting this chemical method for food analysis are included. The method is, thus, found to be rapid and convenient for accurate estimation of strontium-90 in milk and food samples. (author). 2 tabs., 1 fig
Contamination of ready-to-eat raw vegetables with Clostridium difficile in France.
Eckert, Catherine; Burghoffer, Béatrice; Barbut, Frédéric
2013-09-01
The presence of Clostridium difficile in food like shellfish, vegetables and meat has been reported in several publications during the past few years. The objective of this study was to assess the prevalence of ready-to-eat raw vegetables contaminated with C. difficile in France. One hundred and four ready-to-eat salads and vegetables were studied. Toxigenic C. difficile strains were isolated in three samples (2.9 %): two ready-to-eat salads (one heart of lettuce and one lamb's lettuce salad) and one portion of pea sprouts. The strains belonged to three different PCR ribotypes: 001, 014/020/077 and 015. The detection thresholds for vegetative cells and spores cells varied between 1 and 3 c.f.u. in 20 g salad and between 6 and 15 c.f.u. in 20 g salad, respectively, for the method employed.
Castillo, Daniela S; Cassola, Alejandro
2017-01-01
Cow milk protein allergy (CMPA) is the most common childhood food allergy, which can sometimes persist or can newly develop in adulthood with severe symptoms. CMPA's treatment is complete dietary avoidance of milk proteins. To achieve this task, patients have to be aware of milk proteins found as "hidden allergens" in food commodities. In regard to milk proteins, it has been reported that allergenicity of caseins remains unaffected upon heat treatment. For these reasons, we aimed to obtain monoclonal antibodies (mAbs) against native and denatured β-casein, one of the most abundant and antigenic caseins, in order to develop an indirect competitive ELISA (icELISA) to detect and quantify traces of this milk allergen in raw and processed foodstuffs. We developed two specific hybridoma clones, 1H3 and 6A12, which recognized β-casein in its denatured and native conformations by indirect ELISA (iELISA). Cross-reaction analysis by Western blot and iELISA indicated that these mAbs specifically recognized β-casein from bovine and goat milk extracts, while they did not cross-react with proteins present in other food matrixes. These highly specific mAbs enabled the development of sensitive, reliable and reproducible icELISAs to detect and quantify this milk protein allergen in food commodities. The extraction of β-casein from foodstuff was efficiently carried out at 60°C for 15 minutes, using an extraction buffer containing 1% SDS. The present study establishes a valid 1H3 based-icELISA, which allows the detection and quantification -0.29 ppm and 0.80 ppm, respectively- of small amounts of β-casein in raw and processed foods. Furthermore, we were able to detect milk contamination in incurred food samples with the same sensitivity as a commercial sandwich ELISA thus showing that this icELISA constitutes a reliable analytical method for control strategies in food industry and allergy prevention.
Study of chemisrty and hydrolysates drying parameters of feather-downy raw material
LISITSYN A.B.; KRIGER O.V.; MITROKHIN P.V.
2016-01-01
The article describes chemical and amino acid composition of feather-downy raw material. It determines the mass fraction of crude protein, crude fiber, ash, calcium, phosphorus, sodium in the samples of feather-downy raw material. It is stated that the waste from poultry processing obtained from hens of all the studied species are characterized by a high content of crude protein and low in crude fiber and ash. The most valuable feather-downy raw material regarding protein is waste containing ...
Ripabelli, G; Sammarco, M L; Ruberto, A; Iannitto, G; Grasso, G M
1997-06-01
The aim of the study was to compare immunomagnetic separation (IMS) and conventional selective enrichment procedures using selenite cystine broth (SC) and Rappaport-Vassiliadis broth (RV) in 137 naturally contaminated food samples (69 raw pork sausages and 68 chicken meat). The utilization of SC or IMS appeared to be the most appropriate enrichment procedure: 15 out of 18 Salmonella-positive samples (83.3%) were detected by SC and 12 (66.7%) by IMS; RV yielded only seven positive isolations (38.9%). However, RV yielded the highest count of Salmonella colonies per plate and the lowest interference by competing organisms. IMS could become a reliable alternative to standard enrichment procedures and a combined IMS and selective enrichment broth could increase the chance of Salmonella recovery.
Fluoroquinolone residues in raw meat from open markets in Ibadan, Southwest, Nigeria
Directory of Open Access Journals (Sweden)
Adekunbi Bridget Omotoso
2015-07-01
Full Text Available Misuse of fluoroquinolones in livestock production may lead to the presence of their residues in tissues of meat animals after slaughter, constituting health hazards to consumers. The present study was designed to screen for residues of three fluoroquinolones (ciprofloxacin, norfloxacin and ofloxacin in raw meat. Microbiological assay, followed by High Performance Liquid Chromatography (HPLC was used to screen three hundred and twenty samples of beef, chicken, pork and chevon purchased from open markets. Initial screening by microbiological assay revealed that 50%, 55%, 40% and 40% of beef, chicken, pork and chevon, respectively were positive for residues of antibiotics. Further analysis by HPLC with UV detection revealed the presence of ciprofloxacin, norfloxacin and ofloxacin at varying concentrations in the meat samples. Ofloxacin was the least in frequency and abundance in all meat types. Results obtained in this study have implications for public health and will lead to steps that will further enhance the safety of animal foods in order to protect consumers and the animal production industry
Ecofeed, animal feed produced from recycled food waste.
Sugiura, Katsuaki; Yamatani, Shoich; Watahara, Masashi; Onodera, Takashi
2009-01-01
Due to the price hike of imported grains for feed, the production of Ecofeed, feed produced from recycled food waste, has increased in recent years. Food dregs from the food and beverage processing industry and out-of-date food from supermarkets and convenience stores are most often used as raw materials for Ecofeed. As food waste usually contains a lot of moisture and is easily spoiled, guidelines prescribing measures to be taken when collecting, transporting and storing raw materials, and for the production, shipment, storage and use of Ecofeed products, have been developed to ensure the safety of Ecofeed. The guidelines also include measures that should be taken to prevent the spread of bovine spongiform encephalopathy when producing and using Ecofeed. A certification system was introduced in March 2009 to ensure the quality and safety of Ecofeed and thus promote its use.
Abbring, S.; Diks, M.A.P.|info:eu-repo/dai/nl/372617298; Dingjan, G.M.; Baars, T.; Garssen, J.|info:eu-repo/dai/nl/086369962; Van Esch, B.C.A.M.|info:eu-repo/dai/nl/304839256
2016-01-01
Background: Epidemiological studies show that the consumption of raw milk early in life is protective against the development of allergies later in life. The effect was found to be limited to raw milk consumption and was not observed when this milk was boiled or when pasteurized and homogenized shop
Red mud addition in the raw meal for the production of Portland cement clinker.
Tsakiridis, P E; Agatzini-Leonardou, S; Oustadakis, P
2004-12-10
The aim of the present research work was to investigate the possibility of adding red mud, an alkaline leaching waste, which is obtained from bauxite during the Bayer process for alumina production, in the raw meal for the production of Portland cement clinker. For that reason, two samples of raw meals were prepared: one with ordinary raw materials, as a reference sample ((PC)Ref), and another with 3.5% red mud ((PC)R/M). The effect on the reactivity of the raw mix was evaluated on the basis of the unreacted lime content in samples sintered at 1350, 1400 and 1450 degrees C. Subsequently, the clinkers were produced by sintering the two raw meals at 1450 degrees C. The results of chemical and mineralogical analyses as well as the microscopic examination showed that the use of the red mud did not affect the mineralogical characteristics of the so produced Portland cement clinker. Furthermore, both clinkers were tested by determining the grindability, setting time, compressive strength and expansibility. The hydration products were examined by XRD analysis at 2, 7, 28 and 90 days. The results of the physico-mechanical tests showed that the addition of the red mud did not negatively affect the quality of the produced cement.
Syrko, Joseph; Kaylegian, Kerry E.
2015-01-01
Growth in the dairy industry and the passage of the Food Safety Modernization Act have renewed interest in dairy foods processing extension positions. A needs assessment survey was sent to Pennsylvania dairy processors and raw milk providers to guide priorities for a dairy foods extension program. The successful development and delivery of…
Contamination of faecal coliforms in ice cubes sampled from food outlets in Kubang Kerian, Kelantan.
Noor Izani, N J; Zulaikha, A R; Mohamad Noor, M R; Amri, M A; Mahat, N A
2012-03-01
The use of ice cubes in beverages is common among patrons of food outlets in Malaysia although its safety for human consumption remains unclear. Hence, this study was designed to determine the presence of faecal coliforms and several useful water physicochemical parameters viz. free residual chlorine concentration, turbidity and pH in ice cubes from 30 randomly selected food outlets in Kubang Kerian, Kelantan. Faecal coliforms were found in ice cubes in 16 (53%) food outlets ranging between 1 CFU/100mL to >50 CFU/ 100mL, while in the remaining 14 (47%) food outlets, in samples of tap water as well as in commercially bottled drinking water, faecal coliforms were not detected. The highest faecal coliform counts of >50 CFU/100mL were observed in 3 (10%) food outlets followed by 11-50 CFU/100mL and 1-10 CFU/100mL in 7 (23%) and 6 (20%) food outlets, respectively. All samples recorded low free residual chlorine concentration (contamination by faecal coliforms was not detected in 47% of the samples, tap water and commercially bottled drinking water, it was concluded that (1) contamination by faecal coliforms may occur due to improper handling of ice cubes at the food outlets or (2) they may not be the water sources used for making ice cubes. Since low free residual chlorine concentrations were observed (food outlets, including that of ice cube is crucial in ensuring better food and water for human consumption.
International Nuclear Information System (INIS)
Boniglia, C.; Aureli, P.; Bortolin, E.; Onori, S.
2009-01-01
The Italian National Institute of Health in 2005-2006 performed an analytical survey of import on dried spices and herbs, including herbs used in food supplements, to investigate the entry in Italy of irradiated, and not correctly labelled, raw materials. In this survey, 52 samples, including nine herbal extracts, were collected. The method of photo-stimulated luminescence (PSL) was applied to all samples and only samples screened positive or intermediate with PSL were analysed by using the thermo-luminescence (TL) method. Out of the 12 samples screened positive or intermediate with PSL, the TL method confirmed irradiation of five samples (10% of the total assayed samples). One out of these five samples was a herbal supplement whereas three were herbal extracts that are known to be used as ingredients of herbal supplements, and another one was a spice.
Energy Technology Data Exchange (ETDEWEB)
Boniglia, C. [Department of Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Rome (Italy)], E-mail: concetta.boniglia@iss.it; Aureli, P. [Department of Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Rome (Italy); Bortolin, E.; Onori, S. [Department of Technology and Health, Istituto Superiore di Sanita, Rome (Italy)
2009-07-15
The Italian National Institute of Health in 2005-2006 performed an analytical survey of import on dried spices and herbs, including herbs used in food supplements, to investigate the entry in Italy of irradiated, and not correctly labelled, raw materials. In this survey, 52 samples, including nine herbal extracts, were collected. The method of photo-stimulated luminescence (PSL) was applied to all samples and only samples screened positive or intermediate with PSL were analysed by using the thermo-luminescence (TL) method. Out of the 12 samples screened positive or intermediate with PSL, the TL method confirmed irradiation of five samples (10% of the total assayed samples). One out of these five samples was a herbal supplement whereas three were herbal extracts that are known to be used as ingredients of herbal supplements, and another one was a spice.
Use of raw materials in the United States from 1900 through 2014
Matos, Grecia R.
2017-08-22
The economic growth of an industrialized nation such as the United States requires raw materials for construction (buildings, bridges, highways, and so forth), defense, and processing and manufacture of goods and services. Since the beginning of the 20th century, the types and quantities of raw materials used have increased and changed significantly. This fact sheet quantifies the amounts of raw materials (other than food and fuel) that have been used in the U.S. economy annually for a period of 115 years, from 1900 through 2014. It provides a broad overview of the quantity (weight) of nonfood and nonfuel materials used in the economy and illustrates the use and significance of raw nonfuel minerals in particular as building blocks of society.These data have been compiled to help the public and policymakers understand the changing annual flow of raw materials put into use in the United States. Such information can be helpful in assessing the potential effects of materials use on the environment, assessing materials’ intensity of use, and examining the role that these materials play in the economy. The data presented indicate the substitution and shift in materials usage from renewable to nonrenewable materials during the 20th century. The disaggregated quantities by commodity (not shown in this fact sheet) may be tested against supply adequacy and end of life issues.
Directory of Open Access Journals (Sweden)
Danuser Jürg
2003-12-01
Full Text Available Abstract Background The world-wide increase of foodborne infections with antibiotic resistant pathogens is of growing concern and is designated by the World Health Organization as an emerging public health problem. Thermophilic Campylobacter have been recognised as a major cause of foodborne bacterial gastrointestinal human infections in Switzerland and in many other countries throughout the world. Poultry meat is the most common source for foodborne cases caused by Campylobacter. Because all classes of antibiotics recommended for treatment of human campylobacteriosis are also used in veterinary medicine, in view of food safety, the resistance status of Campylobacter isolated from poultry meat is of special interest. Methods Raw poultry meat samples were collected throughout Switzerland and Liechtenstein at retail level and examined for Campylobacter spp. One strain from each Campylobacter-positive sample was selected for susceptibility testing with the disc diffusion and the E-test method. Risk factors associated with resistance to the tested antibiotics were analysed by multiple logistic regression. Results In total, 91 Campylobacter spp. strains were isolated from 415 raw poultry meat samples. Fifty-one strains (59% were sensitive to all tested antibiotics. Nineteen strains (22% were resistant to a single, nine strains to two antibiotics, and eight strains showed at least three antibiotic resistances. Resistance was observed most frequently to ciprofloxacin (28.7%, tetracycline (12.6%, sulphonamide (11.8%, and ampicillin (10.3%. One multiple resistant strain exhibited resistance to five antibiotics including ciprofloxacin, tetracycline, and erythromycin. These are the most important antibiotics for treatment of human campylobacteriosis. A significant risk factor associated with multiple resistance in Campylobacter was foreign meat production compared to Swiss meat production (odds ratio = 5.7. Conclusion Compared to the situation in other
Eftekhari, Mohsen; Mosavari, Nader
2016-12-01
Mycobacterium avium subsp. paratuberculosis (MAP) is an etiological agent of Johne's disease in ruminant including cattle, sheep and goats. This disease is considered an economically important disease in cattle. Animals with paratuberculosis shed viable MAP, particularly in their milk and feces. MAP may be involved in the development of Crohn's disease in humans through the consumption of contaminated milk and dairy products. Common methods of pasteurization are not enough to kill all MAP present in the milk and the bacterium has been isolated from raw milk, pasteurized milk and cheese samples. The purpose of this study was to evaluate two different methods for detecting MAP in milk and milk products. We analyzed the commonly used methods such as culture and molecular biology for identification of MAP. For this study, 50 milk samples from cows with suspected Johne's disease located in two dairy farms and 10 commercially available pasteurized milk and cheese samples from the market in Karaj city, Iran were selected. Following Ziehl-Neelsen staining of milk samples, direct microscopic detection of MAP was performed. All milk samples were centrifuged, and the concentrated samples were decontaminated using hexadecyl pyridinium chloride. The decontaminated milk suspensions were washed three times by centrifuging, and the collected filtrates were cultivated on Herrold's egg yolk medium enriched by Mycobactin J. Finally, identification and confirmation of isolates to MAP was performed using IS900-nested polymerase chain reaction (PCR). According to the obtained results by culture and PCR methods, none of the pasteurized milk and cheese samples showed the presence of MAP. However, 10% of the tested raw milk samples collected from suspected cattle showed the presence of MAP by both culture and PCR methods. Culture and PCR methods are reliable for identification of MAP from milk samples. Copyright © 2016.
International Nuclear Information System (INIS)
Kimi Nishikawa; Abdul Bari; Abdul Jabbar Khan; Xin Li; Traci Menia; Semkow, T.M.
2017-01-01
We have developed a method of food sample preparation for gamma spectrometry involving the use of tetramethylammonium hydroxide (TMAH) and/or enzymes such as α-amylase or cellulase for sample homogenization. We demonstrated the effectiveness of this method using food matrices spiked with "6"0Co, "1"3"1I, "1"3"4","1"3"7Cs, and "2"4"1Am radionuclides, homogenized with TMAH (mixed salad, parmesan cheese, and ground beef); enzymes (α-amylase for bread, and cellulase for baked beans); or α-amylase followed by TMAH (cheeseburgers). Procedures were developed which are best compromises between the degree of homogenization, accuracy, speed, and minimizing laboratory equipment contamination. Based on calculated sample biases and z-scores, our results suggest that homogenization using TMAH and enzymes would be a useful method of sample preparation for gamma spectrometry samples during radiological emergencies. (author)
Real Deal or No Deal? A Comparative Analysis of Raw Milk Cheese Regulation in Australia and France
Directory of Open Access Journals (Sweden)
William van Caenegem
2017-04-01
cheeses, the new standard is rigid and does not encourage new entrants into the emerging raw milk cheese consumer market. This article compares the Australian system with the French raw milk cheese regulation and production system, and argues that its approach in encouraging and supporting small farmhouse artisanal traditional raw milk cheese is beneficial to both producer and consumer, and has not resulted in any significant health risks. The Australian approach amounts to a missed opportunity to encourage the emergence of a value-added industry with local and export potential, and is at odds with important movements in food policy, such as recognition of the value of localism and terroir.
Raw material versus processing
International Nuclear Information System (INIS)
Berg, E.A.T.
1989-01-01
Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt
Food safety challenges associated with traditional foods of Turkey
Directory of Open Access Journals (Sweden)
Arzu CAGRI-MEHMETOGLU
Full Text Available Abstract Consumer food safety concerns are continually increasing in Turkey, with consumer demand for safer foods becoming an important challenge for the industry. Most traditional foods in Turkey are produced under different requirements, and food safety risk management and risk assessment are conducted primarily by the government. Based on risk assessment, safety regulations and standards for traditional foods (e.g. Turkish white cheese, doner, helva have been established. In this paper, safety concerns surrounding the commercialization of traditional Turkish foods and related studies to identify and minimize potential hazards are discussed along with pathogen contamination in raw meat balls and aflatoxin in helva and white cheese. Based on this review, additional national risk analysis experts and related databases are urgently needed. In addition, the manufacturing processes for traditional foods need to be standardized and harmonized with international standards, such as CODEX.
Rapid methods for measuring radionuclides in food and environmental samples
International Nuclear Information System (INIS)
Perkins, Richard W.
1995-01-01
The application of ICP/mass spectrometry for the isotopic analysis of environmental samples, the use of drum assayers for measuring radionuclides in food and a rapid procedure for the measurement of the transuranic elements and thorium, performed at the Pacific Northwest Laboratory are discussed
Ecofeed, animal feed produced from recycled food waste
Directory of Open Access Journals (Sweden)
Katsuaki Sugiura
2009-09-01
Full Text Available Due to the price hike of imported grains for feed, the production of Ecofeed, feed produced from recycled food waste, has increased in recent years. Food dregs from the food and beverage processing industry and out-of-date food from supermarkets and convenience stores are most often used as raw materials for Ecofeed. As food waste usually contains a lot of moisture and is easily spoiled, guidelines prescribing measures to be taken when collecting, transporting and storing raw materials, and for the production, shipment, storage and use of Ecofeed products, have been developed to ensure the safety of Ecofeed. The guidelines also include measures that should be taken to prevent the spread of bovine spongiform encephalopathy when producing and using Ecofeed. A certification system was introduced in March 2009 to ensure the quality and safety of Ecofeed and thus promote its use.
Effects of inulin, carrot and cellulose fibres on the properties of raw ...
African Journals Online (AJOL)
The effects of inulin, carrot, and cellulose fibres (3%, 6%, and 9%) on raw and fried chicken meatballs were studied. Meatball pH, thiobarbituric acid reactive substances (TBARS), and colour values were determined for raw samples in refrigerated storage on the 1st, 5th and 10th days. The effects of fibres and their various ...
Natural Dyeing and UV Protection of Raw and Bleached/Mercerised Cotton
Directory of Open Access Journals (Sweden)
Čuk Nina
2017-05-01
Full Text Available Dyeing with natural dyes extracted from curcuma, green tea, avocado seed, pomegranate peel and horse chestnut bark was studied to evaluate the dyeability and ultraviolet (UV blocking properties of raw and bleached/mercerised cotton fabrics. 20 g/l of powdered plant material was extracted in distilled water and used as a dyeing bath. No mordants were used to obtain ecologically friendly finishing. The colour of samples was measured on a refl ectance spectrophotometer, while UV-blocking properties were analysed with UV-Vis spectrophotometer. The results showed that dyeing increased UV protection factor (UPF to all samples, however much higher UPF values were measured for the dyed raw cotton samples. The highest UPF values were obtained on both cotton fabrics dyed with pomegranate peel and green tea extracts, giving them excellent protective properties (UPF 50+. The lowest UPF values were obtained by dyeing cotton with avocado seed extract and curcumin. Dyeing with selected dyes is not stable to washing, so the UV-blocking properties worsen after repetitive washing. However, raw cotton samples retain their very good Uvblocking properties, while bleached/mercerised cotton fabrics do not provide even satisfactory UV-blocking properties. No correlation between CIE L*a*b*, K/S and UPF values were found.
Prevalence of Parasitic Contamination of Raw Vegetables in Sanandaj, Iran, in 2013
Directory of Open Access Journals (Sweden)
ghasem zamini
2017-03-01
Full Text Available Introduction and purpose: Parasitic diseases have led to economic and health problems around the world. One of the most common ways for the transmission of these diseases is the consumption of raw vegetables contaminated with parasite. These diseases can be prevented through obtaining knowledge about the parasitic contamination of the vegetables. Regarding this, the aim of the present study was to evaluate the prevalence and type of raw vegetables contamination in Sanandaj, Iran, in 2013.Methods: This cross-sectional study was conducted on 360 vegetable samples distributed in 60 greengroceries in Sanandaj in 2017. The data were analyzed using the SPSS version 16.Results: In total, 16.3% of the vegetable samples were contaminated with various types of parasites, including free-living nematode (12.2%, Entamoeba coli (1.7%, Giardia (0.8%, Blastocystis hominis (0.8%, and Dicrocoelium (0.8%. However, most of the contaminations (81.6% were found in the vegetables, which were imported from regions other than Kurdistan province. Basil had the highest level of contamination, whereas coriander and lettuce had the lowest contamination level (P=0<05. Additionally, the vegetables had the highest and lowest contamination levels in the winter and spring, respectively.Conclusion: Regarding the findings of the present study, it is recommend to thoroughly perform parasite decontamination before the consumption of vegetables. Furthermore, the officials can prevent the parasitic diseases by careful monitoring of public food distribution centers and controlling the source of vegetables in the winter.
Ulbin-Figlewicz, Natalia; Jarmoluk, Andrzej
2016-06-01
The effect of low-pressure plasma on quality attributes of meat is an important aspect, which must be considered before application in food. The aim of this study was to determine the color, fatty acid composition, lipid oxidation expressed as thiobarbituric acid reactive substances and total antioxidant capacity of raw pork samples exposed to helium low-pressure plasma treatment (20 kPa) for 0, 2, 5, and 10 min during the storage period. The thiobarbituric acid reactive substance concentrations of all plasma-treated samples during storage were in the range from 0.26 to 0.61 mg malondialdehyde/kg. Exposure time caused significant changes only in total color difference, hue angle, and chroma after 10 min of treatment. Ferric reducing ability of plasma values of meat samples decreased from 1.93 to 1.40 mmol Trolox Eq/kg after 14 days of storage. The storage period significantly affected proportion of polyunsaturated fatty acids, with an increase about 3% after 14 days of refrigeration storage while the content of saturated fatty acids was at the same level. Helium low-pressure plasma does not induce oxidative processes. Application of this decontamination technique while maintaining product quality is possible in food industry. © The Author(s) 2015.
