Effect of acid treatment on thermal extraction yield in ashless coal production
Energy Technology Data Exchange (ETDEWEB)
Chunqi Li; Toshimasa Takanohashi; Takahiro Yoshida; Ikuo Saito; Hideki Aoki; Kiyoshi Mashimo [National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan). Institute for Energy Utilization
2004-04-01
Coals of different ranks were acid-treated in aqueous methoxyethoxy acetic acid (MEAA), acetic acid (AA), and HCl. The acid-treated coals were extracted with polar N-methyl-2-pyrrolidinone (NMP) and nonpolar 1-methylnaphthalene (1MN) solvents at temperatures from 200 to 360{sup o}C for 10 60 min. The thermal extraction yields with NMP for some acid-treated low-rank coals increased greatly; for example, the extraction yield for Wyodak coal (%C; 75.0%) increased from 58.4% for the raw coal to 82.9% for coal treated in 1.0 M MEAA. Conversely, the extraction yields changed minimally for all the acid-treated coals extracted in 1-MN. The type and concentration of acid affected the extraction yield when NMP was used as the extraction solvent. With increasing MEAA concentration from 0.01 to 0.1 M, the extraction yield for Wyodak coal increased from 66.3 to 81.4%, and subsequently did not change clearly with concentration. Similar changes in the extraction yield with acid concentration were also observed with AA and HCl. The de-ashing ratio for coals acid-treated in MEAA, AA, and HCl also increased greatly with concentration from 0.01 to 0.1 M, which corresponded to the change in the thermal extraction yield in NMP. For the acid-treated coals, high extraction yields were obtained at lower extraction temperatures and shorter extraction times than for the raw coal. The mechanisms for the acid treatment and thermal extraction are discussed. 27 refs., 6 figs., 3 tabs.
Production of low ash coal by thermal extraction with N-methyl-2-pyrrolidinone
Energy Technology Data Exchange (ETDEWEB)
Do Kim, S.; Woo, K.J.; Jeong, S.K.; Rhim, Y.J.; Lee, S.H. [Korean Institute for Energy Research, Taejon (Republic of Korea). Clean Coal Technological Research Center
2008-07-15
Present study was conducted for the purpose of producing low ash coal from LRC (low rank coals) such as lignite and sub-bituminous coal through thermal extraction using polar solvent. Extraction from bituminous coal was also investigated for comparison. NMP as a polar solvent was used. The ratio of coal to solvent was adjusted as 1:10. Experimental conditions were established which include the extraction temperature of 200-430{sup o}C, initial applied pressure of 1-20 bar and extraction time of 0.5-2 hr were used. Extraction yield and ash content of extracted and residual coal were measured. The extraction yield increased with the increase of extraction temperature, and the ash content of extracted coal decreased below 0.4% at 400{sup o}C from the raw coal samples that have the ash contents of 4-6%. According to the analysis of experiments results, fixed carbon and calorific value increased, and H/C and O/C decreased.
RESEARCH ON CARBON PRODUCTS FROM COAL USING AN EXTRACTIVE PROCESS
Energy Technology Data Exchange (ETDEWEB)
Peter G. Stansberry; Alfred H. Stiller; John W. Zondlo; Chong Chen; Brian Bland; David Fenton
2002-03-31
This report presents the results of a one-year effort directed at the exploration of the use of coal as a feedstock for a variety of industrially-relevant carbon products. The work was basically divided into three focus areas. The first area dealt with the acquisition of laboratory equipment to aid in the analysis and characterization of both the raw coal and the coal-derived feedstocks. Improvements were also made on the coal-extraction pilot plant which will now allow larger quantities of feedstock to be produced. Mass and energy balances were also performed on the pilot plant in an attempt to evaluate the scale-up potential of the process. The second focus area dealt with exploring hydrogenation conditions specifically aimed at testing several less-expensive candidate hydrogen-donor solvents. Through a process of filtration and vacuum distillation, viable pitch products were produced and evaluated. Moreover, a recycle solvent was also isolated so that the overall solvent balance in the system could be maintained. The effect of variables such as gas pressure and gas atmosphere were evaluated. The pitch product was analyzed and showed low ash content, reasonable yield, good coking value and a coke with anisotropic optical texture. A unique plot of coke yield vs. pitch softening point was discovered to be independent of reaction conditions or hydrogen-donor solvent. The third area of research centered on the investigation of alternate extraction solvents and processing conditions for the solvent extraction step. A wide variety of solvents, co-solvents and enhancement additives were tested with varying degrees of success. For the extraction of raw coal, the efficacy of the alternate solvents when compared to the benchmark solvent, N-methyl pyrrolidone, was not good. However when the same coal was partially hydrogenated prior to solvent extraction, all solvents showed excellent results even for extractions performed at room temperature. Standard analyses of the
Extraction of Coal and Gangue Geometric Features with Multifractal Detrending Fluctuation Analysis
Directory of Open Access Journals (Sweden)
Kai Liu
2018-03-01
Full Text Available The separation of coal and gangue is an important process of the coal preparation technology. The conventional way of manual selection and separation of gangue from the raw coal can be replaced by computer vision technology. In the literature, research on image recognition and classification of coal and gangue is mainly based on the grayscale and texture features of the coal and gangue. However, there are few studies on characteristics of coal and gangue from the perspective of their outline differences. Therefore, the multifractal detrended fluctuation analysis (MFDFA method is introduced in this paper to extract the geometric features of coal and gangue. Firstly, the outline curves of coal and gangue in polar coordinates are detected and achieved along the centroid, thereby the multifractal characteristics of the series are analyzed and compared. Subsequently, the modified local singular spectrum widths Δ h of the outline curve series are extracted as the characteristic variables of the coal and gangue for pattern recognition. Finally, the extracted geometric features by MFDFA combined with the grayscale and texture features of the images are compared with other methods, indicating that the recognition rate of coal gangue images can be increased by introducing the geometric features.
Effect of pre-swelling of coal on its solvent extraction and liquefaction properties
Energy Technology Data Exchange (ETDEWEB)
Hengfu Shui; Zhicai Wang; Meixia Cao [Anhui University of Technology, Ma' anshan (China). School of Chemistry and Chemical Engineering
2008-10-15
Effects of pre-swelling of coal on solvent extraction and liquefaction properties were studied with Shenhua coal. It was found that pre-swelling treatments of the coal in three solvents, i.e., toluene (TOL), N-methyl-2-pyrrolidinone (NMP) and tetralin (THN) increased its extraction yield and liquefaction conversion, and differed the liquefied product distributions. The pre-swollen coals after removing the swelling solvents showed increased conversion in liquefaction compared with that of the swollen coals in the presence of swelling solvents. It was also found that the yields of (oil + gas) in liquefaction of the pre-swollen coals with NMP and TOL dramatically decreased in the presence of swelling solvent. TG and FTIR analyses of the raw coal, the swollen coals and the liquefied products were carried out in order to investigate the mechanism governing the effects of pre-swelling treatment on coal extraction and liquefaction. The results showed that the swelling pre-treatment could disrupt some non-covalent interactions of the coal molecules, relax its network structure and loosened the coal structure. It would thus benefit diffusion of a hydrogen donor solvent into the coal structure during liquefaction, and also enhance the hydrogen donating ability of the hydrogen-rich species derived from the coal. 21 refs., 4 figs., 3 tabs.
Changes in thermal plasticity of low grade coals during selective extraction of metals
Directory of Open Access Journals (Sweden)
В. Ю. Бажин
2016-08-01
Full Text Available As the world oil market tends to be highly volatile, the coal becomes a primary source of organic raw materials for chemical and metallurgical industries. Fossil coals can accumulate high amounts of elements and mixtures quite often reaching commercially valuable concentrations. Reserves of scandium and other rare elements in coal deposits in Siberia alone are sufficient to satisfy the expected global demand for several decades. This study is intended to solve complex tasks associated with extraction of metal oxides using the developed enrichment method to ensure the required thermal plasticity determining the quality and properties of metallurgical coke.Laboratory experiments have been conducted for the enrichment of high-ash coals containing the highest concentrations of metals. Thermal plasticity values have been determined with the help of Gieseler plastometer . Using modern technologies and equipment individual deposits can be turned into profitable production of enriched coking coals with concurrent extraction of rare metals. It has been proven that the highest commercial potential lies with the extraction of scandium and some other rare metals in the form of oxides from the coal.
Energy Technology Data Exchange (ETDEWEB)
Jie Wang; Chunqi Li; Kinya Sakanishi; Tetsuya Nakazato; Hiroaki Tao; Toshimasa Takanohashi; Takayuki Takarada; Ikuo Saito [National Institute Advanced Industrial Science and Technology (AIST), Ibaraki (Japan). Energy Technology Research Institute
2005-09-01
A sub-bituminous Wyodak coal (WD coal) and a bituminous Illinois No. 6 coal (IL coal) were thermally extracted with 1-methylnaphthalene (1-MN) and N-methyl-2-pyrrolidone (NMP) to produce clean extract. A mild pretreatment with acetic acid was also carried out. Major and trace inorganic elements in the raw coals and resultant extracts were determined by means of inductively coupled plasma optical emission spectrometry (ICP-OES), flow injection inductively coupled plasma mass spectrometry (FI-ICP-MS), and cold vapor atomic absorption spectrometry (CV-AAS). It was found that the extraction with 1-MN resulted in 73-100% reductions in the concentration of Li, Be, V, Ga, As, Se, Sr, Cd, Ba, Hg, and Pb. The extraction with NMP yielded more extract than that with 1-MN, but it retained more organically associated major and trace metals in the extracts. In the extraction of WD coal with NMP, the acid pretreatment not only significantly enhanced the extraction yield but also significantly reduced the concentrations of alkaline earth elements such as Be, Ca, Mg, Sr, and Ba in the extract. In addition, the modes of occurrence of trace elements in the coals were discussed according to their extraction behaviors. 30 refs., 2 figs., 5 tabs.
Effect of hydrothermal treatment on the extraction of coal in the CS{sub 2}/NMP mixed solvent
Energy Technology Data Exchange (ETDEWEB)
Hengfu Shui; Zhicai Wang; Gaoqiang Wang [Anhui University of Technology, Maanshan (China). School of Chemistry and Chemical Engineering
2006-09-15
The extraction of four Chinese different rank bituminous coals with the carbon disulfide/N-2-pyrrolidinone (CS2/NMP) mixed solvent (1:1 by volume) was carried out in room temperature. It was found that one of middle bituminous raw coal of the four coals gave more than 74% (daf) extraction yield, suggesting an associative structural model for the coal. The four coals were hydrothermal treated under different conditions, and it was found that the extraction yields of the treated coals obviously increased. This will have great significance for coal liquefaction. FTIR measurements show the removal of minerals after the hydrothermal treatment of coals suggesting the dissociation of the coal aggregation structure due to ionic interactions and/or hydrogen bonds broken because of the removal of oxygen and hydroxyl oxygen proceeded through ionic pathways, resulting in the extraction yields of the treated coals increase. However, breaking of {pi}-cation interactions by hydrothermal treatment may be one of possible mechanisms for the enhancement of extraction yield of higher rank of treated coal. The mechanism of hydrothermal treatment of coal was discussed in the paper. 28 refs., 4 figs., 4 tabs.
Increase in extraction yields of coals by water treatment: Beulah-Zap lignite
Energy Technology Data Exchange (ETDEWEB)
Masashi Iino; Toshimasa Takanohashi; Takahiro Shishido; Ikuo Saito; Haruo Kumagai [National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan)
2007-01-15
In a previous paper, we have reported that water pretreatments of Argonne premium coals, Pocahontas No. 3 (PO), Upper Freeport (UF), and Illinois No. 6 (IL) at 600 K increased greatly the room-temperature extraction yields with a 1:1 carbon disulfide/N-methyl-2-pyrrolidinone (CS{sub 2}/NMP) mixed solvent. In this paper, the water treatment of Beulah-Zap (BZ) lignite has been carried out and the results obtained were compared with those for the three bituminous coals above. The extraction yields of BZ with CS{sub 2}/NMP increased from 5.5% for the raw coal to 21.7% by the water treatment at 600 K. Similar to the other three coals, the water treatments at 500 K gave little increase in the yields. The larger decrease in oxygen content and hydrogen-bonded OH and the increase in the methanol swelling ratio by the water treatment suggest that the yield enhancements for BZ are attributed to the removal of oxygen functional groups and the breaking of hydrogen bonds to a greater extent than that for IL. From the characterizations of the treated coals and the extraction temperature dependency of their extraction yields, it is suggested that, for high-coal-rank coals, PO and UF, the breaking of noncovalent bonds such as {pi}-{pi} interactions between aromatic layers and hydrogen bonds is responsible for the extraction yield enhancements. 14 refs., 3 figs., 2 tabs.
PRODUCTION OF FOAMS, FIBERS AND PITCHES USING A COAL EXTRACTION PROCESS
Energy Technology Data Exchange (ETDEWEB)
Chong Chen; Elliot B. Kennel; Liviu Magean; Pete G. Stansberry; Alfred H. Stiller; John W. Zondlo
2004-06-20
This Department of Energy National Energy Technology Laboratory sponsored project developed processes for converting coal feedstocks to carbon products, including coal-derived pitch, coke foams and fibers based on solvent extraction processes. A key technology is the use of hydrogenation accomplished at elevated temperatures and pressures to obtain a synthetic coal pitch. Hydrogenation, or partial direct liquefaction of coal, is used to modify the properties of raw coal such that a molten synthetic pitch can be obtained. The amount of hydrogen required to produce a synthetic pitch is about an order of magnitude less than the amount required to produce synthetic crude oil. Hence the conditions for synthetic pitch production consume very little hydrogen and can be accomplished at substantially lower pressure. In the molten state, hot filtration or centrifugation can be used to separate dissolved coal chemicals from mineral matter and insolubles (inertinite), resulting in the production of a purified hydrocarbon pitch. Alternatively, if hydrogenation is not used, aromatic hydrocarbon liquids appropriate for use as precursors to carbon products can obtained by dissolving coal in a solvent. As in the case for partial direct liquefaction pitches, undissolved coal is removed via hot filtration or centrifugation. Excess solvent is boiled off and recovered. The resultant solid material, referred to as Solvent Extracted Carbon Ore or SECO, has been used successfully to produce artificial graphite and carbon foam.
Mishra, S. B.; Langwenya, S. P.; Mamba, B. B.; Balakrishnan, M.
South African coal and coal fly ash were selected as the raw materials to be used for study of their morphology and physicochemical properties and their respective activated carbons for adsorption applications. Coal and fly ash were individually steam activated at a temperature range of 550-1000 °C for 1 h in a muffle furnace using cylindrical stainless steel containers. Scanning electron micrographs revealed a change in surface morphology with more mineral matter available on the surface of the coal particles due to increased devolatilization. However, in the case of fly ash, the macerals coalesced to form agglomerates and the presence of unburnt carbon constituted pores of diameter between 50 and 100 nm. The BET surface area of coal improved significantly from 5.31 to 52.12 m 2/g whereas in case of fly ash the surface area of the raw sample which was originally 0.59 m 2/g and upon activation increased only up to 2.04 m 2/g. The chemical composition of the fly ash confirmed that silica was the major component which was approximately 60% by weight fraction. The impact of this study was to highlight the importance of using raw materials such as coal and a waste product, in the form of coal ash, in order to produce affordable activated carbon that can be used in drinking water treatment. This would therefore ensure that the quality of water supplied to communities for drinking is not contaminated especially by toxic organic compounds.
Effect of hydrothermal treatment on some properties of Shenhua coal
Energy Technology Data Exchange (ETDEWEB)
Wang Zhi-cai; Shui Heng-fu; Zhang De-xiang; Gao Jin-sheng [East China University of Science and Technology, Shanghai (China). College of Resource and Environmental Engineering
2006-10-15
Effects of hydrothermal treatment on swelling, extraction and liquefaction behavior of Shenhua coal were studied through analyses of element content, ash content, volatile content and IR spectrum of treated coal. The results indicate that hydrogenation of coal is distinctly carried out in the process of hydrothermal pre-treatment and the hydrogen content of treated coal is more than that of raw coal. The contents of ash and volatile matters of treated coal are lower than those of raw coal. With the increase of treatment temperature the volatile content of the hydrothermal treated coal decreases and the ash content of treated coal increases. CO{sub 2} is main gas product and unvaries with the temperature changing, whereas CO and CH{sub 4} are formed when the temperature is above 250{sup o}C and increase with the temperature during hydrothermal treatment. Hydrothermal treatment is not in favor of coal swelling and the swelling ratio of treated coal decreases with the increase of treatment temperature. The swelling ratio of extraction residue by CS{sub 2}/NMP mixed solvent in NMP solvent is lower than that of the corresponding raw coal. The CS{sub 2}/NMP mixed solvent extraction yields of coal treated at appropriate temperature are higher than that of raw coal, but the extraction yields of treated coal obtained by n-hexane, toluene and THF successive Soxhelt extraction are lower. Hydrothermal treatment at 250-300{sup o}C can increase the conversion of treated coal in direct hydro-liquefaction. The gas + oil yield of treated coal is lower than that of raw coal and the preasphaltene yield of treated coal is much higher. IR spectra of treated coals show that the forms of non-covalent bonds are changed by hydrothermal treatment, and the hydrolysis of ester and ether bonds and the pyrolysis of aromatic side chains also maybe occur at high treatment temperature. 21 refs., 3 figs., 4 tabs.
Aromatic raw materials from coal
Energy Technology Data Exchange (ETDEWEB)
Collin, G
1982-06-01
Liquid byproducts of coal carbonization meet some 25% of the world demand for aromatic chemicals, currently at approx. 30 million t/a, in particular 15% of the demand for benzene and over 95% of the demand for condensed aromatics and heteroaromatics. Industrial processing of the aromatic byproducts of coal pressure gasification is carried out to only a minor extent. Other methods that may be employed in future to obtain carbochemical aromatic compounds are solvolysis and supercritical gas extraction, the catalytic liquid-phase hydrogenation and hydropyrolysis of coal, which also permit recovery of benzene and homologues, phenols, and condensed and partially hydrogenated aromatics, and the synthesis of aromatics using methanol as the key compound. As with the present means of obtaining aromatic chemicals from coal, the processes that may in future be applied on an industrial scale to obtain pure aromatics will only be economically feasible if linked with the manufacture of other mass products and combined with the present production of carbochemical aromatics. (In German)
Swelling behavior of several bituminous coals and their thermally treated coals
Energy Technology Data Exchange (ETDEWEB)
Shui, Heng-fu; Cao, Mei-xia; Wang, Zhi-cai [Anhui University of Technology, Maanshan (China). School of Chemistry & Chemical Engineering
2007-07-01
The swelling behavior in different solvents of 4 bituminous coals with different ranks and their residues from extraction by CS{sub 2}/NMP mixed solvent (l:1 in volume) were measured. The change in swelling property of the four coals thermally treated at different temperature was observed. The results show that the swelling ratio decreases with increasing rank of coal. For lower rank bituminous coals the swelling ratios in polar solvent are higher than those in non-polar solvent, and this difference decreases with increasing rank. The cross-linking densities of the four residues decrease, and the swelling ratios increase compared with those of raw coals. The swelling ratios of the four thermally treated coals under 150{sup o}C in CS{sub 2} increase, suggesting the decrease in crosslinking density of them. When the thermal treatment temperature increases to 240{sup o}C, the swelling rations of the other three coals in NMP and CS{sub 2} increase again except gas coal, demonstrating the further decrease in crosslinking density. This result is coincident with the extraction yield change in the mixed solvent of the thermally treated coal. For example, the extraction yield of lean coal treated at 240{sup o}C increases from 6.9% to 17.3%. FT-IR results show the removal of oxygen group of the thermally treated coals. This may explain the increase in swelling ratio and extraction yield in the mixed solvent of coal after thermal treatment. The cross-linking density of the thermally treated coal decreases because of the break of hydrogen bonds due to removal of C = 0 and -OH oxygen groups during the thermal treatment, resulting in the increases of swelling ratio and extraction yield in the mixed solvent of thermally treated coal compared with those of raw coal. 15 refs., 3 figs., 6 tabs.
Energy Technology Data Exchange (ETDEWEB)
Kensuke Masaki; Takahiro Yoshida; Chunqi Li; Toshimasa Takanohashi; Ikuo Saito [National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba (Japan). Institute for Energy Utilization
2004-08-01
The effects of acid and hydrothermal pretreatments and the addition of polar compounds on the production of ashless-coal (HyperCoal) from subbituminous coals using cost-effective industrial solvents were investigated. The extraction yield of Wyodak subbituminous coal (C%, 75.0%) using crude methylnaphthalene oil (CMNO) at 360{sup o}C was increased significantly by 19% following acid pretreatment; it was 41.3% for the raw coal and 60.5% for the acid-treated coal. The addition of strongly polar compounds, such as N-methyl-2-pyrrolidinone (NMP), also increased the extraction yields. For Pasir subbituminous coal (%, 73.0%) the yield increased by 10% from 54.3% for the raw coal to 64.2% when 20% NMP was added to CMNO. The highest extraction yield of 72.2% was obtained for acid-treated Wyodak coal using CMNO with 20% NMP added. The ash content in HyperCoal tended to decrease following acid pretreatment and was less than 200 ppm in some coals. Hydrothermal pretreatment had a negative effect on the thermal extraction at 360{sup o}C, but increased the yield at extraction temperatures below 200{sup o}C. 20 refs., 7 figs., 2 tabs.
Data extraction from proteomics raw data
DEFF Research Database (Denmark)
Mancuso, Francesco; Bunkenborg, Jakob; Wierer, Michael
2012-01-01
In shot-gun proteomics raw tandem MS data are processed with extraction tools to produce condensed peak lists that can be uploaded to database search engines. Many extraction tools are available but to our knowledge, a systematic comparison of such tools has not yet been carried out. Using raw data...
International Nuclear Information System (INIS)
Noor-ul-Amin; Ali, K.
2011-01-01
In this paper the use of coal, found at Jabba Taar and Jabba Khushk Khyber Pakhtoon Khwa, in cement manufacturing as a major fuel and its impacts on the raw mix and clinker parameters has been discussed. The maximum amount of coal for pulverizing with raw mix was found to be 10% of the raw mix as calculated from the calorific value and the heat of clinkerization of coal. The coal residue left after burning was utilized in the cement raw material, for which a new raw mix was designed. The new raw mix was converted in to clinker. The resulting clinker was studied for all parameters as per British specification. It was found that the clinker obtained from the newly designed raw mix with coal ash, was in accordance to the British standard specifications. (author)
Matali, Sharmeela; Rahman, Norazah Abdul; Idris, Siti Shawaliah; Yaacob, Nurhafizah
2017-12-01
Torrefaction, also known as mild pyrolysis, is proven to convert raw biomass into a value-added energy commodity particularly for application in combustion and co-firing systems with improved storage and handling properties. This paper aims to compare the characteristics of Malaysian bituminous coal i.e. Silantek coal with raw and torrefied biomass pellet originated from oil palm frond and fast growing tree species, Leucaena Leucocephala. Biomass samples were initially torrefied at 300 °C for 60 minutes. Resulting torrefied biomass pellets were analysed using a number of standard fuel characterisation analyses i.e. elemental analysis, proximate analysis and calorific content (high heating values) experiments. Investigations on combustion characteristics via dynamic thermogravimetric analysis (TGA), grindability and moisture uptake tests were also performed on the torrefied biomass pellets. Better quality bio-chars were produced as compared to its raw forms and with optimal process conditions, torrefaction may potentially produces a solid fuel with combustion reactivity and porosity equivalent to raw biomass while having compatible energy density and grindability to coal.
NMR investigation of coal extracts
Energy Technology Data Exchange (ETDEWEB)
Lang, I; Sebor, G [Ceskoslovenska Akademie Ved, Prague. Hornicky Ustav; Sebor, G Jr; Hajek, M; Mostecky, J [Vysoka Skola Chemicko-Technologicka, Prague (Czechoslovakia)
1978-07-01
Proton NMR spectroscopy was used for the evaluation of 10% coal extract solutions in deuterated pyridine. Four types of Czechoslovak coal were analyzed. Agreement was found between the aromaticity of coal extracts calculated from /sup 1/H NMR data using Brown's method and Ladner's and Williams' method and the characterization of an average molecule of the coal extract by the number of non-bridge carbon atoms of aromatic rings, by the overall number of aromatic ring carbon atoms and the number of aromatic rings, determined by the Williams and Ferris methods. The methods for calculating carbon distribution from /sup 1/H NMR data, however, contain some constants theoretically estimated or experimentally found using the method which still remain to be verified.
Boiler briquette coal versus raw coal: Part I--Stack gas emissions.
Ge, S; Bai, Z; Liu, W; Zhu, T; Wang, T; Qing, S; Zhang, J
2001-04-01
Stack gas emissions were characterized for a steam-generating boiler commonly used in China. The boiler was tested when fired with a newly formulated boiler briquette coal (BB-coal) and when fired with conventional raw coal (R-coal). The stack gas emissions were analyzed to determine emission rates and emission factors and to develop chemical source profiles. A dilution source sampling system was used to collect PM on both Teflon membrane filters and quartz fiber filters. The Teflon filters were analyzed gravimetrically for PM10 and PM2.5 mass concentrations and by X-ray fluorescence (XRF) for trace elements. The quartz fiber filters were analyzed for organic carbon (OC) and elemental carbon (EC) using a thermal/optical reflectance technique. Sulfur dioxide was measured using the standard wet chemistry method. Carbon monoxide was measured using an Orsat combustion analyzer. The emission rates of the R-coal combustion (in kg/hr), determined using the measured stack gas concentrations and the stack gas emission rates, were 0.74 for PM10, 0.38 for PM2.5, 20.7 for SO2, and 6.8 for CO, while those of the BB-coal combustion were 0.95 for PM10, 0.30 for PM2.5, 7.5 for SO2, and 5.3 for CO. The fuel-mass-based emission factors (in g/kg) of the R-coal, determined using the emission rates and the fuel burn rates, were 1.68 for PM10, 0.87 for PM2.5, 46.7 for SO2, and 15 for CO, while those of the BB-coal were 2.51 for PM10, 0.79 for PM2.5, 19.9 for SO2, and 14 for CO. The task-based emission factors (in g/ton steam generated) of the R-coal, determined using the fuel-mass-based emission factors and the coal/steam conversion factors, were 0.23 for PM10, 0.12 for PM2.5, 6.4 for SO2, and 2.0 for CO, while those of the BB-coal were 0.30 for PM10, 0.094 for PM2.5, 2.4 for SO2, and 1.7 for CO. PM10 and PM2.5 elemental compositions are also presented for both types of coal tested in the study.
Boiler Briquette Coal versus Raw Coal: Part I-Stack Gas Emissions.
Ge, Su; Bai, Zhipeng; Liu, Weili; Zhu, Tan; Wang, Tongjian; Qing, Sheng; Zhang, Junfeng
2001-04-01
Stack gas emissions were characterized for a steam-generating boiler commonly used in China. The boiler was tested when fired with a newly formulated boiler briquette coal (BB-coal) and when fired with conventional raw coal (R-coal). The stack gas emissions were analyzed to determine emission rates and emission factors and to develop chemical source profiles. A dilution source sampling system was used to collect PM on both Teflon membrane filters and quartz fiber filters. The Teflon filters were analyzed gravimetrically for PM 10 and PM 2.5 mass concentrations and by X-ray fluorescence (XRF) for trace elements. The quartz fiber filters were analyzed for organic carbon (OC) and elemental carbon (EC) using a thermal/optical reflectance technique. Sulfur dioxide was measured using the standard wet chemistry method. Carbon monoxide was measured using an Orsat combustion analyzer. The emission rates of the R-coal combustion (in kg/hr), determined using the measured stack gas concentrations and the stack gas emission rates, were 0.74 for PM 10 , 0.38 for PM 25 , 20.7 for SO 2 , and 6.8 for CO, while those of the BB-coal combustion were 0.95 for PM 10 , 0.30 for PM 2 5 , 7.5 for SO 2 , and 5.3 for CO. The fuel-mass-based emission factors (in g/kg) of the R-coal, determined using the emission rates and the fuel burn rates, were 1.68 for PM 10 , 0.87 for PM 25 , 46.7 for SO 2 , and 15 for CO, while those of the BB-coal were 2.51 for PM 10 , 0.79 for PM 2.5 , 19.9 for SO 2 , and 14 for CO. The task-based emission factors (in g/ton steam generated) of the R-coal, determined using the fuel-mass-based emission factors and the coal/ steam conversion factors, were 0.23 for PM 10 , 0.12 for PM 2.5 , 6.4 for SO 2 , and 2.0 for CO, while those of the BB-coal were 0.30 for PM 10 , 0.094 for PM 2.5 , 2.4 for SO 2 , and 1.7 for CO. PM 10 and PM 2.5 elemental compositions are also presented for both types of coal tested in the study.
4-MCHM sorption to and desorption from granular activated carbon and raw coal.
Jeter, T Scott; Sarver, Emily A; McNair, Harold M; Rezaee, Mohammad
2016-08-01
4-Methylcyclohexanemethanol (4-MCHM) is a saturated higher alicyclic primary alcohol that is used in the froth flotation process for cleaning coal. In early 2014, a large spill of crude chemical (containing primarily 4-MCHM) to the Elk River near Charleston, WV contaminated the local water supply. Carbon filters at the affected water treatment facility quickly became saturated, and the contaminated water was distributed to nearby homes and businesses. Sorption of 4-MCHM to granular activated carbon (GAC) was studied in the laboratory using head space (HS) analysis via gas chromatography with a flame ionization detector (GC-FID). Sorption to raw coal was also investigated, since this material may be of interest as a sorbent in the case of an on-site spill. As expected, sorption to both materials increased with decreased particle size and with increased exposure time; although exposure time proved to be much more important in the case of GAC than for coal. Under similar conditions, GAC sorbed more 4-MCHM than raw coal (e.g., 84.9 vs. 63.1 mg/g, respectively, for 20 × 30 mesh particles exposed to 860 mg/L 4-MCHM solution for 24 h). Desorption from both materials was additionally evaluated. Interestingly, desorption of 4-MCHM on a mass per mass basis was also higher for GAC than for raw coal. Overall, results indicated that GAC readily sorbs 4-MCHM but can also readily release a portion of the chemical, whereas coal sorbs somewhat less 4-MCHM but holds it tightly. Copyright © 2016 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Giri, C.C.; Sharma, D.K. [Indian Institute of Technology, New Delhi (India). Centre for Energy Studies
2004-07-01
The washability characteristics of original Indian coals and solvent-extracted residual coals were studied by the float and sink technique. The following conclusions were drawn on the basis of the present study. Anthracene oil-extracted residual coals have lower percentage of reactions in the specific gravity range of 1.4 to 1.6 than the original coals, which indicates that the mineral matter is disassociated from the organic mass, and the anthracene oil-extracted residual coal is more suitable for washing than the original coal. The floatability behaviour of coal increases during NMP (N-methyl-2-pyrrolidone) extraction. This indicates that coal changes its washability character during NMP extractions. As during NMP extraction the surface area of coal increases by creating fissures in the matrix, the chemical leaching technique would be more suitable to remove the mineral matter in the residual coals. 12 refs., 3 figs., 2 tabs.
Producing ashless coal extracts by microwave irradiation
Energy Technology Data Exchange (ETDEWEB)
Ozgur Sonmez; Elife Sultan Giray [Mersin University, Mersin (Turkey). Department of Chemistry
2011-06-15
To produce ashless coal extracts, three Turkish coals were extracted with N-methyl-2-pyrrolidinone (NMP), NMP/ethylenediamine (EDA) (17/1, vol/vol) mixture and NMP/tetralin (9/1, vol/vol) mixture through thermal extraction and microwave extraction. Solvent extraction by microwave irradiation (MI) was found to be more effective than that by thermal extraction. Extraction yield of coals in NMP enhanced by addition of a little EDA, but tetralin addition showed variances according to extraction method used. While tetralin addition caused a decrease in the thermal extraction yield, it increased the yield of the extraction by MI. Following the extraction, the solid extracts were produced with ash content ranging from 0.11% to 1.1%. Ash content of solid extract obtained from microwave extraction are less than ash contents of solid extracts obtained from thermal extraction. 34 refs., 7 figs., 5 tabs.
30 CFR 750.21 - Coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Coal extraction incidental to the extraction of... ENFORCEMENT, DEPARTMENT OF THE INTERIOR INDIAN LANDS PROGRAM REQUIREMENTS FOR SURFACE COAL MINING AND RECLAMATION OPERATIONS ON INDIAN LANDS § 750.21 Coal extraction incidental to the extraction of other minerals...
Energy Technology Data Exchange (ETDEWEB)
Hengfu Shui; Changhui Lin; Meng Zhang; Zhicai Wang; Mingdong Zheng [Anhui University of Technology, Maanshan (China). School of Chemistry and Chemical Engineering
2010-07-15
Solvent extractions of two different types of Chinese rich coals i.e. Aiweiergou coal (AG) and Zaozhuang coal (ZZ) using the mixed solvent of carbon disulfide/N-methyl-2-pyrrolidinone (CS{sub 2}/NMP) with different mixing ratios were carried out and the caking indexes of the extracted residues were measured. It was found that the extracted residues from the two types of coals showed different changing tendencies of the caking indexes with the extraction yield. When the extraction yield attained about 50% for ZZ coal, the extracted residue had no caking property. However for AG coal, when the extraction yield reached the maximum of 63.5%, the corresponding extracted residue still had considerable caking property with the caking index of 25. This difference indicated the different associative structure of the two coals although they are of the same coalification. Hydro-thermal treatment of the two rich coals gave different extract fractionation distributions for the treated coals compared to those of raw coals respectively. The coking property evaluations of the two coals and their hydro-thermally treated ones were carried out in a crucible coking determination. The results showed that the hydro-thermal treatment could greatly improve the micro-strengths of the resulting coke from the two coals, and the improvement was more significant for the more aggregated AG coal. The reactivities of hydro-thermally treated AG coal blends were almost the same as those of raw coal blends. The higher coke reactivities of AG raw coal and its hydro-thermally treated ones than those of ZZ coal might be attributed to its special ash composition. 20 refs.,4 figs., 5 tabs.
Caffeine Extraction from Raw and Roasted Coffee Beans.
Chiang, Donyau; Lin, Chih-Yang; Hu, Chen-Ti; Lee, Sanboh
2018-04-01
Coffee is a stimulant, psychoactive, popular daily beverage, and its caffeine affects human physiological health and behavior. These important issues prompted us to study caffeine extraction from both the raw and roasted coffee beans of 3 types at different temperatures. A hemispheric model is developed to simulate the extraction process of the caffeine from the coffee beans of hemisphere is proposed. The experimental data are in good agreement with the predicted model. The effective diffusivities of caffeine in both the raw and roasted beans increase with temperature in all 3 types. An incubation period, decreasing with increasing temperature, is observed in all samples studied. Caffeine extraction in roasted beans is more rapid than that for the raw beans and the time difference is significant at low temperatures. In both the raw and roasted samples, caffeine diffusion in the raw beans and the incubation behavior are thermally activated processes. Single activation energies are obtained for diffusion within the extraction temperature range for all beans tested with the exception of one type of the coffee beans, Mandheling, which exhibits 2 activation energies in raw samples. The surface energies of the epidermis of the raw beans and roasted beans obtained from the contact angle measurements are used to interpret the difference of incubation periods. This study has a potential application to the decaffeinated coffee industry.Caffeine affects human physiological health and behavior so that caffeine extraction from coffee beans of different types at different temperatures is important for product refining and customers. © 2018 Institute of Food Technologists®.
