
Sample records for raw dna sequence

  1. Haematobia irritans dataset of raw sequence reads from Illumina and Pac Bio sequencing of genomic DNA (United States)

    The genome of the horn fly, Haematobia irritans, was sequenced using Illumina- and Pac Bio-based protocols. Following quality filtering, the raw reads have been deposited at NCBI under the BioProject and BioSample accession numbers PRJNA30967 and SAMN07830356, respectively. The Illumina reads are un...

  2. Rhipicephalus microplus dataset of nonredundant raw sequence reads from 454 GS FLX sequencing of Cot-selected (Cot = 660) genomic DNA (United States)

    A reassociation kinetics-based approach was used to reduce the complexity of genomic DNA from the Deutsch laboratory strain of the cattle tick, Rhipicephalus microplus, to facilitate genome sequencing. Selected genomic DNA (Cot value = 660) was sequenced using 454 GS FLX technology, resulting in 356...

  3. Database-driven primary analysis of raw sequencing data

    DEFF Research Database (Denmark)


    The present invention relates to methods for identifying the source of a biological sequence containing sample from raw sequencing reads. The method may be used to identify the source of unknown DNA and can be used for diagnostic, biodefense, food safety and quality, and hygiene applications...

  4. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)


    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  5. Gomphid DNA sequence data (United States)

    U.S. Environmental Protection Agency — DNA sequence data for several genetic loci. This dataset is not publicly accessible because: It's already publicly available on GenBank. It can be accessed through...

  6. Repeated DNA sequences in fungi

    Energy Technology Data Exchange (ETDEWEB)

    Dutta, S K


    Several fungal species, representatives of all broad groups like basidiomycetes, ascomycetes and phycomycetes, were examined for the nature of repeated DNA sequences by DNA:DNA reassociation studies using hydroxyapatite chromatography. All of the fungal species tested contained 10 to 20 percent repeated DNA sequences. There are approximately 100 to 110 copies of repeated DNA sequences of approximately 4 x 10/sup 7/ daltons piece size of each. Repeated DNA sequence homoduplexes showed on average 5/sup 0/C difference of T/sub e/50 (temperature at which 50 percent duplexes dissociate) values from the corresponding homoduplexes of unfractionated whole DNA. It is suggested that a part of repetitive sequences in fungi constitutes mitochondrial DNA and a part of it constitutes nuclear DNA. (auth)

  7. Biosensors for DNA sequence detection (United States)

    Vercoutere, Wenonah; Akeson, Mark


    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  8. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M


    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  9. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian


    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  10. Duplication in DNA Sequences (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  11. Graphene nanodevices for DNA sequencing

    NARCIS (Netherlands)

    Heerema, S.J.; Dekker, C.


    Fast, cheap, and reliable DNA sequencing could be one of the most disruptive innovations of this decade, as it will pave the way for personalized medicine. In pursuit of such technology, a variety of nanotechnology-based approaches have been explored and established, including sequencing with

  12. Sequence analysis of Leukemia DNA (United States)

    Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa


    Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.

  13. DNA Sequencing by Capillary Electrophoresis (United States)

    Karger, Barry L.; Guttman, Andras


    Sequencing of human and other genomes has been at the center of interest in the biomedical field over the past several decades and is now leading toward an era of personalized medicine. During this time, DNA sequencing methods have evolved from the labor intensive slab gel electrophoresis, through automated multicapillary electrophoresis systems using fluorophore labeling with multispectral imaging, to the “next generation” technologies of cyclic array, hybridization based, nanopore and single molecule sequencing. Deciphering the genetic blueprint and follow-up confirmatory sequencing of Homo sapiens and other genomes was only possible by the advent of modern sequencing technologies that was a result of step by step advances with a contribution of academics, medical personnel and instrument companies. While next generation sequencing is moving ahead at break-neck speed, the multicapillary electrophoretic systems played an essential role in the sequencing of the Human Genome, the foundation of the field of genomics. In this prospective, we wish to overview the role of capillary electrophoresis in DNA sequencing based in part of several of our articles in this journal. PMID:19517496

  14. Fractals in DNA sequence analysis

    Institute of Scientific and Technical Information of China (English)

    Yu Zu-Guo(喻祖国); Vo Anh; Gong Zhi-Min(龚志民); Long Shun-Chao(龙顺潮)


    Fractal methods have been successfully used to study many problems in physics, mathematics, engineering, finance,and even in biology. There has been an increasing interest in unravelling the mysteries of DNA; for example, how can we distinguish coding and noncoding sequences, and the problems of classification and evolution relationship of organisms are key problems in bioinformatics. Although much research has been carried out by taking into consideration the long-range correlations in DNA sequences, and the global fractal dimension has been used in these works by other people, the models and methods are somewhat rough and the results are not satisfactory. In recent years, our group has introduced a time series model (statistical point of view) and a visual representation (geometrical point of view)to DNA sequence analysis. We have also used fractal dimension, correlation dimension, the Hurst exponent and the dimension spectrum (multifractal analysis) to discuss problems in this field. In this paper, we introduce these fractal models and methods and the results of DNA sequence analysis.

  15. Fast and secure retrieval of DNA sequences

    NARCIS (Netherlands)


    Sequence models are retrieved from a sequences index. The sequence models model DNA or RNA sequences stored in a database, and each comprises a finite memory tree source model and parameters for the finite memory tree source model. One or more DNA or RNA sequences stored in the database are

  16. Entropic fluctuations in DNA sequences (United States)

    Thanos, Dimitrios; Li, Wentian; Provata, Astero


    The Local Shannon Entropy (LSE) in blocks is used as a complexity measure to study the information fluctuations along DNA sequences. The LSE of a DNA block maps the local base arrangement information to a single numerical value. It is shown that despite this reduction of information, LSE allows to extract meaningful information related to the detection of repetitive sequences in whole chromosomes and is useful in finding evolutionary differences between organisms. More specifically, large regions of tandem repeats, such as centromeres, can be detected based on their low LSE fluctuations along the chromosome. Furthermore, an empirical investigation of the appropriate block sizes is provided and the relationship of LSE properties with the structure of the underlying repetitive units is revealed by using both computational and mathematical methods. Sequence similarity between the genomic DNA of closely related species also leads to similar LSE values at the orthologous regions. As an application, the LSE covariance function is used to measure the evolutionary distance between several primate genomes.

  17. DNA Replication Profiling Using Deep Sequencing. (United States)

    Saayman, Xanita; Ramos-Pérez, Cristina; Brown, Grant W


    Profiling of DNA replication during progression through S phase allows a quantitative snap-shot of replication origin usage and DNA replication fork progression. We present a method for using deep sequencing data to profile DNA replication in S. cerevisiae.

  18. Low-bandwidth and non-compute intensive remote identification of microbes from raw sequencing reads.

    Directory of Open Access Journals (Sweden)

    Laurent Gautier

    Full Text Available Cheap DNA sequencing may soon become routine not only for human genomes but also for practically anything requiring the identification of living organisms from their DNA: tracking of infectious agents, control of food products, bioreactors, or environmental samples. We propose a novel general approach to the analysis of sequencing data where a reference genome does not have to be specified. Using a distributed architecture we are able to query a remote server for hints about what the reference might be, transferring a relatively small amount of data. Our system consists of a server with known reference DNA indexed, and a client with raw sequencing reads. The client sends a sample of unidentified reads, and in return receives a list of matching references. Sequences for the references can be retrieved and used for exhaustive computation on the reads, such as alignment. To demonstrate this approach we have implemented a web server, indexing tens of thousands of publicly available genomes and genomic regions from various organisms and returning lists of matching hits from query sequencing reads. We have also implemented two clients: one running in a web browser, and one as a python script. Both are able to handle a large number of sequencing reads and from portable devices (the browser-based running on a tablet, perform its task within seconds, and consume an amount of bandwidth compatible with mobile broadband networks. Such client-server approaches could develop in the future, allowing a fully automated processing of sequencing data and routine instant quality check of sequencing runs from desktop sequencers. A web access is available at The source code for a python command-line client, a server, and supplementary data are available at

  19. Low-Bandwidth and Non-Compute Intensive Remote Identification of Microbes from Raw Sequencing Reads (United States)

    Gautier, Laurent; Lund, Ole


    Cheap DNA sequencing may soon become routine not only for human genomes but also for practically anything requiring the identification of living organisms from their DNA: tracking of infectious agents, control of food products, bioreactors, or environmental samples. We propose a novel general approach to the analysis of sequencing data where a reference genome does not have to be specified. Using a distributed architecture we are able to query a remote server for hints about what the reference might be, transferring a relatively small amount of data. Our system consists of a server with known reference DNA indexed, and a client with raw sequencing reads. The client sends a sample of unidentified reads, and in return receives a list of matching references. Sequences for the references can be retrieved and used for exhaustive computation on the reads, such as alignment. To demonstrate this approach we have implemented a web server, indexing tens of thousands of publicly available genomes and genomic regions from various organisms and returning lists of matching hits from query sequencing reads. We have also implemented two clients: one running in a web browser, and one as a python script. Both are able to handle a large number of sequencing reads and from portable devices (the browser-based running on a tablet), perform its task within seconds, and consume an amount of bandwidth compatible with mobile broadband networks. Such client-server approaches could develop in the future, allowing a fully automated processing of sequencing data and routine instant quality check of sequencing runs from desktop sequencers. A web access is available at The source code for a python command-line client, a server, and supplementary data are available at PMID:24391826

  20. Creation of reference DNA barcode library and authentication of medicinal plant raw drugs used in Ayurvedic medicine. (United States)

    Vassou, Sophie Lorraine; Nithaniyal, Stalin; Raju, Balaji; Parani, Madasamy


    Ayurveda is a system of traditional medicine that originated in ancient India, and it is still in practice. Medicinal plants are the backbone of Ayurveda, which heavily relies on the plant-derived therapeutics. While Ayurveda is becoming more popular in several countries throughout the World, lack of authenticated medicinal plant raw drugs is a growing concern. Our aim was to DNA barcode the medicinal plants that are listed in the Ayurvedic Pharmacopoeia of India (API) to create a reference DNA barcode library, and to use the same to authenticate the raw drugs that are sold in markets. We have DNA barcoded 347 medicinal plants using rbcL marker, and curated rbcL DNA barcodes for 27 medicinal plants from public databases. These sequences were used to create Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL). This library was used to authenticate 100 medicinal plant raw drugs, which were in the form of powders (82) and seeds (18). Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL) was created with high quality and authentic rbcL barcodes for 374 out of the 395 medicinal plants that are included in the API. The rbcL DNA barcode differentiated 319 species (85 %) with the pairwise divergence ranging between 0.2 and 29.9 %. PCR amplification and DNA sequencing success rate of rbcL marker was 100 % even for the poorly preserved medicinal plant raw drugs that were collected from local markets. DNA barcoding revealed that only 79 % raw drugs were authentic, and the remaining 21 % samples were adulterated. Further, adulteration was found to be much higher with powders (ca. 25 %) when compared to seeds (ca. 5 %). The present study demonstrated the utility of DNA barcoding in authenticating medicinal plant raw drugs, and found that approximately one fifth of the market samples were adulterated. Powdered raw drugs, which are very difficult to be identified by taxonomists as well as common people, seem to be the easy

  1. DNA sequence modeling based on context trees

    NARCIS (Netherlands)

    Kusters, C.J.; Ignatenko, T.; Roland, J.; Horlin, F.


    Genomic sequences contain instructions for protein and cell production. Therefore understanding and identification of biologically and functionally meaningful patterns in DNA sequences is of paramount importance. Modeling of DNA sequences in its turn can help to better understand and identify such

  2. "First generation" automated DNA sequencing technology. (United States)

    Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M


    Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines. © 2011 by John Wiley & Sons, Inc.

  3. Evaluation of raw nepodin extraction from Rumex japonicus and R. obtusifolius and their DNA polymorphisms. (United States)

    Minami, Motoyasu; Mori, Takako; Yonezawa, Takayuki; Saito, Yukiko; Teruya, Toshiaki; Woo, Je-Tae


    Nepodin, found in the roots of Rumex japonicus Houtt. (Polygonaceae), inhibits osteoclast differentiation and has an antidiabetic effect. We propose nepodin as an ingredient of new functional foods or as a drug candidate for reducing the risk of reduced locomotion resulting from diseases such as osteoporosis. Although there are no previous reports of R. obtusifolius L., which is found throughout Japan, having roots containing nepodin, we found nepodin in the roots of this species. Therefore, R. obtusifolius as well as R. japonicus was considered a candidate raw material for nepodin extraction. We also discuss the suitability of R. japonicus and R. obtusifolius as sources of raw nepodin for cultivation on the Ryukyu Islands. In this study, all specimens on the Ryukyu Islands were identified as R. japonicus. Conversely, all specimens on mainland Japan were R. obtusifolius. The DNA sequence of the chloroplast trnL-trnF intergenic spacer region and partial nuclear internal transcribed spacer was consistent with the identification of R. japonicus and R. obtusifolius by morphological characteristics of the perianth segments. Therefore, to avoid erroneous identification and misuse of the plant species used for extraction of raw materials, it is preferable to develop DNA markers for these two regions. The content of nepodin varied from undetectable to 0.34% of the fresh weight (%FW) in R. japonicus and from undetectable to 0.21%FW in R. obtusifolius. From a pharmacological perspective, as plants that might be suitable as raw materials for nepodin extraction, it became clear that both R. japonicus and R. obtusifolius can be used with the same expected extraction efficiency. Based on our findings, R. obtusifolius could not be confirmed as inhabiting the Ryukyu Islands. For this reason, to conserve the endemic genetic characteristics of the Ryukyu Islands and to prevent genetic pollution by R. obtusifolius, only R. japonicus should be cultivated on the Ryukyu Islands.

  4. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.


    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  5. Human Chromosome 7: DNA Sequence and Biology


    Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.


    DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...

  6. Multiple tag labeling method for DNA sequencing (United States)

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.


    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  7. RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis. (United States)

    Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab


    RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.

  8. Consumer use and response to online third-party raw DNA interpretation services. (United States)

    Wang, Catharine; Cahill, Tiernan J; Parlato, Andrew; Wertz, Blake; Zhong, Qiankun; Cunningham, Tricia Norkunas; Cummings, James J


    With the availability of raw DNA generated from direct-to-consumer (DTC) testing companies, there has been a proliferation of third-party online services that are available to interpret the raw data for both genealogy and/or health purposes. This study examines the current landscape and downstream clinical implications of consumer use of third-party services. Study participants were recruited online from social media platforms. A total of 321 survey respondents reported using third-party services for raw DNA interpretation. Participants were highly motivated to explore raw DNA for ancestral information (67%), individual health implications (62%), or both (40%). Participants primarily used one of seven companies to interpret raw DNA; 73% used more than one. Company choice was driven by the type of results offered (51%), price (45%), and online reviews (31%). Approximately 30% of participants shared results with a medical provider and 21% shared with more than one. Outcomes of sharing ranged from disinterest/discounting of the information to diagnosis of genetic conditions. Participants were highly satisfied with their decision to analyze raw DNA (M = 4.54/5), yet challenges in understanding interpretation results were reported irrespective of satisfaction ratings. Consumers face challenges in understanding the results and may seek out clinical assistance in interpreting their raw DNA results. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  9. EGNAS: an exhaustive DNA sequence design algorithm

    Directory of Open Access Journals (Sweden)

    Kick Alfred


    Full Text Available Abstract Background The molecular recognition based on the complementary base pairing of deoxyribonucleic acid (DNA is the fundamental principle in the fields of genetics, DNA nanotechnology and DNA computing. We present an exhaustive DNA sequence design algorithm that allows to generate sets containing a maximum number of sequences with defined properties. EGNAS (Exhaustive Generation of Nucleic Acid Sequences offers the possibility of controlling both interstrand and intrastrand properties. The guanine-cytosine content can be adjusted. Sequences can be forced to start and end with guanine or cytosine. This option reduces the risk of “fraying” of DNA strands. It is possible to limit cross hybridizations of a defined length, and to adjust the uniqueness of sequences. Self-complementarity and hairpin structures of certain length can be avoided. Sequences and subsequences can optionally be forbidden. Furthermore, sequences can be designed to have minimum interactions with predefined strands and neighboring sequences. Results The algorithm is realized in a C++ program. TAG sequences can be generated and combined with primers for single-base extension reactions, which were described for multiplexed genotyping of single nucleotide polymorphisms. Thereby, possible foldback through intrastrand interaction of TAG-primer pairs can be limited. The design of sequences for specific attachment of molecular constructs to DNA origami is presented. Conclusions We developed a new software tool called EGNAS for the design of unique nucleic acid sequences. The presented exhaustive algorithm allows to generate greater sets of sequences than with previous software and equal constraints. EGNAS is freely available for noncommercial use at

  10. Pattern analysis approach reveals restriction enzyme cutting abnormalities and other cDNA library construction artifacts using raw EST data

    Directory of Open Access Journals (Sweden)

    Zhou Sun


    Full Text Available Abstract Background Expressed Sequence Tag (EST sequences are widely used in applications such as genome annotation, gene discovery and gene expression studies. However, some of GenBank dbEST sequences have proven to be “unclean”. Identification of cDNA termini/ends and their structures in raw ESTs not only facilitates data quality control and accurate delineation of transcription ends, but also furthers our understanding of the potential sources of data abnormalities/errors present in the wet-lab procedures for cDNA library construction. Results After analyzing a total of 309,976 raw Pinus taeda ESTs, we uncovered many distinct variations of cDNA termini, some of which prove to be good indicators of wet-lab artifacts, and characterized each raw EST by its cDNA terminus structure patterns. In contrast to the expected patterns, many ESTs displayed complex and/or abnormal patterns that represent potential wet-lab errors such as: a failure of one or both of the restriction enzymes to cut the plasmid vector; a failure of the restriction enzymes to cut the vector at the correct positions; the insertion of two cDNA inserts into a single vector; the insertion of multiple and/or concatenated adapters/linkers; the presence of 3′-end terminal structures in designated 5′-end sequences or vice versa; and so on. With a close examination of these artifacts, many problematic ESTs that have been deposited into public databases by conventional bioinformatics pipelines or tools could be cleaned or filtered by our methodology. We developed a software tool for Abnormality Filtering and Sequence Trimming for ESTs (AFST, using a pattern analysis approach. To compare AFST with other pipelines that submitted ESTs into dbEST, we reprocessed 230,783 Pinus taeda and 38,709 Arachis hypogaea GenBank ESTs. We found 7.4% of Pinus taeda and 29.2% of Arachis hypogaea GenBank ESTs are “unclean” or abnormal, all of which could be cleaned

  11. Chromatid interchanges at intrachromosomal telomeric DNA sequences

    International Nuclear Information System (INIS)

    Fernandez, J.L.; Vazquez-Gundin, F.; Bilbao, A.; Gosalvez, J.; Goyanes, V.


    Chinese hamster Don cells were exposed to X-rays, mitomycin C and teniposide (VM-26) to induce chromatid exchanges (quadriradials and triradials). After fluorescence in situ hybridization (FISH) of telomere sequences it was found that interstitial telomere-like DNA sequence arrays presented around five times more breakage-rearrangements than the genome overall. This high recombinogenic capacity was independent of the clastogen, suggesting that this susceptibility is not related to the initial mechanisms of DNA damage. (author)

  12. Mitochondrial DNA sequence evolution in shorebird populations

    NARCIS (Netherlands)

    Wenink, P.W.


    This thesis describes the global molecular population structure of two shorebird species, in particular of the dunlin, Calidris alpina, by means of comparative sequence analysis of the most variable part of the mitochondrial DNA (mtDNA) genome. There are several reasons

  13. Recurrence plot analysis of DNA sequences

    Energy Technology Data Exchange (ETDEWEB)

    Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail:


    Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.

  14. On site DNA barcoding by nanopore sequencing.

    Directory of Open Access Journals (Sweden)

    Michele Menegon

    Full Text Available Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet's biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities.

  15. Sequencing intractable DNA to close microbial genomes.

    Directory of Open Access Journals (Sweden)

    Richard A Hurt

    Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  16. Sequencing Intractable DNA to Close Microbial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL


    Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  17. Bacterial identification and subtyping using DNA microarray and DNA sequencing. (United States)

    Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D


    The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.

  18. RANDNA: a random DNA sequence generator. (United States)

    Piva, Francesco; Principato, Giovanni


    Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from:

  19. Compressing DNA sequence databases with coil

    Directory of Open Access Journals (Sweden)

    Hendy Michael D


    Full Text Available Abstract Background Publicly available DNA sequence databases such as GenBank are large, and are growing at an exponential rate. The sheer volume of data being dealt with presents serious storage and data communications problems. Currently, sequence data is usually kept in large "flat files," which are then compressed using standard Lempel-Ziv (gzip compression – an approach which rarely achieves good compression ratios. While much research has been done on compressing individual DNA sequences, surprisingly little has focused on the compression of entire databases of such sequences. In this study we introduce the sequence database compression software coil. Results We have designed and implemented a portable software package, coil, for compressing and decompressing DNA sequence databases based on the idea of edit-tree coding. coil is geared towards achieving high compression ratios at the expense of execution time and memory usage during compression – the compression time represents a "one-off investment" whose cost is quickly amortised if the resulting compressed file is transmitted many times. Decompression requires little memory and is extremely fast. We demonstrate a 5% improvement in compression ratio over state-of-the-art general-purpose compression tools for a large GenBank database file containing Expressed Sequence Tag (EST data. Finally, coil can efficiently encode incremental additions to a sequence database. Conclusion coil presents a compelling alternative to conventional compression of flat files for the storage and distribution of DNA sequence databases having a narrow distribution of sequence lengths, such as EST data. Increasing compression levels for databases having a wide distribution of sequence lengths is a direction for future work.

  20. Quantum-Sequencing: Fast electronic single DNA molecule sequencing (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant


    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  1. Understanding human DNA sequence variation. (United States)

    Kidd, K K; Pakstis, A J; Speed, W C; Kidd, J R


    Over the past century researchers have identified normal genetic variation and studied that variation in diverse human populations to determine the amounts and distributions of that variation. That information is being used to develop an understanding of the demographic histories of the different populations and the species as a whole, among other studies. With the advent of DNA-based markers in the last quarter century, these studies have accelerated. One of the challenges for the next century is to understand that variation. One component of that understanding will be population genetics. We present here examples of many of the ways these new data can be analyzed from a population perspective using results from our laboratory on multiple individual DNA-based polymorphisms, many clustered in haplotypes, studied in multiple populations representing all major geographic regions of the world. These data support an "out of Africa" hypothesis for human dispersal around the world and begin to refine the understanding of population structures and genetic relationships. We are also developing baseline information against which we can compare findings at different loci to aid in the identification of loci subject, now and in the past, to selection (directional or balancing). We do not yet have a comprehensive understanding of the extensive variation in the human genome, but some of that understanding is coming from population genetics.

  2. Identification of species adulteration in traded medicinal plant raw drugs using DNA barcoding. (United States)

    Nithaniyal, Stalin; Vassou, Sophie Lorraine; Poovitha, Sundar; Raju, Balaji; Parani, Madasamy


    Plants are the major source of therapeutic ingredients in complementary and alternative medicine (CAM). However, species adulteration in traded medicinal plant raw drugs threatens the reliability and safety of CAM. Since morphological features of medicinal plants are often not intact in the raw drugs, DNA barcoding was employed for species identification. Adulteration in 112 traded raw drugs was tested after creating a reference DNA barcode library consisting of 1452 rbcL and matK barcodes from 521 medicinal plant species. Species resolution of this library was 74.4%, 90.2%, and 93.0% for rbcL, matK, and rbcL + matK, respectively. DNA barcoding revealed adulteration in about 20% of the raw drugs, and at least 6% of them were derived from plants with completely different medicinal or toxic properties. Raw drugs in the form of dried roots, powders, and whole plants were found to be more prone to adulteration than rhizomes, fruits, and seeds. Morphological resemblance, co-occurrence, mislabeling, confusing vernacular names, and unauthorized or fraudulent substitutions might have contributed to species adulteration in the raw drugs. Therefore, this library can be routinely used to authenticate traded raw drugs for the benefit of all stakeholders: traders, consumers, and regulatory agencies.

  3. DNA Sequencing in Cultural Heritage. (United States)

    Vai, Stefania; Lari, Martina; Caramelli, David


    During the last three decades, DNA analysis on degraded samples revealed itself as an important research tool in anthropology, archaeozoology, molecular evolution, and population genetics. Application on topics such as determination of species origin of prehistoric and historic objects, individual identification of famous personalities, characterization of particular samples important for historical, archeological, or evolutionary reconstructions, confers to the paleogenetics an important role also for the enhancement of cultural heritage. A really fast improvement in methodologies in recent years led to a revolution that permitted recovering even complete genomes from highly degraded samples with the possibility to go back in time 400,000 years for samples from temperate regions and 700,000 years for permafrozen remains and to analyze even more recent material that has been subjected to hard biochemical treatments. Here we propose a review on the different methodological approaches used so far for the molecular analysis of degraded samples and their application on some case studies.

  4. Enhanced throughput for infrared automated DNA sequencing (United States)

    Middendorf, Lyle R.; Gartside, Bill O.; Humphrey, Pat G.; Roemer, Stephen C.; Sorensen, David R.; Steffens, David L.; Sutter, Scott L.


    Several enhancements have been developed and applied to infrared automated DNA sequencing resulting in significantly higher throughput. A 41 cm sequencing gel (31 cm well- to-read distance) combines high resolution of DNA sequencing fragments with optimized run times yielding two runs per day of 500 bases per sample. A 66 cm sequencing gel (56 cm well-to-read distance) produces sequence read lengths of up to 1000 bases for ds and ss templates using either T7 polymerase or cycle-sequencing protocols. Using a multichannel syringe to load 64 lanes allows 16 samples (compatible with 96-well format) to be visualized for each run. The 41 cm gel configuration allows 16,000 bases per day (16 samples X 500 bases/sample X 2 ten hour runs/day) to be sequenced with the advantages of infrared technology. Enhancements to internal labeling techniques using an infrared-labeled dATP molecule (Boehringer Mannheim GmbH, Penzberg, Germany; Sequenase (U.S. Biochemical) have also been made. The inclusion of glycerol in the sequencing reactions yields greatly improved results for some primer and template combinations. The inclusion of (alpha) -Thio-dNTP's in the labeling reaction increases signal intensity two- to three-fold.

  5. Dog Y chromosomal DNA sequence: identification, sequencing and SNP discovery

    Directory of Open Access Journals (Sweden)

    Kirkness Ewen


    Full Text Available Abstract Background Population genetic studies of dogs have so far mainly been based on analysis of mitochondrial DNA, describing only the history of female dogs. To get a picture of the male history, as well as a second independent marker, there is a need for studies of biallelic Y-chromosome polymorphisms. However, there are no biallelic polymorphisms reported, and only 3200 bp of non-repetitive dog Y-chromosome sequence deposited in GenBank, necessitating the identification of dog Y chromosome sequence and the search for polymorphisms therein. The genome has been only partially sequenced for one male dog, disallowing mapping of the sequence into specific chromosomes. However, by comparing the male genome sequence to the complete female dog genome sequence, candidate Y-chromosome sequence may be identified by exclusion. Results The male dog genome sequence was analysed by Blast search against the human genome to identify sequences with a best match to the human Y chromosome and to the female dog genome to identify those absent in the female genome. Candidate sequences were then tested for male specificity by PCR of five male and five female dogs. 32 sequences from the male genome, with a total length of 24 kbp, were identified as male specific, based on a match to the human Y chromosome, absence in the female dog genome and male specific PCR results. 14437 bp were then sequenced for 10 male dogs originating from Europe, Southwest Asia, Siberia, East Asia, Africa and America. Nine haplotypes were found, which were defined by 14 substitutions. The genetic distance between the haplotypes indicates that they originate from at least five wolf haplotypes. There was no obvious trend in the geographic distribution of the haplotypes. Conclusion We have identified 24159 bp of dog Y-chromosome sequence to be used for population genetic studies. We sequenced 14437 bp in a worldwide collection of dogs, identifying 14 SNPs for future SNP analyses, and

  6. The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence. (United States)

    Khoe, Clairine V; Chung, Long H; Murray, Vincent


    The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  7. Special Issue: Next Generation DNA Sequencing

    Directory of Open Access Journals (Sweden)

    Paul Richardson


    Full Text Available Next Generation Sequencing (NGS refers to technologies that do not rely on traditional dideoxy-nucleotide (Sanger sequencing where labeled DNA fragments are physically resolved by electrophoresis. These new technologies rely on different strategies, but essentially all of them make use of real-time data collection of a base level incorporation event across a massive number of reactions (on the order of millions versus 96 for capillary electrophoresis for instance. The major commercial NGS platforms available to researchers are the 454 Genome Sequencer (Roche, Illumina (formerly Solexa Genome analyzer, the SOLiD system (Applied Biosystems/Life Technologies and the Heliscope (Helicos Corporation. The techniques and different strategies utilized by these platforms are reviewed in a number of the papers in this special issue. These technologies are enabling new applications that take advantage of the massive data produced by this next generation of sequencing instruments. [...

  8. Simulating efficiently the evolution of DNA sequences. (United States)

    Schöniger, M; von Haeseler, A


    Two menu-driven FORTRAN programs are described that simulate the evolution of DNA sequences in accordance with a user-specified model. This general stochastic model allows for an arbitrary stationary nucleotide composition and any transition-transversion bias during the process of base substitution. In addition, the user may define any hypothetical model tree according to which a family of sequences evolves. The programs suggest the computationally most inexpensive approach to generate nucleotide substitutions. Either reproducible or non-repeatable simulations, depending on the method of initializing the pseudo-random number generator, can be performed. The corresponding options are offered by the interface menu.

  9. Genomic signal processing for DNA sequence clustering. (United States)

    Mendizabal-Ruiz, Gerardo; Román-Godínez, Israel; Torres-Ramos, Sulema; Salido-Ruiz, Ricardo A; Vélez-Pérez, Hugo; Morales, J Alejandro


    Genomic signal processing (GSP) methods which convert DNA data to numerical values have recently been proposed, which would offer the opportunity of employing existing digital signal processing methods for genomic data. One of the most used methods for exploring data is cluster analysis which refers to the unsupervised classification of patterns in data. In this paper, we propose a novel approach for performing cluster analysis of DNA sequences that is based on the use of GSP methods and the K-means algorithm. We also propose a visualization method that facilitates the easy inspection and analysis of the results and possible hidden behaviors. Our results support the feasibility of employing the proposed method to find and easily visualize interesting features of sets of DNA data.

  10. Google matrix analysis of DNA sequences. (United States)

    Kandiah, Vivek; Shepelyansky, Dima L


    For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW). At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.

  11. Google matrix analysis of DNA sequences.

    Directory of Open Access Journals (Sweden)

    Vivek Kandiah

    Full Text Available For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW. At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.

  12. Genome sequencing of Deutsch strain of cattle ticks, Rhipicephalus microplus: Raw Pac Bio reads. (United States)

    Pac Bio RS II whole genome shotgun sequencing technology was used to sequence the genome of the cattle tick, Rhipicephalus microplus. The DNA was derived from 14 day old eggs from the Deutsch Texas outbreak strain reared at the USDA-ARS Cattle Fever Tick Research Laboratory, Edinburg, TX. Each corre...

  13. Comparison of the effect of raw and blanched-frozen broccoli on DNA damage in colonocytes. (United States)

    Lynn, Anthony; Fuller, Zoë; Collins, Andrew R; Ratcliffe, Brian


    Consumption of cruciferous vegetables may protect against colorectal cancer. Cruciferous vegetables are rich in a number of bioactive constituents including polyphenols, vitamins and glucosinolates. Before consumption, cruciferous vegetables often undergo some form of processing that reduces their content of bioactive constituents and may determine whether they exert protective effects. The aim of this study was to compare the ability of raw and blanched-frozen broccoli to protect colonocytes against DNA damage, improve antioxidant status and induce xenobiotic metabolizing enzymes (XME). Fifteen Landrace × Large White male pigs were divided into five age-matched and weight-matched sets (79 days, SD 3, and 34·7 kg, SD 3·9, respectively). Each set consisted of siblings to minimize genetic variation. Within each set, pigs received a cereal-based diet, unsupplemented (control) or supplemented with 600 g day(-1) of raw or blanched-frozen broccoli for 12 days. The consumption of raw broccoli caused a significant 27% increase in DNA damage in colonocytes (p = 0·03) relative to the control diet, whereas blanched-frozen broccoli had no significant effect. Both broccoli diets had no significant effect on plasma antioxidant status or hepatic and colonic XME. This study is the first to report that the consumption of raw broccoli can damage DNA in porcine colonocytes. Copyright © 2015 John Wiley & Sons, Ltd.

  14. Aspects of coverage in medical DNA sequencing

    Directory of Open Access Journals (Sweden)

    Wilson Richard K


    Full Text Available Abstract Background DNA sequencing is now emerging as an important component in biomedical studies of diseases like cancer. Short-read, highly parallel sequencing instruments are expected to be used heavily for such projects, but many design specifications have yet to be conclusively established. Perhaps the most fundamental of these is the redundancy required to detect sequence variations, which bears directly upon genomic coverage and the consequent resolving power for discerning somatic mutations. Results We address the medical sequencing coverage problem via an extension of the standard mathematical theory of haploid coverage. The expected diploid multi-fold coverage, as well as its generalization for aneuploidy are derived and these expressions can be readily evaluated for any project. The resulting theory is used as a scaling law to calibrate performance to that of standard BAC sequencing at 8× to 10× redundancy, i.e. for expected coverages that exceed 99% of the unique sequence. A differential strategy is formalized for tumor/normal studies wherein tumor samples are sequenced more deeply than normal ones. In particular, both tumor alleles should be detected at least twice, while both normal alleles are detected at least once. Our theory predicts these requirements can be met for tumor and normal redundancies of approximately 26× and 21×, respectively. We explain why these values do not differ by a factor of 2, as might intuitively be expected. Future technology developments should prompt even deeper sequencing of tumors, but the 21× value for normal samples is essentially a constant. Conclusion Given the assumptions of standard coverage theory, our model gives pragmatic estimates for required redundancy. The differential strategy should be an efficient means of identifying potential somatic mutations for further study.

  15. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

  16. Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

    Energy Technology Data Exchange (ETDEWEB)

    Winston Chen, C.H.; Taranenko, N.I.; Zhu, Y.F.; Chung, C.N.; Allman, S.L.


    Since laser mass spectrometry has the potential for achieving very fast DNA analysis, the authors recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Snager`s enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. The preliminary results indicate laser mass spectrometry can possibly be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, the authors applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

  17. Method for priming and DNA sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Mugasimangalam, R.C.; Ulanovsky, L.E.


    A method is presented for improving the priming specificity of an oligonucleotide primer that is non-unique in a nucleic acid template which includes selecting a continuous stretch of several nucleotides in the template DNA where one of the four bases does not occur in the stretch. This also includes bringing the template DNA in contract with a non-unique primer partially or fully complimentary to the sequence immediately upstream of the selected sequence stretch. This results in polymerase-mediated differential extension of the primer in the presence of a subset of deoxyribonucleotide triphosphates that does not contain the base complementary to the base absent in the selected sequence stretch. These reactions occur at a temperature sufficiently low for allowing the extension of the non-unique primer. The method causes polymerase-mediated extension reactions in the presence of all four natural deoxyribonucleotide triphosphates or modifications. At this high temperature discrimination occurs against priming sites of the non-unique primer where the differential extension has not made the primer sufficiently stable to prime. However, the primer extended at the selected stretch is sufficiently stable to prime.

  18. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches (United States)

    McCutchen-Maloney, Sandra L.


    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  19. High-Quality Exome Sequencing of Whole-Genome Amplified Neonatal Dried Blood Spot DNA

    DEFF Research Database (Denmark)

    Poulsen, Jesper Buchhave; Lescai, Francesco; Grove, Jakob


    Stored neonatal dried blood spot (DBS) samples from neonatal screening programmes are a valuable diagnostic and research resource. Combined with information from national health registries they can be used in population-based studies of genetic diseases. DNA extracted from neonatal DBSs can...... be amplified to obtain micrograms of an otherwise limited resource, referred to as whole-genome amplified DNA (wgaDNA). Here we investigate the robustness of exome sequencing of wgaDNA of neonatal DBS samples. We conducted three pilot studies of seven, eight and seven subjects, respectively. For each subject...... we analysed a neonatal DBS sample and corresponding adult whole-blood (WB) reference sample. Different DNA sample types were prepared for each of the subjects. Pilot 1: wgaDNA of 2x3.2mm neonatal DBSs (DBS_2x3.2) and raw DNA extract of the WB reference sample (WB_ref). Pilot 2: DBS_2x3.2, WB...

  20. Poincaré recurrences of DNA sequences (United States)

    Frahm, K. M.; Shepelyansky, D. L.


    We analyze the statistical properties of Poincaré recurrences of Homo sapiens, mammalian, and other DNA sequences taken from the Ensembl Genome data base with up to 15 billion base pairs. We show that the probability of Poincaré recurrences decays in an algebraic way with the Poincaré exponent β≈4 even if the oscillatory dependence is well pronounced. The correlations between recurrences decay with an exponent ν≈0.6 that leads to an anomalous superdiffusive walk. However, for Homo sapiens sequences, with the largest available statistics, the diffusion coefficient converges to a finite value on distances larger than one million base pairs. We argue that the approach based on Poncaré recurrences determines new proximity features between different species and sheds a new light on their evolution history.

  1. Image correlation method for DNA sequence alignment. (United States)

    Curilem Saldías, Millaray; Villarroel Sassarini, Felipe; Muñoz Poblete, Carlos; Vargas Vásquez, Asticio; Maureira Butler, Iván


    The complexity of searches and the volume of genomic data make sequence alignment one of bioinformatics most active research areas. New alignment approaches have incorporated digital signal processing techniques. Among these, correlation methods are highly sensitive. This paper proposes a novel sequence alignment method based on 2-dimensional images, where each nucleic acid base is represented as a fixed gray intensity pixel. Query and known database sequences are coded to their pixel representation and sequence alignment is handled as object recognition in a scene problem. Query and database become object and scene, respectively. An image correlation process is carried out in order to search for the best match between them. Given that this procedure can be implemented in an optical correlator, the correlation could eventually be accomplished at light speed. This paper shows an initial research stage where results were "digitally" obtained by simulating an optical correlation of DNA sequences represented as images. A total of 303 queries (variable lengths from 50 to 4500 base pairs) and 100 scenes represented by 100 x 100 images each (in total, one million base pair database) were considered for the image correlation analysis. The results showed that correlations reached very high sensitivity (99.01%), specificity (98.99%) and outperformed BLAST when mutation numbers increased. However, digital correlation processes were hundred times slower than BLAST. We are currently starting an initiative to evaluate the correlation speed process of a real experimental optical correlator. By doing this, we expect to fully exploit optical correlation light properties. As the optical correlator works jointly with the computer, digital algorithms should also be optimized. The results presented in this paper are encouraging and support the study of image correlation methods on sequence alignment.

  2. Highly accurate fluorogenic DNA sequencing with information theory-based error correction. (United States)

    Chen, Zitian; Zhou, Wenxiong; Qiao, Shuo; Kang, Li; Duan, Haifeng; Xie, X Sunney; Huang, Yanyi


    Eliminating errors in next-generation DNA sequencing has proved challenging. Here we present error-correction code (ECC) sequencing, a method to greatly improve sequencing accuracy by combining fluorogenic sequencing-by-synthesis (SBS) with an information theory-based error-correction algorithm. ECC embeds redundancy in sequencing reads by creating three orthogonal degenerate sequences, generated by alternate dual-base reactions. This is similar to encoding and decoding strategies that have proved effective in detecting and correcting errors in information communication and storage. We show that, when combined with a fluorogenic SBS chemistry with raw accuracy of 98.1%, ECC sequencing provides single-end, error-free sequences up to 200 bp. ECC approaches should enable accurate identification of extremely rare genomic variations in various applications in biology and medicine.

  3. A microfabricated hybrid device for DNA sequencing. (United States)

    Liu, Shaorong


    We have created a hybrid device of a microfabricated round-channel twin-T injector incorporated with a separation capillary in order to extend the straight separation distance for high speed and long readlength DNA sequencing. Semicircular grooves on glass wafers are obtained using a photomask with a narrow line-width and a standard isotropic photolithographic etching process. Round channels are made when two etched wafers are face-to-face aligned and bonded. A two-mask fabrication process has been developed to make channels of two different diameters. The twin-T injector is formed by the smaller channels whose diameter matches the bore of the separation capillary, and the "usual" separation channel, now called the connection channel, is formed by the larger ones whose diameter matches the outer diameter of the separation capillary. The separation capillary is inserted through the connection channel all the way to the twin-T injector to allow the capillary bore flush with the twin-T injector channels. The total dead-volume of the connection is estimated to be approximately 5 pL. To demonstrate the efficiency of this hybrid device, we have performed four-color DNA sequencing on it. Using a 200 microm twin-T injector coupled with a separation capillary of 20 cm effective separation distance, we have obtained readlengths of 800 plus bases at an accuracy of 98.5% in 56 min, compared to about 650 bases in 100 min on a conventional 40 cm long capillary sequencing machine under similar conditions. At an increased separation field strength and using a diluted sieving matrix, the separation time has been reduced to 20 min with a readlength of 700 bases at 98.5% base-calling accuracy.

  4. Identification of Meconopsis species by a DNA barcode sequence ...

    African Journals Online (AJOL)

    Deoxyribonucleic acid (DNA) barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Species identification is necessary for the authentication of traditional plant based medicines. Although a consensus has not been agreed regarding which DNA sequences can be used as ...

  5. A DNA Structure-Based Bionic Wavelet Transform and Its Application to DNA Sequence Analysis

    Directory of Open Access Journals (Sweden)

    Fei Chen


    Full Text Available DNA sequence analysis is of great significance for increasing our understanding of genomic functions. An important task facing us is the exploration of hidden structural information stored in the DNA sequence. This paper introduces a DNA structure-based adaptive wavelet transform (WT – the bionic wavelet transform (BWT – for DNA sequence analysis. The symbolic DNA sequence can be separated into four channels of indicator sequences. An adaptive symbol-to-number mapping, determined from the structural feature of the DNA sequence, was introduced into WT. It can adjust the weight value of each channel to maximise the useful energy distribution of the whole BWT output. The performance of the proposed BWT was examined by analysing synthetic and real DNA sequences. Results show that BWT performs better than traditional WT in presenting greater energy distribution. This new BWT method should be useful for the detection of the latent structural features in future DNA sequence analysis.

  6. Next Generation DNA Sequencing and the Future of Genomic Medicine


    Anderson, Matthew W.; Schrijver, Iris


    In the years since the first complete human genome sequence was reported, there has been a rapid development of technologies to facilitate high-throughput sequence analysis of DNA (termed “next-generation” sequencing). These novel approaches to DNA sequencing offer the promise of complete genomic analysis at a cost feasible for routine clinical diagnostics. However, the ability to more thoroughly interrogate genomic sequence raises a number of important issues with regard to result interpreta...