International Nuclear Information System (INIS)
Martinez, G.L.; Navarrete, J.M.
2007-01-01
Erosion caused by external factors such as wind, rain, sunlight and temperature changes is considerable in raw materials used to build pre-hispanic monuments. However, there does exist an internal destruction factor even stronger: the humidity coming from the soil, which goes up by capillarity, depositing soluble salts on the walls surface. Therefore, one way to find some figure related to the specific capillarity or porosity shown by each raw material, is to obtain small prism-shaped pieces cut out from the large debris fallen down spontaneously from ancient walls due to internal humidity. Once these small samples are placed in contact with a 22 Na labeled solution during a given time, at the same geometrical conditions, dried overnight, conditioned either in test tubes or wrapped into polyethylene and detected in a well type 3' x 3' scintillation detector, the counts accumulated per time and weight units are a measure of the relative porosity shown by each material. In order to pull down this porosity, the samples are impregnated with a gelatin solution (50 g/l) at 60-80 deg C plus food preservatives such as potassium sorbate (2.5%) and sodium benzoate (2.5%). When gelatin begins to be formed 3 hours later and the samples look humid and brilliant, they are impregnated with formaldehyde solution (38%), and their absorption rate is dramatically reduced overnight (75-100%), which can be proven when samples are tested by making use of the 22 Na labeled solution. This technique has been applied at real scale in some pre-hispanic monuments. Ancient raw materials seems to be much more compact and well preserved during one limited period of time (10 to 13 months). Treatment is unnoticeable and reversible, and it may be applied periodically. (author)
Changchai, Nuttawee; Saunjit, Sudarat
2014-05-01
Occurrence, population density and virulence of Vibrio parahaemolyticus and V. vulnificus in 240 retail raw oysters collected monthly between March 2010 and February 2011 from Ang Sila coast, Chon Buri Province, Thailand were determined using most probable number (MPN) multiplex PCR. Multiplex PCR detected V. parahaemolyticus in 219 raw oyster samples, of which 29 samples contained the virulence tdh. MPN values for V. parahaemolyticus and pathogenic strains in most samples ranged from 10 to 10(2) and from 3 to 10 MPN/g, respectively. The presence of V. vulnificus was found in 53 oyster samples in amounts between 10 and 10(2) MPN/g. Of 1,087 V. parahaemolyticus isolates, 14 and 2 isolates carried tdh and virulence trh, respectively but none with both genes. However, none of the presumptive isolates was shown to be V. vulnificus. The detection of pathogenic V. parahaemolyticus and V. vulnificus in raw oysters has rendered high awareness of risk in consumption of raw or undercooked oysters.
Zohri, Maryam; Alavidjeh, Mohammad Shafiee; Haririan, Ismaeil; Ardestani, Mehdi Shafiee; Ebrahimi, Seyed Esmaeil Sadat; Sani, Hadi Tarighati; Sadjadi, Seyed Kazem
2010-12-01
The aim of this study was to evaluate the antibacterial effect of nisin-loaded chitosan/alginate nanoparticles as a novel antibacterial delivery vehicle. The nisin-loaded nanoparticles were prepared using colloidal dispersion of the chitosan/alginate polymers in the presence of nisin. After the preparation of the nisin-loaded nanoparticles, their physicochemical properties such as size, shape, and zeta potential of the formulations were studied using scanning electron microscope and nanosizer instruments, consecutively. FTIR and differential scanning calorimetery studies were performed to investigate polymer-polymer or polymer-protein interactions. Next, the release kinetics and entrapment efficiency of the nisin-loaded nanoparticles were examined to assess the application potential of these formulations as a candidate vector. For measuring the antibacterial activity of the nisin-loaded nanoparticles, agar diffusion and MIC methods were employed. The samples under investigation for total microbial counts were pasteurized and raw milks each of which contained the nisin-loaded nanoparticles and inoculated Staphylococcus aureus (ATCC 19117 at 10(6) CFU/mL), pasteurized and raw milks each included free nisin and S. aureus (10(6) CFU/mL), and pasteurized and raw milks each had S. aureus (10(6) CFU/mL) in as control. Total counts of S. aureus were measured after 24 and 48 h for the pasteurized milk samples and after the time intervals of 0, 6, 10, 14, 18, and 24 h for the raw milk samples, respectively. According to the results, entrapment efficiency of nisin inside of the nanoparticles was about 90-95%. The average size of the nanoparticles was 205 nm, and the average zeta potential of them was -47 mV. In agar diffusion assay, an antibacterial activity (inhibition zone diameter, at 450 IU/mL) about 2 times higher than that of free nisin was observed for the nisin-loaded nanoparticles. MIC of the nisin-loaded nanoparticles (0.5 mg/mL) was about four times less than
Aslan, O; Hamill, R M; Sweeney, T; Reardon, W; Mullen, A M
2009-01-01
It is essential to isolate high-quality DNA from muscle tissue for PCR-based applications in traceability of animal origin. We wished to examine the impact of cooking meat to a range of core temperatures on the quality and quantity of subsequently isolated genomic (specifically, nuclear) DNA. Triplicate steak samples were cooked in a water bath (100 degrees C) until their final internal temperature was 75, 80, 85, 90, 95, or 100 degrees C, and DNA was extracted. Deoxyribonucleic acid quantity was significantly reduced in cooked meat samples compared with raw (6.5 vs. 56.6 ng/microL; P 800 bp) were observed only when using DNA from raw meat and steak cooked to lower core temperatures. Small amplicons (food authentication, it is less abundant, and results suggest that analyses should be designed to use small amplicon sizes for meat cooked to high core temperatures.
Food spoilage - interactions between food spoilage bacteria
DEFF Research Database (Denmark)
Gram, Lone; Flodgaard, Lars; Rasch, Maria
2002-01-01
Food spoilage is a complex process and excessive amounts of foods are lost due to microbial spoilage even with modem day preservation techniques. Despite the heterogeneity in raw materials and processing conditions, the microflora that develops during storage and in spoiling foods can be predicted...... based on knowledge of the origin of the food, the substrate base and a few central preservation parameters such as temperature, atmosphere, a(w) and pH. Based on such knowledge, more detailed sensory, chemical and microbiological analysis can be carried out on the individual products to determine...... the actual specific spoilage organism. Whilst the chemical and physical parameters are the main determining factors for selection of spoilage microorganisms, a level of refinement may be found in some products in which the interactive behavior of microorganisms may contribute to their growth and/or spoilage...
Directory of Open Access Journals (Sweden)
Supreena Srisaikham
2017-02-01
Full Text Available Preservation of raw milk quality by activation of lactoperoxidase system (LPs was studied for the inhibition of microorganism growth. The antimicrobial effects of LPs were examined by measuring thiocyanate (SCN- concentration, lactoperoxidase (LP activity, milk composition, total bacterial count (TBC and coliform count (CC. All parameters were analyzed at 0 h and at 25°C and 30°C as a control. Thus, the experiment was conducted to evaluate the effect of 2 different temperatures (25°C vs 30°C and 4 ratios of NaSCN:2Na2CO3 3H2O2 (0:0, 7:15, 14:30 and 21:45 mg/L on milk samples (both uninoculated raw milk samples and Escherichia coli (E. coli inoculated milk samples with 8 replicates per run using 0-12 h incubation time in vitro assay. The runs were conducted on the same 4 NaSCN:2Na2CO3 3H2O2 ratios and different temperature and time of incubation were used. The results showed that the milk SCN- concentration and LP activity increased with increasing NaSCN:2Na2CO3 3H2O2 ratios. Milk compositions retained the quality of normal milk fat, protein, lactose, solid-not-fat (SNF and total solid (TS contents, and they were not significantly affected by the LPs activation. An obvious effect of the LP activated milk was the inhibition of TBC in uninoculated raw milk samples for 6 to 12 h both at 25°C and 30°C, and for 6 to 9 h in E. coil inoculated milk samples, whereas CC (6 h at 25°C and at least 3 h at 30°C for both uninoculated and E. coil inoculated milk samples. It is concluded that improved preservation of milk can be achieved through the addition of 14:30 and 21:45 mg/L of NaSCN:2Na2CO3 3H2O2 in uninoculated and E. coil inoculated milk samples respectively, to extend milk quality during storage.
Leijs, Hans; Broekhans, Joost; van Pelt, Leon; Mussinan, Cynthia
2005-07-13
The adoption of the 7th amendment of the European Cosmetic Directive 76/768/EEC requires any cosmetic product containing any of 26 raw materials identified by the Scientific Committee on Cosmetic Products and Non-Food Products intended for Consumers as likely to cause a contact allergy when present above certain trigger levels to be declared on the package label. Of these 26, 24 are volatile and can be analyzed by GC. This paper describes a method for the quantitative analysis of these volatile raw materials in perfume ingredients as well as complex perfume compositions. The method uses sequential dual-column GC-MS analysis. The full-scan data acquired minimize the false-positive and false-negative identifications that can be observed with alternate methods based on data acquired in the SIM mode. For each sample, allergen levels are determined on both columns sequentially, leading to two numerical results for each allergen. Quantification limits for each allergen in a perfume mixture based on the analysis of a standard are 0.999) and stable for multiple days. Studies on perfumes spiked with multiple allergens at 30, 50, and 70 mg/kg show recoveries close to nominal values.
Arsenic species in raw and cooked rice: Implications for human health in rural Bengal
Energy Technology Data Exchange (ETDEWEB)
Halder, Dipti, E-mail: dipti@kth.se [KTH-International Groundwater Arsenic Research Group, Division of Land and Water Resources Engineering, Department of Sustainable Development, Environmental Sciences and Engineering, KTH Royal Institute of Technology, Teknikringen 76, SE-100 44 Stockholm (Sweden); Department of Chemistry, University of Kalyani, Kalyani, 741 235, West Bengal (India); Biswas, Ashis [KTH-International Groundwater Arsenic Research Group, Division of Land and Water Resources Engineering, Department of Sustainable Development, Environmental Sciences and Engineering, KTH Royal Institute of Technology, Teknikringen 76, SE-100 44 Stockholm (Sweden); Department of Chemistry, University of Kalyani, Kalyani, 741 235, West Bengal (India); Šlejkovec, Zdenka [Environmental Sciences Department, Jožef Stefan Institute, Jamova 39, 1000, Ljubljana (Slovenia); Chatterjee, Debashis [Department of Chemistry, University of Kalyani, Kalyani, 741 235, West Bengal (India); Nriagu, Jerome [Department of Environmental Health Sciences, School of Public Health, University of Michigan, 109 Observatory Street, Ann Arbor, MI 48109-2029 (United States); Jacks, Gunnar; Bhattacharya, Prosun [KTH-International Groundwater Arsenic Research Group, Division of Land and Water Resources Engineering, Department of Sustainable Development, Environmental Sciences and Engineering, KTH Royal Institute of Technology, Teknikringen 76, SE-100 44 Stockholm (Sweden)
2014-11-01
This study compares the concentrations of total and different species of arsenic (As) in 29 pairs of raw and cooked rice samples collected from households in an area of West Bengal affected by endemic arsenicism. The aim is to investigate the effects of indigenous cooking practice of the rural villagers on As accumulation and speciation in cooked rice. It is found that inorganic As is the predominant species in both raw (93.8%) and cooked rice (88.1%). Cooking of rice with water low in As (< 10 μg L{sup −1}) significantly decreases the total and inorganic As content in cooked rice compared to raw rice. Arsenic concentration is mainly decreased during boiling of rice grains with excess water. Washing of rice grains with low As water has negligible effect on grain As concentration. The study suggests that rice cooking with low As water by the villagers is a beneficial risk reduction strategy. Despite reductions in As content in cooked rice because of cooking with low As water, the consumption of cooked rice represents a significant health threat (in terms of chronic As toxicity) to the study population. - Highlights: • Pairs of raw and cooked rice samples are collected from households. • Total and different species of As in raw and cooked rice samples are compared. • Cooking with As safe water reduces total and inorganic As contents in cooked rice. • Inorganic As is the predominant species in both raw (93.8%) and cooked rice (88.1%). • Risks of As exposure from cooked rice consumption exceed the safety standards.
Arsenic species in raw and cooked rice: Implications for human health in rural Bengal
International Nuclear Information System (INIS)
Halder, Dipti; Biswas, Ashis; Šlejkovec, Zdenka; Chatterjee, Debashis; Nriagu, Jerome; Jacks, Gunnar; Bhattacharya, Prosun
2014-01-01
This study compares the concentrations of total and different species of arsenic (As) in 29 pairs of raw and cooked rice samples collected from households in an area of West Bengal affected by endemic arsenicism. The aim is to investigate the effects of indigenous cooking practice of the rural villagers on As accumulation and speciation in cooked rice. It is found that inorganic As is the predominant species in both raw (93.8%) and cooked rice (88.1%). Cooking of rice with water low in As (< 10 μg L −1 ) significantly decreases the total and inorganic As content in cooked rice compared to raw rice. Arsenic concentration is mainly decreased during boiling of rice grains with excess water. Washing of rice grains with low As water has negligible effect on grain As concentration. The study suggests that rice cooking with low As water by the villagers is a beneficial risk reduction strategy. Despite reductions in As content in cooked rice because of cooking with low As water, the consumption of cooked rice represents a significant health threat (in terms of chronic As toxicity) to the study population. - Highlights: • Pairs of raw and cooked rice samples are collected from households. • Total and different species of As in raw and cooked rice samples are compared. • Cooking with As safe water reduces total and inorganic As contents in cooked rice. • Inorganic As is the predominant species in both raw (93.8%) and cooked rice (88.1%). • Risks of As exposure from cooked rice consumption exceed the safety standards
... wash your hands before preparing or serving food. Cook eggs until they are solid, not runny. DO NOT eat raw ground beef, chicken, eggs, or fish. Heat all casseroles to ... Use a thermometer when cooking beef to at least 160°F (71.1° ...
Tran, Ngoc Han; Hu, Jiangyong; Li, Jinhua; Ong, Say Leong
2014-01-01
There is no quantitative data on the occurrence of artificial sweeteners in the aquatic environment in Southeast Asian countries, particularly no information on their suitability as indicators of raw wastewater contamination on surface water and groundwater. This study provided the first quantitative information on the occurrence of artificial sweeteners in raw wastewater, surface water and groundwater in the urban catchment area in Singapore. Acesulfame, cyclamate, saccharin, and sucralose were ubiquitous in raw wastewater samples at concentrations in the range of ng/L-μg/L, while other sweeteners were not found or found only in a few of the raw wastewater samples. Residential and commercial effluents were demonstrated to be the two main sources of artificial sweeteners entering the municipal sewer systems. Relatively higher concentrations of the detected sweeteners were frequently found in surface waters at the sampling sites located in the residential/commercial areas. No significant difference in the concentrations of the detected sweeteners in surface water or groundwater was noted between wet and dry weather conditions (unpaired T-test, p> 0.05). Relatively higher concentrations and detection frequencies of acesulfame, cyclamate and saccharin in surface water samples were observed at the potentially impacted sampling sites, while these sweeteners were absent in most of the background surface water samples. Similarly, acesulfame, cyclamate, and saccharin were found in most groundwater samples at the monitoring well (GW6), which is located close to known leaking sewer segment; whereas these were absent in the background monitoring well, which is located in the catchment with no known wastewater sources. Taken together, the results suggest that acesulfame, cyclamate, and saccharin can be used as potential indicators of raw wastewater contamination in surface water and groundwater. Copyright © 2013 Elsevier Ltd. All rights reserved.
Macro elemental analysis of food samples by nuclear analytical technique
Syahfitri, W. Y. N.; Kurniawati, S.; Adventini, N.; Damastuti, E.; Lestiani, D. D.
2017-06-01
Energy-dispersive X-ray fluorescence (EDXRF) spectrometry is a non-destructive, rapid, multi elemental, accurate, and environment friendly analysis compared with other detection methods. Thus, EDXRF spectrometry is applicable for food inspection. The macro elements calcium and potassium constitute important nutrients required by the human body for optimal physiological functions. Therefore, the determination of Ca and K content in various foods needs to be done. The aim of this work is to demonstrate the applicability of EDXRF for food analysis. The analytical performance of non-destructive EDXRF was compared with other analytical techniques; neutron activation analysis and atomic absorption spectrometry. Comparison of methods performed as cross checking results of the analysis and to overcome the limitations of the three methods. Analysis results showed that Ca found in food using EDXRF and AAS were not significantly different with p-value 0.9687, whereas p-value of K between EDXRF and NAA is 0.6575. The correlation between those results was also examined. The Pearson correlations for Ca and K were 0.9871 and 0.9558, respectively. Method validation using SRM NIST 1548a Typical Diet was also applied. The results showed good agreement between methods; therefore EDXRF method can be used as an alternative method for the determination of Ca and K in food samples.
Lipid analyses of fumigated vs irradiated raw and roasted almonds
International Nuclear Information System (INIS)
Uthman, R.S.; Toma, R.B.; Garcia, R.; Medora, N.P.; Cunningham, S.
1998-01-01
The purpose of this study was to compare the effects of propylene oxide (PO) and irradiation treatments on the lipid analyses of raw and roasted almonds. Eight kilograms each of raw and roasted almonds were divided into four batches (2 kg each). Three of the batches were subjected to PO treatment or irradiation treatment with a dose of 6, 10·5 kGy. The untreated batch served as control samples, they were taken from all the batches at three consecutive times during storage (day 0, 8 weeks and 16 weeks) and analysed for iodine number, peroxide value and 2-thiobarbituric acid number. Overall, irradiated almonds incurred a higher variation in lipid stability than PO tested almonds while roasted almonds incurred a higher variation than raw almonds
Directory of Open Access Journals (Sweden)
Jhonathan Campos do Couto Beltrão
2017-11-01
Full Text Available Introduction: The consumption of meals outside the home has become an increasingly common practice in the life of the Brazilian population and of everyone. Objective: The aim of this work was to evaluate the microbiological quality of raw white cabbage (Brassica oleracea var. capitata f. alba, served in an institutional self-service restaurant, in the different stages of processing (reception, sanitation, slicing, cooling and distribution. In addition, Good Manufacturing Practices (GMP were evaluated through a checklist. Method: Total coliform, Escherichia coli and total aerobic bacteria were counted and Salmonella spp. was searched. Results: A sample collected at the reception stage showed Salmonella spp. Sanitization eliminated Salmonella spp. and reduced total coliforms and E. coli to undetectable numbers. The environment, the equipment and the manipulation strongly influenced the microbiological quality of food. Samples collected on day 4, after slicing, showed 3.2 log CFU of E. coli per g and at distribution 4.1 log CFU/g, which indicates unsatisfactory hygienic conditions. The restaurant had 55.75% compliance with GMP items, being classified as regular (Group 2, in accordance with RDC n° 275/2002. Conclusions: The non-conformities (37.00% observed in the exposure to prepared food consumption may be influencing the microbiological quality of raw white cabbage salad served. In this way we highlight the importance of the application of GMP in the production process to obtain a safe food and the compliance with the four POP required by RDC n° 216/2004.
Lan, X Y; Zhao, S G; Zheng, N; Li, S L; Zhang, Y D; Liu, H M; McKillip, J; Wang, J Q
2017-06-01
Contamination of raw milk with bacterial pathogens is potentially hazardous to human health. The aim of this study was to evaluate the total bacteria count (TBC) and presence of pathogens in raw milk in Northern China along with the associated herd management practices. A total of 160 raw milk samples were collected from 80 dairy herds in Northern China. All raw milk samples were analyzed for TBC and pathogens by culturing. The results showed that the number of raw milk samples with TBC milk samples were Staphylococcus aureus positive, 72 (45.00%) were Escherichia coli positive, 2 (1.25%) were Salmonella positive, 2 (1.25%) were Listeria monocytogenes positive, and 3 (1.88%) were Campylobacter positive. The prevalence of S. aureus was influenced by season, herd size, milking frequency, disinfection frequency, and use of a Dairy Herd Improvement program. The TBC was influenced by season and milk frequency. The correlation between TBC and prevalence of S. aureus or E. coli is significant. The effect size statistical analysis showed that season and herd (but not Dairy Herd Improvement, herd size, milking frequency, disinfection frequency, and area) were the most important factors affecting TBC in raw milk. In conclusion, the presence of bacteria in raw milk was associated with season and herd management practices, and further comprehensive study will be powerful for effectively characterizing various factors affecting milk microbial quality in bulk tanks in China. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Raw-fish-eating behavior and fishborne zoonotic trematode infection in people of northern Vietnam
DEFF Research Database (Denmark)
Phan, Van Thi; Ersbæll, Annette Kjær; Do, Dung Trung
2011-01-01
, as they know effective drug treatment is available. Raw fish dishes are consumed at social gatherings from shared plates and dipping sauces using the same chop sticks. This is likely to pose risks of crosscontamination with FZT metacercariae to different food items as indicated by the finding that 25...
Study on optimum length of raw material in stainless steel high-lock nuts forging
Cheng, Meiwen; Liu, Fenglei; Zhao, Qingyun; Wang, Lidong
2018-04-01
Taking 302 stainless steel (1Cr18Ni9) high-lock nuts for research objects, adjusting the length of raw material, then using DEFORM software to simulate the isothermal forging process of each station and conducting the corresponding field tests to study the effects of raw material size on the stainless steel high-lock nuts forming performance. The tests show that the samples of each raw material length is basically the same as the results of the DEFORM software. When the length of the raw material is 10mm, the appearance size of the parts can meet the design requirements.
40 CFR 89.413 - Raw sampling procedures.
2010-07-01
... of the exhaust pipe—whichever is the larger—upstream of the exit of the exhaust gas system. (b) In..., such as in a “Vee” engine configuration, it is permissible to: (1) Sample after all exhaust pipes have been connected together into a single exhaust pipe. (2) For each mode, sample from each exhaust pipe...
Ultra-low field MRI food inspection system prototype
Energy Technology Data Exchange (ETDEWEB)
Kawagoe, Satoshi, E-mail: s133413@edu.tut.ac.jp; Toyota, Hirotomo; Hatta, Junichi; Ariyoshi, Seiichiro; Tanaka, Saburo, E-mail: tanakas@ens.tut.ac.jp
2016-11-15
Highlights: • We have developed a ULF-MRI system using HTS-SQUID for food inspection. • We developed a compact magnetically shielded box to attenuate environmental noise. • The 2D-MR image was reconstructed from the grid processing data using 2D-FFT method. • The 2D-MR images of a disk-shaped and a multiple cell water sample were obtained. • The results showed the possibility of applying the ULF-MRI system to food inspection. - Abstract: We develop an ultra-low field (ULF) magnetic resonance imaging (MRI) system using a high-temperature superconducting quantum interference device (HTS-SQUID) for food inspection. A two-dimensional (2D)-MR image is reconstructed from the grid processing raw data using the 2D fast Fourier transform method. In a previous study, we combined an LC resonator with the ULF-MRI system to improve the detection area of the HTS-SQUID. The sensitivity was improved, but since the experiments were performed in a semi-open magnetically shielded room (MSR), external noise was a problem. In this study, we develop a compact magnetically shielded box (CMSB), which has a small open window for transfer of a pre-polarized sample. Experiments were performed in the CMSB and 2D-MR images were compared with images taken in the semi-open MSR. A clear image of a disk-shaped water sample is obtained, with an outer dimension closer to that of the real sample than in the image taken in the semi-open MSR. Furthermore, the 2D-MR image of a multiple cell water sample is clearly reconstructed. These results show the applicability of the ULF-MRI system in food inspection.