Stolboushkin, A. Yu; Akst, D. V.; Fomina, O. A.; Ivanov, A. I.; Syromyasov, V. A.
2017-09-01
The analysis of waste coal from mining enterprises of Kemerovo region as raw materials for production of building ceramics is given. The results of studies of material, chemical and mineralogical compositions of waste coal from Abashevskaya processing plant (Novokuznetsk) are presented. It was established that the chemical composition of waste coal refers to aluminosilicate raw materials with a high content of alumina and coloring oxides, the residual carbon content in the wastes is 12-25 %. According to the granulometric composition the waste coal is basically a sandy-dusty fraction with a small amount of clay particles (1-3 %). Additional grinding of coal waste and the introduction of a clay additive in an amount of up to 30 % are recommended. The results of the study of the mineral composition of waste coal are presented. Clay minerals are represented in the descending order by hydromuscovite, montmorillonite and kaolinite, minerals-impurities consist of quartz, feldspar fine-dispersed carbonates. The results of the investigation of ceramic-technological properties of waste coal, which belong to the group of moderately plastic low-melting raw materials, are given. As a result of a comprehensive study it was been established that with chemical, granulometric and mineralogical compositions waste coal with the reduced residual carbon can be used in the production of ceramic bricks.
Alkali-assisted coal extraction with polar aprotic solvents
Energy Technology Data Exchange (ETDEWEB)
Makgato, M.H.; Moitsheki, L.J.; Shoko, L.; Kgobane, B.L.; Morgan, D.L.; Focke, W.W. [SARChI Chair in Carbon Technology and Materials, Institute of Applied Materials, University of Pretoria, Pretoria 0002 (South Africa)
2009-04-15
Coal extraction experiments were conducted using a coal, containing ca. 10% ash, from the Tshikondeni mine in South Africa. This coal dissolves only to a limited extent in pure polar aprotic solvents such as dimethylformamide (DMF) and N-methyl-2-pyrrolidinone (NMP). However, the addition of a strong base, e.g. sodium hydroxide (NaOH) or sodium tert-butoxide increased the degree of coal dissolution in these organic solvents. Depending on the extraction conditions, carbon extraction efficiencies of up to 90% were obtained. Carbon precursor material was recovered from the solution as a gel by precipitation with water. Ash content was reduced from 10% in the coal to less than 1.6% in the coal extracts. Sodium sulfide (Na{sub 2}S) addition further reduced ash content and aided the recovery of carbon precursors that led to graphitizable cokes but the degree of extraction was significantly reduced. (author)
Effect of coal extracted with NMP on its aggregation
Energy Technology Data Exchange (ETDEWEB)
Hengfu Shui [Anhui University of Technology, Maanshan (China). Department of Chemical Engineering
2005-05-01
Tow-step extraction of Upper Freeport (UF) coal, i.e. exhaustive extraction with N-methyl-2-pyrrolidinone (NMP) solvent and subsequent extraction with the CS{sub 2}/NMP mixed solvent (1:1 by volume) with or without additive was compared with the direct extraction of UF coal with the CS{sub 2}/NMP mixed solvent (1:1 by volume) with or without additive. It was found that there is almost no difference of extraction yields between the two-step extraction and direct extraction with or without additive. The result show that NMP can only give external extraction to extract the outside fractions of coal particles, and this will not cause the new aggregation formed in the coal molecules. The interactions between coal molecule and additive are responsible for the extraction yield enhancement by additive. 10 refs., 3 figs., 1 tab.
Process for the gas extraction of coal
Energy Technology Data Exchange (ETDEWEB)
Urquhart, D B
1976-05-20
The object of the invention is a process for the hydroextraction of coal is treated with water and carbon monoxide at a temperature in the region of 300 - 380/sup 0/C. After treatment is completed, the gases are separated from the treated gas; the treated coal is then extracted with an extraction medium during the gas phase at a temperature of at least 400/sup 0/C, the remainder is separated from the gas phase and the coal extract is obtained from the extraction medium. Hydrogenation is preferably carried out at a temperature in the region of 320 - 370/sup 0/C and at a pressure of 200 - 400 at. The time required for treatment with carbon monoxide and water is 1/4 - 2 hours, and in special cases 3/4 - 1 1/2 hours. The coal material itself is nutty slack, of which more than 95% of the coal particles pass through a 1.5 mm mesh sieve. After the hydrogenation the extraction is carried out at a temperature in the region of 400 - 450/sup 0/C. The patent claims relate to the types of extraction media used.
Environmental impact of coal utilization (from raw material to waste resources): Proceedings
International Nuclear Information System (INIS)
Sahu, K.C.
1991-10-01
The proceedings contains 27 papers presented at the conference on environmental impact of coal utilization from raw material to waste resources which was held at the Indian Institute of Technology, Bombay, during 14-15 January 1991. The conference was held as a follow-up of the research project to study the impact of coal utilization. The project was undertaken jointly by the Indian Institute of Technology, Bombay and the University of Western Ontario, Canada. The project was funded by the International Development Research Centre, Ottawa (Canada). The principle themes of the conference were : occurrence of trace elements in coal, fate of trace elements during combustion of coal, characterisation of fly ash and its properties and utilization, and environmental impact of ash disposal. (M.G.B.)
Extraction of hydrocarbon products from shales and coals
Energy Technology Data Exchange (ETDEWEB)
Reed, V Z
1918-05-17
A process is disclosed of extracting hydrocarbon oil matter from petroleum-bearing shales and coals which comprises subjecting a mass of such shale or coal, before distillation to the solvent action of material containing an acid, permitting the solvent material to pass through the mass of shale or coal, and recovering the combined solvent and extracted matter.
Effect of hydrothermal treatment of coal on its associative structure
Energy Technology Data Exchange (ETDEWEB)
Shui Heng-fu; Wang Zhi-cai; Wang Gao-qiang; Niu Min-feng [Anhui University of Technology, Maanshan (China). School of Chemistry & Chemical Engineering
2006-10-15
4 bituminous coals with different ranks were thermally and hydrothermally treated under different conditions, and the raw and treated coals were extracted with carbon disulfide/N-2-pyrrolidinone (CS{sub 2}/NMP) mixed solvent (1:1 by volume). It is found that the extraction yields of the thermal or hydrothermal treated coals at proper conditions increase in different extent. The increments of extraction yields for hydrothermal treated coals are higher than those of thermal treated coals. FT-IR shows that the adsorption peaks at 3410 cm{sup -1} attributed to OH group for the hydrothermal treated coals decrease, suggesting the dissociation of the coal aggregation structure due to the breakage of hydrogen bonds, resulting in the increase of extraction yields for the treated coals. For higher rank coal, the removal of minerals and the dissociation of {pi}-cation association after hydrothermal treatment of coal may be responsible for the increase of extraction yield. In addition, the mechanism of hydrothermal treatment of coal was discussed. 15 refs., 2 figs., 5 tabs.
179 Extraction of Coal-tar Pitch by Supercritical Carbon Dioxide ...
African Journals Online (AJOL)
Meyer
Several extractions of coal-tar pitch were performed using supercritical fluid ..... pressure and temperature, unlike exhaustive extraction, which involves a change in ... mechanism that is operative on extracting coal-tar pitch components with.
Structure determination of small molecular phase in coal by solvent extraction
Energy Technology Data Exchange (ETDEWEB)
Feng, J.; Wang, B.; Ye, C.; Li, W.; Xie, K. [Taiyuan University of Technology, Taiyuan (China)
2004-04-01
7 typical Chinese coal samples were extracted by NMP/CS{sub 2} system at around 90{degree}C by Soxhlet method. Compared with results from NMP, a higher coal extraction rate was acquired when NMP + CS{sub 2} solvent system was adopted. Except for anthracite extraction rate of about 20% was acquired, particularly 41% for long flame coal. By using the method of retention index of coal extracts analysis by HPLC, it is found that the polar part with less than six-carbon numbers in coal is the active site for coal reactivity, and the inert site belongs to the aromatic hydrocarbon derivation with 3 aromatic rings. 13 refs., 3 figs., 2 tabs.
30 CFR 947.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 947.702 Section 947.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of...
30 CFR 933.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 933.702 Section 933.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of...
30 CFR 939.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 939.702 Section 939.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of...
30 CFR 903.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 903.702 Section 903.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...
30 CFR 912.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 912.702 Section 912.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...
30 CFR 937.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 937.702 Section 937.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...
30 CFR 921.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 921.702 Section 921.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of the chapter, Exemption for Coal Extraction Incidental to the Extraction of...
30 CFR 905.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 905.702 Section 905.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of...
30 CFR 942.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 942.702 Section 942.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...
30 CFR 910.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 910.702 Section 910.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...
30 CFR 922.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 922.702 Section 922.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...
30 CFR 941.702 - Exemption for coal extraction incidental to the extraction of other minerals.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 941.702 Section 941.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of...
Supercritical CO2 extraction of raw propolis and its dry ethanolic extract
Directory of Open Access Journals (Sweden)
L. C. Paviani
2012-06-01
Full Text Available Three types of propolis extract were prepared and analyzed with respect to their global extraction yields and with respect to the concentration of the following markers: 3,5-diprenyl-4-hydroxycinnamic acid; 3-prenyl-4-hydroxycinnamic acid; 4-hydroxycinnamic acid and 4-methoxy-3,5,7-trihydroxyflavone. The extract EEP (ethanolic extract of propolis was obtained by the conventional method from raw propolis using ethanol as solvent. The extracts (SFE were obtained by supercritical solvent extraction from the raw propolis using supercritical carbon dioxide (sc-CO2, with and without the addition of ethanol as a co-solvent. The fractionated supercritical extracts (FSCE were obtained by fractionation (extract and raffinate of the dry EEP with sc-CO2. EEP yields of 39.5% were obtained and maximum global extraction yields were 7.3% for SFE with no co-solvent, 51% for SFE with 15% ethanol and 18% for the FSCE extract fraction. The concentrations of the markers in the different extracts differed as a function of the operational parameters, indicating that the addition of co-solvent and the selectivity of sc-CO2 could be manipulated so as to obtain extracts with the yields and concentrations of interest.
Washability equations of raw coal from some lithostratigraphic units of the Upper Silesian coalfield
Energy Technology Data Exchange (ETDEWEB)
1977-12-01
On the basis of statistical analysis, partial and general washability equations have been calculated for coarse and slack raw coal from the Upper Silesian Coalfield. The equations make it possible to forecast the quantity and quality of saleable products, and to select preparation plant equipment.
The increase in extraction yields of coals by water treatment
Energy Technology Data Exchange (ETDEWEB)
M. Iino; T. Takanohashi; C. Li; N. Kashimura; K. Masaki; T. Shishido; I. Saito; H. Kumagai [Institute for Energy Utilization, National Institute of Advanced Industrial Science and Technology (AIST), Ibaraki (Japan)
2005-07-01
We have reported that the water treatments of bituminous coals at 600 K for 1 h increased their extraction yields greatly (Energy Fuels, 2005, 18, 1414). In this paper the effect of coal rank on the extraction yields enhancement by the water treatment has been investigated using four Argonne Premium coals, i.e., Pocahontas No. 3 (PO), Upper Freeport (UF), Illinois No.6 (IL), and Beulah Zap (BZ) coals with C % (daf) in the range 67 - 90%. All the coals used show that the water treatments at 600 K increased the extraction yields greatly with a 1:1 carbon disulfide / N-methyl-2-pyrrolidinone mixed solvent (CS2 / NMP) at room temperature. While, the water treatments at 500 K or the heat treatments at 600 K without water gave little increase in the yields. Characterizations of the water-treated coals were carried out from ultimate and proximate compositions, FT-IR spectrum, solvent swelling, NMR relaxation time, and viscoelasticity behavior. The effect of extraction temperature on the extraction yield enhancement was also investigated using polar NMP or non-polar 1-MN solvent. From these results it is concluded that for high coal rank coals the loosening of non-covalent bonds is responsible for the extraction yields enhancement by the water treatment. The loosening non-covalent bonds may be {pi}-{pi} interactions between aromatic rings for PO, and both {pi}-{pi} interactions and hydrogen bonds for UF. While, for lower rank IL and BZ, which showed decrease in O% and hydrogen-bonded OH, the yield enhancements may be due to the loosening of hydrogen bonds and the removal of oxygen functional groups. 9 refs., 5 figs., 1 tab.
Effect of Rhodococcus sp. on desulfurization, swelling and extraction of coal
Energy Technology Data Exchange (ETDEWEB)
Wang De-qiang; Shui Heng-fu [University of Technology of Anhui, Maanshang (China). School of Chemical Engineering
2006-08-15
Bio-desulfurization of coal by rhodococcus sp. was studied. Some kinds of coal were swelled with different organic solvents, and then the swelled coals were treated by rhodococcus sp. The results show that the ratios of desulfurization of coals increase after they are swelled, especially swelled with NMP, the ratio is more than 80%. The swelling and extraction of coal were also studied after the coal had been treated by rhodococcus sp. The results show that the ratios of swelling increase more than 65%, but the extraction yield decreases for the coal treated by rhodococcus sp. 11 refs., 5 tabs.
Impacts of Coal Seam Gas (Coal Bed Methane) Extraction on Water Resources in Australia
Post, David
2017-04-01
While extraction of methane from shale gas deposits has been the principal source of the recent expansion of the industry in the United States, in Australia extraction of methane from coal bed methane deposits (termed 'coal seam gas' in Australia) has been the focus to date. The two sources of methane share many of the same characteristics including the potential requirement for hydraulic fracturing. However, as coal seam gas deposits generally occur at shallower depths than shale gas, the potential impacts of extraction on surface and groundwater resources may be of even greater concern. In Australia, an Independent Expert Scientific Committee (IESC) has been established to provide scientific advice to federal and state government regulators on the impact that coal seam gas and large coal mining developments may have on water resources. This advice is provided to enable decisions to be informed by the best available science about the potential water-related impacts associated with these developments. To support this advice, the Australian Government Department of the Environment has implemented a programme of research termed 'bioregional assessments' to investigate these potential impacts. A bioregional assessment is defined as a scientific analysis of the ecology, hydrology, geology and hydrogeology of a bioregion with explicit assessment of the potential direct, indirect and cumulative impacts of coal seam gas and large coal mining development on water resources. These bioregional assessments are currently being carried out across large portions of eastern Australia underlain by coal reserves. Further details of the programme and results to date can be found at http://www.bioregionalassessments.gov.au. The bioregional assessment programme has modelled the impacts of coal seam gas development on surface and groundwater resources in three regions of eastern Australia, namely the Clarence-Moreton, Gloucester, and Namoi regions. This presentation will discuss the
Energy Technology Data Exchange (ETDEWEB)
Marshall, H.P.
1980-03-01
Performance tests using an 11 kW single cylinder diesel engine were made to determine the effects of three different micronized coal-fuel oil slurries being considered as alternative fuels. Slurries containing 20, 32, and 40%-wt micronized raw coal in No. 2 fuel oil were used. Results are presented indicating the changes in the concentrations of SO/sub X/ and NO/sub X/ in the exhaust, exhaust opacity, power and efficiency, and in wear rates relative to operation on fuel oil No. 2. The engine was operated for 10 h at full load and 1400 rpm on al fuels except the 40%-wt slurry. This test was discontinued because of extremely poor performance.
Prospects for recovering gallium from extracted coal
Energy Technology Data Exchange (ETDEWEB)
Ratynskiy, V M; Reznik, A M; Zekel, L A; Zharov, Yu N
1979-01-01
The authors conducted research in order to establish the physical-chemical mechanisms governing the behavior of rare and dispersed elements within the thermal treatment processes used to treat coal and enrichment waste. New means are proposed for obtaining concentrations of gallium. These methods are under consideration primarily for the isolation of gallium as a by-product during the production of aggloporite from coal waste. The authors examine in detail the results of research dealing with the transfer of gallium compounds in a solution, the extraction of gallium from solutions, the separation of impurities from gallium, and the isolation of gallium from extract. Utilizing research results, the authors determine the expenditure coefficient and costs for additives used to extract gallium from waste by-products. The realization of this gallium extraction process from those products having the best prospects for gallium content resulted in economic savings.
Increase in extraction yields of coals by water treatment
Energy Technology Data Exchange (ETDEWEB)
Masashi Iino; Toshimasa Takanohashi; Chunqi Li; Haruo Kumagai [National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba (Japan). Institute for Energy Utilization
2004-10-01
The effect of water treatment at 500 and 600 K on solvent extractions of Pocahontas No. 3 (PO), Upper Freeport (UF), and Illinois No. 6 (IL) coals was investigated. All the coals used show that the water treatments at 600 K increased the extraction yields greatly in the extractions with a 1:1 carbon disulfide/N-methyl-2-pyrrolidinone (CS{sub 2}/NMP) mixed solvent, NMP, or 1-methylnaphthalene (1-MN). However, the water treatments at 500 K and the heat treatments at 600 K without water gave only a slight increase in the yields. Characterizations of the water-treated coals were performed using ultimate and proximate compositions, Fourier transform infrared analysis, solvent swelling, nuclear magnetic resonance relaxation time, and viscoelasticity behavior. The swelling degree in methanol and toluene was increased by the water treatment at 600 K, suggesting that crosslinks become loosened by the treatment. The results of infrared analysis and the extraction temperature dependency of the extraction yields with NMP and 1-MN suggest that the loosening of {pi} - interactions, and of both {pi} - interactions and hydrogen bonds, are responsible for the yield enhancements for PO and UF coals, respectively. However, for IL coal, which exhibited a decrease in oxygen content and the amount of hydrogen-bonded OH, suggesting the occurrence of some chemical reactions, the yield enhancements may be due to the relaxation of hydrogen bonds and the removal of oxygen functional groups, such as the breaking of ether bonds. 17 refs., 3 figs., 5 tabs.
Evaluation of Rare Earth Element Extraction from North Dakota Coal-Related Feed Stocks
Laudal, Daniel A.
identified that the predominant modes of rare earths occurrence in the lignite coals are associations with the organic matter, primarily as coordination complexes and a lesser amount as ion-exchangeable cations on oxygen functional groups. Overall it appears that about 80-95% of rare earths content in North Dakota lignite is organically associated, and not present in mineral forms, which due to the weak organic bonding, presented a unique opportunity for extraction. The process developed for extraction of rare earths was applied to the raw lignite coals instead of fly ash or other byproducts being investigated extensively in the literature. Rather, the process uses a dilute acid leaching process to strip the organically associated rare earths from the lignite with very high efficiency of about 70-90% at equilibrium contact times. Although the extraction kinetics are quite fast given commercial leaching operations, there is some tradeoff between extraction efficiency and contact time. (Abstract shortened by ProQuest.).
Swelling kinetics of several residues from Shenhua coal extraction
Energy Technology Data Exchange (ETDEWEB)
Cao, Mei-xia; Shui, Heng-fu; Wang, Zhi-cai [Anhui University of Technology, Maanshan (China). School of Chemistry and Chemical Engineering
2008-08-15
In order to understand the mechanism of swelling and the relation between swelling behavior and solvent extraction, the swelling kinetics of residues from Shenhua coal extracted by CS{sub 2}/NMP with different mixing ratios were studied in different solvents. The result shows that the swelling rates of extraction residues increase along with swelling temperature. The swelling rate in polar solvent NMP is much higher than that in non-polar solvent THN. Solvent extraction has a great effect on the swelling of extraction residues. The swelling activation energy of extraction residues increases and the swelling rate decreases with the increase of extraction yield. The swelling activation energies of extraction residues in NMP and THN are less than 10 kJ/mol, suggesting that the swelling process is controlled by solvent molecular diffusion in coal structure. 22 refs., 2 figs., 7 tabs.
Preparation and evaluation of coal extracts as precursors for carbon and graphite products
Energy Technology Data Exchange (ETDEWEB)
Zondlo, J.W.; Stiller, A.W.; Stansberry, P.G. [West Virginia Univ., Morgantown, WV (United States)] [and others
1996-08-01
A coal extraction process coupled with coal hydrotreatment has been shown capable of producing suitable precursors for a variety of commercially important carbon and graphite products. The N-methylpyrolidone (NMP) extracts of hydrotreated coals have been analytically and chemically characterized and shown to have properties acceptable for use as binder and impregnation pitch. Mesophase formation studies have demonstrated their capability for producing both needle and anode grade coke as well as precursors for mesophase pitch fibers. A graphite artifact has been produced using a coal extract as a binder and coke derived from the extract as a filler. Further evaluation of the extract materials is being carried out by industrial members of the Carbon Products Consortium.
International Nuclear Information System (INIS)
Kindig, J.K.
1992-01-01
More than 502 million tons - 65 percent of all coal shipped to utilities in 1990 - were above 1.2 pounds of sulfur dioxide per million Btu. Most of the coal, even though cleaned in conventional coal preparation plants, still does not meet the emission limitation the Clean Air Act Amendments mandate for the year 2000. To cope with this fact, most utilities plan to switch to low sulfur (western U.S. or Central Appalachian) coal or install scrubbers. Both solutions have serous drawbacks. Switching puts local miners out of work and weakens the economy in the utility's service territory. Scrubbing requires a major capital expenditure by the utility. Scrubbers also increase the operating complexity and costs of the generating station and produce yet another environmental problem, scrubber sludge. Employing three new cost-effective technologies developed by Customer Coals International (CCl), most non-compliance coals east of the Mississippi River can be brought into year-2000 compliance. The compliance approach employed, depends upon the characteristics of the raw coal. Three types of raw coal are differentiated, based upon the amount of organic sulfur in the coals and the ease (or difficultly) of liberating the pyrite. They are: Low organic sulfur content and pyrite that liberates easily. Moderate organic sulfur content and pyrite that liberates easily. High organic sulfur content or the pyrite liberates with difficulty. In this paper examples of each type of raw coal are presented below, and the compliance approach employed for each is described. The names of the beneficiated coal products produced from each type of raw coal give above are: Carefree Coal, Self-Scrubbing Coal and Dry-Scrubbing Coal
International Nuclear Information System (INIS)
Lowe, N.J.; Wortzman, M.S.; Breeding, J.; Koudsi, H.; Taylor, L.
1983-01-01
Recent studies have questioned the therapeutic value of coal tar versus ultraviolet (UV) radiation and their relative necessity in phototherapy for psoriasis. In this investigation, different aspects of tar phototherapy have been studied in single-blind bilateral paired comparison studies. The effects of 1% crude coal tar were compared with those of petrolatum in conjunction with erythemogenic and suberythemogenic doses of ultraviolet light (UVB) using a FS72 sunlamp tubed cabinet. Crude coal tar was clinically superior to petrolatum with suberythemogenic ultraviolet. With the erythemogenic UVB, petrolatum was equal in efficacy to crude coal tar. Suberythemogenic UVB was also used adjunctively to compare the effects of a 5% concentration of a tar extract in an oil base to 5% crude coal tar in petrolatum or the oil base without tar. The tar extract in oil plus suberythemogenic UVB produced significantly more rapid improvement than the oil base plus UVB. The direct bilateral comparison of equal concentrations of tar extract in oil base versus crude coal tar in petrolatum in a suberythemogenic UV photo regimen revealed no statistical differences between treatments. In a study comparing tar extract in oil and the oil base without ultraviolet radiation, the tar extract in oil side responded more rapidly
Effectiveness of underground coal extraction. Effektivnost' podzemnoy dobychi uglya
Energy Technology Data Exchange (ETDEWEB)
Pirskiy, A A
1982-01-01
This book examines the possibility of improving the efficiency of underground coal extraction based on the solution to the scientific-technical problem of monitoring and controlling concentration and intensifying mining operations. The problem has been resolved as applied to conditions of working coal fields of the Lvov-Volynskiy basin, West Donbass and other regions which are similar in relation to mining-geological conditions. The main conclusions and recommendations consist of the following: synthesized concept ''concentration of mining operations'' is determined by regulation and concentration, intensification of mining operations by using progressive technology, mechanization and organization of production in order to increase extraction, improve productivity of labor and reduce the net cost of coal. The structure of concentration of mining operations is based on the synthesis of natural, technical and organizational conditions for working coal seams. The problem of monitoring and control of the concentration of mining operations was realized by using the systems method based on the laws of development, principles of comprehensive evaluation and optimization of the level of concentration based on economic-mathematical modeling. The use of the systems approach guarantees a comprehensive solution to the problem. In definite periods of development of the coal industry, between the organizational-technical potentialities, natural conditions and trends determined in the sector for the change in the level of mining operation concentration, disproportions develop. The level of work concentration goes beyond the limits of optimal values, and the effectiveness of coal extraction is reduced. In order to predict and eliminate this phenomenon, it is recommended that the level of mining concentration be controlled.
Macroscopic observation of thermal behavior of concentrated solution of coal extracts
Energy Technology Data Exchange (ETDEWEB)
Masao Suzuki; Koyo Norinaga; Masashi Iino [Tohoku University, Sendai (Japan). Institute of Multidisciplinary Research for Advanced Materials
2004-11-01
The solvent extracts of Upper Freeport and Illinois No.6 coals were mixed with N-methyl-2-pyrolidinone (NMP) and annealed at 353 K to produce the gelatinous materials. Differential scanning calorimetric measurements revealed that the materials can hold significant amounts of nonfreezable NMP (as much as 3 g NMP per 1 g coal extracts) which disperse in the materials on a molecular scale, indicating the materials are not phase separated. The thermal behaviors were measured macroscopically as a function of the extract concentration using a needle penetrometer during heating from 223 to 360 K. The penetration-temperature curves were analyzed to estimate the apparent viscosity ({eta}{sub a}). During the penetrations, {eta}{sub a} was decreased very rapidly, approximately four orders of the magnitude by a temperature increase of 20 K, suggesting that the coal extracts-NMP mixtures undergoes a gel to sol transition. The heats of dissociation of crosslinks ({Delta}H{sub m}) were estimated by applying Eldridge-Ferry equation. The {Delta}H{sub m} of coal extracts-NMP mixtures was relatively small, i.e. approximately 10 kJ/mol, whereas the ?Hm of polyvinyl alcohol-NMP gel in which the hydrogen bonds contribute the formation of the physical network structures, was about 65 kJ/mol. Not the specific interaction such as hydrogen bonds, but weak interactions such as van der Waals force were likely to contribute the formation of the coal extracts-NMP gel. 28 refs., 7 figs., 2 tabs.
Extraction of protoactinium from silicaceous raw material
Energy Technology Data Exchange (ETDEWEB)
Broda, E.
1946-07-01
This report was written by E. Broda and P.K. Wright at the Cavendish Laboratory (Cambridge) in March 1946 and is about the Extraction of protoactinium from a silicaceous raw material. In this report the isolation of Pa on Er carrier is described and it includes the experiment description and the discussion of the results. (nowak)
Directory of Open Access Journals (Sweden)
Dmitry Alexandrovich Izotov
2013-12-01
Full Text Available Deficit of raw materials is becoming an important concern for the Chinese economy as it continues to grow. This deficit is amended with imports, which – in their own turn – are limited by the high level of global prices. The build-up issue of raw materials imports is going to solve by the measures of monetary policy (RMB’s revaluation against the USD. Analysis of China’s market of raw materials reveals that the largest increase in the physical volume of imports is concentrated in crude oil, LNG, iron ore and coal. As for Russia, its supplies and share in total Chinese imports of raw materials tend to increase. Author employs regression equations based on international statistics data to show that RMB’s revaluation, ceteris paribus, increases physical volumes of raw materials imports. However, the main factor of coal and LNG imports growth is energy consumption by Chinese heavy industry; imports of oil products – producers’ prices; meanwhile imports of steel products tend to decrease with the growth of steel exports. RMB’s revaluation increases physical volumes of imports of low value added raw materials from Russia (coal, crude oil, iron ore
Energy Technology Data Exchange (ETDEWEB)
Cheng Shuqun; Zhou Yanrong; Wang Yi' nan; Wang Xun; Liu Yuanfu; Iwao Uchiyama; Wang Qiangyue; Kazuhiki Sakamoto [Chongqing University of Medical Sciences. Chongqing (China). School of Public Health
2006-12-15
This study was conducted to evaluate the adverse health effects on rabbits exposed to SO{sub 2} emitted indoors from burning coals, and compare differences between coal-biomass briquette (BB) and raw coal (RC). Thirty-six male rabbits were divided equally into three groups at random, and then exposed to burning RC, BB, and the third without burning coal (Control) for 90 days. Data showed that the average concentration of SO{sub 2} in 24 h in RC was 13.04 mg m{sup -3}, which was 5-fold greater than BB and 31-fold higher than control (0.41 mg m{sup -3}). After 45 days, the numbers of rabbits, with increased frequency of Comet cell was highest in RC. After 90 days, the % positive Comet cell was significant at 10.36% in RC, 5.42% in BB, and 1.73% in Control. There was a nonlinear dose-effect relationship between % positive Comet cell and the concentration of SO{sub 2}. The incidence of interstitial pneumonia was 6/12 in RC and 4/12 in BB showing severe squamous metaplasia with atypical hyperplasia in bronchial epithelia in RC animals. The results of study indicate that use of BB reduced the emission of SO{sub 2}; but the smoke emitted from burning coal still produced DNA damage.
Target costing as an element of the hard coal extraction cost planning process
Directory of Open Access Journals (Sweden)
Katarzyna Segeth-Boniecka
2017-09-01
Full Text Available Target costing as an element of the hard coal extraction cost planning process Striving for the efficiency of activities is of great significance in the management of hard coal extractive enterprises, which are constantly subjected to the process of restructuring. Effective cost management is an important condition of the increase in the efficiency of the researched business entities’ activity. One of the tools whose basic objective is conscious influencing cost levels is target costing. The aim of this article is to analyse the conditions of implementing target costing in the planning of hard coal extraction costs in hard coal mines in Poland. The subject area raises a topical and important problem of the scope of solutions concerning cost analysis in hard coal mines in Poland, which has not been thoroughly researched yet. To achieve the abovementioned aim, the theoretical works of the subject area have been referenced. The mine management process is difficult and requires the application of best suited and most modern tools, including those used in the planning process of hard coal extraction costs in order to support the economic efficiency of mining operations. The use of the target costing concept in the planning of hard coal mine operations aims to support the decision-making process, so as to achieve a specified level of economic efficiency of the operations carried out in a territorially designated site of hard coal extraction.
International Nuclear Information System (INIS)
Carta Petrolera
2001-01-01
The paper analyzes the characteristics and advantages of extracting gas of the coal, idea that from previous years Colombia wanted to develop, and owing to the association contract Rio Rancheria; Colombia decided to carry out it using modern technologies used today in day in the international environment
Phytotoxicity assessment of a methanolic coal dust extract in Lemna minor.
Coronado-Posada, Nadia; Cabarcas-Montalvo, Maria; Olivero-Verbel, Jesus
2013-09-01
Coal mining generates negative effects on environment, human health, hydrodynamics of mining areas and biodiversity. However, the impacts of this activity are less known in plants. Lemna minor is one of the most commonly used plants in aquatic toxicity tests due to its ubiquitous distribution in ponds and lakes, culture conditions and the free-floating habitat that exposes it to hydrophobic as well as dissolved compounds. The goal of this research was to evaluate the effects of a methanolic coal dust extract on L. minor. Macrophytes were exposed to six different concentrations of coal extract (from 7.81 to 250 mg/L) for 5 days, following the OECD test guideline 221. The coal extract had a half inhibitory concentration (IC50) of 99.66 (184.95-54.59) mg/L for the number of fronds. Several signs of toxicity such as chlorosis, reduction in the size of the fronds, abscission of fronds and roots, and the presence of necrotic tissues were observed at concentrations lower than the IC50. Preliminary Gas Chromatography-Mass Spectrometry analysis of the coal dust extract revealed the presence of several compounds, including, among others, alkanes, carboxylic acids and polycyclic aromatic hydrocarbons (PAHs), these lasts, may be responsible for some of the observed effects. These results demonstrated that coal dust has phytotoxic effects and should not be considered as an inert material. Copyright © 2013 Elsevier Inc. All rights reserved.
Renal Cell Toxicity of Water-Soluble Coal Extracts from the Gulf Coast
Ojeda, A. S.; Ford, S.; Ihnat, M.; Gallucci, R. M.; Philp, P. R.
2017-12-01
In the Gulf Coast, many rural residents rely on private well water for drinking, cooking, and other domestic needs. A large portion of this region contains lignite coal deposits within shallow aquifers that potentially leach organic matter into the water supply. It is proposed that the organic matter leached from low-rank coal deposits contributes to the development of kidney disease, however, little work has been done to investigate the toxicity of coal extracts. In this study, human kidney cells (HK-2) were exposed to water-soluble extracts of Gulf Coast Coals to assess toxicity. Cell viability was measured by direct counts of total and necrotic cells. A dose-response curve was used to generate IC50 values, and the extracts showed significant toxicity that ranged from 0.5% w/v to 3% w/v IC50. The most toxic extract was from Louisiana where coal-derived organic material has been previously linked to high incidents of renal pelvic cancer (RPC). Although the toxic threshold measured in this study is significantly higher than the concentration of organic matter in the groundwater, typically affected areas may consume contaminated water over a lifetime. It is possible that the cumulative toxic effects of coal-derived material contribute to the development of disease.
Optimizing Pretreatment of Medicinal Raw Materials by RFC Plasma before Extraction
Directory of Open Access Journals (Sweden)
O.Yu. Kuznetsova
2016-06-01
Full Text Available Optimization of the RF-plasma treatment modes of chaga raw materials using the Statistica 6.0 software package has been performed. Mathematical design has been carried out to calculate the optimum parameters of RF-plasma treatment using three plasma-forming gases – argon, air, and nitrogen. Plasma treatment of chaga raw materials has been undertaken at the constant parameters: pressure P = 30.0 Pa, anodic current J = 0.7 A, gas consumption G = 0.04 g/s; the variable parameters were power U = 5.0÷7.0 kV and treatment duration at the high-frequency capacitor category of the lowered pressure t = 30÷60 min. Optimization of four key parameters for extraction of chaga raw materials (solid residue, melanin yield, antioxidant activity of both extract and chaga melanin depending on the chosen plasma-forming gas (argon, air, or nitrogen has been achieved. The optimum modes of RF-plasma treatment allowing to obtain the extracts and melanin of chaga mushroom with the improved physicochemical and antioxidant characteristics have been calculated.
Rives, Jesús; Fernandez-Rodriguez, Ivan; Rieradevall, Joan; Gabarrell, Xavier
2012-11-15
Cork oak grows endemically in a narrow region bordering the western Mediterranean, and especially in the Iberian Peninsula. The importance of cork agro-forestry systems lies in the fact that a natural and renewable raw material - cork - can be extracted sustainably without endangering the tree or affecting biodiversity. This paper describes an environmental analysis of the extraction of raw cork in cork oak forests in Catalonia, using data from five representative local forest exploitations. The evaluation was carried out using life cycle assessment (LCA) methodology, and all the forestry management required to obtain a tonne of raw cork was included. The aim of the study was to evaluate the environmental impacts - in terms of global warming, acidification, eutrophication, human toxicity, and so on - caused by cork extraction and determine the carbon dioxide balance of these forestry systems, with a tree lifespan of about 200 years. During the life cycle extraction of cork in Catalonia, 0.2 kg of CO(2) eq. was emitted per kg of raw cork extracted. Moreover, cork cannot be extracted without the tree, which will be fixing carbon dioxide throughout its technological useful life (200 years), despite the fact that the bark is removed periodically: every 13-14 years. If the emission from extraction and the carbon contained in the material is discounted, the carbon dioxide balance indicates that 18 kg of CO(2) are fixed per kg of raw cork extracted. Therefore, cork is a natural, renewable and local material that can replace other non-renewable materials, at local level, to reduce the environmental impacts of products, and particularly to reduce their carbon footprint. Copyright © 2012 Elsevier Ltd. All rights reserved.