  7. SWORDS: A statistical tool for analysing large DNA sequences

    Indian Academy of Sciences (India)


    These techniques are based on frequency distributions of DNA words in a large sequence, and have been packaged into a software called SWORDS. Using sequences available in ... tions with the cellular processes like recombination, replication .... in DNA sequences using certain specific probability laws. (Pevzner et al ...

  8. A novel constraint for thermodynamically designing DNA sequences.

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    Full Text Available Biotechnological and biomolecular advances have introduced novel uses for DNA such as DNA computing, storage, and encryption. For these applications, DNA sequence design requires maximal desired (and minimal undesired hybridizations, which are the product of a single new DNA strand from 2 single DNA strands. Here, we propose a novel constraint to design DNA sequences based on thermodynamic properties. Existing constraints for DNA design are based on the Hamming distance, a constraint that does not address the thermodynamic properties of the DNA sequence. Using a unique, improved genetic algorithm, we designed DNA sequence sets which satisfy different distance constraints and employ a free energy gap based on a minimum free energy (MFE to gauge DNA sequences based on set thermodynamic properties. When compared to the best constraints of the Hamming distance, our method yielded better thermodynamic qualities. We then used our improved genetic algorithm to obtain lower-bound DNA sequence sets. Here, we discuss the effects of novel constraint parameters on the free energy gap.

  9. An automated annotation tool for genomic DNA sequences using

    Indian Academy of Sciences (India)

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...

  10. Levenshtein error-correcting barcodes for multiplexed DNA sequencing

    NARCIS (Netherlands)

    Buschmann, Tilo; Bystrykh, Leonid V.


    Background: High-throughput sequencing technologies are improving in quality, capacity and costs, providing versatile applications in DNA and RNA research. For small genomes or fraction of larger genomes, DNA samples can be mixed and loaded together on the same sequencing track. This so-called

  11. Molecular design of sequence specific DNA alkylating agents. (United States)

    Minoshima, Masafumi; Bando, Toshikazu; Shinohara, Ken-ichi; Sugiyama, Hiroshi


    Sequence-specific DNA alkylating agents have great interest for novel approach to cancer chemotherapy. We designed the conjugates between pyrrole (Py)-imidazole (Im) polyamides and DNA alkylating chlorambucil moiety possessing at different positions. The sequence-specific DNA alkylation by conjugates was investigated by using high-resolution denaturing polyacrylamide gel electrophoresis (PAGE). The results showed that polyamide chlorambucil conjugates alkylate DNA at flanking adenines in recognition sequences of Py-Im polyamides, however, the reactivities and alkylation sites were influenced by the positions of conjugation. In addition, we synthesized conjugate between Py-Im polyamide and another alkylating agent, 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI). DNA alkylation reactivies by both alkylating polyamides were almost comparable. In contrast, cytotoxicities against cell lines differed greatly. These comparative studies would promote development of appropriate sequence-specific DNA alkylating polyamides against specific cancer cells.

  12. Food Fish Identification from DNA Extraction through Sequence Analysis (United States)

    Hallen-Adams, Heather E.


    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  13. DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

    Directory of Open Access Journals (Sweden)

    Cheng-Yao eChen


    Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

  14. Sequence of human protamine 2 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)


    The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

  15. Sequence periodicity in nucleosomal DNA and intrinsic curvature. (United States)

    Nair, T Murlidharan


    Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

  16. Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform

    Directory of Open Access Journals (Sweden)

    Shan Wei


    Full Text Available Real-time sequencing of short DNA reads has a wide variety of clinical and research applications including screening for mutations, target sequences and aneuploidy. We recently demonstrated that MinION, a nanopore-based DNA sequencing device the size of a USB drive, could be used for short-read DNA sequencing. In this study, an ultra-rapid multiplex library preparation and sequencing method for the MinION is presented and applied to accurately test normal diploid and aneuploidy samples’ genomic DNA in under three hours, including library preparation and sequencing. This novel method shows great promise as a clinical diagnostic test for applications requiring rapid short-read DNA sequencing.


    Directory of Open Access Journals (Sweden)

    Edith Burbano


    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  18. Analysis of quality raw data of second generation sequencers with Quality Assessment Software. (United States)

    Ramos, Rommel Tj; Carneiro, Adriana R; Baumbach, Jan; Azevedo, Vasco; Schneider, Maria Pc; Silva, Artur


    Second generation technologies have advantages over Sanger; however, they have resulted in new challenges for the genome construction process, especially because of the small size of the reads, despite the high degree of coverage. Independent of the program chosen for the construction process, DNA sequences are superimposed, based on identity, to extend the reads, generating contigs; mismatches indicate a lack of homology and are not included. This process improves our confidence in the sequences that are generated. We developed Quality Assessment Software, with which one can review graphs showing the distribution of quality values from the sequencing reads. This software allow us to adopt more stringent quality standards for sequence data, based on quality-graph analysis and estimated coverage after applying the quality filter, providing acceptable sequence coverage for genome construction from short reads. Quality filtering is a fundamental step in the process of constructing genomes, as it reduces the frequency of incorrect alignments that are caused by measuring errors, which can occur during the construction process due to the size of the reads, provoking misassemblies. Application of quality filters to sequence data, using the software Quality Assessment, along with graphing analyses, provided greater precision in the definition of cutoff parameters, which increased the accuracy of genome construction.

  19. Spectral entropy criteria for structural segmentation in genomic DNA sequences

    International Nuclear Information System (INIS)

    Chechetkin, V.R.; Lobzin, V.V.


    The spectral entropy is calculated with Fourier structure factors and characterizes the level of structural ordering in a sequence of symbols. It may efficiently be applied to the assessment and reconstruction of the modular structure in genomic DNA sequences. We present the relevant spectral entropy criteria for the local and non-local structural segmentation in DNA sequences. The results are illustrated with the model examples and analysis of intervening exon-intron segments in the protein-coding regions

  20. Adenoviral DNA replication: DNA sequences and enzymes required for initiation in vitro

    International Nuclear Information System (INIS)

    Stillman, B.W.; Tamanoi, F.


    In this paper evidence is provided that the 140,000-dalton DNA polymerase is encoded by the adenoviral genome and is required for the initiation of DNA replication in vitro. The DNA sequences in the template DNA that are required for the initiation of replication have also been identified, using both plasmid DNAs and synthetic oligodeoxyribonucleotides. 48 references, 7 figures, 1 table

  1. Order and correlations in genomic DNA sequences. The spectral approach

    International Nuclear Information System (INIS)

    Lobzin, Vasilii V; Chechetkin, Vladimir R


    The structural analysis of genomic DNA sequences is discussed in the framework of the spectral approach, which is sufficiently universal due to the reciprocal correspondence and mutual complementarity of Fourier transform length scales. The spectral characteristics of random sequences of the same nucleotide composition possess the property of self-averaging for relatively short sequences of length M≥100-300. Comparison with the characteristics of random sequences determines the statistical significance of the structural features observed. Apart from traditional applications to the search for hidden periodicities, spectral methods are also efficient in studying mutual correlations in DNA sequences. By combining spectra for structure factors and correlation functions, not only integral correlations can be estimated but also their origin identified. Using the structural spectral entropy approach, the regularity of a sequence can be quantitatively assessed. A brief introduction to the problem is also presented and other major methods of DNA sequence analysis described. (reviews of topical problems)

  2. Toward a Better Compression for DNA Sequences Using Huffman Encoding. (United States)

    Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi


    Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).

  3. Next Generation Sequencing of Ancient DNA: Requirements, Strategies and Perspectives

    Directory of Open Access Journals (Sweden)

    Michael Knapp


    Full Text Available The invention of next-generation-sequencing has revolutionized almost all fields of genetics, but few have profited from it as much as the field of ancient DNA research. From its beginnings as an interesting but rather marginal discipline, ancient DNA research is now on its way into the centre of evolutionary biology. In less than a year from its invention next-generation-sequencing had increased the amount of DNA sequence data available from extinct organisms by several orders of magnitude. Ancient DNA  research is now not only adding a temporal aspect to evolutionary studies and allowing for the observation of evolution in real time, it also provides important data to help understand the origins of our own species. Here we review progress that has been made in next-generation-sequencing of ancient DNA over the past five years and evaluate sequencing strategies and future directions.

  4. Thermodynamics of sequence-specific binding of PNA to DNA

    DEFF Research Database (Denmark)

    Ratilainen, T; Holmén, A; Tuite, E


    For further characterization of the hybridization properties of peptide nucleic acids (PNAs), the thermodynamics of hybridization of mixed sequence PNA-DNA duplexes have been studied. We have characterized the binding of PNA to DNA in terms of binding affinity (perfectly matched duplexes) and seq......For further characterization of the hybridization properties of peptide nucleic acids (PNAs), the thermodynamics of hybridization of mixed sequence PNA-DNA duplexes have been studied. We have characterized the binding of PNA to DNA in terms of binding affinity (perfectly matched duplexes...

  5. Characteristics of alternating current hopping conductivity in DNA sequences

    International Nuclear Information System (INIS)

    Song-Shan, Ma; Hui, Xu; Huan-You, Wang; Rui, Guo


    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of ø ac (ω) ∼ ω 2 ln 2 (1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p ≥ 0.5, the conductivity increases with the increase of p. (cross-disciplinary physics and related areas of science and technology)

  6. Sequence-dependent DNA deformability studied using molecular dynamics simulations. (United States)

    Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori


    Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.

  7. Characteristics of alternating current hopping conductivity in DNA sequences

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Wang Huan-You; Guo Rui


    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences,in which DNA is considered as a one-dimensional (1D) disordered system,and electrons transport via hopping between localized states.It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises,and it takes the form of σac(ω)~ω2 ln2(1/ω).Also AC conductivity of DNA sequences increases with the increase of temperature,this phenomenon presents characteristics of weak temperature-dependence.Meanwhile,the AC conductivity in an off diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures,which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity,while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition,the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences.For p<0.5,the conductivity of DNA sequence decreases with the increase of p,while for p > 0.5,the conductivity increases with the increase of p.

  8. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.


    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  9. High-Throughput Block Optical DNA Sequence Identification. (United States)

    Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant


    Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)


    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  11. DNA Nucleotide Sequence Restricted by the RI Endonuclease (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.


    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  12. Capillary gel electrophoresis for rapid, high resolution DNA sequencing.


    Swerdlow, H; Gesteland, R


    Capillary gel electrophoresis has been demonstrated for the separation and detection of DNA sequencing samples. Enzymatic dideoxy nucleotide chain termination was employed, using fluorescently tagged oligonucleotide primers and laser based on-column detection (limit of detection is 6,000 molecules per peak). Capillary gel separations were shown to be three times faster, with better resolution (2.4 x), and higher separation efficiency (5.4 x) than a conventional automated slab gel DNA sequenci...

  13. Recurrence time statistics: versatile tools for genomic DNA sequence analysis. (United States)

    Cao, Yinhe; Tung, Wen-Wen; Gao, J B


    With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

  14. An extended sequence specificity for UV-induced DNA damage. (United States)

    Chung, Long H; Murray, Vincent


    The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  15. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie


    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...


    KAUST Repository

    Bahabri, Rihab R.


    Activities of DNA are to a great extent controlled epigenetically through the internal struc- ture of chromatin. This structure is dynamic and is influenced by different modifications of histone proteins. Various combinations of epigenetic modification of histones pinpoint to different functional regions of the DNA determining the so-called chromatin states. How- ever, the characterization of chromatin states by the DNA sequence properties remains largely unknown. In this study we aim to explore whether DNA sequence patterns in the human genome can characterize different chromatin states. Using DNA sequence motifs we built binary classifiers for each chromatic state to eval- uate whether a given genomic sequence is a good candidate for belonging to a particular chromatin state. Of four classification algorithms (C4.5, Naive Bayes, Random Forest, and SVM) used for this purpose, the decision tree based classifiers (C4.5 and Random Forest) yielded best results among those we evaluated. Our results suggest that in general these models lack sufficient predictive power, although for four chromatin states (insulators, het- erochromatin, and two types of copy number variation) we found that presence of certain motifs in DNA sequences does imply an increased probability that such a sequence is one of these chromatin states.

  17. PNA Directed Sequence Addressed Self-Assembly of DNA Nanostructures

    DEFF Research Database (Denmark)

    Nielsen, Peter E.


    sequence specifically recognize another PNA oligomer. We describe how such three domain PNAs have utility for assembling dsDNA grid and clover leaf structures, and in combination with SNAP-tag technol. of protein dsDNA structures. (c) 2008 American Institute of Physics. [on SciFinder (R)] Udgivelsesdato...

  18. AU2EU : Privacy-preserving matching of DNA sequences

    NARCIS (Netherlands)

    Ignatenko, T.; Petkovic, M.; Naccache, D.; Sauveron, D.


    Advances in DNA sequencing create new opportunities for the use of DNA data in healthcare for diagnostic and treatment purposes, but also in many other health and well-being services. This brings new challenges with regard to the protection and use of this sensitive data. Thus, special technical

  19. Close sequence identity between ribosomal DNA episomes of the ...

    Indian Academy of Sciences (India)


    The restriction map of the E. dispar rDNA circle showed close simi- larity to EhR1 .... for 30 cycles in a DNA Thermal cycler (MJ Research,. USA). 3. .... by asterisk. The gaps show the variation between E. dispar and E. histolytica sequences.

  20. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  1. Effects of sequence on DNA wrapping around histones (United States)

    Ortiz, Vanessa


    A central question in biophysics is whether the sequence of a DNA strand affects its mechanical properties. In epigenetics, these are thought to influence nucleosome positioning and gene expression. Theoretical and experimental attempts to answer this question have been hindered by an inability to directly resolve DNA structure and dynamics at the base-pair level. In our previous studies we used a detailed model of DNA to measure the effects of sequence on the stability of naked DNA under bending. Sequence was shown to influence DNA's ability to form kinks, which arise when certain motifs slide past others to form non-native contacts. Here, we have now included histone-DNA interactions to see if the results obtained for naked DNA are transferable to the problem of nucleosome positioning. Different DNA sequences interacting with the histone protein complex are studied, and their equilibrium and mechanical properties are compared among themselves and with the naked case. NLM training grant to the Computation and Informatics in Biology and Medicine Training Program (NLM T15LM007359).

  2. DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants. (United States)

    Sucher, Nikolaus J; Hennell, James R; Carles, Maria C


    DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

  3. Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa. (United States)

    Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F


    In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.

  4. Highly multiplexed targeted DNA sequencing from single nuclei. (United States)

    Leung, Marco L; Wang, Yong; Kim, Charissa; Gao, Ruli; Jiang, Jerry; Sei, Emi; Navin, Nicholas E


    Single-cell DNA sequencing methods are challenged by poor physical coverage, high technical error rates and low throughput. To address these issues, we developed a single-cell DNA sequencing protocol that combines flow-sorting of single nuclei, time-limited multiple-displacement amplification (MDA), low-input library preparation, DNA barcoding, targeted capture and next-generation sequencing (NGS). This approach represents a major improvement over our previous single nucleus sequencing (SNS) Nature Protocols paper in terms of generating higher-coverage data (>90%), thereby enabling the detection of genome-wide variants in single mammalian cells at base-pair resolution. Furthermore, by pooling 48-96 single-cell libraries together for targeted capture, this approach can be used to sequence many single-cell libraries in parallel in a single reaction. This protocol greatly reduces the cost of single-cell DNA sequencing, and it can be completed in 5-6 d by advanced users. This single-cell DNA sequencing protocol has broad applications for studying rare cells and complex populations in diverse fields of biological research and medicine.

  5. Googling DNA sequences on the World Wide Web. (United States)

    Hajibabaei, Mehrdad; Singer, Gregory A C


    New web-based technologies provide an excellent opportunity for sharing and accessing information and using web as a platform for interaction and collaboration. Although several specialized tools are available for analyzing DNA sequence information, conventional web-based tools have not been utilized for bioinformatics applications. We have developed a novel algorithm and implemented it for searching species-specific genomic sequences, DNA barcodes, by using popular web-based methods such as Google. We developed an alignment independent character based algorithm based on dividing a sequence library (DNA barcodes) and query sequence to words. The actual search is conducted by conventional search tools such as freely available Google Desktop Search. We implemented our algorithm in two exemplar packages. We developed pre and post-processing software to provide customized input and output services, respectively. Our analysis of all publicly available DNA barcode sequences shows a high accuracy as well as rapid results. Our method makes use of conventional web-based technologies for specialized genetic data. It provides a robust and efficient solution for sequence search on the web. The integration of our search method for large-scale sequence libraries such as DNA barcodes provides an excellent web-based tool for accessing this information and linking it to other available categories of information on the web.

  6. Complete cDNA sequence coding for human docking protein

    Energy Technology Data Exchange (ETDEWEB)

    Hortsch, M; Labeit, S; Meyer, D I


    Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

  7. Phylogenetic analysis of the genus Hordeum using repetitive DNA sequences

    DEFF Research Database (Denmark)

    Svitashev, S.; Bryngelsson, T.; Vershinin, A.


    A set of six cloned barley (Hordeum vulgare) repetitive DNA sequences was used for the analysis of phylogenetic relationships among 31 species (46 taxa) of the genus Hordeum, using molecular hybridization techniques. In situ hybridization experiments showed dispersed organization of the sequences...

  8. Sequence specificity of DNA cleavage by Micrococcus luteus γ endonuclease

    International Nuclear Information System (INIS)

    Hentosh, P.; Henner, W.D.; Reynolds, R.J.


    DNA fragments of defined sequence have been used to determine the sites of cleavage by γ-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus γ endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to γ radiation

  9. Nanobiosensor for Detection and Quantification of DNA Sequences in Degraded Mixed Meats

    Directory of Open Access Journals (Sweden)

    M. E. Ali


    Full Text Available A novel class of nanobiosensor was developed by integrating a 27-nucleotide AluI fragment of swine cytochrome b (cytb gene to a 3-nm diameter citrate-tannate coated gold nanoparticle (GNP. The biosensor detected 0.5% and 1% pork in raw and 2.5-h autoclaved pork-beef binary admixtures in a single step without any separation or washing. The hybridization kinetics of the hybrid sensor was studied with synthetic and AluI digested real pork targets from moderate to extreme target concentrations and a sigmoidal relationship was found. Using the kinetic curve, a convenient method for quantifying and counting target DNA copy number was developed. The accuracy of the method was over 90% and 80% for raw and autoclaved pork-beef binary admixtures in the range of 5–100% pork adulteration. The biosensor probe identified a target DNA sequence that was several-folds shorter than a typical PCR-template. This offered the detection and quantitation of potential targets in highly processed or degraded samples where PCR amplification was not possible due to template crisis. The assay was a viable alternative approach of qPCR for detecting, quantifying and counting copy number of shorter size DNA sequences to address a wide ranging biological problem in food industry, diagnostic laboratories and forensic medicine.

  10. Sequencing of chloroplast genome using whole cellular DNA and Solexa sequencing technology

    Directory of Open Access Journals (Sweden)

    Jian eWu


    Full Text Available Sequencing of the chloroplast genome using traditional sequencing methods has been difficult because of its size (>120 kb and the complicated procedures required to prepare templates. To explore the feasibility of sequencing the chloroplast genome using DNA extracted from whole cells and Solexa sequencing technology, we sequenced whole cellular DNA isolated from leaves of three Brassica rapa accessions with one lane per accession. In total, 246 Mb, 362Mb, 361 Mb sequence data were generated for the three accessions Chiifu-401-42, Z16 and FT, respectively. Microreads were assembled by reference-guided assembly using the cpDNA sequences of B. rapa, Arabidopsis thaliana, and Nicotiana tabacum. We achieved coverage of more than 99.96% of the cp genome in the three tested accessions using the B. rapa sequence as the reference. When A. thaliana or N. tabacum sequences were used as references, 99.7–99.8% or 95.5–99.7% of the B. rapa chloroplast genome was covered, respectively. These results demonstrated that sequencing of whole cellular DNA isolated from young leaves using the Illumina Genome Analyzer is an efficient method for high-throughput sequencing of chloroplast genome.

  11. Next-generation sequencing offers new insights into DNA degradation

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Orlando, Ludovic Antoine Alexandre; Willerslev, Eske


    The processes underlying DNA degradation are central to various disciplines, including cancer research, forensics and archaeology. The sequencing of ancient DNA molecules on next-generation sequencing platforms provides direct measurements of cytosine deamination, depurination and fragmentation...... rates that previously were obtained only from extrapolations of results from in vitro kinetic experiments performed over short timescales. For example, recent next-generation sequencing of ancient DNA reveals purine bases as one of the main targets of postmortem hydrolytic damage, through base...... elimination and strand breakage. It also shows substantially increased rates of DNA base-loss at guanosine. In this review, we argue that the latter results from an electron resonance structure unique to guanosine rather than adenosine having an extra resonance structure over guanosine as previously suggested....

  12. Mapping Base Modifications in DNA by Transverse-Current Sequencing (United States)

    Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.


    Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.

  13. Directed PCR-free engineering of highly repetitive DNA sequences

    Directory of Open Access Journals (Sweden)

    Preissler Steffen


    Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.

  14. Spreadsheet-based program for alignment of overlapping DNA sequences. (United States)

    Anbazhagan, R; Gabrielson, E


    Molecular biology laboratories frequently face the challenge of aligning small overlapping DNA sequences derived from a long DNA segment. Here, we present a short program that can be used to adapt Excel spreadsheets as a tool for aligning DNA sequences, regardless of their orientation. The program runs on any Windows or Macintosh operating system computer with Excel 97 or Excel 98. The program is available for use as an Excel file, which can be downloaded from the BioTechniques Web site. Upon execution, the program opens a specially designed customized workbook and is capable of identifying overlapping regions between two sequence fragments and displaying the sequence alignment. It also performs a number of specialized functions such as recognition of restriction enzyme cutting sites and CpG island mapping without costly specialized software.

  15. Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.

    Directory of Open Access Journals (Sweden)

    Jason D Thompson

    Full Text Available Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.

  16. Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment. (United States)

    Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre


    Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.

  17. Chaos game representation (CGR)-walk model for DNA sequences

    International Nuclear Information System (INIS)

    Jie, Gao; Zhen-Yuan, Xu


    Chaos game representation (CGR) is an iterative mapping technique that processes sequences of units, such as nucleotides in a DNA sequence or amino acids in a protein, in order to determine the coordinates of their positions in a continuous space. This distribution of positions has two features: one is unique, and the other is source sequence that can be recovered from the coordinates so that the distance between positions may serve as a measure of similarity between the corresponding sequences. A CGR-walk model is proposed based on CGR coordinates for the DNA sequences. The CGR coordinates are converted into a time series, and a long-memory ARFIMA (p, d, q) model, where ARFIMA stands for autoregressive fractionally integrated moving average, is introduced into the DNA sequence analysis. This model is applied to simulating real CGR-walk sequence data of ten genomic sequences. Remarkably long-range correlations are uncovered in the data, and the results from these models are reasonably fitted with those from the ARFIMA (p, d, q) model. (cross-disciplinary physics and related areas of science and technology)

  18. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...

  19. Novel DNA sequence detection method based on fluorescence energy transfer

    International Nuclear Information System (INIS)

    Kobayashi, S.; Tamiya, E.; Karube, I.


    Recently the detection of specific DNA sequence, DNA analysis, has been becoming more important for diagnosis of viral genomes causing infections disease and human sequences related to inherited disorders. These methods typically involve electrophoresis, the immobilization of DNA on a solid support, hybridization to a complementary probe, the detection using labeled with /sup 32/P or nonisotopically with a biotin-avidin-enzyme system, and so on. These techniques are highly effective, but they are very time-consuming and expensive. A principle of fluorescene energy transfer is that the light energy from an excited donor (fluorophore) is transferred to an acceptor (fluorophore), if the acceptor exists in the vicinity of the donor and the excitation spectrum of donor overlaps the emission spectrum of acceptor. In this study, the fluorescence energy transfer was applied to the detection of specific DNA sequence using the hybridization method. The analyte, single-stranded DNA labeled with the donor fluorophore is hybridized to a probe DNA labeled with the acceptor. Because of the complementary DNA duplex formation, two fluorophores became to be closed to each other, and the fluorescence energy transfer was occurred

  20. Management of High-Throughput DNA Sequencing Projects: Alpheus. (United States)

    Miller, Neil A; Kingsmore, Stephen F; Farmer, Andrew; Langley, Raymond J; Mudge, Joann; Crow, John A; Gonzalez, Alvaro J; Schilkey, Faye D; Kim, Ryan J; van Velkinburgh, Jennifer; May, Gregory D; Black, C Forrest; Myers, M Kathy; Utsey, John P; Frost, Nicholas S; Sugarbaker, David J; Bueno, Raphael; Gullans, Stephen R; Baxter, Susan M; Day, Steve W; Retzel, Ernest F


    High-throughput DNA sequencing has enabled systems biology to begin to address areas in health, agricultural and basic biological research. Concomitant with the opportunities is an absolute necessity to manage significant volumes of high-dimensional and inter-related data and analysis. Alpheus is an analysis pipeline, database and visualization software for use with massively parallel DNA sequencing technologies that feature multi-gigabase throughput characterized by relatively short reads, such as Illumina-Solexa (sequencing-by-synthesis), Roche-454 (pyrosequencing) and Applied Biosystem's SOLiD (sequencing-by-ligation). Alpheus enables alignment to reference sequence(s), detection of variants and enumeration of sequence abundance, including expression levels in transcriptome sequence. Alpheus is able to detect several types of variants, including non-synonymous and synonymous single nucleotide polymorphisms (SNPs), insertions/deletions (indels), premature stop codons, and splice isoforms. Variant detection is aided by the ability to filter variant calls based on consistency, expected allele frequency, sequence quality, coverage, and variant type in order to minimize false positives while maximizing the identification of true positives. Alpheus also enables comparisons of genes with variants between cases and controls or bulk segregant pools. Sequence-based differential expression comparisons can be developed, with data export to SAS JMP Genomics for statistical analysis.

  1. DNA-PK dependent targeting of DNA-ends to a protein complex assembled on matrix attachment region DNA sequences

    International Nuclear Information System (INIS)

    Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.


    Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus

  2. DNA data (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  3. PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities

    Directory of Open Access Journals (Sweden)

    Baldwin Stephen A


    Full Text Available Abstract Background Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. Results The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. Conclusions PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from

  4. PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities. (United States)

    Troshin, Peter V; Postis, Vincent Lg; Ashworth, Denise; Baldwin, Stephen A; McPherson, Michael J; Barton, Geoffrey J


    Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS) that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from

  5. Dialects of the DNA uptake sequence in Neisseriaceae.

    Directory of Open Access Journals (Sweden)

    Stephan A Frye


    Full Text Available In all sexual organisms, adaptations exist that secure the safe reassortment of homologous alleles and prevent the intrusion of potentially hazardous alien DNA. Some bacteria engage in a simple form of sex known as transformation. In the human pathogen Neisseria meningitidis and in related bacterial species, transformation by exogenous DNA is regulated by the presence of a specific DNA Uptake Sequence (DUS, which is present in thousands of copies in the respective genomes. DUS affects transformation by limiting DNA uptake and recombination in favour of homologous DNA. The specific mechanisms of DUS-dependent genetic transformation have remained elusive. Bioinformatic analyses of family Neisseriaceae genomes reveal eight distinct variants of DUS. These variants are here termed DUS dialects, and their effect on interspecies commutation is demonstrated. Each of the DUS dialects is remarkably conserved within each species and is distributed consistent with a robust Neisseriaceae phylogeny based on core genome sequences. The impact of individual single nucleotide transversions in DUS on meningococcal transformation and on DNA binding and uptake is analysed. The results show that a DUS core 5'-CTG-3' is required for transformation and that transversions in this core reduce DNA uptake more than two orders of magnitude although the level of DNA binding remains less affected. Distinct DUS dialects are efficient barriers to interspecies recombination in N. meningitidis, N. elongata, Kingella denitrificans, and Eikenella corrodens, despite the presence of the core sequence. The degree of similarity between the DUS dialect of the recipient species and the donor DNA directly correlates with the level of transformation and DNA binding and uptake. Finally, DUS-dependent transformation is documented in the genera Eikenella and Kingella for the first time. The results presented here advance our understanding of the function and evolution of DUS and genetic

  6. Dialects of the DNA Uptake Sequence in Neisseriaceae (United States)

    Frye, Stephan A.; Nilsen, Mariann; Tønjum, Tone; Ambur, Ole Herman


    In all sexual organisms, adaptations exist that secure the safe reassortment of homologous alleles and prevent the intrusion of potentially hazardous alien DNA. Some bacteria engage in a simple form of sex known as transformation. In the human pathogen Neisseria meningitidis and in related bacterial species, transformation by exogenous DNA is regulated by the presence of a specific DNA Uptake Sequence (DUS), which is present in thousands of copies in the respective genomes. DUS affects transformation by limiting DNA uptake and recombination in favour of homologous DNA. The specific mechanisms of DUS–dependent genetic transformation have remained elusive. Bioinformatic analyses of family Neisseriaceae genomes reveal eight distinct variants of DUS. These variants are here termed DUS dialects, and their effect on interspecies commutation is demonstrated. Each of the DUS dialects is remarkably conserved within each species and is distributed consistent with a robust Neisseriaceae phylogeny based on core genome sequences. The impact of individual single nucleotide transversions in DUS on meningococcal transformation and on DNA binding and uptake is analysed. The results show that a DUS core 5′-CTG-3′ is required for transformation and that transversions in this core reduce DNA uptake more than two orders of magnitude although the level of DNA binding remains less affected. Distinct DUS dialects are efficient barriers to interspecies recombination in N. meningitidis, N. elongata, Kingella denitrificans, and Eikenella corrodens, despite the presence of the core sequence. The degree of similarity between the DUS dialect of the recipient species and the donor DNA directly correlates with the level of transformation and DNA binding and uptake. Finally, DUS–dependent transformation is documented in the genera Eikenella and Kingella for the first time. The results presented here advance our understanding of the function and evolution of DUS and genetic transformation

  7. Mitochondrial DNA sequence evolution in the Arctoidea.


    Zhang, Y P; Ryder, O A


    Some taxa in the superfamily Arctoidea, such as the giant panda and the lesser panda, have presented puzzles to taxonomists. In the present study, approximately 397 bases of the cytochrome b gene, 364 bases of the 12S rRNA gene, and 74 bases of the tRNA(Thr) and tRNA(Pro) genes from the giant panda, lesser panda, kinkajou, raccoon, coatimundi, and all species of the Ursidae were sequenced. The high transition/transversion ratios in cytochrome b and RNA genes prior to saturation suggest that t...

  8. Noninvasive prenatal paternity testing (NIPAT) through maternal plasma DNA sequencing

    DEFF Research Database (Denmark)

    Jiang, Haojun; Xie, Yifan; Li, Xuchao


    developed a noninvasive prenatal paternity testing (NIPAT) based on SNP typing with maternal plasma DNA sequencing. We evaluated the influence factors (minor allele frequency (MAF), the number of total SNP, fetal fraction and effective sequencing depth) and designed three different selective SNP panels......Short tandem repeats (STRs) and single nucleotide polymorphisms (SNPs) have been already used to perform noninvasive prenatal paternity testing from maternal plasma DNA. The frequently used technologies were PCR followed by capillary electrophoresis and SNP typing array, respectively. Here, we...... paternity test using STR multiplex system. Our study here proved that the maternal plasma DNA sequencing-based technology is feasible and accurate in determining paternity, which may provide an alternative in forensic application in the future....

  9. Statistical assignment of DNA sequences using Bayesian phylogenetics

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Huelsenbeck, John P.


    We provide a new automated statistical method for DNA barcoding based on a Bayesian phylogenetic analysis. The method is based on automated database sequence retrieval, alignment, and phylogenetic analysis using a custom-built program for Bayesian phylogenetic analysis. We show on real data...... that the method outperforms Blast searches as a measure of confidence and can help eliminate 80% of all false assignment based on best Blast hit. However, the most important advance of the method is that it provides statistically meaningful measures of confidence. We apply the method to a re......-analysis of previously published ancient DNA data and show that, with high statistical confidence, most of the published sequences are in fact of Neanderthal origin. However, there are several cases of chimeric sequences that are comprised of a combination of both Neanderthal and modern human DNA....

  10. Network clustering coefficient approach to DNA sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Gerhardt, Guenther J.L. [Universidade Federal do Rio Grande do Sul-Hospital de Clinicas de Porto Alegre, Rua Ramiro Barcelos 2350/sala 2040/90035-003 Porto Alegre (Brazil); Departamento de Fisica e Quimica da Universidade de Caxias do Sul, Rua Francisco Getulio Vargas 1130, 95001-970 Caxias do Sul (Brazil); Lemke, Ney [Programa Interdisciplinar em Computacao Aplicada, Unisinos, Av. Unisinos, 950, 93022-000 Sao Leopoldo, RS (Brazil); Corso, Gilberto [Departamento de Biofisica e Farmacologia, Centro de Biociencias, Universidade Federal do Rio Grande do Norte, Campus Universitario, 59072 970 Natal, RN (Brazil)]. E-mail:


    In this work we propose an alternative DNA sequence analysis tool based on graph theoretical concepts. The methodology investigates the path topology of an organism genome through a triplet network. In this network, triplets in DNA sequence are vertices and two vertices are connected if they occur juxtaposed on the genome. We characterize this network topology by measuring the clustering coefficient. We test our methodology against two main bias: the guanine-cytosine (GC) content and 3-bp (base pairs) periodicity of DNA sequence. We perform the test constructing random networks with variable GC content and imposed 3-bp periodicity. A test group of some organisms is constructed and we investigate the methodology in the light of the constructed random networks. We conclude that the clustering coefficient is a valuable tool since it gives information that is not trivially contained in 3-bp periodicity neither in the variable GC content.

  11. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting


    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  12. DNA sequence responsible for the amplification of adjacent genes. (United States)

    Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K


    A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

  13. Anaplasma phagocytophilum in Danish sheep: confirmation by DNA sequencing

    Directory of Open Access Journals (Sweden)

    Thamsborg Stig M


    Full Text Available Abstract Background The presence of Anaplasma phagocytophilum, an Ixodes ricinus transmitted bacterium, was investigated in two flocks of Danish grazing lambs. Direct PCR detection was performed on DNA extracted from blood and serum with subsequent confirmation by DNA sequencing. Methods 31 samples obtained from clinically normal lambs in 2000 from Fussingø, Jutland and 12 samples from ten lambs and two ewes from a clinical outbreak at Feddet, Zealand in 2006 were included in the study. Some of the animals from Feddet had shown clinical signs of polyarthritis and general unthriftiness prior to sampling. DNA extraction was optimized from blood and serum and detection achieved by a 16S rRNA targeted PCR with verification of the product by DNA sequencing. Results Five DNA extracts were found positive by PCR, including two samples from 2000 and three from 2006. For both series of samples the product was verified as A. phagocytophilum by DNA sequencing. Conclusions A. phagocytophilum was detected by molecular methods for the first time in Danish grazing lambs during the two seasons investigated (2000 and 2006.

  14. Isolation of a sex-linked DNA sequence in cranes. (United States)

    Duan, W; Fuerst, P A


    A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

  15. DNA Qualification Workflow for Next Generation Sequencing of Histopathological Samples (United States)

    Simbolo, Michele; Gottardi, Marisa; Corbo, Vincenzo; Fassan, Matteo; Mafficini, Andrea; Malpeli, Giorgio; Lawlor, Rita T.; Scarpa, Aldo


    Histopathological samples are a treasure-trove of DNA for clinical research. However, the quality of DNA can vary depending on the source or extraction method applied. Thus a standardized and cost-effective workflow for the qualification of DNA preparations is essential to guarantee interlaboratory reproducible results. The qualification process consists of the quantification of double strand DNA (dsDNA) and the assessment of its suitability for downstream applications, such as high-throughput next-generation sequencing. We tested the two most frequently used instrumentations to define their role in this process: NanoDrop, based on UV spectroscopy, and Qubit 2.0, which uses fluorochromes specifically binding dsDNA. Quantitative PCR (qPCR) was used as the reference technique as it simultaneously assesses DNA concentration and suitability for PCR amplification. We used 17 genomic DNAs from 6 fresh-frozen (FF) tissues, 6 formalin-fixed paraffin-embedded (FFPE) tissues, 3 cell lines, and 2 commercial preparations. Intra- and inter-operator variability was negligible, and intra-methodology variability was minimal, while consistent inter-methodology divergences were observed. In fact, NanoDrop measured DNA concentrations higher than Qubit and its consistency with dsDNA quantification by qPCR was limited to high molecular weight DNA from FF samples and cell lines, where total DNA and dsDNA quantity virtually coincide. In partially degraded DNA from FFPE samples, only Qubit proved highly reproducible and consistent with qPCR measurements. Multiplex PCR amplifying 191 regions of 46 cancer-related genes was designated the downstream application, using 40 ng dsDNA from FFPE samples calculated by Qubit. All but one sample produced amplicon libraries suitable for next-generation sequencing. NanoDrop UV-spectrum verified contamination of the unsuccessful sample. In conclusion, as qPCR has high costs and is labor intensive, an alternative effective standard workflow for

  16. DNA qualification workflow for next generation sequencing of histopathological samples.

    Directory of Open Access Journals (Sweden)

    Michele Simbolo

    Full Text Available Histopathological samples are a treasure-trove of DNA for clinical research. However, the quality of DNA can vary depending on the source or extraction method applied. Thus a standardized and cost-effective workflow for the qualification of DNA preparations is essential to guarantee interlaboratory reproducible results. The qualification process consists of the quantification of double strand DNA (dsDNA and the assessment of its suitability for downstream applications, such as high-throughput next-generation sequencing. We tested the two most frequently used instrumentations to define their role in this process: NanoDrop, based on UV spectroscopy, and Qubit 2.0, which uses fluorochromes specifically binding dsDNA. Quantitative PCR (qPCR was used as the reference technique as it simultaneously assesses DNA concentration and suitability for PCR amplification. We used 17 genomic DNAs from 6 fresh-frozen (FF tissues, 6 formalin-fixed paraffin-embedded (FFPE tissues, 3 cell lines, and 2 commercial preparations. Intra- and inter-operator variability was negligible, and intra-methodology variability was minimal, while consistent inter-methodology divergences were observed. In fact, NanoDrop measured DNA concentrations higher than Qubit and its consistency with dsDNA quantification by qPCR was limited to high molecular weight DNA from FF samples and cell lines, where total DNA and dsDNA quantity virtually coincide. In partially degraded DNA from FFPE samples, only Qubit proved highly reproducible and consistent with qPCR measurements. Multiplex PCR amplifying 191 regions of 46 cancer-related genes was designated the downstream application, using 40 ng dsDNA from FFPE samples calculated by Qubit. All but one sample produced amplicon libraries suitable for next-generation sequencing. NanoDrop UV-spectrum verified contamination of the unsuccessful sample. In conclusion, as qPCR has high costs and is labor intensive, an alternative effective standard

  17. Compilation and analysis of Escherichia coli promoter DNA sequences.


    Hawley, D K; McClure, W R


    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

  18. Polyfluorophore Labels on DNA: Dramatic Sequence Dependence of Quenching (United States)

    Teo, Yin Nah; Wilson, James N.


    We describe studies carried out in the DNA context to test how a common fluorescence quencher, dabcyl, interacts with oligodeoxynu-cleoside fluorophores (ODFs)—a system of stacked, electronically interacting fluorophores built on a DNA scaffold. We tested twenty different tetrameric ODF sequences containing varied combinations and orderings of pyrene (Y), benzopyrene (B), perylene (E), dimethylaminostilbene (D), and spacer (S) monomers conjugated to the 3′ end of a DNA oligomer. Hybridization of this probe sequence to a dabcyl-labeled complementary strand resulted in strong quenching of fluorescence in 85% of the twenty ODF sequences. The high efficiency of quenching was also established by their large Stern–Volmer constants (KSV) of between 2.1 × 104 and 4.3 × 105M−1, measured with a free dabcyl quencher. Interestingly, quenching of ODFs displayed strong sequence dependence. This was particularly evident in anagrams of ODF sequences; for example, the sequence BYDS had a KSV that was approximately two orders of magnitude greater than that of BSDY, which has the same dye composition. Other anagrams, for example EDSY and ESYD, also displayed different responses upon quenching by dabcyl. Analysis of spectra showed that apparent excimer and exciplex emission bands were quenched with much greater efficiency compared to monomer emission bands by at least an order of magnitude. This suggests an important role played by delocalized excited states of the π stack of fluorophores in the amplified quenching of fluorescence. PMID:19780115

  19. Detecting differential DNA methylation from sequencing of bisulfite converted DNA of diverse species. (United States)

    Huh, Iksoo; Wu, Xin; Park, Taesung; Yi, Soojin V


    DNA methylation is one of the most extensively studied epigenetic modifications of genomic DNA. In recent years, sequencing of bisulfite-converted DNA, particularly via next-generation sequencing technologies, has become a widely popular method to study DNA methylation. This method can be readily applied to a variety of species, dramatically expanding the scope of DNA methylation studies beyond the traditionally studied human and mouse systems. In parallel to the increasing wealth of genomic methylation profiles, many statistical tools have been developed to detect differentially methylated loci (DMLs) or differentially methylated regions (DMRs) between biological conditions. We discuss and summarize several key properties of currently available tools to detect DMLs and DMRs from sequencing of bisulfite-converted DNA. However, the majority of the statistical tools developed for DML/DMR analyses have been validated using only mammalian data sets, and less priority has been placed on the analyses of invertebrate or plant DNA methylation data. We demonstrate that genomic methylation profiles of non-mammalian species are often highly distinct from those of mammalian species using examples of honey bees and humans. We then discuss how such differences in data properties may affect statistical analyses. Based on these differences, we provide three specific recommendations to improve the power and accuracy of DML and DMR analyses of invertebrate data when using currently available statistical tools. These considerations should facilitate systematic and robust analyses of DNA methylation from diverse species, thus advancing our understanding of DNA methylation. © The Author 2017. Published by Oxford University Press.

  20. The cDNA sequence of a neutral horseradish peroxidase. (United States)

    Bartonek-Roxå, E; Eriksson, H; Mattiasson, B


    A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

  1. RNA-DNA sequence differences spell genetic code ambiguities

    DEFF Research Database (Denmark)

    Bentin, Thomas; Nielsen, Michael L


    A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

  2. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  3. DNA sequence and prokaryotic expression analysis of vitellogenin ...

    African Journals Online (AJOL)

    In this study, the DNA sequence of vitellogenin from Antheraea pernyi (Ap-Vg) was identified and its functional domain (30-740 aa, Ap-Vg-1) was expressed in Escherichia coli BL21 (DE3) cells. The recombinant Ap-Vg-1 proteins were purified and used for antibody preparation. The results showed that the intact DNA ...

  4. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  5. High Performance Systolic Array Core Architecture Design for DNA Sequencer

    Directory of Open Access Journals (Sweden)

    Saiful Nurdin Dayana


    Full Text Available This paper presents a high performance systolic array (SA core architecture design for Deoxyribonucleic Acid (DNA sequencer. The core implements the affine gap penalty score Smith-Waterman (SW algorithm. This time-consuming local alignment algorithm guarantees optimal alignment between DNA sequences, but it requires quadratic computation time when performed on standard desktop computers. The use of linear SA decreases the time complexity from quadratic to linear. In addition, with the exponential growth of DNA databases, the SA architecture is used to overcome the timing issue. In this work, the SW algorithm has been captured using Verilog Hardware Description Language (HDL and simulated using Xilinx ISIM simulator. The proposed design has been implemented in Xilinx Virtex -6 Field Programmable Gate Array (FPGA and improved in the core area by 90% reduction.