Detection of aflatoxin M1 in raw and commercial pasteurized milk in Urmia, Iran.
Tajik, Hossein; Rohani, Seyed Mehdi Razavi; Moradi, Mehran
2007-11-15
During the years 2005 and 2006, samples of raw and of pasteurized milk (72 samples each) were collected randomly from various parts of Urmia city in Iran for the detection of aflatoxin M1. Aflatoxin M1 levels were assessed by Enzyme Linked Immuno Sorbent Assay (ELISA). There was a high incidence of AFM1 (100%), in both raw and pasteurized milk samples. The AFM1 levels in 6.25% of samples were higher than the maximum tolerance limit accepted by European Union (50 ng L(-1)), while the observed mean ofAFM1 was lower than those proposed for European diets. Maximum level ofAFM1 in raw and pasteurized samples were 91.8 and 28.5 ng L(-1), while minimum levels were 4.3 and 5.1 ng L(-1), respectively. The levels ofAFM1 in total samples indicated that feeds for cows in this region were contaminated with AFB1 in such a level that appears to be a serious public health problem at the moment. Therefore, there is a need to limit exposure to aflatoxins by imposing regulatory limits.
Efimochkina, N R; Bykova, I B; Stetsenko, V V; Minaeva, L P; Pichugina, T V; Markova, Yu M; Korotkevich, Yu V; Kozak, S S; Sheveleva, S A
2016-01-01
The purpose of the work was to study the nature of the Campylobacter spp. contamination during the processing of food products of plant and animal origin (raw poultry and beef meat, raw milk, leafy salads, sliced raw vegetables). In the study of 148 samples 50 strains of Campylobacter spp. (33.8%) were found. For the main phenotypic characteristics they were identified as C. jejuni spp. jejuni and C. jejuni spp. doylei (over 75%). The highest level of detection of campylobacteria (over 45%) was set for raw poultry, including the carcasses of chickens broilers, quails, turkeys and their semi-finished products. 19 of the 27 strains from poultry were identified as C. jejuni. Among the strains isolated from the environment, including swabs from equipment surfaces, 91% of the isolates were also presented by C. jejuni. It was found that the investigated foodstuffs were characterized by high levels of contamination with bacteria of the family Enterobacteriaceae, the content of which was comparable with the identified values of total viable bacteria (cfu). Salmonella was detected in 19% of the investigated poultry samples and in 14.3% of raw cow milk. In the study of swabs from surfaces of poultry processing equipment, the frequency of detection of Campylobacter strains was 38.7%, Salmonella - 12.9%. Most commonly Campylobacter and Salmonella were detected in the zones of primary processing of poultry: the frequency of isolation of Salmonella in slaughter corner was 25%, Campylobacter - 43%. When testing the swabs taken in the cooking zone of «fast food» restaurants Campylobacter and Salmonella were not detected. For studying the swabs from equipment surfaces and the environment for the presence of Campylobacter spp. a modified technique of sampling was developed. The method includes a comprehensive analysis in the test area with the use of three types of media for transportation and incubation of Campylobacter spp. (Preston broth with blood, Brucella broth, Cary
Quantitative analysis of food and feed samples with droplet digital PCR.
Directory of Open Access Journals (Sweden)
Dany Morisset
Full Text Available In this study, the applicability of droplet digital PCR (ddPCR for routine analysis in food and feed samples was demonstrated with the quantification of genetically modified organisms (GMOs. Real-time quantitative polymerase chain reaction (qPCR is currently used for quantitative molecular analysis of the presence of GMOs in products. However, its use is limited for detecting and quantifying very small numbers of DNA targets, as in some complex food and feed matrices. Using ddPCR duplex assay, we have measured the absolute numbers of MON810 transgene and hmg maize reference gene copies in DNA samples. Key performance parameters of the assay were determined. The ddPCR system is shown to offer precise absolute and relative quantification of targets, without the need for calibration curves. The sensitivity (five target DNA copies of the ddPCR assay compares well with those of individual qPCR assays and of the chamber digital PCR (cdPCR approach. It offers a dynamic range over four orders of magnitude, greater than that of cdPCR. Moreover, when compared to qPCR, the ddPCR assay showed better repeatability at low target concentrations and a greater tolerance to inhibitors. Finally, ddPCR throughput and cost are advantageous relative to those of qPCR for routine GMO quantification. It is thus concluded that ddPCR technology can be applied for routine quantification of GMOs, or any other domain where quantitative analysis of food and feed samples is needed.
Quantification of isotope-labelled and unlabelled folates in plasma, ileostomy and food samples.
Büttner, Barbara E; Öhrvik, Veronica E; Witthöft, Cornelia M; Rychlik, Michael
2011-01-01
New stable isotope dilution assays were developed for the simultaneous quantitation of [(13)C(5)]-labelled and unlabelled 5-methyltetrahydrofolic acid, 5-formyltetrahydrofolic acid, folic acid along with unlabelled tetrahydrofolic acid and 10-formylfolic acid in clinical samples deriving from human bioavailability studies, i.e. plasma, ileostomy samples, and food. The methods were based on clean-up by strong anion exchange followed by LC-MS/MS detection. Deuterated analogues of the folates were applied as the internal standards in the stable isotope dilution assays. Assay sensitivity was sufficient to detect all relevant folates in the respective samples as their limits of detection were below 0.62 nmol/L in plasma and below 0.73 μg/100 g in food or ileostomy samples. Quantification of the [(13)C(5)]-label in clinical samples offers the possibility to differentiate between folate from endogenous body pools and the administered dose when executing bioavailability trials.
Comparison of food processing retention factors of 137Cs and 40K in vegetables
International Nuclear Information System (INIS)
Keiko Tagami; Shigeo Uchida
2013-01-01
Removal of radiocesium from food by processing is of great concern following the accident of TEPCO's Fukushima Daiichi Nuclear Power Plant accident. To provide more Cs removal rates, we studied the applicability of K data using edible plant samples. Values were compared for 137 Cs and 40 K of the food processing retention factors, F r (total activity in processed food/total activity in raw food), and they were found to be close to the 1:1 line and highly correlated (R = 0.96, p r ) x 100, for ten vegetable types to provide potential Cs removal rates. The average percent of K removal were as follows: dried pulses, 33; fresh pulses, 15; leafy vegetables, 52; fruit vegetables, 7; flower vegetables, 44: root crops, 18; tubers, 16; ferns, 93: mushrooms, 32; and others, 30. (author)
South Korea's entry to the global food economy: shifts in consumption of food between 1998 and 2009.
Lee, Haeng-Shin; Duffey, Kiyah J; Popkin, Barry M
2012-01-01
Korea has undergone a major opening of its food markets and economy in the past decade. Little is understood about the impact of these shifts on the diet of Koreans. This analysis studies the shifts in consumption of foods between 1998 and 2009 to provide a thorough understanding of the transition and insights into directions in the next decades in Korea. Data are from the Korea National Health and Nutrition Examination Survey (KNHANES). The sample used was a nationally representative sample of individuals age ≥2 in 1998 and 2009 (n=10,267 and 9,264, respectively). The data was corrected for seasonality, and the original raw food data was regrouped into 53 food groups. SAS was used to adjust for design effects and weight. Despite a decade of efforts to increase whole grains intake, and fruit and vegetable intake, the mean intake of whole grains increased only a small amount (16 kcal/person/day); however, the proportion consuming any whole grains doubled from 24% to 46.3%. Rice declined significantly, and several important less healthful food trends emerged: total alcohol intake increased from 39 kcal/person/day to 82 kcal/person/day. Also, energy from sugar-sweetened beverages increased among teens and energy from tea and coffee increased among adults. Remarkably, compared to other Asian countries and a general worldwide trend, vegetable intake remained relative high in South Korea during this last decade while fat energy increased modestly from relative low levels. Dynamic causes of these trends and the government's response are discussed.
Directory of Open Access Journals (Sweden)
Sani Saidu
2017-12-01
Full Text Available The effect of cooking on starch hydrolysis, polyphenol contents, and in vitro α-amylase inhibitory properties of mushrooms (two varieties Russula virescens and Auricularia auricula-judae, sweet potato (Ipomea batatas, and potato (Solanum tuberosum was investigated. The total, resistant, and digestible starch contents of the raw and cooked food samples (FS ranged from 6.4 to 64.9; 0 to 10.1; and 6.4 to 62.7 g/100 g, respectively, while their percentages of starch digestibility (DS values expressed as percentages of total starch hydrolyzed ranged from 45.99 to 100. Raw and boiled unpeeled potato, raw and boiled peeled potato, raw A. auricula-judae, and sweet potato showed mild to high α-amylase inhibition (over a range of concentration of 10–50 mg/mL, which was lower than that of acarbose (that had 69% inhibition of α-amylase over a range of concentration of 2–10 mg/mL, unlike raw R. virescens, boiled A. auricula-judae, and boiled sweet potatoes that activated α-amylase and boiled R. virescens that gave 0% inhibition. The FS contained flavonoids and phenols in addition. The significant negative correlation (r = −0.55; P = 0.05 between the α-amylase inhibitory properties of the raw and cooked FS versus their SD indicates that the α-amylase inhibitors in these FS also influenced the digestibility of their starches. In addition, the significant positive correlation between the α-amylase inhibitory properties of the raw and cooked FS versus their resistant starch (RS (r = 0.59; P = 0.01 contents indicates that the RS constituents of these FS contributed to their α-amylase inhibitory properties. The study showed the usefulness of boiled unpeeled potato, boiled potato peeled, and raw sweet potato as functional foods for people with type 2 diabetes.
International Nuclear Information System (INIS)
Garcia, T.Y.; Enriquez, S.O.; Duran, E.B.
1986-01-01
The natural radioactivity levels of tritium in environmental samples collected around the vicinity and more distant environment of the first Philippine Nuclear Power Plant (PNPP-1) in Bataan were assessed. The samples analyzed consisted of water samples such as seawater, freshwater, drinking water, groundwater and rainwater; and food samples such as cereals, vegetables, fruits; meat, milk fish and crustaceans. Tritium concentrations in water samples were determined by distillation and liquid scintillation counting techniques. The food samples were analyzed for tissue-free water tritium by the freezing-drying method followed by liquid scintillation counting techniques. (Auth.) 13 refs
Long-lasting stability of vaccinia virus (orthopoxvirus) in food and environmental samples.
Essbauer, S; Meyer, H; Porsch-Ozcürümez, M; Pfeffer, M
2007-01-01
Poxviruses are known to remain infectious in the scabs of patients for months to years. The aim of this study was to investigate viral stability in storm water, food or gauze spiked with vaccinia virus strain Munich 1 (VACV M1). Storm water, storm water supplemented with either fetal calf serum (FCS) or potting soil was stored at two different temperatures (refrigerator, room temperature; 4 degrees C/25 degrees C). In addition, we analysed the viability of VACV M1 on the surface of bread, salad, sausages and gauze bandages stored at 4 degrees C. Samples were titrated in MA 104 cells and the presence of viral DNA was demonstrated by orthopoxvirus-specific PCRs. After 2 weeks, reisolation of VACV M1 from all kinds of food, bandage and water samples except for storm water supplemented with potting soil was possible. Viral DNA was detected in almost all samples by PCR. Prolonged experiments with VACV M1-spiked storm water and storm water supplemented with FCS revealed that samples kept at 4.5 degrees C are infectious for up to 166 days. Our data demonstrate that VACV M1 has a longlasting stability in water and food. The results obtained during this study should be taken into account for risk assessment calculations for poxvirus transmission. Implying that variola virus and vaccinia virus behave in a similar way, our data call for sophisticated countermeasures in cases of a variola release in biological warfare.
Thorium and Uranium in the Rock Raw Materials Used For the Production of Building Materials
Pękala, Agnieszka
2017-10-01
Thorium and uranium are constant components of all soils and most minerals thereby rock raw materials. They belong to the particularly dangerous elements because of their natural radioactivity. Evaluation of the content of the radioactive elements in the rock raw materials seems to be necessary in the early stage of the raw material evaluation. The rock formations operated from deposits often are accumulated in landfills and slag heaps where the concentration of the radioactive elements can be many times higher than under natural conditions. In addition, this phenomenon may refer to buildings where rock raw materials are often the main components of the construction materials. The global control system of construction products draws particular attention to the elimination of used construction products containing excessive quantities of the natural radioactive elements. In the presented study were determined the content of thorium and uranium in rock raw materials coming from the Bełachatów lignite deposit. The Bełchatów lignite deposit extracts mainly lignite and secondary numerous accompanying minerals with the raw material importance. In the course of the field works within the framework of the carried out work has been tested 92 samples of rocks of varied petrographic composition. There were carried out analyses of the content of the radioactive elements for 50 samples of limestone of the Jurassic age, 18 samples of kaolinite clays, and 24 samples of siliceous raw materials, represented by opoka-rocks, diatomites, gaizes and clastic rocks. The measurement of content of the natural radioactive elements thorium and uranium based on measuring the frequency counts of gamma quantum, recorded separately in measuring channels. At the same time performed measurements on volume patterns radioactive: thorium and uranium. The studies were carried out in Mazar spectrometer on the powdered material. Standardly performed ten measuring cycles, after which were calculated
Toxin production ability of Bacillus cereus strains from food product of Ukraine
Directory of Open Access Journals (Sweden)
I. Pylypenko
2017-10-01
Full Text Available Potential pathogens of foodborne toxic infections – bacterial contaminants Bacillus cereus isolated from plant raw materials and food products from the Ukrainian region were investigated. When determining of the proportion of isolated bacilli from the plant samples, it was established that the epidemiologically significant microorganisms of Bacillus cereus as agents of food poisoning are the second largest. The average value of contaminated samples of Ukrainian plant raw materials and processed products with Bacillus cereus is 36,2 %. The ability of Bacillus cereus strains identified by a complex of morphological, tinctorial, cultural and biochemical properties, to produce specific emetic and enterotoxins was studied. Molecular genetic diagnosis and detection of the toxin-producing ability of isolated 42 Bacillus cereus strains showed both the possibility of their rapid identification and the presence of specific toxicity genes. Multiplex polymerase chain reaction (PCR was carried out with specific primers to detect toxicity determined of various bacilli genes: nheA, hblD, cytK, cesВ. The distribution of toxigenic genes is significantly different among the Bacillus cereus isolates from various sources. The nheA, hblD and cytK enterotoxin genes were detected in 100, 83,3 and 61,9 % of the investigated strains of Bacillus cereus, respectively. The cesB gene encoding emetic toxin was detected in 4,8 % of strains. Molecular-genetic PCR-method confirmed that all the isolated strains belong to the Bacillus cereus group, and the ability to produce toxins can be attributed to five groups. The main toxins that produce the investigated Bacillus cereus strains were nhe and hbl enterotoxins encoded by the corresponding genes of nheA and hblD. The enterotoxic type of Bacillus cereus was predominant in Ukrainian region. Studies of domestic plant food raw materials and products have confirmed the need to improve microbiological control of product safety
Kim, Hyun Jung; Griffiths, Mansel W; Fazil, Aamir M; Lammerding, Anna M
2009-09-01
Foodborne illness contracted at food service operations is an important public health issue in Korea. In this study, the probabilities for growth of, and enterotoxin production by, Staphylococcus aureus in pork meat-based foods prepared in food service operations were estimated by the Monte Carlo simulation. Data on the prevalence and concentration of S. aureus as well as compliance to guidelines for time and temperature controls during food service operations were collected. The growth of S. aureus was initially estimated by using the U.S. Department of Agriculture's Pathogen Modeling Program. A second model based on raw pork meat was derived to compare cell number predictions. The correlation between toxin level and cell number as well as minimum toxin dose obtained from published data was adopted to quantify the probability of staphylococcal intoxication. When data gaps were found, assumptions were made based on guidelines for food service practices. Baseline risk model and scenario analyses were performed to indicate possible outcomes of staphylococcal intoxication under the scenarios generated based on these data gaps. Staphylococcal growth was predicted during holding before and after cooking, and the highest estimated concentration (4.59 log CFU/g for the 99.9th percentile value) of S. aureus was observed in raw pork initially contaminated with S. aureus and held before cooking. The estimated probability for staphylococcal intoxication was very low, using currently available data. However, scenario analyses revealed an increased possibility of staphylococcal intoxication when increased levels of initial contamination in the raw meat, andlonger holding time both before and after cooking the meat occurred.
Moreno-Bondi, María Cruz; Marazuela, María Dolores; Herranz, Sonia; Rodriguez, Erika
2009-10-01
Antibiotics are a class of pharmaceuticals that are of great interest due to the large volumes of these substances that are consumed in both human and veterinary medicine, and due to their status as the agents responsible for bacterial resistance. They can be present in foodstuffs and in environmental samples as multicomponent chemical mixtures that exhibit a wide range of mechanisms of action. Moreover, they can be transformed into different metabolites by the action of microorganisms, as well as by other physical or chemical means, resulting in mixtures with higher ecotoxicities and risks to human health than those of the individual compounds. Therefore, there is growing interest in the availability of multiclass methods for the analysis of antimicrobial mixtures in environmental and food samples at very low concentrations. Liquid chromatography (LC) has become the technique of choice for multiclass analysis, especially when coupled to mass spectrometry (LC-MS) and tandem MS (LC-MS(2)). However, due to the complexity of the matrix, in most cases an extraction step for sample clean-up and preconcentration is required before analysis in order to achieve the required sensitivities. This paper reviews the most recent developments and applications of multiclass antimicrobial determination in environmental and food matrices, emphasizing the practical aspects of sample preparation for the simultaneous extraction of antimicrobials from the selected samples. Future trends in the application of LC-MS-based techniques to multiclass antibiotic analysis are also presented.
Vitamin D-3 and 25-hydroxyvitamin D-3 in raw and cooked pork cuts
DEFF Research Database (Denmark)
Clausen, Ina; Jakobsen, Jette; Leth, Torben
2003-01-01
The contents of vitamin D-3 and its metabolically active metabolite 25-hydroxyvitamin D-3 (25OHD(3)) were examined by HPLC in different parts of four common raw pork cuts (loin boneless, leg inside, thin belly, neck) and in cooked meat (loin boneless). In whole raw pork cuts, varying in fat content......, and that rind, despite its limited fat content, has a high concentration of vitamin D-3 and 25OHD(3). Cooking increased vitamin D-3 and 25OHD(3) calculated per 100 g of tissue in all parts and in the whole cut (in whole cuts in raw and cooked meat, respectively: vitamin D-3: 0.15 (0.08-0.24) mug/100 g and 0...... 25OHD(3) contributes significantly to vitamin D activity. Food databases should include concentrations of both vitamin D and 25OHD(3). (C) 2003 Elsevier Ltd. All rights reserved....
Costa, Renata G; Bah, Homegnon A F; Bandeira, Matheus J; Oliveira, Sérgio S P; Menezes-Filho, José A
2017-09-01
Lead (Pb) and cadmium (Cd) were determined in mangrove root crab (Goniopsis cruentata) tissues (in natura) and in two culinary preparations by graphite furnace atomic absorption spectrometry. Mangrove root crab samples from three sampling sites along the Jaguaripe River, Bahia, Brazil, where lead-glazed ceramics are produced, and from two commercial preparations were collected or purchased in March and April 2016. Cd levels in raw and processed samples were below the methods' limits of detection (0.016 mg kg -1 ), while Pb levels in the raw tissues were determined only in the gills (0.67 mg kg -1 ) and in the hepatopancreas (0.14 mg kg -1 ). However, Pb levels increased from 0.05 to 2.84 mg kg -1 in boiled/sorted muscle and in the traditional stew (with a 57-fold increase), respectively. Pb levels augmented significantly in the processed food due to migration of Pb used in the glazing of cooking ceramic utensils, surpassing the Brazilian and international safety limits.
Detection of triglycerides using immobilized enzymes in food and biological samples
Raichur, Ashish; Lesi, Abiodun; Pedersen, Henrik
1996-04-01
A scheme for the determination of total triglyceride (fat) content in biomedical and food samples is being developed. The primary emphasis is to minimize the reagents used, simplify sample preparation and develop a robust system that would facilitate on-line monitoring. The new detection scheme developed thus far involves extracting triglycerides into an organic solvent (cyclohexane) and performing partial least squares (PLS) analysis on the NIR (1100 - 2500 nm) absorbance spectra of the solution. A training set using 132 spectra of known triglyceride mixtures was complied. Eight PLS calibrations were generated and were used to predict the total fat extracted from commercial samples such as mayonnaise, butter, corn oil and coconut oil. The results typically gave a correlation coefficient (r) of 0.99 or better. Predictions were typically within 90% and better at higher concentrations. Experiments were also performed using an immobilized lipase reactor to hydrolyze the fat extracted into the organic solvent. Performing PLS analysis on the difference spectra of the substrate and product could enhance specificity. This is being verified experimentally. Further work with biomedical samples is to be performed. This scheme may be developed into a feasible detection method for triglycerides in the biomedical and food industries.
Control System Radioactive Contamination in Food Samples in Poland
International Nuclear Information System (INIS)
Grabowski, D.; Kurowski, W.; Muszynski, W.; Rubel, B.; Smagala, G.; Swietochowska, J.
2001-01-01
Full text: The analyses of the level of radioactive contamination in food samples are carried out by the Service for Measurements of Radioactive Contamination (SMRC) in Poland. The Service was brought into existence in 1961. The Service comprises of a network of measurement stations and the Centre of Radioactive Contamination Measurements (CRCM). The duty of the Centre is being executed by the Central Laboratory for Radiological Protection (CLRP). The uniform methods of sampling are used in measurement stations. All important foodstuff: milk, meat, vegetables, fruit, cereals are controlled in the Service stations. The radiochemical and spectrometric methods are used to determine the activity of radioactive isotopes. The standard equipment of the measurement station is the measurement system type SAPOS-90 and multichannel analyser with scintillation or germanium detector. The structure of the Service, kinds of samples tested by each station, program of sampling in normal and during accident situation are presented in this paper. (author)
Tremonte, Patrizio; Tipaldi, Luca; Succi, Mariantonietta; Pannella, Gianfranco; Falasca, Luisa; Capilongo, Valeria; Coppola, Raffaele; Sorrentino, Elena
2014-01-01
In Italy, the sale of raw milk from vending machines has been allowed since 2004. Boiling treatment before its use is mandatory for the consumer, because the raw milk could be an important source of foodborne pathogens. This study fits into this context with the aim to evaluate the microbiological quality of 30 raw milk samples periodically collected (March 2013 to July 2013) from 3 vending machines located in Molise, a region of southern Italy. Milk samples were stored for 72 h at 4 °C and then subjected to different treatments, such as boiling and microwaving, to simulate domestic handling. The results show that all the raw milk samples examined immediately after their collection were affected by high microbial loads, with values very close to or even greater than those acceptable by Italian law. The microbial populations increased during refrigeration, reaching after 72 h values of about 8.0 log cfu/mL for Pseudomonas spp., 6.5 log cfu/mL for yeasts, and up to 4.0 log cfu/mL for Enterobacteriaceae. Boiling treatment, applied after 72 h to refrigerated milk samples, caused complete decontamination, but negatively affected the nutritional quality of the milk, as demonstrated by a drastic reduction of whey proteins. The microwave treatment at 900 W for 75 s produced microbiological decontamination similar to that of boiling, preserving the content in whey proteins of milk. The microbiological characteristics of raw milk observed in this study fully justify the obligation to boil the raw milk from vending machines before consumption. However, this study also showed that domestic boiling causes a drastic reduction in the nutritional value of milk. Microwave treatment could represent a good alternative to boiling, on the condition that the process variables are standardized for safe domestic application. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
USING OF SECONDARY PRODUCTS OF RAPESEED PROCESSING IN THE FOOD INDUSTRY
Directory of Open Access Journals (Sweden)
E. A. Raksha-Slusareva
2014-04-01
Full Text Available When oil and biodiesel are extracted from rapeseed, secondary derived products are formed, which are not used effectively at the moment. The article deals with the problems of possible their use in food industry. During food product preparation for special dietary consumption we used electrophysical (processing by hydroelectropulse and physical (drying, grinding, steam treatment processing of raw materials. Through the developed technology for rapeseed cake processing, we received raw materials suitable for use in food industry. On the basis of these raw materials, the «Nutrition product for special dietary consumption “Ripakovyi”» was developed. It is a part of rape seed meal obtained from the seeds with low content of glucosinolates and erucic acid processed by hydroelectropulse dried in the cabinet oven or in the convective dryer, crushed and disinfected based on a developed soft technology for biologically active substances conservation. The production of this product solves the problem of rational utilization of rapeseed meal and diversification of foods for special dietary consumption.