Prospects For Coal And Clean Coal Technologies In Kazakhstan
Energy Technology Data Exchange (ETDEWEB)
NONE
2011-12-15
The coal sector in Kazakhstan is said to have enough reserves to last over 100 years, but the forecasted reserves are expected to last several hundreds of years. This makes investing in the fuel and energy sector of the country an attractive option for many international and private organisations. The proven on-shore reserves will ensure extraction for over 30 years for oil and 75 years for gas. The future development of the domestic oil sector depends mainly on developing the Kazakh sector of the Caspian Sea. The coal sector, while not a top priority for the Kazakh government, puts the country among the world's top ten coal-rich countries. Kazakhstan contains Central Asia's largest recoverable coal reserves. In future, the development of the raw materials base will be achieved through enriching and improving the quality of the coal and the deep processing of coal to obtain fluid fuel and synthetic substances. Developing shale is also topical. The high concentration of methane in coal layers makes it possible to extract it and utilise it on a large scale. However, today the country's energy sector, which was largely established in the Soviet times, has reached its potential. Kazakhstan has about 18 GW of installed electricity capacity, of which about 80% is coal fired, most of it built before 1990. Being alert to the impending problems, the government is planning to undertake large-scale modernisation of the existing facilities and construct new ones during 2015-30. The project to modernise the national electricity grid aims to upgrade the power substations to ensure energy efficiency and security of operation. The project will result in installation of modern high-voltage equipment, automation and relay protection facilities, a dispatch control system, monitoring and data processing and energy management systems, automated electricity metering system, as well as a digital corporate telecommunication network.
Analysis of solvent extracts from coal liquefaction in a flowing solvent reactor
Energy Technology Data Exchange (ETDEWEB)
Li, Wen-Ying; Feng, Jie; Xie, Ke-Chang [Key Laboratory of Coal Science and Technology, Taiyuan University of Technology, Ministry of Education and Shanxi Province, No. 79 Yingze West Street, Taiyuan 030024 (China); Kandiyoti, R. [Department of Chemical Engineering and Chemical Technology, Imperial College, University of London, London SW7 2BY (United Kingdom)
2004-10-15
Point of Ayr coal has been extracted using three solvents, tetralin, quinoline and 1-methyl-2-pyrrolidinone (NMP) at two temperatures 350 and 450 C, corresponding approximately to before and after the onset of massive covalent bond scission by pyrolysis. The three solvents differ in solvent power and the ability to donate hydrogen atoms to stabilise free radicals produced by pyrolysis of the coal. The extracts were prepared in a flowing solvent reactor to minimise secondary thermal degradation of the primary extracts. Analysis of the pentane-insoluble fractions of the extracts was achieved by size exclusion chromatography, UV-fluorescence spectroscopy in NMP solvent and probe mass. With increasing extraction temperature, the ratio of the amount having big molecular weight to that having small molecular weight in tetralin extracts was increased; the tetralin extract yield increased from 12.8% to 75.9%; in quinoline, increasing extraction temperature did not have an effect on the molecular weight of products but there was a big increase in extract yield. The extracts in NMP showed the enhanced solvent extraction power at both temperatures, with a shift in the ratio of larger molecules to smaller molecules with increasing extraction temperature and with the highest conversion of Point of Ayr coal among these three solvents at both temperatures. Solvent adducts were detected in the tetralin and quinoline extracts by probe mass spectrometry; solvent products were formed from NMP at both temperatures.
Bubble feature extracting based on image processing of coal flotation froth
Energy Technology Data Exchange (ETDEWEB)
Wang, F.; Wang, Y.; Lu, M.; Liu, W. [China University of Mining and Technology, Beijing (China). Dept of Chemical Engineering and Environment
2001-11-01
Using image processing the contrast ratio between the bubble on the surface of flotation froth and the image background was enhanced, and the edges of bubble were extracted. Thus a model about the relation between the statistic feature of the bubbles in the image and the cleaned coal can be established. It is feasible to extract the bubble by processing the froth image of coal flotation on the basis of analysing the shape of the bubble. By means of processing the 51 group images sampled from laboratory column, it is thought that the use of the histogram equalization of image gradation and the medium filtering can obviously improve the dynamic contrast range and the brightness of bubbles. Finally, the method of threshold value cut and the bubble edge detecting for extracting the bubble were also discussed to describe the bubble feature, such as size and shape, in the froth image and to distinguish the froth image of coal flotation. 6 refs., 3 figs.
Directory of Open Access Journals (Sweden)
Meng Li
2017-10-01
Full Text Available As thick rock partings delay the efficient mining of coal seams and constrain the sustainable development of coal mines, an innovative extraction method for a coal seam with thick rock parting was proposed. The coal seams were divided into different sub-zones according to the thickness of rock parting and then the sub-zones were mined by separately using three mining schemes involving full-seam mining, combined mining using backfill and caving (CMBC, and reducing height mining. Afterwards, the study introduced the basic mechanism and key devices for the CMBC and analysed the working state of the backfill support in detail. Moreover, the method for calculating the length of the backfill zone was proposed to design the length of backfill zone and the influences of four factors (including bulking coefficient of rock parting on the length of the backfill zone were also explored. By taking the No. 22203 panel, Buertai mine, Inner Mongolia, China as an example, the mined coal resource by using the CMBC extraction method will increase by 1.83 × 106 tons and the recovery ratio will rise from 56.2% to 92.4% compared with mining of the 2-2 upper coal seam alone. Moreover, by applying CMBC, a series of environmental and ecological problems caused by rock parting is reduced, which can improve the environment in mined areas. The research can provide technological guidance for mining panels of a coal seam with a thick rock parting and the disposal thereof under similar conditions.
The coupling of coal and nuclear energy for the long-term supply of energy and raw materials
International Nuclear Information System (INIS)
Knizia, K.
1986-10-01
In view of the limited world reserves of fossil fuels and the increase in demand to be expected because of the continued growth of the world population, coal and nuclear energy will have to make an increasing contribution to the energy supply. Their contribution will range from electricity generation to the heat sector and to the raw materials market via various gases obtained from them. The further development towards this field of tasks will lead first via the gasification of coal. It will be carried out autothermally in the first stage of development. The gas produced is suitable for realising considerable improvements in efficiency as compared to coal-fired power stations of present-day design since it will permit the generation of electricity via combined gas turbine/steam turbine processes. Efforts are being made to take further the processes based on this technology by introducing a sodium circuit in addition to the coal gasification, which will make it possible to keep the plants required for coal gasification small. In later stages, this technology will also be suitable for producing a considerable improvement in the diversion of heat at high temperatures from high-temperature reactor nuclear power stations for several purposes. (author)
Energy Technology Data Exchange (ETDEWEB)
Chen, Jianping; Deng, Chunping; Wang, Huitong
2009-02-15
There exists a great difference in group-type fractions and biomarker distributions of chloroform extracts from coals and coal-seams oils, which makes the source identification of coal-seams oils in sedimentary basins rather difficult. The experiment, in which four different polarity solvents, n-hexane, benzene, dichloromethane and chloroform, were used to extract 9 coal-seams source rocks and 3 typical lacustrine source rocks, showed that the yield of extracts increased gradually with increasing solvent polarity. The distribution features of their n-alkanes, isoprenoids and sterane and terpane biomarkers remained, in general, similar, showing no distinct enrichment or depletion for a certain fraction by any solvent. The compositional analysis on n-hexane and chloroform extracts showed that the absolute amount (concentration) of biomarkers was relatively low for the n-hexane extract but comparatively high for the chloroform extract, this difference became great among coal-seams source rocks but small among lacustrine mudstones. The statistical analysis on the relative amount of the 18 major biomarkers in n-hexane and chloroform extracts from 10 source rock samples showed that extracts with a proportional error for the same biomarker of less than 5% (including the analytical error) accounted for 84% while those with a proportional error over 10% amounted to below 5%. This suggested that the outcome of oil-source correlation made by these biomarkers will be independent of variations in amounts of saturates and biomarkers arising from solvent polarity. Therefore, biomarkers obtained from organic-rich source rocks including coals by the extraction with the commonly used chloroform solvent can be applied for the oilsource correlation of coal-seams petroliferous basins.
Energy Technology Data Exchange (ETDEWEB)
McCoy, B.J.; Smith, J.M.; Wang, M.; Zhang, C.J.
1993-02-01
The overall objective of this project was to study the supercritical fluid extraction of hydrocarbons from coal. Beyond the practical concern of deriving products from coal, the research has provided insights into the structure, properties, and reactivities of coal. Information on engineering fundamentals of coal thermolysis and extraction, including physical and chemical processes, is presented in this final report. To accomplish the goals of the project we developed continuous-flow experiments for fixed-bed samples of coal that allow two types of analysis of the extract: continuous spectrophotometric absorbance measurements of the lumped concentration of extract, and chromatographic determinations of molecular-weight distributions as a function of time. Thermolysis of coal yields a complex mixture of many extract products whose molecular-weight distribution (MWD) varies with time for continuous-flow, semibatch experiments. The flow reactor with a differential, fixed bed of coal particles contacted by supercritical t-butanol was employed to provide dynamic MWD data by means of HPLC gel permeation chromatography of the extract. The experimental results, time-dependent MWDs of extract molecules, were interpreted by a novel mathematical model based on continuous-mixture kinetics for thermal cleavage of chemical bonds in the coal network. The parameters for the MWDs of extractable groups in the coal and the rate constants for one- and two-fragment reaction are determined from the experimental data. The significant effect of temperature on the kinetics of the extraction was explained in terms of one- and two-fragment reactions in the coal.
IR and NMR characterisation of extraction products of radioactively deuteromethylated coals
Energy Technology Data Exchange (ETDEWEB)
Kozlowski, M.; Wachowska, H.; Adriaensens, P.; Gelan, J. [Adam Mickiewicz University, Poznan (Poland). Faculty of Chemistry
1999-12-01
Products of reductive methylation and deuteromethylation of two Polish coals of different rank performed in the potassium/liquid ammonia system were subjected to extraction by dichloromethane. Spectral analysis of the extracts was made. A comparison of {sup 1}H and {sup 2}H NMR spectra indicated that the cleavage of C-C bonds in methylene bridges is of substantial importance for the fragmentation of the coal structure taking place under the effect of potassium in liquid ammonia. This finding was confirmed by results of IR analysis. 25 refs., 3 figs., 2 tabs.
Evaluation of pitches and cokes from solvent-extracted coal materials
Energy Technology Data Exchange (ETDEWEB)
McHenry, E.R.
1996-12-01
Three initial coal-extracted (C-E) samples were received from the West Virginia University (WVU) Chemical Engineering Department. Two samples had been hydrogenated to obtain pitches that satisfy Theological requirements. One of the hydrogenated (HC-E) samples had been extracted by toluene to remove ash and higher molecular weight aromatic compounds. We were unable to measure the softening point and viscosity of the non-hydro treated solid extract sample, Positive characteristics in the HC-E materials were softening points of 113-119{degrees}C, low sulfur and ash. The oxygen and nitrogen content of the HC-E samples may limit future usage in premium carbon and graphite products. Coking values were similar to petroleum pitches. Laboratory anode testing indicates that in combination with standard coal-tar pitch, the HC-E material can be used as a binder pitch.
Examination of the role of CS{sub 2} in the CS{sub 2}/NMP mixed solvents to coal extraction
Energy Technology Data Exchange (ETDEWEB)
Shui, Hengfu; Wang, Zhicai [School of Chemistry and Chemical Engineering, Anhui University of Technology, 243002 Maanshan Anhui (China); Gao, Jinsheng [Department of Energy Resources and Chemical Engineering, East China University of Science & amp; Technology, 200237 Shanghai (China)
2006-02-15
The roles of CS{sub 2} in the CS{sub 2}/NMP mixed solvent to coal extraction and solubilization were investigated in this study. There was little effect of removing of CS{sub 2} from the solutions on the solubilities of UF coal extract and pyridine insoluble (PI) of the extract in the NMP/CS{sub 2} mixed solvent, suggesting that NMP has high enough solubilities to the UF coal extract and PI. Six Argonne different rank coals were extracted with the CS{sub 2}/NMP mixed solvent and NMP, respectively. It was found that the extraction yield difference between NMP and CS{sub 2}/NMP mixed solvent for UF coal is largely deviated from the curve obtained for the other 5 coals, suggesting that the pre-swelling of CS{sub 2} in the mixed solvent may be one of important roles for high extraction yield of UF coal in the CS{sub 2}/NMP mixed solvent. FTIR indicated that there was a strong interaction between CS{sub 2} and NMP in the CS{sub 2}/NMP mixed solvent of 1:1 volume ratio, which made the strong absorbance at 2156 cm{sup -1} in the FTIR spectra, and this interaction may disrupt the dipole based association of NMP thus making the CS{sub 2}/NMP mixed solvent lower viscosity, to penetrate more quickly into the network structure of coal, resulting in the larger solvent partner (NMP) to enter and break the stronger coal-coal interactions. (author)
Hydrocracking of coal extracts to highly aromatic petroleum
Energy Technology Data Exchange (ETDEWEB)
Kotowski, W; Gorski, R
1972-07-01
Coal extracts were hydrocracked at 400 to 450/sup 0/C, 250 atm, 0.8 to 2.0 hr/sup -1/ space velocity, and with 1.5 cu m/l./hr of hydrogen over a bed of fluidized, 0.6 to 0.8 mm granules of nickel-molybdenum zeolite catalyst using the Consolidation Coal Co. process. The 330/sup 0/C bp extract was diluted with the 230 to 320/sup 0/C fraction of the product. At 440/sup 0/C and 1.2 hr/sup -1/ space velocity, the hydrotreatment removed 97% of the sulfur compounds, 95% of oxygen compounds, and 92% of nitrogen compounds. The yield of 35 to 230/sup 0/C gasoline stock decreased with increasing feed space velocity, but that of 230 to 340/sup 0/C gas oils increased. The synthetic crude product contained 48.7% aromatics, 35.1% naphthenes, 13.4% paraffins, 2.8% olefins, 0.14% sulfur, and 1.07% asphaltene. The product is compared with Romashkino crude.
Exploitation and use of coal field gas
Energy Technology Data Exchange (ETDEWEB)
Wang, K; Li, Z; Sun, Q
1982-04-25
There are slightly more than 440 mine shafts in the world from which gas is pumped at the same time coal is being mined, the volume pumped being 3.125 billion cubic meters. All the countries of the world today widely use gas as a fuel and as a raw material for the chemical industry. In China 40 percent of the total number of mine shafts are high gas mine shafts. In China, gas is used largely as fuel by the people, to fire boilers, to make formaldehyde, and to make carbon ink. Prospects are good for the exploitation of mine shaft gas that is produced in association with coal. Mine shaft gas is a top quality energy source with an extraction life that is longer than coals. (DP)
PRODUCTION OF CARBON PRODUCTS USING A COAL EXTRACTION PROCESS
Energy Technology Data Exchange (ETDEWEB)
Dady Dadyburjor; Philip R. Biedler; Chong Chen; L. Mitchell Clendenin; Manoj Katakdaunde; Elliot B. Kennel; Nathan D. King; Liviu Magean; Peter G. Stansberry; Alfred H. Stiller; John W. Zondlo
2004-08-31
This Department of Energy National Energy Technology Laboratory sponsored project developed carbon products, using mildly hydrogenated solvents to extract the organic portion of coal to create synthetic pitches, cokes, carbon foam and carbon fibers. The focus of this effort was on development of lower cost solvents, milder hydrogenation conditions and improved yield in order to enable practical production of these products. This technology is needed because of the long-term decline in production of domestic feedstocks such as petroleum pitch and coal tar pitch. Currently, carbon products represents a market of roughly 5 million tons domestically, and 19 million tons worldwide. Carbon products are mainly derived from feedstocks such as petroleum pitch and coal tar pitch. The domestic supply of petroleum pitch is declining because of the rising price of liquid fuels, which has caused US refineries to maximize liquid fuel production. As a consequence, the long term trend has a decline in production of petroleum pitch over the past 20 years. The production of coal tar pitch, as in the case of petroleum pitch, has likewise declined significantly over the past two decades. Coal tar pitch is a byproduct of metallurgical grade coke (metcoke) production. In this industry, modern metcoke facilities are recycling coal tar as fuel in order to enhance energy efficiency and minimize environmental emissions. Metcoke production itself is dependent upon the production requirements for domestic steel. Hence, several metcoke ovens have been decommissioned over the past two decades and have not been replaced. As a consequence sources of coal tar are being taken off line and are not being replaced. The long-term trend is a reduction in coal tar pitch production. Thus import of feedstocks, mainly from Eastern Europe and China, is on the rise despite the relatively large transportation cost. To reverse this trend, a new process for producing carbon products is needed. The process must be
Calculating the flue gas dew point for raw brown coal fired steam generators
Energy Technology Data Exchange (ETDEWEB)
Schinkel, W.
1977-01-01
The paper analyzes parameters influencing the sulfuric acid dew point in flue gas of steam generators. Sulfur content and alkaline earths content in the fuel air ratio during combustion, fly ash content in the flue gas (which absorbs sulfur dioxide and sulfur trioxide) and combustion conditions in steam generators are relevant parameters in the combustion process. A thermodynamic and reaction kinetic calculation of the sulfuric acid dew point is, however, not yet possible. A statistical evaluation of dew point measurements in steam generators is, therefore, employed. Various diagrams show results of dew point measurements carried out at generators with steam capacities ranging from 40 to 660 t/h, which demonstrate relations of these parameters to flue gas dew points, in particular the relative sulfur content (sulfur content in the raw brown coal compared to coal ash content and alkaline earths content). A function is derived for the conversion of fuel sulfur to sulfur trioxide. A diagram presents the relation of the flue gas dew point to partial pressures of sulfuric acid and steam. Direct calculation of the flue gas dew point was achieved by the proposed method. It is applied in steam generator design. (17 refs.)
BARZAS DEPOSIT SAPROPELITE COALS: PROSPECTS OF INTEGRATED DEVELOPMENT
Directory of Open Access Journals (Sweden)
L. V. Kuznetsova
2018-03-01
the enterprises for extraction of coal, semi-coking plant, boiler room, the chemical enterprise for processing of ash-slag from burning of waste of pyrolysis. The enterprise for receiving ore raw materials and construction materials are also among them. Summary. The organization of the main processes (from coal mining to commercial production within the framework of the energy chemical cluster will create an efficient, environmentally friendly and low-waste production. The consumer value of the obtained commodity products (resin, pyrogenetic water, fuel gas, thermal energy, ore concentrate and building materials will be much higher than the cost of raw high-ash coal.
Predicting the granulometric composition of the coal extracted from a drum cutter loader
Energy Technology Data Exchange (ETDEWEB)
Sikora, W; Chodura, J; Siwiec, J
1983-01-01
An analysis is presented of the effect of the design parameters of the operational element on the output of the large class on the basis of theoretical calculations of the granulometric composition of the coal extracted by the cutter loaders. The effect of the physical and mechanical properties of the coal being extracted is also taken into consideration. The results of the conducted calculations are cited in a graph.
Energy Technology Data Exchange (ETDEWEB)
Atul Sharma; Hiroyuki Kawashima; Ikuo Saito; Toshimasa Takanohashi [National Institute of Advanced Industrial Science and Technology, Ibaraki (Japan). Advanced Fuel Group
2009-04-15
HyperCoal is a clean coal with mineral matter content <0.05 wt %. Oaky Creek (C = 82%), and Pasir (C = 68%) coals were subjected to solvent extraction method to prepare Oaky Creek HyperCoal, and Pasir HyperCoal. Experiments were carried out to compare the gasification reactivity of HyperCoals and parent raw coals with 20, 40, 50 and 60% K{sub 2}CO{sub 3} as a catalyst at 600, 650, 700, and 775{sup o}C with steam. Gasification rates of coals and HyperCoals were strongly influenced by the temperature and catalyst loading. Catalytic steam gasification of HyperCoal chars was found to be chemical reaction controlled in the 600-700{sup o}C temperature range for all catalyst loadings. Gasification rates of HyperCoal chars were found to be always higher than parent coals at any given temperature for all catalyst loadings. However, X-ray diffraction results showed that the microstructures of chars prepared from coals and HyperCoals were similar. Results from nuclear magnetic resonance spectroscopy show no significant difference between the chemical compositions of the chars. Significant differences were observed from scanning electron microscopy images, which showed that the chars from HyperCoals had coral-reef like structures whereas dense chars were observed for coals. 26 refs., 8 figs., 2 tabs.
Effect of heat reflux extraction on the structure and composition of a high-volatile bituminous coal
International Nuclear Information System (INIS)
Tian, Bin; Qiao, Ying-yun; Tian, Yuan-yu; Xie, Ke-chang; Li, Da-wei
2016-01-01
Highlights: • A novel HRE process with CYC is proposed to dissolve coal. • Most of the aliphatic compounds in coal are extracted during HRE process. • The carbon crystallite structure of coal changes after HRE process with CYC. • The thermal degradation behavior of ER is significantly different from that of the SFHB. - Abstract: Heat reflux extraction (HRE) process with cyclohexanone (CYC) in a high-performance mass transfer extractor was applied to dissolve Shenmu-Fugu high-volatile bituminous (SFHB) coal for the first time to afford extract (E) and extract residue (ER) from the extraction. SFHB, E, and ER were characterized by elemental analysis, solid-state "1"3C NMR spectrometry, FTIR spectrometry, XRD, SEM, and TG-FTIR to elucidate the effect of HRE on the evolution of functional groups and macromolecular structure of coal during extraction. The soluble portion in SFHB was 24.37% in the course of HRE with CYC. The aromaticity of SFHB derived from both curve-fitting of "1"3C NMR and FTIR spectra was obviously increased after extraction suggesting that most of the aliphatic fractions were extracted during HRE process. It was clarified that the substituted degree of aromatic ring in SFHB became low but the substituents on aromatics were larger after extraction. Due to irreversibly swelling crystal structure of SFHB, its interlayer spacing became larger and the stacking height of crystallite decreased after extraction. Moreover, significant amounts of volatile matters were extracted, which caused relatively lower mass loss rate and contents of gaseous products (CO_2, aliphatic moieties, CH_4, and CO) of ER than SFHB during main pyrolysis stage.
Antioxidant Effect of Extracts from the Coffee Residue in Raw and Cooked Meat
Directory of Open Access Journals (Sweden)
Ji-Hee Kim
2016-07-01
Full Text Available The residue of ground coffee obtained after the brewing process (spent coffee still contains various functional components with high antioxidant capacity and health benefits, but no attempts have been made to use it as a resource to produce value-added food ingredients. This study evaluates the antioxidant activity of ethanol or hot water extracts from the residues of coffee after brewing. An extraction experiment was carried out using the conventional solid–liquid methods, including ethanol and water as the extraction media at different temperatures and liquid/solid ratios. The antioxidant activity of extracts was tested for total phenolic compound (TPC, 2,2-diphenyl-1-picrylhydrazyl (DPPH, and 2-thiobarbituric acid reactive substances (TBARS using oil emulsion and raw/cooked meat systems. The DPPH radical scavenging activity of the ethanol extracts with heating (HEE and without heating (CEE were higher than that of the hot water extracts (WE. The highest DPPH value of HEE and CEE at 1000 ppm was 91.22% and 90.21%, respectively. In oil emulsion and raw/cooked systems, both the water and ethanol extracts had similar antioxidant effects to the positive control (BHA, but HEE and CEE extracts showed stronger antioxidant activities than WE extract. These results indicated that the ethanol extracts of coffee residue have a strong antioxidant activity and have the potential to be used as a natural antioxidant in meat.
Microwave-assisted extraction of polycyclic aromatic compounds from coal.
Kerst, M; Andersson, J T
2001-08-01
Microwave-assisted extraction (MAE) of polycyclic aromatic compounds (PACs) from coal is shown to give the same pattern of compounds as Soxhlet extraction. MAE requires only 10 mL solvent and 10 min extraction time whereas Soxhlet uses 200 mL and takes 24 h. Although the yields were lower, dichloromethane (DCM) was preferred to pyridine, N-methyl-2-pyrrolidone (NMP), and NMP with CS2 because the pattern of the PACs is shown to be independent of solvent and DCM is a much more convenient solvent to work with.
Directory of Open Access Journals (Sweden)
O.Yu. Kuznetsova
2016-03-01
Full Text Available High-frequency capacitive discharge (RF plasma at low pressure was used as preliminary stage for the intensification of extraction from natural medicinal raw material. RF-plasma treatment was carried out in two modes differed by the nature of plasma-forming gas. Chaga (Inonotus obliquus (Pers. Pil. known as the birch mushroom was selected as a perspective source of raw material. Extraction was carried out in two ways – remaceration and maceration. The analy-sis of chaga extracts and melanins was performed using traditional techniques including determination of physical and chemical, antioxidant and spectral characteristics. The obtained extracts and melanins were compared to the control samples and literature data. RF-plasma treatment of medicinal raw material increased the yield of extractive substances, in particular of the main active component of chaga – melanin. The antioxidant activity of chaga extracts grew, while for melanins it remained at the level similar to that of control samples. The IR spectral characteristics of the studied chaga melanins are similar and agree well with the literature data. Insignificant deviations in the position and intensity of absorption strips were observed for the samples after RF treatment. IR spectra of the studied chaga melanins are similar to those for mushroom melanins, thereby confirming the similarity in their nature. RF-plasma treatment of chaga medicinal raw materials allows to modify them partially. The structural and mechanical properties of melanins modified by RF plasma remain the same.
Black coal. Australian statistics for 1984-85
Energy Technology Data Exchange (ETDEWEB)
1986-06-01
According to the Joint Coal Board, production of raw black coal in Australia in 1984-85 was 145,137,000 tonnes - 12.1% more than in 1983-84. Saleable coal production was 118,261,000 tonnes, 12% more than the previous year. Raw coal production from open cut mines rose by 20.3% to 96,523,000 tonnes, whilst underground mine production fell by 1.1% to 48,614,000 tonnes. As in the previous year, the growth in coal production was the result of further strong expansion of exports of both metallurgical and steaming coals. Significant production increases were achieved for the year in both coal exporting states: New South Wales and Queensland.
Mass Transfer Coefficientin Stirred Tank for p -Cresol Extraction Process from Coal Tar
International Nuclear Information System (INIS)
Fardhyanti, D S; Tyaningsih, D S; Afifah, S N
2017-01-01
Indonesia is a country that has a lot of coal resources. The Indonesian coal has a low caloric value. Pyrolysis is one of the process to increase the caloric value. One of the by-product of the pyrolysis process is coal tar. It contains a lot of aliphatic or aromatic compounds such as p -cresol (11% v/v). It is widely used as a disinfectant. Extractionof p -Cresol increases the economic value of waste of coal. The aim of this research isto study about mass tranfer coefficient in the baffled stirred tank for p -Cresolextraction from coal tar. Mass transfer coefficient is useful for design and scale up of industrial equipment. Extraction is conducted in the baffled stirred tank equipped with a four-bladed axial impeller placed vertically in the vessel. Sample for each time processing (5, 10, 15, 20, 25 and 30minutes) was poured into a separating funnel, settled for an hour and separated into two phases. Then the two phases were weighed. The extract phases and raffinate phases were analyzed by Spectronic UV-Vis. The result showed that mixing speed of p -Cresol extraction increasesthe yield of p -Cresol and the mass transfer coefficient. The highest yield of p -Cresol is 49.32% and the highest mass transfer coefficient is 4.757 x 10 -6 kg/m 2 s. (paper)
Mass Transfer Coefficientin Stirred Tank for p-Cresol Extraction Process from Coal Tar
Fardhyanti, D. S.; Tyaningsih, D. S.; Afifah, S. N.
2017-04-01
Indonesia is a country that has a lot of coal resources. The Indonesian coal has a low caloric value. Pyrolysis is one of the process to increase the caloric value. One of the by-product of the pyrolysis process is coal tar. It contains a lot of aliphatic or aromatic compounds such asp-cresol (11% v/v). It is widely used as a disinfectant. Extractionof p-Cresol increases the economic value of waste of coal. The aim of this research isto study about mass tranfer coefficient in the baffled stirred tank for p-Cresolextraction from coal tar. Mass transfer coefficient is useful for design and scale up of industrial equipment. Extraction is conducted inthe baffled stirred tank equipped with a four-bladed axial impeller placed vertically in the vessel. Sample for each time processing (5, 10, 15, 20, 25 and 30minutes) was poured into a separating funnel, settled for an hour and separated into two phases. Then the two phases were weighed. The extract phases and raffinate phases were analyzed by Spectronic UV-Vis. The result showed that mixing speed of p-Cresol extraction increasesthe yield of p-Cresol and the mass transfer coefficient. The highest yield of p-Cresol is 49.32% and the highest mass transfer coefficient is 4.757 x 10-6kg/m2s.
Effect of pre-swelling of coal on its liquefaction properties
Energy Technology Data Exchange (ETDEWEB)
Hengfu Shui; Zhicai Wang; Meixia Cao [Anhui University of Technology, Ma' anshan (China). School of Chemistry & Chemical Engineering
2007-07-01
The effects of pre-swelling of Shenhua coal on its liquefaction property were studied in this paper. It was found that pre-swelling treatments of Shenhua coal in three solvents, i.e toluene (TOL), N-methyl-2-pyrrolidinone (NMP) and tetralin (THN) increased its liquefaction conversion, and the liquefied product distributions were also quite different. Removal of the pre-swelling solvent from the swollen coals further increased the liquefaction conversion compared to that of the swollen coals with the swelling solvent existed in them. It was found that oil and gas yields for the liquefaction of swollen coals in NMP and TOL with swelling solvent existed dramatically decreased. Pre-swelling in THN at 120{sup o}C gave the highest liquefaction conversion, however the liquefaction conversion decreased with the increase of pre-swelling temperature in the case of NMP. TG and FTIR analyses of raw coal, the swollen coals and liquefied products were carried out and the mechanism of the effects of pre-swelling of coal on its extraction and liquefaction behaviors were probed in the paper. 12 refs., 6 figs., 3 tabs.
Kolak, Jonathan J.; Burruss, Robert A.
2014-01-01
Samples of three high volatile bituminous coals were subjected to parallel sets of extractions involving solvents dichloromethane (DCM), carbon disulfide (CS2), and supercritical carbon dioxide (CO2) (40 °C, 100 bar) to study processes affecting coal–solvent interactions. Recoveries of perdeuterated surrogate compounds, n-hexadecane-d34 and four polycyclic aromatic hydrocarbons (PAHs), added as a spike prior to extraction, provided further insight into these processes. Soxhlet-DCM and Soxhlet-CS2 extractions yielded similar amounts of extractable organic matter (EOM) and distributions of individual hydrocarbons. Supercritical CO2 extractions (40 °C, 100 bar) yielded approximately an order of magnitude less EOM. Hydrocarbon distributions in supercritical CO2 extracts generally mimicked distributions from the other solvent extracts, albeit at lower concentrations. This disparity increased with increasing molecular weight of target hydrocarbons. Five- and six-ring ring PAHs generally were not detected and no asphaltenes were recovered in supercritical CO2 extractions conducted at 40 °C and 100 bar. Supercritical CO2 extraction at elevated temperature (115 °C) enhanced recovery of four-ring and five-ring PAHs, dibenzothiophene (DBT), and perdeuterated PAH surrogate compounds. These results are only partially explained through comparison with previous measurements of hydrocarbon solubility in supercritical CO2. Similarly, an evaluation of extraction results in conjunction with solubility theory (Hildebrand and Hansen solubility parameters) does not fully account for the hydrocarbon distributions observed among the solvent extracts. Coal composition (maceral content) did not appear to affect surrogate recovery during CS2 and DCM extractions but might affect supercritical CO2 extractions, which revealed substantive uptake (partitioning) of PAH surrogates into the coal samples. This uptake was greatest in the sample (IN-1) with the highest vitrinite content. These
Directory of Open Access Journals (Sweden)
I. I. Shishatskii
2014-01-01
Full Text Available Summary. Theoretical and experimental researches of extraction processes from plant origin raw materials: barley, acorns and chicory with liquid carbon dioxide, as well as lupin with cheese whey were carried out. Quality indicators of extracts and secondary raw materials are defined. It is established that they are perspective raw sources for the enriched and functional products as they contain amino acids, vitamins and microelements. The dairy-vegetative lupine extract, for example, contains 17 amino acids, including the essential as well as vitamins and minerals. The studies of secondary raw materials, barley, acorns, chicory and lupine quality showed the expediency of their use for foods enrichment. Quality indicators of secondary raw materials are presented in the tables form in the given work. It formed the basis for the development of hardware-technological schemes of obtaining СО2-extracts and their use. The hardware-technological scheme of obtaining СО2-extracts from barley, acorns and chicory includes a number of equipment units: motor transport for raw materials delivery to the enterprise, the scraper hydroconveyor, the jet washer, a photoseparator for of poor-quality raw materials and impurities removal, a blowing machine for removing surface moisture from the raw materials, a jet washer for peeling, a cutter, drying and frying device, a crusher, a roller machine tool and an extracting unit. Hardware providing for yoghurt technology enriched with amino acids, microelements and vitamins which are present in a dairy-plant extract differs from the mentioned above one in the following. The extract used is a cheese whey, and the extraction of a target component is carried out in a vibrating extractor. The hardwaretechnological scheme is made according to Russian technology of yoghurt and furnished with the equipment for dairy-vegetative extract feeding into a product. It includes the following: a vibrating extractor (not shown in fig
Activated carbons from Mongolian coals by thermal treatment
Directory of Open Access Journals (Sweden)
A Ariunaa
2014-09-01
Full Text Available Mongolian different rank coals were used as raw material to prepare activatedcarbons by physical activation method. The coal derived carbons were oxidized with nitric acid in order to introduce surface oxygen groups. The ultimate elemental analysis, scanning electron microscopy, surface area, pore size distribution analysis and selective neutralization method were used to characterize the surface properties of activated carbons, oxidizedcarbons and raw coals. The effect of coal grade on the adsorption properties of the carbons were studied. It was concluded that Naryn sukhait bituminous coal could be serve as suitable raw material for production of activated carbons for removal of heavy metal ions from solution.DOI: http://dx.doi.org/10.5564/mjc.v12i0.174 Mongolian Journal of Chemistry Vol.12 2011: 60-64
New approach to brown coal pricing using internal rate of return methodology
International Nuclear Information System (INIS)
Bejbl, Jan; Bemš, Julius; Králík, Tomáš; Starý, Oldřich; Vastl, Jaromír
2014-01-01
Highlights: • We showed that brown coal is the substitute for black coal only at the time of the investment decision. • We compiled the model used in a calculation of the economically justified price for the productive and extractive component. • The resulting economically justified price is on a par with the current black coal price. • The proposed methodological approach is applicable to solve similar tasks not only in the energy sector. - Abstract: Brown coal is one of the dominant local strategic raw materials in Europe, used, to a large extent, in the power-generating industry. The current situation, where the price of gas and electricity precludes the efficient use of gas sources, leads to the extraction of older sources, chiefly brown coal ones. In tandem with a turning away from nuclear power, brown coal is experiencing a renaissance and the issue of brown coal price setting is, and will be, relevant. This paper deals with a proposal of a new method for determining the base price, consisting of defining the reference fuel chain for electricity and heat production based on brown coal. It builds on the notion that the degree of risk of the involved parties should be reflected in the modified amount of revenue per capital invested. The resulting price is then an economically justified price which encourages a respect for the specific features of the market in question and set the base price of the commodity in a way that is acceptable for both the extractive and the productive components of the fuel chain
Effect of coal soluble constituents on caking property of coal
Energy Technology Data Exchange (ETDEWEB)
Hengfu Shui; Mingdong Zheng; Zhicai Wang; Xunming Li [Anhui University of Technology, Maanshan (China). School of Chemistry and Chemical Engineering, Key Laboratory of Anhui Educational Department
2007-07-15
Three cokemaking bituminous coals were extracted by the CS{sub 2}/NMP mixed solvents with different content of NMP, and the effect of the amount and the component of coal soluble constituents on the caking property of the extracted residues of coals were investigated in this study. The CS{sub 2}/NMP mixed solvent (1:1 by volume) was found to give the maximal extraction yields for the three coals, and the fat coal gave the highest extraction yield of 78.6% (daf) corresponding to its highest caking index of 101. It was found that for coking coal, when the extraction yield got to the maximum of 25.3% in the 1:1 by volume of CS{sub 2}/NMP mixed solvent, the residue extracted still had caking property with the caking index of 19. This means parts of the caking constituents of coal are un-extractible because of covalent bonding or strong associative cross-links. The soluble components extracted by the CS{sub 2}/NMP mixed solvent and their effects on the caking indexes of the residues at a similar extraction yield quite differed depending on the NMP content in the mixed solvent. The coal solubles extracted by the CS{sub 2}/NMP mixed solvent with NMP less than 50% contained less light constituents with less of oxygen groups. This may lead to the decrease in the caking indexes for the residues obtained at the similar extraction yields compared to those of the CS{sub 2}/NMP mixed solvent with NMP more than 50%. 11 refs., 5 figs., 3 tabs.