  6. Sequence heterogeneity accelerates protein search for targets on DNA

    International Nuclear Information System (INIS)

    Shvets, Alexey A.; Kolomeisky, Anatoly B.


    The process of protein search for specific binding sites on DNA is fundamentally important since it marks the beginning of all major biological processes. We present a theoretical investigation that probes the role of DNA sequence symmetry, heterogeneity, and chemical composition in the protein search dynamics. Using a discrete-state stochastic approach with a first-passage events analysis, which takes into account the most relevant physical-chemical processes, a full analytical description of the search dynamics is obtained. It is found that, contrary to existing views, the protein search is generally faster on DNA with more heterogeneous sequences. In addition, the search dynamics might be affected by the chemical composition near the target site. The physical origins of these phenomena are discussed. Our results suggest that biological processes might be effectively regulated by modifying chemical composition, symmetry, and heterogeneity of a genome

  7. Sequence heterogeneity accelerates protein search for targets on DNA

    Energy Technology Data Exchange (ETDEWEB)

    Shvets, Alexey A.; Kolomeisky, Anatoly B., E-mail: [Department of Chemistry and Center for Theoretical Biological Physics, Rice University, Houston, Texas 77005 (United States)


    The process of protein search for specific binding sites on DNA is fundamentally important since it marks the beginning of all major biological processes. We present a theoretical investigation that probes the role of DNA sequence symmetry, heterogeneity, and chemical composition in the protein search dynamics. Using a discrete-state stochastic approach with a first-passage events analysis, which takes into account the most relevant physical-chemical processes, a full analytical description of the search dynamics is obtained. It is found that, contrary to existing views, the protein search is generally faster on DNA with more heterogeneous sequences. In addition, the search dynamics might be affected by the chemical composition near the target site. The physical origins of these phenomena are discussed. Our results suggest that biological processes might be effectively regulated by modifying chemical composition, symmetry, and heterogeneity of a genome.

  8. DNA watermarks in non-coding regulatory sequences

    Directory of Open Access Journals (Sweden)

    Pyka Martin


    Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.

  9. Draft Genome Sequence of Bacillus sp. FMQ74, a Dairy-contaminating Isolate from Raw Milk

    DEFF Research Database (Denmark)

    Okshevsky, Mira Ursula; Regina, Viduthalai R.; Marshall, Ian


    Representatives of the genus Bacillus are common milk contaminants that cause spoilage and flavor alterations of dairy products. Bacillus sp. FMQ74 was isolated from raw milk on a Danish dairy farm. To elucidate the genomic basis of this strain’s survival in the dairy industry, a high-quality draft...

  10. VoSeq: a voucher and DNA sequence web application.

    Directory of Open Access Journals (Sweden)

    Carlos Peña

    Full Text Available There is an ever growing number of molecular phylogenetic studies published, due to, in part, the advent of new techniques that allow cheap and quick DNA sequencing. Hence, the demand for relational databases with which to manage and annotate the amassing DNA sequences, genes, voucher specimens and associated biological data is increasing. In addition, a user-friendly interface is necessary for easy integration and management of the data stored in the database back-end. Available databases allow management of a wide variety of biological data. However, most database systems are not specifically constructed with the aim of being an organizational tool for researchers working in phylogenetic inference. We here report a new software facilitating easy management of voucher and sequence data, consisting of a relational database as back-end for a graphic user interface accessed via a web browser. The application, VoSeq, includes tools for creating molecular datasets of DNA or amino acid sequences ready to be used in commonly used phylogenetic software such as RAxML, TNT, MrBayes and PAUP, as well as for creating tables ready for publishing. It also has inbuilt BLAST capabilities against all DNA sequences stored in VoSeq as well as sequences in NCBI GenBank. By using mash-ups and calls to web services, VoSeq allows easy integration with public services such as Yahoo! Maps, Flickr, Encyclopedia of Life (EOL and GBIF (by generating data-dumps that can be processed with GBIF's Integrated Publishing Toolkit.

  11. Next generation sequencing of DNA-launched Chikungunya vaccine virus

    Energy Technology Data Exchange (ETDEWEB)

    Hidajat, Rachmat; Nickols, Brian [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Forrester, Naomi [Institute for Human Infections and Immunity, Sealy Center for Vaccine Development and Department of Pathology, University of Texas Medical Branch, GNL, 301 University Blvd., Galveston, TX 77555 (United States); Tretyakova, Irina [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Weaver, Scott [Institute for Human Infections and Immunity, Sealy Center for Vaccine Development and Department of Pathology, University of Texas Medical Branch, GNL, 301 University Blvd., Galveston, TX 77555 (United States); Pushko, Peter, E-mail: [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States)


    Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3′ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. - Highlights: • Chikungunya virus (CHIKV) is an emerging pandemic threat. • In vivo DNA-launched attenuated CHIKV is a novel vaccine technology. • DNA-launched virus was sequenced using HiSeq2000 and compared to the 181/25 virus. • DNA-launched virus has lower frequency of SNPs at E2-12 and E2-82 attenuation loci.

  12. Next generation sequencing of DNA-launched Chikungunya vaccine virus

    International Nuclear Information System (INIS)

    Hidajat, Rachmat; Nickols, Brian; Forrester, Naomi; Tretyakova, Irina; Weaver, Scott; Pushko, Peter


    Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3′ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. - Highlights: • Chikungunya virus (CHIKV) is an emerging pandemic threat. • In vivo DNA-launched attenuated CHIKV is a novel vaccine technology. • DNA-launched virus was sequenced using HiSeq2000 and compared to the 181/25 virus. • DNA-launched virus has lower frequency of SNPs at E2-12 and E2-82 attenuation loci.

  13. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides. (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C


    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  14. High-Throughput DNA sequencing of ancient wood. (United States)

    Wagner, Stefanie; Lagane, Frédéric; Seguin-Orlando, Andaine; Schubert, Mikkel; Leroy, Thibault; Guichoux, Erwan; Chancerel, Emilie; Bech-Hebelstrup, Inger; Bernard, Vincent; Billard, Cyrille; Billaud, Yves; Bolliger, Matthias; Croutsch, Christophe; Čufar, Katarina; Eynaud, Frédérique; Heussner, Karl Uwe; Köninger, Joachim; Langenegger, Fabien; Leroy, Frédéric; Lima, Christine; Martinelli, Nicoletta; Momber, Garry; Billamboz, André; Nelle, Oliver; Palomo, Antoni; Piqué, Raquel; Ramstein, Marianne; Schweichel, Roswitha; Stäuble, Harald; Tegel, Willy; Terradas, Xavier; Verdin, Florence; Plomion, Christophe; Kremer, Antoine; Orlando, Ludovic


    Reconstructing the colonization and demographic dynamics that gave rise to extant forests is essential to forecasts of forest responses to environmental changes. Classical approaches to map how population of trees changed through space and time largely rely on pollen distribution patterns, with only a limited number of studies exploiting DNA molecules preserved in wooden tree archaeological and subfossil remains. Here, we advance such analyses by applying high-throughput (HTS) DNA sequencing to wood archaeological and subfossil material for the first time, using a comprehensive sample of 167 European white oak waterlogged remains spanning a large temporal (from 550 to 9,800 years) and geographical range across Europe. The successful characterization of the endogenous DNA and exogenous microbial DNA of 140 (~83%) samples helped the identification of environmental conditions favouring long-term DNA preservation in wood remains, and started to unveil the first trends in the DNA decay process in wood material. Additionally, the maternally inherited chloroplast haplotypes of 21 samples from three periods of forest human-induced use (Neolithic, Bronze Age and Middle Ages) were found to be consistent with those of modern populations growing in the same geographic areas. Our work paves the way for further studies aiming at using ancient DNA preserved in wood to reconstruct the micro-evolutionary response of trees to climate change and human forest management. © 2018 John Wiley & Sons Ltd.

  15. Low-Bandwidth and Non-Compute Intensive Remote Identification of Microbes from Raw Sequencing Reads

    DEFF Research Database (Denmark)

    Gautier, Laurent; Lund, Ole


    , allowing a fully automated processing of sequencing data and routine instant quality check of sequencing runs from desktop sequencers. A web access is available at The source code for a python command-line client, a server, and supplementary data are available at

  16. Micropatterning stretched and aligned DNA for sequence-specific nanolithography (United States)

    Petit, Cecilia Anna Paulette

    Techniques for fabricating nanostructured materials can be categorized as either "top-down" or "bottom-up". Top-down techniques use lithography and contact printing to create patterned surfaces and microfluidic channels that can corral and organize nanoscale structures, such as molecules and nanorods in contrast; bottom-up techniques use self-assembly or molecular recognition to direct the organization of materials. A central goal in nanotechnology is the integration of bottom-up and top-down assembly strategies for materials development, device design; and process integration. With this goal in mind, we have developed strategies that will allow this integration by using DNA as a template for nanofabrication; two top-down approaches allow the placement of these templates, while the bottom-up technique uses the specific sequence of bases to pattern materials along each strand of DNA. Our first top-down approach, termed combing of molecules in microchannels (COMMIC), produces microscopic patterns of stretched and aligned molecules of DNA on surfaces. This process consists of passing an air-water interface over end adsorbed molecules inside microfabricated channels. The geometry of the microchannel directs the placement of the DNA molecules, while the geometry of the airwater interface directs the local orientation and curvature of the molecules. We developed another top-down strategy for creating micropatterns of stretched and aligned DNA using surface chemistry. Because DNA stretching occurs on hydrophobic surfaces, this technique uses photolithography to pattern vinyl-terminated silanes on glass When these surface-, are immersed in DNA solution, molecules adhere preferentially to the silanized areas. This approach has also proven useful in patterning protein for cell adhesion studies. Finally, we describe the use of these stretched and aligned molecules of DNA as templates for the subsequent bottom-up construction of hetero-structures through hybridization

  17. The influence of DNA sequence on epigenome-induced pathologies

    Directory of Open Access Journals (Sweden)

    Meagher Richard B


    Full Text Available Abstract Clear cause-and-effect relationships are commonly established between genotype and the inherited risk of acquiring human and plant diseases and aberrant phenotypes. By contrast, few such cause-and-effect relationships are established linking a chromatin structure (that is, the epitype with the transgenerational risk of acquiring a disease or abnormal phenotype. It is not entirely clear how epitypes are inherited from parent to offspring as populations evolve, even though epigenetics is proposed to be fundamental to evolution and the likelihood of acquiring many diseases. This article explores the hypothesis that, for transgenerationally inherited chromatin structures, “genotype predisposes epitype”, and that epitype functions as a modifier of gene expression within the classical central dogma of molecular biology. Evidence for the causal contribution of genotype to inherited epitypes and epigenetic risk comes primarily from two different kinds of studies discussed herein. The first and direct method of research proceeds by the examination of the transgenerational inheritance of epitype and the penetrance of phenotype among genetically related individuals. The second approach identifies epitypes that are duplicated (as DNA sequences are duplicated and evolutionarily conserved among repeated patterns in the DNA sequence. The body of this article summarizes particularly robust examples of these studies from humans, mice, Arabidopsis, and other organisms. The bulk of the data from both areas of research support the hypothesis that genotypes predispose the likelihood of displaying various epitypes, but for only a few classes of epitype. This analysis suggests that renewed efforts are needed in identifying polymorphic DNA sequences that determine variable nucleosome positioning and DNA methylation as the primary cause of inherited epigenome-induced pathologies. By contrast, there is very little evidence that DNA sequence directly

  18. Characterization of the indigenous microflora in raw and pasteurized buffalo milk during storage at refrigeration temperature by high-throughput sequencing (United States)

    The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High quality samples of raw buffalo milk were obtained from five dairy farms in the Guangxi province of China. A sample of each milk was pasteurized, and both r...

  19. Pericentric satellite DNA sequences in Pipistrellus pipistrellus (Vespertilionidae; Chiroptera). (United States)

    Barragán, M J L; Martínez, S; Marchal, J A; Fernández, R; Bullejos, M; Díaz de la Guardia, R; Sánchez, A


    This paper reports the molecular and cytogenetic characterization of a HindIII family of satellite DNA in the bat species Pipistrellus pipistrellus. This satellite is organized in tandem repeats of 418 bp monomer units, and represents approximately 3% of the whole genome. The consensus sequence from five cloned monomer units has an A-T content of 62.20%. We have found differences in the ladder pattern of bands between two populations of the same species. These differences are probably because of the absence of the target sites for the HindIII enzyme in most monomer units of one population, but not in the other. Fluorescent in situ hybridization (FISH) localized the satellite DNA in the pericentromeric regions of all autosomes and the X chromosome, but it was absent from the Y chromosome. Digestion of genomic DNAs with HpaII and its isoschizomer MspI demonstrated that these repetitive DNA sequences are not methylated. Other bat species were tested for the presence of this repetitive DNA. It was absent in five Vespertilionidae and one Rhinolophidae species, indicating that it could be a species/genus specific, repetitive DNA family.

  20. Early Lyme disease with spirochetemia - diagnosed by DNA sequencing

    Directory of Open Access Journals (Sweden)

    Jones William


    Full Text Available Abstract Background A sensitive and analytically specific nucleic acid amplification test (NAAT is valuable in confirming the diagnosis of early Lyme disease at the stage of spirochetemia. Findings Venous blood drawn from patients with clinical presentations of Lyme disease was tested for the standard 2-tier screen and Western Blot serology assay for Lyme disease, and also by a nested polymerase chain reaction (PCR for B. burgdorferi sensu lato 16S ribosomal DNA. The PCR amplicon was sequenced for B. burgdorferi genomic DNA validation. A total of 130 patients visiting emergency room (ER or Walk-in clinic (WALKIN, and 333 patients referred through the private physicians' offices were studied. While 5.4% of the ER/WALKIN patients showed DNA evidence of spirochetemia, none (0% of the patients referred from private physicians' offices were DNA-positive. In contrast, while 8.4% of the patients referred from private physicians' offices were positive for the 2-tier Lyme serology assay, only 1.5% of the ER/WALKIN patients were positive for this antibody test. The 2-tier serology assay missed 85.7% of the cases of early Lyme disease with spirochetemia. The latter diagnosis was confirmed by DNA sequencing. Conclusion Nested PCR followed by automated DNA sequencing is a valuable supplement to the standard 2-tier antibody assay in the diagnosis of early Lyme disease with spirochetemia. The best time to test for Lyme spirochetemia is when the patients living in the Lyme disease endemic areas develop unexplained symptoms or clinical manifestations that are consistent with Lyme disease early in the course of their illness.

  1. Spectral sum rules and search for periodicities in DNA sequences

    International Nuclear Information System (INIS)

    Chechetkin, V.R.


    Periodic patterns play the important regulatory and structural roles in genomic DNA sequences. Commonly, the underlying periodicities should be understood in a broad statistical sense, since the corresponding periodic patterns have been strongly distorted by the random point mutations and insertions/deletions during molecular evolution. The latent periodicities in DNA sequences can be efficiently displayed by Fourier transform. The criteria of significance for observed periodicities are obtained via the comparison versus the counterpart characteristics of the reference random sequences. We show that the restrictions imposed on the significance criteria by the rigorous spectral sum rules can be rationally described with De Finetti distribution. This distribution provides the convenient intermediate asymptotic form between Rayleigh distribution and exact combinatoric theory. - Highlights: → We study the significance criteria for latent periodicities in DNA sequences. → The constraints imposed by sum rules can be described with De Finetti distribution. → It is intermediate between Rayleigh distribution and exact combinatoric theory. → Theory is applicable to the study of correlations between different periodicities. → The approach can be generalized to the arbitrary discrete Fourier transform.

  2. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe


    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  3. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  4. cDNA sequences of two apolipoproteins from lamprey

    International Nuclear Information System (INIS)

    Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.


    The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point

  5. Biased distribution of DNA uptake sequences towards genome maintenance genes

    DEFF Research Database (Denmark)

    Davidsen, T.; Rodland, E.A.; Lagesen, K.


    Repeated sequence signatures are characteristic features of all genomic DNA. We have made a rigorous search for repeat genomic sequences in the human pathogens Neisseria meningitidis, Neisseria gonorrhoeae and Haemophilus influenzae and found that by far the most frequent 9-10mers residing within...... in these organisms. Pasteurella multocida also displayed high frequencies of a putative DUS identical to that previously identified in H. influenzae and with a skewed distribution towards genome maintenance genes, indicating that this bacterium might be transformation competent under certain conditions....

  6. Development of a defined-sequence DNA system for use in DNA misrepair studies

    International Nuclear Information System (INIS)

    Sutton, S.; Tobias, C.A.


    The authors have developed a system that allows them to study cellular DNA repair processes at the molecular level. In particular, the authors are using this system to examine the consequences of a misrepair of radiation-induced DNA damage, as a function of dose. The cells being used are specially engineered haploid yeast cells. Maintained in the cells, at one copy per cell, is a cen plasmid, a plasmid that behaves like a functional chromosome. This plasmid carries a small defined sequence of DNA from the E. coli lac z gene. It is this lac z region (called the alpha region) that serves as the target for radiation damage. Two copies of the complimentary portion of the lac z gene are integrated into the yeast genome. Irradiated cells are screened for possible mutation in the alpha region by testing the cells' ability to hydrolyze xgal, a lactose substrate. The DNA of interest is then extracted from the cells, sequenced, and the sequence is compared to that of the control. Unlike the usual defined-sequence DNA systems, theirs is an in vivo system. A disadvantage is the relatively high background mutation rate. Results achieved with this system, as well as future applications, are discussed

  7. Rapid DNA sequencing by horizontal ultrathin gel electrophoresis.


    Brumley, R L; Smith, L M


    A horizontal polyacrylamide gel electrophoresis apparatus has been developed that decreases the time required to separate the DNA fragments produced in enzymatic sequencing reactions. The configuration of this apparatus and the use of circulating coolant directly under the glass plates result in heat exchange that is approximately nine times more efficient than passive thermal transfer methods commonly used. Bubble-free gels as thin as 25 microns can be routinely cast on this device. The appl...

  8. Is photocleavage of DNA by YOYO-1 using a synchrotron radiation light source sequence dependent?

    DEFF Research Database (Denmark)

    Gilroy, Emma L.; Hoffmann, Søren Vrønning; Jones, Nykola C.


    ) throughout the irradiation period. The dependence of LD signals on DNA sequences and on time in the intense light beam was explored and quantified for single-stranded poly(dA), poly[(dA-dT)2], calf thymus DNA (ctDNA) and Micrococcus luteus DNA (mlDNA). The DNA and ligand regions of the spectrum showed...

  9. Comparison of DNA Quantification Methods for Next Generation Sequencing. (United States)

    Robin, Jérôme D; Ludlow, Andrew T; LaRanger, Ryan; Wright, Woodring E; Shay, Jerry W


    Next Generation Sequencing (NGS) is a powerful tool that depends on loading a precise amount of DNA onto a flowcell. NGS strategies have expanded our ability to investigate genomic phenomena by referencing mutations in cancer and diseases through large-scale genotyping, developing methods to map rare chromatin interactions (4C; 5C and Hi-C) and identifying chromatin features associated with regulatory elements (ChIP-seq, Bis-Seq, ChiA-PET). While many methods are available for DNA library quantification, there is no unambiguous gold standard. Most techniques use PCR to amplify DNA libraries to obtain sufficient quantities for optical density measurement. However, increased PCR cycles can distort the library's heterogeneity and prevent the detection of rare variants. In this analysis, we compared new digital PCR technologies (droplet digital PCR; ddPCR, ddPCR-Tail) with standard methods for the titration of NGS libraries. DdPCR-Tail is comparable to qPCR and fluorometry (QuBit) and allows sensitive quantification by analysis of barcode repartition after sequencing of multiplexed samples. This study provides a direct comparison between quantification methods throughout a complete sequencing experiment and provides the impetus to use ddPCR-based quantification for improvement of NGS quality.

  10. Application of synthetic DNA probes to the analysis of DNA sequence variants in man

    International Nuclear Information System (INIS)

    Wallace, R.B.; Petz, L.D.; Yam, P.Y.


    Oligonucleotide probes provide a tool to discriminate between any two alleles on the basis of hybridization. Random sampling of the genome with different oligonucleotide probes should reveal polymorphism in a certain percentage of the cases. In the hope of identifying polymorphic regions more efficiently, we chose to take advantage of the proposed hypermutability of repeated DNA sequences and the specificity of oligonucleotide hybridization. Since, under appropriate conditions, oligonucleotide probes require complete base pairing for hybridization to occur, they will only hybridize to a subset of the members of a repeat family when all members of the family are not identical. The results presented here suggest that oligonucleotide hybridization can be used to extend the genomic sequences that can be tested for the presence of RFLPs. This expands the tools available to human genetics. In addition, the results suggest that repeated DNA sequences are indeed more polymorphic than single-copy sequences. 28 references, 2 figures

  11. Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus. (United States)

    Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N


    The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic DNA methylation between sperm and oocyte DNA. The methylation levels of the minor satellite sequences did not change during spermiogenesis, and were not associated with the onset of meiosis or a specific stage in sperm development.

  12. Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence. (United States)

    André, P; Kim, A; Khrapko, K; Thilly, W G


    The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.

  13. A sequence-dependent rigid-base model of DNA (United States)

    Gonzalez, O.; Petkevičiutė, D.; Maddocks, J. H.


    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

  14. A sequence-dependent rigid-base model of DNA. (United States)

    Gonzalez, O; Petkevičiūtė, D; Maddocks, J H


    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

  15. Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus.


    Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N


    The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic...

  16. Chimeric TALE recombinases with programmable DNA sequence specificity. (United States)

    Mercer, Andrew C; Gaj, Thomas; Fuller, Roberta P; Barbas, Carlos F


    Site-specific recombinases are powerful tools for genome engineering. Hyperactivated variants of the resolvase/invertase family of serine recombinases function without accessory factors, and thus can be re-targeted to sequences of interest by replacing native DNA-binding domains (DBDs) with engineered zinc-finger proteins (ZFPs). However, imperfect modularity with particular domains, lack of high-affinity binding to all DNA triplets, and difficulty in construction has hindered the widespread adoption of ZFPs in unspecialized laboratories. The discovery of a novel type of DBD in transcription activator-like effector (TALE) proteins from Xanthomonas provides an alternative to ZFPs. Here we describe chimeric TALE recombinases (TALERs): engineered fusions between a hyperactivated catalytic domain from the DNA invertase Gin and an optimized TALE architecture. We use a library of incrementally truncated TALE variants to identify TALER fusions that modify DNA with efficiency and specificity comparable to zinc-finger recombinases in bacterial cells. We also show that TALERs recombine DNA in mammalian cells. The TALER architecture described herein provides a platform for insertion of customized TALE domains, thus significantly expanding the targeting capacity of engineered recombinases and their potential applications in biotechnology and medicine.

  17. Structural properties of replication origins in yeast DNA sequences

    International Nuclear Information System (INIS)

    Cao Xiaoqin; Zeng Jia; Yan Hong


    Sequence-dependent DNA flexibility is an important structural property originating from the DNA 3D structure. In this paper, we investigate the DNA flexibility of the budding yeast (S. Cerevisiae) replication origins on a genome-wide scale using flexibility parameters from two different models, the trinucleotide and the tetranucleotide models. Based on analyzing average flexibility profiles of 270 replication origins, we find that yeast replication origins are significantly rigid compared with their surrounding genomic regions. To further understand the highly distinctive property of replication origins, we compare the flexibility patterns between yeast replication origins and promoters, and find that they both contain significantly rigid DNAs. Our results suggest that DNA flexibility is an important factor that helps proteins recognize and bind the target sites in order to initiate DNA replication. Inspired by the role of the rigid region in promoters, we speculate that the rigid replication origins may facilitate binding of proteins, including the origin recognition complex (ORC), Cdc6, Cdt1 and the MCM2-7 complex

  18. Mixed Sequence Reader: A Program for Analyzing DNA Sequences with Heterozygous Base Calling (United States)

    Chang, Chun-Tien; Tsai, Chi-Neu; Tang, Chuan Yi; Chen, Chun-Houh; Lian, Jang-Hau; Hu, Chi-Yu; Tsai, Chia-Lung; Chao, Angel; Lai, Chyong-Huey; Wang, Tzu-Hao; Lee, Yun-Shien


    The direct sequencing of PCR products generates heterozygous base-calling fluorescence chromatograms that are useful for identifying single-nucleotide polymorphisms (SNPs), insertion-deletions (indels), short tandem repeats (STRs), and paralogous genes. Indels and STRs can be easily detected using the currently available Indelligent or ShiftDetector programs, which do not search reference sequences. However, the detection of other genomic variants remains a challenge due to the lack of appropriate tools for heterozygous base-calling fluorescence chromatogram data analysis. In this study, we developed a free web-based program, Mixed Sequence Reader (MSR), which can directly analyze heterozygous base-calling fluorescence chromatogram data in .abi file format using comparisons with reference sequences. The heterozygous sequences are identified as two distinct sequences and aligned with reference sequences. Our results showed that MSR may be used to (i) physically locate indel and STR sequences and determine STR copy number by searching NCBI reference sequences; (ii) predict combinations of microsatellite patterns using the Federal Bureau of Investigation Combined DNA Index System (CODIS); (iii) determine human papilloma virus (HPV) genotypes by searching current viral databases in cases of double infections; (iv) estimate the copy number of paralogous genes, such as β-defensin 4 (DEFB4) and its paralog HSPDP3. PMID:22778697

  19. Phylogeny of the Serrasalmidae (Characiformes based on mitochondrial DNA sequences

    Directory of Open Access Journals (Sweden)

    Guillermo Ortí


    Full Text Available Previous studies based on DNA sequences of mitochondrial (mt rRNA genes showed three main groups within the subfamily Serrasalminae: (1 a "pacu" clade of herbivores (Colossoma, Mylossoma, Piaractus; (2 the "Myleus" clade (Myleus, Mylesinus, Tometes, Ossubtus; and (3 the "piranha" clade (Serrasalmus, Pygocentrus, Pygopristis, Pristobrycon, Catoprion, Metynnis. The genus Acnodon was placed as the sister taxon of clade (2+3. However, poor resolution within each clade was obtained due to low levels of variation among rRNA gene sequences. Complete sequences of the hypervariable mtDNA control region for a total of 45 taxa, and additional sequences of 12S and 16S rRNA from a total of 74 taxa representing all genera in the family are now presented to address intragroup relationships. Control region sequences of several serrasalmid species exhibit tandem repeats of short motifs (12 to 33 bp in the 3' end of this region, accounting for substantial length variation. Bayesian inference and maximum parsimony analyses of these sequences identify the same groupings as before and provide further evidence to support the following observations: (a Serrasalmus gouldingi and species of Pristobrycon (non-striolatus form a monophyletic group that is the sister group to other species of Serrasalmus and Pygocentrus; (b Catoprion, Pygopristis, and Pristobrycon striolatus form a well supported clade, sister to the group described above; (c some taxa assigned to the genus Myloplus (M. asterias, M tiete, M ternetzi, and M rubripinnis form a well supported group whereas other Myloplus species remain with uncertain affinities (d Mylesinus, Tometes and Myleus setiger form a monophyletic group.

  20. Haematobia irritans dataset of raw sequence reads from Illumina-based transcriptome sequencing of specific tissues and life stages (United States)

    Illumina HiSeq technology was used to sequence the transcriptome from various dissected tissues and life stages from the horn fly, Haematobia irritans. These samples include eggs (0, 2, 4, and 9 hours post-oviposition), adult fly gut, adult fly legs, adult fly malpighian tubule, adult fly ovary, adu...

  1. Bacterial DNA Sequence Compression Models Using Artificial Neural Networks

    Directory of Open Access Journals (Sweden)

    Armando J. Pinho


    Full Text Available It is widely accepted that the advances in DNA sequencing techniques have contributed to an unprecedented growth of genomic data. This fact has increased the interest in DNA compression, not only from the information theory and biology points of view, but also from a practical perspective, since such sequences require storage resources. Several compression methods exist, and particularly, those using finite-context models (FCMs have received increasing attention, as they have been proven to effectively compress DNA sequences with low bits-per-base, as well as low encoding/decoding time-per-base. However, the amount of run-time memory required to store high-order finite-context models may become impractical, since a context-order as low as 16 requires a maximum of 17.2 x 109 memory entries. This paper presents a method to reduce such a memory requirement by using a novel application of artificial neural networks (ANN to build such probabilistic models in a compact way and shows how to use them to estimate the probabilities. Such a system was implemented, and its performance compared against state-of-the art compressors, such as XM-DNA (expert model and FCM-Mx (mixture of finite-context models , as well as with general-purpose compressors. Using a combination of order-10 FCM and ANN, similar encoding results to those of FCM, up to order-16, are obtained using only 17 megabytes of memory, whereas the latter, even employing hash-tables, uses several hundreds of megabytes.

  2. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

    Directory of Open Access Journals (Sweden)

    Adam D. Hargreaves


    Full Text Available Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete and Sanger-based ESTs (15/29. We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  3. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing. (United States)

    Hargreaves, Adam D; Mulley, John F


    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  4. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA (United States)

    Dimitrov, Valentin V.


    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  5. Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing

    Directory of Open Access Journals (Sweden)

    Zdepski Anna


    Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.

  6. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  7. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  8. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  9. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  10. PISMA: A Visual Representation of Motif Distribution in DNA Sequences

    Directory of Open Access Journals (Sweden)

    Rogelio Alcántara-Silva


    Full Text Available Background: Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code–like, as a gene-map–like, and as a transcript scheme. Results: We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. Availability and Implementation: PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at and .

  11. DNA Sequencing as a Tool to Monitor Marine Ecological Status

    Directory of Open Access Journals (Sweden)

    Kelly D. Goodwin


    Full Text Available Many ocean policies mandate integrated, ecosystem-based approaches to marine monitoring, driving a global need for efficient, low-cost bioindicators of marine ecological quality. Most traditional methods to assess biological quality rely on specialized expertise to provide visual identification of a limited set of specific taxonomic groups, a time-consuming process that can provide a narrow view of ecological status. In addition, microbial assemblages drive food webs but are not amenable to visual inspection and thus are largely excluded from detailed inventory. Molecular-based assessments of biodiversity and ecosystem function offer advantages over traditional methods and are increasingly being generated for a suite of taxa using a “microbes to mammals” or “barcodes to biomes” approach. Progress in these efforts coupled with continued improvements in high-throughput sequencing and bioinformatics pave the way for sequence data to be employed in formal integrated ecosystem evaluation, including food web assessments, as called for in the European Union Marine Strategy Framework Directive. DNA sequencing of bioindicators, both traditional (e.g., benthic macroinvertebrates, ichthyoplankton and emerging (e.g., microbial assemblages, fish via eDNA, promises to improve assessment of marine biological quality by increasing the breadth, depth, and throughput of information and by reducing costs and reliance on specialized taxonomic expertise.

  12. Authentication of ruta graveolens and its adulterant using internal transcribed spacer (its) sequences of nuclear ribosomal DNA

    International Nuclear Information System (INIS)

    Qurainy, F.A.; Khan, S.; Ali, M.A.; Hemaid, M.A.; Ashraf, M.


    Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)

  13. Food safety in raw milk production: risk factors associated to bacterial DNA contamination. (United States)

    Cerva, Cristine; Bremm, Carolina; Reis, Emily Marques dos; Bezerra, André Vinícius Andrade; Loiko, Márcia Regina; Cruz, Cláudio Estêvão Farias da; Cenci, Alexander; Mayer, Fabiana Quoos


    While human illness from milkborne pathogens may be linked to contamination of the product after pasteurization or improper pasteurization, such diseases are usually associated with consumption of raw milk or its by-products. Molecular biology tools were applied to investigate contamination by Listeria monocytogenes, Salmonella spp., some pathogenic strains of Escherichia coli, and Campylobacter jejuni in 548 raw milk samples from 125 dairy farms established in two regions from southern Brazil. Moreover, 15 variables were evaluated for their association with raw milk contamination levels, and the risk factors were determined by multiple regression analysis. Salmonella spp. were more frequently detected, followed by pathogenic E. coli. There was difference in contamination index between the regions, in which risk factors such as temporary cattle confinement, low milk production, low milking machine cleaning frequency, and milk storage area without tile walls were identified. The risk factors were specific to each region studied. Nevertheless, the data can be used to improve milk quality of dairy farms/herds with similar management practices.

  14. A MapReduce Framework for DNA Sequencing Data Processing

    Directory of Open Access Journals (Sweden)

    Samy Ghoneimy


    Full Text Available Genomics and Next Generation Sequencers (NGS like Illumina Hiseq produce data in the order of ‎‎200 billion base pairs in a single one-week run for a 60x human genome coverage, which ‎requires modern high-throughput experimental technologies that can ‎only be tackled with high performance computing (HPC and specialized software algorithms called ‎‎“short read aligners”. This paper focuses on the implementation of the DNA sequencing as a set of MapReduce programs that will accept a DNA data set as a FASTQ file and finally generate a VCF (variant call format file, which has variants for a given DNA data set. In this paper MapReduce/Hadoop along with Burrows-Wheeler Aligner (BWA, Sequence Alignment/Map (SAM ‎tools, are fully utilized to provide various utilities for manipulating alignments, including sorting, merging, indexing, ‎and generating alignments. The Map-Sort-Reduce process is designed to be suited for a Hadoop framework in ‎which each cluster is a traditional N-node Hadoop cluster to utilize all of the Hadoop features like HDFS, program ‎management and fault tolerance. The Map step performs multiple instances of the short read alignment algorithm ‎‎(BoWTie that run in parallel in Hadoop. The ordered list of the sequence reads are used as input tuples and the ‎output tuples are the alignments of the short reads. In the Reduce step many parallel instances of the Short ‎Oligonucleotide Analysis Package for SNP (SOAPsnp algorithm run in the cluster. Input tuples are sorted ‎alignments for a partition and the output tuples are SNP calls. Results are stored via HDFS, and then archived in ‎SOAPsnp format. ‎ The proposed framework enables extremely fast discovering somatic mutations, inferring population genetical ‎parameters, and performing association tests directly based on sequencing data without explicit genotyping or ‎linkage-based imputation. It also demonstrate that this method achieves comparable

  15. Retroviral DNA Sequences as a Means for Determining Ancient Diets.

    Directory of Open Access Journals (Sweden)

    Jessica I Rivera-Perez

    Full Text Available For ages, specialists from varying fields have studied the diets of the primeval inhabitants of our planet, detecting diet remains in archaeological specimens using a range of morphological and biochemical methods. As of recent, metagenomic ancient DNA studies have allowed for the comparison of the fecal and gut microbiomes associated to archaeological specimens from various regions of the world; however the complex dynamics represented in those microbial communities still remain unclear. Theoretically, similar to eukaryote DNA the presence of genes from key microbes or enzymes, as well as the presence of DNA from viruses specific to key organisms, may suggest the ingestion of specific diet components. In this study we demonstrate that ancient virus DNA obtained from coprolites also provides information reconstructing the host's diet, as inferred from sequences obtained from pre-Columbian coprolites. This depicts a novel and reliable approach to determine new components as well as validate the previously suggested diets of extinct cultures and animals. Furthermore, to our knowledge this represents the first description of the eukaryotic viral diversity found in paleofaeces belonging to pre-Columbian cultures.

  16. Mitochondrial DNA sequencing of cat hair: an informative forensic tool. (United States)

    Tarditi, Christy R; Grahn, Robert A; Evans, Jeffrey J; Kurushima, Jennifer D; Lyons, Leslie A


    Approximately 81.7 million cats are in 37.5 million U.S. households. Shed fur can be criminal evidence because of transfer to victims, suspects, and/or their belongings. To improve cat hairs as forensic evidence, the mtDNA control region from single hairs, with and without root tags, was sequenced. A dataset of a 402-bp control region segment from 174 random-bred cats representing four U.S. geographic areas was generated to determine the informativeness of the mtDNA region. Thirty-two mtDNA mitotypes were observed ranging in frequencies from 0.6-27%. Four common types occurred in all populations. Low heteroplasmy, 1.7%, was determined. Unique mitotypes were found in 18 individuals, 10.3% of the population studied. The calculated discrimination power implied that 8.3 of 10 randomly selected individuals can be excluded by this region. The genetic characteristics of the region and the generated dataset support the use of this cat mtDNA region in forensic applications. 2010 American Academy of Forensic Sciences. Published 2010. This article is a U.S. Government work and is in the public domain in the U.S.A.

  17. Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks (United States)

    Belotserkovskii, Boris P.; Neil, Alexander J.; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M.; Hanawalt, Philip C.


    The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation. PMID:23275544

  18. Automated methods for single-stranded DNA isolation and dideoxynucleotide DNA sequencing reactions on a robotic workstation

    International Nuclear Information System (INIS)

    Mardis, E.R.; Roe, B.A.


    Automated procedures have been developed for both the simultaneous isolation of 96 single-stranded M13 chimeric template DNAs in less than two hours, and for simultaneously pipetting 24 dideoxynucleotide sequencing reactions on a commercially available laboratory workstation. The DNA sequencing results obtained by either radiolabeled or fluorescent methods are consistent with the premise that automation of these portions of DNA sequencing projects will improve the reproducibility of the DNA isolation and the procedures for these normally labor-intensive steps provides an approach for rapid acquisition of large amounts of high quality, reproducible DNA sequence data

  19. Roche genome sequencer FLX based high-throughput sequencing of ancient DNA

    DEFF Research Database (Denmark)

    Alquezar-Planas, David E; Fordyce, Sarah Louise


    Since the development of so-called "next generation" high-throughput sequencing in 2005, this technology has been applied to a variety of fields. Such applications include disease studies, evolutionary investigations, and ancient DNA. Each application requires a specialized protocol to ensure...... that the data produced is optimal. Although much of the procedure can be followed directly from the manufacturer's protocols, the key differences lie in the library preparation steps. This chapter presents an optimized protocol for the sequencing of fossil remains and museum specimens, commonly referred...

  20. DNA interaction with platinum-based cytostatics revealed by DNA sequencing. (United States)

    Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech


    The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. New scoring schema for finding motifs in DNA Sequences

    Directory of Open Access Journals (Sweden)

    Nowzari-Dalini Abbas


    Full Text Available Abstract Background Pattern discovery in DNA sequences is one of the most fundamental problems in molecular biology with important applications in finding regulatory signals and transcription factor binding sites. An important task in this problem is to search (or predict known binding sites in a new DNA sequence. For this reason, all subsequences of the given DNA sequence are scored based on an scoring function and the prediction is done by selecting the best score. By assuming no dependency between binding site base positions, most of the available tools for known binding site prediction are designed. Recently Tomovic and Oakeley investigated the statistical basis for either a claim of dependence or independence, to determine whether such a claim is generally true, and they presented a scoring function for binding site prediction based on the dependency between binding site base positions. Our primary objective is to investigate the scoring functions which can be used in known binding site prediction based on the assumption of dependency or independency in binding site base positions. Results We propose a new scoring function based on the dependency between all positions in biding site base positions. This scoring function uses joint information content and mutual information as a measure of dependency between positions in transcription factor binding site. Our method for modeling dependencies is simply an extension of position independency methods. We evaluate our new scoring function on the real data sets extracted from JASPAR and TRANSFAC data bases, and compare the obtained results with two other well known scoring functions. Conclusion The results demonstrate that the new approach improves known binding site discovery and show that the joint information content and mutual information provide a better and more general criterion to investigate the relationships between positions in the TFBS. Our scoring function is formulated by simple

  2. Hypervariable minisatellite DNA sequences in the Indian peafowl Pavo cristatus. (United States)

    Hanotte, O; Burke, T; Armour, J A; Jeffreys, A J


    We report here for the first time the large-scale isolation of hypervariable minisatellite DNA sequences from a non-human species, the Indian peafowl (Pavo cristatus). A size-selected genomic DNA fraction, rich in hypervariable minisatellites, was cloned into Charomid 9-36. This library was screened using two multilocus hypervariable probes, 33.6 and 33.15 and also, in a "probe-walking" approach, with five of the peafowl minisatellites initially isolated. Forty-eight positively hybridizing clones were characterized and found to originate from 30 different loci, 18 of which were polymorphic. Five of these variable minisatellite loci were studied further. They all showed Mendelian inheritance. The heterozygosities of these loci were relatively low (range 22-78%) in comparison with those of previously cloned human loci, as expected in view of inbreeding in our semicaptive study population. No new length allele mutations were observed in families and the mean mutation rate per locus is low (less than 0.004, 95% confidence maximum). These loci were also investigated by cross-species hybridization in related taxa. The ability of the probes to detect hypervariable sequences in other species within the same avian family was found to vary, from those probes that are species-specific to those that are apparently general to the family. We also illustrate the potential usefulness of these probes for paternity analysis in a study of sexual selection, and discuss the general application of specific hypervariable probes in behavioral and evolutionary studies.

  3. A pneumatic device for rapid loading of DNA sequencing gels. (United States)

    Panussis, D A; Cook, M W; Rifkin, L L; Snider, J E; Strong, J T; McGrane, R M; Wilson, R K; Mardis, E R


    This work describes the design and construction of a device that facilitates the loading of DNA samples onto polyacrylamide gels for detection in the Perkin Elmer/Applied Biosystems (PE/ABI) 373 and 377 DNA sequencing instruments. The device is mounted onto the existing gel cassettes and makes the process of loading high-density gels less cumbersome while the associated time and errors are reduced. The principle of operation includes the simultaneous transfer of the entire batch of samples, in which a spring-loaded air cylinder generates positive pressure and flexible silica capillaries transfer the samples. A retractable capillary array carrier allows the delivery ends of the capillaries to be held up clear of the gel during loader attachment on the gel plates, while enabling their insertion in the gel wells once the device is securely mounted. Gel-loading devices capable of simultaneously transferring 72 samples onto the PE/ABI 373 and 377 are currently being used in our production sequencing groups while a 96-sample transfer prototype undergoes testing.

  4. Phylogenomics of Phrynosomatid Lizards: Conflicting Signals from Sequence Capture versus Restriction Site Associated DNA Sequencing (United States)

    Leaché, Adam D.; Chavez, Andreas S.; Jones, Leonard N.; Grummer, Jared A.; Gottscho, Andrew D.; Linkem, Charles W.


    Sequence capture and restriction site associated DNA sequencing (RADseq) are popular methods for obtaining large numbers of loci for phylogenetic analysis. These methods are typically used to collect data at different evolutionary timescales; sequence capture is primarily used for obtaining conserved loci, whereas RADseq is designed for discovering single nucleotide polymorphisms (SNPs) suitable for population genetic or phylogeographic analyses. Phylogenetic questions that span both “recent” and “deep” timescales could benefit from either type of data, but studies that directly compare the two approaches are lacking. We compared phylogenies estimated from sequence capture and double digest RADseq (ddRADseq) data for North American phrynosomatid lizards, a species-rich and diverse group containing nine genera that began diversifying approximately 55 Ma. Sequence capture resulted in 584 loci that provided a consistent and strong phylogeny using concatenation and species tree inference. However, the phylogeny estimated from the ddRADseq data was sensitive to the bioinformatics steps used for determining homology, detecting paralogs, and filtering missing data. The topological conflicts among the SNP trees were not restricted to any particular timescale, but instead were associated with short internal branches. Species tree analysis of the largest SNP assembly, which also included the most missing data, supported a topology that matched the sequence capture tree. This preferred phylogeny provides strong support for the paraphyly of the earless lizard genera Holbrookia and Cophosaurus, suggesting that the earless morphology either evolved twice or evolved once and was subsequently lost in Callisaurus. PMID:25663487

  5. DNA hybridization kinetics: zippering, internal displacement and sequence dependence. (United States)

    Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A


    Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.