McAuley, Catherine M; Britz, Margaret L; Gobius, Kari S; Craven, Heather M
2015-12-01
This study investigated the prevalence, seasonality, and species variety of enterococci present in raw milk factory silos and pasteurized milk in 3 dairying regions in Victoria, Australia, over a 1-yr period. Additionally, the growth ability of thermoduric enterococci isolated in this study (Enterococcus faecalis, E. faecium, E. hirae, and E. durans) was determined in milk at temperatures likely to occur during storage, transport, and distribution, and before domestic consumption (4 and 7°C). Enterococci were detected in 96% of 211 raw milk samples, with an average count of 2.48 log10 cfu/mL. Counts were significantly lower in winter than summer (average 1.84 log10 cfu/mL) and were different between factories but not regions. Enterococcus faecalis was the most prevalent species isolated from raw milk in every factory, comprising between 61.5 and 83.5% of enterococcal species across each season. Enterococci were detected in lower numbers in pasteurized milk than in raw milk and were below the limit of detection on spread plates (pasteurization. Residual viable cells were only detected following enrichment using 100-mL samples of milk, with 20.8% of the samples testing positive; this equated to a decrease in the average raw milk enterococci count of >4 log10 cfu/mL following pasteurization. Although E. faecalis predominated in raw milk and E. durans was found in only 2.9% of raw milk samples, E. durans was the most prevalent species detected in pasteurized milk. The detection of enterococci in the pasteurized milk did not correlate with higher enterococci counts in the raw milk. This suggested that the main enterococci populations in raw milk were heat-sensitive and that thermoduric enterococci survived pasteurization in a small numbers of instances. All of the thermoduric enterococci that were assessed for growth at likely refrigeration temperatures were able to grow at both 4 and 7°C in sterile milk, with generation times of 35 to 41h and 16 to 22h, respectively
Herrera, Fanny C; García-López, María-Luisa; Santos, Jesús A
2016-10-01
The aim of this study was the characterization of a collection of 8 methicillin-resistant Staphylococcus aureus (MRSA) isolates, obtained from samples of fresh cheese (Doble Crema) produced from raw cow milk in small dairies in Colombia. All the isolates harbored the mecA and Panton-Valentine leukocidin (PVL) genes, presented with SCCmec type IV, and belonged to multilocus sequence type 8 and spa type 024. Seven isolates presented 3 closely related pulsed-field gel electrophoresis profiles. Three of them carried the staphylococcal enterotoxin B gene. The isolates were resistant to cefoxitin, oxacillin, penicillin, and ampicillin and susceptible to all non-β-lactams antibiotics tested, with minimum inhibitory concentration values for oxacillin of 4 to 8mg/L. The isolates belonged to the community-acquired MRSA group, suggesting a human source of contamination. The risk of human infection by MRSA via contaminated foods is considered low, but contaminated food commodities can contribute to the worldwide dissemination of clones of community-acquired MRSA. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Siddappa, Vinutha; Nanjegowda, Divyashree Kallenahalli; Viswanath, Prema
2012-11-01
Aflatoxin M(1) (AFM(1)) is a toxic metabolite found in the milk of lactating animals which have consumed feedstuffs contaminated with aflatoxin B(1). Ultra high temperature treated (UHT) milk is a product which is becoming popular in developing countries like India as there is a lack of proper cold storage or refrigeration facilities. In this study, 45 samples of UHT milk of popular brands prevalent in the market were analyzed for the presence of AFM(1) by reversed phase HPLC using fluorescent detector after cleanup of sample with immunoaffinity columns. All samples of plain UHT milk were positive for AFM(1) and 38% of these contained levels more than 0.5 μg/kg, the maximum permitted limit prescribed by the Codex Alimentarius Commission and by the mandatory regulations of the country, the FSSAI Regulations, 2011. In 62.5% of flavored UHT milk, AFM(1) was below detectable levels (0.02 μgL(-1)). However, 12.5% of these samples also contained levels exceeding the maximum permitted limits. AFM(1) was present in 61.6% of the 52 raw milk samples analyzed from the two states of Karnataka and Tamilnadu with a range of 0.1-3.8 μgL(-1). 17.3% of these samples also exceeded the regulatory limits of the country. Copyright © 2012 Elsevier Ltd. All rights reserved.
Bird, Patrick; Fisher, Kiel; Boyle, Megan; Huffman, Travis; Benzinger, M Joseph; Bedinghaus, Paige; Flannery, Jonathon; Crowley, Erin; Agin, James; Goins, David; Benesh, DeAnn; David, John
2014-01-01
The 3M(™) Molecular Detection Assay (MDA) Salmonella utilizes isothermal amplification of nucleic acid sequences with high specificity, efficiency, rapidity and bioluminescence to detect amplification of Salmonella spp. in food, food-related, and environmental samples after enrichment. A method modification and matrix extension study of the previously approved AOAC Official Method(SM) 2013.09 was conducted, and approval of the modification was received on March 20, 2014. Using an unpaired study design in a multilaboratory collaborative study, the 3M MDA Salmonella method was compared to the U.S. Department of Agriculture/Food Safety and Inspection Service (USDA/FSIS) Microbiology Laboratory Guidebook (MLG) 4.05 (2011), Isolation and Identification of Salmonella from Meat, Poultry, Pasteurized Egg, and Catfish Products for raw ground beef and the U.S. Food and Drug Administration (FDA)/Bacteriological Analytical Manual (BAM) Chapter 5, Salmonella reference method for wet dog food following the current AOAC guidelines. A total of 20 laboratories participated. For the 3M MDA Salmonella method, raw ground beef was analyzed using 25 g test portions, and wet dog food was analyzed using 375 g test portions. For the reference methods, 25 g test portions of each matrix were analyzed. Each matrix was artificially contaminated with Salmonella at three inoculation levels: an uninoculated control level (0 CFU/test portion), a low inoculum level (0.2-2 CFU/test portion), and a high inoculum level (2-5 CFU/test portion). In this study, 1512 unpaired replicate samples were analyzed. Statistical analysis was conducted according to the probability of detection (POD). For the low-level raw ground beef test portions, the following dLPOD (difference between the LPODs of the reference and candidate method) values with 95% confidence intervals were obtained: -0.01 (-0.14, +0.12). For the low-level wet dog food test portions, the following dLPOD with 95% confidence intervals were
Analysis of Cl, Mn, Na, Zn in Food Samples by a Neutron Activation Analysis
International Nuclear Information System (INIS)
Moon, Jong Hwa; Kim, Sun Ha; Chung, Yong Sam; Lee, Ok Hee
2008-01-01
Due to their westernized dietary habit, Korean children are still threatened by the increasing risks of chronic disease such as obesity, hypertension, low immunity, etc. In addition, they are often exposed to a deficiency of Ca, Mg, Fe and micro-minerals which are necessary for their growth, immunity, and prevention of anemia. Nonetheless, the nutritional adequacy of mineral intakes for children is difficult to assess because of a lack of related studies and a nutritional database with respect to Korean children's foods. In this study, ninety kinds of foods consisting of lunch meals from an elementary and a middle school and children's favorite snacks were collected and prepared for an analysis. INAA which has an advantage of a non-destructive technique was employed to determine the elements like Cl, Mn, Na, Cl in the pretreated food samples. Quality control was carried out by using certified reference materials. From the analytical results, elemental concentration range in the collected samples according to the food groups was summarized
40 CFR 1065.245 - Sample flow meter for batch sampling.
2010-07-01
... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Sample flow meter for batch sampling... Sample flow meter for batch sampling. (a) Application. Use a sample flow meter to determine sample flow... difference between a diluted exhaust sample flow meter and a dilution air meter to calculate raw exhaust flow...
DEFF Research Database (Denmark)
Hald, Tine; Baggesen, Dorte Lau
Leafy greens eaten raw as salads are minimally processed and widely consumed foods. Risk factors for leafy greens contamination by Salmonella spp. and Norovirus were considered in the context of the whole food chain including agricultural production and processing. Available estimates...... combination of numerous characteristics that can influence occurrence and persistence of pathogens in leafy greens production. Appropriate implementation of food safety management systems, including Good Agricultural Practices (GAP), Good Hygiene Practices (GHP) and Good Manufacturing Practices (GMP), should...... of the prevalence of these pathogens (together with the use of Escherichia coli as an indicator organism) in leafy greens were evaluated. Specific mitigation options relating to contamination of leafy greens were considered and qualitatively assessed. It was concluded that each farm environment represents a unique...
Microbial Flora and Food Borne Pathogens on Minced Meat and ...
African Journals Online (AJOL)
BACKGROUND: Food-borne pathogens are the leading cause of illness and death in developing countries. Changes in eating habits, mass catering, unsafe food storage conditions and poor hygiene practices are major contributing factors to food associated illnesses. In Ethiopia, the widespread habit of raw beef ...
Detection of hepatitis A virus and bacterial contamination in raw oysters in Thailand.
Kittigul, Leera; Pombubpa, Kannika; Sukonthalux, Suntharee; Rattanatham, Tippawan; Utrarachkij, Fuangfa; Diraphat, Pornphan
2010-01-01
This study was conducted to determine the presence of hepatitis A virus (HAV) in raw oysters (Crassostrea belcheri) using a virus concentration method and reverse transcription-nested polymerase chain reaction (RT-nested PCR). A total of 220 oyster samples were collected from oyster farms and local markets in Thailand. HAV was found in three oyster samples. Nested PCR products of HAV detected in oysters were characterized further by DNA sequencing of the VP1/2A region and subjected to phylogenetic analysis. All HAV sequences (168 basepairs) were associated with human HAV subgenotype IB (GIB). Fecal coliforms and Escherichia coli were determined using the multiple tube fermentation method, to assess the microbiological quality of collected oysters. Among oyster samples tested, 65% had fecal coliforms higher than the standard level for raw shellfish [oyster samples (85%) were contaminated with E. coli in the range of 3.0-4.6 x 10(4) MPN/g. One oyster sample with an acceptable level of fecal coliforms contained HAV GIB. E. coli was found in all HAV-positive oyster samples. The results suggest a significant presence of HAV and bacterial indicators of fecal contamination in raw oysters, which are a health risk for consumers and a source of gastrointestinal illness. Enteric viruses should also be tested to assess the microbiological quality of oysters.
Raspor Lainšček, P; Biasizzo, M; Henigman, U; Dolenc, J; Kirbiš, A
2014-01-01
In antibiotic residue analyses the first step of screening is just as important as the following steps. Screening methods need to be quick and inexpensive, but above all sensitive enough to detect the antibiotic residue at or below the maximum residue limit (MRL). In the case of a positive result, the next step is conducted and further methods are used for confirmation. MRLs stated in European Union Regulation 37/2010 for tetracyclines in raw milk are: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 100 µg kg(-1) for chlortetracycline and no limit for doxycycline because it is prohibited for use in animals from which milk is produced for human consumption. The current five-plate microbiological screening method for the detection of antibiotic residues in raw milk was found to be simple and inexpensive, but not specific, sensitive and reliable enough to detect tetracycline at MRL in routine raw milk screening procedures. Spiking samples with tetracycline at the MRL level and applying them on Bacillus cereus ATCC 11778 microbiological plates often gave false-negative results, indicating that tetracyclines may have to be inactivated or masked. Tetracyclines seem to bind to a certain component in milk. Consequently, when applying samples to the B. cereus microbiological plate the antibiotic cannot inhibit the growth of B. cereus which disables the formation of inhibition zones on the test plate. After adding the appropriate amount of citric acid into the milk samples, we solved the problem of false-negative results. During the validation 79 samples of milk were spiked with tetracyclines at different concentrations: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 80 µg kg(-1) for chlortetracycline and 30 µg kg(-1) for doxycycline. Concentrations used in the validation matched the requirements for MRLs (they were either at or below the MRLs) stated in European Union Regulation 37/2010. The sensitivity of the validation was 100%.
Żelaziński, Tomasz; Ekielski, Adam; Siwek, Adam; Dardziński, Leszek
2017-01-01
Novel food batters, recommended for various products, are at present manufactured by extru- sion. Thanks to this, it is possible to look for and process new raw materials, if their processing has so far been considered impossible or economically unviable. The purpose of the work was therefore to investigate the extrudates produced from the corn and brewers' spent grain compounds that are subsequently used as raw material for food batter production. The work presents the findings of research on extrusion of corn mixes with varying levels of brewers' spent grains, to the maximum amount of 30%. Tests were conducted using a co-rotating double screw extruder, equipped with a single-outlet matrix with a diameter of 2.5mm. The products obtained were subjected to analysis of their parameters (apparent density, strength parameters, abrasiveness index) and the granulation of a single fraction was checked. The sample for which the percentage content was the highest was subjected to a detailed analysis of particle shape using vision software. It was found that an increase in the content of brewers' spent grains resulted in increased hardness of the products obtained. During the tests it was observed that the increasing hardness of the measured sam- ples is opposite to their abrasion resistance. The maximum decrement of the brasion parameters was seen for extrudates with 30% spent grain addition and was 1.4%, while the minimum decrement values for extrudates with brewers' grain content (10%) amounted to 0.85%. It was noted that this may prove the high brittleness of such products, particularly on the outer surface. It was also observed that lower grindability was recorded for samples produced by extrusion at a temperature of 140°C. On the other hand, higher grindability obtained at a temperature of 120°C may facilitate the grinding of such products, which may be particularly important in the production of food batter. Brewers' spent grains used as an addition to corn groats
Thung, T Y; Mahyudin, N A; Basri, D F; Wan Mohamed Radzi, C W J; Nakaguchi, Y; Nishibuchi, M; Radu, S
2016-08-01
Salmonellosis is one of the major food-borne diseases in many countries. This study was carried out to determine the occurrence of Salmonella spp., Salmonella Enteritidis, and Salmonella Typhimurium in raw chicken meat from wet markets and hypermarkets in Selangor, as well as to determine the antibiotic susceptibility profile of S. Enteritidis and S. Typhimurium. The most probable number (MPN) in combination with multiplex polymerase chain reaction (mPCR) method was used to quantify the Salmonella spp., S. Enteritidis, and S. Typhimurium in the samples. The occurrence of Salmonella spp., S. Enteritidis, and S. Typhimurium in 120 chicken meat samples were 20.80%, 6.70%, and 2.50%, respectively with estimated quantity varying from retail chicken meat could be a source of multiple antimicrobial-resistance Salmonella and may constitute a public health concern in Malaysia. © 2016 Poultry Science Association Inc.
Rall, V L M; Vieira, F P; Rall, R; Vieitis, R L; Fernandes, A; Candeias, J M G; Cardoso, K F G; Araújo, J P
2008-12-10
Milk is considered a nutritious food because it contains several important nutrients including proteins and vitamins. Conversely, it can be a vehicle for several pathogenic bacteria such as Staphylococcus aureus. This study aimed to analyze the frequency of genes encoding the staphylococcal enterotoxins (SEs) SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI and SEJ in S. aureus strains isolated from raw or pasteurized bovine milk. S. aureus was found in 38 (70.4%) out of 54 raw milk samples at concentrations of up to 8.9 x 10(5) CFU/ml. This microorganism was present in eight samples of pasteurized milk before the expiration date and in 11 samples analyzed on the expiration date. Of the 57 strains studied, 68.4% were positive for one or more genes encoding the enterotoxins, and 12 different genotypes were identified. The gene coding for enterotoxin A, sea, was the most frequent (16 strains, 41%), followed by sec (8 strains, 20.5%), sed (5 strains, 12.8%), seb (3 strains, 7.7%) and see (2 strains, 5.1%). Among the genes encoding the other enterotoxins, seg was the most frequently observed (11 strains, 28.2%), followed by sei (10 strains) and seh and sej (3 strains each). With the recent identification of new SEs, the perceived frequency of enterotoxigenic strains has increased, suggesting that the pathogenic potential of staphylococci may be higher than previously thought; however, further studies are required to assess the expression of these new SEs by S. aureus, and their impact in foodborne disease. The quality of Brazilian milk is still low, and efforts from the government and the entire productive chain are required to attain consumer safety.
Knowledge and Attitudes towards Handling Eggs in the Home: An Unexplored Food Safety Issue?
Whiley, Harriet; Clarke, Beverley; Ross, Kirstin
2017-01-06
Foodborne illness is a global public health issue, with food handling in the home identified as an underestimated source. In Australia, there has been a significant increase in the incidence of salmonellosis with the majority of outbreaks linked to eggs. This study investigated Australian eggs consumer attitudes, behaviours and risk perceptions associated with the handling of raw eggs in the home. It was identified that 67% of participants chose free range eggs, 11% kept poultry, 7% did not have any preference, 7% cage eggs, 4% barn eggs, 2% organic eggs and 1% pasteurized eggs. The majority of participants (91%) reported they stored eggs in the fridge. It was identified that there is an underestimation of "risky behaviour" associated with the consumption of raw eggs in the home, as 84% of participants indicated that they did not consume raw eggs, but subsequently 86% indicated that they had eaten mixture/batter containing raw eggs. Participants' responses relating to food safety were also examined in relation to their profession and gender. Safer food handling practices were identified by Environmental Health Officers (EHO) and Food handlers compared to all other professions ( p 0.05) their responses.
International Nuclear Information System (INIS)
Iswani S
2002-01-01
Preparation of environmental and food samples to support the heavy metals detection by stripping electrochemistry was done. The water samples taken directly from the ground water were acidified with 1 mL of HNO 3 acic suprapure was not digested, while the soils samples which have already dried in the oven at 105 o C, ware grinded and sieved through 150 μm, werte digested with HNO 3 acic suprapure in the digestion bomb at 150 o C for 3-4 hours. The mussels samples which have already freezed in the freezer were peeled, dried with N 2 liquid, grinded and dried again in the freeze drier at the pressure of ≅ 10 -2 mBar, and then were grinded again, weighted, digested with HNO 3 acic and HClO 4 suprapure in the digestion bomb at 150 o C for 3 hours. Food samples were homogenized by electric mixer, dried with freeze dried, homogenized again by using ZrO 2 ball mill, weighted, digested by HPA (high Pressure Asher). The heavy metals in the food samples solution of digestion product were detected by using Polarographic Analyzer EGandG of SWV and DPASV methods, while in the water, soils and the mussels solution were detected by using PDV 2000 and Polarograf E-505, DPASV method. The method validity were tested with SRM materials such as soil-5, soil-7, water W-4, and coppepoda. The heavy metals detection results in the water, soils, mussels, and food by electrochemical method were reported in this paper. (author)
Seasonal variation in the Dutch bovine raw milk composition
Heck, J.M.L.; Valenberg, van H.J.F.; Dijkstra, J.; Hooijdonk, van A.C.M.
2009-01-01
In this study, we determined the detailed composition of and seasonal variation in Dutch dairy milk. Raw milk samples representative of the complete Dutch milk supply were collected weekly from February 2005 until February 2006. Large seasonal variation exists in the concentrations of the main
Directory of Open Access Journals (Sweden)
Samy Selim
2015-09-01
Full Text Available This study was undertaken to investigate the prevalence and antibiotic resistance of food borne bacterial contamination in some Egyptian food. Total viable bacteria and total coliform bacteriawere isolated from different sources of food; carbohydrates (bread, flour and basbousa, vegetables (outer and inner tissues of potato and outer and inner tissues of cucumber and proteins (mincedmeat, cheese and milk. The study resulted in maximum value of total viable bacteria found in outer tissue of potato 68X104±1.0, while the minimum value found in inner tissues of potato andcucumber. The study resulted in total coliform was maximum value in minced meat 6.4X103±0.3. Basbousa and inner tissue of potato and cucumber were free from coliforms. The ability of isolatesto producing proteolytic enzymes was tested, we found that 326 isolate (63.92% from all isolates had this ability, thus we selected most 2 potent proteolytic isolates. The two isolates were identifiedas Bacillus cereus and Escherichia coli. The identification confirmed by microlog 34.20 system and 16SrRNA for two isolates and the same result was founded. Sensitivity tested for the most potentproteolytic species to 12 of the most commonly used antibiotics in the Egyptian pharmacy. The results showed that all species were sensitive to most of antibiotics, except B. cereus which was strongly susceptible to azteronam and ceftazidim. The data showed that raw meat, cooked food products, and raw milk were most commonly contaminated with foodborne pathogens and many pathogens were resistant to different antibiotics. The study provided useful information for assessment of the possible risk posed to consumers, which has significant public health impact.
Hu, Jiawei; Wang, Caixia; Tian, Li; Wang, Minjuan; Guo, Rong; Qiao, Haiou
2017-07-01
To investigate the contamination of zearalenone in food in Shaanxi Province, and to assess the dietary zearalenone exposure and the health risk of intaking zearalenone from corn products for Shaanxi residents. In 2013-2016, samples of five kinds of food including grains, vegetable oil, liquor and infants' food were collected randomly from ten cities, and determined with ultra-performance liquid chromatography. Dietary intake assessment of human exposure to zearalenone was carried out in combination of food consumption data with concentration of zearalenone. 1193 samples were detected zearalenone and the total detection rate was 17. 27%, with the mean value of 13. 5 μg/kg. Among all food samples, oil products were more seriously polluted than other kinds of foods, its detection rate was 79. 37%. And 12 samples of grain products exceed the standard, the exceeding standard rate was 1. 64%, which were all corn products. The level of zearalenone detected in wheat flour, rice, millet, beer and bakery products was low. The overall level of zearalenone contamination inmarket food is common, but corn products may be the severely contaminated foods with zearalenone in Shaanxi Province. The risk assessmentresult suggests that the current dietary intake of zearalenone from corn products in Shaanxi Province has no appreciable effect on health, however, the concentrations of zearalenone in corn products are relatively high, and need to be monitored in the future.
21 CFR 170.19 - Pesticide chemicals in processed foods.
2010-04-01
... the concentration of the residue in the processed food when ready to eat is not greater than the... processed food when ready to eat is higher than the tolerance prescribed for the raw agricultural commodity... authorized by the regulations in this part. Food that is itself ready to eat, and which contains a higher...
21 CFR 570.19 - Pesticide chemicals in processed foods.
2010-04-01
... the concentration of the residue in the processed food when ready to eat is not greater than the... processed food when ready to eat is higher than the tolerance prescribed for the raw agricultural commodity... authorized by the regulations in this part. Food that is itself ready to eat, and which contains a higher...
Applications of sonochemistry in Russian food processing industry.
Krasulya, Olga; Shestakov, Sergey; Bogush, Vladimir; Potoroko, Irina; Cherepanov, Pavel; Krasulya, Boris
2014-11-01
In food industry, conventional methodologies such as grinding, mixing, and heat treatment are used for food processing and preservation. These processes have been well studied for many centuries and used in the conversion of raw food materials to consumable food products. This report is dedicated to the application of a cost-efficient method of energy transfer caused by acoustic cavitation effects in food processing, overall, having significant impacts on the development of relatively new area of food processing such as food sonochemistry. Copyright © 2014 Elsevier B.V. All rights reserved.