Air extraction in gas turbines burning coal-derived gas
Energy Technology Data Exchange (ETDEWEB)
Yang, Tah-teh; Agrawal, A.K.; Kapat, J.S.
1993-11-01
In the first phase of this contracted research, a comprehensive investigation was performed. Principally, the effort was directed to identify the technical barriers which might exist in integrating the air-blown coal gasification process with a hot gas cleanup scheme and the state-of-the-art, US made, heavy-frame gas turbine. The guiding rule of the integration is to keep the compressor and the expander unchanged if possible. Because of the low-heat content of coal gas and of the need to accommodate air extraction, the combustor and perhaps, the flow region between the compressor exit and the expander inlet might need to be modified. In selecting a compressed air extraction scheme, one must consider how the scheme affects the air supply to the hot section of the turbine and the total pressure loss in the flow region. Air extraction must preserve effective cooling of the hot components, such as the transition pieces. It must also ensure proper air/fuel mixing in the combustor, hence the combustor exit pattern factor. The overall thermal efficiency of the power plant can be increased by minimizing the total pressure loss in the diffusers associated with the air extraction. Therefore, a study of airflow in the pre- and dump-diffusers with and without air extraction would provide information crucial to attaining high-thermal efficiency and to preventing hot spots. The research group at Clemson University suggested using a Griffith diffuser for the prediffuser and extracting air from the diffuser inlet. The present research establishes that the analytically identified problems in the impingement cooling flow are factual. This phase of the contracted research substantiates experimentally the advantage of using the Griffith diffuser with air extraction at the diffuser inlet.
Energy Technology Data Exchange (ETDEWEB)
Marzec, A.; Czajkowska, S.; Moszynski, J.; Schulten, H.-R. (Polish Academy of Sciences, Gliwice (Poland). Inst. of Coal Chemistry)
Twenty-seven coals from Carboniferous seams in Poland were studied with the aim to find links between thermoplastic properties and chemical characteristics of the coals. Three sets of data were obtained for all the coals: (1) thermoplastic properties measured using the Gieseler plastometer; (2) yields of pyridine extractables and swelling measurements for pyridine residues; (3) ultimate, proximate, and petrographic analyses. The three data sets were evaluated using chemometric techniques with the purpose of looking for significant correlations between all the data. Temperature of softening is a linear regression of pyridine extractables and hydrogen content in coals as well as of swelling data. Temperatures of maximum fluidity and resolidification are correlated with each other and with oxygen, exinite, and moisture contents of the coals as well as with the swelling data. It has been concluded that temperature of softening is a colligative property and indicates a phase transition resulting in an increase of thermal induced mobility of coal material; the energy demand of the transition is dependent on contents of bulk components of coal system that were specified in this study. Temperatures of maximum fluidity and resolidification appear to have the same chemical background; i.e. the temperatures depend on the content of the same structural units or components. However, the means of chemical characterization of coal material used in this study were not capable of identifying them. Volatile matter and petrographic composition showed rather limited value as predictive means for some (T{sub F(max)} and T{sub R}) and no predictive value for the other thermoplastic properties. 20 refs., 1 fig., 5 tabs.
Analysis of small molecular phase in coal involved in pyrolysis and solvent extraction by PGC
Energy Technology Data Exchange (ETDEWEB)
Jie Feng; Wen-Ying Li; Ke-Chang Xie [Taiyuan University of Technology, Taiyuan (China). Key Laboratory of Coal Science and Technology
2004-06-01
The small molecular phase, which strongly affects coal's reactivity, is the main part of the structure unit in coal. At present, its composition and structure features have not been clearly understood. In this paper, a flash pyrolysis technique with on-line GC (PGC) was used to investigate the properties of the small molecular phase from six kinds of rank coal in China. Experiments were divided into two parts: one is PGC of parent coal; another is PGC of coal extracts from NMP + CS{sub 2} (75:1) solvent extraction at 373 K. Results show that the small molecular phase mainly consists of C12-C16 compounds that could be integrally released when the heating rate was greater than 10 K/ms and the final pyrolysis temperature was 1373 K; other compounds may be the products of decomposition and polymerization from this small molecular phase during pyrolysis. 13 refs., 7 figs., 1 tab.
Study on standard coal preparation plant for coking coal in Jharia Coalfield
Energy Technology Data Exchange (ETDEWEB)
Winiewski, J; Sarkar, G G
1975-10-01
The proposed standardization of coal preparation plant will be based on three standard types of crushing station, a standard jig washery or cyclone washery, and three standard types of slurry water treatment section. Some large installations, and some existing washeries after modification, may incorporate heavy media baths for coarse coal and jigs for slack coal, where coal is easy or moderately easy to wash. Flow sheets are given for the standard types of crushing plant, washery, and slurry water circuit. The storage of raw coal and saleable products is briefly discussed.
Waste pyritic coal as a raw material for energetic industry
Energy Technology Data Exchange (ETDEWEB)
Gasiorek, J. [Institute of Inorganic Chemistry, Poznan (Poland). Dept. of Research and Technology
1997-11-01
Results are presented of large laboratory studies on coal desulphurisation with foam flotation method improved by application of bioadsorption of Thiobacillus ferrooxidans bacteria to the modification of superficial properties of pyrite particulates from hydrophobic to hydrophillic ones. Results of coal desulfurization with and without bioadsorption have been compared. Bioadsorption improved pyritic sulfur removal by 30% (for coal from `Sierza mine`, coal size 0.3 to 0.102 mm, S pyritic content 1.69%) after 6-week adaptation of bacteria and 30 min of bioadsorption. Bacteria concentration in 5% water suspension of coal reached 22 {mu}g of biomass cm{sup -3}. 12 refs., 4 figs., 1 tab.
DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS
Energy Technology Data Exchange (ETDEWEB)
Dady B. Dadyburjor; Mark E. Heavner; Manoj Katakdaunde; Liviu Magean; J. Joshua Maybury; Alfred H. Stiller; Joseph M. Stoffa; John W. Zondlo
2006-08-01
The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. The largest applications are those which support metals smelting, such as anodes for aluminum smelting and electrodes for arc furnaces. Other carbon products include materials used in creating fuels for the Direct Carbon Fuel Cell, and porous carbon structural material referred to as ''carbon foam'' and carbon fibers. During this reporting period, hydrotreatment of solvent was completed in preparation for pitch fabrication for graphite electrodes. Coal digestion has lagged but is expected to be complete by next quarter. Studies are reported on coal dissolution, pitch production, foam synthesis using physical blowing agents, and alternate coking techniques.
Distribution of trace elements in Western Canadian coal ashes
Energy Technology Data Exchange (ETDEWEB)
Kronberg, B I; Brown, J R; Fyfe, W S; Peirce, M; Winder, C G
1981-01-01
Concentrations of 52 minor elements in coal ash were determined using spark source mass spectroscopy. Hg levels in raw coal were investigated by cold vapour atomic absorption spectrophotometry. The concentration of elements are compared to other available data and to levels in the Earth's crust. F levels in coal ash exceed 500/sub g-1/ and may be greater than 1 wt% om raw coal. Approximately half the elements (B, S, Ni, Zn, Ga, Se, Sr, Y, Mo, Sn, Sb, I, Ba, Pr, Nd, Sm, Eu, Ho, Hf, Pt, Hg, Pb, Tl, Bi, U) investigated are enriched in the coal ash with respect to the Earth's crust. The ranges in minor element concentrations in coal ash and coal from different global regions are very similar.
Create a Consortium and Develop Premium Carbon Products from Coal
Energy Technology Data Exchange (ETDEWEB)
Frank Rusinko; John Andresen; Jennifer E. Hill; Harold H. Schobert; Bruce G. Miller
2006-01-01
The objective of these projects was to investigate alternative technologies for non-fuel uses of coal. Special emphasis was placed on developing premium carbon products from coal-derived feedstocks. A total of 14 projects, which are the 2003 Research Projects, are reported herein. These projects were categorized into three overall objectives. They are: (1) To explore new applications for the use of anthracite in order to improve its marketability; (2) To effectively minimize environmental damage caused by mercury emissions, CO{sub 2} emissions, and coal impounds; and (3) To continue to increase our understanding of coal properties and establish coal usage in non-fuel industries. Research was completed in laboratories throughout the United States. Most research was performed on a bench-scale level with the intent of scaling up if preliminary tests proved successful. These projects resulted in many potential applications for coal-derived feedstocks. These include: (1) Use of anthracite as a sorbent to capture CO{sub 2} emissions; (2) Use of anthracite-based carbon as a catalyst; (3) Use of processed anthracite in carbon electrodes and carbon black; (4) Use of raw coal refuse for producing activated carbon; (5) Reusable PACs to recycle captured mercury; (6) Use of combustion and gasification chars to capture mercury from coal-fired power plants; (7) Development of a synthetic coal tar enamel; (8) Use of alternative binder pitches in aluminum anodes; (9) Use of Solvent Extracted Carbon Ore (SECO) to fuel a carbon fuel cell; (10) Production of a low cost coal-derived turbostratic carbon powder for structural applications; (11) Production of high-value carbon fibers and foams via the co-processing of a low-cost coal extract pitch with well-dispersed carbon nanotubes; (12) Use of carbon from fly ash as metallurgical carbon; (13) Production of bulk carbon fiber for concrete reinforcement; and (14) Characterizing coal solvent extraction processes. Although some of the
Use of moist run-of-mine coal for gasification
Energy Technology Data Exchange (ETDEWEB)
Sowka, K.; Duerlich, M.; Rabe, W. (VEB Gaskombinat Fritz Selbmann, Schwarze Pumpe (German Democratic Republic))
1988-01-01
A Series of experiments was performed in 1982 and 1986 to assess the feasibility of substituting brown coal briquets by raw brown coal in the fixed bed gasification plant for producing town gas at Schwarze Pumpe, GDR. Raw brown coal (50% coal moisture, screened coal of fractions 20 to 80 mm) had to be mixed with dry briquets to maintain a maximum 35% coal charge moisture. Briquet substitution degree varied from 20 to 50%. Short-term gasification tests were also carried out at an experimental generator examining 80 to 100% substitution degrees. Parameters of generator operation that were achieved are provided. Experiments proved that 50% briquet substitution is technologically feasible in industrial plant operation employing unscreened coal containing all coal fines. An economic assessment is further made that shows substantial energy savings in coal drying and briquetting.
Mechanism of Enhancing Extraction of Vanadium from Stone Coal by Roasting with MgO
Directory of Open Access Journals (Sweden)
Fang Chen
2017-02-01
Full Text Available In this paper, the extraction of vanadium from stone coal by roasting with MgO and leaching with sulfuric acid has been investigated, and the mechanism analysis of stone coal roasting with MgO was studied. The results indicated that under the conditions that the mass fraction of the particles with grain size of 0–0.074 mm in raw ore was 75%, the roasting temperature was 500 °C, the roasting time was 1 h, MgO addition was 3 wt %, the sulfuric acid concentration was 20 vol %, the liquid-to-solid ratio was 1.5 mL/g, the leaching temperature was 95 °C, and leaching time was 2 h, resulting in a vanadium leaching efficiency of 86.63%, which increased by 7.73% compared with that of blank roasting. The mechanism analysis showed that the degree of calcite decomposition was low and, thus, magnesium vanadate was more easily formed than calcium vanadate below 500 °C. Moreover, magnesium vanadate was easier to dissolve than calcium vanadate during the sulfuric acid leaching process. Thus, the vanadium leaching efficiency was enhanced by using MgO as a roasting additive below 500 °C. Additionally, at high temperature the formation of tremolite would consume calcium oxide produced from the decomposition of calcite, thus, the formation of calcium vanadate was hindered, and V2O5 would react with MgO to form magnesium vanadate. Therefore, the vanadium leaching efficiency of roasting with MgO was higher than that of blank roasting at high temperature.
Oil Extraction from “Morelos Rice” Bran: Kinetics and Raw Oil Stability
Directory of Open Access Journals (Sweden)
J. Zúñiga-Diaz
2017-01-01
Full Text Available “Morelos rice” is a variety of rice with certificate of denomination of origin. It is a large grain of opaque appearance and extra large size that is grown exclusively in Morelos state (Mexico. Thus, the quality and characteristics of its rice bran may affect the kinetic of the extraction process of its oil as well as its stability. Therefore, this work is oriented to determine the extraction kinetics of its oil and its oxidative stability. The latter one is obtained through the proposal of a method based on open-circuit potential measurements. The results showed that the rice bran has 21.44% of raw oil, with a chemical composition (based on fatty acids of 48.48% oleic acid, 35.26% linoleic acid, and 14.54% palmitic acid, as well as a free fatty acid content of 8.15%. A high percentage of its oil content can be recovered in a short time at room temperature, and its extraction kinetics is a function of both the washing and the diffusion of its oil. Under storage conditions the raw oil has a high stability, at least 8 months, and its oxidative stability was of 24, 9, and 7 hours at 50°C, 80°C, and 110°C, respectively.
Minami, Motoyasu; Mori, Takako; Yonezawa, Takayuki; Saito, Yukiko; Teruya, Toshiaki; Woo, Je-Tae
2018-01-01
Nepodin, found in the roots of Rumex japonicus Houtt. (Polygonaceae), inhibits osteoclast differentiation and has an antidiabetic effect. We propose nepodin as an ingredient of new functional foods or as a drug candidate for reducing the risk of reduced locomotion resulting from diseases such as osteoporosis. Although there are no previous reports of R. obtusifolius L., which is found throughout Japan, having roots containing nepodin, we found nepodin in the roots of this species. Therefore, R. obtusifolius as well as R. japonicus was considered a candidate raw material for nepodin extraction. We also discuss the suitability of R. japonicus and R. obtusifolius as sources of raw nepodin for cultivation on the Ryukyu Islands. In this study, all specimens on the Ryukyu Islands were identified as R. japonicus. Conversely, all specimens on mainland Japan were R. obtusifolius. The DNA sequence of the chloroplast trnL-trnF intergenic spacer region and partial nuclear internal transcribed spacer was consistent with the identification of R. japonicus and R. obtusifolius by morphological characteristics of the perianth segments. Therefore, to avoid erroneous identification and misuse of the plant species used for extraction of raw materials, it is preferable to develop DNA markers for these two regions. The content of nepodin varied from undetectable to 0.34% of the fresh weight (%FW) in R. japonicus and from undetectable to 0.21%FW in R. obtusifolius. From a pharmacological perspective, as plants that might be suitable as raw materials for nepodin extraction, it became clear that both R. japonicus and R. obtusifolius can be used with the same expected extraction efficiency. Based on our findings, R. obtusifolius could not be confirmed as inhabiting the Ryukyu Islands. For this reason, to conserve the endemic genetic characteristics of the Ryukyu Islands and to prevent genetic pollution by R. obtusifolius, only R. japonicus should be cultivated on the Ryukyu Islands.
Hackley, Keith C.; Buchanan, D.H.; Coombs, K.; Chaven, C.; Kruse, C.W.
1990-01-01
Hot tetrachloroethene (perchloroethylene, PCE) extracts significant amounts of elemental sulfur (So) from weathered coals but not from pristine coals. The objective of this study was to determine whether So extracted by PCE is an oxidation product of pyrite or whether it originates in some way from unstable, organically-bound sulfur. The isotopic composition of the PCE-extracted So was compared to the isotopic compositions of the pyritic and the organic sulfur in a coal. The So was shown to have an isotopic signature similar to the pyritic sulfur. Additionally, the isotopic differences observed between the pyritic, So and sulfatic sulfur were consistent with bacterial mediated oxidation of sulfide sulfur (pyrite) as the source of both the sulfatic and elemental sulfur. ?? 1990.
The mine where extracting coal is a bonus
Energy Technology Data Exchange (ETDEWEB)
NONE
1993-07-01
Bowmans Harbour opencast mine is probably unique. Here Clay Colliery is mining an area that was derelict and contaminated land, which became a landfill site. When standards for landfill were raised the Black Country Development Corporation decided to redeposit the waste in a new repository on the same site, using higher standards. New cells for waste are being constructed. In creating these new cells coal is being extracted and sold. Four excavators are involved in this project.
Elemental characterization of coal ash and its leachates using sequential extraction techniques
International Nuclear Information System (INIS)
Landsberger, S.; Cerbus, J.F.; Larson, S.
1995-01-01
Over 50 million tons of coal ash are produced annually in North America. Technological improvements in air pollution control have decreased stack emissions but have also increased contaminant concentrations in the ash of coal-fired boiler applications. The leaching of heavy metals and other elements during regulatory tests may cause coal ash to be classified as hazardous waste, complicating land disposal. The hazardous nature of coal ash remains unclear because current toxicity tests fail to effectively characterize the elemental distribution and chemical solubility of trace metals in the landfill environment. Leaching characteristics of ash samples can be investigated with various laboratory extraction procedures in association with multi-elemental analytical techniques (e.g., neutron activation analysis and inductively coupled plasma - atomic emission spectroscopy). Such methods provide more thorough analyses of coal ash leaching dynamics than the regulatory assessments can demonstrate. Regulatory elements including Ag, As, Ba, Cd, Cr, Hg, Pb, and Se were shown to remain in largely insoluble forms while elements such as B and S leached at higher levels. Experimental results may assist operators of coal-fired boiler industries in selecting coal types and disposal options to curtail the leaching of potentially toxic inorganic contaminants. (author) 12 refs.; 4 figs.; 3 tabs
COAL OF THE FUTURE (Supply Prospects for Thermal Coal by 2030-2050)
2007-01-01
The report, produced by Messrs. Energy Edge Ltd. (the U.K.) for the JRC Institute for Energy, aims at making a techno-economic analysis of novel extraction technologies for coal and their potential contribution to the global coal supply. These novel extraction technologies include: advanced coal mapping techniques, improved underground coal mining, underground coal gasification and utilisation of coalmine methane gas.
Ultravitrinite coals from Chukotka
Energy Technology Data Exchange (ETDEWEB)
Lapo, A.V.; Letushova, I.A.
1979-03-01
Chemical and petrographic analysis was conducted on coals from the Anadyrya and Bukhti Ugol'noi deposits. Characteristics of the most prevalent type of vitrinite coals in both regions are presented here. Anadyrya coals belong to a transitional phase between brown coal and long flame. Ultravitrinite coals predominate. Gas coals from Bukti Ugol'noi have a higher carbon content than Anadyrya coals. They also have a higher hydrogen content and yield of initial resin. In several cases there was also a higher yield of volatile substances. Chukotka coals are characterized by a 10 percent higher initial resin yield than equally coalified Donetsk coals, other indicators were equal to those of Donetsk coals. Because of this, Chukotka coals are suitable for fuel in power plants and as raw materials in the chemical industry. (15 refs.) (In Russian)
Energy Technology Data Exchange (ETDEWEB)
Avigliano, A. [Bedeschi (Italy)
2006-10-15
In September 2005, Bedeschi was commissioned to design and supply a coal unloading, conveying and storage facility for a new raw coal line system within Hatien II Cement Co. The new plant is composed of a grab unloader, a conveyor system, a storage shed with stacking and reclaiming facilities, a complete dedusting system and civil and steel structure engineering. The scope of supply includes a local fabrication portion; however, main components will be imported. The project will be completed in 21 months. The paper looks into the mechanics of loading and unloading coal. 4 figs., 4 photos.
Investigation on the activation of coal gangue by a new compound method.
Li, Chao; Wan, Jianhua; Sun, Henghu; Li, Longtu
2010-07-15
In order to comprehensively utilize coal gangue as the main raw material in cementitious materials, improving its cementitious activity is a question of fundamental importance. In this paper, we present a new compound mechanical-hydro-thermal activation (CMHTA) technology to investigate the activation effect of coal gangue, and the traditional mechanical-thermal activation (TMTA) technology was used as reference. The purpose of this study is to give a detailed comparison between these two methods with regard to the mineral composition, crystal structure and microstructure, by XRD, IR, MAS NMR, XPS and mechanical property analysis. The prepared coal gangue based blended cement, containing 52% of activated coal gangue C (by CMHTA technology), has a better mechanical property than activated coal gangue T (by TMTA technology) and raw coal gangue. The results show that both of the TMTA and CMHTA technologies can improve the cementitious activity of raw gangue greatly. Moreover, compared with TMTA, the mineral phases such as feldspar and muscovite in raw coal gangue were partially decomposed, and the crystallinity of quartz decreased, due to the effect of adding CaO and hydro-thermal process of CMHTA technology. 2010 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Hackley, K.C.; Buchanan, D.H.; Coombs, K.; Chaven, C.; Kruse, C.W. (Eastern Illinois University, Charleston, IL (USA). Chemistry Dept.)
1990-01-01
Hot tetrachloroethene (perchloroethylen PCE) extracts significant amounts of elemental sulfur (S{sup o}) from weathered coals but not from pristine coals. The objective of this study was to determine whether S{sup o} extracted by PCE is an oxidation product of pyrite or whether it originates in some way from unstable, organically-bound sulfur. The isotopic composition of the PCE-extracted S{sup o} was compared to the isotopic compositions of the pyritic and the organic sulfur in a coal. The S{sup o} was shown to have an isotopic signature similar to the pyritic sulfur. Additionally, the isotopic differences observed between the pyritic, S{sup o} and sulfatic sulfur were consistent with bacterial mediated oxidation of sulfide sulfur (pyrite) as the source of both the sulfatic and elemental sulfur. 21 refs., 2 tabs.
Extractive de-sulfurization and de-ashing of high sulfur coals by oxidation with ionic liquids
International Nuclear Information System (INIS)
Saikia, Binoy K.; Khound, Kakoli; Baruah, Bimala P.
2014-01-01
Highlights: • Extractive de-sulfurization and de-ashing process for cleaning high sulfur coals. • The process removes inorganic as well as organic sulfur components from high sulfur coals. • The process has less risk to chemists and other surroundings. - Abstract: The environmental consequences of energy production from coals are well known, and are driving the development of desulfurization technologies. In this investigation, ionic liquids were examined for extractive desulfurization and de-ashing in industrially important high sulfur sub-bituminous Indian coals. The ionic liquids, namely, 1-n-butyl-3-methylimidazolium tetrafluoroborate (IL1) and 1-n-butyl 3-methylimidazolium chloride (IL2) were employed for desulfurization of a few Indian coal samples in presence of HCOOH/H 2 O 2 and V 2 O 5 . Results show the maximum removal of 50.20% of the total sulfur, 48.00% of the organic sulfur, and 70.37 wt% of the ash in this process. The ionic liquids were recovered and subsequently used for further desulfurization. FT-IR spectra reveal the transformation of organic sulfur functionalities into the sulfoxides (S=O) and sulfones (-SO 2 ) due to the oxidative reactions. The sulfate, pyrite and sulfides (aryls) signals in the near edge X-ray absorption fine structure (NEXAFS) of the oxidized coal samples showed sulfur transformation during the desulfurization process. The study demonstrates the removal of significant amount of inorganic as well as organic sulfur (aryls) components from the original high sulfur coal samples to make them cleaner
DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS
Energy Technology Data Exchange (ETDEWEB)
Elliot B. Kennel; R. Michael Bergen; Stephen P. Carpenter; Dady Dadyburjor; Manoj Katakdaunde; Liviu Magean; Alfred H. Stiller; W. Morgan Summers; John W. Zondlo
2006-05-12
The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. The largest applications are those which support metals smelting, such as anodes for aluminum smelting and electrodes for arc furnaces. Other carbon products include materials used in creating fuels for the Direct Carbon Fuel Cell, metals smelting, especially in the aluminum and steel industries, as well as porous carbon structural material referred to as ''carbon foam'' and carbon fibers. During this reporting period, coking and composite fabrication continued using coal-derived samples. These samples were tested in direct carbon fuel cells. Methodology was refined for determining the aromatic character of hydro treated liquid, based on Nuclear Magnetic Resonance (NMR) and Fourier Transform Infrared (FTIR). Tests at GrafTech International showed that binder pitches produced using the WVU solvent extraction protocol can result in acceptable graphite electrodes for use in arc furnaces. These tests were made at the pilot scale.
Reduced emissions from inexpensive high-sulphur coal briquettes
International Nuclear Information System (INIS)
Gammage, R.B.; Wachter, E.A.; Wade, J.; Wilson, D.L.; Haas, J.W.; Ahmad, N.; Siltain, F.; Raza, M.Z.
1992-01-01
Airborne emissions were measured during the combustion of Pakistani high-sulphur coal, cold briquetted with lime and clay; comparison was made to emissions from raw coal and traditional fuels burnt in a native, mud-lined Angethi stove. Compared to raw coal, the amended coal gave fourfold reduced emission of respirable-size particles (RSP) and threefold reduced total releases of SO 2 . In domestic cooking, substitution of the amended coal briquettes for traditional fuels will not worsen indoor air quality with respect to CO, SO 2 , NO x , and RSP. The high peak amounts of CO (100--250 ppm), SO 2 (2--5 ppm), and NO x (1--5 ppm) were limited to the early phase of burning. The high thermal value of the coal briquettes together with a simple briquetting technology, make this fuel an attractive energy alternative in countries that are underdeveloped, developing, or experiencing major restructuring
Directory of Open Access Journals (Sweden)
Boyko N.N.
2014-12-01
Full Text Available This paper presents data on screening of antimicrobial properties of extracts from some kinds of raw materials (18 plants with hydroquinone, naphtoquinone or anthraquinone derivatives. Some technological parameters of extracts (density and concentration of extraneous substances have been determined. The most appropriate microbiological method of studying antimicrobial properties of extracts, diffusion method of “well”, has been applied; special mathematic method of comparison of antimicrobial properties of extracts vector analysis has been applied in order to study and to compare antimicrobial properties of extracts. Indexes of antimicrobial properties of extracts have been determined: a complex index of medicinal product antimicrobial activity for quantitative estimation of antimicrobial effect - A, and square of correlation coefficient - r², which demonstrates the spectrum of antimicrobial activity of the extracts (degree of similarity to the standard. The most active extracts have been selected; they have antimicrobial properties of medium strength: from the herb of chimaphila umbellata А=2.20; the fruits of rhamnus cathartica А=2.12; the root of rubia tinctorum А=2.11; the bark of frangula alnus А=2.05; the root of rumex confertus А=2.04; the leaf of pyrola rotundifolia А=2.00; and leaf of arctostaphylos uva-ursi А=2.08 (but extract from uva-ursi did not affected on 2 strains of microorganisms r²=0.64. Low levels of antimicrobial activity have been demonstrated by the extract obtained from the leaf of urtica dioica А=0.72, r²=0.34. The mean result of the complex index of antimicrobial activity for the most of extracts from plants containing quinonederivatives is A = 1.77 (on 70% vol. ethanol at a ratio of raw material : extracting agent – 1:7 wt. : vol. and may range from 0.68 to 2.85. The mean result of the correlation coefficient is r = 0.93 and may range from 0.59 to 0.99. The mean result of the concentration of
Pre-Concentration of Vanadium from Stone Coal by Gravity Using Fine Mineral Spiral
Directory of Open Access Journals (Sweden)
Xin Liu
2016-08-01
Full Text Available Due to the low grade of V2O5 in stone coal, the existing vanadium extraction technologies face challenges in terms of large handling capacity, high acid consumption and production cost. The pre-concentration of vanadium from stone coal before the extraction process is an effective method to reduce cost. In this study, detailed mineral characterization of stone coal was investigated. It has been confirmed that the vanadium mainly occurs in muscovite and illite. A significant demand for an effective pre-concentration process with simple manipulation for discarding quartz and other gangue minerals is expected. Based on the mineralogical study, a new vanadium pre-concentration process using a fine mineral spiral was investigated. The experimental results showed that the separation process, which was comprised of a rougher and scavenger, could efficiently discard quartz, pyrite and apatite. A final concentrate with V2O5 grade of 1.02% and recovery of 89.6% could be obtained, with 26.9% of the raw ore being discarded as final tailings.
High temperature solvent extraction of oil shale and bituminous coal using binary solvent mixtures
Energy Technology Data Exchange (ETDEWEB)
Goetz, G.K.E. [Lehrstuhl fuer Geologie, Geochemie und Lagerstaetten des Erdoels und der Kohle, RWTH Aachen (Germany)
1997-12-31
A high volatile bituminous coal from the Saar Basin and an oil shale from the Messel deposit, both Germany, were extracted with binary solvent mixtures using the Advanced Solvent Extraction method (ASE). Extraction temperature and pressure were kept at 100 C, respectively 150 C, and 20,7 MPa. After the heating phase (5 min) static extractions were performed with mixtures (v:v, 1:3) of methanol with toluene, respectively trichloromethane, for further 5 min. Extract yields were the same or on a higher level compared to those from classical soxhlet extractions (3 days) using the same solvents at 60 C. Comparing the results from ASE with those from supercritical fluid extraction (SFE) the extract yields were similar. Increasing the temperature in ASE releases more soluble organic matter from geological samples, because compounds with higher molecular weight and especially more polar substances were solubilized. But also an enhanced extraction efficiency resulted for aliphatic and aromatic hydrocarbons which are used as biomarkers in Organic Geochemistry. Application of thermochemolysis with tetraethylammonium hydroxide (TEAH) using pyrolysis-gas chromatography-mass spectrometry (Py-GC-MS) on the extraction residues shows clearly that at higher extraction temperatures minor amounts of free fatty acids or their methyl esters (original or produced by ASE) were trapped inside the pore systems of the oil shale or the bituminous coal. ASE offers a rapid and very efficient extraction method for geological samples reducing analysis time and costs for solvents. (orig.)
Recovery of gallium from coal fly ash by a dual reactive extraction process
Energy Technology Data Exchange (ETDEWEB)
Gutierrez, B.; Pazos, C.; Coca, J. [University of Oviedo, Oviedo (Spain). Dept. of Chemical Engineering and Environmental Technology
1997-08-01
This paper describes the extraction of gallium from coal fly ash by leaching and extraction with commercial extractants Amerlite LA-2 and LIX-54N dissolved in kerosene. Leaching of gallium and other metals from the fly ash was carried out with 6 M hydrochloric acid. The leaching liquor is first contacted with Amerlite LA-2 which extracts the gallium and iron. The iron is then precipitated with sodium hydroxide, while gallium remains in solution. Gallium is extracted selectively from the base solution with LIX 54; the resulting stripped solution contains 83% of the gallium present in the leaching liquor.
Coal blending preparation for non-carbonized coal briquettes
Widodo; Fatimah, D.; Estiaty, L. M.
2018-02-01
Referring to the national energy policy targets for the years 2025, the government has launched the use of coal briquettes as an alternative energy replacement for kerosene and firewood. Non-carbonized briquettes in the form of coal briquettes as well as bio-coal briquettes are used in many small-medium industries and households, and are rarely used by large industries. The standard quality of coal briquettes used as raw material for non-carbonized briquettes is a minimum calorific value of 4,400 kcal/kg (adb); total sulfur at a maximum of 1% (adb), and water content at plants), the environment of deposition, and the geological conditions of the surrounding area, so that the coal deposits in each region will be different as well as the amount and also the quality. Therefore, the quantity and the quality of coal in each area are different to be eligible in the making of briquettes to do blending. In addition to the coal blending, it is also necessary to select the right materials in the making of coal briquettes and bio-coal briquettes. The formulation of the right mixture of material in the making of briquettes, can be produced of good quality and environmental friendly.
Directory of Open Access Journals (Sweden)
XINZHUANG ZHANG
2016-03-01
Full Text Available The study aims to investigate the effects of garlic extracts on color, lipid oxidation, and oxidative breakdown products in raw ground beef during refrigerated storage. The two treatments were:control group (C, with no addition and experiment group (D, 50 mg garlic extracts added to 100 g beef. Adding garlic extracts significant increased a* value (PA ≤ 0.05, and significant decreased TBARS and PV values (PA ≤ 0.05. The pH and –SH value of D group had a decreasing tendency (PA=0.0522 and an increasing tendency (PA=0.0636 respectively compared to C group. Garlic extracts protected phospholipids, fatty acids and polypeptides from oxidation. The results indicatethat garlic extracts have the antioxidant activity, helping maintain the meat color, inhibiting lipid oxidation and protein degradation of raw ground beef during refrigerated storage.
Experimental investigations on drying behaviour of Bulgarian brown coal in steam fluidized bed
International Nuclear Information System (INIS)
Buschsieweke, F.; Koenig, J.
1999-01-01
The main targets were: to investigate the parameters for optimizing the drying process as steam pressure, fluidization velocity and particle size; to identify the cost of drying and combustion processes considering the necessity of milling the coal (raw or dried). Test series with Bulgarian brown coal from Maritsa-East has been made. Two fractions with different particle size was got: A from 0 to 1.6 mm (0.5 mm average) and B, resp. 1.6 to 6.3 (1.7 mm). The particle size is depending on the coal moisture. The fluidized bed process with the both fractions was performed at variations of the following parameters: steam velocity (0.07 to 1.7 m/s); raw coal feed rate (4 to 16 kg/h); raw moisture (18 to 43 wt %) and pressure (1.3 and 5 bar). Also the shrinking behaviour of the coal in different pore sizes was tested. Comparing pore size of the oven dried coal to the fluidized bed dried coal, significantly higher inner surface for the oven dried coal was established. To indicate the pore size of raw coal samples were made by freeze drying. Ice expanding should cause higher inner surface compared to oven drying method but no significant difference was established. A significant increase of heat transfer of the particles from A fraction (300 to 350 W/m 2 K0 compared to B (200 to 230 W/m 2 K) was determined. The heat transfer coefficient increased at increasing of the raw coal feed rate, mostly significant for A, due to higher particle contact. In conclusion: the particle convective mechanism is predominant for the heat transfer; development of pressurized fluidized bed drying is not of interest and the question about the total expenditure for crushing and milling remains open
International Nuclear Information System (INIS)
Satova, R.K.