  6. An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library

    Directory of Open Access Journals (Sweden)

    Wallis James G


    Full Text Available Abstract Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12 gene that is responsible for ricinoleate biosynthesis. The role(s of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2 gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at

  7. A Novel Computational Method for Detecting DNA Methylation Sites with DNA Sequence Information and Physicochemical Properties. (United States)

    Pan, Gaofeng; Jiang, Limin; Tang, Jijun; Guo, Fei


    DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods-especially machine learning methods-have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k -gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria-area under the receiver operating characteristic curve (AUC), Matthew's correlation coefficient (MCC), accuracy (ACC), sensitivity (SN), and specificity-are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from:

  8. A Novel Computational Method for Detecting DNA Methylation Sites with DNA Sequence Information and Physicochemical Properties

    Directory of Open Access Journals (Sweden)

    Gaofeng Pan


    Full Text Available DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods—especially machine learning methods—have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k-gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria—area under the receiver operating characteristic curve (AUC, Matthew’s correlation coefficient (MCC, accuracy (ACC, sensitivity (SN, and specificity—are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from:

  9. Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

  10. Anti-DNA antibodies: Sequencing, cloning, and expression

    Energy Technology Data Exchange (ETDEWEB)

    Barry, M.M.


    To gain some insight into the mechanism of systemic lupus erythematosus, and the interactions involved in proteins binding to DNA four anti-DNA antibodies have been investigated. Two of the antibodies, Hed 10 and Jel 242, have previously been prepared from female NZB/NZW mice which develop an autoimmune disease resembling human SLE. The remaining two antibodies, Jel 72 and Jel 318, have previously been produced via immunization of C57BL/6 mice. The isotypes of the four antibodies investigated in this thesis were determined by an enzyme-linked-immunosorbent assay. All four antibodies contained [kappa] light chains and [gamma]2a heavy chains except Jel 318 which contains a [gamma]2b heavy chain. The complete variable regions of the heavy and light chains of these four antibodies were sequenced from their respective mRNAs. The gene segments and variable gene families expressed in each antibody were identified. Analysis of the genes used in the autoimmune anti-DNA antibodies and those produced by immunization indicated no obvious differences to account for their different origins. Examination of the amino acid residues present in the complementary-determining regions of these four antibodies indicates a preference for aromatic amino acids. Jel 72 and Jel 242 contain three arginine residues in the third complementary-determining region. A single-chain Fv and the variable region of the heavy chain of Hed 10 were expressed in Escherichia coli. Expression resulted in the production of a 26,000 M[sub r] protein and a 15,000 M[sub r] protein. An immunoblot indicated that the 26,000 M[sub r] protein was the Fv for Hed 10, while the 15,000 M[sub r] protein was shown to bind poly (dT). The contribution of the heavy chain to DNA binding was assessed.

  11. Comparative d2/d3 LSU–rDNA sequence study of some Iranian ...

    African Journals Online (AJOL)



    Nov 5, 2007 ... segments yielded one fragment at over all sequenced isolates as 787 bp in size. The DNA sequences were aligned .... expansion segments of the 28S rDNA subunit (D2/D3. LSU-rDNA) are the ... isolated from different geographical location from tea shrubs infested roots of Guilan province, Iran (Table 1).

  12. Sequence specificity and biological consequences of drugs that bind covalently in the minor groove of DNA

    International Nuclear Information System (INIS)

    Hurley, L.H.; Needham-VanDevanter, D.R.


    DNA ligands which bind within the minor groove of DNA exhibit varying degrees of sequence selectivity. Factors which contribute to nucleotide sequence recognition by minor groove ligands have been extensively investigated. Electrostatic interactions, ligand and DNA dehydration energies, hydrophobic interactions and steric factors all play significant roles in sequence selectivity in the minor groove. Interestingly, ligand recognition of nucleotide sequence in the minor groove does not involve significant hydrogen bonding. This is in sharp contrast to cellular enzyme and protein recognition of nucleotide sequence, which is achieved in the major groove via specific hydrogen bond formation between individual bases and the ligand. The ability to read nucleotide sequence via hydrogen bonding allows precise binding of proteins to specific DNA sequences. Minor groove ligands examined to date exhibit a much lower sequence specificity, generally binding to a subset of possible sequences, rather than a single sequence. 19 refs., 7 figs

  13. Quantification of meat proportions by measuring DNA contents in raw and boiled sausages using matrix-adapted calibrators and multiplex real-time PCR. (United States)

    Köppel, René; Eugster, Albert; Ruf, Jürg; Rentsch, Jürg


    The quantification of meat proportions in raw and boiled sausage according to the recipe was evaluated using three different calibrators. To measure the DNA contents from beef, pork, sheep (mutton), and horse, a tetraplex real-time PCR method was applied. Nineteen laboratories analyzed four meat products each made of different proportions of beef, pork, sheep, and horse meat. Three kinds of calibrators were used: raw and boiled sausages of known proportions ranging from 1 to 55% of meat, and a dilution series of DNA from muscle tissue. In general, results generated using calibration sausages were more accurate than those resulting from the use of DNA from muscle tissue, and exhibited smaller measurement uncertainties. Although differences between uses of raw and boiled calibration sausages were small, the most precise and accurate results were obtained by calibration with fine-textured boiled reference sausages.

  14. The DNA sequence of the human X chromosome (United States)

    Ross, Mark T.; Grafham, Darren V.; Coffey, Alison J.; Scherer, Steven; McLay, Kirsten; Muzny, Donna; Platzer, Matthias; Howell, Gareth R.; Burrows, Christine; Bird, Christine P.; Frankish, Adam; Lovell, Frances L.; Howe, Kevin L.; Ashurst, Jennifer L.; Fulton, Robert S.; Sudbrak, Ralf; Wen, Gaiping; Jones, Matthew C.; Hurles, Matthew E.; Andrews, T. Daniel; Scott, Carol E.; Searle, Stephen; Ramser, Juliane; Whittaker, Adam; Deadman, Rebecca; Carter, Nigel P.; Hunt, Sarah E.; Chen, Rui; Cree, Andrew; Gunaratne, Preethi; Havlak, Paul; Hodgson, Anne; Metzker, Michael L.; Richards, Stephen; Scott, Graham; Steffen, David; Sodergren, Erica; Wheeler, David A.; Worley, Kim C.; Ainscough, Rachael; Ambrose, Kerrie D.; Ansari-Lari, M. Ali; Aradhya, Swaroop; Ashwell, Robert I. S.; Babbage, Anne K.; Bagguley, Claire L.; Ballabio, Andrea; Banerjee, Ruby; Barker, Gary E.; Barlow, Karen F.; Barrett, Ian P.; Bates, Karen N.; Beare, David M.; Beasley, Helen; Beasley, Oliver; Beck, Alfred; Bethel, Graeme; Blechschmidt, Karin; Brady, Nicola; Bray-Allen, Sarah; Bridgeman, Anne M.; Brown, Andrew J.; Brown, Mary J.; Bonnin, David; Bruford, Elspeth A.; Buhay, Christian; Burch, Paula; Burford, Deborah; Burgess, Joanne; Burrill, Wayne; Burton, John; Bye, Jackie M.; Carder, Carol; Carrel, Laura; Chako, Joseph; Chapman, Joanne C.; Chavez, Dean; Chen, Ellson; Chen, Guan; Chen, Yuan; Chen, Zhijian; Chinault, Craig; Ciccodicola, Alfredo; Clark, Sue Y.; Clarke, Graham; Clee, Chris M.; Clegg, Sheila; Clerc-Blankenburg, Kerstin; Clifford, Karen; Cobley, Vicky; Cole, Charlotte G.; Conquer, Jen S.; Corby, Nicole; Connor, Richard E.; David, Robert; Davies, Joy; Davis, Clay; Davis, John; Delgado, Oliver; DeShazo, Denise; Dhami, Pawandeep; Ding, Yan; Dinh, Huyen; Dodsworth, Steve; Draper, Heather; Dugan-Rocha, Shannon; Dunham, Andrew; Dunn, Matthew; Durbin, K. James; Dutta, Ireena; Eades, Tamsin; Ellwood, Matthew; Emery-Cohen, Alexandra; Errington, Helen; Evans, Kathryn L.; Faulkner, Louisa; Francis, Fiona; Frankland, John; Fraser, Audrey E.; Galgoczy, Petra; Gilbert, James; Gill, Rachel; Glöckner, Gernot; Gregory, Simon G.; Gribble, Susan; Griffiths, Coline; Grocock, Russell; Gu, Yanghong; Gwilliam, Rhian; Hamilton, Cerissa; Hart, Elizabeth A.; Hawes, Alicia; Heath, Paul D.; Heitmann, Katja; Hennig, Steffen; Hernandez, Judith; Hinzmann, Bernd; Ho, Sarah; Hoffs, Michael; Howden, Phillip J.; Huckle, Elizabeth J.; Hume, Jennifer; Hunt, Paul J.; Hunt, Adrienne R.; Isherwood, Judith; Jacob, Leni; Johnson, David; Jones, Sally; de Jong, Pieter J.; Joseph, Shirin S.; Keenan, Stephen; Kelly, Susan; Kershaw, Joanne K.; Khan, Ziad; Kioschis, Petra; Klages, Sven; Knights, Andrew J.; Kosiura, Anna; Kovar-Smith, Christie; Laird, Gavin K.; Langford, Cordelia; Lawlor, Stephanie; Leversha, Margaret; Lewis, Lora; Liu, Wen; Lloyd, Christine; Lloyd, David M.; Loulseged, Hermela; Loveland, Jane E.; Lovell, Jamieson D.; Lozado, Ryan; Lu, Jing; Lyne, Rachael; Ma, Jie; Maheshwari, Manjula; Matthews, Lucy H.; McDowall, Jennifer; McLaren, Stuart; McMurray, Amanda; Meidl, Patrick; Meitinger, Thomas; Milne, Sarah; Miner, George; Mistry, Shailesh L.; Morgan, Margaret; Morris, Sidney; Müller, Ines; Mullikin, James C.; Nguyen, Ngoc; Nordsiek, Gabriele; Nyakatura, Gerald; O’Dell, Christopher N.; Okwuonu, Geoffery; Palmer, Sophie; Pandian, Richard; Parker, David; Parrish, Julia; Pasternak, Shiran; Patel, Dina; Pearce, Alex V.; Pearson, Danita M.; Pelan, Sarah E.; Perez, Lesette; Porter, Keith M.; Ramsey, Yvonne; Reichwald, Kathrin; Rhodes, Susan; Ridler, Kerry A.; Schlessinger, David; Schueler, Mary G.; Sehra, Harminder K.; Shaw-Smith, Charles; Shen, Hua; Sheridan, Elizabeth M.; Shownkeen, Ratna; Skuce, Carl D.; Smith, Michelle L.; Sotheran, Elizabeth C.; Steingruber, Helen E.; Steward, Charles A.; Storey, Roy; Swann, R. Mark; Swarbreck, David; Tabor, Paul E.; Taudien, Stefan; Taylor, Tineace; Teague, Brian; Thomas, Karen; Thorpe, Andrea; Timms, Kirsten; Tracey, Alan; Trevanion, Steve; Tromans, Anthony C.; d’Urso, Michele; Verduzco, Daniel; Villasana, Donna; Waldron, Lenee; Wall, Melanie; Wang, Qiaoyan; Warren, James; Warry, Georgina L.; Wei, Xuehong; West, Anthony; Whitehead, Siobhan L.; Whiteley, Mathew N.; Wilkinson, Jane E.; Willey, David L.; Williams, Gabrielle; Williams, Leanne; Williamson, Angela; Williamson, Helen; Wilming, Laurens; Woodmansey, Rebecca L.; Wray, Paul W.; Yen, Jennifer; Zhang, Jingkun; Zhou, Jianling; Zoghbi, Huda; Zorilla, Sara; Buck, David; Reinhardt, Richard; Poustka, Annemarie; Rosenthal, André; Lehrach, Hans; Meindl, Alfons; Minx, Patrick J.; Hillier, LaDeana W.; Willard, Huntington F.; Wilson, Richard K.; Waterston, Robert H.; Rice, Catherine M.; Vaudin, Mark; Coulson, Alan; Nelson, David L.; Weinstock, George; Sulston, John E.; Durbin, Richard; Hubbard, Tim; Gibbs, Richard A.; Beck, Stephan; Rogers, Jane; Bentley, David R.


    The human X chromosome has a unique biology that was shaped by its evolution as the sex chromosome shared by males and females. We have determined 99.3% of the euchromatic sequence of the X chromosome. Our analysis illustrates the autosomal origin of the mammalian sex chromosomes, the stepwise process that led to the progressive loss of recombination between X and Y, and the extent of subsequent degradation of the Y chromosome. LINE1 repeat elements cover one-third of the X chromosome, with a distribution that is consistent with their proposed role as way stations in the process of X-chromosome inactivation. We found 1,098 genes in the sequence, of which 99 encode proteins expressed in testis and in various tumour types. A disproportionately high number of mendelian diseases are documented for the X chromosome. Of this number, 168 have been explained by mutations in 113 X-linked genes, which in many cases were characterized with the aid of the DNA sequence. PMID:15772651

  15. Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human. (United States)

    Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai


    DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation.

  16. An Efficient Approach to Mining Maximal Contiguous Frequent Patterns from Large DNA Sequence Databases

    Directory of Open Access Journals (Sweden)

    Md. Rezaul Karim


    Full Text Available Mining interesting patterns from DNA sequences is one of the most challenging tasks in bioinformatics and computational biology. Maximal contiguous frequent patterns are preferable for expressing the function and structure of DNA sequences and hence can capture the common data characteristics among related sequences. Biologists are interested in finding frequent orderly arrangements of motifs that are responsible for similar expression of a group of genes. In order to reduce mining time and complexity, however, most existing sequence mining algorithms either focus on finding short DNA sequences or require explicit specification of sequence lengths in advance. The challenge is to find longer sequences without specifying sequence lengths in advance. In this paper, we propose an efficient approach to mining maximal contiguous frequent patterns from large DNA sequence datasets. The experimental results show that our proposed approach is memory-efficient and mines maximal contiguous frequent patterns within a reasonable time.

  17. Beyond DNA Sequencing in Space: Current and Future Omics Capabilities of the Biomolecule Sequencer Payload (United States)

    Wallace, Sarah


    Why do we need a DNA sequencer to support the human exploration of space? (A) Operational environmental monitoring; (1) Identification of contaminating microbes, (2) Infectious disease diagnosis, (3) Reduce down mass (sample return for environmental monitoring, crew health, etc.). (B) Research; (1) Human, (2) Animal, (3) Microbes/Cell lines, (4) Plant. (C) Med Ops; (1) Response to countermeasures, (2) Radiation, (3) Real-time analysis can influence medical intervention. (C) Support astrobiology science investigations; (1) Technology superiorly suited to in situ nucleic acid-based life detection, (2) Functional testing for integration into robotics for extraplanetary exploration mission.

  18. Biomolecule Sequencer: Next-Generation DNA Sequencing Technology for In-Flight Environmental Monitoring, Research, and Beyond (United States)

    Smith, David J.; Burton, Aaron; Castro-Wallace, Sarah; John, Kristen; Stahl, Sarah E.; Dworkin, Jason Peter; Lupisella, Mark L.


    On the International Space Station (ISS), technologies capable of rapid microbial identification and disease diagnostics are not currently available. NASA still relies upon sample return for comprehensive, molecular-based sample characterization. Next-generation DNA sequencing is a powerful approach for identifying microorganisms in air, water, and surfaces onboard spacecraft. The Biomolecule Sequencer payload, manifested to SpaceX-9 and scheduled on the Increment 4748 research plan (June 2016), will assess the functionality of a commercially-available next-generation DNA sequencer in the microgravity environment of ISS. The MinION device from Oxford Nanopore Technologies (Oxford, UK) measures picoamp changes in electrical current dependent on nucleotide sequences of the DNA strand migrating through nanopores in the system. The hardware is exceptionally small (9.5 x 3.2 x 1.6 cm), lightweight (120 grams), and powered only by a USB connection. For the ISS technology demonstration, the Biomolecule Sequencer will be powered by a Microsoft Surface Pro3. Ground-prepared samples containing lambda bacteriophage, Escherichia coli, and mouse genomic DNA, will be launched and stored frozen on the ISS until experiment initiation. Immediately prior to sequencing, a crew member will collect and thaw frozen DNA samples, connect the sequencer to the Surface Pro3, inject thawed samples into a MinION flow cell, and initiate sequencing. At the completion of the sequencing run, data will be downlinked for ground analysis. Identical, synchronous ground controls will be used for data comparisons to determine sequencer functionality, run-time sequence, current dynamics, and overall accuracy. We will present our latest results from the ISS flight experiment the first time DNA has ever been sequenced in space and discuss the many potential applications of the Biomolecule Sequencer for environmental monitoring, medical diagnostics, higher fidelity and more adaptable Space Biology Human

  19. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo; Zhu, Bin; Hamdan, Samir; Richardson, Charles C.


    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical

  20. Assessing the fidelity of ancient DNA sequences amplified from nuclear genes

    DEFF Research Database (Denmark)

    Binladen, Jonas; Wiuf, Carsten Henrik; Gilbert, M. Thomas P.


    To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved...... in phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from...... adenine), respectively. Type 2 transitions are by far the most dominant and increase relative to those of type 1 with damage load. The results suggest that the deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine) is the main cause of miscoding lesions in both ancient mtDNA and nu...

  1. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE


    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  2. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC


    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  3. Analysis of Litopenaeus vannamei transcriptome using the next-generation DNA sequencing technique.

    Directory of Open Access Journals (Sweden)

    Chaozheng Li

    Full Text Available BACKGROUND: Pacific white shrimp (Litopenaeus vannamei, the major species of farmed shrimps in the world, has been attracting extensive studies, which require more and more genome background knowledge. The now available transcriptome data of L. vannamei are insufficient for research requirements, and have not been adequately assembled and annotated. METHODOLOGY/PRINCIPAL FINDINGS: This is the first study that used a next-generation high-throughput DNA sequencing technique, the Solexa/Illumina GA II method, to analyze the transcriptome from whole bodies of L. vannamei larvae. More than 2.4 Gb of raw data were generated, and 109,169 unigenes with a mean length of 396 bp were assembled using the SOAP denovo software. 73,505 unigenes (>200 bp with good quality sequences were selected and subjected to annotation analysis, among which 37.80% can be matched in NCBI Nr database, 37.3% matched in Swissprot, and 44.1% matched in TrEMBL. Using BLAST and BLAST2Go softwares, 11,153 unigenes were classified into 25 Clusters of Orthologous Groups of proteins (COG categories, 8171 unigenes were assigned into 51 Gene ontology (GO functional groups, and 18,154 unigenes were divided into 220 Kyoto Encyclopedia of Genes and Genomes (KEGG pathways. To primarily verify part of the results of assembly and annotations, 12 assembled unigenes that are homologous to many embryo development-related genes were chosen and subjected to RT-PCR for electrophoresis and Sanger sequencing analyses, and to real-time PCR for expression profile analyses during embryo development. CONCLUSIONS/SIGNIFICANCE: The L. vannamei transcriptome analyzed using the next-generation sequencing technique enriches the information of L. vannamei genes, which will facilitate our understanding of the genome background of crustaceans, and promote the studies on L. vannamei.

  4. Sequence Capture versus Restriction Site Associated DNA Sequencing for Shallow Systematics. (United States)

    Harvey, Michael G; Smith, Brian Tilston; Glenn, Travis C; Faircloth, Brant C; Brumfield, Robb T


    Sequence capture and restriction site associated DNA sequencing (RAD-Seq) are two genomic enrichment strategies for applying next-generation sequencing technologies to systematics studies. At shallow timescales, such as within species, RAD-Seq has been widely adopted among researchers, although there has been little discussion of the potential limitations and benefits of RAD-Seq and sequence capture. We discuss a series of issues that may impact the utility of sequence capture and RAD-Seq data for shallow systematics in non-model species. We review prior studies that used both methods, and investigate differences between the methods by re-analyzing existing RAD-Seq and sequence capture data sets from a Neotropical bird (Xenops minutus). We suggest that the strengths of RAD-Seq data sets for shallow systematics are the wide dispersion of markers across the genome, the relative ease and cost of laboratory work, the deep coverage and read overlap at recovered loci, and the high overall information that results. Sequence capture's benefits include flexibility and repeatability in the genomic regions targeted, success using low-quality samples, more straightforward read orthology assessment, and higher per-locus information content. The utility of a method in systematics, however, rests not only on its performance within a study, but on the comparability of data sets and inferences with those of prior work. In RAD-Seq data sets, comparability is compromised by low overlap of orthologous markers across species and the sensitivity of genetic diversity in a data set to an interaction between the level of natural heterozygosity in the samples examined and the parameters used for orthology assessment. In contrast, sequence capture of conserved genomic regions permits interrogation of the same loci across divergent species, which is preferable for maintaining comparability among data sets and studies for the purpose of drawing general conclusions about the impact of

  5. repDNA: a Python package to generate various modes of feature vectors for DNA sequences by incorporating user-defined physicochemical properties and sequence-order effects. (United States)

    Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen


    In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at or Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  6. [Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform]. (United States)

    Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y


    To analyze and detect the whole genome sequence of human mitochondrial DNA (mtDNA) by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

  7. De novo assembly and annotation of the Asian tiger mosquito (Aedes albopictus) repeatome with dnaPipeTE from raw genomic reads and comparative analysis with the yellow fever mosquito (Aedes aegypti). (United States)

    Goubert, Clément; Modolo, Laurent; Vieira, Cristina; ValienteMoro, Claire; Mavingui, Patrick; Boulesteix, Matthieu


    Repetitive DNA, including transposable elements (TEs), is found throughout eukaryotic genomes. Annotating and assembling the "repeatome" during genome-wide analysis often poses a challenge. To address this problem, we present dnaPipeTE-a new bioinformatics pipeline that uses a sample of raw genomic reads. It produces precise estimates of repeated DNA content and TE consensus sequences, as well as the relative ages of TE families. We shows that dnaPipeTE performs well using very low coverage sequencing in different genomes, losing accuracy only with old TE families. We applied this pipeline to the genome of the Asian tiger mosquito Aedes albopictus, an invasive species of human health interest, for which the genome size is estimated to be over 1 Gbp. Using dnaPipeTE, we showed that this species harbors a large (50% of the genome) and potentially active repeatome with an overall TE class and order composition similar to that of Aedes aegypti, the yellow fever mosquito. However, intraorder dynamics show clear distinctions between the two species, with differences at the TE family level. Our pipeline's ability to manage the repeatome annotation problem will make it helpful for new or ongoing assembly projects, and our results will benefit future genomic studies of A. albopictus. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. RevTrans: multiple alignment of coding DNA from aligned amino acid sequences

    DEFF Research Database (Denmark)

    Wernersson, Rasmus; Pedersen, Anders Gorm


    The simple fact that proteins are built from 20 amino acids while DNA only contains four different bases, means that the 'signal-to-noise ratio' in protein sequence alignments is much better than in alignments of DNA. Besides this information-theoretical advantage, protein alignments also benefit...... proteins. It is therefore preferable to align coding DNA at the amino acid level and it is for this purpose we have constructed the program RevTrans. RevTrans constructs a multiple DNA alignment by: (i) translating the DNA; (ii) aligning the resulting peptide sequences; and (iii) building a multiple DNA...

  9. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific. (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E


    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  10. OPTSDNA: Performance evaluation of an efficient distributed bioinformatics system for DNA sequence analysis. (United States)

    Khan, Mohammad Ibrahim; Sheel, Chotan


    Storage of sequence data is a big concern as the amount of data generated is exponential in nature at several locations. Therefore, there is a need to develop techniques to store data using compression algorithm. Here we describe optimal storage algorithm (OPTSDNA) for storing large amount of DNA sequences of varying length. This paper provides performance analysis of optimal storage algorithm (OPTSDNA) of a distributed bioinformatics computing system for analysis of DNA sequences. OPTSDNA algorithm is used for storing various sizes of DNA sequences into database. DNA sequences of different lengths were stored by using this algorithm. These input DNA sequences are varied in size from very small to very large. Storage size is calculated by this algorithm. Response time is also calculated in this work. The efficiency and performance of the algorithm is high (in size calculation with percentage) when compared with other known with sequential approach.

  11. Sequencing of megabase plus DNA by hybridization: Method development ENT. Final technical progress report

    Energy Technology Data Exchange (ETDEWEB)

    Crkvenjakov, R.; Drmanac, R.


    Sequencing by hybridization (SBH) is the only sequencing method based on the experimental determination of the content of oligonucleotide sequences. The data acquisition relies on the natural process of base pairing. It is possible to determine the content of complementary oligosequences in the target DNA by the process of hybridization with oligonucleotide probes of known sequences.

  12. Microsatellite DNA in genomic survey sequences and UniGenes of loblolly pine (United States)

    Craig S Echt; Surya Saha; Dennis L Deemer; C Dana Nelson


    Genomic DNA sequence databases are a potential and growing resource for simple sequence repeat (SSR) marker development in loblolly pine (Pinus taeda L.). Loblolly pine also has many expressed sequence tags (ESTs) available for microsatellite (SSR) marker development. We compared loblolly pine SSR densities in genome survey sequences (GSSs) to those in non-redundant...

  13. A 28,000 Years Old Cro-Magnon mtDNA Sequence Differs from All Potentially Contaminating Modern Sequences (United States)

    Caramelli, David; Milani, Lucio; Vai, Stefania; Modi, Alessandra; Pecchioli, Elena; Girardi, Matteo; Pilli, Elena; Lari, Martina; Lippi, Barbara; Ronchitelli, Annamaria; Mallegni, Francesco; Casoli, Antonella; Bertorelle, Giorgio; Barbujani, Guido


    Background DNA sequences from ancient speciments may in fact result from undetected contamination of the ancient specimens by modern DNA, and the problem is particularly challenging in studies of human fossils. Doubts on the authenticity of the available sequences have so far hampered genetic comparisons between anatomically archaic (Neandertal) and early modern (Cro-Magnoid) Europeans. Methodology/Principal Findings We typed the mitochondrial DNA (mtDNA) hypervariable region I in a 28,000 years old Cro-Magnoid individual from the Paglicci cave, in Italy (Paglicci 23) and in all the people who had contact with the sample since its discovery in 2003. The Paglicci 23 sequence, determined through the analysis of 152 clones, is the Cambridge reference sequence, and cannot possibly reflect contamination because it differs from all potentially contaminating modern sequences. Conclusions/Significance: The Paglicci 23 individual carried a mtDNA sequence that is still common in Europe, and which radically differs from those of the almost contemporary Neandertals, demonstrating a genealogical continuity across 28,000 years, from Cro-Magnoid to modern Europeans. Because all potential sources of modern DNA contamination are known, the Paglicci 23 sample will offer a unique opportunity to get insight for the first time into the nuclear genes of early modern Europeans. PMID:18628960

  14. A 28,000 years old Cro-Magnon mtDNA sequence differs from all potentially contaminating modern sequences.

    Directory of Open Access Journals (Sweden)

    David Caramelli

    Full Text Available BACKGROUND: DNA sequences from ancient specimens may in fact result from undetected contamination of the ancient specimens by modern DNA, and the problem is particularly challenging in studies of human fossils. Doubts on the authenticity of the available sequences have so far hampered genetic comparisons between anatomically archaic (Neandertal and early modern (Cro-Magnoid Europeans. METHODOLOGY/PRINCIPAL FINDINGS: We typed the mitochondrial DNA (mtDNA hypervariable region I in a 28,000 years old Cro-Magnoid individual from the Paglicci cave, in Italy (Paglicci 23 and in all the people who had contact with the sample since its discovery in 2003. The Paglicci 23 sequence, determined through the analysis of 152 clones, is the Cambridge reference sequence, and cannot possibly reflect contamination because it differs from all potentially contaminating modern sequences. CONCLUSIONS/SIGNIFICANCE: The Paglicci 23 individual carried a mtDNA sequence that is still common in Europe, and which radically differs from those of the almost contemporary Neandertals, demonstrating a genealogical continuity across 28,000 years, from Cro-Magnoid to modern Europeans. Because all potential sources of modern DNA contamination are known, the Paglicci 23 sample will offer a unique opportunity to get insight for the first time into the nuclear genes of early modern Europeans.

  15. Sequence analysis of mitochondrial DNA hypervariable region III of ...

    African Journals Online (AJOL)



    Jul 1, 2015 ... population genetics research, studies based on mitochondrial DNA (mtDNA) and Y-chromosome DNA are an excellent way of illustrating population structure .... avoid landing investigators into serious situations of medical genetic privacy and ethnics, especially for. mtDNA coding area whose mutation often ...

  16. Protein and DNA sequence determinants of thermophilic adaptation.

    Directory of Open Access Journals (Sweden)

    Konstantin B Zeldovich


    Full Text Available There have been considerable attempts in the past to relate phenotypic trait--habitat temperature of organisms--to their genotypes, most importantly compositions of their genomes and proteomes. However, despite accumulation of anecdotal evidence, an exact and conclusive relationship between the former and the latter has been elusive. We present an exhaustive study of the relationship between amino acid composition of proteomes, nucleotide composition of DNA, and optimal growth temperature (OGT of prokaryotes. Based on 204 complete proteomes of archaea and bacteria spanning the temperature range from -10 degrees C to 110 degrees C, we performed an exhaustive enumeration of all possible sets of amino acids and found a set of amino acids whose total fraction in a proteome is correlated, to a remarkable extent, with the OGT. The universal set is Ile, Val, Tyr, Trp, Arg, Glu, Leu (IVYWREL, and the correlation coefficient is as high as 0.93. We also found that the G + C content in 204 complete genomes does not exhibit a significant correlation with OGT (R = -0.10. On the other hand, the fraction of A + G in coding DNA is correlated with temperature, to a considerable extent, due to codon patterns of IVYWREL amino acids. Further, we found strong and independent correlation between OGT and the frequency with which pairs of A and G nucleotides appear as nearest neighbors in genome sequences. This adaptation is achieved via codon bias. These findings present a direct link between principles of proteins structure and stability and evolutionary mechanisms of thermophylic adaptation. On the nucleotide level, the analysis provides an example of how nature utilizes codon bias for evolutionary adaptation to extreme conditions. Together these results provide a complete picture of how compositions of proteomes and genomes in prokaryotes adjust to the extreme conditions of the environment.

  17. Characterization of the indigenous microflora in raw and pasteurized buffalo milk during storage at refrigeration temperature by high-throughput sequencing. (United States)

    Li, Ling; Renye, John A; Feng, Ling; Zeng, Qingkun; Tang, Yan; Huang, Li; Ren, Daxi; Yang, Pan


    The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High-quality samples of raw buffalo milk were obtained from 3 dairy farms in the Guangxi province in southern China. Five liters of each milk sample were pasteurized (72°C; 15 s); and both raw and pasteurized milks were stored at refrigeration temperature (1-4°C) for various times with their microbial communities characterized using the Illumina Miseq platform (Novogene, Beijing, China). Results showed that both raw and pasteurized milks contained a diverse microbial population and that the populations changed over time during storage. In raw buffalo milk, Lactococcus and Streptococcus dominated the population within the first 24h; however, when stored for up to 72h the dominant bacteria were members of the Pseudomonas and Acinetobacter genera, totaling more than 60% of the community. In pasteurized buffalo milk, the microbial population shifted from a Lactococcus-dominated community (7d), to one containing more than 84% Paenibacillus by 21d of storage. To increase the shelf-life of buffalo milk and its products, raw milk needs to be refrigerated immediately after milking and throughout transport, and should be monitored for the presence of Paenibacillus. Results from this study suggest pasteurization should be performed within 24h of raw milk collection, when the number of psychrotrophic bacteria are low; however, as Paenibacillus spores are resistant to pasteurization, additional antimicrobial treatments may be required to extend shelf-life. The findings from this study are expected to aid in improving the quality and safety of raw and pasteurized buffalo milk. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae). (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang


    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    NARCIS (Netherlands)

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it

  20. The DNA sequence and biology of human chromosome 19

    Energy Technology Data Exchange (ETDEWEB)

    Grimwood, J; Gordon, L A; Olsen, A; Terry, A; Schmutz, J; Lamerdin, J; Hellsten, U; Goodstein, D; Couronne, O; Tran-Gyamfi, M


    Chromosome 19 has the highest gene density of all human chromosomes, more than double the genome-wide average. The large clustered gene families, corresponding high GC content, CpG islands and density of repetitive DNA indicate a chromosome rich in biological and evolutionary significance. Here we describe 55.8 million base pairs of highly accurate finished sequence representing 99.9% of the euchromatin portion of the chromosome. Manual curation of gene loci reveals 1,461 protein-coding genes and 321 pseudogenes. Among these are genes directly implicated in Mendelian disorders, including familial hypercholesterolemia and insulin-resistant diabetes. Nearly one quarter of these genes belong to tandemly arranged families, encompassing more than 25% of the chromosome. Comparative analyses show a fascinating picture of conservation and divergence, revealing large blocks of gene orthology with rodents, scattered regions with more recent gene family expansions and deletions, and segments of coding and non-coding conservation with the distant fish species Takifugu.

  1. High Interlaboratory Reprocucibility of DNA Sequence-based Typing of Bacteria in a Multicenter Study

    DEFF Research Database (Denmark)

    Sousa, MA de; Boye, Kit; Lencastre, H de


    Current DNA amplification-based typing methods for bacterial pathogens often lack interlaboratory reproducibility. In this international study, DNA sequence-based typing of the Staphylococcus aureus protein A gene (spa, 110 to 422 bp) showed 100% intra- and interlaboratory reproducibility without...... extensive harmonization of protocols for 30 blind-coded S. aureus DNA samples sent to 10 laboratories. Specialized software for automated sequence analysis ensured a common typing nomenclature....

  2. Targeted DNA Methylation Analysis by High Throughput Sequencing in Porcine Peri-attachment Embryos


    MORRILL, Benson H.; COX, Lindsay; WARD, Anika; HEYWOOD, Sierra; PRATHER, Randall S.; ISOM, S. Clay


    Abstract The purpose of this experiment was to implement and evaluate the effectiveness of a next-generation sequencing-based method for DNA methylation analysis in porcine embryonic samples. Fourteen discrete genomic regions were amplified by PCR using bisulfite-converted genomic DNA derived from day 14 in vivo-derived (IVV) and parthenogenetic (PA) porcine embryos as template DNA. Resulting PCR products were subjected to high-throughput sequencing using the Illumina Genome Analyzer IIx plat...

  3. Sequence analysis of mitochondrial DNA hypervariable region III of ...

    African Journals Online (AJOL)

    The aims of this research were to study mitochondrial DNA hypervariable region III and establish the degree of variation characteristic of a fragment. The mitochondrial DNA (mtDNA) is a small circular genome located within the mitochondria in the cytoplasm of the cell and a smaller 1.2 kb pair fragment, called the control ...

  4. Low-Energy Electron-Induced Strand Breaks in Telomere-Derived DNA Sequences-Influence of DNA Sequence and Topology. (United States)

    Rackwitz, Jenny; Bald, Ilko


    During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

    International Nuclear Information System (INIS)

    Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P


    Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

  6. Functional role of a highly repetitive DNA sequence in anchorage of the mouse genome. (United States)

    Neuer-Nitsche, B; Lu, X N; Werner, D


    The major portion of the eukaryotic genome consists of various categories of repetitive DNA sequences which have been studied with respect to their base compositions, organizations, copy numbers, transcription and species specificities; their biological roles, however, are still unclear. A novel quality of a highly repetitive mouse DNA sequence is described which points to a functional role: All copies (approximately 50,000 per haploid genome) of this DNA sequence reside on genomic Alu I DNA fragments each associated with nuclear polypeptides that are not released from DNA by proteinase K, SDS and phenol extraction. By this quality the repetitive DNA sequence is classified as a member of the sub-set of DNA sequences involved in tight DNA-polypeptide complexes which have been previously shown to be components of the subnuclear structure termed 'nuclear matrix'. From these results it has to be concluded that the repetitive DNA sequence characterized in this report represents or comprises a signal for a large number of site specific attachment points of the mouse genome in the nuclear matrix.

  7. Sequencing historical specimens: successful preparation of small specimens with low amounts of degraded DNA. (United States)

    Sproul, John S; Maddison, David R


    Despite advances that allow DNA sequencing of old museum specimens, sequencing small-bodied, historical specimens can be challenging and unreliable as many contain only small amounts of fragmented DNA. Dependable methods to sequence such specimens are especially critical if the specimens are unique. We attempt to sequence small-bodied (3-6 mm) historical specimens (including nomenclatural types) of beetles that have been housed, dried, in museums for 58-159 years, and for which few or no suitable replacement specimens exist. To better understand ideal approaches of sample preparation and produce preparation guidelines, we compared different library preparation protocols using low amounts of input DNA (1-10 ng). We also explored low-cost optimizations designed to improve library preparation efficiency and sequencing success of historical specimens with minimal DNA, such as enzymatic repair of DNA. We report successful sample preparation and sequencing for all historical specimens despite our low-input DNA approach. We provide a list of guidelines related to DNA repair, bead handling, reducing adapter dimers and library amplification. We present these guidelines to facilitate more economical use of valuable DNA and enable more consistent results in projects that aim to sequence challenging, irreplaceable historical specimens. © 2017 John Wiley & Sons Ltd.

  8. Sequence-Dependent Diastereospecific and Diastereodivergent Crosslinking of DNA by Decarbamoylmitomycin C. (United States)

    Aguilar, William; Paz, Manuel M; Vargas, Anayatzinc; Clement, Cristina C; Cheng, Shu-Yuan; Champeil, Elise


    Mitomycin C (MC), a potent antitumor drug, and decarbamoylmitomycin C (DMC), a derivative lacking the carbamoyl group, form highly cytotoxic DNA interstrand crosslinks. The major interstrand crosslink formed by DMC is the C1'' epimer of the major crosslink formed by MC. The molecular basis for the stereochemical configuration exhibited by DMC was investigated using biomimetic synthesis. The formation of DNA-DNA crosslinks by DMC is diastereospecific and diastereodivergent: Only the 1''S-diastereomer of the initially formed monoadduct can form crosslinks at GpC sequences, and only the 1''R-diastereomer of the monoadduct can form crosslinks at CpG sequences. We also show that CpG and GpC sequences react with divergent diastereoselectivity in the first alkylation step: 1"S stereochemistry is favored at GpC sequences and 1''R stereochemistry is favored at CpG sequences. Therefore, the first alkylation step results, at each sequence, in the selective formation of the diastereomer able to generate an interstrand DNA-DNA crosslink after the "second arm" alkylation. Examination of the known DNA adduct pattern obtained after treatment of cancer cell cultures with DMC indicates that the GpC sequence is the major target for the formation of DNA-DNA crosslinks in vivo by this drug. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus. (United States)

    Osipiuk, J; Joachimiak, A


    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  10. Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines

    Directory of Open Access Journals (Sweden)

    Joanne G. Bartlett


    Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.

  11. Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition. (United States)

    Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S


    Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

  12. Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs (United States)

    M.N. lslam-Faridi; C.D. Nelson; S.P. DiFazio; L.E. Gunter; G.A. Tuskan


    The 185-285 rDNA and 55 rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 185-285 rDNA sites and one 55 rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis-type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones...

  13. cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

    International Nuclear Information System (INIS)

    Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.


    The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

  14. Real sequence effects on the search dynamics of transcription factors on DNA

    DEFF Research Database (Denmark)

    Bauer, Maximilian; Rasmussen, Emil S.; Lomholt, Michael A.


    Recent experiments show that transcription factors (TFs) indeed use the facilitated diffusion mechanism to locate their target sequences on DNA in living bacteria cells: TFs alternate between sliding motion along DNA and relocation events through the cytoplasm. From simulations and theoretical...... analysis we study the TF-sliding motion for a large section of the DNA-sequence of a common E. coli strain, based on the two-state TF-model with a fast-sliding search state and a recognition state enabling target detection. For the probability to detect the target before dissociating from DNA the TF...... on the underlying nucleotide sequence is varied. A moderate dependence maximises the capability to distinguish between the main operator and similar sequences. Moreover, these auxiliary operators serve as starting points for DNA looping with the main operator, yielding a spectrum of target detection times spanning...

  15. Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA. (United States)

    Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin


    Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

  16. Scalable whole-exome sequencing of cell-free DNA reveals high concordance with metastatic tumors. (United States)

    Adalsteinsson, Viktor A; Ha, Gavin; Freeman, Samuel S; Choudhury, Atish D; Stover, Daniel G; Parsons, Heather A; Gydush, Gregory; Reed, Sarah C; Rotem, Denisse; Rhoades, Justin; Loginov, Denis; Livitz, Dimitri; Rosebrock, Daniel; Leshchiner, Ignaty; Kim, Jaegil; Stewart, Chip; Rosenberg, Mara; Francis, Joshua M; Zhang, Cheng-Zhong; Cohen, Ofir; Oh, Coyin; Ding, Huiming; Polak, Paz; Lloyd, Max; Mahmud, Sairah; Helvie, Karla; Merrill, Margaret S; Santiago, Rebecca A; O'Connor, Edward P; Jeong, Seong H; Leeson, Rachel; Barry, Rachel M; Kramkowski, Joseph F; Zhang, Zhenwei; Polacek, Laura; Lohr, Jens G; Schleicher, Molly; Lipscomb, Emily; Saltzman, Andrea; Oliver, Nelly M; Marini, Lori; Waks, Adrienne G; Harshman, Lauren C; Tolaney, Sara M; Van Allen, Eliezer M; Winer, Eric P; Lin, Nancy U; Nakabayashi, Mari; Taplin, Mary-Ellen; Johannessen, Cory M; Garraway, Levi A; Golub, Todd R; Boehm, Jesse S; Wagle, Nikhil; Getz, Gad; Love, J Christopher; Meyerson, Matthew


    Whole-exome sequencing of cell-free DNA (cfDNA) could enable comprehensive profiling of tumors from blood but the genome-wide concordance between cfDNA and tumor biopsies is uncertain. Here we report ichorCNA, software that quantifies tumor content in cfDNA from 0.1× coverage whole-genome sequencing data without prior knowledge of tumor mutations. We apply ichorCNA to 1439 blood samples from 520 patients with metastatic prostate or breast cancers. In the earliest tested sample for each patient, 34% of patients have ≥10% tumor-derived cfDNA, sufficient for standard coverage whole-exome sequencing. Using whole-exome sequencing, we validate the concordance of clonal somatic mutations (88%), copy number alterations (80%), mutational signatures, and neoantigens between cfDNA and matched tumor biopsies from 41 patients with ≥10% cfDNA tumor content. In summary, we provide methods to identify patients eligible for comprehensive cfDNA profiling, revealing its applicability to many patients, and demonstrate high concordance of cfDNA and metastatic tumor whole-exome sequencing.