The Effects of Cooking Process and Meat Inclusion on Pet Food Flavor and Texture Characteristics
Koppel, Kadri; Gibson, Michael; Alavi, Sajid; Aldrich, Greg
2014-01-01
Simple Summary The results of this research indicate that processing (baked vs. extruded) plays an important role in determining pet food product texture. In addition, raw ingredients (fresh meat vs. meal-based) did not consistently affect product sensory characteristics. These results may help pet food technologists better understand factors that affect palatability. Abstract The pet food industry is an important portion of the food and feed industries in the US. The objectives of this study were (1) to determine cooking method (baking or extrusion), meat inclusion (0 or 20%), and extrusion thermal to mechanical energy ratios (low, medium, and high) effects on sensory and volatile properties of pet foods, and (2) to determine associations among sensory and volatile characteristics of baked and extruded pet foods. Descriptive sensory analysis and gas chromatography-mass spectrometry were used to analyze the pet food samples. It was found that baked samples were lighter in color (2.0–2.6 baked vs. 3.5–4.3 extruded, color intensity scale 0–15), and had lower levels of attributes that indicated rancidity (i.e., fishy flavor; 0.3–0.6 baked, 0.6–1.5 extruded, scale 0–15), whereas extruded pet foods were more cohesive in mass, more friable, hard, and crisp, but less powdery than baked samples. Fresh meat inclusion tended to decrease bitterness and increase fishy flavor and cohesiveness of pet foods. High thermal to mechanical energy ratio during extrusion resulted in less musty and more porous kibbles. The main volatile compounds included aldehydes, such as hexanal and heptanal, ketones, and alcohols. Extruded samples did not contain methylpyrazine, while baked samples did not contain 2-butyl furan. Future studies should consider evaluating the relationship between sensory results and animal palatability for these types of foods. PMID:26480040
Arsenic species in wheat, raw and cooked rice: Exposure and associated health implications.
Rasheed, Hifza; Kay, Paul; Slack, Rebecca; Gong, Yun Yun
2018-09-01
Arsenic concentrations above 10μgL -1 were previously found in 89% of ground water sources in six villages of Pakistan. The present study has ascertained the health risks associated with exposure to total arsenic (tAs) and its species in most frequently consumed foods. Inorganic arsenic (iAs) concentrations were found to be 92.5±41.88μgkg -1 , 79.21±76.42μgkg -1 , and 116.38±51.38μgkg -1 for raw rice, cooked rice and wheat respectively. The mean tAs concentrations were 47.47±30.72μgkg -1 , 71.65±74.7μgkg -1 , 105±61.47μgkg -1 . Wheat is therefore demonstrated to be a significant source of arsenic exposure. Dimethylarsinic acid was the main organic species detected in rice, whilst monomethylarsonic acid was only found at trace levels. Total daily intake of iAs exceeded the provisional tolerable daily intake of 2.1μgkg -1 day -1 body weight in 74% of study participants due to concurrent intake from water (94%), wheat (5%) and raw rice (1%). A significant association between tAs in cooked rice and cooking water resulted in tAs intake 43% higher in cooked rice compared to raw rice. The study suggests that arsenic intake from food, particularly from wheat consumption, holds particular significance where iAs is relatively low in water. Chronic health risks were found to be significantly higher from wheat intake than rice, whilst the risk in terms of acute effects was below the USEPA's limit of 1.0. Children were at significantly higher health risk than adults due to iAs exposure from rice and/or wheat. The dietary exposure of participants to tAs was attributable to staple food intake with ground water iAs iAs in drinking water. Although the daily iAs intake from food was lower than total water intake, the potential health risk from exposure to arsenic and its species still exists and requires exposure control measures. Copyright © 2018 Elsevier B.V. All rights reserved.
Past, Present and Future of Sensors in Food Production.
Adley, Catherine C
2014-08-19
Microbial contamination management is a crucial task in the food industry. Undesirable microbial spoilage in a modern food processing plant poses a risk to consumers' health, causing severe economic losses to the manufacturers and retailers, contributing to wastage of food and a concern to the world's food supply. The main goal of the quality management is to reduce the time interval between the filling and the detection of a microorganism before release, from several days, to minutes or, at most, hours. This would allow the food company to stop the production, limiting the damage to just a part of the entire batch, with considerable savings in terms of product value, thereby avoiding the utilization of raw materials, packaging and strongly reducing food waste. Sensor systems offer major advantages over current systems as they are versatile and affordable but need to be integrated in the existing processing systems as a process analytical control (PAT) tool. The desire for good selectivity, low cost, portable and usable at working sites, sufficiently rapid to be used at-line or on-line, and no sample preparation devices are required. The application of biosensors in the food industry still has to compete with the standard analytical techniques in terms of cost, performance and reliability.
Past, Present and Future of Sensors in Food Production
Directory of Open Access Journals (Sweden)
Catherine C. Adley
2014-08-01
Full Text Available Microbial contamination management is a crucial task in the food industry. Undesirable microbial spoilage in a modern food processing plant poses a risk to consumers’ health, causing severe economic losses to the manufacturers and retailers, contributing to wastage of food and a concern to the world’s food supply. The main goal of the quality management is to reduce the time interval between the filling and the detection of a microorganism before release, from several days, to minutes or, at most, hours. This would allow the food company to stop the production, limiting the damage to just a part of the entire batch, with considerable savings in terms of product value, thereby avoiding the utilization of raw materials, packaging and strongly reducing food waste. Sensor systems offer major advantages over current systems as they are versatile and affordable but need to be integrated in the existing processing systems as a process analytical control (PAT tool. The desire for good selectivity, low cost, portable and usable at working sites, sufficiently rapid to be used at-line or on-line, and no sample preparation devices are required. The application of biosensors in the food industry still has to compete with the standard analytical techniques in terms of cost, performance and reliability.
Advances in paper-based sample pretreatment for point-of-care testing.
Tang, Rui Hua; Yang, Hui; Choi, Jane Ru; Gong, Yan; Feng, Shang Sheng; Pingguan-Murphy, Belinda; Huang, Qing Sheng; Shi, Jun Ling; Mei, Qi Bing; Xu, Feng
2017-06-01
In recent years, paper-based point-of-care testing (POCT) has been widely used in medical diagnostics, food safety and environmental monitoring. However, a high-cost, time-consuming and equipment-dependent sample pretreatment technique is generally required for raw sample processing, which are impractical for low-resource and disease-endemic areas. Therefore, there is an escalating demand for a cost-effective, simple and portable pretreatment technique, to be coupled with the commonly used paper-based assay (e.g. lateral flow assay) in POCT. In this review, we focus on the importance of using paper as a platform for sample pretreatment. We firstly discuss the beneficial use of paper for sample pretreatment, including sample collection and storage, separation, extraction, and concentration. We highlight the working principle and fabrication of each sample pretreatment device, the existing challenges and the future perspectives for developing paper-based sample pretreatment technique.
Effect of food processing on degradation of hexachlorocyclohexane and its isomers in milk.
Singh, Sujatha; Nelapati, Krishnaiah
2017-03-01
To study the effect of different food processing techniques on the degradation of organochlorine compounds (α, β, ɣ and δ hexachlorocyclohexane isomers (HCH)) residues in both natural and fortified samples of milk. Raw milk samples are collected from the local areas of Hyderabad, India. Naturally and fortified milk samples (HCH) were subjected to various food processing techniques, pasteurization (63ºC for ½ h), sterilization (121ºC for 15 min) and boiling for 5 min and analyzed by gas chromatography with electron capture detector using quick, easy, cheap, effective, rugged and safe method for multiresidue analysis of pesticides in milk with slight modification. The final mean residual concentration of pesticide in milk after heat processing and percentage of degradation were calculated with respective treatments. Heat treatments are highly effective on reduction of mean residual concentration of HCH in milk. In which Sterilization and boiling proved to be more effective in degradation of HCH isomers.
Ranieri, Matthew L.; Ivy, Reid A.; Mitchell, W. Robert; Call, Emma; Masiello, Stephanie N.; Wiedmann, Martin; Boor, Kathryn J.
2012-01-01
Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect...
Nutritional quality of raw and processed unripe Carica papaya fruit ...
African Journals Online (AJOL)
the unripe or green fruit is added into fresh salads (Boshra .... Copper showed the least concentration being undetectable in the raw and dried-cooked samples ..... meat. COMPETING INTERESTS. The authors declare that there is no conflict of ...
International Nuclear Information System (INIS)
Vucina, L.J.
1977-01-01
Trace elements in aluminium, raw materials and in the samples from different stages of aluminium production were determined by nondestructive neutron radioactivation analysis. The samples were taken from the Bayer's process of alumina production (bauxite, red sludge and alumina), from the components of the reduction cell (anode, criolyte and AlF 3 ) and of the final product - aluminium (purity 99.5-99.7%). Under given set of conditions ten trace elements (V,La,Ga,Mn,Co,Cr,Sc,Sb,Zn and Fe) were determined in aluminium and followed through the production process. It was found that the main impurities in aluminium are iron (0.15%) and zinc (0.O6%). It has been concluded that the purity of produced aluminium depends mainly on the purity of used alumina. The second important source of contamination of aluminium is anode. The results obtained by radioactivation analysis for V, Mn, Cr and Fe fall within the ranges of concentrations of these elements determined by use of other methods (volumetry, spectrophotometry, atomic absorption). Higher values for zinc were obtained by radioactivation analysis, probably due to unsatisfactory irradiation and measuring conditions for this element. The possibilities of application of radioactivation analysis to these kinds of samples are also disscused
International Nuclear Information System (INIS)
Thayer, D.W.; Boyd, G.; Kim, A.; Fox, J.B. Jr.; Farrell, H.M. Jr.
1998-01-01
The radiation resistance and ability of Listeria monocytogenes ATCC 7644, 15313, 43256, and 49594 to multiply on irradiated, air-packed, refrigerated raw or cooked turkey breast meat nuggets (ca. 25 g) and ground turkey breast meat was investigated. Gamma-radiation D values for L. monocytogenes were significantly different on raw and cooked nuggets, 0.56 +/- 0.03 kGy and 0.69 +/- 0.03 kGy, respectively; but they were not significantly different (P less than or equal to 0.05) on raw and cooked ground turkey meat. High populations (approximately 10(9) CFU/g) of L. monocytogenes declined during 14 days of storage at 4 degrees C in both irradiated and nonirradiated samples of raw but not of cooked ground turkey breast meat. A moderate inoculum (approximately 10(3) CFU/g) did not survive a radiation dose of 3 kGy. The population increased in cooked but not in raw samples of irradiated ground turkey meat stored at either 2 or 7 degrees C for 21 days. The D value changed significantly from 0.70 +/- 0.04 to 0.60 +/- 0.02 kGy when the product was cooked to an internal temperature of 80 degrees C before irradiation. Growth on either raw or cooked turkey meat did not alter the radiation resistance of L. monocytogenes. Analyses were performed for pH, a(w), moisture, and reducing potential of raw and cooked turkey meat and for pH, amino acid profile, thiamine, and riboflavin contents of aqueous extracts of raw and cooked turkey meats without identifying the factor or factors involved in differences in the survival and multiplication of L. monocytogenes on raw and cooked meat
Qin, Kunming; Wang, Bin; Li, Weidong; Cai, Hao; Chen, Danni; Liu, Xiao; Yin, Fangzhou; Cai, Baochang
2015-05-01
In traditional Chinese medicine, raw and processed herbs are used to treat different diseases. Suitable quality assessment methods are crucial for the discrimination between raw and processed herbs. The dried fruit of Arctium lappa L. and their processed products are widely used in traditional Chinese medicine, yet their therapeutic effects are different. In this study, a novel strategy using high-performance liquid chromatography and diode array detection coupled with multivariate statistical analysis to rapidly explore raw and processed Arctium lappa L. was proposed and validated. Four main components in a total of 30 batches of raw and processed Fructus Arctii samples were analyzed, and ten characteristic peaks were identified in the fingerprint common pattern. Furthermore, similarity evaluation, principal component analysis, and hierachical cluster analysis were applied to demonstrate the distinction. The results suggested that the relative amounts of the chemical components of raw and processed Fructus Arctii samples are different. This new method has been successfully applied to detect the raw and processed Fructus Arctii in marketed herbal medicinal products. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Parasitic Contamination of Raw Vegetables in Zanjan Markets, Iran
Directory of Open Access Journals (Sweden)
Negin Torabi
2016-09-01
Full Text Available Background: Complex surface of vegetables facilitate attachment and transmission of several pathogens. No previous study has been conducted in survey of parasitic contamination of vegetables in Zanjan. This study aimed to detect the parasitic contamination in common raw vegetables in Zanjan markets. Methods: A total of 352 raw vegetable samples, including leek, parsley, basil, mint, radish, cress and dill were collected from grocery stores using cluster sampling in different regions of the city during 2014. The edible parts of vegetables were separated and immersed in normal saline solution. Floating vegetables were removed and the solution was allowed to sediment at room temperature for 24 hours. The pellet was examined following sedimentation and floatation methods. Results:Various Organisms were detected in 54% (190 of the 352 samples, but only 2.8% of samples had pathogenic parasites including; Trichostrongylus eggs (3, Hookworm eggs (2, Eimeria oocysts (2, Sarcocystis oocyst (1, Strongyloides larvae (1, and Fasciola eggs (1. The contamination rate of vegetables was highest (90.4% in the fall (p˂0.05. Conclusion: Vegetable contamination with parasitic organisms in this area was low, maybe due to irrigation of vegetables with sources other than sewage water, but it is still necessary to improve sanitary conditions of vegetables.
Applications of PTR-MS in food flavour research: recent progress and prospects
International Nuclear Information System (INIS)
Yeretzian, C.; Pollien, P.; Jordan, A.; Graus, M.; Lindinger, W.
2002-01-01
Food products all along the food chain from raw material to final products continuously emit volatile organic compounds (VOs), which are related to important properties of the product itself such as flavor, age, or safety among others. Several analytical techniques for sampling and analysing the head space (HS) of food has been developed, however the proton-transfer-reaction mass spectrometry (PTR-MS) has the particularity to be able to work on real time-basis. By applying PTR-MS two qualitatively distinct types of information were obtained: HS profiles can be averaged over a given time window to yield concentration vs. mass spectra (static data). Such spectra can be used to asses authenticity, monitor deviation in production from a reference or classify product. Alternatively, temporal changes can be analysed via time-intensity plots (dynamic data). As example soluble coffee data is given. (nevyjel)
Analysis of Cl, Mn, Na, Zn in Food Samples by a Neutron Activation Analysis
Energy Technology Data Exchange (ETDEWEB)
Moon, Jong Hwa; Kim, Sun Ha; Chung, Yong Sam [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Lee, Ok Hee [YongIn University, Yongin (Korea, Republic of)
2008-10-15
Due to their westernized dietary habit, Korean children are still threatened by the increasing risks of chronic disease such as obesity, hypertension, low immunity, etc. In addition, they are often exposed to a deficiency of Ca, Mg, Fe and micro-minerals which are necessary for their growth, immunity, and prevention of anemia. Nonetheless, the nutritional adequacy of mineral intakes for children is difficult to assess because of a lack of related studies and a nutritional database with respect to Korean children's foods. In this study, ninety kinds of foods consisting of lunch meals from an elementary and a middle school and children's favorite snacks were collected and prepared for an analysis. INAA which has an advantage of a non-destructive technique was employed to determine the elements like Cl, Mn, Na, Cl in the pretreated food samples. Quality control was carried out by using certified reference materials. From the analytical results, elemental concentration range in the collected samples according to the food groups was summarized.
Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein
2012-12-01
Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.
Directory of Open Access Journals (Sweden)
Dajana Gašo-Sokač
2010-01-01
Full Text Available Human food is a very complex biological mixture and food processing and safety are very important and essential disciplines. Proteomics technology using different high-performance separation techniques such as two-dimensional gel electrophoresis, one-dimensional and multidimensional chromatography, combined with high-resolution mass spectrometry has the power to monitor the protein composition of foods and their changes during the production process. The use of proteomics in food technology is presented, especially for characterization and standardization of raw materials, process development, detection of batch-to-batch variations and quality control of the final product. Further attention is paid to the aspects of food safety, especially regarding biological and microbial safety and the use of genetically modified foods.
Directory of Open Access Journals (Sweden)
Dmitry Alexandrovich Izotov
2013-12-01
Full Text Available Deficit of raw materials is becoming an important concern for the Chinese economy as it continues to grow. This deficit is amended with imports, which – in their own turn – are limited by the high level of global prices. The build-up issue of raw materials imports is going to solve by the measures of monetary policy (RMB’s revaluation against the USD. Analysis of China’s market of raw materials reveals that the largest increase in the physical volume of imports is concentrated in crude oil, LNG, iron ore and coal. As for Russia, its supplies and share in total Chinese imports of raw materials tend to increase. Author employs regression equations based on international statistics data to show that RMB’s revaluation, ceteris paribus, increases physical volumes of raw materials imports. However, the main factor of coal and LNG imports growth is energy consumption by Chinese heavy industry; imports of oil products – producers’ prices; meanwhile imports of steel products tend to decrease with the growth of steel exports. RMB’s revaluation increases physical volumes of imports of low value added raw materials from Russia (coal, crude oil, iron ore
Józwa, Wojciech; Czaczyk, Katarzyna
2012-04-02
Flow cytometry constitutes an alternative for traditional methods of microorganisms identification and analysis, including methods requiring cultivation step. It enables the detection of pathogens and other microorganisms contaminants without the need to culture microbial cells meaning that the sample (water, waste or food e.g. milk, wine, beer) may be analysed directly. This leads to a significant reduction of time required for analysis allowing monitoring of production processes and immediate reaction in case of contamination or any disruption occurs. Apart from the analysis of raw materials or products on different stages of manufacturing process, the flow cytometry seems to constitute an ideal tool for the assessment of microbial contamination on the surface of technological lines. In the present work samples comprising smears from 3 different surfaces of technological lines from fruit and vegetable processing company from Greater Poland were analysed directly with flow cytometer. The measured parameters were forward and side scatter of laser light signals allowing the estimation of microbial cell contents in each sample. Flow cytometric analysis of the surface of food industry production lines enable the preliminary evaluation of microbial contamination within few minutes from the moment of sample arrival without the need of sample pretreatment. The presented method of fl ow cytometric initial evaluation of microbial state of food industry technological lines demonstrated its potential for developing a robust, routine method for the rapid and labor-saving detection of microbial contamination in food industry.
International Nuclear Information System (INIS)
Ojo, T.J.; Ojo, O.C.
2007-01-01
Measurement of the average radioactivity concentration in brackish and fresh water food samples in Lagos and Ondo States of Nigeria was carried out using a very sensitive gamma spectroscopic system consisting of a 76 mm x 76 mm Nal (TI) scintillation detector coupled to a computerized ACCUSPEC installation. All the radionuclide detected are traceable to the naturally occurring 4 ''0K and ''2''3''2Th. The average concentrations of ''2''3''8U and ''2''3''2Th were found to be higher in brackish water food samples, 50.92±7.04 Bq/kg and 24.60± 6.47 Bq/kg respectively. The average concentration of ''4''0K was found to be higher in food samples got from freshwater, 738.94±84.81Bq/kg
Cardiotoxic Effects of Raw Opium.
Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj
2018-01-01
While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.
Cardiotoxic Effects of Raw Opium
Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj
2018-01-01
While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.
A General Model for Food Purchasing in Captive Food Service Institutions.
1979-08-28
pounds Turnip greens Canned Asparagus 904 38 cases* Chicken Canadian Bacon 1670 1670 pounds Turkey breast Veal 3580 358 pounds Hamburger Rump roast 9648...65 11. RAW TURNIP PRICES .. .. ....... ............. 66 12. PROCESSED CHICKEN PRICES...planning, edited by Birchflield (10), emphasizes the Importance of standard recipes in determining quantities of food required for menu items. Standard
Food irradiation newsletter. V. 17, no. 2
International Nuclear Information System (INIS)
1993-07-01
This issue of the Food Irradiation Newsletter includes reports of a number of activities of the Food Preservation Section of the FAO/IAEA from the final quarter of 1992 to the middle of 1993. In addition there is a summary of food irradiation activities in the USA, an excerpt from the Official Gazette of the French Republic concerning the use of ionizing radiation to treat camembert made from raw milk, and a discussion of the potential for the application of food irradiation in Russia
Carotene location in processed food samples measured by cryo In-SEM Raman.
Lopez-Sanchez, Patricia; Schumm, Stephan; Pudney, Paul D A; Hazekamp, Johan
2011-09-21
Cryo In-SEM Raman has been used for the first time to localise carotene compounds in a food matrix. Raman spectra of lycopene and β-carotene have been obtained from sampling oil droplets and plant cell structures visualised with cryo-SEM in tomato and carrot based emulsions containing 5% oil. It was possible to identify the carotenoids in both the oil droplets and the cell walls. Furthermore our results gave some indication that the carotenoids were in the non-crystalline state. It has been suggested that a higher amount of carotenes solubilised into the oil phase of the food matrix would lead to a higher bioaccessibility, thus understanding the effect of processing conditions on micronutrients distribution in a food matrix might help the design of plant based food products with a better nutritional quality. This shows improved structural characterisation of the cryo-SEM with the molecular sensitivity of Raman spectroscopy as a promising approach for complex biological problems.
Bostic, Joshua N; Palafox, Sherilyn J; Rottmueller, Marina E; Jahren, A Hope
2015-05-30
Isotope ratio mass spectrometry (IRMS) is used extensively to reconstruct general attributes of prehistoric and modern diets in both humans and animals. In order to apply these methods to the accurate determination of specific intakes of foods/nutrients of interest, the isotopic signature of individually consumed foods must be constrained. For example, 86% of the calories consumed in the USA are derived from processed and prepared foods, but the relationship between the stable isotope composition of raw ingredients and the resulting products has not been characterized. To examine the effect of common cooking techniques on the stable isotope composition of grain-based food items, we prepared yeast buns and sugar cookies from standardized recipes and measured bulk δ(13) C and δ(15) N values of samples collected throughout a 75 min fermentation process (buns) and before and after baking at 190°C (buns and cookies). Simple isotope mixing models were used to determine if the isotopic signatures of 13 multi-ingredient foods could be estimated from the isotopic signatures of their constituent raw ingredients. No variations in δ(13) C or δ(15) N values were detected between pre- and post-baked yeast buns (pre: -24.78‰/2.61‰, post: -24.75‰/2.74‰), beet-sugar cookies (pre: -24.48‰/3.84‰, post: -24.47‰/3.57‰), and cane-sugar cookies (pre: -19.07‰/2.97‰, post: -19.02‰/3.21‰), or throughout a 75 min fermentation process in yeast buns. Using isotopic mass balance equations, the δ(13) C/δ(15) N values of multi-ingredient foods were estimated from the isotopic composition of constituent raw ingredients to within 0.14 ± 0.13‰/0.24 ± 0.17‰ for gravimetrically measured recipes and 0.40 ± 0.38‰/0.58 ± 0.53‰ for volumetrically measured recipes. Two common food preparation techniques, baking and fermentation, do not substantially affect the carbon or nitrogen isotopic signature of grain-based foods. Mass-balance equations can be used to
Fruits Bioactive Compounds Characterization from a New Food Product
Directory of Open Access Journals (Sweden)
Valentina Mariana RUS
2014-12-01
Full Text Available The aim of this study was (I to create a new product, smart bar type which can be consumed as protective food by adults and children (II to characterize the bioactive compounds from the designed food. The bioactive compounds were identified from nuts, raw seeds of almonds, dry cranberries, dry plums and flax seeds. Secoisolariciresinol (683 ppm has been identified as a major compound in flax seeds. The vitamin C was quantified by HPLC in a concentration of 35.02 mg% in cranberries extract. The total phenolic content varied from 7.1 mg/g for walnut to 71.8 mg/g for cranberries. In addition, the antioxidative capability of phenolic compounds was monitored and evaluated using a colored free radical 2,2-diphenyl-1-picrylhydrazyl (DPPH. Almond showed better results than walnut in the antioxidant capacity test. The results obtained in this study collect information that enables the use of nuts, raw seeds of almonds, dry cranberries, dry plums and flax seeds as raw material for the production of smart bar which may serve as a new product for food market.