1999-01-01
In Kazakhstan during the period of transition to the market economy in the condition of reduction of coal production and increasing expenditures in coal branch, the problem of of the rational utilization of coal resources becomes the most vital issue. In the thesis theoretical and methodological aspects of socio-economic efficiency of utilization of the fuel and energetic resources are investigated. Different fields of usage of coal and coal wastes are studied, economic evaluation of mechanic and thermo-chemical methods of producing coal in process of bringing resources saving technologies; the national efficiency of using products in the quantity of technological raw and energetic fuel is brought out; the influence refining for the widening of the raw-base of industry, promoting the economic results of production and the lowering environmental pollution. It was estimated that the extracted coal of the region includes 1020 thousand tonne of aluminium oxide and 996 thousand tonne of sulphur; in the course of extracting and coal processing 3650 thousand tonne of firm wastes appeared; during the extracting of Ehkibastuz coal - 90970 thousand tonne, and the Karaganda coal - 40040 thousand tonne.The coal components and wastes mentioned above should be considered not only as source of environment pollution but also as potential resource for the production of industrial goods according to their qualitative characteristics and the availability of technical ideas of the processing. The implementation of the mentioned pre-sup-positions in the conditions of the forming market economy will allow to use the organic part of coal more competently, to involve the other useful components of coal in the sphere of production consumption, to utilize gaseous and firm wastes and to gain of the basis the expansion of resource base of same branches of industry and the reduction of environment pollution. It will be also accompanied by the needs in capital investments for the industrial
Annual report 1997. Energies and raw materials
International Nuclear Information System (INIS)
1997-01-01
This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)
Non-covalent associative structure of coal
Energy Technology Data Exchange (ETDEWEB)
Shui, H. [Anhui University of Technology, Maanshan (China). School of Chemistry and Chemical Engineering
2004-06-01
The recent progress of non-covalent associative structure of coal and the mechanisms of the carbon disulphide-N-methyl-2-pyrrolidone (CS{sub 2}/NMP) are mixed solvent and the additive addition enhancing the extraction yield of coals are reviewed, and the aggregation behaviour of coal in solid and solution states are presented, and the aggregation behavior of coal in solid and solution states are introduced in this paper. Coal extraction and swelling in organic solvents at room temperature were the most useful methods to understand the associative structure of coal. CS{sub 2}/NMP is a unique solvent to give high extraction yields for some bituminous coals. Some additives such as tetracyanoethylene (TCNE) can dissociate the stronger interactions among coal molecules and enhance the extraction yields of coal in the mixed solvent. 37 refs., 1 fig.
Possibilities of employing saliferous raw brown coal for technical fodder drying
Energy Technology Data Exchange (ETDEWEB)
Koerdel, P; Haeusler, W
1978-09-01
The successful utilization of saliferous brown coal is demonstrated with a sodium oxide content greater than 0.5% in dry substance, but with high calorific value (2300 to 3000 kcal/kg) for fodder drying (sugar beets and green fodder). Details of the fodder dryer and its performance, and combustion and drying parameters of 11 dryers using saliferous coal are presented. Hot air enters the dryer with temperatures between 300 and 800 C depending on the operation, and dries the fodder to 88-92% dry substance. Chemical analysis showed no significant increase in sulfur dioxide, hydrogen sulfide, chlorine, or sodium content in the dry fodder, which is recognized as safe to feed to ruminants. The substitution of ordinary brown coal by saliferous coal led to a savings of 4.000 Marks/kt coal in drying. (8 refs.) (In German)
International Nuclear Information System (INIS)
Vigineix, Thomas; Guillot, Nicolas; Saurel, Nicolas
2013-06-01
Gamma ray spectrometry is a passive non destructive assay most commonly used to identify and quantify the radionuclides present in complex huge objects such as nuclear waste packages. The treatment of spectra from the measurement of nuclear waste is done in two steps: the first step is to extract the raw data from the spectra (energies and the net photoelectric absorption peaks area) and the second step is to determine the detection efficiency of the measuring scene. Commercial software use different methods to extract the raw data spectrum but none are optimal in the treatment of spectra containing actinides. Spectra should be handled individually and requires settings and an important feedback part from the operator, which prevents the automatic process of spectrum and increases the risk of human error. In this context the Nuclear Measurement and Valuation Laboratory (LMNE) in the Atomic Energy Commission Valduc (CEA Valduc) has developed a new methodology for quantifying the uncertainty associated with the extraction of the raw data over spectrum. This methodology was applied with raw data and commercial software that need configuration by the operator (GENIE2000, Interwinner...). This robust and fully automated methodology of uncertainties calculation is performed on the entire process of the software. The methodology ensures for all peaks processed by the deconvolution software an extraction of energy peaks closed to 2 channels and an extraction of net areas with an uncertainty less than 5 percents. The methodology was tested experimentally with actinides spectrum. (authors)
Thallium in mineral resources extracted in Poland
Directory of Open Access Journals (Sweden)
Bojakowska I.
2013-04-01
Full Text Available Thallium concentrations in primary mineral commodities extracted in Poland and processed in high temperatures were determined by ICP-MS method. Samples of hard and brown coal, copper-silver and zinclead ores, argillaceous and calcareous rocks of different genesis and age were analyzed. The highest thallium concentrations occur in the zinc-lead ores, the average content being of 52.1 mg/kg. The copper ores contain in average 1.4 mg/kg of thallium. Hard coals from the Upper Silesian Coal Basin display higher thallium content than those exploited in the Lublin Coal Basin. Brown coals from Turow deposit distinguish by much higher values, 0.7 mg/kg Tl, than those from huge Bełchatów and smaller Konin-Turek region deposits. Average thallium concentrations in clays used for ceramic materials are lower than 1 mg/kg, except of Mio-Pliocene Slowiany deposit. The average content of thallium in the studied limestone and dolomite raw materials for cement, lime, and metallurgical flux, and refractories is very low in comparison to the average amounts in the world carbonate rocks.
Energy Technology Data Exchange (ETDEWEB)
1978-02-17
British Petroleum and NCB are collaborating in a two year study of coal liquefaction which could result in a demonstration plant being built. The two liquefaction techniques which the NCB is developing at present are supercritical extraction, and dissolution in anthracene oil. A disadvantage of the latter process is that high grade coking coals must be used.
Preliminary experimental studies of waste coal gasification
Energy Technology Data Exchange (ETDEWEB)
Su, S.; Jin, Y.G.; Yu, X.X.; Worrall, R. [CSIRO, Brisbane, QLD (Australia). Advanced Coal Technology
2013-07-01
Coal mining is one of Australia's most important industries. It was estimated that coal washery rejects from black coal mining was approximately 1.82 billion tonnes from 1960 to 2009 in Australia, and is projected to produce another one billion tonnes by 2018 at the current production rate. To ensure sustainability of the Australian coal industry, we have explored a new potential pathway to create value from the coal waste through production of liquid fuels or power generation using produced syngas from waste coal gasification. Consequently, environmental and community impacts of the solid waste could be minimized. However, the development of an effective waste coal gasification process is a key to the new pathway. An Australian mine site with a large reserve of waste coal was selected for the study, where raw waste coal samples including coarse rejects and tailings were collected. After investigating the initial raw waste coal samples, float/sink testing was conducted to achieve a desired ash target for laboratory-scale steam gasification testing and performance evaluation. The preliminary gasification test results show that carbon conversions of waste coal gradually increase as the reaction proceeds, which indicates that waste coal can be gasified by a steam gasification process. However, the carbon conversion rates are relatively low, only reaching to 20-30%. Furthermore, the reactivity of waste coal samples with a variety of ash contents under N{sub 2}/air atmosphere have been studied by a home-made thermogravimetric analysis (TGA) apparatus that can make the sample reach the reaction temperature instantly.
Energy Technology Data Exchange (ETDEWEB)
Garcia, Roberto; Arenillas, Ana; Rubiera, Fernando; Moinelo, Sabino R. [Instituto Nacional del Carbon INCAR, CSIC, Apartado 73, 33080, Oviedo (Spain)
2004-11-25
This paper studies the chemical composition of several supercritical gas (SCG) extracts and its influence on the thermal behaviour under carbonisation conditions. The extracts were obtained from a Spanish lignite (Mequinenza), a low-quality coal from the point of view of energy applications. The lignite was treated with toluene, ethanol (EtOH) and tetrahydrofuran (THF) as solvents under different supercritical temperature and pressure conditions. The extracts display high aliphatic nature and enhanced concentrations of oxygen functional groups, aided by the contribution of hydrogenation and oxygen incorporation reactions occurring in the SCG extraction with EtOH and THF. Thiophenic compounds are also present in great concentrations derived from the exceptionally high organic sulphur content of the parent coal. The carbonisation of the extracts renders anisotropic material with fine mosaic texture, as a consequence of the significant thermal reactivity inferred by the aliphatic and oxygenated groups. The size of the mosaic increases with the temperature of the SCG extraction and varies with the supercritical solvent in the order: toluene
DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS
Energy Technology Data Exchange (ETDEWEB)
Elliot B. Kennel; Philip L. Biedler; Chong Chen; Dady Dadyburjor; Liviu Magean; Peter G. Stansberry; Alfred H. Stiller; John W. Zondlo
2005-04-13
The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. These carbon products include materials used in metals smelting, especially in the aluminum and steel industries, as well as porous carbon structural material referred to as ''carbon foam'' and carbon fibers. A process has been developed which results in high quality binder pitch suitable for use in graphite electrodes or carbon anodes. A detailed description of the protocol is given by Clendenin. Briefly, aromatic heavy oils are hydro-treated under mild conditions in order to increase their ability to dissolve coal. An example of an aromatic heavy oil is Koppers Carbon Black Base (CBB) oil. CBB oil has been found to be an effective solvent and acceptably low cost (i.e., significantly below the market price for binder pitch, or about $280 per ton at the time of this writing). It is also possible to use solvents derived from hydrotreated coal and avoid reliance on coke oven recovery products completely if so desired.
Buchanan, D.H.; Coombs, K.J.; Murphy, P.M.; Chaven, C.
1993-01-01
A convenient method for the quantitative determination of elemental sulfur in coal is described. Elemental sulfur is extracted from the coal with hot perchloroethylene (PCE) (tetrachloroethene, C2Cl4) and quantitatively determined by HPLC analysis on a C18 reverse-phase column using UV detection. Calibration solutions were prepared from sublimed sulfur. Results of quantitative HPLC analyses agreed with those of a chemical/spectroscopic analysis. The HPLC method was found to be linear over the concentration range of 6 ?? 10-4 to 2 ?? 10-2 g/L. The lower detection limit was 4 ?? 10-4 g/L, which for a coal sample of 20 g is equivalent to 0.0006% by weight of coal. Since elemental sulfur is known to react slowly with hydrocarbons at the temperature of boiling PCE, standard solutions of sulfur in PCE were heated with coals from the Argonne Premium Coal Sample program. Pseudo-first-order uptake of sulfur by the coals was observed over several weeks of heating. For the Illinois No. 6 premium coal, the rate constant for sulfur uptake was 9.7 ?? 10-7 s-1, too small for retrograde reactions between solubilized sulfur and coal to cause a significant loss in elemental sulfur isolated during the analytical extraction. No elemental sulfur was produced when the following pure compounds were heated to reflux in PCE for up to 1 week: benzyl sulfide, octyl sulfide, thiane, thiophene, benzothiophene, dibenzothiophene, sulfuric acid, or ferrous sulfate. A sluury of mineral pyrite in PCE contained elemental sulfur which increased in concentration with heating time. ?? 1993 American Chemical Society.
Li, Qi; Dong, Dan-Dan; Huang, Qiu-Ping; Li, Jing; Du, Yong-Yong; Li, Bin; Li, Huan-Qing; Huyan, Ting
2017-12-01
Sonchus oleraceus L. (Asteraceae) (SO) is a dietary and traditional medicinal plant in China. However, its underlying mechanism of action as an anti-inflammatory agent is not known. This study evaluates the anti-inflammatory activity of aqueous extract of SO. The extract of SO was used to treat RAW 264.7 cells (in the working concentrations of 500, 250, 125, 62.5, 31.3 and 15.6 μg/mL) for 24 h. Pro-inflammatory cytokines and mediators produced in LPS-stimulated RAW 264.7 cells were assessed. Meanwhile, the expression level of TLR-4, COX-2, pSTATs and NF-κB was tested. Moreover, the anti-inflammatory activity of the extract in vivo was assessed using xylene-induced mouse ear oedema model and the anti-inflammatory compounds in the extracts were analyzed by HPLC-MS. SO extract significantly inhibited the production of pro-inflammatory cytokines and mediators at gene and protein levels with the concentration of 31.3 μg/mL, and suppressed the expression of TLR-4, COX-2, NF-κB and pSTAT in RAW 264.7 cells. The anti-inflammatory activity of SO in vivo has significant anti-inflammatory effects with the concentration of 250 and 125 mg/kg, and less side effect on the weights of the mice at the concentration of 250 mg/kg. Moreover, HPLC-MS analysis revealed that the anti-inflammatory compounds in the extract were identified as villosol, ferulaic acid, β-sitosterol, ursolic acid and rutin. This study indicated that SO extract has anti-inflammatory effects in vitro and in vivo, which will be further developed as novel pharmacological strategies in order to defeat inflammatory diseases.
Control of the extraction, transport and quality of coal in sections in actual time intervals
Energy Technology Data Exchange (ETDEWEB)
Prochazka, P; Sladek, J
1981-01-01
This paper describes the design of a system for the automatic, semiautomatic and manual control of the extraction, transport and quality of the coal in two sections of the Severo-Cheshsk brown coal basin using computers. The coal in these sections is transported along a joint transport main line which consists of three conveyor lines to two grinding works and from there to 3 thermoelectric power plants. Based on information about the coal quality in the mining sections of individual excavators, about their productivity and about the throughput of the conveyor lines, the computer determines in a quite short time the maximally possible throughput of the conveyor lines for ensuring the required coal quality. Programs are written in the ALGOL language. The information in the SM-3 computer from the excavators will be transmitted using a Tesla Radom wireless communications apparatus through a JPR-12 computer. A terminal will be mounted on each excavator which will report to the computer the number of ledges subject to mining, the type of coal in them, the distance of the excavator from the coal loading point and the size of required and actual productivity of the excavator.
Influence of stabilizer on the environment and their use as possible secondary raw material
International Nuclear Information System (INIS)
Jelenova, M.
2001-01-01
In this paper author deals with the environmental impact of coal combustion in coal fired power plants and with influence of ash and stabilizer on the environment and their use as possible secondary raw material
Energy Technology Data Exchange (ETDEWEB)
Lacheta, A; Stangiewicz, T
1979-01-01
The use of dynamic programming of monthly extraction and storage of coal at mines was examined in order to reduce the annual outlays for these operations. In addition, realization of the model simultaneously satisfies the orders of the consumers, despite the seasonal fluctuations in the demand of the customers and the coal shipment capabilities of the mining enterprise.
Effect of coal mine dust and clay extracts on the biological activity of the quartz surface
Energy Technology Data Exchange (ETDEWEB)
Stone, V.; Jones, R.; Rollo, K.; Duffin, R.; Donaldson, K.; Brown, D.M. [Napier University, Edinburgh (United Kingdom). School of Life Science
2004-04-01
Modification of the quartz surface by aluminum salts and metallic iron have been shown to reduce the biological activity of quartz. This study aimed to investigate the ability of water soluble extracts of coal mine dust (CMD), low aluminum clays (hectorite and montmorillonite) and high aluminum clays (attapulgite and kaolin) to inhibit the reactivity of the quartz surface. DQ12 induced significant haemolysis of sheep erythrocytes in vitro and inflammation in vivo as indicated by increases in the total cell numbers, neutrophil cell numbers, MIP-2 protein and albumin content of bronchoalveolar lavage (BAL) fluid. Treatment of DQ12 with CMD extract prevented both haemolysis and inflammation. Extracts of the high aluminum clays (kaolin and attapulgite) prevented inhibition of DQ12 induced haemolysis, and the kaolin extract inhibited quartz driven inflammation. DQ12 induced haemolysis by coal mine dust and kaolin extract could be prevented by pre-treatment of the extracts with a cation chellator. Extracts of the low aluminum clays (montmorillonite and hectorite) did not prevent DQ12 induced haemolysis, although the hectorite extract did prevent inflammation. These results suggest that CMD, and clays both low and rich in aluminum, all contain soluble components (possibly cations) capable of masking the reactivity of the quartz surface.
Energy Technology Data Exchange (ETDEWEB)
Maiti, S.K.; Saxena, N.C. [Indian School of Mines, Dhanbad (India). Centre of Mining Environment
1997-12-31
A range of tree species were successfully established and grown on spoil site irrigated with domestic raw sewage in India. The heavy metals content in leaves, stem wood, stem bark root wood and root bark differ between species. In general, heavy metals like Fe, Zn, Mn, Cu, and Pb were accumulated more in Eucalyptus then Melia, however only Co accumulated maximum in Acacia. Increase trend was reported in respect of Na, K, Fe, Zn, Cu in grass and vegetables which were grown at a sewage fed farm. However, in all the cases micronutrients and heavy metals contents did not reach the critical limits to produce any phytotoxic effect. Irrigation with raw sewage had no adverse effect on chemical properties of spoil over the 3 year period. This study shows that raising vegetation on spoil material in mining areas irrigated with raw sewage is feasible. However, irrigation by raw sewage caused the accumulation of heavy metals in different plant parts. These plants are not of the fodder type and thus are not entering directly into ecological food chains, hence they can act as heavy metals sinks. On the basis of the Grass-legume experimental study, it may be concluded that N accumulation of coal mine spoil related with nature of spoil, prevailing climate and legume used. In a tropical climate N accumulation rate was found higher than in a temperate one. Addition of phosphorus fertilizer is essential for the reclamation of many mine spoils because even after three years available P level can remain deficient. Available K was found to be sufficient after three years.
Raw materials for energy generation in Canada
Energy Technology Data Exchange (ETDEWEB)
Robertson, D S
1976-03-01
Canada is self-sufficient in energy. The energy demand in Canada up to the end of the century is predicted, and the present and future of the oil, gas, coal and uranium industries are considered. Since it is now Canadian policy to restrict export of energy sources, in the future Canada will probably make more domestic use of its coal reserves. An increase is forecast in the use of coal for electricity generation and as a feedstock for synthetic gas. A long lead time and large capital expenditure will be needed before coal can be transported from western Canada to markets in the east of the country. A relatively small amount of the coal reserves are extractable by surface mining, and new underground mining techniques will be needed to extract the extremely friable coal from the deformed seams in the mountains.
Directory of Open Access Journals (Sweden)
Li Ma
2018-05-01
Full Text Available Pore structure has a significant influence on coal-bed methane (CBM enhancement. Injecting liquid CO2 into coal seams is an effective way to increase CBM recovery. However, there has been insufficient research regarding the damage effects and fractal characteristics of pore structure at low temperature induced by injecting liquid CO2 into coal samples. Therefore, the methods of low-pressure nitrogen adsorption-desorption (LP-N2-Ad and mercury intrusion porosimetry (MIP were used to investigate the damage effects and fractal characteristics of pore structure with full aperture as the specimens were frozen by liquid CO2. The adsorption isotherms revealed that the tested coal samples belonged to type B, indicating that they contained many bottle and narrow-slit shaped pores. The average pore diameter (APD; average growth rate of 18.20%, specific surface area (SSA; average growth rate of 7.38%, and total pore volume (TPV; average growth rate of 18.26% increased after the specimens were infiltrated by liquid CO2, which indicated the generation of new pores and the transformation of original pores. Fractal dimensions D1 (average of 2.58 and D2 (average of 2.90 of treated coal samples were both larger the raw coal (D1, average of 2.55 and D2, average of 2.87, which indicated that the treated specimens had more rough pore surfaces and complex internal pore structures than the raw coal samples. The seepage capacity was increased because D4 (average of 2.91 of the treated specimens was also higher than the raw specimens (D4, average of 2.86. The grey relational coefficient between the fractal dimension and pore structure parameters demonstrated that the SSA, APD, and porosity positively influenced the fractal features of the coal samples, whereas the TPV and permeability exerted negative influences.
International Nuclear Information System (INIS)
Ge, Lichao; Zhang, Yanwei; Wang, Zhihua; Zhou, Junhu; Cen, Kefa
2013-01-01
Highlights: • Typical Chinese lignites with various ranks are upgraded through microwave. • The pore distribution extends to micropore region, BET area and volume increase. • FTIR show the change of microstructure and improvement in coal rank after upgrading. • Upgraded coals exhibit weak combustion similar to Da Tong bituminous coal. • More evident effects are obtained for raw brown coal with relative lower rank. - Abstract: This study investigates the effects of microwave irradiation treatment on coal composition, pore structure, coal rank, function groups, and combustion characteristics of typical Chinese low-rank coals. Results showed that the upgrading process (microwave irradiation treatment) significantly reduced the coals’ inherent moisture, and increased their calorific value and fixed carbon content. It was also found that the upgrading process generated micropores and increased pore volume and surface area of the coals. Results on the oxygen/carbon ratio parameter indicated that the low-rank coals were upgraded to high-rank coals after the upgrading process, which is in agreement with the findings from Fourier transform infrared spectroscopy. Unstable components in the coal were converted into stable components during the upgrading process. Thermo-gravimetric analysis showed that the combustion processes of upgraded coals were delayed toward the high-temperature region, the ignition and burnout temperatures increased, and the comprehensive combustion parameter decreased. Compared with raw brown coals, the upgraded coals exhibited weak combustion characteristics similar to bituminous coal. The changes in physicochemical characteristics became more notable when processing temperature increased from 130 °C to 160 °C or the rank of raw brown coal was lower. Microwave irradiation treatment could be considered as an effective dewatering and upgrading process
National Coal Quality Inventory (NACQI)
Energy Technology Data Exchange (ETDEWEB)
Robert Finkelman
2005-09-30
The U.S. Geological Survey (USGS) conducted the National Coal Quality Inventory (NaCQI) between 1999 and 2005 to address a need for quality information on coals that will be mined during the next 20-30 years. Collaboration between the USGS, State geological surveys, universities, coal burning utilities, and the coal mining industry plus funding support from the Electric Power Research Institute (EPRI) and the U.S. Department of Energy (DOE) permitted collection and submittal of coal samples for analysis. The chemical data (proximate and ultimate analyses; major, minor and trace element concentrations) for 729 samples of raw or prepared coal, coal associated shale, and coal combustion products (fly ash, hopper ash, bottom ash and gypsum) from nine coal producing States are included. In addition, the project identified a new coal reference analytical standard, to be designated CWE-1 (West Elk Mine, Gunnison County, Colorado) that is a high-volatile-B or high-volatile-A bituminous coal with low contents of ash yield and sulfur, and very low, but detectable contents of chlorine, mercury and other trace elements.
Energy Technology Data Exchange (ETDEWEB)
Dong, S.N.; Wu, L.; Paterson, N.; Herod, A.A.; Dugwell, D.R.; Kandiyoti, R. [University of London Imperial College of Science & Technology, London (United Kingdom). Dept. of Chemical Engineering
2005-07-01
The aim of the work was to investigate the fate of injectant coal in blast furnaces and the origin of extractable materials in blast furnace carryover dusts. Two sets of samples including injectant coal and the corresponding carryover dusts from a full sized blast furnace and a pilot scale rig have been examined. The samples were extracted using 1-methyl-2-pyrrolidinone (NMP) solvent and the extracts studied by size exclusion chromatography (SEC). The blast furnace carryover dust extracts contained high molecular weight carbonaceous material, of apparent mass corresponding to 10{sup 7}-10{sup 8} u, by polystyrene calibration. In contrast, the feed coke and char prepared in a wire mesh reactor under high temperature conditions did not give any extractable material. Meanwhile, controlled combustion experiments in a high-pressure wire mesh reactor suggest that the extent of combustion of injectant coal in the blast furnace tuyeres and raceways is limited by time of exposure and very low oxygen concentration. It is thus likely that the extractable, soot-like material in the blast furnace dust originated in tars is released by the injectant coal. Our results suggest that the unburned tars were thermally altered during the upward path within the furnace, giving rise to the formation of heavy molecular weight (soot-like) materials.
E-commerce finally finds the coal industry
Energy Technology Data Exchange (ETDEWEB)
Hudson, M.
2000-12-01
In the last few months, new web sites have come online which are not only showcase for coal mining products and equipment but also act as sales platforms. A large set of sites deal with the purchase of coal and other raw materials. Most of them offer 24-hour news updates, a coal library and a reference section to help with financing, insurance and transportation of purchased coal. Another group focuses on the sale of equipment. Short writeups are given of 18 web sites. 1 photo.
Optimizing Transport in Surface Mines, Taking into Account the Quality of Extracted Raw Ore
Directory of Open Access Journals (Sweden)
Marian Šofranko
2012-12-01
Full Text Available This articles concerns problemacy of appropriate separation of transporting mechanisms for mining minerals from individulalteritories. In the following sections of the article a model solution is presented with the use of newly created program for optimizationof transport, taking into account the required quality of extracted raw ore. This process is being done through computing analysisand programming language Borland C++ Builder
DEFF Research Database (Denmark)
Ryberg, Morten W.; Owsianiak, Mikolaj; Laurent, Alexis
2015-01-01
Power generation from high-ash coals is a niche technology for power generation, but coal cleaning is deemed necessary to avoid problems associated with low combustion efficiencies and to minimize environmental burdens associated with emissions of pollutants originating from ash. Here, chemical...... beneficiation of coals using acid and alkali–acid leaching procedures is evaluated as a potential coal cleaning technology employing life cycle assessment (LCA). Taking into account the environmental benefits from firing cleaner coal in pulverized coal power plants and the environmental burden of the cleaning...... itself, it is demonstrated that for a wide range of cleaning procedures and types of coal, chemical cleaning generally performs worse than combustion of the raw coals and physical cleaning using dense medium separation. These findings apply for many relevant impact categories, including climate change...
Directory of Open Access Journals (Sweden)
Wang Lei
2007-12-01
Full Text Available Abstract Forms of selenium in bituminous coal, anthracite, and cokeite (natural coke from Huaibei Coalfield, Anhui, China, have been determined by sequential solvent extraction. The selenium content in bulk samples is 4.0, 2.4, and 2.0 μg/g in bituminous coal, anthracite, and cokeite, respectively. The six forms of selenium determined by six-step solvent extraction are water-leachable, ion-exchangeable, organic matter-associated, carbonate-associated, silicate-associated, and sulfide-associated. The predominant forms of selenium in bituminous coal are organic matter-associated (39.0%, sulfide-associated (21.1%, and silicate bound (31.8%; these three forms account for 92% of the total. The organic matter bound-selenium decrease dramatically from bituminous coal (39.0% to anthracite (11.6% and to cokeite (0%, indicating that organic matter bound selenium is converted to other forms during metamorphism of the coal, most likely sulfide-form. The sulfide-associated form increased remarkably from bituminous coal (21.1% to anthracite (50.4% and cokeite (54.5%, indicating the formation of selenium sulfide, possibly in pyrite during the transformation of bituminous coal to anthracite and cokeite. The silicate-associated selenium in bituminous coal (31.8% is much higher than that in anthracite (16.4% and cokeite (15.8%, indicating that silicate-associated selenium is partly converted to sulfide during metamorphism.
Taddeo, Vito Alessandro; Epifano, Francesco; Fiorito, Serena; Genovese, Salvatore
2016-09-10
In this paper the presence of selected prenylated and unprenylated phenylpropanoids, namely ferulic acid 1, boropinic acid 2, 4'-geranyloxyferulic acid 3, umbelliferone 4, 7-isopentenyloxycoumarin 5, and auraptene 6, have been determined in Italian raw propolis after having been extracted with different methodologies. An aqueous solution of β-cyclodextrin was the best extraction method for ferulic acid 1, treatment with indifferently EtOH or aqueous β-cyclodextrin were the most effective one for umbelliferone 4, boropinic acid 2 gave the best yields either with H2O/β-cyclodextrin or olive oil treatment or in biphasic systems, maceration with biphasic mixtures of aqueous β-cyclodextrin and olive oil was seen to be the most effective procedure for 7-isopentenyloxycoumarin 5, the only method providing significant quantities of 4'-geranyloxyferulic acid 3 was the maceration of raw propolis with olive oil, and finally auraptene 4 was best extracted with absolute EtOH. "Classic" maceration in general performed better than ultrasound-assisted one. Copyright © 2016 Elsevier B.V. All rights reserved.
Aspects of the environmental geology of coal extraction in South Africa
International Nuclear Information System (INIS)
Thamm, A.G.
1996-01-01
Existing areas of regulatory intervention in South Africa, related to coal extraction, are discard and stockpile burning (low level air pollution), acid rock drainage (water pollution) and landscape and mine rehabilitation. These impacts are managed in terms of the Minerals Act (No. 50 of 1991) and its subsequent amendments. Exploration and mining companies (at any scale or size) are required to prepare Environmental Management Programme Reports (EMPR) in terms of existing legislation. The submission and approval of an EMPR results in site-specific legal obligations for which the mining company must make pecuniary provision. Individual coal producers have led the mining industry in the establishment of trusts to fund such rehabilitation. River catchment areas in the Mpumalanga Province and in northern KwaZulu Natal have suffered serious water quality deterioration as a result of polluted water emanating from abandoned coal mines. The relatively small household coal sector has health impacts out of proportion with its size, with the attendant increases in health risk clearly documented. Economic geologists have been concerned with the proving of non-renewable resources and management and production of reserves once mining commences. Mining investment decisions are increasingly influenced by the necessity to rehabilitate mined out areas and manage environmental impact. Understanding potential cost, at the end of the mining project cycle is as significant as understanding the genesis or value of a deposit. Site specific examples of typical South African problems will be presented
Energy Technology Data Exchange (ETDEWEB)
Passi, K.K.; Kumar, C.R.; Prasad, P. [DGMS, Dhanbad (India)
2001-07-01
The scope of this paper has been limited to the use of available machines and techniques for attaining higher and more efficient production in underground coal mines. Under certain conditions of strata and higher degree of gassiness, the longwall method with hydraulic sand stowing is the only appropriate method of work for extraction of thick seam. In Moonidih Jitpur Colliery of M/S IISCO, No. 14 seam, Degree III gassy seam, 9.07 m thick, is extracted in multilift system with hydraulic sand stowing. In general, the bottom lift is extracted by Single Ended Ranging Arm Shearer and the middle and top lift are extracted by conventional method. However, in one of the panels spare road header machine was used as face cutting machine in bottom lift, on an experimental basis. This paper presents a successful case study of extraction of bottom lift coal by the longwall method with hydraulic sand stowing using road header (AM 50) as the face cutting machines. 9 figs.
Possibility of chemical products from coal
Energy Technology Data Exchange (ETDEWEB)
Harris, G A; Sinnett, C E; Swift, H E
1982-01-01
An account of the SRC-II plant, which produces solvent refined coal (SRC), a liquid product. SRC is a raw material with potential as a new source of hydrocarbons. Topics discussed include the possibilities of its use as a petrochemical feedstock; derivatives and the amounts obtained; economic assessments and expected prices. The translator of this article puts forward the view that, due to the difficulty of obtaining the type of coal needed for SRC-II, the best policy for Japanese coal liquefaction is methanol synthesis.
International Nuclear Information System (INIS)
Huang, Shuyuan; Yuan, Dongxing; Lin, Haiying; Sun, Lumin; Lin, Shanshan
2017-01-01
In the current study, fractionation of mercury isotopes during coal combustion and seawater flue gas desulfurization (SFGD) in a coal-fired power plant using a SFGD system was investigated. Fourteen samples were collected from the power plant. The samples were pretreated with a combustion-trapping method and were analyzed with a multi-collector inductively coupled plasma mass spectrometer (MC-ICP-MS). Compared with the raw coal, the bottom ash was enriched with lighter mercury isotopes with δ 202 Hg values ranging from −0.45 to −0.03‰. The fly ash was enriched with lighter mercury isotopes with δ 202 Hg values ranging from −1.49 to −0.73‰ for Chinese coal and from −1.47 to −0.62‰ for Indonesian coal. The δ 202 Hg of fresh seawater and desulfurized seawater was found to be −1.32 and −0.32‰ respectively. These δ 202 Hg values indicated that the desulfurized seawater was enriched with heavier mercury isotopes. Based upon the calculated results obtained from the mass balance equation, it was suggested that the stack emissions were enriched with lighter mercury isotopes. Mass independent fractionation was observed in most of the samples with a Δ 199 Hg/Δ 201 Hg ratio of approximately 0.96. The results help in improving the understanding of mercury isotope fractionation during coal combustion and SFGD, and are also useful in tracing the mercury emissions from coal fired power plants. - Highlights: • Spread of 1.5‰ was observed in δ 202 Hg values of raw coals and coal related samples. • The δ 202 Hg values were more negative in fly ash than those in the raw coal. • The flue gas had a significant Hg fractionation after desulfurization. • The stack emissions were enriched with lighter isotopes compared with the raw coal.
Trends on the international coal markets; Trends auf den internationalen Steinkohlenmaerkten
Energy Technology Data Exchange (ETDEWEB)
Wedig, Martin; Luebke, Roland [Gesamtverband Steinkohle e.V., Herne (Germany)
2011-01-15
Following the worldwide financial and economic crisis the international coal markets are again well on the road to recovery and are currently exhibiting clear growth and boom trends, particularly in the Asian consumption regions. In most OECD countries, however, the recovery process to achieve the status quo at the pre-crisis level is still far from concluded, so that the certain catching-up effect can still be anticipated. Because of the high Asian demand - meanwhile not only in PR China, but also in India - the upward trend in the raw material sector as a whole is intact and the global raw material supercycle is continuing on an increasingly wider scale. The prices of raw materials have risen sharply. This applies essentially to the energy raw materials (e.g. oil and coal), but also to the many metallic raw materials. (orig.)
CSIR Research Space (South Africa)
Jeffrey, JS
2002-04-01
Full Text Available This report describes a literature review that identified geotechnical factors impacting on unplanned secondary coal extraction. These factors are grouped into nine broad classes of factors; namely, stratigraphy, rock /coal engineering properties...
Profit from plant experience in specifying coal conveyors
Energy Technology Data Exchange (ETDEWEB)
Rajter, L C
1985-09-01
Most coal conveyors in operation today were designed to handle raw unwashed coal and are experiencing difficulties when dealing with fine, wet coal which has been cleaned. Conveyor designers should base their designs for new systems on the worst possible materials. Design criteria are discussed in detail and recommendations made for chute liners and radii, skirt system, belt speed, transfer points, belt wipers, weather protection and access. 3 references.
Mineral raw materials for power production in legislation of the Republic of Croatia
International Nuclear Information System (INIS)
Matisa, Z.