  17. Targeting and tracing of specific DNA sequences with dTALEs in living cells (United States)

    Thanisch, Katharina; Schneider, Katrin; Morbitzer, Robert; Solovei, Irina; Lahaye, Thomas; Bultmann, Sebastian; Leonhardt, Heinrich


    Epigenetic regulation of gene expression involves, besides DNA and histone modifications, the relative positioning of DNA sequences within the nucleus. To trace specific DNA sequences in living cells, we used programmable sequence-specific DNA binding of designer transcription activator-like effectors (dTALEs). We designed a recombinant dTALE (msTALE) with variable repeat domains to specifically bind a 19-bp target sequence of major satellite DNA. The msTALE was fused with green fluorescent protein (GFP) and stably expressed in mouse embryonic stem cells. Hybridization with a major satellite probe (3D-fluorescent in situ hybridization) and co-staining for known cellular structures confirmed in vivo binding of the GFP-msTALE to major satellite DNA present at nuclear chromocenters. Dual tracing of major satellite DNA and the replication machinery throughout S-phase showed co-localization during mid to late S-phase, directly demonstrating the late replication timing of major satellite DNA. Fluorescence bleaching experiments indicated a relatively stable but still dynamic binding, with mean residence times in the range of minutes. Fluorescently labeled dTALEs open new perspectives to target and trace DNA sequences and to monitor dynamic changes in subnuclear positioning as well as interactions with functional nuclear structures during cell cycle progression and cellular differentiation. PMID:24371265

  18. Targeting and tracing of specific DNA sequences with dTALEs in living cells. (United States)

    Thanisch, Katharina; Schneider, Katrin; Morbitzer, Robert; Solovei, Irina; Lahaye, Thomas; Bultmann, Sebastian; Leonhardt, Heinrich


    Epigenetic regulation of gene expression involves, besides DNA and histone modifications, the relative positioning of DNA sequences within the nucleus. To trace specific DNA sequences in living cells, we used programmable sequence-specific DNA binding of designer transcription activator-like effectors (dTALEs). We designed a recombinant dTALE (msTALE) with variable repeat domains to specifically bind a 19-bp target sequence of major satellite DNA. The msTALE was fused with green fluorescent protein (GFP) and stably expressed in mouse embryonic stem cells. Hybridization with a major satellite probe (3D-fluorescent in situ hybridization) and co-staining for known cellular structures confirmed in vivo binding of the GFP-msTALE to major satellite DNA present at nuclear chromocenters. Dual tracing of major satellite DNA and the replication machinery throughout S-phase showed co-localization during mid to late S-phase, directly demonstrating the late replication timing of major satellite DNA. Fluorescence bleaching experiments indicated a relatively stable but still dynamic binding, with mean residence times in the range of minutes. Fluorescently labeled dTALEs open new perspectives to target and trace DNA sequences and to monitor dynamic changes in subnuclear positioning as well as interactions with functional nuclear structures during cell cycle progression and cellular differentiation.

  19. MotifMark: Finding Regulatory Motifs in DNA Sequences


    Hassanzadeh, Hamid Reza; Kolhe, Pushkar; Isbell, Charles L.; Wang, May D.


    The interaction between proteins and DNA is a key driving force in a significant number of biological processes such as transcriptional regulation, repair, recombination, splicing, and DNA modification. The identification of DNA-binding sites and the specificity of target proteins in binding to these regions are two important steps in understanding the mechanisms of these biological activities. A number of high-throughput technologies have recently emerged that try to quantify the affinity be...

  20. Sequence analysis of the canine mitochondrial DNA control region from shed hair samples in criminal investigations. (United States)

    Berger, C; Berger, B; Parson, W


    In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.

  1. A duplex DNA-gold nanoparticle probe composed as a colorimetric biosensor for sequence-specific DNA-binding proteins. (United States)

    Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa


    Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.

  2. Ecological niche modelling and nDNA sequencing support a new, morphologically cryptic beetle species unveiled by DNA barcoding. (United States)

    Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael


    DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species.

  3. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  4. Bisulfite sequencing reveals that Aspergillus flavus holds a hollow in DNA methylation.

    Directory of Open Access Journals (Sweden)

    Si-Yang Liu

    Full Text Available Aspergillus flavus first gained scientific attention for its production of aflatoxin. The underlying regulation of aflatoxin biosynthesis has been serving as a theoretical model for biosynthesis of other microbial secondary metabolites. Nevertheless, for several decades, the DNA methylation status, one of the important epigenomic modifications involved in gene regulation, in A. flavus remains to be controversial. Here, we applied bisulfite sequencing in conjunction with a biological replicate strategy to investigate the DNA methylation profiling of A. flavus genome. Both the bisulfite sequencing data and the methylome comparisons with other fungi confirm that the DNA methylation level of this fungus is negligible. Further investigation into the DNA methyltransferase of Aspergillus uncovers its close relationship with RID-like enzymes as well as its divergence with the methyltransferase of species with validated DNA methylation. The lack of repeat contents of the A. flavus' genome and the high RIP-index of the small amount of remanent repeat potentially support our speculation that DNA methylation may be absent in A. flavus or that it may possess de novo DNA methylation which occurs very transiently during the obscure sexual stage of this fungal species. This work contributes to our understanding on the DNA methylation status of A. flavus, as well as reinforces our views on the DNA methylation in fungal species. In addition, our strategy of applying bisulfite sequencing to DNA methylation detection in species with low DNA methylation may serve as a reference for later scientific investigations in other hypomethylated species.

  5. Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions. (United States)

    Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A


    The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.

  6. Sequence of a cDNA encoding turtle high mobility group 1 protein. (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng


    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  7. Human pro. cap alpha. 1(III) collagen: cDNA sequence for the 3' end

    Energy Technology Data Exchange (ETDEWEB)

    Mankoo, B S; Dalgleish, R


    The authors have previously isolated two overlapping cDNA clones, pIII-21 and pIII-33, which encode the C-terminal end of human type III procollagen. They now present the sequence of 2520 bases encoded in these cDNAs which overlaps other previously published sequences for the same gene. The sequence presented differs from previously published sequences at five positions.

  8. Protein identification from two-dimensional gel electrophoresis analysis of Klebsiella pneumoniae by combined use of mass spectrometry data and raw genome sequences

    Directory of Open Access Journals (Sweden)

    Zeng An-Ping


    Full Text Available Abstract Separation of proteins by two-dimensional gel electrophoresis (2-DE coupled with identification of proteins through peptide mass fingerprinting (PMF by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS is the widely used technique for proteomic analysis. This approach relies, however, on the presence of the proteins studied in public-accessible protein databases or the availability of annotated genome sequences of an organism. In this work, we investigated the reliability of using raw genome sequences for identifying proteins by PMF without the need of additional information such as amino acid sequences. The method is demonstrated for proteomic analysis of Klebsiella pneumoniae grown anaerobically on glycerol. For 197 spots excised from 2-DE gels and submitted for mass spectrometric analysis 164 spots were clearly identified as 122 individual proteins. 95% of the 164 spots can be successfully identified merely by using peptide mass fingerprints and a strain-specific protein database (ProtKpn constructed from the raw genome sequences of K. pneumoniae. Cross-species protein searching in the public databases mainly resulted in the identification of 57% of the 66 high expressed protein spots in comparison to 97% by using the ProtKpn database. 10 dha regulon related proteins that are essential for the initial enzymatic steps of anaerobic glycerol metabolism were successfully identified using the ProtKpn database, whereas none of them could be identified by cross-species searching. In conclusion, the use of strain-specific protein database constructed from raw genome sequences makes it possible to reliably identify most of the proteins from 2-DE analysis simply through peptide mass fingerprinting.

  9. Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA (United States)

    Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.


    DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

  10. High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.

    Directory of Open Access Journals (Sweden)

    Soichi Inagaki

    Full Text Available Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

  11. High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture. (United States)

    Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca


    Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

  12. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A


    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  13. Plant DNA sequences from feces: potential means for assessing diets of wild primates. (United States)

    Bradley, Brenda J; Stiller, Mathias; Doran-Sheehy, Diane M; Harris, Tara; Chapman, Colin A; Vigilant, Linda; Poinar, Hendrik


    Analyses of plant DNA in feces provides a promising, yet largely unexplored, means of documenting the diets of elusive primates. Here we demonstrate the promise and pitfalls of this approach using DNA extracted from fecal samples of wild western gorillas (Gorilla gorilla) and black and white colobus monkeys (Colobus guereza). From these DNA extracts we amplified, cloned, and sequenced small segments of chloroplast DNA (part of the rbcL gene) and plant nuclear DNA (ITS-2). The obtained sequences were compared to sequences generated from known plant samples and to those in GenBank to identify plant taxa in the feces. With further optimization, this method could provide a basic evaluation of minimum primate dietary diversity even when knowledge of local flora is limited. This approach may find application in studies characterizing the diets of poorly-known, unhabituated primate species or assaying consumer-resource relationships in an ecosystem. (c) 2007 Wiley-Liss, Inc.

  14. Decoding the regulatory landscape of medulloblastoma using DNA methylation sequencing

    NARCIS (Netherlands)

    Hovestadt, Volker; Jones, David T. W.; Picelli, Simone; Wang, Wei; Kool, Marcel; Northcott, Paul A.; Sultan, Marc; Stachurski, Katharina; Ryzhova, Marina; Warnatz, Hans-Jörg; Ralser, Meryem; Brun, Sonja; Bunt, Jens; Jäger, Natalie; Kleinheinz, Kortine; Erkek, Serap; Weber, Ursula D.; Bartholomae, Cynthia C.; von Kalle, Christof; Lawerenz, Chris; Eils, Jürgen; Koster, Jan; Versteeg, Rogier; Milde, Till; Witt, Olaf; Schmidt, Sabine; Wolf, Stephan; Pietsch, Torsten; Rutkowski, Stefan; Scheurlen, Wolfram; Taylor, Michael D.; Brors, Benedikt; Felsberg, Jörg; Reifenberger, Guido; Borkhardt, Arndt; Lehrach, Hans; Wechsler-Reya, Robert J.; Eils, Roland; Yaspo, Marie-Laure; Landgraf, Pablo; Korshunov, Andrey; Zapatka, Marc; Radlwimmer, Bernhard; Pfister, Stefan M.; Lichter, Peter


    Epigenetic alterations, that is, disruption of DNA methylation and chromatin architecture, are now acknowledged as a universal feature of tumorigenesis. Medulloblastoma, a clinically challenging, malignant childhood brain tumour, is no exception. Despite much progress from recent genomics studies,

  15. Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

    DEFF Research Database (Denmark)

    Ibaraki, K; Kozak, C A; Wewer, U M


    regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

  16. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan


    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  17. Genomic signal processing methods for computation of alignment-free distances from DNA sequences. (United States)

    Borrayo, Ernesto; Mendizabal-Ruiz, E Gerardo; Vélez-Pérez, Hugo; Romo-Vázquez, Rebeca; Mendizabal, Adriana P; Morales, J Alejandro


    Genomic signal processing (GSP) refers to the use of digital signal processing (DSP) tools for analyzing genomic data such as DNA sequences. A possible application of GSP that has not been fully explored is the computation of the distance between a pair of sequences. In this work we present GAFD, a novel GSP alignment-free distance computation method. We introduce a DNA sequence-to-signal mapping function based on the employment of doublet values, which increases the number of possible amplitude values for the generated signal. Additionally, we explore the use of three DSP distance metrics as descriptors for categorizing DNA signal fragments. Our results indicate the feasibility of employing GAFD for computing sequence distances and the use of descriptors for characterizing DNA fragments.

  18. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo


    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  19. Molecular-Sized DNA or RNA Sequencing Machine | NCI Technology Transfer Center | TTC (United States)

    The National Cancer Institute's Gene Regulation and Chromosome Biology Laboratory is seeking statements of capability or interest from parties interested in collaborative research to co-develop a molecular-sized DNA or RNA sequencing machine.

  20. Structural basis for sequence-specific recognition of DNA by TAL effectors

    KAUST Repository

    Deng, Dong; Yan, Chuangye; Pan, Xiaojing; Mahfouz, Magdy M.; Wang, Jiawei; Zhu, Jiankang; Shi, Yi Gong; Yan, Nieng


    TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat comprises 33 to 35 conserved amino acids and targets a specific base pair

  1. Efficiency of ITS Sequences for DNA Barcoding in Passiflora (Passifloraceae

    Directory of Open Access Journals (Sweden)

    Giovanna Câmara Giudicelli


    Full Text Available DNA barcoding is a technique for discriminating and identifying species using short, variable, and standardized DNA regions. Here, we tested for the first time the performance of plastid and nuclear regions as DNA barcodes in Passiflora. This genus is a largely variable, with more than 900 species of high ecological, commercial, and ornamental importance. We analyzed 1034 accessions of 222 species representing the four subgenera of Passiflora and evaluated the effectiveness of five plastid regions and three nuclear datasets currently employed as DNA barcodes in plants using barcoding gap, applied similarity-, and tree-based methods. The plastid regions were able to identify less than 45% of species, whereas the nuclear datasets were efficient for more than 50% using “best match” and “best close match” methods of TaxonDNA software. All subgenera presented higher interspecific pairwise distances and did not fully overlap with the intraspecific distance, and similarity-based methods showed better results than tree-based methods. The nuclear ribosomal internal transcribed spacer 1 (ITS1 region presented a higher discrimination power than the other datasets and also showed other desirable characteristics as a DNA barcode for this genus. Therefore, we suggest that this region should be used as a starting point to identify Passiflora species.

  2. Underwound DNA under Tension: Structure, Elasticity, and Sequence-Dependent Behaviors (United States)

    Sheinin, Maxim Y.; Forth, Scott; Marko, John F.; Wang, Michelle D.


    DNA melting under torsion plays an important role in a wide variety of cellular processes. In the present Letter, we have investigated DNA melting at the single-molecule level using an angular optical trap. By directly measuring force, extension, torque, and angle of DNA, we determined the structural and elastic parameters of torsionally melted DNA. Our data reveal that under moderate forces, the melted DNA assumes a left-handed structure as opposed to an open bubble conformation and is highly torsionally compliant. We have also discovered that at low forces melted DNA properties are highly dependent on DNA sequence. These results provide a more comprehensive picture of the global DNA force-torque phase diagram.

  3. A next generation semiconductor based sequencing approach for the identification of meat species in DNA mixtures.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43% in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97 and lower for avian species (0.70. PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.

  4. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution


    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.


    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it possible to map SCEs at orders-of-magnitude greater resolution than was previously possible. On average, murine embryonic stem (mES) cells exhibit eight SCEs, which are detected at a resolution of up...

  5. The use of permanganate as a sequencing reagent for identification of 5-methylcytosine residues in DNA.


    Fritzsche, E; Hayatsu, H; Igloi, G L; Iida, S; Kössel, H


    The use of permanganate as a reagent for DNA sequencing by chemical degradation has been studied with respect to its specificity for 5-methylcytosine residues. At weakly acidic pH and room temperature, 0.2 mM potassium permanganate reacts preferentially with thymine, 5-methylcytosine, and to a lesser extent with purine residues, while cytosine remains essentially intact. Permanganate oxidation is, therefore, a suitable DNA sequencing reaction for positive discrimination between 5-methylcytosi...

  6. Solving the Curriculum Sequencing Problem with DNA Computing Approach (United States)

    Debbah, Amina; Ben Ali, Yamina Mohamed


    In the e-learning systems, a learning path is known as a sequence of learning materials linked to each others to help learners achieving their learning goals. As it is impossible to have the same learning path that suits different learners, the Curriculum Sequencing problem (CS) consists of the generation of a personalized learning path for each…

  7. Research on Image Encryption Based on DNA Sequence and Chaos Theory (United States)

    Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin


    Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.

  8. Detection of herpes simplex virus-specific DNA sequences in latently infected mice and in humans. (United States)

    Efstathiou, S; Minson, A C; Field, H J; Anderson, J R; Wildy, P


    Herpes simplex virus-specific DNA sequences have been detected by Southern hybridization analysis in both central and peripheral nervous system tissues of latently infected mice. We have detected virus-specific sequences corresponding to the junction fragment but not the genomic termini, an observation first made by Rock and Fraser (Nature [London] 302:523-525, 1983). This "endless" herpes simplex virus DNA is both qualitatively and quantitatively stable in mouse neural tissue analyzed over a 4-month period. In addition, examination of DNA extracted from human trigeminal ganglia has shown herpes simplex virus DNA to be present in an "endless" form similar to that found in the mouse model system. Further restriction enzyme analysis of latently infected mouse brainstem and human trigeminal DNA has shown that this "endless" herpes simplex virus DNA is present in all four isomeric configurations.

  9. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2]. (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I


    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  10. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    International Nuclear Information System (INIS)

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.


    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

  11. Torque measurements reveal sequence-specific cooperative transitions in supercoiled DNA (United States)

    Oberstrass, Florian C.; Fernandes, Louis E.; Bryant, Zev


    B-DNA becomes unstable under superhelical stress and is able to adopt a wide range of alternative conformations including strand-separated DNA and Z-DNA. Localized sequence-dependent structural transitions are important for the regulation of biological processes such as DNA replication and transcription. To directly probe the effect of sequence on structural transitions driven by torque, we have measured the torsional response of a panel of DNA sequences using single molecule assays that employ nanosphere rotational probes to achieve high torque resolution. The responses of Z-forming d(pGpC)n sequences match our predictions based on a theoretical treatment of cooperative transitions in helical polymers. “Bubble” templates containing 50–100 bp mismatch regions show cooperative structural transitions similar to B-DNA, although less torque is required to disrupt strand–strand interactions. Our mechanical measurements, including direct characterization of the torsional rigidity of strand-separated DNA, establish a framework for quantitative predictions of the complex torsional response of arbitrary sequences in their biological context. PMID:22474350

  12. DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference. (United States)

    Rieben, W Kurt; Coulombe, Roger A


    Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

  13. Mitochondrial DNA sequence variation in Finnish patients with matrilineal diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Soini Heidi K


    Full Text Available Abstract Background The genetic background of type 2 diabetes is complex involving contribution by both nuclear and mitochondrial genes. There is an excess of maternal inheritance in patients with type 2 diabetes and, furthermore, diabetes is a common symptom in patients with mutations in mitochondrial DNA (mtDNA. Polymorphisms in mtDNA have been reported to act as risk factors in several complex diseases. Findings We examined the nucleotide variation in complete mtDNA sequences of 64 Finnish patients with matrilineal diabetes. We used conformation sensitive gel electrophoresis and sequencing to detect sequence variation. We analysed the pathogenic potential of nonsynonymous variants detected in the sequences and examined the role of the m.16189 T>C variant. Controls consisted of non-diabetic subjects ascertained in the same population. The frequency of mtDNA haplogroup V was 3-fold higher in patients with diabetes. Patients harboured many nonsynonymous mtDNA substitutions that were predicted to be possibly or probably damaging. Furthermore, a novel m.13762 T>G in MTND5 leading to p.Ser476Ala and several rare mtDNA variants were found. Haplogroup H1b harbouring m.16189 T > C and m.3010 G > A was found to be more frequent in patients with diabetes than in controls. Conclusions Mildly deleterious nonsynonymous mtDNA variants and rare population-specific haplotypes constitute genetic risk factors for maternally inherited diabetes.

  14. DNA sequences from the quagga, an extinct member of the horse family. (United States)

    Higuchi, R; Bowman, B; Freiberger, M; Ryder, O A; Wilson, A C

    To determine whether DNA survives and can be recovered from the remains of extinct creatures, we have examined dried muscle from a museum specimen of the quagga, a zebra-like species (Equus quagga) that became extinct in 1883 (ref. 1). We report that DNA was extracted from this tissue in amounts approaching 1% of that expected from fresh muscle, and that the DNA was of relatively low molecular weight. Among the many clones obtained from the quagga DNA, two containing pieces of mitochondrial DNA (mtDNA) were sequenced. These sequences, comprising 229 nucleotide pairs, differ by 12 base substitutions from the corresponding sequences of mtDNA from a mountain zebra, an extant member of the genus Equus. The number, nature and locations of the substitutions imply that there has been little or no postmortem modification of the quagga DNA sequences, and that the two species had a common ancestor 3-4 Myr ago, consistent with fossil evidence concerning the age of the genus Equus.

  15. Complete DNA sequence of the linear mitochondrial genome of the pathogenic yeast Candida parapsilosis

    DEFF Research Database (Denmark)

    Nosek, J.; Novotna, M.; Hlavatovicova, Z.


    The complete sequence of the mitochondrial DNA of the opportunistic yeast pathogen Candida parapsilosis was determined. The mitochondrial genome is represented by linear DNA molecules terminating with tandem repeats of a 738-bp unit. The number of repeats varies, thus generating a population...

  16. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.


    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  17. Protocols for 16S rDNA Array Analyses of Microbial Communities by Sequence-Specific Labeling of DNA Probes

    Directory of Open Access Journals (Sweden)

    Knut Rudi


    Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.

  18. Ray Wu as Fifth Business: Deconstructing collective memory in the history of DNA sequencing. (United States)

    Onaga, Lisa A


    The concept of 'Fifth Business' is used to analyze a minority standpoint and bring serious attention to the role of scientists who play a galvanizing role in a science but for multiple reasons appear less prominently in more common recounts of any particular development. Biochemist Ray Wu (1928-2008) published a DNA sequencing experiment in March 1970 using DNA polymerase catalysis and specific nucleotide labeling, both of which are foundational to general sequencing methods today. The scant mention of Wu's work from textbooks, research articles, and other accounts of DNA sequencing calls into question how scientific collective memory forms. This alternative history seeks to understand why a key figure in nucleic acid sequence analysis has remained less visibly connected or peripheral to solidifying narratives about the history of DNA sequencing. The study resists predictable dismissals of Wu's work in order to seriously examine the formation of his nucleic acid sequence analysis research program and how he shared his knowledge of sequencing during a period of rapid advancement in the field. An analysis of Wu's work on sequencing the cohesive ends of lambda bacteriophage in the 1960s and 1970s exemplifies how a variety of individuals and groups attempted to develop protocol for sequencing the order of nucleotide base pairs comprising DNA. This historical examination of the sociality of scientific research suggests a way to understand how Wu and others contributed to the very collective memory of DNA sequencing that Wu eventually tried to repair. The study of Wu, who was a Chinese immigrant to the United States, provides a foundation for further critical scholarship on the heterogeneous histories of Asian American bioscientists, the sociality of their scientific works, and how the resulting knowledge produced is preserved, if not evenly, in a scientific field's collective memory. Copyright © 2014 Elsevier Ltd. All rights reserved.


    Nuclear and chloroplast-encoded small subunit ribosomal DNA sequences were obtainedfrom several strains of the toxic dinoflagellate Gymnodinium galatheanum. Phylogenetic analyses andcomparison of sequences indicate that the chloroplast sequences show a higher degree of se...

  20. Sequence-specific DNA alkylation by tandem Py-Im polyamide conjugates. (United States)

    Taylor, Rhys Dylan; Kawamoto, Yusuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi


    Tandem N-methylpyrrole-N-methylimidazole (Py-Im) polyamides with good sequence-specific DNA-alkylating activities have been designed and synthesized. Three alkylating tandem Py-Im polyamides with different linkers, which each contained the same moiety for the recognition of a 10 bp DNA sequence, were evaluated for their reactivity and selectivity by DNA alkylation, using high-resolution denaturing gel electrophoresis. All three conjugates displayed high reactivities for the target sequence. In particular, polyamide 1, which contained a β-alanine linker, displayed the most-selective sequence-specific alkylation towards the target 10 bp DNA sequence. The tandem Py-Im polyamide conjugates displayed greater sequence-specific DNA alkylation than conventional hairpin Py-Im polyamide conjugates (4 and 5). For further research, the design of tandem Py-Im polyamide conjugates could play an important role in targeting specific gene sequences. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Budding yeast cDNA sequencing project: S03036-05_I15 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)


  2. Application of high-throughput DNA sequencing in phytopathology. (United States)

    Studholme, David J; Glover, Rachel H; Boonham, Neil


    The new sequencing technologies are already making a big impact in academic research on medically important microbes and may soon revolutionize diagnostics, epidemiology, and infection control. Plant pathology also stands to gain from exploiting these opportunities. This manuscript reviews some applications of these high-throughput sequencing methods that are relevant to phytopathology, with emphasis on the associated computational and bioinformatics challenges and their solutions. Second-generation sequencing technologies have recently been exploited in genomics of both prokaryotic and eukaryotic plant pathogens. They are also proving to be useful in diagnostics, especially with respect to viruses. Copyright © 2011 by Annual Reviews. All rights reserved.

  3. Tomato protoplast DNA transformation : physical linkage and recombination of exogenous DNA sequences

    NARCIS (Netherlands)

    Jongsma, Maarten; Koornneef, Maarten; Zabel, Pim; Hille, Jacques


    Tomato protoplasts have been transformed with plasmid DNA's, containing a chimeric kanamycin resistance gene and putative tomato origins of replication. A calcium phosphate-DNA mediated transformation procedure was employed in combination with either polyethylene glycol or polyvinyl alcohol. There

  4. Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria. (United States)

    Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly


    Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

  5. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao


    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  6. DNA sequence evolution in fast evolving mitochondrial DNA nad1 exons in Geraniaceae and Plantaginaceae

    NARCIS (Netherlands)

    Bakker, F.T.; Breman, F.; Merckx, V.


    Previously, nucleotide substitution rates in mitochondrial DNA of Geraniaceae and Plantaginaceae have been shown to be exceptionally high compared with other angiosperm mtDNA lineages. It has also been shown that mtDNA introns were lost in Geraniaceae and Plantaginaceae. In this study we compile 127

  7. 2D-dynamic representation of DNA sequences as a graphical tool in bioinformatics (United States)

    Bielińska-Wa̧Ż, D.; Wa̧Ż, P.


    2D-dynamic representation of DNA sequences is briefly reviewed. Some new examples of 2D-dynamic graphs which are the graphical tool of the method are shown. Using the examples of the complete genome sequences of the Zika virus it is shown that the present method can be applied for the study of the evolution of viral genomes.

  8. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.


    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

  9. Sequence-specific protection of duplex DNA against restriction and methylation enzymes by pseudocomplementary PNAs

    DEFF Research Database (Denmark)

    Izvolsky, K I; Demidov, V V; Nielsen, P E


    I restriction endonuclease and dam methylase. The pcPNA-assisted protection against enzymatic methylation is more efficient when the PNA-binding site embodies the methylase-recognition site rather than overlaps it. We conclude that pcPNAs may provide the robust tools allowing to sequence-specifically manipulate...... DNA duplexes in a virtually sequence-unrestricted manner....

  10. ABI Base Recall: Automatic Correction and Ends Trimming of DNA Sequences. (United States)

    Elyazghi, Zakaria; Yazouli, Loubna El; Sadki, Khalid; Radouani, Fouzia


    Automated DNA sequencers produce chromatogram files in ABI format. When viewing chromatograms, some ambiguities are shown at various sites along the DNA sequences, because the program implemented in the sequencing machine and used to call bases cannot always precisely determine the right nucleotide, especially when it is represented by either a broad peak or a set of overlaying peaks. In such cases, a letter other than A, C, G, or T is recorded, most commonly N. Thus, DNA sequencing chromatograms need manual examination: checking for mis-calls and truncating the sequence when errors become too frequent. The purpose of this paper is to develop a program allowing the automatic correction of these ambiguities. This application is a Web-based program powered by Shiny and runs under R platform for an easy exploitation. As a part of the interface, we added the automatic ends clipping option, alignment against reference sequences, and BLAST. To develop and test our tool, we collected several bacterial DNA sequences from different laboratories within Institut Pasteur du Maroc and performed both manual and automatic correction. The comparison between the two methods was carried out. As a result, we note that our program, ABI base recall, accomplishes good correction with a high accuracy. Indeed, it increases the rate of identity and coverage and minimizes the number of mismatches and gaps, hence it provides solution to sequencing ambiguities and saves biologists' time and labor.

  11. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    A strain SH 2016, capable of producing xylanase, was isolated and identified as Aspergillus awamori, based on its physiological and biochemical characteristics as well as its ITS rDNA gene sequence analysis. A xylanase gene of 591 bp was cloned from this newly isolated A. awamori and the ORF sequence predicted a ...

  12. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  13. Tandemly repeated sequence in 5'end of mtDNA control region of ...

    African Journals Online (AJOL)

    Extensive length variability was observed in 5' end sequence of the mitochondrial DNA control region of the Japanese Spanish mackerel (Scomberomorus niphonius). This length variability was due to the presence of varying numbers of a 56-bp tandemly repeated sequence and a 46-bp insertion/deletion (indel).

  14. Open source tools to exploit DNA sequence data from livestock species (United States)

    Next-Generation Sequencing (NGS) is a recent technological development that allows researchers to rapidly determine the DNA sequence of an individual. The decrease in cost of NGS has brought the technology into the realm of practical applications in livestock genomics, where it can be used to genera...

  15. Noninvasive prenatal diagnosis of fetal trisomy 18 and trisomy 13 by maternal plasma DNA sequencing.

    NARCIS (Netherlands)

    Chen, E.Z.; Chiu, R.W.; Sun, H; Akolekar, R.; Chan, K.C.; Leung, T.Y.; Jiang, P.; Zheng, Y.W.; Lun, F.M.; Chan, L.Y.; Jin, Y.; Go, A.T.; Lau, E.T; To, W.W.; Leung, W.C.; Tang, R.Y.; Au-Yeung, S.K.; Lam, H.; Kung, Y.Y.; Zhang, X.; Vugt, J.M.G. van; Minekawa, R.; Tang, M.H.; Wang, J.; Oudejans, C.B.; Lau, T.K.; Nicolaides, K.H.; Lo, Y.M.


    Massively parallel sequencing of DNA molecules in the plasma of pregnant women has been shown to allow accurate and noninvasive prenatal detection of fetal trisomy 21. However, whether the sequencing approach is as accurate for the noninvasive prenatal diagnosis of trisomy 13 and 18 is unclear due

  16. True single-molecule DNA sequencing of a pleistocene horse bone

    DEFF Research Database (Denmark)

    Orlando, Ludovic Antoine Alexandre; Ginolhac, Aurélien; Raghavan, Maanasa


    -preserved Pleistocene horse bone using the Helicos HeliScope and Illumina GAIIx platforms, respectively. We find that the percentage of endogenous DNA sequences derived from the horse is higher among the Helicos data than Illumina data. This result indicates that the molecular biology tools used to generate sequencing...

  17. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)


    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  18. Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes (United States)

    Roxbury, Daniel

    It is known that single-stranded DNA adopts a helical wrap around a single-walled carbon nanotube (SWCNT), forming a water-dispersible hybrid molecule. The ability to sort mixtures of SWCNTs based on chirality (electronic species) has recently been demonstrated using special short DNA sequences that recognize certain matching SWCNTs of specific chirality. This thesis investigates the intricacies of DNA-SWCNT sequence-specific interactions through both experimental and molecular simulation studies. The DNA-SWCNT binding strengths were experimentally quantified by studying the kinetics of DNA replacement by a surfactant on the surface of particular SWCNTs. Recognition ability was found to correlate strongly with measured binding strength, e.g. DNA sequence (TAT)4 was found to bind 20 times stronger to the (6,5)-SWCNT than sequence (TAT)4T. Next, using replica exchange molecular dynamics (REMD) simulations, equilibrium structures formed by (a) single-strands and (b) multiple-strands of 12-mer oligonucleotides adsorbed on various SWCNTs were explored. A number of structural motifs were discovered in which the DNA strand wraps around the SWCNT and 'stitches' to itself via hydrogen bonding. Great variability among equilibrium structures was observed and shown to be directly influenced by DNA sequence and SWCNT type. For example, the (6,5)-SWCNT DNA recognition sequence, (TAT)4, was found to wrap in a tight single-stranded right-handed helical conformation. In contrast, DNA sequence T12 forms a beta-barrel left-handed structure on the same SWCNT. These are the first theoretical indications that DNA-based SWCNT selectivity can arise on a molecular level. In a biomedical collaboration with the Mayo Clinic, pathways for DNA-SWCNT internalization into healthy human endothelial cells were explored. Through absorbance spectroscopy, TEM imaging, and confocal fluorescence microscopy, we showed that intracellular concentrations of SWCNTs far exceeded those of the incubation

  19. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)



    Nov 2, 2009 ... basic machinery of protein synthesis and regulation, but also in various ... The genomic DNA was isolated from Giant Panda muscle tissue according to the ... for 45 s, 72°C for 2 min in the first cycle and the anneal temperature deceased 0.2°C ..... edition, Cold Spring Harbor aboratory Press. Cold Spring ...

  20. DNA fingerprinting based on simple sequence repeat (SSR ...

    African Journals Online (AJOL)

    New varieties of sugarcane are protected using morphological descriptors, which have limitations in identifying morphologically similar cultivars. Development of a reliable DNA fingerprint system for identification of new varieties would contribute greatly to the breeding of these species. Microsatellite markers are tools with ...

  1. MotifMark: Finding regulatory motifs in DNA sequences. (United States)

    Hassanzadeh, Hamid Reza; Kolhe, Pushkar; Isbell, Charles L; Wang, May D


    The interaction between proteins and DNA is a key driving force in a significant number of biological processes such as transcriptional regulation, repair, recombination, splicing, and DNA modification. The identification of DNA-binding sites and the specificity of target proteins in binding to these regions are two important steps in understanding the mechanisms of these biological activities. A number of high-throughput technologies have recently emerged that try to quantify the affinity between proteins and DNA motifs. Despite their success, these technologies have their own limitations and fall short in precise characterization of motifs, and as a result, require further downstream analysis to extract useful and interpretable information from a haystack of noisy and inaccurate data. Here we propose MotifMark, a new algorithm based on graph theory and machine learning, that can find binding sites on candidate probes and rank their specificity in regard to the underlying transcription factor. We developed a pipeline to analyze experimental data derived from compact universal protein binding microarrays and benchmarked it against two of the most accurate motif search methods. Our results indicate that MotifMark can be a viable alternative technique for prediction of motif from protein binding microarrays and possibly other related high-throughput techniques.

  2. Potential of DNA sequences to identify zoanthids (Cnidaria: Zoantharia). (United States)

    Sinniger, Frederic; Reimer, James D; Pawlowski, Jan


    The order Zoantharia is known for its chaotic taxonomy and difficult morphological identification. One method that potentially could help for examining such troublesome taxa is DNA barcoding, which identifies species using standard molecular markers. The mitochondrial cytochrome oxidase subunit I (COI) has been utilized to great success in groups such as birds and insects; however, its applicability in many other groups is controversial. Recently, some studies have suggested that barcoding is not applicable to anthozoans. Here, we examine the use of COI and mitochondrial 16S ribosomal DNA for zoanthid identification. Despite the absence of a clear barcoding gap, our results show that for most of 54 zoanthid samples, both markers could separate samples to the species, or species group, level, particularly when easily accessible ecological or distributional data were included. Additionally, we have used the short V5 region of mt 16S rDNA to identify eight old (13 to 50 years old) museum samples. We discuss advantages and disadvantages of COI and mt 16S rDNA as barcodes for Zoantharia, and recommend that either one or both of these markers be considered for zoanthid identification in the future.

  3. Spliced DNA Sequences in the Paramecium Germline: Their Properties and Evolutionary Potential (United States)

    Catania, Francesco; McGrath, Casey L.; Doak, Thomas G.; Lynch, Michael


    Despite playing a crucial role in germline-soma differentiation, the evolutionary significance of developmentally regulated genome rearrangements (DRGRs) has received scant attention. An example of DRGR is DNA splicing, a process that removes segments of DNA interrupting genic and/or intergenic sequences. Perhaps, best known for shaping immune-system genes in vertebrates, DNA splicing plays a central role in the life of ciliated protozoa, where thousands of germline DNA segments are eliminated after sexual reproduction to regenerate a functional somatic genome. Here, we identify and chronicle the properties of 5,286 sequences that putatively undergo DNA splicing (i.e., internal eliminated sequences [IESs]) across the genomes of three closely related species of the ciliate Paramecium (P. tetraurelia, P. biaurelia, and P. sexaurelia). The study reveals that these putative IESs share several physical characteristics. Although our results are consistent with excision events being largely conserved between species, episodes of differential IES retention/excision occur, may have a recent origin, and frequently involve coding regions. Our findings indicate interconversion between somatic—often coding—DNA sequences and noncoding IESs, and provide insights into the role of DNA splicing in creating potentially functional genetic innovation. PMID:23737328

  4. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments. (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias


    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  5. Sequence-selective topoisomerase II inhibition by anthracycline derivatives in SV40 DNA: Relationship with DNA binding affinity and cytotoxicity

    International Nuclear Information System (INIS)

    Capranico, G.; Kohn, K.W.; Pommier, Y.; Zunino, F.


    Topoisomerase II mediated double-strand breaks produced by anthracycline analogues were studied in SV40 DNA. The compounds included doxorubicin, daunorubicin, two doxorubicin stereoisomers (4'-epimer and β-anomer), and five chromophore-modified derivatives, with a wide range of cytotoxic activity and DNA binding affinity. Cleavage of 32 P-end-labeled DNA fragments was visualized by autoradiography of agarose and polyacrylamide gels. Structure-activity relationships indicated that alterations in the chromophore structure greatly affected drug action on topoisomerase II. In particular, removal of substituents on position 4 of the D ring resulted in more active inducers of cleavage with lower DNA binding affinity. The stereochemistry between the sugar and the chromophore was also essential for activity. All the active anthracyclines induced a single region of prominent cleavage in the entire SV40 DNA, which resulted from a cluster of sites between nucleotides 4237 and 4294. DNA cleavage intensity patterns exhibited differences among analogues and were also dependent upon drug concentration. Intensity at a given site dependent on both stimulatory and suppressive effects depending upon drug concentration and DNA sequence. A good correlation was found between cytotoxicity and intensity of topoisomerase II mediated DNA breakage

  6. Unexpected DNA affinity and sequence selectivity through core rigidity in guanidinium-based minor groove binders. (United States)

    Nagle, Padraic S; McKeever, Caitriona; Rodriguez, Fernando; Nguyen, Binh; Wilson, W David; Rozas, Isabel


    In this paper we report the design and biophysical evaluation of novel rigid-core symmetric and asymmetric dicationic DNA binders containing 9H-fluorene and 9,10-dihydroanthracene cores as well as the synthesis of one of these fluorene derivatives. First, the affinity toward particular DNA sequences of these compounds and flexible core derivatives was evaluated by means of surface plasmon resonance and thermal denaturation experiments finding that the position of the cations significantly influence the binding strength. Then their affinity and mode of binding were further studied by performing circular dichroism and UV studies and the results obtained were rationalized by means of DFT calculations. We found that the fluorene derivatives prepared have the ability to bind to the minor groove of certain DNA sequences and intercalate to others, whereas the dihydroanthracene compounds bind via intercalation to all the DNA sequences studied here.

  7. Roles of genes and Alu repeats in nonlinear correlations of HUMHBB DNA sequence

    International Nuclear Information System (INIS)

    Xiao Yi; Huang Yanzhao


    DNA sequences of different species and different portion of the DNA of the same species may have completely different correlation properties, but the origin of these correlations is still not very clear and is currently being investigated, especially in different particular cases. We report here a study of the DNA sequence of human beta globin region (HUMHBB) which has strong linear and nonlinear correlations. We studied the roles of two of the typical elements of DNA sequence, genes and Alu repeats, in the nonlinear correlations of HUMHBB. We find that there exist strong nonlinear correlations between the exons or introns in different genes and between the Alu repeats. They may be one of the major sources of the nonlinear correlations in HUMBHB

  8. Applicability of Ion Torrent Colon and Lung sequencing panel on circulating cell-free DNA

    DEFF Research Database (Denmark)

    Demuth, Christina; Tranberg Madsen, Anne; Larsen, Anne Winther

    of targeted sequencing have been optimised for clinical use on FFPE, e.g. the Ion Torrent Colon and Lung panel. The size of DNA extracted from FFPE tissue is comparable with that from cfDNA. We therefore investigated the performance of the clinically relevant Ion Torrent Colon and Lung panel on cfDNA. Methods...... a baseline for the panel. Lastly, the panel was tested on 52 patient samples. Patient plasma samples are from a previously collected cohort of EGFR wild-type non-small cell lung cancer patients ( NCT02043002) All samples were sequenced using the Ion Torrent Oncomine Solid Tumor DNA kit...... (Colon and Lung panel) from Thermo Fisher. Sample preparation was performed using the Ion Torrent Chef and sequencing was performed on the Personal Genome Machine (PGM) system. Data was analyzed using the Torrent Suite software, and variants called by Ion Reporter. Results: No somatic mutations were...

  9. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences (United States)

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.


    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  10. DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T


    Choudhary, M.; Kaplan, Samuel


    This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T. The photosynthesis gene cluster is located within a ~73 kb AseI genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The da...

  11. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.


    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  12. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer. (United States)

    Álvarez-Martos, Isabel; Ferapontova, Elena E


    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Rapid detection and purification of sequence specific DNA binding proteins using magnetic separation

    Directory of Open Access Journals (Sweden)



    Full Text Available In this paper, a method for the rapid identification and purification of sequence specific DNA binding proteins based on magnetic separation is presented. This method was applied to confirm the binding of the human recombinant USF1 protein to its putative binding site (E-box within the human SOX3 protomer. It has been shown that biotinylated DNA attached to streptavidin magnetic particles specifically binds the USF1 protein in the presence of competitor DNA. It has also been demonstrated that the protein could be successfully eluted from the beads, in high yield and with restored DNA binding activity. The advantage of these procedures is that they could be applied for the identification and purification of any high-affinity sequence-specific DNA binding protein with only minor modifications.

  14. Characteristics of palindromic sequences in DNA of the sea urchin Stronglyocentrotus intermedius

    International Nuclear Information System (INIS)

    Brykov, V.A.; Kukhlevskii, A.D.