Quantification of uncertainty in gamma spectrometric analysis of food and environmental samples
International Nuclear Information System (INIS)
Yii Mei Wo; Zaharudin Ahmad; Norfaizal Mohamed
2005-01-01
Gamma Spectrometry is widely used to determine the activity of gamma-ray emitter radionuclide inside a sample. Reporting the activity of the measurement for a sample should not be a single value only but it shall be associated with a reasonable uncertainty value since disintegration of radionuclide is a random/spontaneous process. This paper will focus on how the uncertainty was estimated, quantified and calculated, when measuring the activity of Cs-134 and Cs-137 in food and Ra-226, Ra-228 and K-40 in the environmental samples. (Author)
Directory of Open Access Journals (Sweden)
Diana C. Vanegas
2018-04-01
Full Text Available In foods, high levels of biogenic amines (BA are the result of microbial metabolism that could be affected by temperatures and storage conditions. Thus, the level of BA is commonly used as an indicator of food safety and quality. This manuscript outlines the development of laser scribed graphene electrodes, with locally sourced materials, for reagent-free food safety biosensing. To fabricate the biosensors, the graphene surface was functionalized with copper microparticles and diamine oxidase, purchased from a local supermarket; and then compared to biosensors fabricated with analytical grade materials. The amperometric biosensor exhibits good electrochemical performance, with an average histamine sensitivity of 23.3 µA/mM, a lower detection limit of 11.6 µM, and a response time of 7.3 s, showing similar performance to biosensors constructed from analytical grade materials. We demonstrated the application of the biosensor by testing total BA concentration in fish paste samples subjected to fermentation with lactic acid bacteria. Biogenic amines concentrations prior to lactic acid fermentation were below the detection limit of the biosensor, while concentration after fermentation was 19.24 ± 8.21 mg histamine/kg, confirming that the sensor was selective in a complex food matrix. The low-cost, rapid, and accurate device is a promising tool for biogenic amine estimation in food samples, particularly in situations where standard laboratory techniques are unavailable, or are cost prohibitive. This biosensor can be used for screening food samples, potentially limiting food waste, while reducing chances of foodborne outbreaks.
Knowledge and Attitudes towards Handling Eggs in the Home: An Unexplored Food Safety Issue?
Directory of Open Access Journals (Sweden)
Harriet Whiley
2017-01-01
Full Text Available Foodborne illness is a global public health issue, with food handling in the home identified as an underestimated source. In Australia, there has been a significant increase in the incidence of salmonellosis with the majority of outbreaks linked to eggs. This study investigated Australian eggs consumer attitudes, behaviours and risk perceptions associated with the handling of raw eggs in the home. It was identified that 67% of participants chose free range eggs, 11% kept poultry, 7% did not have any preference, 7% cage eggs, 4% barn eggs, 2% organic eggs and 1% pasteurized eggs. The majority of participants (91% reported they stored eggs in the fridge. It was identified that there is an underestimation of “risky behaviour” associated with the consumption of raw eggs in the home, as 84% of participants indicated that they did not consume raw eggs, but subsequently 86% indicated that they had eaten mixture/batter containing raw eggs. Participants’ responses relating to food safety were also examined in relation to their profession and gender. Safer food handling practices were identified by Environmental Health Officers (EHO and Food handlers compared to all other professions (p < 0.05. However, the gender of participants did not significantly affect (p > 0.05 their responses.
International Nuclear Information System (INIS)
Arnold, O.
1975-01-01
In this paper some aspects are being considered, in as far as they can contribute to a better understanding of uranium as a raw material and an energy carrier, and as they can indicate the possible ways and means open to the German Federal Republic for securing this highly desirable raw material, without becoming even more dependent on the economic and political views of the producing countries, than it is the case in respect of oil. (orig.) [de
The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High quality samples of raw buffalo milk were obtained from five dairy farms in the Guangxi province of China. A sample of each milk was pasteurized, and both r...
International Nuclear Information System (INIS)
Gomes, Bruna G.; Maihara, Vera A.; Avegliano, Roseane P.
2013-01-01
The eggs are among the twenty foods consumed by the population of the five major regions of Brazil. Among the types of eggs, there are differences in nutritional value, which can vary according to the food of the bird. This study evaluating the elements Cl, K, Mg, Mn and Na considered essential micronutrients in food, because they are fundamental in several metabolic processes necessary for the maintenance and training of the human body. We analyzed three types of eggs: egg whites, of the quail, and the colonial in cooked and raw form, using the Instrumental Neutron Activation Analysis method (INAA). The egg samples were lyophilized and pulverized before analysis. To validate the methodology, reference materials NIST RM 8415 Whole Egg Powder and NIST SRM 1567 Wheat Flour were analyzed. The samples, reference materials and standards of the elements were irradiated for 20 seconds under a thermal neutron flux of 6,6x10 12 cm -2 s -1 in the nuclear research reactor IEA-R1 of IPEN-CNEN / SP. The results were consistent with the values of the Brazilian Table of Food Composition (TACO)
Impact of rearing conditions on the microbiological quality of raw retail poultry meat.
Hardy, Bridgshe; Crilly, Nate; Pendleton, Sean; Andino, Ana; Wallis, Audra; Zhang, Nan; Hanning, Irene
2013-08-01
There is a gap in knowledge of microbiological quality in raw chicken products produced by nonconventional methods and no studies have reported the microbiological quality of turkeys produced under different rearing environments. Thus, the aim of this study was to compare the microbiological quality of conventionally and organically reared whole chicken and turkey carcasses purchased from 3 retail outlets in Knoxville, Tenn., U.S.A. A total of 100 raw broiler chickens organically (n = 50) and 50 raw turkey carcasses consisting of 3 brands reared either conventionally (n = 25) or organically (n = 25) were evaluated. The FDA BAM protocol for rinsing poultry carcasses was used to enumerate of aerobic bacteria, Campylobacter, and Staphylococcus spp., and for qualitative analysis of Salmonella. Organic chickens from one brand had the highest average counts of aerobic bacteria, Staphylococcus spp. and Campylobacter (4.8, 4.8, and 4.7 Log10 CFU/mL rinsate, respectively) while the other organic brand had the lowest average counts (3.4, 3.3, and 3.1, respectively) of all 4 brands evaluated. The organic turkeys had the highest average counts of these same bacteria (4, 3.9, and 3.8, respectively) compared to the 2 brands of conventional turkeys evaluated. Salmonella (5% prevalence) was isolated only from organic chickens and turkeys. From these data, it appears that the microbiological quality of the raw product was not dependent on rearing conditions and, thus, it cannot be assumed that organic raw poultry is safer than conventionally raised poultry in terms of microbiological quality. © 2013 Institute of Food Technologists®
Diversity and killer activity of yeasts in Malaysian fermented food samples.
Lim, S L; Tay, S T
2011-08-01
The biodiversity and the killer activity of yeasts isolated from various types of fermented food in Malaysia were investigated in this study. Of 252 yeasts isolated from 48 fermented food samples in this study, 19 yeast species were identified based on sequence analysis of the ITS1-5.8S-ITS2 partial fragments of the yeasts. A total of 29 (11.5%) of the yeast isolates demonstrated killer activity to at least one Candida species tested in this study; including 22 isolates of Trichosporon asahii, 4 isolates of Pichia anomala, and one isolate each of Pichia norvegensis, Pichia fermentans and Issatchenkia orientalis, respectively. The presence of killer yeasts reflects antagonism that occurs during microbial interaction in the fermented food, whereby certain yeasts produce killer toxins and possibly other toxic substances in competition for limited nutrients and space. The anti-Candida activity demonstrated by killer yeasts in this study should be further explored for development of alternative therapy against candidiasis.
Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O
2016-09-24
The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.
Kim, In Seon; Hur, Yoo Kyung; Kim, Eun Ji; Ahn, Young-Tae; Kim, Jong Geun; Choi, Yun-Jaie; Huh, Chul Sung
2017-11-01
The control of psychrotrophic bacteria causing milk spoilage and illness due to toxic compounds is an important issue in the dairy industry. In South Korea, Gangwon-do province is one of the coldest terrains in which eighty percent of the area is mountainous regions, and mainly plays an important role in the agriculture and dairy industries. The purposes of this study were to analyze the indigenous microbiota of raw milk in Gangwon-do and accurately investigate a putative microbial group causing deterioration in milk quality. We collected raw milk from the bulk tank of 18 dairy farms in the Hoengseong and Pyeongchang regions of Gangwon-do. Milk components were analyzed and the number of viable bacteria was confirmed. The V3 and V4 regions of 16S rRNA gene were amplified and sequenced on an Illumina Miseq platform. Sequences were then assigned to operational taxonomic units, followed by the selection of representative sequences using the QIIME software package. The milk samples from Pyeongchang were higher in fat, protein, lactose, total solid, and solid non-fat, and bacterial cell counts were observed only for the Hoengseong samples. The phylum Proteobacteria was detected most frequently in both the Hoengseong and Pyeongchang samples, followed by the phyla Firmicutes and Actinobacteria. Notably, Corynebacterium, Pediococcus, Macrococcus, and Acinetobacter were significantly different from two regions. Although the predominant phylum in raw milk is same, the abundances of major genera in milk samples were different between Hoengseong and Pyeongchang. We assumed that these differences are caused by regional dissimilar farming environments such as soil, forage, and dairy farming equipment so that the quality of milk raw milk from Pyeongchang is higher than that of Hoengseong. These results could provide the crucial information for identifying the microbiota in raw milk of South Korea.
Directory of Open Access Journals (Sweden)
Uzelac Ema D.
2013-01-01
Full Text Available The results of tests on the presence of yeasts and molds in cornstarch [AD ‘IPOK’ Zrenjanin, 2007-2008, made at the time when previous Regulations were valid] were analyzed in terms of bioindicative values of microfungi as indicators of quality and safety of raw material or final food products. Microbiological analysis was used to detect the presence of a number of microorganisms MMI-0001, and a questionnaire was designed at the Department of Public Health in Zrenjanin town (Republic of Serbia, where the analyses were done, regarding the microbiological tests on starch. In order to rationalize the analyses and make them more economical, several areas of product quality control (water, food, raw materials, space were recommended either to be excluded or regarded as optional. Thus, analysis of presence of microfungi as indicators of product quality was categorized as optional. The results obtained from this research suggest a different conclusion because the bacteria in the samples indicated ˮmicrobiologically“, namely bacteriologically, safe samples of food, while, on the contrary, the presence of some microfungi as distinct xerophilous or xerotolerant microorganisms, indicated that the food was mycologically non-safe. The obtained data are crucial for questioning the decision to exclude the earlier required (mycological analysis of the samples (in the production of starch, or end products, etc. and categorize such analyses in new Regulations as optional, depending on the manufacturer’s preference. Bioindicative values of microfungi as indicators of the quality of starch, clearly point to the shortsightedness of the new Regulations on food hygiene and safety, where tests on certain microorganisms (in this case, yeasts and molds are not legally defined as mandatory, but the Law leaves manufacturers a possibility to choose (or not to choose the testing and frequency of testing on the presence (absence of microorganisms, which can be
Microbial Safety of Low Water Activity Foods: Study of Simulated and Durban Household Samples
Directory of Open Access Journals (Sweden)
O. A. Ijabadeniyi
2017-01-01
Full Text Available Sixty household low water activity foods were examined and a simulative study was conducted in a high sugar, low aw almond and macadamia butter to determine the survival of Bacillus cereus and Staphylococcus aureus ATCC 25923. Results obtained from 60 low aw samples collected at household level had some significant differences (P≤0,05 within food categories amongst the various tests. Spices had the highest number of aerobic bacteria, aerobic spore-formers, anaerobic spore-formers, and S. aureus. Mean aerobic colony counts for nuts and spices were 2.30 log CFU/g and 4.40 log CFU/g, respectively. Pathogens such as Escherichia coli and Cronobacter sakazakii were present in nuts, whilst Salmonella spp. was present in chocolates. This implies that certain low aw foods may present a public health risk. In the simulative study, temperature and high sucrose concentrations played a significant role in the survival of B. cereus and S. aureus ATCC 25923. B. cereus was found to be more osmotolerant at both reduced and elevated temperatures (18°C and 25°C in the 12% sucrose sample in both butters, whilst S. aureus ATCC 25923 seemed to grow better in sucrose-free samples at both temperatures in both butters. This implies that certain low aw foods may present a public health risk. Also, B. cereus, being a spore-forming bacterium, can be osmotolerant at both reduced and elevated temperatures.
Use of alternative raw materials for yoghurt production | Farinde ...
African Journals Online (AJOL)
Soymilk and maize steep water were used as alternative raw materials to cow milk and commercial starter, respectively, for production of yoghurt. The cow milk used was both Fresh milk and dried powdered milk (DANO). The cost of production of the yoghurt samples as well as their chemical, microbial and organoleptic ...
Energy Technology Data Exchange (ETDEWEB)
Park, Ji Young; Lim, Chung Sup [Radiation Biotechnology and Applied Radioiostope Science, University of Science and Technology, Daejeon (Korea, Republic of); Lim, Jong Myoung; Ji, Young Yong; Chung, Kun Ho; Lee, Wan No; Kang, Mun Ja [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Jang, Byung Uck [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)
2016-12-15
As new legislation has come into force implementing radiation safety management for the use of naturally occurring radioactive materials (NORM), it is necessary to establish a rapid and accurate measurement technique. Measurement of {sup 238}U and {sup 232}Th using conventional methods encounter the most significant difficulties for pretreatment (e.g., purification, speciation, and dilution/enrichment) or require time-consuming processes. Therefore, in this study, the applicability of ED-XRF as a non-destructive and rapid screening method was validated for raw materials and by-product samples. A series of experiments was conducted to test the applicability for rapid screening of XRF measurement to determine activity of {sup 238}U and {sup 23{sup 2}}Th based on certified reference materials (e.g., soil, rock, phosphorus rock, bauxite, zircon, and coal ash) and NORM samples commercially used in Korea. Statistical methods were used to compare the analytical results of ED-XRF to those of certified values of certified reference materials (CRM) and inductively coupled plasma mass spectrometry (ICP-MS). Results of the XRF measurement for {sup 238}U and {sup 232}Th showed under 20% relative error and standard deviation. The results of the U-test were statistically significant except for the case of U in coal fly ash samples. In addition, analytical results of {sup 238}U and {sup 232}Th in the raw material and by-product samples using XRF and the analytical results of those using ICP-MS (R{sup 2}≥0.95) were consistent with each other. Thus, the analytical results rapidly derived using ED-XRF were fairly reliable. Based on the validation results, it can be concluded that the ED-XRF analysis may be applied to rapid screening of radioactivities ({sup 238}U and {sup 232}Th) in NORM samples.
Liu, Zhibin; Wang, Wei; Huang, Guangwei; Zhang, Wen; Ni, Li
2016-03-30
Almonds contain considerable amounts of potential prebiotic components, and the roasting process may alter these components. The aim of this study was to compare the in vitro fermentation properties and in vivo prebiotic effect of raw and roasted almonds. In vitro, predigested raw and roasted almonds promoted the growth of Lactobacillus acidophilus (La-14) and Bifidobacterium breve (JCM 1192), and no significant differences were found between these two nuts. In a 4-week animal trial, daily intake of raw or roasted almonds promoted the population of Bifidobacterium spp. and Lactobacillus spp. and inhibited the growth of Enterococcus spp. in faeces and caecal contains of rats. Compared with roasted almonds, raw almonds had a greater bifidobacteria promotion effect. Besides, significantly higher β-galactosidase activity and lower β-glucuronidase and azoreductase activities in faeces or caecal contents of rats were observed with raw almonds than with roasted almonds. While, in terms of metabolic effects, the ingestion of roasted almonds resulted in significantly greater intestinal lipase activities. Both raw and roasted almonds exhibit potential prebiotic effects, including regulation of intestinal bacteria and improved metabolic activities. The roasting process may slightly reduce the prebiotic effects of almonds but significantly improve the metabolic effects © 2016 The Authors. Journal of the Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.
Tryland, Ingun; Eregno, Fasil Ejigu; Braathen, Henrik; Khalaf, Goran; Sjølander, Ingrid; Fossum, Marie
2015-02-04
The fully automated Colifast ALARM™ has been used for two years for daily monitoring of the presence/absence of Escherichia coli in 100 mL raw water at Oset drinking water treatment plant in Oslo, Norway. The raw water is extracted from 35 m depth from the Lake Maridalsvannet. E. coli was detected in 18% of the daily samples. In general, most samples positive for E. coli were observed during the autumn turnover periods, but even in some samples taken during warm and dry days in July, with stable temperature stratification in the lake, E. coli was detected. The daily samples gave useful additional information compared with the weekly routine samples about the hygienic raw water quality and the hygienic barrier efficiency of the lake under different weather conditions and seasons. The winter 2013/2014 was much warmer than the winter 2012/2013. The monitoring supported the hypothesis that warmer winters with shorter periods with ice cover on lakes, which may be a consequence of climate changes, may reduce the hygienic barrier efficiency in deep lakes used as drinking water sources.
Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin
2011-06-01
The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.
Directory of Open Access Journals (Sweden)
Valeriy Valentinovich Patsiorkovskiy
2011-12-01
Full Text Available This paper is devoted to the questions of further development of agricultural and food policy in the Russian Federation. The subject of in-depth consideration is the problem related to ensuring food safety. A critical review and analysis of major regulations in the field of food safety is made, including in the implementation of sanitary and epidemiological surveillance. The necessity of the expansion of measures to improve the statistics of food poisoning is grounded. The basic reasons for the spread of management practices of production and sale of food products that pose a threat to human life are revealed. The factors of unhindered penetration of local markets in the cities and the surrounding countrysides with counterfeiting, smuggling and production of global junk food manufacturers and consumer goods are defined. A systematic view is put on the problems of food production in the private farms, ways to limit direct access to the market of food and food raw materials, which production was not controlled and who have not passed state registration, are suggested. One of these problems is creation of independent industrial structures that link production and sales of small-scale sector goods.
[Understanding and development strategy of health food containing Chinese materia medica].
Wang, Lin-Yuan; Zhang, Jian-Jun; Wang, Chun; Wang, Jing-Xia; Zhu, Ying-Li; Wang, Jia; Gao, Xue-Min
2016-11-01
Health food containing Chinese materia medica (CMM) conforms to the development demands of the age of big health and the theory of preventive treatment. In the view of health care and improvement of resisting diseases, it plays an important role in the market. It is very necessary to have further study and discussion on health food containing CMM. First of all, by comparing, analyzing and summarizing, the health food containing CMM could be defined as the health food which is qualified in security and functionality evaluation, with the traditional Chinese medicines(TCM) within TCM standards as the main raw materials, and the formulation-composition is based on the theory of TCM. It is characterized by higher safety than medicines, stronger biological activities than common food, multiple forms, abundant raw materials and integrated supervision and management. Secondly, we discussed the research and development (R&D) strategies and rules of health food containing CMM, pointing out that the core tasks of R&D include the investigation of formula, technology and the standards of quality. The fundamental principles of declaration and production include scientificity, rationality, reality and uniformity. Three key requirements (security, functionality and controllability) in the review as well as the process management of R&D and the key-points of risks control were summarized in this paper. Finally, the dynamic trends of policies and regulations related to health food containing CMM were analyzed in the view of registration, recording, raw materials and functions, and then related suggestions were proposed. Therefore, this article will be helpful in overall understanding the health food containing CMM and play a guiding role for its research and development. Copyright© by the Chinese Pharmaceutical Association.
Simultaneous identification of synthetic and natural dyes in different food samples by UPLC-MS
Mandal, Badal Kumar; Mathiyalagan, Siva; Dalavai, Ramesh; Ling, Yong-Chien
2017-11-01
Fast foods and variety food items are populating among the food lovers. To improve the appearance of the food product in surviving gigantic competitive environment synthetic or natural food dyes are added to food items and beverages. Although regulatory bodies permit addition of natural colorants due to its safe and nontoxic nature in food, synthetic dyes are stringently controlled in all food products due to their toxicity by regulatory bodies. Artificial colors are need certification from the regulatory bodies for human consumption. To analyze food dyes in different food samples many analytical techniques are available like high pressure liquid chromatography (HPLC), thin layer chromatography (TLC), spectroscopic and gas chromatographic methods. However all these reported methods analyzed only synthetic dyes or natural dyes. Not a single method has analyzed both synthetic and natural dyes in a single run. In this study a robust ultra-performance liquid chromatographic method for simultaneous identification of 6 synthetic dyes (Tartrazine, Indigo carmine, Briliant blue, Fast green, malachite green, sunset yellow) and one natural dye (Na-Cu-Chlorophyllin) was developed using acquitic UPLC system equipped with Mass detector and acquity UPLC HSS T3 column (1.8 μm, 2.1 × 50 mm, 100Å). All the dyes were separated and their masses were determined through fragments’ masses analyses.
Hyperbaric storage at room temperature for food preservation: A study in strawberry juice
Segovia-Bravo, Kharla A.; Guignon, Bérengère; Bermejo-Prada, Ana; Sanz Martínez, Pedro D.; Otero, Laura
2012-01-01
Hyperbaric storage at room temperature was evaluated as a new food preservation method. To do that, strawberry juices maintained at different pressure levels (0.1, 25, 100 or 220 MPa) and 20°C for 15 days were compared to raw and thermally pasteurized samples stored at atmospheric pressure and 5°C for the same period. Hyperbaric storage reduced the initial microbial load of the juices by more than 2 log units to levels below the limit of detection. Moreover, pressure was effective to attenuat...
Aflatoxin M1 contamination of raw and pasteurized milk produced in Sanandaj, Iran
Directory of Open Access Journals (Sweden)
Mafakheri, Sh.
2010-07-01
Full Text Available This study was conducted to evaluate and compare the levels of aflatoxin M1 in raw and pasteurized milk samples during different seasons by Enzyme- Linked Immuno Sorbent Assay in Sanandaj, Iran. In 257 (94.49% out of 272 milk samples the presence of aflatoxin M1 was detected in concentrations ranging between 0.007 and 115.930 ng/l. AFM1 level in 12 (4.4% of positive samples were higher than the maximum tolerance limit (50 ng/l accepted by Iran and European Union countries. Statistical evaluations showed that the differences between raw and pasteurized samples were not significant (p<0.05. There was no significant difference between spring and summer but the differences between other seasons were statistically significant. Winter samples with 22.35 ng/l and summer samples with 5.14 ng/l had the highest and lowest concentration, respectively (p<0.05. Since contamination of milk with aflatoxin is a potential risk for human health, milk and milk products should be controlled periodically for Aflatoxin contamination.
DNA extraction methods for detecting genetically modified foods: A comparative study.