1999-01-01
According to the Constitution of the Republic of Croatia, mineral wealth is a public good of legal interest to the Republic of Croatia and enjoys its special protection. The Mining Law establishes that mineral wealth (including mineral resources that are used for power production) is the property of the Republic of Croatia. Among other mineral raw materials, this refers to mineral raw materials that are used for power production: coal, oil, natural gas, radioactive mineral raw materials and geothermal waters. These mineral resources are as almost all other mineral raw materials with the exception of geothermal waters, an unrecoverable natural resource. The right to use that natural resource may be granted only by a concession. The mining legislation provides for exploration and exploitation of mineral raw materials. Exploration of oil and gas is considered to comprise operations and testing with the aim to establish the existence, position and form of oil and natural gas deposits, their quality and quantity, as well as exploitation conditions. Exploitation of oil and natural gas is considered to comprise extraction from deposits, refining and transport, as well as disposal in geological structures. Mineral raw materials used in power production amount to 63% of national total primary energy production, and they cover 33% of total power consumption in the country. Legislation in the Republic of Croatia, which refers to exploration and exploitation of oil and natural gas, allows economic utilization of that unrecoverable natural wealth to run smoothly and in compliance with practices in our European environment. (author)
Rare and Rare-Earth Metals in Coal Processing Waste
Cherkasova, Tatiana; Cherkasova, Elizaveta; Tikhomirova, Anastasia; Bobrovni-kova, Alyona; Goryunova, Irina
2017-11-01
An urgent issue for power plants operating on solid fuels (coal) is the issue of utilization or use of accumulated production waste - ash and slag materials - in the related production. Ash-slag materials are classified as "waste", usually grade 5; tens of millions of tons of them being pro-duced annually in the Kemerovo region, which threatens the ecology of the region. At the same time, ash and slag is a very promising raw material. The use of this material as a base for the final product allows us to signifi-cantly expand the possibilities of using coal. The most widespread is the system of ash and slag involving in construction or as a replacement for sand in road construction, or as an additive to building mixtures. However, there are both industrially valuable and environmentally dangerous ele-ments in ash-slag materials. Ash-slag materials can be considered as inde-pendent ore deposits located on the surface and requiring the costs of their extraction.
Anderson, Eric
2013-01-01
This volume, available in both hardcover and paperback, is an English translation of the fifth edition of the German language text Mineralische und Energie-Rohstoffe. The book provides an extensive overview of natural resources and societal issues associated with extracting raw materials. The comprehensive list of raw materials discussed includes metals, industrial minerals, coal, and hydrocarbons. The book is divided into four parts: (1) “Metalliferous ore deposits,” (2) “Nonmetallic minerals and rocks,” (3) “Practice of economic geology,” and (4) “Fossil energy raw materials—coal, oil, and gas.” These sections are bound by a brief introduction and an extensive list of up-to-date references as well as an index. Each chapter begins with a concise synopsis and concludes with a summary that contains useful suggestions for additional reading. All figures are grayscale images and line drawings; however, several have been grouped together and reproduced as color plates. Also included is a companion website (www.wiley.com/go/pohl/geology) that contains additional resources, such as digital copies of figures, tables, and an expanded index, all available for download in easy-to-use formats.Economic Geology: Principles and Practice: Metals, Minerals, Coal and Hydrocarbons—Introduction to Formation and Sustainable Exploitation of Mineral Deposits. Walter l. Pohl. 2011. Wiley-Blackwell. Pp. 663. ISBN 978-1-4443-3663-4 (paperback).
Identification of organosulfurs and organonitrogens in the extracts of Pocahontas No. 3 Coal
Energy Technology Data Exchange (ETDEWEB)
Jing-Pei Cao; Zhi-Min Zong; Xiao-Yan Zhao; Chang-Cheng Liu; Guang-Feng Liu; Hong Zhang; Chul Wee Lee; Xian-Yong Wei [China University of Mining and Technology, Xuzhou (China). School of Chemical Engineering
2007-07-01
Pocahontas No. 3 coal was extracted with CS{sub 2}, n-hexane, benzene, methanol, acetone and acetone/CS{sub 2} (1:1 vol/vol) mixed solvent sequentially. The resulting six extracts were analyzed with GC and GC/MS. Hexathiane, octathiane, twenty-one organosulfurs (OSs) and twenty-one organonitrogens (ONs) were detected in the extracts. OSs detected in the extracts include ethylmethylsulfane, 1,2-dimethyldisulfane, S-ethyl dipropylcarbamothioate, dimexano and its derivatives, dibenzothiophene, mono- and dimethyldibenzothiophenes, benzonaphthothiophene, mono- and dimethyl benzonaphthothiophenes, among which dimexano and dixanthogen were seldom reported in any sediments. Benzene is effective for extracting aromatic-ring-containing OSs, while OSs without aromatic ring tend to dissolve in methanol. Most of ONs detected in the extracts are acridinone, methylacridinones, carbazole, methylcarbazoles, benzocarbazoles, amines, phenanthridinone and piperidinone. Species and amounts of ONs detected in the extracts were increased along with the increasing of solvent polarity. N and O atoms often coexist in the same compounds. 2 figs., 3 tabs.
Coal on the shovel. Choice for coal is choosing for expensive, scarce and unreliable
International Nuclear Information System (INIS)
2008-01-01
Researchers of Peak oil warn about imminent worldwide coal shortages as of 2025. Countries that fully depend on coal import, such as the Netherlands, run great risks due to strongly rising prices and insecurity of supply. How large is the supply of extractable coal? How long will extraction and export continue undisturbed under increasing demand? What effect will this have on the coal price? The real data on supply, demand, price and export mainly tell a tale of unreliable reserves and high prices according to Greenpeace. [mk] [nl
Directory of Open Access Journals (Sweden)
Tae Gyu Nam
2017-01-01
Full Text Available Buckwheat sprouts have been widely consumed all around world due to their great abundance of bioactive compounds. In this study, the anti-inflammatory effects of flavonoid-rich common buckwheat sprout (CBS and tartary buckwheat sprout (TBS extracts were evaluated in lipopolysaccharide- (LPS- stimulated RAW 264.7 murine macrophages and primary peritoneal macrophages from male BALB/c mice. Based on the reversed-phase HPLC analysis, the major flavonoids in CBS were determined to be C-glycosylflavones (orientin, isoorientin, vitexin, and isovitexin, quercetin-3-O-robinobioside, and rutin, whereas TBS contained only high amounts of rutin. The TBS extract exhibited higher inhibitory activity as assessed by the production of proinflammatory mediators such as nitric oxide and cytokines including tumor necrosis factor-α, interleukin- (IL- 6, and IL-12 in LPS-stimulated RAW 264.7 macrophages than CBS extract. In addition, TBS extract suppressed nuclear factor-kappa B activation by preventing inhibitor kappa B-alpha degradation and mitogen-activated protein kinase phosphorylation in LPS-stimulated RAW 264.7 macrophages. Moreover, the TBS extract markedly reduced LPS-induced cytokine production in peritoneal macrophages. Taken together, these findings suggest that TBS extract can be a potential source of anti-inflammatory agents that may influence macrophage-mediated inflammatory disorders.
Raw-materials mixtures from waste of the coal industry for production of ceramic materials
Energy Technology Data Exchange (ETDEWEB)
Galpern, E I [Scientific-Manufacturing Enterprise ` ` Ceramics` ` , Donetsk (Ukraine); Pashchenko, L V [Inst. of Physical, Organic and Coal Chemistry of NASU, Donetsk (Ukraine)
1998-09-01
The liquidation of waste dumps on the surface of mining enterprises and realization of measures by environment protection of air and aquatic basins are connected to the complex processing of mining mass. The main directions of utilization of mining rocks and coal wastes realized in Ukraine industry are: - filling of mines worked-out area by grouting solutions; - ceramic brick, porous filling materials and binding materials production; - road-making, construction of hydrostructures and industrial objects; - output of concrete items predominantly for using in mining conditions. The peculiarity of wastes using in above-mentioned fields is the possibility of their mass application in quantities commensurable with valumes of their yields. The experience of enterprises work which process mining rocks into building materials by burning method (ceramic brick, porous aggregates of concretes as aggloporite, expanded clay aggregate) has shown that unconstant and, as the rule, exceeding norms content of carbon and sulphur in the rock results to deterioration of products quality and technological factors of production. Unstability of carbon content in raw material makes the burning process hardly operated. Obtained products having residual carbon in the view of coke residue are often characterized by lower physical-mechanical characteristics. (orig./SR)
Directory of Open Access Journals (Sweden)
Valeriu PLESEA
2014-05-01
Full Text Available Besides oil and gas, coal is the most important fossil fuel for energy production. Of the energy mixture of our country, the internal production gas share is 80% of the required annual consumption, of about 14 billion cubic meters, the rest of 20% being insured by importing, by the Russian company Gazprom. The share of coal in the National Power System (NPS is of 24% and is one of the most profitable energy production sources, taking into account the continuous increase of gas price and its dependence on external suppliers. Taking into account the infestation of the atmosphere and global warming as effect of important release of greenhouse gas and carbon dioxide as a result of coal burning for energy production in thermal power plants, there is required to identify new solutions for keeping the environment clean. Such a solution is presented in the study and analysis shown in the paper and is the extraction and capitalization of methane from the coal deposits and the underground spaces remaining free after mine closures. Underground methane extraction is considered even more opportune because, during coal exploitation, large quantities of such combustible gas are released and exhausted into the atmosphere by the degasification and ventilation stations from the surface, representing and important pollution factor for the environment, as greenhouse gas with high global warming potential (high GWP of about 21 times higher than carbon dioxide.
29 CFR 779.357 - May qualify as exempt 13(a)(2) establishments; classification of coal sales.
2010-07-01
... principal raw material, such as sales of coal for the production of coke, coal gas, coal tar, or electricity... production of coke, coal gas, coal tar, or electricity. This is distinguished from sales of coal for use in...; classification of coal sales. 779.357 Section 779.357 Labor Regulations Relating to Labor (Continued) WAGE AND...
DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS
Energy Technology Data Exchange (ETDEWEB)
Elliot B. Kennel; Stephen P. Carpenter; Dady Dadyburjor; Manoj Katakdaunde; Liviu Magean; Peter G. Stansberry; Alfred H. Stiller; John W. Zondlo
2005-06-08
The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. These carbon products include materials used in metals smelting, especially in the aluminum and steel industries, as well as porous carbon structural material referred to as ''carbon foam'' and carbon fibers. During this reporting period, efforts have focused on the development of continuous processes for hydrogenation as well as continuous production of carbon foam and coke.
DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS
Energy Technology Data Exchange (ETDEWEB)
Elliot B. Kennel; Stephen P. Carpenter; Dady Dadyburjor; Manoj Katakdaunde; Liviu Magean; Madhavi Nallani-Chakravartula; Peter G. Stansberry; Alfred H. Stiller; John W. Zondlo
2006-03-27
The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. These carbon products include materials used in metals smelting, especially in the aluminum and steel industries, as well as porous carbon structural material referred to as ''carbon foam'' and carbon fibers. During this reporting period, efforts have focused on the development of continuous processes for hydrogenation as well as continuous production of carbon foam and coke.
Comparison of the composition between coal-liquid naphtha and petroleum gasoline
Energy Technology Data Exchange (ETDEWEB)
Miki, Y.; Sugimoto, Y.; Ono, S.; Machida, M. [National Chemical Laboratory for Industry, Tsukuba (Japan)
1997-08-01
Compositional characterization was performed using a gas chromatography-mass spectrometry-atomic emission detector technique on coal-liquid raw naphtha, coal-liquid refined naphtha, coal-liquid reformate and commercial petroleum gasoline. The chemical composition of these oils are divided into five groups: chain hydrocarbons, monocyclic hydrocarbons, bicyclic hydrocarbons, oxygen-containing compounds and other compounds (containing unidentified compounds). Compared to petroleum gasoline, the coal-liquid raw naphtha contains higher concentrations of straight paraffins, cycloparaffins, cycloolefins, bicycloparaffins and oxygen-containing compounds, and contains lower concentrations of brached paraffins and monocyclic aromatic compounds. Phenols and ketones are the major components of oxygen-containing compounds. The total concentration of paraffins and cycloparaffins increased after refining. The hydrogenation of olefins and the hydrodeoxygenation of oxygen-containing compounds are suggested to proceed during the refining process. The reforming treatment increased the concentrations of branched paraffins and monocyclic aromatic compounds; this suggests that coal-liquid reformat could be used as a major blending substance with petroleum gasoline.
The effect of solvent swelling for the production of ashless coal
Energy Technology Data Exchange (ETDEWEB)
Aylin Kurman; Sultan Giray; Ozgur Sonmez [Cukurova University, Adana (Turkey). Chemistry Department, Art& Science Faculty
2005-07-01
Two Turkish coal (a bituminous and a brown coal) were extracted with NMP-CS2 (1:1 v/v) and NMP-EDA (1:17, v/v) at room conditions and with NMP and NMP/EDA under reflux. To obtain any effect of solvent swelling on extraction yield coals were also extracted at same conditions after swelling with NMP and EDA. The extraction yield was maximum in the NMP-CS2 mixed solvent for higher ranked coal, suggesting a synergistic effect of the system. It was possible to extract over 35 % of sub-bituminous coal by using NMP- CS2. The extraction of same coal with NMP under reflux gave an extraction yield of 33% suggesting the useful effect of solvent swelling and heat during the reflux period. A positive effect of pre-swelling with NMP and EDA on extraction yield and recovery of solid extracts were observed , especially for brown coal sample. Following the extraction, solid extracts were produced with less than 0.12 % in ash content for almost all extraction conditions.
Liu, Jianmin; Wang, Baoyu; Tai, Chao; Wu, Li; Zhao, Han; Guan, Jiadong; Chen, Linyong
2016-01-01
Bioconversion of coal to methane has gained increased attention in recent decades because of its economic and environmental advantages. However, the mechanism of this process is difficult to study in depth, partly because of difficulties associated with the analysis of intermediates generated in coal bioconversion. In this investigation, we report on an effective method to analyze volatile intermediates generated in the bioconversion of coal under strict anaerobic conditions. We conduct in-situ extraction of intermediates using headspace solid-phase micro-extraction followed by detection by gas chromatography-mass spectrometry. Bioconversion simulation equipment was modified and combined with a solid-phase micro-extraction device. In-situ extraction could be achieved by using the combined units, to avoid a breakdown in anaerobic conditions and to maintain the experiment continuity. More than 30 intermediates were identified qualitatively in the conversion process, and the variation in trends of some typical intermediates has been discussed. Volatile organic acids (C2-C7) were chosen for a quantitative study of the intermediates because of their importance during coal bioconversion to methane. Fiber coating, extraction time, and solution acidity were optimized in the solid-phase micro-extraction procedure. The pressure was enhanced during the bioconversion process to investigate the influence of headspace pressure on analyte extraction. The detection limits of the method ranged from 0.0006 to 0.02 mmol/L for the volatile organic acids and the relative standard deviations were between 4.6% and 11.5%. The volatile organic acids (C2-C7) generated in the bioconversion process were 0.01-1.15 mmol/L with a recovery range from 80% to 105%. The developed method is useful for further in-depth research on the bioconversion of coal to methane.
The long term means coal market improvements
Energy Technology Data Exchange (ETDEWEB)
Soras, C.G.; Stodden, J.R.
1988-01-01
Statistical data for the US coal industry in 1987 are presented - coal production, energy consumption, inventories, exports, operating rate, employment, hours worked, wages, electric power output, raw steel production, new orders for blast furnaces and steel mills, and fuel oil prices - and contrasted with the situation a year before. The US economy and trade figures are discussed. It is believed that the coal industry stands to benefit from the changing mix of economic activity but must strive to keep competitive. 1 tab., 1 fig.
Role of complex utilization of mineral raw materials In geological research
Energy Technology Data Exchange (ETDEWEB)
Takacs, P.; Varju, G.
1979-01-01
Presents Hungarian research efforts on ways of utilizing the secondary raw materials alunite, pumice and slate coal from various mines. The slate coal is separated from brown coal and disposed of at spoil banks of brown coal mines, due to its high ash content (up to 56.8% under dry conditions), silicate content up to 58.2% and low calorific value between 1500 and 2780 kcal/kg. The research proposal for utilizing slate coal is directed at partial separation of the mineral and coal content by comminution, peptization and hydrocentrifugal separation. The larger part of the silicate content is held in the colloid suspension, which could be used for conditioning drilling mud or foundry sand. The produced coal concentrate has a reduced ash content and higher calorific value (between 500 and 800 kcal/kg) and could be employed in soil amelioration or combustion. (10 refs.) (In German)
China's coal export and inspection
International Nuclear Information System (INIS)
Xiaodong Li
1993-01-01
With the development of world's business and trade, coal has become a large part of the import and export goods in the international market. The total amount of coal trade has risen a lot. China is rich in coal resources. According to the estimate made by some experts, the reserve which has been explored recently could be exploited hundreds of years. China's output of raw coal has risen a lot during the past forty years. China coal industry has developed rapidly since the 1980s. It is possible for China to become a big coal export country since it has rich resources and increasing output. The paper suggests four steps which must be taken to expand coal exports in China: improve the level of management and administration of coal mines so as to raise the economic benefit; the follow-up production capacity of the present mines must be enhanced rapidly; step up construction of new large-scale mines; and China's coal washing capacity must be improved speedily since the low capacity has seriously influenced the improvement of coal quality. The paper describes the inspection bureaus and companies that have developed to perform inspection of exports in order to guarantee the quality of export coal
Pilot plant for hydrogasification of coal with nuclear heat
International Nuclear Information System (INIS)
Falkenhain, G.; Velling, G.
1976-01-01
In the framework of a research and development programme sponsored by the Ministry of Research and Technology of the Federal Republic of Germany, two process variants for hydrogasification of coal by means of nuclear heat have been developed by the Rheinische Braunkohlenwerke AG, Cologne. For testing these process variants a semi-technical pilot plant for gasification of coal under pressure in a fluidized bed was constructed. The pilot plant, in which the gasification of lignite and hard coal is planned, is designed for a throughput of 100kg carbon per hour corresponding to 400kg raw lignite per hour or 150kg hard coal per hour. The plant should provide data on the influence of the most essential process parameters (pressure, temperature, residence time of gas and coal, type and pre-treatment of feed coal) on the performance of gasification and raw gas composition. Different plant components will also be tested. Since the pilot plant will permit testing of both process variants of hydrogasification, it was designed in such a way that it is possible to vary a great number of process parameters. Thus, for instance, the pressure can be chosen in a range up to 100 bar and pure hydrogen or mixtures of hydrogen, carbon monoxide and steam can be applied as gasification agents. The gasifier is an internally insulated fluidized bed reactor with an inner diameter of 200mm and a height of about 8m, to which an internally insulated cyclone for separation of the entrained fines is attached. The raw gas is then cooled down by direct water scrubbing. (author)
Friedl, R; Moeslinger, T; Kopp, B; Spieckermann, P G
2001-12-01
1. In this study, we investigated the effect of Panax ginseng root aqueous extracts upon inducible nitric oxide synthesis in RAW 264.7 cells. Panax ginseng root extract has been used in the Asian world for centuries as a traditional herb to enhance physical strength and resistance and is becoming more and more popular in Europe and North America. 2. Incubation of murine macrophages (RAW 264.7 cells) with increasing amounts of aqueous extracts of Panax ginseng (0.05 - 0.8 microg microl(-1)) showed a dose dependent stimulation of inducible nitric oxide synthesis. 3. Polysaccharides isolated from Panax ginseng showed strong stimulation of inducible nitric oxide synthesis, whereas a triterpene-enriched fraction from an aqueous extract of Panax ginseng did not show any stimulation. 4. Inducible nitric oxide synthase protein expression was enhanced in a dose dependent manner as revealed by immunoblotting when cells were incubated with increasing amounts of Panax ginseng extract. This was associated with an incline in inducible nitric oxide synthase mRNA-levels as determined by semiquantitative polymerase chain reaction and electromobility shift assay studies indicated enhanced nuclear factor-kappaB DNA binding activity. 5. As nitric oxide plays an important role in immune function, Panax ginseng treatment could modulate several aspects of host defense mechanisms due to stimulation of the inducible nitric oxide synthase.
Combustion and environmental performance of clean coal end products
Energy Technology Data Exchange (ETDEWEB)
Skodras, G.; Sakellaropoulos, G. [Centre for Research and Technology, Hellas, Ptolemaidas-Kozanis, Ptolemaida (Greece). Inst. for Solid Fuel Technolgy and Applications]|[Aristotle Univ. of Thessaloniki, Thessaloniki (Greece). Dept. of Chemical Engineering, Chemical Process Engineering Lab]|[Chemical Process Engineering Research Inst., Thessaloniki (Greece). Lab. of Solid Fuels and Environment; Someus, E. [Thermal Desorption Technology Group (Greece); Grammelis, P.; Amarantos, P.S. [Centre for Research and Technology, Hellas, Ptolemaidas-Kozanis, Ptolemaida (Greece). Inst. for Solid Fuel Technolgy and Applications; Palladas, A.; Basinas, P.; Natas, P.; Prokopidou, M.; Diamantopoulou, I.; Sakellaropoulos, G. [Aristotle Univ. of Thessaloniki, Thessaloniki (Greece). Dept. of Chemical Engineering, Chemical Process Engineering Lab
2006-07-01
Clean and affordable power production is needed in order to achieve sustainable economic development. This paper focused on clean coal technologies in which coal-fired power plants are used in conjunction with large amounts of renewable energy sources to offer a high level of process safety and long term management of all residual operation streams. Thermal Desorption Recycle-Reduce-Reuse Technology (TDT-3R) was described as being a promising solid fuel pretreatment process for clean energy production up to 300 MWe capacities. TDT-3R is based on low temperature carbonisation fuel pre-treatment principles, which produce cleansed anthracite type fuels from coal and other carbonaceous material such as biomass and organic wastes. The combustion efficiency of such clean coals and the environmental performance of the TDT-3R process were investigated in this study via pilot scale tests of clean fuel production. Tests included flue gas emissions monitoring, raw fuel and product characterisation and thermogravimetric tests, polychlorinated dibenzo-p-dioxins and dibenzo-furans, and heavy metals analyses, and toxicity tests. Raw material included coal and biomass, such as willow, straw and demolition wood. The fuels were heated in a rotary kiln operating at 550 degrees C under slightly vacuum conditions. Clean coals were tested either alone or in conjunction with biomass fuels in a pilot scale combustion facility at Dresden, Germany. The clean coal samples were shown to have higher fixed carbon and ash content and lower volatiles compared to the respective raw coal samples. The major advantage of the TDT-3R process is the production of fuels with much lower pollutants content. Low nitrogen, sulphur, chlorine and heavy metal contents result in produced fuels that have excellent environmental performance, allow boiler operation in higher temperatures and overall better efficiency. Moreover, the use of clean fuels reduces deposition problems in the combustion chamber due to the
Characterization of coal blends for effective utilization in thermal power plants
International Nuclear Information System (INIS)
Santhosh Raaj, S.; Arumugam, S.; Muthukrishnan, M.; Krishnamoorthy, S.; Anantharaman, N.
2016-01-01
Highlights: • This work will assist utilities to decide on the choice of coals for blending. • Conventional and advanced analytical techniques were used for characterization. • Fuel ratio, burnout profile, ash chemistry and carbon burnout are key factors. • Basic properties were additive while carbon burnout was non additive for the blends. - Abstract: This paper deals with the characterization of coal blends using various conventional and advanced analytical techniques. There has been an increasing trend in utilizing imported coals for power generation in India and utilities are resorting to blended coal firing for various reasons, both financially as well as technically. Characterization studies were carried out on 2 combinations of Indian and imported coal blends. Conventional characterization such as proximate and ultimate analysis and determination of calorific value were carried out for the raw coals and blends as per ASTM standards. Following this thermal and mineral analysis of the samples were carried out using thermo gravimetric analyzer (TGA), X-ray fluorescence spectrometer (XRF) and computer controlled scanning electron microscope (CCSEM). Combustion experiments were also conducted using drop tube furnace (DTF) to determine the burnout of the raw coals and blends. The selection of technically suitable coal combination for blending, based on these characterization studies, has been detailed.
Meeravali, Noorbasha N; Madhavi, K; Kumar, Sunil Jai
2013-01-30
A simple cloud point extraction method is described for the separation and pre-concentration of thallium from the microwave assisted aqua regia extracts of sediment and coal fly ash samples. The method is based on the formation of extractable species of thallium and its interaction with hydrophobic solubilizing sites of Triton X-114 micelles in the presence of aqua regia and electrolyte NaCl. These interactions of micelles are used for extraction of thallium from a bulk aqueous phase into a small micelles-rich phase. The potential chloride interferences are eliminated effectively, which enabled interference free determination of thallium from aqua regia extracts using continuum source ETAAS. The parameters affecting the extraction process are optimized. Under the optimized conditions, pre-concentration factor and limit of detection are 40 and 0.2 ng g(-1), respectively. The recoveries are in the range of 95-102%. A characteristic mass, 13 pg was obtained. The accuracy of the method is verified by analyzing certified reference materials such as NIST 1633b coal fly ash, NIST 1944 marine sediment and GBW 07312 stream sediments. The results obtained are in good agreement with the certified values and method is also applied to real samples. Copyright © 2012 Elsevier B.V. All rights reserved.
Choi, Hyeon-Son; Im, Suji; Park, Yooheon; Hong, Ki-Bae; Suh, Hyung Joo
2016-01-01
The aim of this study was to investigate the effect of deer bone oil extract (DBOE) on lipopolysaccharide (LPS)-induced inflammatory responses in RAW264.7 cells. DBOE was fractionated by liquid-liquid extraction to obtain two fractions: methanol fraction (DBO-M) and hexane fraction (DBO-H). TLC showed that DBO-M had relatively more hydrophilic lipid complexes, including unsaturated fatty acids, than DBOE and DBO-H. The relative compositions of tetradecenoyl carnitine, α-linoleic acid, and palmitoleic acid increased in the DBO-M fraction by 61, 38, and 32%, respectively, compared with DBOE. The concentration of sugar moieties was 3-fold higher in the DBO-M fraction than DBOE and DBO-H. DBO-M significantly decreased LPS-induced nitric oxide (NO) production in RAW264.7 cells in a dose-dependent manner. This DBO-M-mediated decrease in NO production was due to downregulation of mRNA and protein levels of inducible nitric oxide synthase (iNOS). In addition, mRNA expression of pro-inflammatory mediators, such as cyclooxygenase (COX-2), interleukin (IL)-1β, and IL-12β, was suppressed by DBO-M. Our data showed that DBO-M, which has relatively higher sugar content than DBOE and DBO-H, could play an important role in suppressing inflammatory responses by controlling pro-inflammatory cytokines and mediators.
A Study on the Hydrotreating of Coal Hydroliquefaction Residue and its Kinetics
Directory of Open Access Journals (Sweden)
Jinsheng Gao
2010-09-01
Full Text Available Hydro-conversion of coal hydroliquefaction residue obtained from a 6t/day pilot plant of Shenhua Group in Shanghai was carried out under the hydrotreating condition. The coal hydroliquefaction residue and its product were extracted in sequence with n-hexane, toluene and tetrahydrofuran in a Soxhlet apparatus. The n-hexane soluble fractions increased with the increase of reaction temperature and time. Its amount increased from 14.14% to a maximum of 40.86% under the conditions of 470 °C and 30 min, which meant that moderate extension of coal residence time in the coal hydroliquefaction reactor is beneficial to the increase of oil yield. A 4-lumped kinetic model of coal hydroliquefaction residue hydro-conversion was performed using solubility-based lumped fractions. In the model, the tetrahydrofuran insoluble fractions were classified into two parts: easily reactive part and unreactive part. The kinetic parameters were estimated by a fourth-order Runge-Kutta method and a nonlinear least squares method, and the apparent activation energies were calculated according to the Arrhenius Equation. A large quantity of total catalyst consisting of remained liquefaction catalyst, part of the mineral from raw coal and additive Fe-based catalyst could considerably reduce the apparent activation energy of hydro-conversion for the toluene insoluble/tetrahydrofuran insoluble fractions to 36.79 kJ•mol-1. The calculated values of the model coincided well with the experimental values.
DEFF Research Database (Denmark)
Lindhardt, Bo; Holst, Helle; Christensen, Thomas Højlund
1994-01-01
This study compares three extraction methods for PAHs in coal tar polluted soil: 3-times repeated shaking of the soil with dichloromethane-methanol (1:1), Soxhlet extraction with dichloromethane, and Soxhlet extraction with dichloromethane followed by Soxhlet extraction with methanol....... The extraction efficiencies were determined for ten selected PAHs in triplicate samples of six soils sampled at former gasworks sites. The samples covered a wide range of PAH concentrations, from 0.6 to 397 mg/kg soil. Soxhlet extraction with dichloromethane followed by Soxhlet extraction with methanol...
Coal-peat compositions for co-combustion in local boilers
Directory of Open Access Journals (Sweden)
А. В. Михайлов
2016-08-01
Full Text Available In article results of experiments on creation of coal and peat fuel compositions for burning in solid-fuel boilers are described. The main objective of research consisted in development of combination of coal dust and natural peat without binding additives. The role of peat consists that it increases efficiency of process of granulation, being natural binding. The method of granulation allows to utilize waste of the coal industry. Joint burning of two types of fuel – coal dust and peat reduces emission of sulfur dioxides. The cost of peat raw materials is lower, than artificial binding, applied to briquetting of coal dust. The composition of mix of coal dust and peat varied in the ratio 2:1, 1:1 and 1:2 in volume ratio at humidity of mix before extrusion of 65 %. In the course of preparatory operations of coal raw materials its crushing and sifting through sieve of 24 mesh (0,707 mm was carried out. Procedure of hashing of samples of coal and peat was carried out before receiving homogeneous mixture. After hashing mix was located in piston press for receiving granules. Coal dust and wet peat pass semifixed extrusion on piston press with formation of cylindrical granules with a diameter of 16 mm. After extrusion of granule are dried to operational humidity of 25 %. Coal and peat fuel granules showed sufficient mechanical strength for transportation and power feed in solid-fuel boilers. Burning of coal and peat fuel granules in vitro at temperature of 800 °C does not lead to ashes agglomeration. The conducted preliminary researches showed prospects of utilization of coal waste by granulation method in mix with natural peat.
Initiative hard coal; Initiative Steinkohle
Energy Technology Data Exchange (ETDEWEB)
Leonhardt, J.
2007-08-02
In order to decrease the import dependence of hard coal in the European Union, the author has submitted suggestions to the director of conventional sources of energy (directorate general for energy and transport) of the European community, which found a positive resonance. These suggestions are summarized in an elaboration 'Initiative Hard Coal'. After clarifying the starting situation and defining the target the presupposition for a better use of hard coal deposits as raw material in the European Union are pointed out. On that basis concrete suggestions for measures are made. Apart from the conditions of the deposits it concerns thereby also new mining techniques and mining-economical developments, connected with tasks for the mining-machine industry. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Senmura, Akira
1988-12-01
In the negotiation on raw coal price for 1988, which began at the end of 1987, Australia requested price rise of 4 - 5 dollars for the reason of rise of Australian dollars, conditions of mines, price drop in the past five years, and world supply/demand of coal. Japan insisted to maintain the price of preceding year. The talk ended in a dead lock which could last a long time. Negotiation on the Canadian coal price also encountered difficulties but an agreement was obtained in March as Japan accepted the increased price. After which, Japan and Australia agreed to raise the price by 2.90 dollars and an increase over last year. Producing countries also requested a wide price rise as 7.50 dollars for general coal, making in this area very difficult to progress. Finally, they agreed to raise the price by 6.30 dollars and the electric power utility in Japan responded by importing of U.S. coal, which has a lower heat output but is also cheaper. It depends on Australia for 70% of coal supply but started to diversify the source. 3 tabs.
Radiant-and-plasma technology for coal processing
Directory of Open Access Journals (Sweden)
Vladimir Messerle
2012-12-01
Full Text Available Radiant-and-plasma technology for coal processing is presented in the article. Thermodynamic computation and experiments on plasma processing of bituminous coal preliminary electron-beam activated were fulfilled in comparison with plasma processing of the coal. Positive influence of the preliminary electron-beam activation of coal on synthesis gas yield was found. Experiments were carried out in the plasma gasifier of 100 kW power. As a result of the measurements of material and heat balance of the process gave the following integral indicators: weight-average temperature of 2200-2300 K, and carbon gasification degree of 82,4-83,2%. Synthesis gas yield at thermochemical preparation of raw coal dust for burning was 24,5% and in the case of electron-beam activation of coal synthesis gas yield reached 36,4%, which is 48% higher.
Contents and occurrence of cadmium in the coals from Guizhou province, China.
Song, Dangyu; Wang, Mingshi; Zhang, Junying; Zheng, Chuguang
2008-10-01
Eleven raw coal samples were collected from Liuzhi, Suicheng, Zunyi, Xingren, Xingyi, and Anlong districts in Guizhou Province, Southwest China. The content of cadmium (Cd) in coal was determined using inductively coupled plasma mass-spectrometry (ICP-MS). Cd contents ranged from 0.146 to 2.74 ppm (whole coal basis), with an average of 1.09 ppm. In comparison with the arithmetic means of Cd in Chinese coal (0.25 ppm), this is much higher. In order to find its occurrence in coal, float-sink analysis and a coal flotation test by progressive release were conducted on two raw coal samples. The content of the Cd and ash yield of the flotation products were determined. The organic matter was removed by low-temperature ashing (LTA). X-ray diffraction (XRD) was used to differentiate the main, minor, and trace minerals in the LTA from different flotation subproducts. Quartz, kaolinite, pyrite, and calcite were found to dominate the mineral matters, with a proportion of anatase, muscovite, and illite. Then quantitative analysis of minerals in LTA was conducted using material analysis using diffraction (MAUD) based on the Rietveld refinement method. Results show that Cd has a strong association with kaolinite.
Contents and occurrence of cadmium in the coals from Guizhou Province, China
Energy Technology Data Exchange (ETDEWEB)
Dangyu Song; Mingshi Wang; Junying Zhang; Chuguang Zheng [Henan Polytechnic University, Jiaozuo (China). Institute of Resources and Environment
2008-10-15
Eleven raw coal samples were collected from Liuzhi, Suicheng, Zunyi, Xingren, Xingyi, and Anlong districts in Guizhou Province, Southwest China. The content of cadmium (Cd) in coal was determined using inductively coupled plasma mass-spectrometry (ICP-MS). Cd contents ranged from 0.146 to 2.74 ppm (whole coal basis), with an average of 1.09 ppm. In comparison with the arithmetic means of Cd in Chinese coal (0.25 ppm), this is much higher. In order to find its occurrence in coal, float-sink analysis and a coal flotation test by progressive release were conducted on two raw coal samples. The content of the Cd and ash yield of the flotation products were determined. The organic matter was removed by low-temperature ashing (LTA). X-ray diffraction (XRD) was used to differentiate the main, minor, and trace minerals in the LTA from different flotation subproducts. Quartz, kaolinite, pyrite, and calcite were found to dominate the mineral matters, with a proportion of anatase, muscovite, and illite. Then quantitative analysis of minerals in LTA was conducted using material analysis using diffraction (MAUD) based on the Rietveld refinement method. Results show that Cd has a strong association with kaolinite.