    The fraction of palindromic sequences in the nuclear DNA of the sea urchin S. intermedius was characterized. Using chromatography on hydroxyapatite and treatment with S1 nuclease, it was shown that the fraction of palindromic sequences more than doubles when the sodium concentration in solution is increased or the temperature of reassociation is lowered. The increase is due to the involvement of inverted repeats in reassociation, which are characterized by a substantial nonhomologous character and/or the presence of an extended intervening DNA sequence. It was found by the method of reassociation of a nicked palindrome fraction with an excess of total homologous DNA that most of the inverted repeats in the sea urchin genome are unique sequences. The complexity of the palindrome fraction was estimated at 8.2 x 10 7 nucleotide pairs, and the number of palindromes per haploid genome ∼ 500,000

  15. Distribution and sequence homogeneity of an abundant satellite DNA in the beetle, Tenebrio molitor. (United States)

    Davis, C A; Wyatt, G R


    The mealworm beetle, Tenebrio molitor, contains an unusually abundant and homogeneous satellite DNA which constitutes up to 60% of its genome. The satellite DNA is shown to be present in all of the chromosomes by in situ hybridization. 18 dimers of the repeat unit were cloned and sequenced. The consensus sequence is 142 nt long and lacks any internal repeat structure. Monomers of the sequence are very similar, showing on average a 2% divergence from the calculated consensus. Variant nucleotides are scattered randomly throughout the sequence although some variants are more common than others. Neighboring repeat units are no more alike than randomly chosen ones. The results suggest that some mechanism, perhaps gene conversion, is acting to maintain the homogeneity of the satellite DNA despite its abundance and distribution on all of the chromosomes. Images PMID:2762148

  16. Mitochondrial DNA D-loop sequence variation among 5 maternal lines of the Zemaitukai horse breed

    Directory of Open Access Journals (Sweden)

    E. Gus Cothran


    Full Text Available Genetic variation in Zemaitukai horses was investigated using mitochondrial DNA (mtDNA sequencing. The study was performed on 421 bp of the mitochondrial DNA control region, which is known to be more variable than other sections of the mitochondrial genome. Samples from each of the remaining maternal family lines of Zemaitukai horses and three random samples for other Lithuanian (Lithuanian Heavy Draught, Zemaitukai large type and ten European horse breeds were sequenced. Five distinct haplotypes were obtained for the five Zemaitukai maternal families supporting the pedigree data. The minimal difference between two different sequence haplotypes was 6 and the maximal 11 nucleotides in Zemaitukai horse breed. A total of 20 nucleotide differences compared to the reference sequence were found in Lithuanian horse breeds. Genetic cluster analysis did not shown any clear pattern of relationship among breeds of different type.

  17. Using TESS to predict transcription factor binding sites in DNA sequence. (United States)

    Schug, Jonathan


    This unit describes how to use the Transcription Element Search System (TESS). This Web site predicts transcription factor binding sites (TFBS) in DNA sequence using two different kinds of models of sites, strings and positional weight matrices. The binding of transcription factors to DNA is a major part of the control of gene expression. Transcription factors exhibit sequence-specific binding; they form stronger bonds to some DNA sequences than to others. Identification of a good binding site in the promoter for a gene suggests the possibility that the corresponding factor may play a role in the regulation of that gene. However, the sequences transcription factors recognize are typically short and allow for some amount of mismatch. Because of this, binding sites for a factor can typically be found at random every few hundred to a thousand base pairs. TESS has features to help sort through and evaluate the significance of predicted sites.

  18. Cloning, sequencing, and expression of cDNA for human β-glucuronidase

    International Nuclear Information System (INIS)

    Oshima, A.; Kyle, J.W.; Miller, R.D.


    The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length

  19. The chemical structure of DNA sequence signals for RNA transcription (United States)

    George, D. G.; Dayhoff, M. O.


    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  20. Algorithms for mapping high-throughput DNA sequences

    DEFF Research Database (Denmark)

    Frellsen, Jes; Menzel, Peter; Krogh, Anders


    of data generation, new bioinformatics approaches have been developed to cope with the large amount of sequencing reads obtained in these experiments. In this chapter, we first introduce HTS technologies and their usage in molecular biology and discuss the problem of mapping sequencing reads...... to their genomic origin. We then in detail describe two approaches that offer very fast heuristics to solve the mapping problem in a feasible runtime. In particular, we describe the BLAT algorithm, and we give an introduction to the Burrows-Wheeler Transform and the mapping algorithms based on this transformation....

  1. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight (United States)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  2. Highly parallel translation of DNA sequences into small molecules.

    Directory of Open Access Journals (Sweden)

    Rebecca M Weisinger

    Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

  3. Mitochondrial DNA sequence variation in human evolution and disease. (United States)

    Wallace, D C


    Germ-line and somatic mtDNA mutations are hypothesized to act together to shape our history and our health. Germ-line mtDNA mutations, both ancient and recent, have been associated with a variety of degenerative diseases. Mildly to moderately deleterious germ-line mutations, like neutral polymorphisms, have become established in the distant past through genetic drift but now may predispose certain individuals to late-onset degenerative diseases. As an example, a homoplasmic, Caucasian, tRNA(Gln) mutation at nucleotide pair (np) 4336 has been observed in 5% of Alzheimer disease and Parkinson disease patients and may contribute to the multifactorial etiology of these diseases. Moderately to severely deleterious germ-line mutations, on the other hand, appear repeatedly but are eliminated by selection. Hence, all extant mutations of this class are recent and associated with more devastating diseases of young adults and children. Representative of these mutations is a heteroplasmic mutation in MTND6 at np 14459 whose clinical presentations range from adult-onset blindness to pediatric dystonia and basal ganglial degeneration. To the inherited mutations are added somatic mtDNA mutations which accumulate in random arrays within stable tissues. These mutations provide a molecular clock that measures our age and may cause a progressive decline in tissue energy output that could precipitate the onset of degenerative diseases in individuals harboring inherited deleterious mutations.

  4. Mitochondrial DNA sequence variation in the Anatolian Peninsula ...

    Indian Academy of Sciences (India)


    necting the Middle East, Europe and Central Asia, and, thus, has been subject to major population movements. The ... from different parts of Anatolia by direct sequencing. Analysis of the two ... the country, samples were obtained from individuals com- ing from ..... Arlequin: a software environment for the analysis of popula-.

  5. The DNA sequence, annotation and analysis of human chromosome 3

    DEFF Research Database (Denmark)

    Muzny, D.M.; Bolund, Lars; As part of the Chinese Human Genome Sequencing Consortium, E.T.A.L.


    as numerous loci involved in multiple human cancers such as the gene encoding FHIT, which contains the most common constitutive fragile site in the genome, FRA3B. Using genomic sequence from chimpanzee and rhesus macaque, we were able to characterize the breakpoints defining a large pericentric inversion...

  6. Short Note DNA sequences from the Little Brown Bustard Eupodotis ...

    African Journals Online (AJOL)

    Taxonomic classification of birds based exclusively on morphology and plumage traits has often been found to be inconsistent with true evolutionary history when tested with molecular phylogenies based on neutrally evolving markers. Here we present cytochrome-b gene sequences for the poorly known Little Brown ...

  7. Identification of circo-like virus-Brazil genomic sequences in raw sewage from the metropolitan area of São Paulo: evidence of circulation two and three years after the first detection

    Directory of Open Access Journals (Sweden)

    Silvana Beres Castrignano

    Full Text Available BACKGROUND Two novel viruses named circo-like virus-Brazil (CLV-BR hs1 and hs2 were previously discovered in a Brazilian human fecal sample through metagenomics. CLV-BR hs1 and hs2 possess a small circular DNA genome encoding a replication initiator protein (Rep, and the two genomes exhibit 92% nucleotide identity with each other. Phylogenetic analysis based on the Rep protein showed that CLV-BRs do not cluster with circoviruses, nanoviruses, geminiviruses or cycloviruses. OBJECTIVE The aim of this study was to search for CLV-BR genomes in sewage and reclaimed water samples from the metropolitan area of São Paulo, Brazil, to verify whether the first detection of these viruses was an isolated finding. METHODS Sewage and reclaimed water samples collected concomitantly during the years 2005-2006 were purified and concentrated using methodologies designed for the study of viruses. A total of 177 treated reclaimed water samples were grouped into five pools, as were 177 treated raw sewage samples. Nucleic acid extraction, polymerase chain reaction (PCR amplification and Sanger sequencing were then performed.e FINDINGS CLV-BR genomes were detected in two pools of sewage samples, p6 and p9. Approximately 28% and 51% of the CLV-BR genome was amplified from p6 and p9, respectively, including 76% of the Rep gene. The detected genomes are most likely related to CLV-BR hs1. Comparative analysis showed several synonymous substitutions within Rep-encoding sequences, suggesting purifying selection for this gene, as has been observed for other eukaryotic circular Rep-encoding single-stranded DNA (CRESS-DNA viruses. MAIN CONCLUSION The results therefore indicated that CLV-BR has continued to circulate in Brazil two and three years after first being detected.

  8. Ligation bias in illumina next-generation DNA libraries: implications for sequencing ancient genomes.

    Directory of Open Access Journals (Sweden)

    Andaine Seguin-Orlando

    Full Text Available Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by-products, resulting from post-mortem DNA damage. Such chemical modifications can interfere with the molecular tools used for building second-generation DNA libraries, and limit our ability to fully characterize the true complexity of ancient DNA extracts. In this study, we first use fresh DNA extracts to demonstrate that library preparation based on adapter ligation at AT-overhangs are biased against DNA templates starting with thymine residues, contrarily to blunt-end adapter ligation. We observe the same bias on fresh DNA extracts sheared on Bioruptor, Covaris and nebulizers. This contradicts previous reports suggesting that this bias could originate from the methods used for shearing DNA. This also suggests that AT-overhang adapter ligation efficiency is affected in a sequence-dependent manner and results in an uneven representation of different genomic contexts. We then show how this bias could affect the base composition of ancient DNA libraries prepared following AT-overhang ligation, mainly by limiting the ability to ligate DNA templates starting with thymines and therefore deaminated cytosines. This results in particular nucleotide misincorporation damage patterns, deviating from the signature generally expected for authenticating ancient sequence data. Consequently, we show that models adequate for estimating post-mortem DNA damage levels must be robust to the molecular tools used for building ancient DNA libraries.

  9. Ultra-deep sequencing of mouse mitochondrial DNA: mutational patterns and their origins.

    Directory of Open Access Journals (Sweden)

    Adam Ameur


    Full Text Available Somatic mutations of mtDNA are implicated in the aging process, but there is no universally accepted method for their accurate quantification. We have used ultra-deep sequencing to study genome-wide mtDNA mutation load in the liver of normally- and prematurely-aging mice. Mice that are homozygous for an allele expressing a proof-reading-deficient mtDNA polymerase (mtDNA mutator mice have 10-times-higher point mutation loads than their wildtype siblings. In addition, the mtDNA mutator mice have increased levels of a truncated linear mtDNA molecule, resulting in decreased sequence coverage in the deleted region. In contrast, circular mtDNA molecules with large deletions occur at extremely low frequencies in mtDNA mutator mice and can therefore not drive the premature aging phenotype. Sequence analysis shows that the main proportion of the mutation load in heterozygous mtDNA mutator mice and their wildtype siblings is inherited from their heterozygous mothers consistent with germline transmission. We found no increase in levels of point mutations or deletions in wildtype C57Bl/6N mice with increasing age, thus questioning the causative role of these changes in aging. In addition, there was no increased frequency of transversion mutations with time in any of the studied genotypes, arguing against oxidative damage as a major cause of mtDNA mutations. Our results from studies of mice thus indicate that most somatic mtDNA mutations occur as replication errors during development and do not result from damage accumulation in adult life.

  10. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation. (United States)

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip


    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  11. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship]. (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren


    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  12. Comparison of microbial DNA enrichment tools for metagenomic whole genome sequencing. (United States)

    Thoendel, Matthew; Jeraldo, Patricio R; Greenwood-Quaintance, Kerryl E; Yao, Janet Z; Chia, Nicholas; Hanssen, Arlen D; Abdel, Matthew P; Patel, Robin


    Metagenomic whole genome sequencing for detection of pathogens in clinical samples is an exciting new area for discovery and clinical testing. A major barrier to this approach is the overwhelming ratio of human to pathogen DNA in samples with low pathogen abundance, which is typical of most clinical specimens. Microbial DNA enrichment methods offer the potential to relieve this limitation by improving this ratio. Two commercially available enrichment kits, the NEBNext Microbiome DNA Enrichment Kit and the Molzym MolYsis Basic kit, were tested for their ability to enrich for microbial DNA from resected arthroplasty component sonicate fluids from prosthetic joint infections or uninfected sonicate fluids spiked with Staphylococcus aureus. Using spiked uninfected sonicate fluid there was a 6-fold enrichment of bacterial DNA with the NEBNext kit and 76-fold enrichment with the MolYsis kit. Metagenomic whole genome sequencing of sonicate fluid revealed 13- to 85-fold enrichment of bacterial DNA using the NEBNext enrichment kit. The MolYsis approach achieved 481- to 9580-fold enrichment, resulting in 7 to 59% of sequencing reads being from the pathogens known to be present in the samples. These results demonstrate the usefulness of these tools when testing clinical samples with low microbial burden using next generation sequencing. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Integration of hepatitis B virus DNA in chromosome-specific satellite sequences

    International Nuclear Information System (INIS)

    Shaul, Y.; Garcia, P.D.; Schonberg, S.; Rutter, W.J.


    The authors previously reported the cloning and detailed analysis of the integrated hepatitis B virus sequences in a human hepatoma cell line. They report here the integration of at least one of hepatitis B virus at human satellite DNA sequences. The majority of the cellular sequences identified by this satellite were organized as a multimeric composition of a 0.6-kilobase EcoRI fragment. This clone hybridized in situ almost exclusively to the centromeric heterochromatin of chromosomes 1 and 16 and to a lower extent to chromosome 2 and to the heterochromatic region of the Y chromosome. The immediate flanking host sequence appeared as a hierarchy of repeating units which were almost identical to a previously reported human satellite III DNA sequence

  14. Applications of statistical physics and information theory to the analysis of DNA sequences (United States)

    Grosse, Ivo


    DNA carries the genetic information of most living organisms, and the of genome projects is to uncover that genetic information. One basic task in the analysis of DNA sequences is the recognition of protein coding genes. Powerful computer programs for gene recognition have been developed, but most of them are based on statistical patterns that vary from species to species. In this thesis I address the question if there exist universal statistical patterns that are different in coding and noncoding DNA of all living species, regardless of their phylogenetic origin. In search for such species-independent patterns I study the mutual information function of genomic DNA sequences, and find that it shows persistent period-three oscillations. To understand the biological origin of the observed period-three oscillations, I compare the mutual information function of genomic DNA sequences to the mutual information function of stochastic model sequences. I find that the pseudo-exon model is able to reproduce the mutual information function of genomic DNA sequences. Moreover, I find that a generalization of the pseudo-exon model can connect the existence and the functional form of long-range correlations to the presence and the length distributions of coding and noncoding regions. Based on these theoretical studies I am able to find an information-theoretical quantity, the average mutual information (AMI), whose probability distributions are significantly different in coding and noncoding DNA, while they are almost identical in all studied species. These findings show that there exist universal statistical patterns that are different in coding and noncoding DNA of all studied species, and they suggest that the AMI may be used to identify genes in different living species, irrespective of their taxonomic origin.

  15. DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding. (United States)

    Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford


    Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at or Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  16. Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes. (United States)

    Sadikovic, Bekim; Wang, Jing; El-Hattab, Ayman W; Landsverk, Megan; Douglas, Ganka; Brundage, Ellen K; Craigen, William J; Schmitt, Eric S; Wong, Lee-Jun C


    Mitochondrial DNA (mtDNA) deletions are a common cause of mitochondrial disorders. Large mtDNA deletions can lead to a broad spectrum of clinical features with different age of onset, ranging from mild mitochondrial myopathies (MM), progressive external ophthalmoplegia (PEO), and Kearns-Sayre syndrome (KSS), to severe Pearson syndrome. The aim of this study is to investigate the molecular signatures surrounding the deletion breakpoints and their association with the clinical phenotype and age at onset. MtDNA deletions in 67 patients were characterized using array comparative genomic hybridization (aCGH) followed by PCR-sequencing of the deletion junctions. Sequence homology including both perfect and imperfect short repeats flanking the deletion regions were analyzed and correlated with clinical features and patients' age group. In all age groups, there was a significant increase in sequence homology flanking the deletion compared to mtDNA background. The youngest patient group (deletion distribution in size and locations, with a significantly lower sequence homology flanking the deletion, and the highest percentage of deletion mutant heteroplasmy. The older age groups showed rather discrete pattern of deletions with 44% of all patients over 6 years old carrying the most common 5 kb mtDNA deletion, which was found mostly in muscle specimens (22/41). Only 15% (3/20) of the young patients (deletion, which is usually present in blood rather than muscle. This group of patients predominantly (16 out of 17) exhibit multisystem disorder and/or Pearson syndrome, while older patients had predominantly neuromuscular manifestations including KSS, PEO, and MM. In conclusion, sequence homology at the deletion flanking regions is a consistent feature of mtDNA deletions. Decreased levels of sequence homology and increased levels of deletion mutant heteroplasmy appear to correlate with earlier onset and more severe disease with multisystem involvement.

  17. Reconstruction of DNA sequences using genetic algorithms and cellular automata: towards mutation prediction? (United States)

    Mizas, Ch; Sirakoulis, G Ch; Mardiris, V; Karafyllidis, I; Glykos, N; Sandaltzopoulos, R


    Change of DNA sequence that fuels evolution is, to a certain extent, a deterministic process because mutagenesis does not occur in an absolutely random manner. So far, it has not been possible to decipher the rules that govern DNA sequence evolution due to the extreme complexity of the entire process. In our attempt to approach this issue we focus solely on the mechanisms of mutagenesis and deliberately disregard the role of natural selection. Hence, in this analysis, evolution refers to the accumulation of genetic alterations that originate from mutations and are transmitted through generations without being subjected to natural selection. We have developed a software tool that allows modelling of a DNA sequence as a one-dimensional cellular automaton (CA) with four states per cell which correspond to the four DNA bases, i.e. A, C, T and G. The four states are represented by numbers of the quaternary number system. Moreover, we have developed genetic algorithms (GAs) in order to determine the rules of CA evolution that simulate the DNA evolution process. Linear evolution rules were considered and square matrices were used to represent them. If DNA sequences of different evolution steps are available, our approach allows the determination of the underlying evolution rule(s). Conversely, once the evolution rules are deciphered, our tool may reconstruct the DNA sequence in any previous evolution step for which the exact sequence information was unknown. The developed tool may be used to test various parameters that could influence evolution. We describe a paradigm relying on the assumption that mutagenesis is governed by a near-neighbour-dependent mechanism. Based on the satisfactory performance of our system in the deliberately simplified example, we propose that our approach could offer a starting point for future attempts to understand the mechanisms that govern evolution. The developed software is open-source and has a user-friendly graphical input interface.

  18. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.


    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA


    Chiba, Satoshi


    An endemic land snail genus Mandarina of the oceanic Bonin (Ogasawara) Islands shows exceptionally rapid evolution not only of morphological and ecological traits, but of DNA sequence. A phylogenetic relationship based on mitochondrial DNA (mtDNA) sequences suggests that morphological differences equivalent to the differences between families were produced between Mandarina and its ancestor during the Pleistocene. The inferred phylogeny shows that species with similar morphologies and life habitats appeared repeatedly and independently in different lineages and islands at different times. Sequential adaptive radiations occurred in different islands of the Bonin Islands and species occupying arboreal, semiarboreal, and terrestrial habitat arose independently in each island. Because of a close relationship between shell morphology and life habitat, independent evolution of the same life habitat in different islands created species possesing the same shell morphology in different islands and lineages. This rapid evolution produced some incongruences between phylogenetic relationship and species taxonomy. Levels of sequence divergence of mtDNA among the species of Mandarina is extremely high. The maximum level of sequence divergence at 16S and 12S ribosomal RNA sequence within Mandarina are 18.7% and 17.7%, respectively, and this suggests that evolution of mtDNA of Mandarina is extremely rapid, more than 20 times faster than the standard rate in other animals. The present examination reveals that evolution of morphological and ecological traits occurs at extremely high rates in the time of adaptive radiation, especially in fragmented environments. © 1999 The Society for the Study of Evolution.

  20. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    International Nuclear Information System (INIS)

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S.; Arbuthnot, Patrick


    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.

  1. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    Energy Technology Data Exchange (ETDEWEB)

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S. [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa); Arbuthnot, Patrick, E-mail: [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa)


    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.

  2. Rational design of DNA sequences for nanotechnology, microarrays and molecular computers using Eulerian graphs. (United States)

    Pancoska, Petr; Moravek, Zdenek; Moll, Ute M


    Nucleic acids are molecules of choice for both established and emerging nanoscale technologies. These technologies benefit from large functional densities of 'DNA processing elements' that can be readily manufactured. To achieve the desired functionality, polynucleotide sequences are currently designed by a process that involves tedious and laborious filtering of potential candidates against a series of requirements and parameters. Here, we present a complete novel methodology for the rapid rational design of large sets of DNA sequences. This method allows for the direct implementation of very complex and detailed requirements for the generated sequences, thus avoiding 'brute force' filtering. At the same time, these sequences have narrow distributions of melting temperatures. The molecular part of the design process can be done without computer assistance, using an efficient 'human engineering' approach by drawing a single blueprint graph that represents all generated sequences. Moreover, the method eliminates the necessity for extensive thermodynamic calculations. Melting temperature can be calculated only once (or not at all). In addition, the isostability of the sequences is independent of the selection of a particular set of thermodynamic parameters. Applications are presented for DNA sequence designs for microarrays, universal microarray zip sequences and electron transfer experiments.

  3. Plasmid P1 replication: negative control by repeated DNA sequences.


    Chattoraj, D; Cordes, K; Abeles, A


    The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pi...

  4. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection (United States)

    Tam, Phuong Dinh; Trung, Tran; Tuan, Mai Anh; Chien, Nguyen Duc


    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when immerged in double distilled water and kept refrigerated.

  5. Structural basis for sequence-specific recognition of DNA by TAL effectors

    KAUST Repository

    Deng, Dong


    TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat comprises 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13. Here, we report the crystal structures of an 11.5-repeat TAL effector in both DNA-free and DNA-bound states. Each TAL repeat comprises two helices connected by a short RVD-containing loop. The 11.5 repeats form a right-handed, superhelical structure that tracks along the sense strand of DNA duplex, with RVDs contacting the major groove. The 12th residue stabilizes the RVD loop, whereas the 13th residue makes a base-specific contact. Understanding DNA recognition by TAL effectors may facilitate rational design of DNA-binding proteins with biotechnological applications.

  6. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    International Nuclear Information System (INIS)

    Phuong Dinh Tam; Mai Anh Tuan; Tran Trung; Nguyen Duc Chien


    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when emerged in double distilled water and kept refrigerated.

  7. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Phuong Dinh Tam; Mai Anh Tuan [International Training Institute for Materials Science (Viet Nam); Tran Trung [Department of Electrochemistry, Hung-Yen University of Technology and Education (Viet Nam); Nguyen Duc Chien [Institute of Engineering Physics, Hanoi University of Technology, 1 Dai Co Viet Road, Hanoi (Viet Nam)], E-mail:


    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when emerged in double distilled water and kept refrigerated.

  8. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo


    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical interactions of the primase with the DNA template to explain the basis of specificity have not been demonstrated. Using a combination of surface plasmon resonance and biochemical assays, we show that T7 DNA primase has only a slightly higher affinity for DNA containing the primase recognition sequence (5\\'-TGGTC-3\\') than for DNA lacking the recognition site. However, this binding is drastically enhanced by the presence of the cognate Nucleoside triphosphates (NTPs), Adenosine triphosphate (ATP) and Cytosine triphosphate (CTP) that are incorporated into the primer, pppACCA. Formation of the dimer, pppAC, the initial step of sequence-specific primer synthesis, is not sufficient for the stable binding. Preformed primers exhibit significantly less selective binding than that observed with ATP and CTP. Alterations in subdomains of the primase result in loss of selective DNA binding. We present a model in which conformational changes induced during primer synthesis facilitate contact between the zinc-binding domain and the polymerase domain. The Author(s) 2010. Published by Oxford University Press.

  9. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.


    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

  10. Oxidative DNA damage in lung tissue from patients with COPD is clustered in functionally significant sequences

    Directory of Open Access Journals (Sweden)

    Viktor M Pastukh


    Full Text Available Viktor M Pastukh1, Li Zhang2, Mykhaylo V Ruchko1, Olena Gorodnya1, Gina C Bardwell1, Rubin M Tuder2, Mark N Gillespie11Department of Pharmacology and Center for Lung Biology, University of South Alabama College of Medicine, Mobile, AL, USA; 2Program in Translational Lung Research, Division of Pulmonary Sciences and Critical Care Medicine, Department of Medicine, University of Colorado at Denver, Aurora, CO, USAAbstract: Lung tissue from COPD patients displays oxidative DNA damage. The present study determined whether oxidative DNA damage was randomly distributed or whether it was localized in specific sequences in either the nuclear or mitochondrial genomes. The DNA damage-specific histone, gamma-H2AX, was detected immunohistochemically in alveolar wall cells in lung tissue from COPD patients but not control subjects. A PCR-based method was used to search for oxidized purine base products in selected 200 bp sequences in promoters and coding regions of the VEGF, TGF-β1, HO-1, Egr1, and β-actin genes while quantitative Southern blot analysis was used to detect oxidative damage to the mitochondrial genome in lung tissue from control subjects and COPD patients. Among the nuclear genes examined, oxidative damage was detected in only 1 sequence in lung tissue from COPD patients: the hypoxic response element (HRE of the VEGF promoter. The content of VEGF mRNA also was reduced in COPD lung tissue. Mitochondrial DNA content was unaltered in COPD lung tissue, but there was a substantial increase in mitochondrial DNA strand breaks and/or abasic sites. These findings show that oxidative DNA damage in COPD lungs is prominent in the HRE of the VEGF promoter and in the mitochondrial genome and raise the intriguing possibility that genome and sequence-specific oxidative DNA damage could contribute to transcriptional dysregulation and cell fate decisions in COPD.Keywords: DNA damage, VEGF hypoxic response element, mtDNA, COPD

  11. Evaluation of DNA bending models in their capacity to predict electrophoretic migration anomalies of satellite DNA sequences. (United States)

    Matyášek, Roman; Fulneček, Jaroslav; Kovařík, Aleš


    DNA containing a sequence that generates a local curvature exhibits a pronounced retardation in electrophoretic mobility. Various theoretical models have been proposed to explain relationship between DNA structural features and migration anomaly. Here, we studied the capacity of 15 static wedge-bending models to predict electrophoretic behavior of 69 satellite monomers derived from four divergent families. All monomers exhibited retarded mobility in PAGE corresponding to retardation factors ranging 1.02-1.54. The curvature varied both within and across the groups and correlated with the number, position, and lengths of A-tracts. Two dinucleotide models provided strong correlation between gel mobility and curvature prediction; two trinucleotide models were satisfactory while remaining dinucleotide models provided intermediate results with reliable prediction for subsets of sequences only. In some cases, similarly shaped molecules exhibited relatively large differences in mobility and vice versa. Generally less accurate predictions were obtained in groups containing less homogeneous sequences possessing distinct structural features. In conclusion, relatively universal theoretical models were identified suitable for the analysis of natural sequences known to harbor relatively moderate curvature. These models could be potentially applied to genome wide studies. However, in silico predictions should be viewed in context of experimental measurement of intrinsic DNA curvature. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23

    International Nuclear Information System (INIS)

    Ghaffari, S.H.; Olson, M.O.J.


    Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved

  13. Construction of a cDNA library and preliminary analysis of expressed sequence tags in Piper hainanense. (United States)

    Fan, R; Ling, P; Hao, C Y; Li, F P; Huang, L F; Wu, B D; Wu, H S


    Black pepper is a perennial climbing vine. It is widely cultivated because its berries can be utilized not only as a spice in food but also for medicinal use. This study aimed to construct a standardized, high-quality cDNA library to facilitated identification of new Piper hainanense transcripts. For this, 262 unigenes were used to generate raw reads. The average length of these 262 unigenes was 774.8 bp. Of these, 94 genes (35.9%) were newly identified, according to the NCBI protein database. Thus, identification of new genes may broaden the molecular knowledge of P. hainanense on the basis of Clusters of Orthologous Groups and Gene Ontology categories. In addition, certain basic genes linked to physiological processes, which can contribute to disease resistance and thereby to the breeding of black pepper. A total of 26 unigenes were found to be SSR markers. Dinucleotide SSR was the main repeat motif, accounting for 61.54%, followed by trinucleotide SSR (23.07%). Eight primer pairs successfully amplified DNA fragments and detected significant amounts of polymorphism among twenty-one piper germplasm. These results present a novel sequence information of P. hainanense, which can serve as the foundation for further genetic research on this species.

  14. [The use of 16S rDNA sequencing in species diversity analysis for sputum of patients with ventilator-associated pneumonia]. (United States)

    Yang, Xiaojun; Wang, Xiaohong; Liang, Zhijuan; Zhang, Xiaoya; Wang, Yanbo; Wang, Zhenhai


    To study the species and amount of bacteria in sputum of patients with ventilator-associated pneumonia (VAP) by using 16S rDNA sequencing analysis, and to explore the new method for etiologic diagnosis of VAP. Bronchoalveolar lavage sputum samples were collected from 31 patients with VAP. Bacterial DNA of the samples were extracted and identified by polymerase chain reaction (PCR). At the same time, sputum specimens were processed for routine bacterial culture. The high flux sequencing experiment was conducted on PCR positive samples with 16S rDNA macro genome sequencing technology, and sequencing results were analyzed using bioinformatics, then the results between the sequencing and bacteria culture were compared. (1) 550 bp of specific DNA sequences were amplified in sputum specimens from 27 cases of the 31 patients with VAP, and they were used for sequencing analysis. 103 856 sequences were obtained from those sputum specimens using 16S rDNA sequencing, yielding approximately 39 Mb of raw data. Tag sequencing was able to inform genus level in all 27 samples. (2) Alpha-diversity analysis showed that sputum samples of patients with VAP had significantly higher variability and richness in bacterial species (Shannon index values 1.20, Simpson index values 0.48). Rarefaction curve analysis showed that there were more species that were not detected by sequencing from some VAP sputum samples. (3) Analysis of 27 sputum samples with VAP by using 16S rDNA sequences yielded four phyla: namely Acitinobacteria, Bacteroidetes, Firmicutes, Proteobacteria. With genus as a classification, it was found that the dominant species included Streptococcus 88.9% (24/27), Limnohabitans 77.8% (21/27), Acinetobacter 70.4% (19/27), Sphingomonas 63.0% (17/27), Prevotella 63.0% (17/27), Klebsiella 55.6% (15/27), Pseudomonas 55.6% (15/27), Aquabacterium 55.6% (15/27), and Corynebacterium 55.6% (15/27). (4) Pyrophosphate sequencing discovered that Prevotella, Limnohabitans, Aquabacterium

  15. Amplification of a transcriptionally active DNA sequence in the human brain

    International Nuclear Information System (INIS)

    Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.


    The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days

  16. Determining physical constraints in transcriptional initiationcomplexes using DNA sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Shultzaberger, Ryan K.; Chiang, Derek Y.; Moses, Alan M.; Eisen,Michael B.


    Eukaryotic gene expression is often under the control ofcooperatively acting transcription factors whose binding is limited bystructural constraints. By determining these structural constraints, wecan understand the "rules" that define functional cooperativity.Conversely, by understanding the rules of binding, we can inferstructural characteristics. We have developed an information theory basedmethod for approximating the physical limitations of cooperativeinteractions by comparing sequence analysis to microarray expressiondata. When applied to the coordinated binding of the sulfur amino acidregulatory protein Met4 by Cbf1 and Met31, we were able to create acombinatorial model that can correctly identify Met4 regulatedgenes.

  17. Germline Variants in Targeted Tumor Sequencing Using Matched Normal DNA. (United States)

    Schrader, Kasmintan A; Cheng, Donavan T; Joseph, Vijai; Prasad, Meera; Walsh, Michael; Zehir, Ahmet; Ni, Ai; Thomas, Tinu; Benayed, Ryma; Ashraf, Asad; Lincoln, Annie; Arcila, Maria; Stadler, Zsofia; Solit, David; Hyman, David M; Hyman, David; Zhang, Liying; Klimstra, David; Ladanyi, Marc; Offit, Kenneth; Berger, Michael; Robson, Mark


    Tumor genetic sequencing identifies potentially targetable genetic alterations with therapeutic implications. Analysis has concentrated on detecting tumor-specific variants, but recognition of germline variants may prove valuable as well. To estimate the burden of germline variants identified through routine clinical tumor sequencing. Patients with advanced cancer diagnoses eligible for studies of targeted agents at Memorial Sloan Kettering Cancer Center are offered tumor-normal sequencing with MSK-IMPACT, a 341-gene panel. We surveyed the germline variants seen in 187 overlapping genes with Mendelian disease associations in 1566 patients who had undergone tumor profiling between March and October 2014. The number of presumed pathogenic germline variants (PPGVs) and variants of uncertain significance per person in 187 genes associated with single-gene disorders and the proportions of individuals with PPGVs in clinically relevant gene subsets, in genes consistent with known tumor phenotypes, and in genes with evidence of second somatic hits in their tumors. The mean age of the 1566 patients was 58 years, and 54% were women. Presumed pathogenic germline variants in known Mendelian disease-associated genes were identified in 246 of 1566 patients (15.7%; 95% CI, 14.0%-17.6%), including 198 individuals with mutations in genes associated with cancer susceptibility. Germline findings in cancer susceptibility genes were concordant with the individual's cancer type in only 81 of 198 cases (40.9%; 95% CI, 34.3%-47.9%). In individuals with PPGVs retained in the tumor, somatic alteration of the other allele was seen in 39 of 182 cases (21.4%; 95% CI, 16.1%-28.0%), of which 13 cases did not show a known correlation of the germline mutation and a known syndrome. Mutations in non-cancer-related Mendelian disease genes were seen in 55 of 1566 cases (3.5%; 95% CI, 27.1%-45.4%). Almost every individual had more than 1 variant of uncertain significance (1565 of 1566 patients; 99

  18. Computational optimisation of targeted DNA sequencing for cancer detection

    DEFF Research Database (Denmark)

    Martinez, Pierre; McGranahan, Nicholas; Birkbak, Nicolai Juul


    Despite recent progress thanks to next-generation sequencing technologies, personalised cancer medicine is still hampered by intra-tumour heterogeneity and drug resistance. As most patients with advanced metastatic disease face poor survival, there is need to improve early diagnosis. Analysing...... detection. Dividing 4,467 samples into one discovery and two independent validation cohorts, we show that up to 76% of 10 cancer types harbour at least one mutation in a panel of only 25 genes, with high sensitivity across most tumour types. Our analyses demonstrate that targeting "hotspot" regions would...

  19. A DNA sequence element that advances replication origin activation time in Saccharomyces cerevisiae. (United States)

    Pohl, Thomas J; Kolor, Katherine; Fangman, Walton L; Brewer, Bonita J; Raghuraman, M K


    Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time.

  20. A novel color image encryption scheme using fractional-order hyperchaotic system and DNA sequence operations

    International Nuclear Information System (INIS)

    Zhang Li-Min; Sun Ke-Hui; Liu Wen-Hao; He Shao-Bo


    In this paper, Adomian decomposition method (ADM) with high accuracy and fast convergence is introduced to solve the fractional-order piecewise-linear (PWL) hyperchaotic system. Based on the obtained hyperchaotic sequences, a novel color image encryption algorithm is proposed by employing a hybrid model of bidirectional circular permutation and DNA masking. In this scheme, the pixel positions of image are scrambled by circular permutation, and the pixel values are substituted by DNA sequence operations. In the DNA sequence operations, addition and substraction operations are performed according to traditional addition and subtraction in the binary, and two rounds of addition rules are used to encrypt the pixel values. The simulation results and security analysis show that the hyperchaotic map is suitable for image encryption, and the proposed encryption algorithm has good encryption effect and strong key sensitivity. It can resist brute-force attack, statistical attack, differential attack, known-plaintext, and chosen-plaintext attacks. (paper)

  1. ADN-Viewer: a 3D approach for bioinformatic analyses of large DNA sequences. (United States)

    Hérisson, Joan; Ferey, Nicolas; Gros, Pierre-Emmanuel; Gherbi, Rachid


    Most of biologists work on textual DNA sequences that are limited to the linear representation of DNA. In this paper, we address the potential offered by Virtual Reality for 3D modeling and immersive visualization of large genomic sequences. The representation of the 3D structure of naked DNA allows biologists to observe and analyze genomes in an interactive way at different levels. We developed a powerful software platform that provides a new point of view for sequences analysis: ADNViewer. Nevertheless, a classical eukaryotic chromosome of 40 million base pairs requires about 6 Gbytes of 3D data. In order to manage these huge amounts of data in real-time, we designed various scene management algorithms and immersive human-computer interaction for user-friendly data exploration. In addition, one bioinformatics study scenario is proposed.

  2. Identification of tissue-embedded ascarid larvae by ribosomal DNA sequencing. (United States)

    Ishiwata, Kenji; Shinohara, Akio; Yagi, Kinpei; Horii, Yoichiro; Tsuchiya, Kimiyuki; Nawa, Yukifumi


    Polymerase chain reaction (PCR) was applied to identify tissue-embedded ascarid nematode larvae. Two sequences of the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA), ITS1 and ITS2, of the ascarid parasites were amplified and compared with those of ascarid-nematodes registered in a DNA database (GenBank). The ITS sequences of the PCR products obtained from the ascarid parasite specimen in our laboratory were compatible with those of registered adult Ascaris and Toxocara parasites. PCR amplification of the ITS regions was sensitive enough to detect a single larva of Ascaris suum mixed with porcine liver tissue. Using this method, ascarid larvae embedded in the liver of a naturally infected turkey were identified as Toxocara canis. These results suggest that even a single larva embedded in tissues from patients with larva migrans could be identified by sequencing the ITS regions.

  3. Multi-scale coding of genomic information: From DNA sequence to genome structure and function

    International Nuclear Information System (INIS)

    Arneodo, Alain; Vaillant, Cedric; Audit, Benjamin; Argoul, Francoise; D'Aubenton-Carafa, Yves; Thermes, Claude


    Understanding how chromatin is spatially and dynamically organized in the nucleus of eukaryotic cells and how this affects genome functions is one of the main challenges of cell biology. Since the different orders of packaging in the hierarchical organization of DNA condition the accessibility of DNA sequence elements to trans-acting factors that control the transcription and replication processes, there is actually a wealth of structural and dynamical information to learn in the primary DNA sequence. In this review, we show that when using concepts, methodologies, numerical and experimental techniques coming from statistical mechanics and nonlinear physics combined with wavelet-based multi-scale signal processing, we are able to decipher the multi-scale sequence encoding of chromatin condensation-decondensation mechanisms that play a fundamental role in regulating many molecular processes involved in nuclear functions.

  4. Default cycle phases determined after modifying discrete DNA sequences in plant cells

    International Nuclear Information System (INIS)

    Sans, J.; Leyton, C.


    After bromosubstituting DNA sequences replicated in the first, second, or third part of the S phase, in Allium cepa L. meristematic cells, radiation at 313 nm wavelength under anoxia allowed ascription of different sequences to both the positive and negative regulation of some cycle phase transitions. The present report shows that the radiation forced cells in late G 1 phase to advance into S, while those in G 2 remained in G 2 and cells in prophase returned to G 2 when both sets of sequences involved in the positive and negative controls were bromosubstituted and later irradiated. In this way, not only G 2 but also the S phase behaved as cycle phases where cells accumulated by default when signals of different sign functionally cancelled out. The treatment did not halt the rates of replication or transcription of plant bromosubstituted DNA. The irradiation under hypoxia apparently prevents the binding of regulatory proteins to Br-DNA. (author)

  5. Autonomous replication of plasmids bearing monkey DNA origin-enriched sequences

    International Nuclear Information System (INIS)

    Frappier, L.; Zannis-Hadjopoulos, M.


    Twelve clones of origin-enriched sequences (ORS) isolated from early replicating monkey (CV-1) DNA were examined for transient episomal replication in transfected CV-1, COS-7, and HeLa cells. Plasmid DNA was isolated at time intervals after transfection and screened by the Dpn I resistance assay or by the bromodeoxyuridine substitution assay to differentiate between input and replicated DNA. The authors have identified four monkey ORS (ORS3, -8, -9, and -12) that can support plasmid replication in mammalian cells. This replication is carried out in a controlled and semiconservative manner characteristic of mammalian replicons. ORS replication was most efficient in HeLa cells. Electron microscopy showed ORS8 and ORS12 plasmids of the correct size with replication bubbles. Using a unique restriction site in ORS12, we have mapped the replication bubble within the monkey DNA sequence

  6. Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing. (United States)

    Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas


    The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

  7. DNA barcoding and NMR spectroscopy-based assessment of species adulteration in the raw herbal trade of Saraca asoca (Roxb.) Willd, an important medicinal plant. (United States)

    Urumarudappa, Santhosh Kumar Jayanthinagar; Gogna, Navdeep; Newmaster, Steven G; Venkatarangaiah, Krishna; Subramanyam, Ragupathy; Saroja, Seethapathy Gopalakrishnan; Gudasalamani, Ravikanth; Dorai, Kavita; Ramanan, Uma Shaanker


    Saraca asoca (Roxb.) Willd, commonly known as "Asoka" or "Ashoka," is one of the most important medicinal plants used in raw herbal trade in India. The bark extracts of the tree are used in the treatment of leucorrhea and other uterine disorders besides also having anti-inflammatory, anti-bacterial, anti-pyretic, anti-helminthic, and analgesic activity. The indiscriminate and rampant extraction of the wood to meet the ever-increasing market demand has led to a sharp decline in naturally occurring populations of the species in the country. Consequently, the species has recently been classified as "vulnerable" by the International Union for Conservation of Nature (IUCN). Increasing deforestation and increasing demand for this medicinal plant have resulted in a limited supply and suspected widespread adulteration of the species in the raw herbal trade market. Adulteration is a serious concern due to: (i) reduction in the efficacy of this traditional medicine, (ii) considerable health risk to consumers, and (iii) fraudulent product substitution that impacts the economy for the Natural Health Product (NHP) Industry and consumers. In this paper, we provide the first attempt to assess the extent of adulteration in the raw herbal trade of S. asoca using DNA barcoding validated by NMR spectroscopic techniques. Analyzing market samples drawn from 25 shops, mostly from peninsular India, we show that more than 80 % of the samples were spurious, representing plant material from at least 7 different families. This is the first comprehensive and large-scale study to demonstrate the widespread adulteration of market samples of S. asoca in India. These results pose grave implications for the use of raw herbal drugs, such as that of S. asoca, on consumer health and safety. Based on these findings, we argue for a strong and robust regulatory framework to be put in place, which would ensure the quality of raw herbal trade products and reassure consumer confidence in indigenous

  8. Transcriptional blockages in a cell-free system by sequence-selective DNA alkylating agents. (United States)

    Ferguson, L R; Liu, A P; Denny, W A; Cullinane, C; Talarico, T; Phillips, D R


    There is considerable interest in DNA sequence-selective DNA-binding drugs as potential inhibitors of gene expression. Five compounds with distinctly different base pair specificities were compared in their effects on the formation and elongation of the transcription complex from the lac UV5 promoter in a cell-free system. All were tested at drug levels which killed 90% of cells in a clonogenic survival assay. Cisplatin, a selective alkylator at purine residues, inhibited transcription, decreasing the full-length transcript, and causing blockage at a number of GG or AG sequences, making it probable that intrastrand crosslinks are the blocking lesions. A cyclopropylindoline known to be an A-specific alkylator also inhibited transcription, with blocks at adenines. The aniline mustard chlorambucil, that targets primarily G but also A sequences, was also effective in blocking the formation of full-length transcripts. It produced transcription blocks either at, or one base prior to, AA or GG sequences, suggesting that intrastrand crosslinks could again be involved. The non-alkylating DNA minor groove binder Hoechst 33342 (a bisbenzimidazole) blocked formation of the full-length transcript, but without creating specific blockage sites. A bisbenzimidazole-linked aniline mustard analogue was a more effective transcription inhibitor than either chlorambucil or Hoechst 33342, with different blockage sites occurring immediately as compared with 2 h after incubation. The blockages were either immediately prior to AA or GG residues, or four to five base pairs prior to such sites, a pattern not predicted from in vitro DNA-binding studies. Minor groove DNA-binding ligands are of particular interest as inhibitors of gene expression, since they have the potential ability to bind selectively to long sequences of DNA. The results suggest that the bisbenzimidazole-linked mustard does cause alkylation and transcription blockage at novel DNA sites. in addition to sites characteristic of

  9. Parallel Sequencing of Expressed Sequence Tags from Two Complementary DNA Libraries for High and Low Phosphorus Adaptation in Common Beans

    Directory of Open Access Journals (Sweden)

    Matthew W. Blair


    Full Text Available Expressed sequence tags (ESTs have proven useful for gene discovery in many crops. In this work, our objective was to construct complementary DNA (cDNA libraries from root tissues of common beans ( L. grown under low and high P hydroponic conditions and to conduct EST sequencing and comparative analyses of the libraries. Expressed sequence tag analysis of 3648 clones identified 2372 unigenes, of which 1591 were annotated as known genes while a total of 465 unigenes were not associated with any known gene. Unigenes with hits were categorized according to biological processes, molecular function, and cellular compartmentalization. Given the young tissue used to make the root libraries, genes for catalytic activity and binding were highly expressed. Comparisons with previous root EST sequencing and between the two libraries made here resulted in a set of genes to study further for differential gene expression and adaptation to low P, such as a 14 kDa praline-rich protein, a metallopeptidase, tonoplast intrinsic protein, adenosine triphosphate (ATP citrate synthase, and cell proliferation genes expressed in the low P treated plants. Given that common beans are often grown on acid soils of the tropics and subtropics that are usually low in P these genes and the two parallel libraries will be useful for selection for better uptake of this essential macronutrient. The importance of EST generation for common bean root tissues under low P and other abiotic soil stresses is also discussed.