Elsanhoty, Rafaat M; Ramadan, Mohamed Fawzy; Jany, Klaus Dieter
2011-06-15
The work presented in this manuscript was achieved to compare six different methods for extracting DNA from raw maize and its derived products. The methods that gave higher yield and quality of DNA were chosen to detect the genetic modification in the samples collected from the Egyptian market. The different methods used were evaluated for extracting DNA from maize kernels (without treatment), maize flour (mechanical treatment), canned maize (sweet corn), frozen maize (sweet corn), maize starch, extruded maize, popcorn, corn flacks, maize snacks, and bread made from corn flour (mechanical and thermal treatments). The quality and quantity of the DNA extracted from the standards, containing known percentages of GMO material and from the different food products were evaluated. For qualitative detection of the GMO varieties in foods, the GMOScreen 35S/NOS test kit was used, to screen the genetic modification in the samples. The positive samples for the 35S promoter and/or the NOS terminator were identified by the standard methods adopted by EU. All of the used methods extracted yielded good DNA quality. However, we noted that the purest DNA extract were obtained using the DNA extraction kit (Roche) and this generally was the best method for extracting DNA from most of the maize-derived foods. We have noted that the yield of DNA extracted from maize-derived foods was generally lower in the processed products. The results indicated that 17 samples were positive for the presence of 35S promoter, while 34% from the samples were positive for the genetically modified maize line Bt-176. Copyright © 2010 Elsevier Ltd. All rights reserved.
From raw material to dish: pasta quality step by step.
Sicignano, Angelo; Di Monaco, Rossella; Masi, Paolo; Cavella, Silvana
2015-10-01
Pasta is a traditional Italian cereal-based food that is popular worldwide because of its convenience, versatility, sensory and nutritional value. The aim of this review is to present a step-by-step guide to facilitate the understanding of the most important events that can affect pasta characteristics, directing the reader to the appropriate production steps. Owing to its unique flavor, color, composition and rheological properties, durum wheat semolina is the best raw material for pasta production. Although pasta is traditionally made from only two ingredients, sensory quality and chemical/physical characteristics of the final product may vary greatly. Starting from the same ingredients, there are a lot of different events in each step of pasta production that can result in the development of varieties of pasta with different characteristics. In particular, numerous studies have demonstrated the importance of temperature and humidity conditions of the pasta drying operation as well as the significance of the choice of raw material and operating conditions on pasta quality. © 2015 Society of Chemical Industry.
Enrichment of Acinetobacter spp. from food samples.
Carvalheira, Ana; Ferreira, Vânia; Silva, Joana; Teixeira, Paula
2016-05-01
Relatively little is known about the role of foods in the chain of transmission of acinetobacters and the occurrence of different Acinetobacter spp. in foods. Currently, there is no standard procedure to recover acinetobacters from food in order to gain insight into the food-related ecology and epidemiology of acinetobacters. This study aimed to assess whether enrichment in Dijkshoorn enrichment medium followed by plating in CHROMagar™ Acinetobacter medium is a useful method for the isolation of Acinetobacter spp. from foods. Recovery of six Acinetobacter species from food spiked with these organisms was compared for two selective enrichment media (Baumann's enrichment and Dijkshoorn's enrichment). Significantly (p enrichment. Next, the Dijkshoorn's enrichment followed by direct plating on CHROMagar™ Acinetobacter was applied to detect Acinetobacter spp. in different foods. Fourteen different presumptive acinetobacters were recovered and assumed to represent nine different strains on the basis of REP-PCR typing. Eight of these strains were identified by rpoB gene analysis as belonging to the species Acinetobacter johnsonii, Acinetobacter calcoaceticus, Acinetobacter guillouiae and Acinetobacter gandensis. It was not possible to identify the species level of one strain which may suggests that it represents a distinct species. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Liu Shunmin; Yang Dawei; Li Rongwu; Li Guoxia; Cheng Huansheng; Zheng Jongxin; Chen Lifang
2010-01-01
In order to find out sources of raw, ingredients and classification relationship for Blue-and-White porcelain from Jingdezhen and Dehua area in different time, 34 Blue-and-White porcelain samples were selected. The chemical ingredients of every sample were determined by proton induced X-ray emission. The chemical ingredients data of all samples were further analyzed using fuzzy cluster analysis. The results indicate that the sources of raw and classification relationship of majority bodies from Blue-and-White porcelain of Dehua and Jingdezhen area are commendably differentiated. The sources of raw and batch formulas of eight transparent enamel samples from Jingdezhen area in Ming Dynasty and majority transparent enamel samples from Dehua area are commendably differentiated. Except one or two samples, majority Blue-and-White glaze samples from two areas are obviously different, and it might be an important path for non-destructive discrimination among Blue-and-White porcelains from two areas. (authors)
PHYSICAL METHODS IN AGRO-FOOD CHAIN
Directory of Open Access Journals (Sweden)
ANNA ALADJADJIYAN
2009-06-01
Full Text Available Chemical additives (fertilizers and plant protection preparations are largely used for improving the production yield of food produce. Their application often causes the contamination of raw materials for food production, which can be dangerous for the health of consumers. Alternative methods are developed and implemented to improve and ensure the safety of on-farm production. The substitution of chemical fertilizers and soil additives with alternative treatment methods, such as irradiation, ultrasound and the use of electromagnetic energy are discussed. Successful application of physical methods in different stages of food-preparation is recommended.
Gundersen, Craig G; Garasky, Steven B
2012-10-01
Food insecurity is one of the leading public health challenges facing children in the United States today. Reducing food insecurity and its attendant consequences requires an understanding of the determinants of food insecurity. Although previous work has greatly advanced our understanding of these determinants, the role of one of the oft-speculated important determinants of food insecurity, household financial management skills, has not been considered. To address this research lacuna, we use a recently conducted survey, the Survey of Household Finances and Childhood Obesity, that has information on specific financial management practices, impressions of financial management skills, and households' food insecurity. The sample included 904 households with children. Within this sample, 19.3% were food insecure and, for our central financial management skill variable, the mean value was 3.55 on a 5-point scale. Probit regression models estimated the probability of a household being food insecure as conditional on financial management skills and other covariates. We found a large and significant inverse relationship between a respondent's use of specific financial management practices and food insecurity and between a respondent's confidence in his or her financial management skills and food insecurity. That is, households with greater financial management abilities are less likely to be food insecure. This finding also holds when the sample is restricted to households with incomes <200% of the poverty line. These results suggest that improving households' financial management skills has the potential to reduce food insecurity in the United States.
DEFF Research Database (Denmark)
Walford, Antonia
2017-01-01
. Although science and technology studies (STS) makes a strong case for associating relationality with certainty, the article argues that a particular form of data, ‘raw data’, complicates this association. It further argues that scientific data is not simply composed out of relations, but is a relation......This article takes scientific ‘raw data’ as its ethnographic object in order to investigate the co-implication of nature and culture in scientific knowledge practices. The article traces out some of the activities that are involved in producing numerical climate data from the Brazilian Amazon...... itself. The article ends with a brief reflection on the possible repercussions of shifting from thinking of science as producing multiple natures and cultures to thinking of it as producing the potential for relations....
Survey of domestic food handling practices in New Zealand.
Gilbert, S E; Whyte, R; Bayne, G; Paulin, S M; Lake, R J; van der Logt, P
2007-07-15
The purpose of this survey was to obtain information on the domestic meat and poultry handling practices of New Zealanders in order to support the development of quantitative risk models, as well as providing data to underpin food safety campaigns to consumers. A sample of 1000 New Zealand residents, over 18 years of age, were randomly selected from the electoral roll and asked to participate in a national postal food safety study during 2005. Three hundred and twenty six respondents completed and returned questionnaires containing usable answers, and most of these respondents 'always' prepared the main meal within the household. The majority of meat (84.6%) and poultry (62.9%) purchased by New Zealanders was fresh (rather than frozen), and most consumers (94.4%) claimed that the time taken from food selection to reaching their home was 1 h or less. The majority (approximately 64%) of fresh meat and poultry was frozen in the home and the most favoured method of thawing was at room temperature for up to 12 h. The most common time period for storing cooked or raw meat and poultry in domestic refrigerators was up to 2 days. Most survey respondents preferred their meat and poultry to be cooked either medium or well done. The most popular cooking method for chicken was roasting or baking, while most respondents preferred to pan-fry steak/beef cuts, minced beef or sausages/hamburgers. The potential for undercooking was greatest with pan-fried steak with 19.8% of respondents preferring to consume this meat raw or rare. In answer to questions relating to food handling hygiene practices, 52.2% of respondents selected a hand washing sequence that would help prevent cross contamination. However, it was estimated that 41% and 28% of respondents would use knives and kitchen surfaces respectively in a manner that could allow cross contamination. The data in this survey are self-reported and, particularly for the hygiene questions, respondents may report an answer that they
Lazo-Vélez, Marco A; Guajardo-Flores, Daniel; Mata-Ramírez, Daniel; Gutiérrez-Uribe, Janet A; Serna-Saldivar, Sergio O
2016-01-01
Pseudocereal Chenopodium berlandieri spp. (huauzontle) was evaluated to determine saponin composition. Saponins were evaluated in raw and germinated grains subjected to chemical stress induced by sodium selenite. Analysis by liquid chromatography coupled with ELSD detector revealed the presence of 12 saponins, identified according to compounds previously assayed in Chenopodium quinoa. Saponins found at the highest concentrations in raw grains were derived from oleanolic and phytolaccagenic acids. Total saponin concentration significantly decreased in germinated compared to raw grains due to the significant loss of 90.1% and 95.7% of the phytolaccagenic acid without and with chemical selenium stress, respectively. The most abundant saponin in germinated sprouts decreased during normal germination. Interestingly, the concentration of this particular saponin significantly increased during the Se-induced stress germination. Chemical stress with selenium salts proved to change the saponin composition in geminated Chenopodium berlandieri spp. grains, therefore affecting their potential use as ingredient in the food industry. © 2015 Institute of Food Technologists®
A Comparison of Flavor Differences between Pecan Cultivars in Raw and Roasted Forms.
Magnuson, Shelby M; Kelly, Brendan; Koppel, Kadri; Reid, William
2016-05-01
The objective of this research was to explore sensory differences among 8 different pecan cultivars ("Pawnee," "Witte," "Kanza," "Major," "Lakota," "Giles," "Maramec," "Chetopa") in raw and roasted forms. The cultivars were collected from 2 growing seasons (2013 and 2014) and evaluated separately. Trained panelists evaluated each cultivar from each season in raw and roasted forms, measuring intensities of 20 flavor attributes using descriptive analysis. The intensities of 10 of the 20 flavor attributes were higher for the roasted pecans across all cultivars. These included pecan ID, overall nutty, nutty-woody, nutty-grainlike, nutty-buttery, brown, caramelized, roasted, overall sweet, and sweet. The cultivars exhibited significant differences from one another for 8 attributes: pecan ID, nutty-buttery, caramelized, acrid, woody, oily, astringent, and bitter. Each of the cultivars displayed unique flavor profiles with some demonstrating extremes of certain attributes, for example the high astringency of "Lakota" or the buttery characteristics of "Pawnee." These results may help pecan growers and pecan product manufacturers understand flavor differences between different varieties of pecans, both in raw and roasted states, and the changes that occur during this process. © 2016 Institute of Food Technologists®
Review of agriculture and agri-food sector performance in the ...
African Journals Online (AJOL)
China encouraged the development of export-oriented agriculture and food processing industry to convert raw farm products to value added finished consumer products. This has been a powerful tool for economic development in the country. Keywords: agriculture, agri food industry, China, performance. Moor Journal of ...
Viedma, Pilar Martínez; Abriouel, Hikmate; Ben Omar, Nabil; López, Rosario Lucas; Valdivia, Eva; Gálvez, Antonio
2009-05-01
The cyclic bacteriocin enterocin AS-48 was tested on a cocktail of two Geobacillus stearothermophilus strains in canned food samples (corn and peas), and in coconut milk. AS-48 (7 microg/g) reduced viable cell counts below detection levels in samples from canned corn and peas stored at 45 degrees C for 30 days. In coconut milk, bacterial inactivation by AS-48 (1.75 microg/ml) was even faster. In all canned food and drink samples inoculated with intact G. stearothermophilus endospores, bacteriocin addition (1.75 microg per g or ml of food sample) rapidly reduced viable cell counts below detection levels and avoided regrowth during storage. After a short-time bacteriocin treatment of endospores, trypsin addition markedly increased G. stearothermophilus survival, supporting the effect of residual bacteriocin on the observed loss of viability for endospores. Results from this study support the potential of enterocin AS-48 as a biopreservative against G. stearothermophilus.
Vakh, Christina; Evdokimova, Ekaterina; Pochivalov, Aleksei; Moskvin, Leonid; Bulatov, Andrey
2017-12-15
An easily performed fully automated and miniaturized flow injection chemiluminescence (CL) method for determination of phenols in smoked food samples has been proposed. This method includes the ultrasound assisted solid-liquid extraction coupled with gas-diffusion separation of phenols from smoked food sample and analytes absorption into a NaOH solution in a specially designed gas-diffusion cell. The flow system was designed to focus on automation and miniaturization with minimal sample and reagent consumption by inexpensive instrumentation. The luminol - N-bromosuccinimide system in an alkaline medium was used for the CL determination of phenols. The limit of detection of the proposed procedure was 3·10 -8 ·molL -1 (0.01mgkg -1 ) in terms of phenol. The presented method demonstrated to be a good tool for easy, rapid and cost-effective point-of-need screening phenols in smoked food samples. Copyright © 2017 Elsevier Ltd. All rights reserved.
Are great apes able to reason from multi-item samples to populations of food items?
Eckert, Johanna; Rakoczy, Hannes; Call, Josep
2017-10-01
Inductive learning from limited observations is a cognitive capacity of fundamental importance. In humans, it is underwritten by our intuitive statistics, the ability to draw systematic inferences from populations to randomly drawn samples and vice versa. According to recent research in cognitive development, human intuitive statistics develops early in infancy. Recent work in comparative psychology has produced first evidence for analogous cognitive capacities in great apes who flexibly drew inferences from populations to samples. In the present study, we investigated whether great apes (Pongo abelii, Pan troglodytes, Pan paniscus, Gorilla gorilla) also draw inductive inferences in the opposite direction, from samples to populations. In two experiments, apes saw an experimenter randomly drawing one multi-item sample from each of two populations of food items. The populations differed in their proportion of preferred to neutral items (24:6 vs. 6:24) but apes saw only the distribution of food items in the samples that reflected the distribution of the respective populations (e.g., 4:1 vs. 1:4). Based on this observation they were then allowed to choose between the two populations. Results show that apes seemed to make inferences from samples to populations and thus chose the population from which the more favorable (4:1) sample was drawn in Experiment 1. In this experiment, the more attractive sample not only contained proportionally but also absolutely more preferred food items than the less attractive sample. Experiment 2, however, revealed that when absolute and relative frequencies were disentangled, apes performed at chance level. Whether these limitations in apes' performance reflect true limits of cognitive competence or merely performance limitations due to accessory task demands is still an open question. © 2017 Wiley Periodicals, Inc.
Zeinhom, Mohamed M A; Abdel-Latef, Gihan K; Jordan, Kieran
2015-12-01
Staphylococcus aureus (S. aureus) can cause mastitis in cattle and, therefore, can be present in milk. This study was undertaken to determine the prevalence of coagulase positive S. aureus and its enterotoxin genes sea, seb, and sec in isolates recovered from raw milk, feta cheese, and human hand swabs of milk and cheese handlers in Beni-Suef province, Egypt. A total of 100 samples of raw milk and 50 samples of pasteurized-milk feta cheese were collected. In addition, 50 hand swabs from milk handlers and 25 hand swabs from cheese handlers were examined for the presence of coagulase positive S. aureus. The isolates were characterized by multiplex PCR for detection of sea, seb, and sec genes, and for resistance to 5 classes of commonly used antibiotics. Twelve (12/100), 12 (6/50), and 17% (13/75) of milk, cheese, and hand swab samples, respectively, were positive for coagulase positive S. aureus. One isolate was obtained from each positive sample (31 isolates), and none contained genes for SEA or SEC production. Twenty-five percent, 33%, and 31%, respectively, of the isolates contained the genes for SEB, resulting in 3%, 4%, and 5% of samples being positive for toxin producing coagulase positive S. aureus, respectively. At least one isolate was resistant to each of the antibiotics tested. Despite the low potential for SEB production shown, preventative measures, such as maintenance of the cold-chain and good hygienic practices should be implemented to further reduce the potential risk to public health from SEB, and to reduce the spread of antimicrobial resistance. © 2015 Institute of Food Technologists®
Xiao, Sanhua; Lv, Xuemin; Zeng, Yifan; Jin, Tao; Luo, Lan; Zhang, Binbin; Zhang, Gang; Wang, Yanhui; Feng, Lin; Zhu, Yuan; Tang, Fei
2017-10-01
Public concern was aroused by frequently reported water pollution incidents in Taihu Lake and the Yangtze River. The pollution also caught and sustained the attention of the scientific community. From 2010 to 2016, raw water and drinking water samples were continually collected at Waterworks A and B (Taihu Lake) and Waterworks C (Yangtze River). The non-volatile organic pollutants in the water samples were extracted by solid phase extraction. Ames tests and yeast estrogen screen (YES) assays were conducted to evaluate the respective mutagenic and estrogenic effects. Water samples from the Yangtze River-based Waterworks C possessed higher mutagenicity than those from Taihu Lake-based Waterworks A (P<0.001) and Waterworks B (P = 0.026). Water treatment enhanced the direct mutagenicity (P = 0.022), and weakened the estrogenicity of the raw water (P<0.001) with a median removal rate of 100%. In fact, very few of the finished samples showed estrogenic activity. Raw water samples from Waterworks A showed weaker estrogenicity than those from Waterworks B (P = 0.034) and Waterworks C (P = 0.006). In summary, mutagenic effects in drinking water and estrogenic effects in raw water merited sustained attention. The Yangtze River was more seriously polluted by mutagenic and estrogenic chemicals than Taihu Lake was. Copyright © 2017 Elsevier Ltd. All rights reserved.
Water activity changes of multicomponent food mixture during processing
Directory of Open Access Journals (Sweden)
Jiří Štencl
2004-01-01
Full Text Available Water activity of multicomponent food mixture was analysed and measured. Samples of dry fermented sausages with two different starter cultures (Pediococcus pentosaceus + Staphylococcus carnosus and Staphylococcus carnosus + Staphylococcus xylosus + Lactobacillus farciminis were tested during ripening (21 days and storing (91 days. The basic raw materials were the same for all samples: lean beef meat, lean pork and pork fat in equal parts, nitrite salt mixture (2.5 %, and sugars (1.0 %. The method used for water activity tests was indirect manometric in a static environment. Moisture content of samples was measured using halogen dryer. The course of water activity and moisture content of sausages was variable during ripening and steady during storage. Diagrams showed gradual decrease of both parameters. Mathematical models of water activity and moisture content for storage of dry fermented sausages were developed and statistically verified. The influence of starter cultures was not significant.
EB surface sterilization of food material
International Nuclear Information System (INIS)
Kaneko, H.; Mizutani, A.; Kato, K.; Nishikimi, T.; Taniguchi, S.
2001-01-01
In this paper, we introduce a food irradiation with low energetic, lower than 300keV, electrons (so-called SOFT ELECTRON) as a rather new method of food sterilization. It is also a physical sterilization method, and free from the problems mentioned above. Low energetic electrons have small penetration power (50-200micron) through raw materials, and by selecting a proper energy of electrons we can sterilize only the surfaces or skins of target materials
Random or systematic sampling to detect a localised microbial contamination within a batch of food
Jongenburger, I.; Reij, M.W.; Boer, E.P.J.; Gorris, L.G.M.; Zwietering, M.H.
2011-01-01
Pathogenic microorganisms are known to be distributed heterogeneously in food products that are solid, semi-solid or powdered, like for instance peanut butter, cereals, or powdered milk. This complicates effective detection of the pathogens by sampling. Two-class sampling plans, which are deployed
Jeong, In-Seek; Kwak, Byung-Man; Ahn, Jang-Hyuk; Leem, Donggil; Yoon, Taehyung; Yoon, Changyong; Jeong, Jayoung; Park, Jung-Min; Kim, Jin-Man
2012-10-01
In this study, nonheated saponification was employed as a novel, rapid, and easy sample preparation method for the determination of cholesterol in emulsified foods. Cholesterol content was analyzed using gas chromatography with a flame ionization detector (GC-FID). The cholesterol extraction method was optimized for maximum recovery from baby food and infant formula. Under these conditions, the optimum extraction solvent was 10 mL ethyl ether per 1 to 2 g sample, and the saponification solution was 0.2 mL KOH in methanol. The cholesterol content in the products was determined to be within the certified range of certified reference materials (CRMs), NIST SRM 1544 and SRM 1849. The results of the recovery test performed using spiked materials were in the range of 98.24% to 99.45% with an relative standard devitation (RSD) between 0.83% and 1.61%. This method could be used to reduce sample pretreatment time and is expected to provide an accurate determination of cholesterol in emulsified food matrices such as infant formula and baby food. A novel, rapid, and easy sample preparation method using nonheated saponification was developed for cholesterol detection in emulsified foods. Recovery tests of CRMs were satisfactory, and the recoveries of spiked materials were accurate and precise. This method was effective and decreased the time required for analysis by 5-fold compared to the official method. © 2012 Institute of Food Technologists®
Anukampa; Shagufta, Bi; Sivakumar, M; Kumar, Surender; Agarwal, Rajesh Kumar; Bhilegaonkar, Kiran Narayan; Kumar, Ashok; Dubal, Zunjar Baburao
2017-07-01
The present study was carried out to find out the occurrence and types of Salmonella present in street vended foods and associated environment, and their resistance pattern against various antibiotics. About 1075 street vended food and associated environment samples were processed for isolation and confirmation of different Salmonella spp. by targeting gene specific inv A gene and serotype specific Sdf I, Via B and Spy genes by PCR. Selected Salmonella isolates were screened for antibiotic resistance by using Baeur-Kirby disk diffusion test. Out of 1075 samples, only 31 (2.88%) isolates could be amplified the inv A gene of which 19 could be recovered from meat vendors; 8 from egg vendors while remaining 4 from milk vendors. Though, majority of Salmonella recovered from raw foods the ready-to-eat food like chicken gravy and rasmalai also showed its presence which pose a serious public health threat. Overall, 19, 6 and 1 isolates of S. Typhimurium, S. Enteritidis and S. Typhi could be detected by PCR while remaining 5 isolates could not be amplified suggesting other type of Salmonella. Selected Salmonella isolates were completely resistance to Oxacillin (100%) followed by Cefoxitin (30.43%) and Ampicillin (26.10%). Thus, it is observed that the street vended foods of animal origin and associated environment play an important role in transmission of food borne pathogens including Salmonella .
Preparation of food supplements from oilseed cakes.
Sunil, L; Appaiah, Prakruthi; Prasanth Kumar, P K; Gopala Krishna, A G
2015-05-01
Oilseed cakes have been in use for feed preparation. Being rich in proteins, antioxidants, fibers, vitamins and minerals, oilseed cakes have been considered ideal for food supplementation. These oilseed cakes can be processed and made more palatable and edible by suitable treatments and then incorporated as food supplements for human consumption. Rice bran pellets (RBP), stabilized rice bran (SRB), coconut cake (CC) and sesame cake (SC) were taken up for the study. These were mixed with distilled water and cooked in such a way to separate the cooked solid residue and liquid extract followed by freeze drying to get two products from each. The raw, cooked dried residue and extract were analyzed for various parameters such as moisture (0.9-27.4 %), fat (2.1-16.1 %), ash (3.3-9.0 %), minerals (2.6-633.2 mg/100 g), total dietary fiber (23.2-58.2 %), crude fiber (2.7-10.5 %), protein (3.2-34.0 %), and the fat further analyzed for fatty acid composition, oryzanol (138-258 mg/100 g) and lignan (99-113 mg/100 g) contents and also evaluated sensory evaluation. Nutritional composition of products as affected by cooking was studied. The cooked products (residue and extract) showed changes in nutrients content and composition from that of the starting cakes and raw materials, but retained more nutrients in cooked residue than in the extract. The sensory evaluation of cooked residue and extract showed overall higher acceptability by the panelists than the starting cakes and raw materials. On the basis of these findings it can be concluded that these cooked residue and extract products are highly valuable for food supplementation than the raw ones.