Efficiency of Low-Profile External Dumping at Open Pit Coal Mining in Kemerovo Region
Selyukov, Alexey; Ermolaev, Vyacheslav; Kostinez, Irina
2017-11-01
Kemerovo region is one of the largest industrial regions of Russia, with a raw material specialization. The rapid growth of the coal industry in recent years has been greatly facilitated by the expansion and development of open pit mining for coal seams extraction, accompanied by an increase in the volumes of overburden and the height of the dumps. There are about 400 objects in the Russian Federation Government Register of Waste Disposal Facilities 80% of which are dumps. Approaches both to external dumping and to the technical stage of reclamation currently contribute to the growth of geomorphic system's instability. Thus, it is proposed to slightly change the approaches to external dumping: the essence consists in the formation of an external dump of overburden, which in future would represent a favorable landscape unit of a flat surface relief used for subsequent differently directed purposes.
Rare and Rare-Earth Metals in Coal Processing Waste
Directory of Open Access Journals (Sweden)
Cherkasova Tatiana
2017-01-01
Full Text Available An urgent issue for power plants operating on solid fuels (coal is the issue of utilization or use of accumulated production waste - ash and slag materials - in the related production. Ash-slag materials are classified as “waste”, usually grade 5; tens of millions of tons of them being pro-duced annually in the Kemerovo region, which threatens the ecology of the region. At the same time, ash and slag is a very promising raw material. The use of this material as a base for the final product allows us to signifi-cantly expand the possibilities of using coal. The most widespread is the system of ash and slag involving in construction or as a replacement for sand in road construction, or as an additive to building mixtures. However, there are both industrially valuable and environmentally dangerous ele-ments in ash-slag materials. Ash-slag materials can be considered as inde-pendent ore deposits located on the surface and requiring the costs of their extraction.
Directory of Open Access Journals (Sweden)
Shendrik, T.G.
2015-11-01
Full Text Available The article presents short historical review and innovation developments of Coal Chemistry Department of L.M. Litvinenko Institute, NAS of Ukraine connected with coal mine exploitation problems, search for decisions toward prevention of spontaneous combustion, dust control in mines, establishing structural chemical features of coal with different genesis and stages of metamorphism with the aim to develop new methods of their modification and rational use. The methods of obtaining inexpensive sorbents from Ukrainian raw materials (including carbon containing waste are proposed. The problems of modern coal chemistry science in IPOCC of NAS of Ukraine are outlined.
Interaction and the structures of coal
Opaprakasit, Pakorn
The origin of a decrease in the amount of soluble material from coal upon a reflux treatment has been investigated in an attempt to obtain insight into the nature of the interaction in the macromolecular network structure of coal. This decrease in the extractable material is a result of an increase in the amount of physical cross-links associated with secondary interactions. The alternate possibility of covalent cross-link formation by ether linkage was found to be unlikely because the coal hydroxyl content remains unchanged upon heat treatment. The functional groups responsible for forming these physical cross-links and their contents vary from coal to coal with coal rank. Carboxylate/cation complexes, similar to those found in ionomers, dominate in low rank coal. In high rank coal, the clusters involving pi-cation interactions were observed. Both mechanisms seem to play a role in mid rank coals. These physical cross-links are responsible for a lowering of the extraction yield of coal, but are disrupted by a treatment with acid solution, resulting in an increase in the extraction yield. As a consequence, the cross-links in coal structure should be classified into two types; a "permanent" covalent cross-link, which break under extreme conditions such as chemical reaction and pyrolysis, and "reversible" cross-links, largely associated with ionomer-like structure and pi-cation interactions. The interaction between a "magic" solvent of N-methylpyrollidone and carbon disulfide (NMP/CS2) and its role in the unusual extractability enhancement of Upper Freeport coal has also been investigated. The results strongly suggest that NMP/CS2 mixed solvents form complexes with cations. These mixed solvents are capable of forming a solid complex with cations from NaOH and some simple salts, such as NaCl and LiCl. Given that Upper Freeport coal contains a large amount of mineral matter, it is not surprising that these types of complexes could be formed in the present of the mixed
Energy Technology Data Exchange (ETDEWEB)
Kikuchi, T.; Hayasaka, K.; Takanohashi, T.; Iino, M. [Tohoku University, Sendai (Japan). Institute for Chemical Reaction Science
1996-10-28
The behavior and properties of associated bodies were studied through measurement of surface tension considering acetone-soluble fraction relatively light among various solvent extracts of coal. In experiment, the acetone-soluble fraction was extracted from the substances extracted from Upper Freeport coal as standard specimen using the mixed solvent of carbon disulfide (CS2) and N-methyl-2-pyrrolidinone (NMP), and it was dissolved into NMP after drying. Surface tension was measured by Wilhelmy method. The experimental results are as follows. Equilibrium surface tension is equal to the surface tension of pure solvent in a low concentration range of solution, and decreases with an increase in concentration approaching a fixed value at 0 in log concentration, nearly showing an S curve. Adsorption of species with non-polar aromatic ring of the acetone-soluble fraction on a solution surface probably decreases surface tension. Change with time in surface tension is observed which suggests fast initial reaction and slow subsequent reaction. 4 figs.
A study on the hydrotreating of coal hydro liquefaction residue and its kinetics
Energy Technology Data Exchange (ETDEWEB)
Huang, J.; Lu, X.; Zhang, D.; Gao, J. [Department of Chemical Engineering for Energy Resources, East China University of Science and Technology, Shanghai (China)
2010-09-15
Hydro-conversion of coal hydro liquefaction residue obtained from a 6 t/day pilot plant of Shenhua Group in Shanghai was carried out under the hydrotreating condition. The coal hydro liquefaction residue and its product were extracted in sequence with n-hexane, toluene and tetrahydrofuran in a Soxhlet apparatus. The n-hexane soluble fractions increased with the increase of reaction temperature and time. Its amount increased from 14.14% to a maximum of 40.86% under the conditions of 470 {sup o}C and 30 min, which meant that moderate extension of coal residence time in the coal hydro liquefaction reactor is beneficial to the increase of oil yield. A 4-lumped kinetic model of coal hydro liquefaction residue hydro-conversion was performed using solubility-based lumped fractions. In the model, the tetrahydrofuran insoluble fractions were classified into two parts: easily reactive part and unreactive part. The kinetic parameters were estimated by a fourth-order Runge-Kutta method and a nonlinear least squares method, and the apparent activation energies were calculated according to the Arrhenius Equation. A large quantity of total catalyst consisting of remained liquefaction catalyst, part of the mineral from raw coal and additive Fe-based catalyst could considerably reduce the apparent activation energy of hydro-conversion for the toluene insoluble/tetrahydrofuran insoluble fractions to 36.79 kJ-mol{sup -1}. The calculated values of the model coincided well with the experimental values. (authors)
Coal Moisture Estimation in Power Plant Mills
DEFF Research Database (Denmark)
Andersen, Palle; Bendtsen, Jan Dimon; Pedersen, Tom S.
2009-01-01
Knowledge of moisture content in raw coal feed to a power plant coal mill is of importance for efficient operation of the mill. The moisture is commonly measured approximately once a day using offline chemical analysis methods; however, it would be advantageous for the dynamic operation...... of the plant if an on-line estimate were available. In this paper we such propose an on-line estimator (an extended Kalman filter) that uses only existing measurements. The scheme is tested on actual coal mill data collected during a one-month operating period, and it is found that the daily measured moisture...
Alkaloid-derived molecules in low rank Argonne premium coals.
Energy Technology Data Exchange (ETDEWEB)
Winans, R. E.; Tomczyk, N. A.; Hunt, J. E.
2000-11-30
Molecules that are probably derived from alkaloids have been found in the extracts of the subbituminous and lignite Argonne Premium Coals. High resolution mass spectrometry (HRMS) and liquid chromatography mass spectrometry (LCMS) have been used to characterize pyridine and supercritical extracts. The supercritical extraction used an approach that has been successful for extracting alkaloids from natural products. The first indication that there might be these natural products in coals was the large number of molecules found containing multiple nitrogen and oxygen heteroatoms. These molecules are much less abundant in bituminous coals and absent in the higher rank coals.
Energies and raw materials. The energy situation
International Nuclear Information System (INIS)
1997-09-01
Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in September 1997: primary energy total consumption has increased (mobile year) of 1.1%, at the same rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 5.9%), slight increase for petroleum products (+ 0.8%), strong increase for gas (+ 3.2%) and moderate increase for electricity (+ 1.7%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a record energy cost level with + 30% on one year, reaching 89.2 billions Francs, to be compared to 68.5 in September 1996
Energy Technology Data Exchange (ETDEWEB)
Ji-Xian Jia; Zhi-Min Zong; Xin Jin; Chan-Min Liu; Hong Zhang; Yan Li; Bin Huang; Xian-Yong Wei [China University of Mining and Technology, Xuzhou (China). School of Chemical Engineering
2007-07-01
Hami and Lingwu coals were extracted with a CS{sub 2}/NMP mixed solvent (1:1 by vol) under ultrasonic irradiation at room temperature. After removing most of CS{sub 2} and NMP by distillation under ambient and reduced pressures, respectively, from the extraction solution, the extract was extracted with petroleum ether (PE) in a Soxhlet extractor. Two layers appeared after concentrating the PE-extractable solution. GC/MS analysis shows that the upper layer mainly consists of normal and branched alkanes along with cyclanes, whereas main components in the lower layer are non-substituted and substituted arenes along with heteroatom-containing organic compounds. 15 refs., 2 figs., 1 tab.
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Directory of Open Access Journals (Sweden)
Edith Burbano
2006-05-01
Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses
Open cast blasting of coal in Australia; Goshu rotenbori tanko kengakuki
Energy Technology Data Exchange (ETDEWEB)
Hashizume, K. [Nippon Kayaku Co. Ltd., Tokyo (Japan)
1997-06-30
Introduced in this report are blastings performed for surface coal mining in the southeastern part of Australia. The Liddell coal mine began mining in 1990. This mine enjoys an annual raw coal yield of 2-million ton, removing approximately 11-million m{sup 3} of rocks consuming 5000 ton of anfo and emulsion explosives. The explosives are carried by a pump truck to the site where mixing is carried out, and non-electrical primers are used for detonation. The other mine described here is the Camberwell mine that yields 3.5-million ton of raw coal annually. For each blasting, 100-200 ton of explosive is consumed. A pump truck reciprocates between the material plant near the mine and the location of blasting, and charges the explosive directly. One of the anfo, emulsion, and heavy-anfo explosives is chosen, dependent upon conditions such as rock hardness. Also mentioned in this report are general blasting specifications relating to blasting at these two mines
Group separation of coal components and new ideas of coal utilization as petroleum
Energy Technology Data Exchange (ETDEWEB)
Zhi-hong Qin; Cui-li Hou; Juan Chen; Li-ying Zhang; Jie-qiong Ma [China University of Mining & Technology, Xuzhou (China). School of Chemical Engineering and Technology
2009-09-15
Four different groups of components were separated from coal under mild conditions of extraction and stripping process. Within these groups, and with pre-separation, individual utilization of all coal components can be realized, similar to petroleum components and enhance the inherent value and utilization value of coal, as well as increase environmental benefits. The characteristics of each component were analyzed with measurements by FTIR, GC/MS, TEM and the establishment of caking properties. The results show that coal can be separated into residues, ultra-pure coal, asphaltene components and light components by adding solvents for stripping into the CS{sub 2}/NMP mixed extraction solution. Those four groups of components present great differences in the presence of carbon and hydrogen elements, in the structure of functional groups, in their macroscopic structure and micro-morphology and caking properties. Every component possesses its own inherent values and approaches. A new idea of coal processes and utilization, similar to the use of petroleum is proposed. 11 refs., 6 figs., 6 tabs.
International Nuclear Information System (INIS)
Buchanan, D.J.; Jones, T.F.
1992-01-01
Perceptions of quality have changed over the years. The attributes of a certain coal (its rank, slagging propensity, ash content etc) are traditionally referred to as its quality. However, the subject of this paper is quality in a much wider sense: quality as fitness for purpose: and all that such a wide definition entails. British Standard BS 5750 (ISO 9000) Quality Systems defines a systems approach to quality, and includes both the supplier of raw materials and the final customer within this boundary. Coal preparation starts at the production face. The greater the proportion of dirt in run-of-mine product the greater the challenge in satisfying the customer's needs. Significant advances have been made in minimizing mined dirt. For example, the sue of vertical steering on longwall faces improves productivity and quality. Unfortunately modern mining methods produce large quantities of fines, despite efforts to reduce them at the point of production and during transportation to the surface. Coal preparation also produces further fines. It has been estimated that fine coal costs 2.5 times as much to clean as large coal, and the costs of handing wet fine coal product will inflate this estimate. Handling considerations rightly concern our customers and are part of the wider meaning of quality. In this paper the authors address some novel solutions to the challenge posed by fines
Unconventional Coal in Wyoming: IGCC and Gasification of Direct Coal Liquefaction Residue
Schaffers, William Clemens
Two unconventional uses for Wyoming Powder River Basin coal were investigated in this study. The first was the use of coal fired integrated gasification combined cycle (IGCC) plants to generate electricity. Twenty-eight different scenarios were modeled using AspenPlusRTM software. These included slurry, mechanical and dried fed gasifiers; Wyodak and Green River coals, 0%, 70%, and 90% CO2 capture; and conventional evaporative vs air cooling. All of the models were constructed on a feed basis of 6,900 tons of coal per day on an "as received basis". The AspenPlus RTM results were then used to create economic models using Microsoft RTM Excel for each configuration. These models assumed a 3 year construction period and a 30 year plant life. Results for capital and operating costs, yearly income, and internal rates of return (IRR) were compared. In addition, the scenarios were evaluated to compare electricity sales prices required to obtain a 12% IRR and to determine the effects of a carbon emissions tax on the sales price. The second part of the study investigated the gasification potential of residue remaining from solvent extraction or liquefaction of Powder River Basin Coal. Coal samples from the Decker mine on the Wyoming-Montana border were extracted with tetralin at a temperature of 360°C and pressure of 250 psi. Residue from the extraction was gasified with CO2 or steam at 833°C, 900°C and 975°C at pressures of 0.1 and 0.4 MPa. Product gases were analyzed with a mass spectrometer. Results were used to determine activation energies, reaction order, reaction rates and diffusion effects. Surface area and electron microscopic analyses were also performed on char produced from the solvent extraction residue.
A brief petrographic review on Nigerian coal resources
International Nuclear Information System (INIS)
Obaje, N. G.; Abaa, S. I.; Najime, T.; Suh, C. E.
2000-01-01
The coal resources of Nigeria are located mainly within the Benue Trough. In the lower Benue, subbituminous coals occur within the Maastrichtian Mamu Formation. High - volatile bituminous coals are found within the Turonian - Santonian Awgu Formation in the middle Benue while the upper Benue contains lignites and sub-bituminous coals in the Maastrichtian Gombe Sandstone Formation. Maceral analyses show that himinite dominates in the petrographic composition of the lower and upper Benue Trough coals with vitrinite reflectance values ranging from 0.30 to 0.63% Rm. In coals from the middle Benue, vitrinite macerals predominate and Rm values range from 0.74 to 1.25%. The present review suggests that the sub-bituminous coals in the lower and upper Benue are optimum for combustion and sub-optimum for liquefaction; while the high-volatile bituminous coals in the middle Benue, apart form being optimum for liquefaction, are the most suitable as raw material for coke making (carbonization) in steel manufacture
Method of gamma transmission analysis for controlling the hydraulic transport of raw coal
International Nuclear Information System (INIS)
Pepelnik, R.; Boessow, E.; Fanger, H.U.
1978-01-01
The capacity of the methods for measuring gamma absorption developed at GKSS to be used for the analysis of conweyer flows of water/coal/refuse mixtures has been studied. As only the absorption properties of the refuse are essentially different from those of water the refuce is detected with higher accuracy than the coal. In this way the sensitivity of the gamma transmission analysis method agrees with the fact that in coal mining the critical mining parameters are influenced by refuse. The results of the investigations indicate that for measuring times of about 10 sec, accounting for realisitic variations of the chemism of the refuse, the volume shares can be determined with an accuracy of about +- 4.7 V/O of coal and about +- . 5 V/O of refuse. The measuring arrangement for the drift velocity is capable to record also the size and the number of the refuse lumps. The methods described therefore are well suited for controlling an optimal conveying operation. (orig.) [de
Analysis of hard coal quality for narrow size fraction under 20 mm
Niedoba, Tomasz; Pięta, Paulina
2018-01-01
The paper presents the results of an analysis of hard coal quality diversion in narrow size fraction by using taxonomic methods. Raw material samples were collected in selected mines of Upper Silesian Industrial Region and they were classified according to the Polish classification as types 31, 34.2 and 35. Then, each size fraction was characterized in terms of the following properties: density, ash content, calorific content, volatile content, total sulfur content and analytical moisture. As a result of the analysis it can be stated that the best quality in the entire range of the tested size fractions was the 34.2 coking coal type. At the same time, in terms of price parameters, high quality of raw material characterised the following size fractions: 0-6.3 mm of 31 energetic coal type and 0-3.15 mm of 35 coking coal type. The methods of grouping (Ward's method) and agglomeration (k-means method) have shown that the size fraction below 10 mm was characterized by higher quality in all the analyzed hard coal types. However, the selected taxonomic methods do not make it possible to identify individual size fraction or hard coal types based on chosen parameters.
Application of the coal-mining waste in building ceramics production
Directory of Open Access Journals (Sweden)
Vaysman Yakov Iosifovich
Full Text Available In the process of construction ceramics production a substantial quantity of non-renewable natural resources - clays - are used. One of the ways of science development in building materials production is investigation of the possibility of regular materials production using technogenic waste. Application of coal-mining waste (technogenic raw material in charge composition for production of ceramic products provides rational use of fuel, contributes to implementation of resource saving technologies on construction materials production enterprises. Though science development on revealing new raw material sources should be conducted with account for safety, reliability, technical, ecological and economical sides of the problem, which is especially current. The article deals with the problem of coal-mining waste usage in building ceramics production instead of fresh primary component (clay, fluxes, thinning agents and combustible additives. The interdependence between the density and shrinkage of the ceramic products and the amount and quality of coal-mining waste in its composition was established. The optimal proportion of coal-mining waste and clay in building ceramics production was estimated.
DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS
Energy Technology Data Exchange (ETDEWEB)
Elliot B. Kennel; Quentin C. Berg; Stephen P. Carpenter; Dady Dadyburjor; Jason C. Hissam; Manoj Katakdaunde; Liviu Magean; Abha Saddawi; Alfred H. Stiller; John W. Zondlo
2006-03-07
The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. The largest applications are those which support metals smelting, such as anodes for aluminum smelting and electrodes for arc furnaces. Other carbon products include materials used in creating fuels for the Direct Carbon Fuel Cell, metals smelting, especially in the aluminum and steel industries, as well as porous carbon structural material referred to as ''carbon foam'' and carbon fibers. During this reporting period, efforts have focused on the development of carbon electrodes for Direct Carbon Fuel Cells (DCFC), and on carbon foam composites used in ballistic armor, as well as the hydrotreatment of solvents used in the basic solvent extraction process. A major goal is the production of 1500 pounds of binder pitch, corresponding to about 3000 pounds of hydrotreated solvent.
Combustion characteristics of intensively cleaned coal fractions. Effect of mineral matter
Energy Technology Data Exchange (ETDEWEB)
Rubiera, F.; Arenillas, A.; Fuente, E.; Pis, J.J. [Inst. Nacional de Carbon, Oviedo (Spain); Ivatt, S. [ETSU, Harwell, Didcot (United Kingdom)
1997-12-31
The purpose of this work has been to assess the effect that intensive coal cleaning exerts on the combustion behaviour of different density-separated coal fractions. Samples with ash contents varying from 39% for the raw coal, to 2% for the cleanest fraction were obtained after density separation. Temperature-programmed combustion and isothermal gasification in air were used to measure the reactivities of the parent coal and the cleaned fractions. Coal and char reactivities increased with increasing ash content of the samples. Thermal analysis-mass spectrometry of the low-temperature ashes was also carried out in order to study the reactions of coal minerals under combustion conditions. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Rao, P.D.
1986-09-01
This final report is the result of a study initiated in 1976 to obtain washability data for Alaskan coals, to supplement the efforts of the US Department of Energy in their ongoing studies on washability of US coals. Washability characteristics were determined for fifty coal samples from the Northern Alaska, Chicago Creek, Unalakleet, Nenana, Matanuska, Beluga, Yentna and Herendeen Bay coal fields. The raw coal was crushed to 1-1/2 inches, 3/8 inch, 14 mesh and 65 mesh top sizes, and float-sink separations were made at 1.30, 1.40 and 1.60 specific gravities. A limited number of samples were also crushed to 200 and 325 mesh sizes prior to float-sink testing. Samples crushed to 65 mesh top size were also separated at 1.60 specific gravity and the float and sink products were characterized for proximate and ultimate analyses, ash composition and ash fusibility. 72 refs., 79 figs., 57 tabs.
International Nuclear Information System (INIS)
Barnert, H.
1986-01-01
Conversion of coal into liquid fuels or into coal gas is considered and the use of high temperature nuclear reactors whose waste heat can be used for remote (district) heating mentioned. The use of high temperature reactors as energy source for coal gasification is also examined and, finally, the extraction of heat from combined coal, steel and high temperature nuclear reactors is suggested. (G.M.E.)
Directory of Open Access Journals (Sweden)
Sida Tian
2016-06-01
Full Text Available To estimate the contribution of clay minerals in light coal fractions to ash deposition in furnaces, we investigated their distribution and thermal reaction products. The light fractions of two Chinese coals were prepared using a 1.5 g·cm−3 ZnCl2 solution as a density separation medium and were burned in a drop-tube furnace (DTF. The mineral matter in each of the light coal fractions was compared to that of the relevant raw coal. The DTF ash from light coal fractions was analysed using hydrochloric acid separation. The acid-soluble aluminium fractions of DTF ash samples were used to determine changes in the amorphous aluminosilicate products with increasing combustion temperature. The results show that the clay mineral contents in the mineral matter of both light coal fractions were higher than those in the respective raw coals. For the coal with a high ash melting point, clay minerals in the light coal fraction thermally transformed more dehydroxylation products compared with those in the raw coal, possibly contributing to solid-state reactions of ash particles. For the coal with a low ash melting point, clay minerals in the light coal fraction produced more easily-slagging material compared with those in the raw coal, playing an important role in the occurrence of slagging. Additionally, ferrous oxide often produces low-melting substances in coal ash. Due to the similarities of zinc oxide and ferrous oxide in silicate reactions, we also investigated the interactions of clay minerals in light coal fractions with zinc oxide introduced by a zinc chloride solution. The extraneous zinc oxide could react, to a small extent, with clay minerals in the coal during DTF combustion.
Efficiency of Low-Profile External Dumping at Open Pit Coal Mining in Kemerovo Region
Directory of Open Access Journals (Sweden)
Selyukov Alexey
2017-01-01
Full Text Available Kemerovo region is one of the largest industrial regions of Russia, with a raw material specialization. The rapid growth of the coal industry in recent years has been greatly facilitated by the expansion and development of open pit mining for coal seams extraction, accompanied by an increase in the volumes of overburden and the height of the dumps. There are about 400 objects in the Russian Federation Government Register of Waste Disposal Facilities 80% of which are dumps. Approaches both to external dumping and to the technical stage of reclamation currently contribute to the growth of geomorphic system's instability. Thus, it is proposed to slightly change the approaches to external dumping: the essence consists in the formation of an external dump of overburden, which in future would represent a favorable landscape unit of a flat surface relief used for subsequent differently directed purposes.
Possibilities of using pulverized non coking coals in ironmaking
Energy Technology Data Exchange (ETDEWEB)
Wijk, Olle; Mathiesen, Mihkel; Eketorp, Sven
1977-08-01
The use of pulverized coal in iron making suggests solutions to the mounting problems created by the increasing scarcity of coking coals, and other fossil fuels such as oil and natural gas. The unavailability of coke can be met with two principally different measures. Blast furnace coke rates can be decreased by substituting injected pulverized coal or other carbon containing fuels for part of the coke burden, and the coke itself may be substituted by formed coke. A more radical solution is to abandon the blast furnace process, and instead produce the raw iron in processes not requiring coke. Two such processes are discussed in the paper, the Inred process, developed by Boliden Kemi AB, Sweden, and the smelting reduction process by means of injection, currently being developed at the Royal Institute of Technology in Stockholm. Both processes have potential advantages over the coke oven/sintering plant/blast furnace-complex especially concerning energy requirements and structure, but also in economical terms. The injection process seems to present a further advantage in the possibility of gasifying coal in the process, thus yielding a synthesis gas for methanol production in addition to the raw iron.
Strategic raw materials. Risk management
International Nuclear Information System (INIS)
Bertau, Martin; Matschullat, Joerg; Kausch, Peter
2014-01-01
This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [de
Coal cleaning: A viable strategy for reduced carbon emissions and improved environment in China?
Glomsrød, Solveig; Taoyuan, Wei
2003-01-01
Abstract: China is a dominant energy consumer in a global context and current energy forecasts emphasise that China’s future energy consumption also will rely heavily on coal. The coal use is the major source of the greenhouse gas CO2 and particles causing serious health damage. This paper looks into the question if coal washing might work as low cost strategy for both CO2 and particle emission reductions. Coal washing removes dirt and rock from raw coal, resulting in a coal pr...
Investigation on pyrolysis of some organic raw materials
Directory of Open Access Journals (Sweden)
Purevsuren B
2017-02-01
Full Text Available We have been working on pyrolysis of some organic raw materials including different rank coals, oil shale, wood waste, animal bone, cedar shell, polypropylene waste, milk casein and characterization of obtained hard residue, tar and pyrolytic water and gas after pyrolysis. The technical characteristics of these organic raw materials have been determined and the thermal stability characteristics such as thermal stability indices (T5% and T25% determined by using thermogravimetric analysis. The pyrolysis experiments were performed at different heating temperatures and the yields of hard residue, tar, pyrolysis water and gaseous products were determined and discussed. The main technical characteristics of hard residue of organic raw materials after pyrolysis have been determined and the adsorption ability of pyrolysis hard residue and its activated carbon of organic raw materials also determined. The pyrolysis tars of organic raw materials were distilled in air condition and determined the yields of obtained light, middle and heavy fractions and bitumen like residue with different boiling temperature. This is the first time to investigate the curing ability of pyrolysis tars of organic raw materials for epoxy resin and the results of these experiments showed that only tar of milk casein has the highest (95.0%, tar of animal bone has certain (18.70% and tars of all other organic raw materials have no curing ability for epoxy resin.
Energies and raw materials. The energy situation
International Nuclear Information System (INIS)
1997-11-01
Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in November 1997: primary energy total consumption has increased (mobile year) of 0.6%, at a slightly inferior rate than the rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 9.3%), slight increase for petroleum products (+ 1.2%), markedly slowing down increase for gas (+ 1.4%) and moderate increase for electricity (+ 1.3%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a maintained high energy cost level with + 14% on one year, reaching 86.8 billions Francs, to be compared to 76.1 in November 1996
Influence of the hydrothermal dewatering on the combustion characteristics of Chinese low-rank coals
International Nuclear Information System (INIS)
Ge, Lichao; Zhang, Yanwei; Xu, Chang; Wang, Zhihua; Zhou, Junhu; Cen, Kefa
2015-01-01
This study investigates the influence of hydrothermal dewatering performed at different temperatures on the combustion characteristics of Chinese low-rank coals with different coalification maturities. It was found that the upgrading process significantly decreased the inherent moisture and oxygen content, increased the calorific value and fixed carbon content, and promoted the damage of the hydrophilic oxygen functional groups. The results of oxygen/carbon atomic ratio indicated that the upgrading process converted the low-rank coals near to high-rank coals which can also be gained using the Fourier transform infrared spectroscopy. The thermogravimetric analysis showed that the combustion processes of upgraded coals were delayed toward the high temperature region, and the upgraded coals had higher ignition and burnout temperature. On the other hand, based on the higher average combustion rate and comprehensive combustion parameter, the upgraded coals performed better compared with raw brown coals and the Da Tong bituminous coal. In ignition segment, the activation energy increased after treatment but decreased in the combustion stage. The changes in coal compositions, microstructure, rank, and combustion characteristics were more notable as the temperature in hydrothermal dewatering increased from 250 to 300 °C or coals of lower ranks were used. - Highlights: • Typical Chinese lignites with various ranks are upgraded by hydrothermal dewatering. • Upgraded coals exhibit chemical compositions comparable with that of bituminous coal. • FTIR show the change of microstructure and improvement in coal rank after upgrading. • Upgraded coals exhibit difficulty in ignition but combust easily. • More evident effects are obtained for raw brown coal with relative lower rank.
Wang, R.; Liu, Gaisheng; Zhang, Jiahua; Chou, C.-L.; Liu, J.
2010-01-01
The abundances of 16 polycyclic aromatic hydrocarbons (PAHs) on the priority list of the United States Environmental Protection Agency (U.S. EPA) have been determined in 14 Chinese and American coals. The ranks of the samples range from lignite, bituminous coal, anthracite, to natural coke. Soxhlet extraction was conducted on each coal for 48 h. The extract was analyzed on a gas chromatograph-mass spectrometer (GC-MS). The results show that the total PAH content ranged from 0.31 to 57.6 ??g/g of coal (on a dry basis). It varied with coal rank and is highest in the maturity range of bituminous coal rank. High-molecular-weight (HMW) PAHs are predominant in low-rank coals, but low-molecular-weight (LMW) PAHs are predominant in high-rank coals. The low-sulfur coals have a higher PAH content than high-sulfur coals. It may be explained by an increasing connection between disulfide bonds and PAHs in high-sulfur coal. In addition, it leads us to conclude that the PAH content of coals may be related to the depositional environment. ?? 2010 American Chemical Society.
Equations describing contamination of run of mine coal with dirt in the Upper Silesian Coalfield
Energy Technology Data Exchange (ETDEWEB)
Winiewski, J J
1977-12-01
Statistical analysis proved that contamination with dirt of run of mine coal from seams in the series 200 to 600 of the Upper Silesian Coalfield depends on the average ash content of a given raw coal. A regression equation is deduced for coarse and fine sizes of each coal. These equations can be used to predict the degree of contamination of run of mine coal to an accuracy sufficient for coal preparation purposes.
Coal combustion products in Europe valuable raw materials for the construction industry
Energy Technology Data Exchange (ETDEWEB)
Berg, W. vom; Feuerborn, H.J. [European Coal Combustion Products Association e.V., Essen (Germany)
2005-07-01
Coal combustion products (CCPs) are formed with the production of electricity in coal-fired power plants. The production of these CCPs has been increased by the years due to legal requirements for flue gas cleaning. The utilisation of CCPS is well is established in some European countries, based on long term experience and technical as well as environmental benefits. As CCPs are defined as waste materials by existing legislation the power industry has to handle the stigma put on the products and hamper the beneficial use. (orig.)
International Nuclear Information System (INIS)
Kniess, C.T.; Prates, P.B.; Brys, M.; Martins, G.J.; Riella, H.G.; Bernardin, A.
2011-01-01
The physical, chemical and mineralogical properties of mineral coal bottom ash derived from thermoelectric power plants are compatible with various raw materials used in ceramic industries, which indicates a possibility of partial or fully substitution of raw materials by this residue. This work intends to obtain and characterize ceramic products with additions of different percentages of bottom ash coal. For this, was used a commercial ceramic body (CI) made by an industry in the state of Santa Catarina. The formulations of the ceramics products were obtained by the mixture design (planning network Simplex). The byproduct of coal bottom ash was found to be an attractive raw material source of SiO_2 and Al_2O_3 to obtain ceramic materials. Was demonstrated the possibility of developing a ceramic materials classified as semi-porous (6 10) with additions of up to 20% of coal bottom ash in the composition of the ceramic body. (author)
Energy Technology Data Exchange (ETDEWEB)
Adnadjevic, B.; Popovic, A.; Mikasinovic, B. [University of Belgrade, Belgrade (Serbia). Dept. of Chemistry
2009-07-01
The most important structural components of coal ash obtained by coal combustion in 'Nikola Tesla A' power plant located near Belgrade (Serbia) are amorphous alumosilicate, alpha-quartz, and mullite. The phase composition of coal ash can be altered to obtain zeolite type NaA that crystallizes in a narrow crystallization field (SiO{sub 2}/Al{sub 2}O{sub 3}; Na{sub 2}O/SiO{sub 2}; H{sub 2}O/Na{sub 2}O ratios). Basic properties (crystallization degree, chemical composition, the energy of activation) of obtained zeolites were established. Coal ash extracts treated with obtained ion-exchange material showed that zeolites obtained from coal ash were able to reduce the amounts of iron, chromium, nickel, zinc, copper, lead, and manganese in ash extracts, thus proving its potential in preventing pollution from dump effluent waters.
Cleaning of Egyptian coal by using column flotation to minimize the environmental pollution
Energy Technology Data Exchange (ETDEWEB)
Khalek, M.A.A. [CMRDI, Cairo (Egypt)
2002-07-01
This work aims to decrease the sulfur content of the Egyptian coal by using column flotation technology to be suitable for various applications. In this study, the column flotation parameters as air flow-rate, wash water, frother dosage and feed rate with its solid percent were studied. A clean coal was obtained containing 1.01 % total sulfur with a yield of 82 %, from Maghara coal (Sinai-Egypt) which contains 3.3 % total sulfur as raw coal.
Coal Enrichment Methods by Using Microorganisms and Their Metabolites
Directory of Open Access Journals (Sweden)
Małgorzata Deska
2018-03-01
Full Text Available The aim of this study is to review the literature on the methods of low-rank coal enrichment by using microorganisms and their metabolites. Effective bio-beneficiation technologies for low-rank coals in the future are also suggested throughout this paper. An extensive literature review highlights recent advances in bio-beneficiation technologies for low rank coals. This paper presents the state of the art in the field of the bio-beneficiation technology - carbon leaching with the aid of microorganisms, especially fungi. The knowledge of the low-rank coals leaching is an important step to meet the carbon eco-requirements and improve the economics of mining companies. There are several reasons to investigate microbial activities towards coal. This paper presents the current state of knowledge concerning bioleaching of coal. Thus, in view of the increasing importance of hard coal as a raw material and energy source, it seems hopeful to study the potential of microorganisms to modify the low-rank coal structure.
Map of critical raw material deposits in Europe
Guillaume, Bertrand
2016-04-01
common interoperable EU Geological Knowledge Base. Such a Knowledge Base will support exploration for indigenous mineral resources and strengthen policy and decision making. In 2010, the European Commission identified 14 non energy non-agricultural raw materials as being critical. Criticality is based on both the scarcity of supply and the importance to European industry. This list was updated in 2014 to include 7 new commodities with one being dropped from the original list. The list now comprises: antimony, beryllium, borates, chromium, cobalt, coking coal, fluorspar, gallium, germanium, graphite, indium, magnesite, magnesium, niobium, phosphate rock, platinum group metals, light and heavy rare earth elements (separately), silicon metal and tungsten. ProMine was a European Union (EU) co-funded project, which had as its main objective the stimulation of the extractive industry to deliver new products to manufacturing industry. A major deliverable of the project was the ProMine Mineral Deposit (MD) database that contains information related to almost 13,000 mineral deposits in Europe. In order to extract data to be displayed on the CRM map of Europe, the ProMine MD database was queried for all commodities on the EC CRM list which were in the medium to super-large deposit size. Following this, the dataset was circulated to MREG in order to verify, validate and update the list.