  10. Yeast identification by sequencing, biochemical kits, MALDI-TOF MS and rep-PCR DNA fingerprinting. (United States)

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Chan, Jasper F W; Lau, Susanna K P; Kong, Fanrong; Xu, Yingchun; Woo, Patrick C Y


    No study has comprehensively evaluated the performance of 28S nrDNA and ITS sequencing, commercial biochemical test kits, MALDI-TOF MS platforms, and the emerging rep-PCR DNA fingerprinting technology using a cohort of yeast strains collected from a clinical microbiology laboratory. In this study, using 71 clinically important yeast isolates (excluding Candida albicans) collected from a single centre, we determined the concordance of 28S nrDNA and ITS sequencing and evaluated the performance of two commercial test kits, two MALDI-TOF MS platforms, and rep-PCR DNA fingerprinting. 28S nrDNA and ITS sequencing showed complete agreement on the identities of the 71 isolates. Using sequencing results as the standard, 78.9% and 71.8% isolates were correctly identified using the API 20C AUX and Vitek 2 YST ID Card systems, respectively; and 90.1% and 80.3% isolates were correctly identified using the Bruker and Vitek MALDI-TOF MS platforms, respectively. Of the 18 strains belonging to the Candida parapsilosis species complex tested by DiversiLab automated rep-PCR DNA fingerprinting, all were identified only as Candida parapsilosis with similarities ≥93.2%, indicating the misidentification of Candida metapsilosis and Candida orthopsilosis. However, hierarchical cluster analysis of the rep-PCR DNA fingerprints of these three species within this species complex formed three different discrete clusters, indicating that this technology can potentially differentiate the three species. To achieve higher accuracies of identification, the databases of commercial biochemical test kits, MALDI-TOF MS platforms, and DiversiLab automated rep-PCR DNA fingerprinting needs further enrichment, particularly for uncommonly encountered yeast species. © The Author 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail:

  11. Identification of genes in anonymous DNA sequences. Annual performance report, February 1, 1991--January 31, 1992

    Energy Technology Data Exchange (ETDEWEB)

    Fields, C.A.


    The objective of this project is the development of practical software to automate the identification of genes in anonymous DNA sequences from the human, and other higher eukaryotic genomes. A software system for automated sequence analysis, gm (gene modeler) has been designed, implemented, tested, and distributed to several dozen laboratories worldwide. A significantly faster, more robust, and more flexible version of this software, gm 2.0 has now been completed, and is being tested by operational use to analyze human cosmid sequence data. A range of efforts to further understand the features of eukaryoyic gene sequences are also underway. This progress report also contains papers coming out of the project including the following: gm: a Tool for Exploratory Analysis of DNA Sequence Data; The Human THE-LTR(O) and MstII Interspersed Repeats are subfamilies of a single widely distruted highly variable repeat family; Information contents and dinucleotide compostions of plant intron sequences vary with evolutionary origin; Splicing signals in Drosophila: intron size, information content, and consensus sequences; Integration of automated sequence analysis into mapping and sequencing projects; Software for the C. elegans genome project.

  12. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.


    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  13. Using sequence-specific chemical and structural properties of DNA to predict transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Amy L Bauer


    Full Text Available An important step in understanding gene regulation is to identify the DNA binding sites recognized by each transcription factor (TF. Conventional approaches to prediction of TF binding sites involve the definition of consensus sequences or position-specific weight matrices and rely on statistical analysis of DNA sequences of known binding sites. Here, we present a method called SiteSleuth in which DNA structure prediction, computational chemistry, and machine learning are applied to develop models for TF binding sites. In this approach, binary classifiers are trained to discriminate between true and false binding sites based on the sequence-specific chemical and structural features of DNA. These features are determined via molecular dynamics calculations in which we consider each base in different local neighborhoods. For each of 54 TFs in Escherichia coli, for which at least five DNA binding sites are documented in RegulonDB, the TF binding sites and portions of the non-coding genome sequence are mapped to feature vectors and used in training. According to cross-validation analysis and a comparison of computational predictions against ChIP-chip data available for the TF Fis, SiteSleuth outperforms three conventional approaches: Match, MATRIX SEARCH, and the method of Berg and von Hippel. SiteSleuth also outperforms QPMEME, a method similar to SiteSleuth in that it involves a learning algorithm. The main advantage of SiteSleuth is a lower false positive rate.

  14. Sequence specific electronic conduction through polyion-stabilized double-stranded DNA in nanoscale break junctions

    International Nuclear Information System (INIS)

    Mahapatro, Ajit K; Jeong, Kyung J; Lee, Gil U; Janes, David B


    This paper presents a study of sequence specific electronic conduction through short (15-base-pair) double-stranded (ds) DNA molecules, measured by immobilizing 3 ' -thiol-derivatized DNAs in nanometre scale gaps between gold electrodes. The polycation spermidine was used to stabilize the ds-DNA structure, allowing electrical measurements to be performed in a dry state. For specific sequences, the conductivity was observed to scale with the surface density of immobilized DNA, which can be controlled by the buffer concentration. A series of 15-base DNA oligonucleotide pairs, in which the centre sequence of five base pairs was changed from G:C to A:T pairs, has been studied. The conductivity per molecule is observed to decrease exponentially with the number of adjacent A:T pairs replacing G:C pairs, consistent with a barrier at the A:T sites. Conductance-based devices for short DNA sequences could provide sensing approaches with direct electrical readout, as well as label-free detection

  15. Fascioliasis transmission by Lymnaea neotropica confirmed by nuclear rDNA and mtDNA sequencing in Argentina. (United States)

    Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores


    Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix

  16. A likelihood ratio test for species membership based on DNA sequence data

    DEFF Research Database (Denmark)

    Matz, Mikhail V.; Nielsen, Rasmus


    DNA barcoding as an approach for species identification is rapidly increasing in popularity. However, it remains unclear which statistical procedures should accompany the technique to provide a measure of uncertainty. Here we describe a likelihood ratio test which can be used to test if a sampled...... sequence is a member of an a priori specified species. We investigate the performance of the test using coalescence simulations, as well as using the real data from butterflies and frogs representing two kinds of challenge for DNA barcoding: extremely low and extremely high levels of sequence variability....

  17. Probing DNA in nanopores via tunneling: from sequencing to ``quantum'' analogies (United States)

    di Ventra, Massimiliano


    Fast and low-cost DNA sequencing methods would revolutionize medicine: a person could have his/her full genome sequenced so that drugs could be tailored to his/her specific illnesses; doctors could know in advance patients' likelihood to develop a given ailment; cures to major diseases could be found faster [1]. However, this goal of ``personalized medicine'' is hampered today by the high cost and slow speed of DNA sequencing methods. In this talk, I will discuss the sequencing protocol we suggest which requires the measurement of the distributions of transverse currents during the translocation of single-stranded DNA into nanopores [2-5]. I will support our conclusions with a combination of molecular dynamics simulations coupled to quantum mechanical calculations of electrical current in experimentally realizable systems [2-5]. I will also discuss recent experiments that support these theoretical predictions. In addition, I will show how this relatively unexplored area of research at the interface between solids, liquids, and biomolecules at the nanometer length scale is a fertile ground to study quantum phenomena that have a classical counterpart, such as ionic quasi-particles, ionic ``quantized'' conductance [6,7] and Coulomb blockade [8]. Work supported in part by NIH. [4pt] [1] M. Zwolak, M. Di Ventra, Physical Approaches to DNA Sequencing and Detection, Rev. Mod. Phys. 80, 141 (2008).[0pt] [2] M. Zwolak and M. Di Ventra, Electronic signature of DNA nucleotides via transverse transport, Nano Lett. 5, 421 (2005).[0pt] [3] J. Lagerqvist, M. Zwolak, and M. Di Ventra, Fast DNA sequencing via transverse electronic transport, Nano Lett. 6, 779 (2006).[0pt] [4] J. Lagerqvist, M. Zwolak, and M. Di Ventra, Influence of the environment and probes on rapid DNA sequencing via transverse electronic transport, Biophys. J. 93, 2384 (2007).[0pt] [5] M. Krems, M. Zwolak, Y.V. Pershin, and M. Di Ventra, Effect of noise on DNA sequencing via transverse electronic transport

  18. High-throughput sequencing of three Lemnoideae (duckweeds chloroplast genomes from total DNA.

    Directory of Open Access Journals (Sweden)

    Wenqin Wang

    Full Text Available BACKGROUND: Chloroplast genomes provide a wealth of information for evolutionary and population genetic studies. Chloroplasts play a particularly important role in the adaption for aquatic plants because they float on water and their major surface is exposed continuously to sunlight. The subfamily of Lemnoideae represents such a collection of aquatic species that because of photosynthesis represents one of the fastest growing plant species on earth. METHODS: We sequenced the chloroplast genomes from three different genera of Lemnoideae, Spirodela polyrhiza, Wolffiella lingulata and Wolffia australiana by high-throughput DNA sequencing of genomic DNA using the SOLiD platform. Unfractionated total DNA contains high copies of plastid DNA so that sequences from the nucleus and mitochondria can easily be filtered computationally. Remaining sequence reads were assembled into contiguous sequences (contigs using SOLiD software tools. Contigs were mapped to a reference genome of Lemna minor and gaps, selected by PCR, were sequenced on the ABI3730xl platform. CONCLUSIONS: This combinatorial approach yielded whole genomic contiguous sequences in a cost-effective manner. Over 1,000-time coverage of chloroplast from total DNA were reached by the SOLiD platform in a single spot on a quadrant slide without purification. Comparative analysis indicated that the chloroplast genome was conserved in gene number and organization with respect to the reference genome of L. minor. However, higher nucleotide substitution, abundant deletions and insertions occurred in non-coding regions of these genomes, indicating a greater genomic dynamics than expected from the comparison of other related species in the Pooideae. Noticeably, there was no transition bias over transversion in Lemnoideae. The data should have immediate applications in evolutionary biology and plant taxonomy with increased resolution and statistical power.

  19. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. (United States)

    Feehan, Joanna M; Scheibel, Katherine E; Bourras, Salim; Underwood, William; Keller, Beat; Somerville, Shauna C


    The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics of these pathogens, in part due to a lack of well-developed genetic and genomic resources. These organisms have large, repetitive genomes, which have made genome sequencing and assembly prohibitively difficult. Here, we describe methods for the collection, extraction, purification and quality control assessment of high molecular weight genomic DNA from one powdery mildew species, Golovinomyces cichoracearum. The protocol described includes mechanical disruption of spores followed by an optimized phenol/chloroform genomic DNA extraction. A typical yield was 7 µg DNA per 150 mg conidia. The genomic DNA that is isolated using this procedure is suitable for long-read sequencing (i.e., > 48.5 kbp). Quality control measures to ensure the size, yield, and purity of the genomic DNA are also described in this method. Sequencing of the genomic DNA of the quality described here will allow for the assembly and comparison of multiple powdery mildew genomes, which in turn will lead to a better understanding and improved control of this agricultural pathogen.

  20. Ultrasensitive DNA sequence detection using nanoscale ZnO sensor arrays

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Nitin; Dorfman, Adam; Hahm, Jong-in [Department of Chemical Engineering, Pennsylvania State University, 160 Fenske Laboratory, University Park, PA 16802 (United States)


    We report that engineered nanoscale zinc oxide structures can be effectively used for the identification of the biothreat agent, Bacillus anthracis by successfully discriminating its DNA sequence from other genetically related species. We explore both covalent and non-covalent linking schemes in order to couple probe DNA strands to the zinc oxide nanostructures. Hybridization reactions are performed with various concentrations of target DNA strands whose sequence is unique to Bacillus anthracis. The use of zinc oxide nanomaterials greatly enhances the fluorescence signal collected after carrying out duplex formation reaction. Specifically, the covalent strategy allows detection of the target species at sample concentrations at a level as low as a few femtomolar as compared to the detection sensitivity in the tens of nanomolar range when using the non-covalent scheme. The presence of the underlying zinc oxide nanomaterials is critical in achieving increased fluorescence detection of hybridized DNA and, therefore, accomplishing rapid and extremely sensitive identification of the biothreat agent. We also demonstrate the easy integration potential of nanoscale zinc oxide into high density arrays by using various types of zinc oxide sensor prototypes in the DNA sequence detection. When combined with conventional automatic sample handling apparatus and computerized fluorescence detection equipment, our approach can greatly promote the use of zinc oxide nanomaterials as signal enhancing platforms for rapid, multiplexed, high-throughput, highly sensitive, DNA sensor arrays.

  1. Ultrasensitive DNA sequence detection using nanoscale ZnO sensor arrays

    International Nuclear Information System (INIS)

    Kumar, Nitin; Dorfman, Adam; Hahm, Jong-in


    We report that engineered nanoscale zinc oxide structures can be effectively used for the identification of the biothreat agent, Bacillus anthracis by successfully discriminating its DNA sequence from other genetically related species. We explore both covalent and non-covalent linking schemes in order to couple probe DNA strands to the zinc oxide nanostructures. Hybridization reactions are performed with various concentrations of target DNA strands whose sequence is unique to Bacillus anthracis. The use of zinc oxide nanomaterials greatly enhances the fluorescence signal collected after carrying out duplex formation reaction. Specifically, the covalent strategy allows detection of the target species at sample concentrations at a level as low as a few femtomolar as compared to the detection sensitivity in the tens of nanomolar range when using the non-covalent scheme. The presence of the underlying zinc oxide nanomaterials is critical in achieving increased fluorescence detection of hybridized DNA and, therefore, accomplishing rapid and extremely sensitive identification of the biothreat agent. We also demonstrate the easy integration potential of nanoscale zinc oxide into high density arrays by using various types of zinc oxide sensor prototypes in the DNA sequence detection. When combined with conventional automatic sample handling apparatus and computerized fluorescence detection equipment, our approach can greatly promote the use of zinc oxide nanomaterials as signal enhancing platforms for rapid, multiplexed, high-throughput, highly sensitive, DNA sensor arrays

  2. Depletion of Human DNA in Spiked Clinical Specimens for Improvement of Sensitivity of Pathogen Detection by Next-Generation Sequencing


    Hasan, Mohammad R.; Rawat, Arun; Tang, Patrick; Jithesh, Puthen V.; Thomas, Eva; Tan, Rusung; Tilley, Peter


    Next-generation sequencing (NGS) technology has shown promise for the detection of human pathogens from clinical samples. However, one of the major obstacles to the use of NGS in diagnostic microbiology is the low ratio of pathogen DNA to human DNA in most clinical specimens. In this study, we aimed to develop a specimen-processing protocol to remove human DNA and enrich specimens for bacterial and viral DNA for shotgun metagenomic sequencing. Cerebrospinal fluid (CSF) and nasopharyngeal aspi...

  3. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence. (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C


    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  4. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing. (United States)

    Schwessinger, Benjamin; Rathjen, John P


    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  5. Protein Science by DNA Sequencing: How Advances in Molecular Biology Are Accelerating Biochemistry. (United States)

    Higgins, Sean A; Savage, David F


    A fundamental goal of protein biochemistry is to determine the sequence-function relationship, but the vastness of sequence space makes comprehensive evaluation of this landscape difficult. However, advances in DNA synthesis and sequencing now allow researchers to assess the functional impact of every single mutation in many proteins, but challenges remain in library construction and the development of general assays applicable to a diverse range of protein functions. This Perspective briefly outlines the technical innovations in DNA manipulation that allow massively parallel protein biochemistry and then summarizes the methods currently available for library construction and the functional assays of protein variants. Areas in need of future innovation are highlighted with a particular focus on assay development and the use of computational analysis with machine learning to effectively traverse the sequence-function landscape. Finally, applications in the fundamentals of protein biochemistry, disease prediction, and protein engineering are presented.

  6. The function analysis of full-length cDNA sequence from IRM-2 mouse cDNA library

    International Nuclear Information System (INIS)

    Wang Qin; Liu Xiaoqiu; Xu Chang; Du Liqing; Sun Zhijuan; Wang Yan; Liu Qiang; Song Li; Li Jin; Fan Feiyue


    Objective: To identify the function of full-length cDNA sequence from IRM-2 mouse cDNA library. Methods: Full-length cDNA products were amplified by PCR from IRM-2 mouse cDNA library according to twenty-one pieces of expressed sequence tag. The expression of full-length cDNAs were detected after mouse embryonic fibroblasts were exposed to 6.5 Gy γ-ray radiation. And the effect on the growth of radiosensitivity cells AT5B1VA transfected with full-length cDNAs was investigated. Results: The expression of No.4, 5 and 2 full-length cDNAs from IRM-2 mouse were higher than that of parental ICR and 615 mouse after mouse embryonic fibroblasts irradiated with γ-ray radiation. And the survival rate of AT5B1VA cells transfected with No.4, 5 and 2 full-length cDNAs was high. Conclusion: No.4, 5 and 2 full-length cDNAs of IRM-2 mouse are of high radioresistance. (authors)

  7. Human β satellite DNA: Genomic organization and sequence definition of a class of highly repetitive tandem DNA

    International Nuclear Information System (INIS)

    Waye, J.S.; Willard, H.F.


    The authors describe a class of human repetitive DNA, called β satellite, that, at a most fundamental level, exists as tandem arrays of diverged ∼68-base-pair monomer repeat units. The monomer units are organized as distinct subsets, each characterized by a multimeric higher-order repeat unit that is tandemly reiterated and represents a recent unit of amplification. They have cloned, characterized, and determined the sequence of two β satellite higher-order repeat units: one located on chromosome 9, the other on the acrocentric chromosomes (13, 14, 15, 21, and 22) and perhaps other sites in the genome. Analysis by pulsed-field gel electrophoresis reveals that these tandem arrays are localized in large domains that are marked by restriction fragment length polymorphisms. In total, β-satellite sequences comprise several million base pairs of DNA in the human genome. Analysis of this DNA family should permit insights into the nature of chromosome-specific and nonspecific modes of satellite DNA evolution and provide useful tools for probing the molecular organization and concerted evolution of the acrocentric chromosomes

  8. Effect of DNA sequence, ionic strength, and cationic DNA affinity binders on the methylation of DNA by N-methyl-N-nitrosourea

    International Nuclear Information System (INIS)

    Wurdeman, R.L.; Gold, B.


    DNA alkylation by N-alkyl-N-nitrosoureas is generally accepted to be responsible for their mutagenic, carcinogenic, and antineoplastic activities. The exact nature of the ultimate alkylating intermediate is still controversial, with a variety of species having been nominated. The sequence specificity for DNA alkylation by simple N-alkyl-N-nitrosoureas has not been reported, although such information is basic in understanding the specific point mutations induced by these compounds in oncogene targets. These two points are addressed by using N-methyl-N-nitrosourea methylation of a 576 base-pair 32 P-end-labeled DNA restriction fragment and high-resolution polyacrylamide sequencing gels. This method provides information on the formation of N 7 -methylguanine, by the generation of single-strand breaks upon exposure to piperidine

  9. Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism. (United States)

    Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard


    Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure.

  10. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.


    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  11. Synthesis and evaluation of sequence-specific DNA alkylating agents: effect of alkylation subunits. (United States)

    Shimizu, Tatsuhiko; Sasaki, Shunta; Minoshima, Masafumi; Shinohara, Ken-ichi; Bando, Toshikazu; Sugiyama, Hiroshi


    We have demonstrated that hairpin pyrrole (Py)- imidazole (Im) polyamide-CBI conjugates selectively alkylate predetermined sequences. In this study, we investigated the effect of alkylation subunits, for example conjugates 1-4 with three types of DNA alkylating units, and Py-Im polyamides with indole linker. Conjugate 3 and 4 selectively alkylated the predetermined sequences as described previously, while conjugates 1 and 2 alkylate at mismatched sites.

  12. DIALIGN: multiple DNA and protein sequence alignment at BiBiServ.


    Morgenstern, Burkhard


    DIALIGN is a widely used software tool for multiple DNA and protein sequence alignment. The program combines local and global alignment features and can therefore be applied to sequence data that cannot be correctly aligned by more traditional approaches. DIALIGN is available online through Bielefeld Bioinformatics Server (BiBiServ). The downloadable version of the program offers several new program features. To compare the output of different alignment programs, we developed the program AltA...

  13. Genetic polymorphism in Gymnodinium galatheanum chloroplast DNA sequences and development of a molecular detection assay. (United States)

    Tengs, T; Bowers, H A; Ziman, A P; Stoecker, D K; Oldach, D W


    Nuclear and chloroplast-encoded small subunit ribosomal DNA sequences were obtained from several strains of the toxic dinoflagellate Gymnodinium galatheanum. Phylogenetic analyses and comparison of sequences indicate that the chloroplast sequences show a higher degree of sequence divergence than the nuclear homologue. The chloroplast sequences were chosen as targets for the development of a 5'--3' exonuclease assay for detection of the organism. The assay has a very high degree of specificity and has been used to screen environmental water samples from a fish farm where the presence of this dinoflagellate species has previously been associated with fish kills. Various hypotheses for the derived nature of the chloroplast sequences are discussed, as well as what is known about the toxicity of the species.

  14. High-throughput sequencing of nematode communities from total soil DNA extractions

    DEFF Research Database (Denmark)

    Sapkota, Rumakanta; Nicolaisen, Mogens


    nematodes without the need for enrichment was developed. Using this strategy on DNA templates from a set of 22 agricultural soils, we obtained 64.4% sequences of nematode origin in total, whereas the remaining sequences were almost entirely from other metazoans. The nematode sequences were derived from...... in previous sequence-based studies are not nematode specific but also amplify other groups of organisms such as fungi and plantae, and thus require a nematode enrichment step that may introduce biases. Results: In this study an amplification strategy which selectively amplifies a fragment of the SSU from...... a broad taxonomic range and most sequences were from nematode taxa that have previously been found to be abundant in soil such as Tylenchida, Rhabditida, Dorylaimida, Triplonchida and Araeolaimida. Conclusions: Our amplification and sequencing strategy for assessing nematode diversity was able to collect...

  15. A survey of the sequence-specific interaction of damaging agents with DNA: emphasis on antitumor agents. (United States)

    Murray, V


    This article reviews the literature concerning the sequence specificity of DNA-damaging agents. DNA-damaging agents are widely used in cancer chemotherapy. It is important to understand fully the determinants of DNA sequence specificity so that more effective DNA-damaging agents can be developed as antitumor drugs. There are five main methods of DNA sequence specificity analysis: cleavage of end-labeled fragments, linear amplification with Taq DNA polymerase, ligation-mediated polymerase chain reaction (PCR), single-strand ligation PCR, and footprinting. The DNA sequence specificity in purified DNA and in intact mammalian cells is reviewed for several classes of DNA-damaging agent. These include agents that form covalent adducts with DNA, free radical generators, topoisomerase inhibitors, intercalators and minor groove binders, enzymes, and electromagnetic radiation. The main sites of adduct formation are at the N-7 of guanine in the major groove of DNA and the N-3 of adenine in the minor groove, whereas free radical generators abstract hydrogen from the deoxyribose sugar and topoisomerase inhibitors cause enzyme-DNA cross-links to form. Several issues involved in the determination of the DNA sequence specificity are discussed. The future directions of the field, with respect to cancer chemotherapy, are also examined.

  16. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species. (United States)

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N


    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

  17. Lack of Detection of Bt Sugarcane Cry1Ab and NptII DNA and Proteins in Sugarcane Processing Products Including Raw Sugar

    Directory of Open Access Journals (Sweden)

    Adriana Cheavegatti-Gianotto


    Full Text Available Brazil is the largest sugarcane producer and the main sugar exporter in the world. The industrial processes applied by Brazilian mills are very efficient in producing highly purified sugar and ethanol. Literature presents evidence of lack of DNA/protein in these products, regardless of the nature of sugarcane used as raw material. Recently CTNBio, the Brazilian biosafety authority, has approved the first biotechnology-derived sugarcane variety for cultivation, event CTC175-A, which expresses the Cry1Ab protein to control the sugarcane borer (Diatraea saccharalis. The event also expresses neomycin-phosphotransferase type II (NptII protein used as selectable marker during the transformation process. Because of the high purity of sugar and ethanol produced from genetically modified sugarcane, these end-products should potentially be classified as “pure substances, chemically defined,” by Brazilian Biosafety Law No. 11.105. If this classification is to be adopted, these substances are not considered as “GMO derivatives” and fall out of the scope of Law No. 11.105. In order to assess sugar composition and quality, we evaluate Cry1Ab and NptII expression in several sugarcane tissues and in several fractions from laboratory-scale processing of event CTC175-A for the presence of these heterologous proteins as well as for the presence of traces of recombinant DNA. The results of these studies show that CTC175-A presents high expression of Cry1Ab in leaves and barely detectable expression of heterologous proteins in stalks. We also evaluated the presence of ribulose-1,5-bisphosphate carboxylase/oxygenase protein and DNA in the fractions of the industrial processing of conventional Brazilian sugarcane cultivars. Results from both laboratory and industrial processing were concordant, demonstrating that DNA and protein are not detected in the clarified juice and downstream processed fractions, including ethanol and raw sugar, indicating that protein

  18. Accurate quantification of mouse mitochondrial DNA without co-amplification of nuclear mitochondrial insertion sequences. (United States)

    Malik, Afshan N; Czajka, Anna; Cunningham, Phil


    Mitochondria contain an extra-nuclear genome in the form of mitochondrial DNA (MtDNA), damage to which can lead to inflammation and bioenergetic deficit. Changes in MtDNA levels are increasingly used as a biomarker of mitochondrial dysfunction. We previously reported that in humans, fragments in the nuclear genome known as nuclear mitochondrial insertion sequences (NumtS) affect accurate quantification of MtDNA. In the current paper our aim was to determine whether mouse NumtS affect the quantification of MtDNA and to establish a method designed to avoid this. The existence of NumtS in the mouse genome was confirmed using blast N, unique MtDNA regions were identified using FASTA, and MtDNA primers which do not co-amplify NumtS were designed and tested. MtDNA copy numbers were determined in a range of mouse tissues as the ratio of the mitochondrial and nuclear genome using real time qPCR and absolute quantification. Approximately 95% of mouse MtDNA was duplicated in the nuclear genome as NumtS which were located in 15 out of 21 chromosomes. A unique region was identified and primers flanking this region were used. MtDNA levels differed significantly in mouse tissues being the highest in the heart, with levels in descending order (highest to lowest) in kidney, liver, blood, brain, islets and lung. The presence of NumtS in the nuclear genome of mouse could lead to erroneous data when studying MtDNA content or mutation. The unique primers described here will allow accurate quantification of MtDNA content in mouse models without co-amplification of NumtS. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  19. Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.

    Directory of Open Access Journals (Sweden)

    Mohammed Bakkali

    Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein

  20. Intermittency as a universal characteristic of the complete chromosome DNA sequences of eukaryotes: From protozoa to human genomes (United States)

    Rybalko, S.; Larionov, S.; Poptsova, M.; Loskutov, A.


    Large-scale dynamical properties of complete chromosome DNA sequences of eukaryotes are considered. Using the proposed deterministic models with intermittency and symbolic dynamics we describe a wide spectrum of large-scale patterns inherent in these sequences, such as segmental duplications, tandem repeats, and other complex sequence structures. It is shown that the recently discovered gene number balance on the strands is not of a random nature, and certain subsystems of a complete chromosome DNA sequence exhibit the properties of deterministic chaos.

  1. Enterohemorrhagic Escherichia coli O157 in milk and dairy products from Libya: Isolation and molecular identification by partial sequencing of 16S rDNA

    Directory of Open Access Journals (Sweden)

    Aboubaker M. Garbaj


    Full Text Available Aim: The aim of this work was to isolate and molecularly identify enterohemorrhagic Escherichia coli (EHEC O157 in milk and dairy products in Libya, in addition; to clear the accuracy of cultural and biochemical identification as compared with molecular identification by partial sequencing of 16S rDNA for the existing isolates. Materials and Methods: A total of 108 samples of raw milk (cow, she-camel, and goat and locally made dairy products (fermented cow’s milk, Maasora, Ricotta and ice cream were collected from some regions (Janzour, Tripoli, Kremiya, Tajoura and Tobruk in Libya. Samples were subjected to microbiological analysis for isolation of E. coli that was detected by conventional cultural and molecular method using polymerase chain reaction and partial sequencing of 16S rDNA. Results: Out of 108 samples, only 27 isolates were found to be EHEC O157 based on their cultural characteristics (Tellurite-Cefixime-Sorbitol MacConkey that include 3 isolates from cow’s milk (11%, 3 isolates from she-camel’s milk (11%, two isolates from goat’s milk (7.4% and 7 isolates from fermented raw milk samples (26%, isolates from fresh locally made soft cheeses (Maasora and Ricotta were 9 (33% and 3 (11%, respectively, while none of the ice cream samples revealed any growth. However, out of these 27 isolates, only 11 were confirmed to be E. coli by partial sequencing of 16S rDNA and E. coli O157 Latex agglutination test. Phylogenetic analysis revealed that majority of local E. coli isolates were related to E. coli O157:H7 FRIK944 strain. Conclusion: These results can be used for further studies on EHEC O157 as an emerging foodborne pathogen and its role in human infection in Libya.

  2. DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms. (United States)

    Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin


    The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

  3. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays. (United States)

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M


    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  4. Mitochondrial DNA sequence data reveals association of haplogroup U with psychosis in bipolar disorder. (United States)

    Frye, Mark A; Ryu, Euijung; Nassan, Malik; Jenkins, Gregory D; Andreazza, Ana C; Evans, Jared M; McElroy, Susan L; Oglesbee, Devin; Highsmith, W Edward; Biernacka, Joanna M


    Converging genetic, postmortem gene-expression, cellular, and neuroimaging data implicate mitochondrial dysfunction in bipolar disorder. This study was conducted to investigate whether mitochondrial DNA (mtDNA) haplogroups and single nucleotide variants (SNVs) are associated with sub-phenotypes of bipolar disorder. MtDNA from 224 patients with Bipolar I disorder (BPI) was sequenced, and association of sequence variations with 3 sub-phenotypes (psychosis, rapid cycling, and adolescent illness onset) was evaluated. Gene-level tests were performed to evaluate overall burden of minor alleles for each phenotype. The haplogroup U was associated with a higher risk of psychosis. Secondary analyses of SNVs provided nominal evidence for association of psychosis with variants in the tRNA, ND4 and ND5 genes. The association of psychosis with ND4 (gene that encodes NADH dehydrogenase 4) was further supported by gene-level analysis. Preliminary analysis of mtDNA sequence data suggests a higher risk of psychosis with the U haplogroup and variation in the ND4 gene implicated in electron transport chain energy regulation. Further investigation of the functional consequences of this mtDNA variation is encouraged. Copyright © 2016. Published by Elsevier Ltd.

  5. Templated Chemistry for Sequence-Specific Fluorogenic Detection of Duplex DNA (United States)

    Li, Hao; Franzini, Raphael M.; Bruner, Christopher; Kool, Eric T.


    We describe the development of templated fluorogenic chemistry for detection of specific sequences of duplex DNA in solution. In this approach, two modified homopyrimidine oligodeoxynucleotide probes are designed to bind by triple helix formation at adjacent positions on a specific purine-rich target sequence of duplex DNA. One fluorescein-labeled probe contains an α-azidoether linker to a fluorescence quencher; the second (trigger) probe carries a triarylphosphine, designed to reduce the azide and cleave the linker. The data showed that at pH 5.6 these probes yielded a strong fluorescence signal within minutes on addition to a complementary homopurine duplex DNA target. The signal increased by a factor of ca. 60, and was completely dependent on the presence of the target DNA. Replacement of cytosine in the probes with pseudoisocytosine allowed the templated chemistry to proceed readily at pH 7. Single nucleotide mismatches in the target oligonucleotide slowed the templated reaction considerably, demonstrating high sequence selectivity. The use of templated fluorogenic chemistry for detection of duplex DNAs has not been previously reported and may allow detection of double stranded DNA, at least for homopurine-homopyrimidine target sites, under native, non-disturbing conditions. PMID:20859985

  6. An integrated multiple capillary array electrophoresis system for high-throughput DNA sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Lu, X.


    A capillary array electrophoresis system was chosen to perform DNA sequencing because of several advantages such as rapid heat dissipation, multiplexing capabilities, gel matrix filling simplicity, and the mature nature of the associated manufacturing technologies. There are two major concerns for the multiple capillary systems. One concern is inter-capillary cross-talk, and the other concern is excitation and detection efficiency. Cross-talk is eliminated through proper optical coupling, good focusing and immersing capillary array into index matching fluid. A side-entry excitation scheme with orthogonal detection was established for large capillary array. Two 100 capillary array formats were used for DNA sequencing. One format is cylindrical capillary with 150 {micro}m o.d., 75 {micro}m i.d and the other format is square capillary with 300 {micro}m out edge and 75 {micro}m inner edge. This project is focused on the development of excitation and detection of DNA as well as performing DNA sequencing. The DNA injection schemes are discussed for the cases of single and bundled capillaries. An individual sampling device was designed. The base-calling was performed for a capillary from the capillary array with the accuracy of 98%.

  7. mtDNA sequence diversity of Hazara ethnic group from Pakistan. (United States)

    Rakha, Allah; Fatima; Peng, Min-Sheng; Adan, Atif; Bi, Rui; Yasmin, Memona; Yao, Yong-Gang


    The present study was undertaken to investigate mitochondrial DNA (mtDNA) control region sequences of Hazaras from Pakistan, so as to generate mtDNA reference database for forensic casework in Pakistan and to analyze phylogenetic relationship of this particular ethnic group with geographically proximal populations. Complete mtDNA control region (nt 16024-576) sequences were generated through Sanger Sequencing for 319 Hazara individuals from Quetta, Baluchistan. The population sample set showed a total of 189 distinct haplotypes, belonging mainly to West Eurasian (51.72%), East & Southeast Asian (29.78%) and South Asian (18.50%) haplogroups. Compared with other populations from Pakistan, the Hazara population had a relatively high haplotype diversity (0.9945) and a lower random match probability (0.0085). The dataset has been incorporated into EMPOP database under accession number EMP00680. The data herein comprises the largest, and likely most thoroughly examined, control region mtDNA dataset from Hazaras of Pakistan. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu


    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  9. Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene. (United States)

    Pietrowski, D; Förster, M


    The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

  10. Characterization of full-length sequenced cDNA inserts (FLIcs from Atlantic salmon (Salmo salar

    Directory of Open Access Journals (Sweden)

    Lunner Sigbjørn


    Full Text Available Abstract Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP, the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91% of the transcripts were annotated using Gene Ontology (GO terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS. The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS. This

  11. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar) (United States)

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn


    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA

  12. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    KAUST Repository

    Kodzius, Rimantas


    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a model cartilaginous fish genome because of its relatively small genome size (910 Mb). The whole genome of C. milii is being sequenced (first cartilaginous fish genome to be sequenced completely). To characterize the transcriptome of C. milii and to assist in annotating exon-intron boundaries, transcriptional start sites and alternatively spliced transcripts, we are generating full-length cDNA sequences from C. milii.

  13. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    DEFF Research Database (Denmark)

    Cowell, G M; Kønigshøfer, E; Danielsen, E M


    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  14. Satellite DNA Sequences in Canidae and Their Chromosome Distribution in Dog and Red Fox. (United States)

    Vozdova, Miluse; Kubickova, Svatava; Cernohorska, Halina; Fröhlich, Jan; Rubes, Jiri


    Satellite DNA is a characteristic component of mammalian centromeric heterochromatin, and a comparative analysis of its evolutionary dynamics can be used for phylogenetic studies. We analysed satellite and satellite-like DNA sequences available in NCBI for 4 species of the family Canidae (red fox, Vulpes vulpes, VVU; domestic dog, Canis familiaris, CFA; arctic fox, Vulpes lagopus, VLA; raccoon dog, Nyctereutes procyonoides procyonoides, NPR) by comparative sequence analysis, which revealed 86-90% intraspecies and 76-79% interspecies similarity. Comparative fluorescence in situ hybridisation in the red fox and dog showed signals of the red fox satellite probe in canine and vulpine autosomal centromeres, on VVUY, B chromosomes, and in the distal parts of VVU9q and VVU10p which were shown to contain nucleolus organiser regions. The CFA satellite probe stained autosomal centromeres only in the dog. The CFA satellite-like DNA did not show any significant sequence similarity with the satellite DNA of any species analysed and was localised to the centromeres of 9 canine chromosome pairs. No significant heterochromatin block was detected on the B chromosomes of the red fox. Our results show extensive heterogeneity of satellite sequences among Canidae and prove close evolutionary relationships between the red and arctic fox. © 2017 S. Karger AG, Basel.

  15. Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing. (United States)

    Raghav, Sunil Kumar; Deplancke, Bart


    Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.

  16. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)



    Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

  17. Modeling genetic imprinting effects of DNA sequences with multilocus polymorphism data

    Directory of Open Access Journals (Sweden)

    Staud Roland


    Full Text Available Abstract Single nucleotide polymorphisms (SNPs represent the most widespread type of DNA sequence variation in the human genome and they have recently emerged as valuable genetic markers for revealing the genetic architecture of complex traits in terms of nucleotide combination and sequence. Here, we extend an algorithmic model for the haplotype analysis of SNPs to estimate the effects of genetic imprinting expressed at the DNA sequence level. The model provides a general procedure for identifying the number and types of optimal DNA sequence variants that are expressed differently due to their parental origin. The model is used to analyze a genetic data set collected from a pain genetics project. We find that DNA haplotype GAC from three SNPs, OPRKG36T (with two alleles G and T, OPRKA843G (with alleles A and G, and OPRKC846T (with alleles C and T, at the kappa-opioid receptor, triggers a significant effect on pain sensitivity, but with expression significantly depending on the parent from which it is inherited (p = 0.008. With a tremendous advance in SNP identification and automated screening, the model founded on haplotype discovery and statistical inference may provide a useful tool for genetic analysis of any quantitative trait with complex inheritance.

  18. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E


    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  19. [Identification of a repetitive sequence element for DNA fingerprinting in Phytophthora sojae]. (United States)

    Yin, Lihua; Wang, Qinhu; Ning, Feng; Zhu, Xiaoying; Zuo, Yuhu; Shan, Weixing


    Establishment of DNA fingerprinting in Phytophthora sojae and an analysis of genetic relationship of Heilongjiang and Xinjiang populations. Bioinformatics tools were used to search repetitive sequences in P. sojae and Southern blot analysis was employed for DNA fingerprinting analysis of P. sojae populations from Heilongjiang and Xinjiang using the identified repetitive sequence. A moderately repetitive sequence was identified and designated as PS1227. Southern blot analysis indicated 34 distinct bands ranging in size from 1.5 kb-23 kb, of which 21 were polymorphic among 49 isolates examined. Analysis of single-zoospore progenies showed that the PS1227 fingerprint pattern was mitotically stable. DNA fingerprinting showed that the P. sojae isolates HP4002, SY6 and GJ0105 of Heilongjiang are genetically identical to DW303, 71228 and 71222 of Xinjiang, respectively. A moderately repetitive sequence designated PS1227 which will be useful for epidemiology and population biology studies of P. sojae was obtained, and a PS1227-based DNA fingerprinting analysis provided molecular evidence that P. sojae in Xinjiang was likely introduced from Heilongjiang.

  20. DNA copy number, including telomeres and mitochondria, assayed using next-generation sequencing

    Directory of Open Access Journals (Sweden)

    Jackson Stuart


    Full Text Available Abstract Background DNA copy number variations occur within populations and aberrations can cause disease. We sought to develop an improved lab-automatable, cost-efficient, accurate platform to profile DNA copy number. Results We developed a sequencing-based assay of nuclear, mitochondrial, and telomeric DNA copy number that draws on the unbiased nature of next-generation sequencing and incorporates techniques developed for RNA expression profiling. To demonstrate this platform, we assayed UMC-11 cells using 5 million 33 nt reads and found tremendous copy number variation, including regions of single and homogeneous deletions and amplifications to 29 copies; 5 times more mitochondria and 4 times less telomeric sequence than a pool of non-diseased, blood-derived DNA; and that UMC-11 was derived from a male individual. Conclusion The described assay outputs absolute copy number, outputs an error estimate (p-value, and is more accurate than array-based platforms at high copy number. The platform enables profiling of mitochondrial levels and telomeric length. The assay is lab-automatable and has a genomic resolution and cost that are tunable based on the number of sequence reads.

  1. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  2. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen


    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  3. An Internet-Accessible DNA Sequence Database for Identifying Fusaria from Human and Animal Infections (United States)

    Because less than one-third of clinically relevant fusaria can be accurately identified to species level using phenotypic data (i.e., morphological species recognition), we constructed a three-locus DNA sequence database to facilitate molecular identification of the 69 Fusarium species associated wi...

  4. Sequence-selective targeting of duplex DNA by peptide nucleic acids

    DEFF Research Database (Denmark)

    Nielsen, Peter E


    Sequence-selective gene targeting constitutes an attractive drug-discovery approach for genetic therapy, with the aim of reducing or enhancing the activity of specific genes at the transcriptional level, or as part of a methodology for targeted gene repair. The pseudopeptide DNA mimic peptide...