Coagulation effectiveness of graphene oxide for the removal of turbidity from raw surface water.
Aboubaraka, Abdelmeguid E; Aboelfetoh, Eman F; Ebeid, El-Zeiny M
2017-08-01
This study presents the performance of graphene oxide (GO) as a coagulant in turbidity removal from naturally and artificially turbid raw surface water. GO is considered an excellent alternative to alum, the more common coagulant used in water treatment processes, to reduce the environmental release of aluminum. Effects of GO dosage, pH, and temperature on its coagulation ability were studied to determine the ideal turbidity removal conditions. The turbidity removal was ≥95% for all levels of turbid raw surface water (20, 100, and 200 NTU) at optimum conditions. The role of alkalinity in inducing turbidity removal by GO coagulation was much more pronounced upon using raw surface water samples compared with that using artificially turbid deionized water samples. Moreover, GO demonstrated high-performance removal of biological contaminants such as algae, heterotrophic bacteria, and fecal coliform bacteria by 99.0%, 98.8% and 96.0%, respectively, at a dosage of 40 mg/L. Concerning the possible environmental release of GO into the treated water following filtration process, there was no residual GO in a wide range of pH values. The outcomes of the study highlight the excellent coagulation performance of GO for the removal of turbidity and biological contaminants from raw surface water. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lead, cadmium and chromium in raw and boiled portions of Norway lobster.
Perugini, Monia; Visciano, Pierina; Manera, Maurizio; Abete, Maria Cesarina; Tarasco, Renata; Amorena, Michele
2014-01-01
Lead, cadmium and chromium levels were determined in different raw and boiled portions of Norway lobster caught in the central Adriatic Sea (Italy). In raw specimens, the lowest concentrations were always detected in the white meat. Lead and cadmium content in the edible portion never exceeded the maximum levels set by European legislation. The highest cadmium and chromium values (0.47 ± 0.04 and 0.62 ± 0.13 mg/kg wet weight, respectively) were detected in the brown meat, while the highest lead concentrations were found in the exoskeleton (0.21 ± 0.01 mg/kg wet weight). Also, the boiled samples showed the lowest metal levels in the white meat, even if a significant increase (p < 0.01) was found for lead and cadmium compared to the corresponding raw portions. Among metals, chromium showed the highest concentrations in both raw and boiled portions, but up to now, the European legislation did not envisage any limits in seafood.
[Genetically modified food--great unknown].
Cichosz, G; Wiackowski, S K
2012-08-01
Genetically modified food (GMF) creates evident threat to consumers' health. In spite of assurances of biotechnologists, DNA of transgenic plants is instable, so, synthesis of foreign, allergenic proteins is possible. Due to high trypsin inhibitor content the GMF is digested much more slowly what, alike Bt toxin presence, increases probability of alimentary canal diseases. Next threats are bound to the presence of fitoestrogens and residues of Roundup pesticide, that can diminish reproductiveness; and even lead to cancerogenic transformation through disturbance of human hormonal metabolism. In spite of food producers and distributors assurances that food made of GMF raw materials is marked, de facto consumers have no choice. Moreover, along the food law products containing less than 0.9% of GMF protein are not included into genetically modified food.
Use of irradiation to control infectivity of food-borne parasites
International Nuclear Information System (INIS)
1993-01-01
Food-borne parasitic diseases are common throughout the world, pose significant health problems and cause economic losses in terms of agricultural commodities and human productivity. The diseases usually occur through consumption of raw or partially cooked foods with are infected by various parasites (e.g. tapeworms, roundworms, flukes, parasitic protozoa, etc.). The problem is significant in developing countries where the population has the habit of consuming raw food of animal origin. Available data, with the exception of data on Trichinella spiralis, a parasitic nematode, were insufficient for the use of irradiation technology to control food-borne parasites. Therefore, a Co-ordinated Research Programme (CRP) on the Use of Irradiation to Control Infectivity of Food-Borne Parasites was implemented by the FAO/IAEA in 1986. The results of the work carried out over five years (1986-1991) by twelve researchers participating in the programme, have established conclusively the potential for application of food irradiation in the control of liver flukes, tapeworms, roundworms, trichinosis, toxoplasmosis, etc. This report includes the conclusions and recommendations of the participants concerning the results obtained and need for further research. Refs, figs and tabs
Norlia, Mahror; Nor-Khaizura, M A R; Selamat, Jinap; Abu Bakar, Fatimah; Radu, Son; Chin, Cheow Keat
2018-06-18
The peanut supply chain in Malaysia is dominated by three main stakeholders (importers, manufacturers, retailers). The present study, aimed to determine the levels and critical points of aflatoxins and fungal contamination in peanuts along the supply chain. Specifically, two types of raw peanuts and six types of peanut-based products were collected (N = 178). Samples were analysed for aflatoxins by using High Performance Liquid Chromatography. Results revealed that the aflatoxins contamination was significantly higher (P≤0.05) in raw peanuts and peanut-based products from the retailers. However, there was no significant different (P≥0.05) in fungal contamination for both types of peanuts except for the total fungal count in raw peanuts from the retailers. Furthermore, raw peanut kernels from the retailers were the most contaminated ones ranged from contamination (0.3 - 3.6 log CFU/g) was relatively higher in raw peanuts compared to that of peanut-based products (0.6 - 2.7 log CFU/g). In conclusion, the manufacturers and retailers were the critical points for aflatoxins contamination in peanuts. However, fungal contamination was more critical in the raw peanuts compared to peanut-based products. The study was limited by a minimal number of samples from the importer. Therefore, further investigations on a larger sample size should be conducted to confirm the findings in this present study.
Directory of Open Access Journals (Sweden)
Naim Deniz Ayaz
2016-08-01
Full Text Available Background: Staphylococcus aureus and Shiga toxin producing Escherichia coli O157:H7 (EHEC are significant foodborne pathogens worldwide. While S. aureus can cause mild superficial skin infections or life-threatening bacteremia and endocarditis, as well as toxininduced cases such as toxic shock syndrome; E. coli O157:H7 can cause symptoms from mild diarrhea to severe hemorrhagic colitis (HC, hemolytic uremic syndrome (HUS, thrombotic thrombocytopenic purpura (TTP. Objectives: The objectives of this study were to find out the prevalence and seasonal distribution of S. aureus in 214 frozen raw meat (turkey, chicken and beef and the prevalence of E. coli O157:H7 in 70 raw beef with the characterization of the E. coli O157:H7 isolate by multiplex polymerase chain reaction (PCR. Materials and Methods: For the detection of S. aureus, a total of 214 frozen raw meat samples including 74 turkey meat, 70 chicken meat and 70 beef cuts (approximately 2 × 3 cm cubic parts; and for the detection of E. coli O157:H7, a total of 70 frozen raw beef samples that all were produced from national companies and consumed in Ağrı, Turkey were analyzed. Results: Out of 214 meat samples, 25.7 % (18/70 of the beef, 11.4 % (8/74 of the chicken meat, and 5.4 % (4/70 of the turkey meat samples were contaminated with S. aureus. Out of 70 frozen raw beef samples, only 1 (1.4% was identified as both Shiga toxin 1 and 2producing E. coli O157:H7 by the detection of stx1, stx2, eaeA, hly, and fliCh7 according to multiplex PCR analysis. Conclusion: Our findings demonstrate that occurrence frequency of S. aureus was higher in frozen raw beef than in raw chicken and turkey meat samples. Although the prevalence of E. coli O157:H7 was low in beef, the presence of virulence genes, especially toxin genesrema in a significant public health concern.
Hultman, Jenni; Rahkila, Riitta; Ali, Javeria; Rousu, Juho; Björkroth, K Johanna
2015-10-01
Refrigerated food processing facilities are specific man-made niches likely to harbor cold-tolerant bacteria. To characterize this type of microbiota and study the link between processing plant and product microbiomes, we followed and compared microbiota associated with the raw materials and processing stages of a vacuum-packaged, cooked sausage product affected by a prolonged quality fluctuation with occasional spoilage manifestations during shelf life. A total of 195 samples were subjected to culturing and amplicon sequence analyses. Abundant mesophilic psychrotrophs were detected within the microbiomes throughout the different compartments of the production plant environment. However, each of the main genera of food safety and quality interest, e.g., Leuconostoc, Brochothrix, and Yersinia, had their own characteristic patterns of contamination. Bacteria from the genus Leuconostoc, commonly causing spoilage of cold-stored, modified-atmosphere-packaged foods, were detected in high abundance (up to >98%) in the sausages studied. The same operational taxonomic units (OTUs) were, however, detected in lower abundances in raw meat and emulsion (average relative abundance of 2%±5%), as well as on the processing plant surfaces (food safety concerns related to their resilient existence on surfaces. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Ingun Tryland
2015-02-01
Full Text Available The fully automated Colifast ALARMTM has been used for two years for daily monitoring of the presence/absence of Escherichia coli in 100 mL raw water at Oset drinking water treatment plant in Oslo, Norway. The raw water is extracted from 35 m depth from the Lake Maridalsvannet. E. coli was detected in 18% of the daily samples. In general, most samples positive for E. coli were observed during the autumn turnover periods, but even in some samples taken during warm and dry days in July, with stable temperature stratification in the lake, E. coli was detected. The daily samples gave useful additional information compared with the weekly routine samples about the hygienic raw water quality and the hygienic barrier efficiency of the lake under different weather conditions and seasons. The winter 2013/2014 was much warmer than the winter 2012/2013. The monitoring supported the hypothesis that warmer winters with shorter periods with ice cover on lakes, which may be a consequence of climate changes, may reduce the hygienic barrier efficiency in deep lakes used as drinking water sources.
Food insecurity and mental health problems among a community sample of young adults.
Pryor, Laura; Lioret, Sandrine; van der Waerden, Judith; Fombonne, Éric; Falissard, Bruno; Melchior, Maria
2016-08-01
Food insecurity has been found to be related to anxiety and depression; however, the association with other psychiatric disorders, particularly among young adults, is not well known. We examined whether food insecurity is independently associated with four common mental health problems among a community sample of young adults in France. Data are from the TEMPO longitudinal cohort study. In 1991, participants' parents provided information on health and family socioeconomic characteristics. In 2011, participants' (18-35 years) reported food insecurity, mental health symptoms, and socioeconomic conditions (n = 1214). Mental health problems ascertained included major depressive episode, suicidal ideation, attention deficit and hyperactivity disorder, and substance abuse and/or dependence (nicotine, alcohol and cannabis). Cross-sectional associations between food insecurity and mental health problems were tested using modified Poisson regressions, weighted by inverse probability weights (IPW) of exposure. This makes food insecure and not food insecure participants comparable on all characteristics including socioeconomic factors and past mental health problems. 8.5 % of young adults were food insecure. In IPW-controlled analyses, food insecurity was associated with increased levels of depression (RR = 2.01, 95 % CI 1.01-4.02), suicidal ideation (RR = 3.23, 95 % CI 1.55-6.75) and substance use problems (RR = 1.68, 95 % CI 1.15-2.46). Food insecurity co-occurs with depression, suicidal ideation and substance use problems in young adulthood. Our findings suggest that reductions in food insecurity during this important life period may help prevent mental health problems. Policies aiming to alleviate food insecurity should also address individuals' psychiatric problems, to prevent a lifelong vicious circle of poor mental health and low socioeconomic attainment.
The use of atomic energy for the irradiation of foods
International Nuclear Information System (INIS)
Wills, P.A.
1982-01-01
Radiation processing is a highly versatile preservation technique for the food industry. It is a cold treatment which can inhibit sprouting, eliminate insects and food pathogens, extend shelf life, decontaminate raw materials, and pasteurise or sterilise food and packaging materials. Recent developments, such as an International Standard for Irradiated Foods and a Code of Practice for the Operation of Radiation Facilities for the Treatment of Foods, are expected to stimulate and facilitate trade in radiation processed foods. These developments and prospects for commercialisation of this new technology in Australia are discussed
1974-09-01
food service facilities. The food factors (quality, variety, and quantity, in that order) were generally rated by consumers as most serious problems, in keeping with many previous survey studies of military food service system. The contractor food service concept with raw food provided by the contractor, as exemplified by Fort Myer, significantly reduced consumer problems in food service personnel, speed, hours, environment, and convenience of location, and also reduced the degree to which food variety,
CO2 Capture by Cement Raw Meal
DEFF Research Database (Denmark)
Pathi, Sharat Kumar; Lin, Weigang; Illerup, Jytte Boll
2013-01-01
The cement industry is one of the major sources of CO2 emissions and is likely to contribute to further increases in the near future. The carbonate looping process has the potential to capture CO2 emissions from the cement industry, in which raw meal for cement production could be used...... as the sorbent. Cyclic experiments were carried out in a TGA apparatus using industrial cement raw meal and synthetic raw meal as sorbents, with limestone as the reference. The results show that the CO2 capture capacities of the cement raw meal and the synthetic raw meal are comparable to those of pure limestone...... that raw meal could be used as a sorbent for the easy integration of the carbonate looping process into the cement pyro process for reducing CO2 emissions from the cement production process....
β-Cyclodextrin coated CdSe/ZnS quantum dots for vanillin sensoring in food samples.
Durán, Gema M; Contento, Ana M; Ríos, Ángel
2015-01-01
An optical sensor for vanillin in food samples using CdSe/ZnS quantum dots (QDs) modified with β-cyclodextrin (β-CD) was developed. This vanillin-sensor is based on the selective host-guest interaction between vanillin and β-cyclodextrin. The procedure for the synthesis of β-cyclodextrin-CdSe/ZnS (β-CD-CdSe/ZnS-QDs) complex was optimized, and its fluorescent characteristics are reported. It was found that the interaction between vanillin and β-CD-CdSe/ZnS-QDs complex produced the quenching of the original fluorescence of β-CD-CdSe/ZnS-QDs according to the Stern-Volmer equation. The mechanism of the interaction is discussed. The analytical potential of this sensoring system was demonstrated by the determination of vanillin in synthetic and food samples. The method was selective for vanillin, with a limit of detection of 0.99 µg mL(-1), and a reproducibility of 4.1% in terms of relative standard deviation (1.2% under repeatability conditions). Recovery values were in the 90-105% range for food samples. Copyright © 2014 Elsevier B.V. All rights reserved.
Er, Buket; Demirhan, Burak; Onurdag, Fatma Kaynak; Ozgacar, Selda Özgen; Oktem, Aysel Bayhan
2014-03-01
Salmonella spp. are widespread foodborne pathogens that contaminate egg and poultry meats. Attachment, colonization, as well as biofilm formation capacity of Salmonella spp. on food and contact surfaces of food may cause continuous contamination. Biofilm may play a crucial role in the survival of salmonellae under unfavorable environmental conditions, such as in animal slaughterhouses and processing plants. This could serve as a reservoir compromising food safety and human health. Addition of antimicrobial preservatives extends shelf lives of food products, but even when products are supplemented with adequate amounts of preservatives, it is not always possible to inhibit the microorganisms in a biofilm community. In this study, our aims were i) to determine the minimum inhibitory concentrations (MIC) and minimum biofilm inhibitory concentrations (MBIC) of selected preservatives against planktonic and biofilm forms of Salmonella spp. isolated from chicken samples and Salmonella Typhimurium SL1344 standard strain, ii) to show the differences in the susceptibility patterns of same strains versus the planktonic and biofilm forms to the same preservative agent, and iii) to determine and compare antimicrobial and antibiofilm effects of selected food preservatives against Salmonella spp. For this purpose, Salmonella Typhimurium SL1344 standard strain and 4 Salmonella spp. strains isolated from chicken samples were used. Investigation of antimicrobial and antibiofilm effects of selected food preservatives against Salmonella spp. was done according to Clinical and Laboratory Standards Institute M100-S18 guidelines and BioTimer assay, respectively. As preservative agents, pure ciprofloxacin, sodium nitrite, potassium sorbate, sodium benzoate, methyl paraben, and propyl paraben were selected. As a result, it was determined that MBIC values are greater than the MIC values of the preservatives. This result verified the resistance seen in a biofilm community to food
Rodriguez, C; Korsak, N; Taminiau, B; Avesani, V; Van Broeck, J; Brach, P; Delmée, M; Daube, G
2015-04-01
This study investigates the contamination of foods and surfaces with Clostridium difficile in a single nursing home. C. difficile PCR-ribotype 078 was found in one food sample and in none of the tested surfaces. These results indicate that food and surfaces are an unlikely source of C. difficile infection in this setting. Copyright © 2015 Elsevier Ltd. All rights reserved.
Heavy metal and pesticide content in commonly prescribed individual raw Chinese Herbal Medicines
Energy Technology Data Exchange (ETDEWEB)
Harris, Eric S.J., E-mail: eric.sj.harris@gmail.com [Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115 (United States); Osher Research Center, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 (United States); Cao, Shugeng [Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115 (United States); Littlefield, Bruce A. [Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115 (United States); Osher Research Center, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 (United States); Craycroft, Jane A.; Scholten, Robert [Osher Research Center, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 (United States); Kaptchuk, Ted [Osher Research Center, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 (United States); Department of Medicine, Division of General Internal Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215 (United States); Fu, Yanling [International Cooperation Center, Beijing University of Chinese Medicine, 11 Bai San Huan Dong Lu, Chao Yang District, Beijing 100029 (China); Wang, Wenquan; Liu, Yong [School of Chinese Pharmacy, Beijing University of Chinese Medicine, No. 6 Wangjing Zhong Huan Nan Lu, Chaoyang District, Beijing 100102 (China); Chen, Hubiao; Zhao, Zhongzhen [School of Chinese Medicine, Hong Kong Baptist University, 7 Baptist University Road, Kowloon Tong, Hong Kong Special Administrative Region (China); Clardy, Jon [Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115 (United States); Woolf, Alan D. [Children' s Hospital Boston, 300 Longwood Avenue and Department of Pediatrics, Harvard Medical School, Boston, MA 02118 (United States); and others
2011-09-15
Heavy metal and pesticide contamination has previously been reported in Chinese Herbal Medicines (CHMs), in some cases at potentially toxic levels. This study was conducted to determine general patterns and toxicological significance of heavy metal and pesticide contamination in a broad sample of raw CHMs. Three-hundred-thirty-four samples representing 126 species of CHMs were collected throughout China and examined for arsenic, cadmium, chromium, lead, and mercury. Of the total, 294 samples representing 112 species were also tested for 162 pesticides. At least 1 metal was detected in all 334 samples (100%) and 115 samples (34%) had detectable levels of all metals. Forty-two different pesticides were detected in 108 samples (36.7%), with 1 to 9 pesticides per sample. Contaminant levels were compared to toxicological reference values in the context of different exposure scenarios. According to a likely scenario of CHM consumption, only 3 samples (1%) with heavy metals and 14 samples (5%) with pesticides were found with concentrations that could contribute to elevated background levels of contaminant exposure. According to the most conservative scenario of CHM consumption, 231 samples (69%) with heavy metals and 81 samples (28%) with pesticides had contaminants that could contribute to elevated levels of exposure. Wild collected plants had higher contaminant levels than cultivated samples. Cadmium, chromium, lead, and chlorpyrifos contamination showed weak correlations with geographic location. Based on our assumptions of the likely mode of consumption of raw CHMs, the vast majority (95%) of the 334 samples in this study contained levels of heavy metals or pesticides that would be of negligible concern. However, given the number of samples with detectable contaminants and the range between the more likely and more conservative scenarios of contaminant exposure, more research and monitoring of heavy metals (especially cadmium and chromium) and pesticide residues
Heavy metal and pesticide content in commonly prescribed individual raw Chinese Herbal Medicines
International Nuclear Information System (INIS)
Harris, Eric S.J.; Cao, Shugeng; Littlefield, Bruce A.; Craycroft, Jane A.; Scholten, Robert; Kaptchuk, Ted; Fu, Yanling; Wang, Wenquan; Liu, Yong; Chen, Hubiao; Zhao, Zhongzhen; Clardy, Jon; Woolf, Alan D.
2011-01-01
Heavy metal and pesticide contamination has previously been reported in Chinese Herbal Medicines (CHMs), in some cases at potentially toxic levels. This study was conducted to determine general patterns and toxicological significance of heavy metal and pesticide contamination in a broad sample of raw CHMs. Three-hundred-thirty-four samples representing 126 species of CHMs were collected throughout China and examined for arsenic, cadmium, chromium, lead, and mercury. Of the total, 294 samples representing 112 species were also tested for 162 pesticides. At least 1 metal was detected in all 334 samples (100%) and 115 samples (34%) had detectable levels of all metals. Forty-two different pesticides were detected in 108 samples (36.7%), with 1 to 9 pesticides per sample. Contaminant levels were compared to toxicological reference values in the context of different exposure scenarios. According to a likely scenario of CHM consumption, only 3 samples (1%) with heavy metals and 14 samples (5%) with pesticides were found with concentrations that could contribute to elevated background levels of contaminant exposure. According to the most conservative scenario of CHM consumption, 231 samples (69%) with heavy metals and 81 samples (28%) with pesticides had contaminants that could contribute to elevated levels of exposure. Wild collected plants had higher contaminant levels than cultivated samples. Cadmium, chromium, lead, and chlorpyrifos contamination showed weak correlations with geographic location. Based on our assumptions of the likely mode of consumption of raw CHMs, the vast majority (95%) of the 334 samples in this study contained levels of heavy metals or pesticides that would be of negligible concern. However, given the number of samples with detectable contaminants and the range between the more likely and more conservative scenarios of contaminant exposure, more research and monitoring of heavy metals (especially cadmium and chromium) and pesticide residues
Food handling in the household environment as a vulnerability factor to foodborne diseases
Directory of Open Access Journals (Sweden)
Carla Rosane Paz Arruda Teo
2016-06-01
Full Text Available Introduction: the concept of food security and nutrition is based on the regular and sufficient access to food of adequate quality and it implies food safety as one of its dimensions. Objective: to analyze the sanitary and hygienic conditions of food handling in households in Chapecó (SC, Brazil. Materials and Methods: descriptive study with 138 households selected by systematic sampling to a 5% significance level and a 4% acceptable error. We applied a questionnaire to the person who was the responsible for food handling in each household. We used descriptive and inferential statistics and we interpreted the data according to health vulnerability framework. Results: we highlight that 50.7% (n=70 reported to just wash vegetables with water, 71% (n=98 reported to wash cutting boards with detergent and cold water, 33, 3% (n=46 reported the use of raw eggs. There was no association between the source of water supply and sanitary failures observed. Conclusions: safe food handling procedures are not adopted in a reasonable proportion of households, which may explain the vulnerability to foodborne diseases in these environments.
Recipe for a Better Tomorrow: A Food Industry Perspective on Sustainability and Our Food System
Wasserman, Arlin
2009-01-01
The food and agriculture sector is central to efforts to improve public health today and protect and restore natural systems necessary to support good health in the future. The sector has a greater direct impact on land and water resources, employment, and economic activity than any other. And, from a finite resource base, it is underpinning not only food and fiber production but is increasingly relied upon to provide the raw materials for energy, building materials, packaging, and nonfood consumable products. This commentary reviews consumer attitudes and the transformational changes required in the food and agriculture sector to meet today's needs and ensure a better tomorrow. PMID:23144679