  5. Frequency of Epstein-Barr virus DNA sequences in human gliomas

    Directory of Open Access Journals (Sweden)

    Renata Fragelli Fonseca

    Full Text Available CONTEXT AND OBJECTIVE: The Epstein-Barr virus (EBV is the most common cause of infectious mononucleosis and is also associated with several human tumors, including Burkitt's lymphoma, Hodgkin's lymphoma, some cases of gastric carcinoma and nasopharyngeal carcinoma, among other neoplasms. The aim of this study was to screen 75 primary gliomas for the presence of specific EBV DNA sequences by means of the polymerase chain reaction (PCR, with confirmation by direct sequencing. DESIGN AND SETTING: Prevalence study on EBV molecular genetics at a molecular pathology laboratory in a university hospital and at an applied genetics laboratory in a national institution. METHODS: A total of 75 primary glioma biopsies and 6 others from other tumors from the central nervous system were obtained. The tissues were immediately frozen for subsequent DNA extraction by means of traditional methods using proteinase K digestion and extraction with a phenol-chloroform-isoamyl alcohol mixture. DNA was precipitated with ethanol, resuspended in buffer and stored. The PCRs were carried out using primers for amplification of the EBV BamM region. Positive and negative controls were added to each reaction. The PCR products were used for direct sequencing for confirmation. RESULTS: The viral sequences were positive in 11/75 (14.7% of our samples. CONCLUSION: The prevalence of EBV DNA was 11/75 (14.7% in our glioma collection. Further molecular and epidemiological studies are needed to establish the possible role played by EBV in the tumorigenesis of gliomas.

  6. Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove (United States)

    Yonetani, Yoshiteru; Kono, Hidetoshi


    Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

  7. C-terminal low-complexity sequence repeats of Mycobacterium smegmatis Ku modulate DNA binding. (United States)

    Kushwaha, Ambuj K; Grove, Anne


    Ku protein is an integral component of the NHEJ (non-homologous end-joining) pathway of DSB (double-strand break) repair. Both eukaryotic and prokaryotic Ku homologues have been characterized and shown to bind DNA ends. A unique feature of Mycobacterium smegmatis Ku is its basic C-terminal tail that contains several lysine-rich low-complexity PAKKA repeats that are absent from homologues encoded by obligate parasitic mycobacteria. Such PAKKA repeats are also characteristic of mycobacterial Hlp (histone-like protein) for which they have been shown to confer the ability to appose DNA ends. Unexpectedly, removal of the lysine-rich extension enhances DNA-binding affinity, but an interaction between DNA and the PAKKA repeats is indicated by the observation that only full-length Ku forms multiple complexes with a short stem-loop-containing DNA previously designed to accommodate only one Ku dimer. The C-terminal extension promotes DNA end-joining by T4 DNA ligase, suggesting that the PAKKA repeats also contribute to efficient end-joining. We suggest that low-complexity lysine-rich sequences have evolved repeatedly to modulate the function of unrelated DNA-binding proteins.

  8. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences. (United States)

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves


    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Assembly and melting of DNA nanotubes from single-sequence tiles

    International Nuclear Information System (INIS)

    Sobey, T L; Renner, S; Simmel, F C


    DNA melting and renaturation studies are an extremely valuable tool to study the kinetics and thermodynamics of duplex dissociation and reassociation reactions. These are important not only in a biological or biotechnological context, but also for DNA nanotechnology which aims at the construction of molecular materials by DNA self-assembly. We here study experimentally the formation and melting of a DNA nanotube structure, which is composed of many copies of an oligonucleotide containing several palindromic sequences. This is done using temperature-controlled UV absorption measurements correlated with atomic force microscopy, fluorescence microscopy and transmission electron microscopy techniques. In the melting studies, important factors such as DNA strand concentration, hierarchy of assembly and annealing protocol are investigated. Assembly and melting of the nanotubes are shown to proceed via different pathways. Whereas assembly occurs in several hierarchical steps related to the formation of tiles, lattices and tubes, melting of DNA nanotubes appears to occur in a single step. This is proposed to relate to fundamental differences between closed, three-dimensional tube-like structures and open, two-dimensional lattices. DNA melting studies can lead to a better understanding of the many factors that affect the assembly process which will be essential for the assembly of increasingly complex DNA nanostructures.

  10. Sequence-influenced interactions of oligoacridines with DNA detected by retarded gel electrophorectic migrations

    International Nuclear Information System (INIS)

    Nielsen, P.E.; Zhen, W.; Henriksen, U.; Buchardt, O.


    The authors have found that di-, tri-, tetra-, and hexa-9-acridinylamines are so efficiently associated with DNA during electrophoresis in polyacrylamide or agarose gels that they retard its migration. The retardation is roughly proportional to the reagent to base pair ratio, and the magnitude of the retardation indicates that a combined charge neutralization/helix extension mechanism is mainly responsible for the effect. Furthermore, DNA sequence dependent differences are observed. Thus, the pUC 19 restriction fragments (HaeIII or AluI), which in the native state comigrate upon gel electrophoretic analysis, could be separated in the presence of a diacridine, and specific DNA fragments responded differently to different diacridines. These results suggest that the effect also is due to a contribution from the DNA conformation and that the DNA conformation dynamics are influenced differently upon binding of different diacridines. They foresee three applications of this observation: (1) in analytical gel electrophoretic separation of otherwise comigrating DNA molecules, (2) in studies of polyintercalator-DNA interaction, and (3) in measurements of polyintercalator-induced DNA unwinding

  11. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson


    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  12. Organization and evolution of primate centromeric DNA from whole-genome shotgun sequence data.

    Directory of Open Access Journals (Sweden)

    Can Alkan


    Full Text Available The major DNA constituent of primate centromeres is alpha satellite DNA. As much as 2%-5% of sequence generated as part of primate genome sequencing projects consists of this material, which is fragmented or not assembled as part of published genome sequences due to its highly repetitive nature. Here, we develop computational methods to rapidly recover and categorize alpha-satellite sequences from previously uncharacterized whole-genome shotgun sequence data. We present an algorithm to computationally predict potential higher-order array structure based on paired-end sequence data and then experimentally validate its organization and distribution by experimental analyses. Using whole-genome shotgun data from the human, chimpanzee, and macaque genomes, we examine the phylogenetic relationship of these sequences and provide further support for a model for their evolution and mutation over the last 25 million years. Our results confirm fundamental differences in the dispersal and evolution of centromeric satellites in the Old World monkey and ape lineages of evolution.

  13. Organization and evolution of primate centromeric DNA from whole-genome shotgun sequence data. (United States)

    Alkan, Can; Ventura, Mario; Archidiacono, Nicoletta; Rocchi, Mariano; Sahinalp, S Cenk; Eichler, Evan E


    The major DNA constituent of primate centromeres is alpha satellite DNA. As much as 2%-5% of sequence generated as part of primate genome sequencing projects consists of this material, which is fragmented or not assembled as part of published genome sequences due to its highly repetitive nature. Here, we develop computational methods to rapidly recover and categorize alpha-satellite sequences from previously uncharacterized whole-genome shotgun sequence data. We present an algorithm to computationally predict potential higher-order array structure based on paired-end sequence data and then experimentally validate its organization and distribution by experimental analyses. Using whole-genome shotgun data from the human, chimpanzee, and macaque genomes, we examine the phylogenetic relationship of these sequences and provide further support for a model for their evolution and mutation over the last 25 million years. Our results confirm fundamental differences in the dispersal and evolution of centromeric satellites in the Old World monkey and ape lineages of evolution.

  14. Inspecting Targeted Deep Sequencing of Whole Genome Amplified DNA Versus Fresh DNA for Somatic Mutation Detection: A Genetic Study in Myelodysplastic Syndrome Patients. (United States)

    Palomo, Laura; Fuster-Tormo, Francisco; Alvira, Daniel; Ademà, Vera; Armengol, María Pilar; Gómez-Marzo, Paula; de Haro, Nuri; Mallo, Mar; Xicoy, Blanca; Zamora, Lurdes; Solé, Francesc


    Whole genome amplification (WGA) has become an invaluable method for preserving limited samples of precious stock material and has been used during the past years as an alternative tool to increase the amount of DNA before library preparation for next-generation sequencing. Myelodysplastic syndromes (MDS) are a group of clonal hematopoietic stem cell disorders characterized by presenting somatic mutations in several myeloid-related genes. In this work, targeted deep sequencing has been performed on four paired fresh DNA and WGA DNA samples from bone marrow of MDS patients, to assess the feasibility of using WGA DNA for detecting somatic mutations. The results of this study highlighted that, in general, the sequencing and alignment statistics of fresh DNA and WGA DNA samples were similar. However, after variant calling and when considering variants detected at all frequencies, there was a high level of discordance between fresh DNA and WGA DNA (overall, a higher number of variants was detected in WGA DNA). After proper filtering, a total of three somatic mutations were detected in the cohort. All somatic mutations detected in fresh DNA were also identified in WGA DNA and validated by whole exome sequencing.

  15. Neurospora ribosomal DNA sequences are indistinguishable within cell types but distinguishable among heterothallic species

    International Nuclear Information System (INIS)

    Chambers, C.; Dutta, S.K.


    High molecular nuclear DNAs were isolated from three developmental cell types of N. crassa: conidia, mycelia and germinated conidia, and from mycelial cells of two other heterothallic species, N. intermedia and N. sitophila. These nuclear DNAs were treated with several restriction enzymes: EcoR1, Bam H1, Hind III, Hinc II, Bgl II, Sma I and Pst 1. All seven restriction enzymes were tested on 0.7% agarose gels. EcoR1, Hind III, Pst 1, and Hinc II showed band differences among the species, but not among the cell types. Southern blot transfers of restricted DNA gels were then hybridized with 32 P-labelled pMF2 rDNAs (probe). This later DNA was prepared from N. crassa rDNA cloned into pBR322 plasmid, obtained from Dr. Robert Metzenberg of the University of Wisconsin. Autoradiograms of these hybrids between southern blots and probe DNA revealed similar rDNA band patterns confirming the observations on restriction gels. In the case of EcoR1 restriction analysis there were differences in fragments on 0.7% agarose gel, but after hybridization of southern blots no differences in band patterns were seen in autoradiograms. This raises the question whether the background bands were all of rDNA sequences. These studies are being continued using ITS (internal transcribed spacer) sequences of N. crassa rDNAs cloned in pBR322 plasmid

  16. Is radon emission in caves causing deletions in satellite DNA sequences of cave-dwelling crickets?

    Directory of Open Access Journals (Sweden)

    Giuliana Allegrucci

    Full Text Available The most stable isotope of radon, 222Rn, represents the major source of natural radioactivity in confined environments such as mines, caves and houses. In this study, we explored the possible radon-related effects on the genome of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae sampled in caves with different concentrations of radon. We analyzed specimens from ten populations belonging to two genetically closely related species, D. geniculata and D. laetitiae, and explored the possible association between the radioactivity dose and the level of genetic polymorphism in a specific family of satellite DNA (pDo500 satDNA. Radon concentration in the analyzed caves ranged from 221 to 26,000 Bq/m3. Specimens coming from caves with the highest radon concentration showed also the highest variability estimates in both species, and the increased sequence heterogeneity at pDo500 satDNA level can be explained as an effect of the mutation pressure induced by radon in cave. We discovered a specific category of nuclear DNA, the highly repetitive satellite DNA, where the effects of the exposure at high levels of radon-related ionizing radiation are detectable, suggesting that the satDNA sequences might be a valuable tool to disclose harmful effects also in other organisms exposed to high levels of radon concentration.

  17. Incorporating DNA sequencing into current prenatal screening practice for Down's syndrome.

    Directory of Open Access Journals (Sweden)

    Nicholas J Wald

    Full Text Available BACKGROUND: Prenatal screening for Down's syndrome is performed using biochemical and ultrasound markers measured in early pregnancy such as the Integrated test using first and second trimester markers. Recently, DNA sequencing methods have been introduced on free DNA in maternal plasma, yielding a high screening performance. These methods are expensive and there is a test failure rate. We determined the screening performance of merging the Integrated test with the newer DNA techniques in a protocol that substantially reduces the cost compared with universal DNA testing and still achieves high screening performance with no test failures. METHODS: Published data were used to model screening performance of a protocol in which all women receive the first stage of the Integrated test at about 11 weeks of pregnancy. On the basis of this higher risk women have reflex DNA testing and lower risk women as well as those with a failed DNA test complete the Integrated test at about 15 weeks. RESULTS: The overall detection rate was 95% with a 0.1% false-positive rate if 20% of women were selected to receive DNA testing. If all women had DNA testing the detection rate would be 3 to 4 percentage points higher with a false-positive rate 30 times greater if women with failed tests were treated as positive and offered a diagnostic amniocentesis, or 3 times greater if they had a second trimester screening test (Quadruple test and treated as positive only if this were positive. The cost per women screened would be about one-fifth, compared with universal DNA testing, if the DNA test were 20 times the cost of the Integrated test. CONCLUSION: The proposed screening protocol achieves a high screening performance without programme test failures and at a substantially lower cost than offering all women DNA testing.

  18. New insights into Trypanosoma cruzi evolution, genotyping and molecular diagnostics from satellite DNA sequence analysis.

    Directory of Open Access Journals (Sweden)

    Juan C Ramírez


    Full Text Available Trypanosoma cruzi has been subdivided into seven Discrete Typing Units (DTUs, TcI-TcVI and Tcbat. Two major evolutionary models have been proposed to explain the origin of hybrid lineages, but while it is widely accepted that TcV and TcVI are the result of genetic exchange between TcII and TcIII strains, the origin of TcIII and TcIV is still a matter of debate. T. cruzi satellite DNA (SatDNA, comprised of 195 bp units organized in tandem repeats, from both TcV and TcVI stocks were found to have SatDNA copies type TcI and TcII; whereas contradictory results were observed for TcIII stocks and no TcIV sequence has been analyzed yet. Herein, we have gone deeper into this matter analyzing 335 distinct SatDNA sequences from 19 T. cruzi stocks representative of DTUs TcI-TcVI for phylogenetic inference. Bayesian phylogenetic tree showed that all sequences were grouped in three major clusters, which corresponded to sequences from DTUs TcI/III, TcII and TcIV; whereas TcV and TcVI stocks had two sets of sequences distributed into TcI/III and TcII clusters. As expected, the lowest genetic distances were found between TcI and TcIII, and between TcV and TcVI sequences; whereas the highest ones were observed between TcII and TcI/III, and among TcIV sequences and those from the remaining DTUs. In addition, signature patterns associated to specific T. cruzi lineages were identified and new primers that improved SatDNA-based qPCR sensitivity were designed. Our findings support the theory that TcIII is not the result of a hybridization event between TcI and TcII, and that TcIV had an independent origin from the other DTUs, contributing to clarifying the evolutionary history of T. cruzi lineages. Moreover, this work opens the possibility of typing samples from Chagas disease patients with low parasitic loads and improving molecular diagnostic methods of T. cruzi infection based on SatDNA sequence amplification.

  19. New insights into Trypanosoma cruzi evolution, genotyping and molecular diagnostics from satellite DNA sequence analysis. (United States)

    Ramírez, Juan C; Torres, Carolina; Curto, María de Los A; Schijman, Alejandro G


    Trypanosoma cruzi has been subdivided into seven Discrete Typing Units (DTUs), TcI-TcVI and Tcbat. Two major evolutionary models have been proposed to explain the origin of hybrid lineages, but while it is widely accepted that TcV and TcVI are the result of genetic exchange between TcII and TcIII strains, the origin of TcIII and TcIV is still a matter of debate. T. cruzi satellite DNA (SatDNA), comprised of 195 bp units organized in tandem repeats, from both TcV and TcVI stocks were found to have SatDNA copies type TcI and TcII; whereas contradictory results were observed for TcIII stocks and no TcIV sequence has been analyzed yet. Herein, we have gone deeper into this matter analyzing 335 distinct SatDNA sequences from 19 T. cruzi stocks representative of DTUs TcI-TcVI for phylogenetic inference. Bayesian phylogenetic tree showed that all sequences were grouped in three major clusters, which corresponded to sequences from DTUs TcI/III, TcII and TcIV; whereas TcV and TcVI stocks had two sets of sequences distributed into TcI/III and TcII clusters. As expected, the lowest genetic distances were found between TcI and TcIII, and between TcV and TcVI sequences; whereas the highest ones were observed between TcII and TcI/III, and among TcIV sequences and those from the remaining DTUs. In addition, signature patterns associated to specific T. cruzi lineages were identified and new primers that improved SatDNA-based qPCR sensitivity were designed. Our findings support the theory that TcIII is not the result of a hybridization event between TcI and TcII, and that TcIV had an independent origin from the other DTUs, contributing to clarifying the evolutionary history of T. cruzi lineages. Moreover, this work opens the possibility of typing samples from Chagas disease patients with low parasitic loads and improving molecular diagnostic methods of T. cruzi infection based on SatDNA sequence amplification.

  20. Bidirectional gene sequences with similar homology to functional proteins of alkane degrading bacterium pseudomonas fredriksbergensis DNA

    International Nuclear Information System (INIS)

    Megeed, A.A.


    The potential for two overlapping fragments of DNA from a clone of newly isolated alkanes degrading bacterium Pseudomonas frederiksbergensis encoding sequences with similar homology to two parts of functional proteins is described. One strand contains a sequence with high homology to alkanes monooxygenase (alkB), a member of the alkanes hydroxylase family, and the other strand contains a sequence with some homology to alcohol dehydrogenase gene (alkJ). Overlapping of the genes on opposite strands has been reported in eukaryotic species, and is now reported in a bacterial species. The sequence comparisons and ORFS results revealed that the regulation and the genes organization involved in alkane oxidation represented in Pseudomonas frederiksberghensis varies among the different known alkane degrading bacteria. The alk gene cluster containing homologues to the known alkane monooxygenase (alkB), and rubredoxin (alkG) are oriented in the same direction, whereas alcohol dehydrogenase (alkJ) is oriented in the opposite direction. Such genomes encode messages on both strands of the DNA, or in an overlapping but different reading frames, of the same strand of DNA. The possibility of creating novel genes from pre-existing sequences, known as overprinting, which is a widespread phenomenon in small viruses. Here, the origin and evolution of the gene overlap to bacteriophages belonging to the family Microviridae have been investigated. Such a phenomenon is most widely described in extremely small genomes such as those of viruses or small plasmids, yet here is a unique phenomenon. (author)

  1. A microfluidic DNA library preparation platform for next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Hanyoup Kim

    Full Text Available Next-generation sequencing (NGS is emerging as a powerful tool for elucidating genetic information for a wide range of applications. Unfortunately, the surging popularity of NGS has not yet been accompanied by an improvement in automated techniques for preparing formatted sequencing libraries. To address this challenge, we have developed a prototype microfluidic system for preparing sequencer-ready DNA libraries for analysis by Illumina sequencing. Our system combines droplet-based digital microfluidic (DMF sample handling with peripheral modules to create a fully-integrated, sample-in library-out platform. In this report, we use our automated system to prepare NGS libraries from samples of human and bacterial genomic DNA. E. coli libraries prepared on-device from 5 ng of total DNA yielded excellent sequence coverage over the entire bacterial genome, with >99% alignment to the reference genome, even genome coverage, and good quality scores. Furthermore, we produced a de novo assembly on a previously unsequenced multi-drug resistant Klebsiella pneumoniae strain BAA-2146 (KpnNDM. The new method described here is fast, robust, scalable, and automated. Our device for library preparation will assist in the integration of NGS technology into a wide variety of laboratories, including small research laboratories and clinical laboratories.

  2. Norgal: extraction and de novo assembly of mitochondrial DNA from whole-genome sequencing data. (United States)

    Al-Nakeeb, Kosai; Petersen, Thomas Nordahl; Sicheritz-Pontén, Thomas


    Whole-genome sequencing (WGS) projects provide short read nucleotide sequences from nuclear and possibly organelle DNA depending on the source of origin. Mitochondrial DNA is present in animals and fungi, while plants contain DNA from both mitochondria and chloroplasts. Current techniques for separating organelle reads from nuclear reads in WGS data require full reference or partial seed sequences for assembling. Norgal (de Novo ORGAneLle extractor) avoids this requirement by identifying a high frequency subset of k-mers that are predominantly of mitochondrial origin and performing a de novo assembly on a subset of reads that contains these k-mers. The method was applied to WGS data from a panda, brown algae seaweed, butterfly and filamentous fungus. We were able to extract full circular mitochondrial genomes and obtained sequence identities to the reference sequences in the range from 98.5 to 99.5%. We also assembled the chloroplasts of grape vines and cucumbers using Norgal together with seed-based de novo assemblers. Norgal is a pipeline that can extract and assemble full or partial mitochondrial and chloroplast genomes from WGS short reads without prior knowledge. The program is available at: .

  3. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.


    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein

  4. A microfluidic DNA library preparation platform for next-generation sequencing. (United States)

    Kim, Hanyoup; Jebrail, Mais J; Sinha, Anupama; Bent, Zachary W; Solberg, Owen D; Williams, Kelly P; Langevin, Stanley A; Renzi, Ronald F; Van De Vreugde, James L; Meagher, Robert J; Schoeniger, Joseph S; Lane, Todd W; Branda, Steven S; Bartsch, Michael S; Patel, Kamlesh D


    Next-generation sequencing (NGS) is emerging as a powerful tool for elucidating genetic information for a wide range of applications. Unfortunately, the surging popularity of NGS has not yet been accompanied by an improvement in automated techniques for preparing formatted sequencing libraries. To address this challenge, we have developed a prototype microfluidic system for preparing sequencer-ready DNA libraries for analysis by Illumina sequencing. Our system combines droplet-based digital microfluidic (DMF) sample handling with peripheral modules to create a fully-integrated, sample-in library-out platform. In this report, we use our automated system to prepare NGS libraries from samples of human and bacterial genomic DNA. E. coli libraries prepared on-device from 5 ng of total DNA yielded excellent sequence coverage over the entire bacterial genome, with >99% alignment to the reference genome, even genome coverage, and good quality scores. Furthermore, we produced a de novo assembly on a previously unsequenced multi-drug resistant Klebsiella pneumoniae strain BAA-2146 (KpnNDM). The new method described here is fast, robust, scalable, and automated. Our device for library preparation will assist in the integration of NGS technology into a wide variety of laboratories, including small research laboratories and clinical laboratories.

  5. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA (United States)

    Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.


    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  6. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection. (United States)

    Hebert, Paul D N; Dewaard, Jeremy R; Zakharov, Evgeny V; Prosser, Sean W J; Sones, Jayme E; McKeown, Jaclyn T A; Mantle, Beth; La Salle, John


    DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera) species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp) were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  7. HLA class I sequence-based typing using DNA recovered from frozen plasma. (United States)

    Cotton, Laura A; Abdur Rahman, Manal; Ng, Carmond; Le, Anh Q; Milloy, M-J; Mo, Theresa; Brumme, Zabrina L


    We describe a rapid, reliable and cost-effective method for intermediate-to-high-resolution sequence-based HLA class I typing using frozen plasma as a source of genomic DNA. The plasma samples investigated had a median age of 8.5 years. Total nucleic acids were isolated from matched frozen PBMC (~2.5 million) and plasma (500 μl) samples from a panel of 25 individuals using commercial silica-based kits. Extractions yielded median [IQR] nucleic acid concentrations of 85.7 [47.0-130.0]ng/μl and 2.2 [1.7-2.6]ng/μl from PBMC and plasma, respectively. Following extraction, ~1000 base pair regions spanning exons 2 and 3 of HLA-A, -B and -C were amplified independently via nested PCR using universal, locus-specific primers and sequenced directly. Chromatogram analysis was performed using commercial DNA sequence analysis software and allele interpretation was performed using a free web-based tool. HLA-A, -B and -C amplification rates were 100% and chromatograms were of uniformly high quality with clearly distinguishable mixed bases regardless of DNA source. Concordance between PBMC and plasma-derived HLA types was 100% at the allele and protein levels. At the nucleotide level, a single partially discordant base (resulting from a failure to call both peaks in a mixed base) was observed out of >46,975 bases sequenced (>99.9% concordance). This protocol has previously been used to perform HLA class I typing from a variety of genomic DNA sources including PBMC, whole blood, granulocyte pellets and serum, from specimens up to 30 years old. This method provides comparable specificity to conventional sequence-based approaches and could be applied in situations where cell samples are unavailable or DNA quantities are limiting. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models. (United States)

    Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook


    As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of

  9. High Sequence Variations in Mitochondrial DNA Control Region among Worldwide Populations of Flathead Mullet Mugil cephalus

    Directory of Open Access Journals (Sweden)

    Brian Wade Jamandre


    Full Text Available The sequence and structure of the complete mtDNA control region (CR of M. cephalus from African, Pacific, and Atlantic populations are presented in this study to assess its usefulness in phylogeographic studies of this species. The mtDNA CR sequence variations among M. cephalus populations largely exceeded intraspecific polymorphisms that are generally observed in other vertebrates. The length of CR sequence varied among M. cephalus populations due to the presence of indels and variable number of tandem repeats at the 3′ hypervariable domain. The high evolutionary rate of the CR in this species probably originated from these mutations. However, no excessive homoplasic mutations were noticed. Finally, the star shaped tree inferred from the CR polymorphism stresses a rapid radiation worldwide, in this species. The CR still appears as a good marker for phylogeographic investigations and additional worldwide samples are warranted to further investigate the genetic structure and evolution in M. cephalus.

  10. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences. (United States)

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F


    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  11. Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA. (United States)

    Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R


    During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

  12. Profiling nematode communities in unmanaged flowerbed and agricultural field soils in Japan by DNA barcode sequencing.

    Directory of Open Access Journals (Sweden)

    Hisashi Morise

    Full Text Available Soil nematodes play crucial roles in the soil food web and are a suitable indicator for assessing soil environments and ecosystems. Previous nematode community analyses based on nematode morphology classification have been shown to be useful for assessing various soil environments. Here we have conducted DNA barcode analysis for soil nematode community analyses in Japanese soils. We isolated nematodes from two different environmental soils of an unmanaged flowerbed and an agricultural field using the improved flotation-sieving method. Small subunit (SSU rDNA fragments were directly amplified from each of 68 (flowerbed samples and 48 (field samples isolated nematodes to determine the nucleotide sequence. Sixteen and thirteen operational taxonomic units (OTUs were obtained by multiple sequence alignment from the flowerbed and agricultural field nematodes, respectively. All 29 SSU rDNA-derived OTUs (rOTUs were further mapped onto a phylogenetic tree with 107 known nematode species. Interestingly, the two nematode communities examined were clearly distinct from each other in terms of trophic groups: Animal predators and plant feeders were markedly abundant in the flowerbed soils, in contrast, bacterial feeders were dominantly observed in the agricultural field soils. The data from the flowerbed nematodes suggests a possible food web among two different trophic nematode groups and plants (weeds in the closed soil environment. Finally, DNA sequences derived from the mitochondrial cytochrome oxidase c subunit 1 (COI gene were determined as a DNA barcode from 43 agricultural field soil nematodes. These nematodes were assigned to 13 rDNA-derived OTUs, but in the COI gene analysis were assigned to 23 COI gene-derived OTUs (cOTUs, indicating that COI gene-based barcoding may provide higher taxonomic resolution than conventional SSU rDNA-barcoding in soil nematode community analysis.

  13. Profiling Nematode Communities in Unmanaged Flowerbed and Agricultural Field Soils in Japan by DNA Barcode Sequencing (United States)

    Morise, Hisashi; Miyazaki, Erika; Yoshimitsu, Shoko; Eki, Toshihiko


    Soil nematodes play crucial roles in the soil food web and are a suitable indicator for assessing soil environments and ecosystems. Previous nematode community analyses based on nematode morphology classification have been shown to be useful for assessing various soil environments. Here we have conducted DNA barcode analysis for soil nematode community analyses in Japanese soils. We isolated nematodes from two different environmental soils of an unmanaged flowerbed and an agricultural field using the improved flotation-sieving method. Small subunit (SSU) rDNA fragments were directly amplified from each of 68 (flowerbed samples) and 48 (field samples) isolated nematodes to determine the nucleotide sequence. Sixteen and thirteen operational taxonomic units (OTUs) were obtained by multiple sequence alignment from the flowerbed and agricultural field nematodes, respectively. All 29 SSU rDNA-derived OTUs (rOTUs) were further mapped onto a phylogenetic tree with 107 known nematode species. Interestingly, the two nematode communities examined were clearly distinct from each other in terms of trophic groups: Animal predators and plant feeders were markedly abundant in the flowerbed soils, in contrast, bacterial feeders were dominantly observed in the agricultural field soils. The data from the flowerbed nematodes suggests a possible food web among two different trophic nematode groups and plants (weeds) in the closed soil environment. Finally, DNA sequences derived from the mitochondrial cytochrome oxidase c subunit 1 (COI) gene were determined as a DNA barcode from 43 agricultural field soil nematodes. These nematodes were assigned to 13 rDNA-derived OTUs, but in the COI gene analysis were assigned to 23 COI gene-derived OTUs (cOTUs), indicating that COI gene-based barcoding may provide higher taxonomic resolution than conventional SSU rDNA-barcoding in soil nematode community analysis. PMID:23284767

  14. GenEST, a powerful bidirectional link between cDNA sequence data and gene expression profiles generated by cDNA-AFLP

    NARCIS (Netherlands)

    Qin Ling,; Prins, P.; Jones, J.T.; Popeijus, H.; Smant, G.; Bakker, J.; Helder, J.


    The release of vast quantities of DNA sequence data by large-scale genome and expressed sequence tag (EST) projects underlines the necessity for the development of efficient and inexpensive ways to link sequence databases with temporal and spatial expression profiles. Here we demonstrate the power

  15. Massively parallel DNA sequencing facilitates diagnosis of patients with Usher syndrome type 1.

    Directory of Open Access Journals (Sweden)

    Hidekane Yoshimura

    Full Text Available Usher syndrome is an autosomal recessive disorder manifesting hearing loss, retinitis pigmentosa and vestibular dysfunction, and having three clinical subtypes. Usher syndrome type 1 is the most severe subtype due to its profound hearing loss, lack of vestibular responses, and retinitis pigmentosa that appears in prepuberty. Six of the corresponding genes have been identified, making early diagnosis through DNA testing possible, with many immediate and several long-term advantages for patients and their families. However, the conventional genetic techniques, such as direct sequence analysis, are both time-consuming and expensive. Targeted exon sequencing of selected genes using the massively parallel DNA sequencing technology will potentially enable us to systematically tackle previously intractable monogenic disorders and improve molecular diagnosis. Using this technique combined with direct sequence analysis, we screened 17 unrelated Usher syndrome type 1 patients and detected probable pathogenic variants in the 16 of them (94.1% who carried at least one mutation. Seven patients had the MYO7A mutation (41.2%, which is the most common type in Japanese. Most of the mutations were detected by only the massively parallel DNA sequencing. We report here four patients, who had probable pathogenic mutations in two different Usher syndrome type 1 genes, and one case of MYO7A/PCDH15 digenic inheritance. This is the first report of Usher syndrome mutation analysis using massively parallel DNA sequencing and the frequency of Usher syndrome type 1 genes in Japanese. Mutation screening using this technique has the power to quickly identify mutations of many causative genes while maintaining cost-benefit performance. In addition, the simultaneous mutation analysis of large numbers of genes is useful for detecting mutations in different genes that are possibly disease modifiers or of digenic inheritance.

  16. Molecular characterization of Fasciola gigantica from Mauritania based on mitochondrial and nuclear ribosomal DNA sequences. (United States)

    Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine


    Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All

  17. Massively parallel DNA sequencing facilitates diagnosis of patients with Usher syndrome type 1. (United States)

    Yoshimura, Hidekane; Iwasaki, Satoshi; Nishio, Shin-Ya; Kumakawa, Kozo; Tono, Tetsuya; Kobayashi, Yumiko; Sato, Hiroaki; Nagai, Kyoko; Ishikawa, Kotaro; Ikezono, Tetsuo; Naito, Yasushi; Fukushima, Kunihiro; Oshikawa, Chie; Kimitsuki, Takashi; Nakanishi, Hiroshi; Usami, Shin-Ichi


    Usher syndrome is an autosomal recessive disorder manifesting hearing loss, retinitis pigmentosa and vestibular dysfunction, and having three clinical subtypes. Usher syndrome type 1 is the most severe subtype due to its profound hearing loss, lack of vestibular responses, and retinitis pigmentosa that appears in prepuberty. Six of the corresponding genes have been identified, making early diagnosis through DNA testing possible, with many immediate and several long-term advantages for patients and their families. However, the conventional genetic techniques, such as direct sequence analysis, are both time-consuming and expensive. Targeted exon sequencing of selected genes using the massively parallel DNA sequencing technology will potentially enable us to systematically tackle previously intractable monogenic disorders and improve molecular diagnosis. Using this technique combined with direct sequence analysis, we screened 17 unrelated Usher syndrome type 1 patients and detected probable pathogenic variants in the 16 of them (94.1%) who carried at least one mutation. Seven patients had the MYO7A mutation (41.2%), which is the most common type in Japanese. Most of the mutations were detected by only the massively parallel DNA sequencing. We report here four patients, who had probable pathogenic mutations in two different Usher syndrome type 1 genes, and one case of MYO7A/PCDH15 digenic inheritance. This is the first report of Usher syndrome mutation analysis using massively parallel DNA sequencing and the frequency of Usher syndrome type 1 genes in Japanese. Mutation screening using this technique has the power to quickly identify mutations of many causative genes while maintaining cost-benefit performance. In addition, the simultaneous mutation analysis of large numbers of genes is useful for detecting mutations in different genes that are possibly disease modifiers or of digenic inheritance.

  18. Detection of genetically modified organisms (GMOs) using isothermal amplification of target DNA sequences. (United States)

    Lee, David; La Mura, Maurizio; Allnutt, Theo R; Powell, Wayne


    The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR). Here we have applied the loop-mediated isothermal amplification (LAMP) method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene) junctions. We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.

  19. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    Tran Duc


    Full Text Available Abstract Background Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the

  20. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.


    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  1. Next generation DNA sequencing technology delivers valuable genetic markers for the genomic orphan legume species, Bituminaria bituminosa

    Directory of Open Access Journals (Sweden)

    Pazos-Navarro María


    Full Text Available Abstract Background Bituminaria bituminosa is a perennial legume species from the Canary Islands and Mediterranean region that has potential as a drought-tolerant pasture species and as a source of pharmaceutical compounds. Three botanical varieties have previously been identified in this species: albomarginata, bituminosa and crassiuscula. B. bituminosa can be considered a genomic 'orphan' species with very few genomic resources available. New DNA sequencing technologies provide an opportunity to develop high quality molecular markers for such orphan species. Results 432,306 mRNA molecules were sampled from a leaf transcriptome of a single B. bituminosa plant using Roche 454 pyrosequencing, resulting in an average read length of 345 bp (149.1 Mbp in total. Sequences were assembled into 3,838 isotigs/contigs representing putatively unique gene transcripts. Gene ontology descriptors were identified for 3,419 sequences. Raw sequence reads containing simple sequence repeat (SSR motifs were identified, and 240 primer pairs flanking these motifs were designed. Of 87 primer pairs developed this way, 75 (86.2% successfully amplified primarily single fragments by PCR. Fragment analysis using 20 primer pairs in 79 accessions of B. bituminosa detected 130 alleles at 21 SSR loci. Genetic diversity analyses confirmed that variation at these SSR loci accurately reflected known taxonomic relationships in original collections of B. bituminosa and provided additional evidence that a division of the botanical variety bituminosa into two according to geographical origin (Mediterranean region and Canary Islands may be appropriate. Evidence of cross-pollination was also found between botanical varieties within a B. bituminosa breeding programme. Conclusions B. bituminosa can no longer be considered a genomic orphan species, having now a large (albeit incomplete repertoire of expressed gene sequences that can serve as a resource for future genetic studies. This

  2. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten


    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  3. Direct DNA Extraction from Mycobacterium tuberculosis Frozen Stocks as a Reculture-Independent Approach to Whole-Genome Sequencing

    DEFF Research Database (Denmark)

    Bjorn-Mortensen, K; Zallet, J; Lillebaek, T


    Culturing before DNA extraction represents a major time-consuming step in whole-genome sequencing of slow-growing bacteria, such as Mycobacterium tuberculosis. We report a workflow to extract DNA from frozen isolates without reculturing. Prepared libraries and sequence data were comparable...... with results from recultured aliquots of the same stocks....

  4. Identifications of Captive and Wild Tilapia Species Existing in Hawaii by Mitochondrial DNA Control Region Sequence (United States)

    Wu, Liang; Yang, Jinzeng


    Background The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. Methodology/Principal Findings In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. Conclusions/Significance This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species

  5. AFEAP cloning: a precise and efficient method for large DNA sequence assembly. (United States)

    Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin


    Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

  6. Sequence specific DNA binding by P53 is enhanced by ionizing radiation and is mediated via DNA-PK activity

    International Nuclear Information System (INIS)

    Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.


    Purpose: P53 is known to be involved in the cellular response to DNA damage. It mediates many of its effects by acting as a transcription factor via sequence-specific DNA binding. The half-life of p53 is prolonged following DNA damage, and this results in elevated levels of p53 for a period of 2-8 hours. The increase in p53 is often relatively small, but this produces significant stimulation of a downstream gene such as p21(WAF1/cip1). We investigated post-translational modification of p53 following ionizing radiation damage. Materials and Methods: The response of normal Balb-C mouse fibroblasts (FC) to ionizing radiation (IR, 8 Gy) was measured at 0,3,6,9 and 24 hours, by the levels of p53, p21, flow cytometry and the electrophoretic mobility shift assay (EMSA). EMSA utilized a 26 bp consensus sequence end-labeled oligonucleotide to measure sequence-specific p53 binding. P53 specificity was confirmed by an enhanced mobility shift (retardation) when using p53 antibody. Comparison was made with scid fibroblasts (FS) and FC cells transfected with a plasmid (CX3) containing mutant p53 (alanine-143) or infected with a retrovirus containing the E6 protein of human papilloma virus type 16. Results: The response of p53 to DNA damage shows a 3-fold increase at 3-6 hours, and was not significantly different between FC and FS. FC-CX3 showed detectable basal levels of p53, and a 2-fold further induction of p53 after IR. FC-E6 showed no detectable levels of p53 before or after IR. No induction of p21 or G1/S arrest was seen in FC-CX3 or FC-E6, as has been observed previously. The induction of p21 in FS cells was attenuated and delayed: a 2-3-fold increase seen maximally at 9 hours, compared with a 5-fold increase seen maximally at 3-6 hours in FC cells. The accumulation of cells at the G1/S junction after IR showed the same kinetics as p21 induction: the peak of cells in G1 occurs at 3-6 hours in FC, but not until 9-24 hours in FS. The response is reminiscent of that seen in

  7. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction (United States)

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang


    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  8. AQME: A forensic mitochondrial DNA analysis tool for next-generation sequencing data. (United States)

    Sturk-Andreaggi, Kimberly; Peck, Michelle A; Boysen, Cecilie; Dekker, Patrick; McMahon, Timothy P; Marshall, Charla K


    The feasibility of generating mitochondrial DNA (mtDNA) data has expanded considerably with the advent of next-generation sequencing (NGS), specifically in the generation of entire mtDNA genome (mitogenome) sequences. However, the analysis of these data has emerged as the greatest challenge to implementation in forensics. To address this need, a custom toolkit for use in the CLC Genomics Workbench (QIAGEN, Hilden, Germany) was developed through a collaborative effort between the Armed Forces Medical Examiner System - Armed Forces DNA Identification Laboratory (AFMES-AFDIL) and QIAGEN Bioinformatics. The AFDIL-QIAGEN mtDNA Expert, or AQME, generates an editable mtDNA profile that employs forensic conventions and includes the interpretation range required for mtDNA data reporting. AQME also integrates an mtDNA haplogroup estimate into the analysis workflow, which provides the analyst with phylogenetic nomenclature guidance and a profile quality check without the use of an external tool. Supplemental AQME outputs such as nucleotide-per-position metrics, configurable export files, and an audit trail are produced to assist the analyst during review. AQME is applied to standard CLC outputs and thus can be incorporated into any mtDNA bioinformatics pipeline within CLC regardless of sample type, library preparation or NGS platform. An evaluation of AQME was performed to demonstrate its functionality and reliability for the analysis of mitogenome NGS data. The study analyzed Illumina mitogenome data from 21 samples (including associated controls) of varying quality and sample preparations with the AQME toolkit. A total of 211 tool edits were automatically applied to 130 of the 698 total variants reported in an effort to adhere to forensic nomenclature. Although additional manual edits were required for three samples, supplemental tools such as mtDNA haplogroup estimation assisted in identifying and guiding these necessary modifications to the AQME-generated profile. Along

  9. Digital Droplet Multiple Displacement Amplification (ddMDA for Whole Genome Sequencing of Limited DNA Samples.

    Directory of Open Access Journals (Sweden)

    Minsoung Rhee

    Full Text Available Multiple displacement amplification (MDA is a widely used technique for amplification of DNA from samples containing limited amounts of DNA (e.g., uncultivable microbes or clinical samples before whole genome sequencing. Despite its advantages of high yield and fidelity, it suffers from high amplification bias and non-specific amplification when amplifying sub-nanogram of template DNA. Here, we present a microfluidic digital droplet MDA (ddMDA technique where partitioning of the template DNA into thousands of sub-nanoliter droplets, each containing a small number of DNA fragments, greatly reduces the competition among DNA fragments for primers and polymerase thereby greatly reducing amplification bias. Consequently, the ddMDA approach enabled a more uniform coverage of amplification over the entire length of the genome, with significantly lower bias and non-specific amplification than conventional MDA. For a sample containing 0.1 pg/μL of E. coli DNA (equivalent of ~3/1000 of an E. coli genome per droplet, ddMDA achieves a 65-fold increase in coverage in de novo assembly, and more than 20-fold increase in specificity (percentage of reads mapping to E. coli compared to the conventional tube MDA. ddMDA offers a powerful method useful for many applications including medical diagnostics, forensics, and environmental microbiology.

  10. Sequence specificity of alkali-labile DNA damage photosensitized by suprofen. (United States)

    Starrs, S M; Davies, R J


    On irradiation at UVB wavelengths, in aerated neutral aqueous solution, the anti-inflammatory drug suprofen (SP) photosensitizes the production of alkali-labile cleavage sites in DNA much more efficiently than direct strand breaks. It is active at submillimolar concentrations despite having no significant binding affinity for DNA. Gel sequencing studies utilizing 32P-end-labeled oligonucleotides have revealed that piperidine-sensitive lesions are formed predominantly at the positions of guanine (G) bases, with the extent of modification being UV dose- and SP concentration-dependent. Quite distinct patterns of G-specific damage are observed in single-stranded and duplex DNA molecules. The uniform attack at all G residues in single-stranded DNA, which is enhanced in D2O, is compatible with a Type-II mechanism. SP is a known generator of singlet oxygen whose participation in the reaction is supported by the effects of quenchers and scavengers. In duplex DNA, piperidine-induced cle