International Nuclear Information System (INIS)
Kong, Shengli; Cheng, Yuanping; Ren, Ting; Liu, Hongyong
2014-01-01
Highlights: • The gas reservoirs characteristics are measured and analyzed. • A sequential approach to control gas of multi-gassy coal seams is proposed. • The design of gas drainage wells has been improved. • The utilization ways of different concentrations of gas production are shown. - Abstract: As coal resources become exhausted in shallow mines, mining operations will inevitably progress from shallow depth to deep and gassy seams due to increased demands for more coal products. However, during the extraction process of deeper and gassier coal seams, new challenges to current gas control methods have emerged, these include the conflict between the coal mine safety and the economic benefits, the difficulties in reservoirs improvement, as well as the imbalance between pre-gas drainage, roadway development and coal mining. To solve these problems, a sequential approach is introduced in this paper. Three fundamental principles are proposed: the mining-induced stress relief effect of the first-mined coalbed should be sufficient to improve the permeability of the others; the coal resource of the first-mined seams must be abundant to guarantee the economic benefits; the arrangement of the vertical wells must fit the underground mining panel. Tunlan coal mine is taken as a typical example to demonstrate the effectiveness of this approach. The approach of integrating surface coalbed methane (CBM) exploitation with underground gas control technologies brings three major benefits: the improvement of underground coal mining safety, the implementation of CBM extraction, and the reduction of greenhouse gas emissions. This practice could be used as a valuable example for other coal mines having similar geological conditions
Steam versus coking coal and the acid rain program
International Nuclear Information System (INIS)
Lange, Ian
2010-01-01
The Clean Air Act of 1990 initiated a tradable permit program for emissions of sulfur dioxide from coal-fired power plants. One effect of this policy was a large increase in the consumption of low-sulfur bituminous coal by coal-fired power plants. However, low-sulfur bituminous coal is also the ideal coking coal for steel production. The analysis presented here will attempt to determine how the market responded to the increased consumption of low-sulfur bituminous coal by the electricity generation sector. Was there a decrease in the quality and/or quantity of coking coal consumption or did extraction increase? Most evidence suggests that the market for coking coal was unaffected, even as the extraction and consumption of low-sulfur bituminous coal for electricity generation increased substantially.
International Nuclear Information System (INIS)
Moreno, Maria Margarita Torres; Rocha, Rogers Raphael da; Zanard, Antenor
2012-01-01
We studied the raw materials used in a factory building blocks, located in Cesario Lange city (SP). It extracts raw materials from various sources in the region to make the dough. The mixtures were prepared from dry milled powders based on data related to the plasticity of the raw materials. It was obtained with the apparatus Vicat-cone in order to obtain similar levels of water absorption of the samples burned at 900 deg C for all compositions. To quantify the proportion of each clay was used the Lever Rule. In this firing temperature, where sintering is mainly by diffusion from a solid state, different compositions of the same set of four raw materials resulted in similar values. (author)
International Nuclear Information System (INIS)
Urban'ski, T.S.; Migdal, V.; Lada, V.
1979-01-01
In laboratory scale equilibrium and kinetics of the liquid extraction of gold, platinum and palladium from chloride and nitrate-chloride solutions were investigated. Experiments were done using model solutions and solutions, obtained in processing of secondary raw materials, for example: solutions in aqua regia of anode slurries after electrical refining of silver and jewelry wastes, as well as solutions after extraction of silver from nitrate mwdia. In investigations for determination of the extraction factor, the radioisotope indicators method have been used. Gold-198, platinum-197, palladium-109, silver-110 m and copper-64 were used. Radioisotope platinum-197 was refined from gold-199 on the ionite Dauex 50VX2 in the medium of hydrobromic acid. Gold was extracted by neutral extraction agents such as tributilphosphate; methylizobutylketone; amylacetate; amil alcohol; 2-ethylhexanol and dibutylcarbitol. In details extraction of palladium and platinum by tri-n-actylamine in different diluents with additions of modifiers, as well as their extraction by aliquat 336 in benzene and by some petroleum products. Influence was determined of the time of phases contact, of application of diluents, influence of extracting agents concentrations on the magnitude of extraction factor and on the separation factor for investigated metals [ru
Genotoxic Evaluation of Mikania laevigata Extract on DNA Damage Caused by Acute Coal Dust Exposure
Energy Technology Data Exchange (ETDEWEB)
Freitas, T.P.; Heuser, V.D.; Tavares, P.; Leffa, D.D.; da Silva, G.A.; Citadini-Zanette, V.; Romao, P.R.T.; Pinho, R.A.; Streck, E.L.; Andrade,V.M. [University of Extremo Catarinense, Criciuma, SC (Brazil)
2009-06-15
We report data on the possible antigenotoxic activity of Mikania laevigata extract (MLE) after acute intratracheal instillation of coal dust using the comet assay in peripheral blood, bone marrow, and liver cells and the micronucleus test in peripheral blood of Wistar rats. The animals were pretreated for 2 weeks with saline solution (groups 1 and 2) or MLE (100 mg/kg) (groups 3 and 4). On day 15, the animals were anesthetized with ketamine (80 mg/kg) and xylazine (20 mg/kg), and gross mineral coal dust (3 mg/0.3 mL saline) (groups 2 and 4) or saline solution (0.3 mL) (groups 1 and 3) was administered directly in the lung by intratracheal administration. Fifteen days after coal dust or saline instillation, the animals were sacrificed, and the femur, liver, and peripheral blood were removed. The results showed a general increase in the DNA damage values at 8 hours for all treatment groups, probably related to surgical procedures that had stressed the animals. Also, liver cells from rats treated with coal dust, pretreated or not with MLE, showed statistically higher comet assay values compared to the control group at 14 days after exposure. These results could be expected because the liver metabolizes a variety of organic compounds to more polar by-products. On the other hand, the micronucleus assay results did not show significant differences among groups. Therefore, our data do not support the antimutagenic activity of M. laevigata as a modulator of DNA damage after acute coal dust instillation.
International Nuclear Information System (INIS)
Hoeoek, Mikael
2010-01-01
The formation of modern society has been dominated by coal and oil, and together these two fossil fuels account for nearly two thirds of all primary energy used by mankind. This makes future production a key question for future social development and this thesis attempts to answer whether it is possible to rely on an assumption of ever increasing production of coal and oil. Both coal and oil are finite resources, created over long time scales by geological processes. It is thus impossible to extract more fossil fuels than geologically available. In other words, there are limits to growth imposed by nature. The concept of depletion and exhaustion of recoverable resources is a fundamental question for the future extraction of coal and oil. Historical experience shows that peaking is a well established phenomenon in production of various natural resources. Coal and oil are no exceptions, and historical data shows that easily exploitable resources are exhausted while more challenging deposits are left for the future. For oil, depletion can also be tied directly to the physical laws governing fluid flows in reservoirs. Understanding and predicting behaviour of individual fields, in particularly giant fields, are essential for understanding future production. Based on comprehensive databases with reserve and production data for hundreds of oilfields, typical patterns were found. Alternatively, depletion can manifest itself indirectly through various mechanisms. This has been studied for coal. Over 60% of the global crude oil production is derived from only around 330 giant oilfields, where many of them are becoming increasingly mature. The annual decline in existing oil production has been determined to be around 6% and it is unrealistic that this will be offset by new field developments, additional discoveries or unconventional oil. This implies that the peak of the oil age is here. For coal a similar picture emerges, where 90% of the global coal production originates
Manufacturing of ashless coal by using solvent de-ashing technology
Energy Technology Data Exchange (ETDEWEB)
Sang-Do Kim; Kwang-Jae Woo; Soon-Kwan Jeong; Young-Jun Rhim; Si-Huyn Lee [Korea Institute of Energy Research, Daejeon (Republic of Korea). Clean Energy Research Center
2007-07-01
Maintenance of a high oil value has an influence to energy crisis and national security in South Korea which does not have energy resources. The coals which have characterized by the abundant reserves and the inexpensive price can be said to be the alternative energy source. Hyper-coal process, which has been developed in Japan since 1999, is a new effective process to produce a clean coal by using the solvent de-ashing technology. When coal is extracted with organic solvent, only the organic portion of coal is dissolved in the solvents. That is possible to apply the low rank coal. This study was performed to produce ashless coal by using the solvent de-ashing technology. The experiment was conducted in the batch(or semi-batch) type reactor with two solvents such as NMP(N-methyl-2-pyrrolidinone) and 1-MN(1-methylnaphthalene) and various coals such as Kideko coal, Roto South coal and Sunhwa coal at 200-400{sup o}C. As a result of the test, extraction yield of coals was more than 60% on daf. Ash concentration which contains the extracted coal was 0.11-1.0wt%. The heat value was increased from 5,400 kcal/kg to 7,920 kcal/kg in the Roto South coal. 10 refs., 4 figs., 2 tabs.
Annual report 1997. Energies and raw materials; Rapport annuel 1997. Energies et matieres premieres
Energy Technology Data Exchange (ETDEWEB)
NONE
1998-12-31
This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)
Annual report 1997. Energies and raw materials; Rapport annuel 1997. Energies et matieres premieres
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-12-31
This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)
Wang, Haixia; Suo, Tongchuan; Wu, Xiaolin; Zhang, Yue; Wang, Chunhua; Yu, Heshui; Li, Zheng
2018-03-01
The control of batch-to-batch quality variations remains a challenging task for pharmaceutical industries, e.g., traditional Chinese medicine (TCM) manufacturing. One difficult problem is to produce pharmaceutical products with consistent quality from raw material of large quality variations. In this paper, an integrated methodology combining the near infrared spectroscopy (NIRS) and dynamic predictive modeling is developed for the monitoring and control of the batch extraction process of licorice. With the spectra data in hand, the initial state of the process is firstly estimated with a state-space model to construct a process monitoring strategy for the early detection of variations induced by the initial process inputs such as raw materials. Secondly, the quality property of the end product is predicted at the mid-course during the extraction process with a partial least squares (PLS) model. The batch-end-time (BET) is then adjusted accordingly to minimize the quality variations. In conclusion, our study shows that with the help of the dynamic predictive modeling, NIRS can offer the past and future information of the process, which enables more accurate monitoring and control of process performance and product quality.
Directory of Open Access Journals (Sweden)
S. B. Evseeva
2016-01-01
Full Text Available In contemporary pharmaceutical practice extracts are used as a separate cosmetic product and as an intermediate for external medicinal forms (ointments, gels, liniments and cosmetic forms. Their range is highly diverse.The aim is an overview of the scientific and technical information concerning plant raw materials extracts using in the external drug and cosmetic products.Methods. To describe the range of extracts proposed for external use the analysis of the proposals of Russian and foreign producers submitted their official websites and online trading platforms was used. The specificity of extraction of biologically active substances of plant extracting agents: water, ethyl alcohol, glycols, vegetable oils, carbon dioxide used to obtain extracts was described on the basis of available scientific literature (eLIBRARY, PubMed, Cyberleninca, Google Books. Results. Examples of external drugs and cosmetic products based on plant raw materials extracts from a range of pharmaceutical organizations are given. It was found that from the extracting solvent used the range is presented by hydrophilic, such as glycol (propylene glycol, glycerin, water, alcoholic extracts; lipophilic (oil, CO2-extracts, and two-phase (caprylic/caprate triglyceride/water extracts. The main features of the extracting solvent used for this category of extracts: the specifics of the use in cosmetics (the skin specific effect, in particular selectivity to groups of biologically active plant substances, microbiological purity, are noted. Results of research data on the study of the prospects for the use of cosmetic ingredients – silicones, caprylic/ capric triglyceride, isopropyl myristate both solvents. The extraction techniques: classical (maceration, percolation and intensified (electro-plasma dynamic extraction, vacuum extraction circulation, CO2 supercritical extraction used in industry to produce cosmetic extracts are described
Gasification of coal with steam using heat from HTRs
International Nuclear Information System (INIS)
Juentgen, H.; Heek, K.H. van
1975-01-01
In existing coal gasification processes a substantial part of the coal is used to provide the heat for the reaction, for the generation and superheating of steam and for the production of oxygen. By using heat from HTRs to substitute this part, the coal is then completely used as raw material for gas production. This offers the following advantages compared with the existing processes: a saving of coal, less CO 2 emission and, in countries with high coal costs, lower gas production costs. A survey is given of the state of the project, discussing the first design of a commercial gasifier, the influence of the helium outlet temperature of the HTR, kinds of products, and the overall efficiency of the plant. The aim of the development is to demonstrate the use of heat from an HTR for full scale coal gasification, starting in 1985. (Auth.)
Energy Technology Data Exchange (ETDEWEB)
NONE
1990-03-01
The 5th IEA (International Energy Agency) International Conference on Coal Science (1989-ICCS) was held in Tokyo in October 1989. A number of essays relative to the basics and applications of the coal science were presented at the event, and recent trends of the coal science have been extracted from these essays and complied into this survey report. In the field of basic coal reaction, it is stated that basic studies relating to the coal structure, physical properties, and chemistry are necessary for the future coal science and that it will be very difficult to construct a database covering various types of coals conserved under different circumstances. In the field of basics of coal combustion and gasification, essays are introduced, titled 'Gasification reactivity and coal structure' and 'Role of catalysts in gasification reaction.' Furthermore, future trends of the science are predicted from the viewpoint of 'Problems of global environment and research on coal gasification.' In the field of coal liquefaction, essays are introduced which discuss the improvement of the coal process, enhancement of cost effectiveness, and higher efficiency, and point to the subjects of research in the future. (NEDO)
Energy Technology Data Exchange (ETDEWEB)
NONE
1990-03-01
The 5th IEA (International Energy Agency) International Conference on Coal Science (1989-ICCS) was held in Tokyo in October 1989. A number of essays relative to the basics and applications of the coal science were presented at the event, and recent trends of the coal science have been extracted from these essays and complied into this survey report. In the field of basic coal reaction, it is stated that basic studies relating to the coal structure, physical properties, and chemistry are necessary for the future coal science and that it will be very difficult to construct a database covering various types of coals conserved under different circumstances. In the field of basics of coal combustion and gasification, essays are introduced, titled 'Gasification reactivity and coal structure' and 'Role of catalysts in gasification reaction.' Furthermore, future trends of the science are predicted from the viewpoint of 'Problems of global environment and research on coal gasification.' In the field of coal liquefaction, essays are introduced which discuss the improvement of the coal process, enhancement of cost effectiveness, and higher efficiency, and point to the subjects of research in the future. (NEDO)
Panda, Vandana Sanjeev; Shinde, Priyanka Mangesh
2016-12-01
BackgroundSpinacia oleracea known as spinach is a green-leafy vegetable consumed by people across the globe. It is reported to possess potent medicinal properties by virtue of its numerous antioxidant phytoconstituents, together termed as the natural antioxidant mixture (NAO). The present study compares the antacid effect of raw spinach juice with an antioxidant-rich methanolic extract of spinach (NAOE) in an artificial stomach model. MethodsThe pH of NAOE at various concentrations (50, 100 and 200 mg/mL) and its neutralizing effect on artificial gastric acid was determined and compared with that of raw spinach juice, water, the active control sodium bicarbonate (SB) and a marketed antacid preparation ENO. A modified model of Vatier's artificial stomach was used to determine the duration of consistent neutralization of artificial gastric acid for the test compounds. The neutralizing capacity of test compounds was determined in vitro using the classical titration method of Fordtran. Results NAOE (50, 100 and 200 mg/mL), spinach juice, SB and ENO showed significantly better acid-neutralizing effect, consistent duration of neutralization and higher antacid capacity when compared with water. Highest antacid activity was demonstrated by ENO and SB followed by spinach juice and NAOE200. Spinach juice exhibited an effect comparable to NAOE (200 mg/mL). ConclusionsThus, it may be concluded that spinach displays significant antacid activity be it in the raw juice form or as an extract in methanol.
30 CFR 206.459 - Allocation of washed coal.
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Allocation of washed coal. 206.459 Section 206... MANAGEMENT PRODUCT VALUATION Indian Coal § 206.459 Allocation of washed coal. (a) When coal is subjected to washing, the washed coal must be allocated to the leases from which it was extracted. (b) When the net...
30 CFR 206.260 - Allocation of washed coal.
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Allocation of washed coal. 206.260 Section 206... MANAGEMENT PRODUCT VALUATION Federal Coal § 206.260 Allocation of washed coal. (a) When coal is subjected to washing, the washed coal must be allocated to the leases from which it was extracted. (b) When the net...
Rababah, Taha
The purpose of this study included: preparing plant extracts and evaluating these extracts for total phenolics and antioxidant activities (AA); infusing extract/combination that demonstrates superior AA into chicken breast and irradiating at 3.0 kGy; evaluating the physicochemical properties of irradiated and non-irradiated raw and cooked chicken breast at 5°C for 12 days and -20°C for 9 months; and selecting the extracts that demonstrated desirable AA, infusing these extracts into chicken breast and evaluating head-space volatiles, and conducting sensory evaluation. The total phenolic content and AA of the plant extracts ranged from 24.8 to 92.5 mg/g dry material (conjugated diene of methyl linoleate) and 3.4 to 86.3%, respectively. The AA of plant extracts using oxidative stability instrument were 4.6 to 10.2 h (Induction time). Green tea and grape seed extracts had the highest AA within several plant extracts, and were selected to retard lipid oxidation in further studies. Fresh boneless and skinless chicken breast meats were vacuum infused with varying concentrations of antioxidants: Green tea and grape seed extracts alone/in combination and tert-butylhydroquinone. The results showed that irradiation had no significant effect on pH, water holding capacity, but increased the redness and carbonyls in raw meats (p extracts into meats increased lightness and decreased redness as well as hardness and shear force. Irradiation increased TBARS, hexanal, and pentanal values in raw and cooked meats. Addition of plant extracts decreased the amount of TBARS, hexanal, pentanal, and carbonyl values. Similar results were observed when the samples were stored at -20°C for 9 months. Descriptive sensory flavor results showed that irradiation did not affect the flavor attributes. Consumer, descriptive, and instrumental results showed that irradiation increased toughness, green tea improved the meat color, and the panel indicated that irradiation decreased the tenderness of the
1996 Activities report on energies and raw materials
International Nuclear Information System (INIS)
1996-01-01
The 1996 activity survey of the French General Directory for Energy and Raw Materials, which main objectives are to preserve the competitiveness of French economy, enhance environmental protection, secure the long term supply safety and maintain the public service basis for energy supply, is presented. The main themes of the survey are: the nuclear safety in Eastern Europe, the electric power inland market, the evolution of the oil market in 1996, the situation of refining in France, restructuring the BRGM (Mining and Geological Research Bureau), followed by brief facts concerning the sustainable energy development, nuclear energy, electric power, electricity and gas common issues, gas, coal, petroleum products, raw materials and underground materials. A series of global diagrams concludes the survey
Emissions of organic hazardous air pollutants during Chinese coal combustion
Energy Technology Data Exchange (ETDEWEB)
Yan, R.; Zhu, H.J.; Zheng, C.G.; Xu, M.H. [Environmental Technology Institute, Singapore (Singapore). Innovative Center
2002-05-01
The emissions of organic hazardous air pollutants (HAPs) during the combustion of several typical Chinese coals were investigated. First, the distribution of four types of HAP, i.e., aliphatics, cyclic hydrocarbons, monoaromatic compounds and PAHs, in the CH{sub 2}C{sub l2} extracts of six Chinese coals were studied and the influences of the extractive times and coal varieties were also evaluated. Second, the partitioning of these HAPs in the flue gas during coal combustion in a small-scale reactor were investigated, depending on oven temperatures (500, 600, 700, 800, 900{sup o}C) and coal varieties. The behaviors of HAP in the combustion flue gas were compared with those in the CH{sub 2}, Cl{sub 2}, extracts. Finally, combustion was conducted at given conditions in two laboratory-scale reactors: a fluidized bed and a fixed bed. Two coals (Shengmu bituminous coal and Xunhuan anthracite coal) and one coke were considered. The HAP partitioning both in flue gases and in ashes were evaluated and compared between the two combustors.
Song, Ji-Hye; Kang, Hee-Bum; Park, Seung-Ho; Jeong, Ji-Hoon; Park, Jeongjin; You, Yanghee; Lee, Yoo-Hyun; Lee, Jeongmin; Kim, Eungpil; Choi, Kyung-Chul; Jun, Woojin
2017-12-01
Porphyra tenera, also known as nori, is a red algal species of seaweed. It is cultivated in Asia for culinary purposes. We report that P. tenera extract (PTE) enhances the immune response in mouse macrophages. We found that P. tenera extract regulates the NF-κB IκB kinase (IKK) signaling pathway, and we assessed the expression and translocation of p65, a subunit of NF-κB, in RAW264.7 mouse macrophage cells after treatment with PTE. We also investigated the effects of 10% ethanol PTE (PTE10) in RAW264.7 cells. The production of IL-10, IL-6, TNF-α, and IFN-γ was induced by PTE treatment of the macrophages, and PTE also enhanced p-IκB and p-AKT. PTE10 showed no cytotoxicity at 10-20 μg/mL in RAW264.7 cells. PTE10, in fact, increased cell viability at 24 h, stimulated macrophage cells, and induced the phosphorylation of Akt. Akt stimulates IKK activity through the phosphorylation of IKKα and enhances immune activity through the activation of NF-κB. In this study, NF-κB activation was induced by increasing p-NF-κB and p-IKK. A subunit of NF-κB, p65, was located in the nucleus and increased the expression of various cytokines. PTE thus enhanced the immune response through IκB-α immunostimulation signaling in RAW264.7 cells. PTE10 has potential therefore for development of future treatments requiring immune system stimulation.
International Nuclear Information System (INIS)
Font, O.; Moreno, N.; Diez, S.; Querol, X.; Lopez-Soler, A.; Coca, P.; Garcia Pena, F.
2009-01-01
Coal gasification (IGCC) and pulverised coal combustion (PCC) fly ashes (FAs), obtained from two power plants fed with the carboniferous bituminous coal from Puertollano (Spain), were characterised and used as raw materials for zeolite synthesis by direct conversion (DC) and by alkaline fusion (Fu), and SiO 2 extraction (Si-Ex) at laboratory scale. The Puertollano FAs are characterised by a high SiO 2 content (59%) with respect to EU coal FAs. High zeolite synthesis yields were obtained from both FAs by using conventional alkaline activation. However, the Si extraction yields were very different. The results of the zeolite synthesis from the Si-bearing extracts from both FAs demonstrated that high purity zeolites with high cation exchange capacity (CEC, between 4.3 and 5.3 meq/g) can be produced. The solid residue arising from Si-Ex is also a relatively high NaP1 zeolite product (CEC 2.4-2.7 meq/g) equivalent to the DC products. The zeolitic materials synthesised from both FAs by Fu showed an intermediate (between the high purity zeolites and the DC products) zeolite content with CEC values from 3.4 to 3.7 meq/g. Low leachable metal contents were obtained from high purity A and X zeolites and zeolite material synthesised by Fu for PCC FA.
International Nuclear Information System (INIS)
Smirnov, Yu.V.; Efimova, Z.I.; Skorovarov, D.I.; Ivanov, G.F.
1979-01-01
The situation is briefly overviewed in the field of exploration, prospecting, extraction and processing of uranium raw material and industrial introduction of the recently developed methods. The method of underground leaching, including that from deep-seated deposits, is gaining wide acceptance. Of high importance is the industrial introduction of such promising processes as bacterial leaching, continuous column-sorption with a pseudo-luquefied sorbent layer, direct production of UF 6 in an ore-processing factory. Active works are under way now in the field of multi-purpose utilization of uranium ore. New methods are industrially introduced for the extraction of associated uranium from phosphoric acid solutions, copper ore, sea water
Coal preparation and coal cleaning in the dry process; Kanshiki sentaku to coal cleaning
Energy Technology Data Exchange (ETDEWEB)
Tanaka, Z; Morikawa, M; Fujii, Y [Okayama University, Okayama (Japan). Faculty of Engineering
1996-09-01
Because the wet process has a problem such as waste water treatment, coal cleaning in the dry process was discussed. When a fluidized bed (using glass beads and calcium carbonate) is utilized instead of the heavy liquid, the fluidized bed will have apparent density as the liquid does, whereas the relative relationship therewith determines whether a substance having been put into the fluidized bed will float or sink. This is utilized for coals. In addition, two powder constituents of A and B may be wanted to be separated using the fluidized extraction process (similar to the liquid-liquid extraction process). In such a case, a fluidized bed in which both constituents are mixed is added with a third constituent C (which will not mix with A, but mix well with B), where the constituents are separated into A and (B + C), and the (B + C) constituent is separated further by using a sieve. If coal has the coal content mixed with ash content and pulverized, it turns into particle groups which have distributions in grain size and density. Groups having higher density may contain more ash, and those having lower density less ash. In addition, the ash content depends also on the grain size. The ash content may be classified by using simultaneously wind classification (for density and grain size) and a sieve (for grain size). This inference may be expanded to consideration of constructing a multi-stage fluidized bed classification tower. 12 figs., 5 tabs.
GAS AND COAL EXTRACTIVE INDUSTRY DURING THE SOCIALIST INDUSTRIALIZATION PERIOD (1948-1989
Directory of Open Access Journals (Sweden)
MARIUS BULEARCA
2015-12-01
Full Text Available This article shows that since 1949 the extractive industry has undergone a strong process of restructuring when enterprises were nationalized and a strict control over all components of the economy was established. The new leadership of the country had the intention of developing the industrial sector as well, basically laying the foundations of the new Romanian economy where the industrial sector economy would bring considerable income. This program will lead to the development of the energy sector in Romania also, thus contributing to a great extent to the development and consolidation of coal and gas extraction. Despite of all the economic and social development achieved during the period 1950-1989, at the end of it, Romania ranked a marginal position in the European countries hierarchy since between its level of development and the market economy developed countries large gaps in respect to the main economic and social indicators occurred.
Low temperature oxidation and spontaneous combustion characteristics of upgraded low rank coal
Energy Technology Data Exchange (ETDEWEB)
Choi, H.K.; Kim, S.D.; Yoo, J.H.; Chun, D.H.; Rhim, Y.J.; Lee, S.H. [Korea Institute of Energy Research, Daejeon (Korea, Republic of)
2013-07-01
The low temperature oxidation and spontaneous combustion characteristics of dried coal produced from low rank coal using the upgraded brown coal (UBC) process were investigated. To this end, proximate properties, crossing-point temperature (CPT), and isothermal oxidation characteristics of the coal were analyzed. The isothermal oxidation characteristics were estimated by considering the formation rates of CO and CO{sub 2} at low temperatures. The upgraded low rank coal had higher heating values than the raw coal. It also had less susceptibility to low temperature oxidation and spontaneous combustion. This seemed to result from the coating of the asphalt on the surface of the coal, which suppressed the active functional groups from reacting with oxygen in the air. The increasing upgrading pressure negatively affected the low temperature oxidation and spontaneous combustion.
Coal development potential in Pakistan
Energy Technology Data Exchange (ETDEWEB)
Khan, M N; Pelofsky, A H [eds.
1986-01-01
A total of 48 papers were presented, and covered the following topics: the current situation in Pakistan with respect to development and utilization of coal resources; the policies that have been responsible for the development and utilization of coal resources in Pakistan; coal development and utilization in other developing nations e.g. Indonesia, Greece, Philippines, China, Thailand and Haiti; and technological developments in coal exploration; extraction, handling, transport and utilization which could accelerate future development of Pakistan's coal resources. Specific subjects covered include the use of coal in the cement industry of Pakistan; the production of briquettes for domestic use, development and training of personnel for the coal industry; and sources of finance for coal development projects. Particular emphasis is given throughout the conference to the Lakhra coal mine/power plant project which aims to develop and effectively utilize the lignite reserves of Sind Province. 47 papers have been abstracted separately.
Synthesis of beta-sialon from coal gangue
Energy Technology Data Exchange (ETDEWEB)
Luo, X.Y.; Sun, J.L.; Deng, C.J.; Hong, Y.R. [Beijing University Science & Technology, Beijing (China)
2003-01-01
It is worth studying the synthesis of beta-Sialon from coal gangue, because coal gangue is a waste of coal production and is a high quality kaolin contained carbon which is a perfect raw material of contained reducer itself for synthesis of beta-sialon. The study showed that a high conversion rate of 95% from coal gangue to beta-Sialon could be obtained by using process of carbothermal reduction nitridation when strictly controlling the thermodynamic conditions of synthesis. For controlling the synthesis conditions, the details of the effects of p(CO), P-O{sub 2} and T on the conversion rate of beta-sialon are discussed and the phase diagrams of oxygen pressure vs composition for Si{sub 3}N{sub 4}-A{sub l}N-Al{sub 2}O{sub 3}-SiO{sub 2} system at 1350, 1500, and 1600{sup o}C are constructed.
Energy Technology Data Exchange (ETDEWEB)
NONE
1983-03-01
This research aims to prepare conceptual designs for a 250t/d-class and 500t/d-class coal liquefaction pilot plants based on the achievement of research on solvent extraction liquefaction of coal. It also aims to define the solvent extraction process and provide decision-making material relative to the development and promotion of coal liquefaction technologies in the future. Development started in 1978 of the technology of solvent extraction liquefaction of coal, and a 1t/d PDU (process development unit) was completed in 1981. Studies through its operation have continued for more than 3000 hours already, and technical data are being accumulated steadily. Techniques acquired through operating the 1t/d PDU have been put together, and rough process conditions are established. A rough process result is achieved of the same conditions. In these two respects, the newly developed process is equal to other processes. The phenomena in this process are roughly grasped. It is deemed that, with the existing technique combined with the technique acquired here, a technological level has been reached where conceptual designs of large pilot plants may be worked out for solvent extraction liquefaction of coal. Under the circumstances, with a view to developing a commercial plant whose main products will be fuel oils, conceptual designs are prepared for large pilot plants, and are compiled into this report. (NEDO)
Characterization of Moroccan coal waste: valorization in the elaboration of the Portland clinker
Directory of Open Access Journals (Sweden)
Belkheiri D.
2014-04-01
Full Text Available Coal exploited in the mine of Jerada (northeast of Morocco was accompanied by large quantities of waste. The purpose of this work is to characterize this waste with the aim of its use as a material for civil engineering. Mineral and chemical investigations on this waste in the raw state, and at different temperature of heat treatments, were carried out by various methods: X-ray fluorescence, X-ray diffraction, infrared spectroscopy. These analyzes showed that the studied waste, contain essentially a mineral part formed by silica and various clays, as well as coal’s residues. The thermal investigation of waste, by differential scanning calorimetry (DSC, revealed an exothermic phenomenon attributed to the combustion of coal residues. Other phenomena were noted on the thermograms due to the mineral part transformations. In this analysis a comparison was also made with pure coal. These characteristics of coal waste encourage studying its development in reducing energy consumption in the Portland cement manufacture. Mixtures of waste with limestone or with raw cement materials were studied, and the resulting products were analyzed by different methods.
Removing heavy metals from wastewaters with use of shales accompanying the coal beds.
Jabłońska, Beata; Siedlecka, Ewa
2015-05-15
A possibility of using clay waste rocks (shales) from coal mines in the removal of heavy metals from industrial wastewaters is considered in this paper. Raw and calcined (600 °C) shales accompanying the coal beds in two Polish coal mines were examined with respect to their adsorptive capabilities for Pb, Ni and Cu ions. The mineralogical composition of the shales was determined and the TG/DTG analysis was carried out. The granulometric compositions of raw and calcined shales were compared. Tests of adsorption for various Pb(II), Ni(II) and Cu(II) concentrations were conducted and the pH before and after adsorption was analyzed. The results indicate that the shales from both coal mines differ in adsorptive capabilities for particular metal ions. The calcination improved the adsorptive capabilities for lead, but worsened them for nickel. The examined shales have good adsorptive capabilities, and could be used as inexpensive adsorbents of heavy metal ions, especially in the regions where resources of shale are easy accessible in the form of spoil tips. Copyright © 2015 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-03-01
This paper describes the demonstrative project for coal preparation technology, as a part of the measures against environmental pollution due to the structuring of demonstration and dissemination basis for clean coal technologies in China, The results for fiscal 1999 is reported. In the utilization of coal in China, a problem of urgency is the highly efficient selection and removal of sulfur contents in raw coal. Coal production in Chongquing City is yearly 30 million tons, of which 90% contains sulfur contents of 3% or higher. At Jinjia Colliery of Panjiang Coal and Electric Co. Ltd., Guizhou Province, a site for the present project, a number of coal seams are unsuitable for single utilization because of high sulfur contents. The coal preparation technologies to be introduced are expected to improve coal preparation efficiency and desulfurization ratio in terms of both the washability of raw coal and the accuracy of the coal washer. This is the third year of the project, with the following activities performed, namely, research/design, manufacturing/procurement of equipment, design for construction work, training of operators or the like, and documentation. The manufacturing and procurement are for such equipment as vacuum disk filter with accessories, waste water thickener, pressure filter for tailings with accessories, flocculant pump/piping, slurry tank/pump, high-shear mixer with accessories, and electric instrumentation. All the equipment arrived at the site in January, 2001. (NEDO)
Advanced physical fine coal cleaning spherical agglomeration. Final report
Energy Technology Data Exchange (ETDEWEB)
1990-09-01
The project included process development, engineering, construction, and operation of a 1/3 tph proof-of-concept (POC) spherical agglomeration test module. The POC tests demonstrated that physical cleaning of ultrafine coal by agglomeration using heptane can achieve: (1) Pyritic sulfur reductions beyond that possible with conventional coal cleaning methods; (2) coal ash contents below those which can be obtained by conventional coal cleaning methods at comparable energy recoveries; (3) energy recoveries of 80 percent or greater measured against the raw coal energy content; (4) complete recovery of the heptane bridging liquid from the agglomerates; and (5) production of agglomerates with 3/8-inch size and less than 30 percent moisture. Test results met or exceeded all of the program objectives. Nominal 3/8-inch size agglomerates with less than 20 percent moisture were produced. The clean coal ash content varied between 1.5 to 5.5 percent by weight (dry basis) depending on feed coal type. Ash reductions of the run-of-mine (ROM) coal were 77 to 83 percent. ROM pyritic sulfur reductions varied from 86 to 90 percent for the three test coals, equating to total sulfur reductions of 47 to 72 percent.
Coal technology in a sustainable society
International Nuclear Information System (INIS)
Anon
2000-01-01
Coal is a major world energy resource. For many countries it is the primary fuel in electricity generation. As world energy demand increases so also will the demand for coal. Steel and aluminium-essential elements in the fabric of modern society -also rely heavily on coal. This article points out that the Australian coal industry is responding to the challenges facing coal by investigating a sustainable development strategy and examining the full life cycle outcomes of coal as fuel and reductant. The challenge is to deliver much more efficient ways of extracting energy from coal. The most effective strategies are seen to be: ash displacement credits, synergies with renewables and integration with other industries
Hong, Se Hyang; Ku, Jin Mo; In Kim, Hyo; Ahn, Chang-Won; Park, Soo-Hyun; Seo, Hye Sook; Shin, Yong Cheol; Ko, Seong-Gyu
2017-09-01
Chemotherapeutics are often used to inhibit the proliferation of cancer cells. However, they can also harm healthy cells and cause side effects such as immunosuppression. Especially traditional oriental medicines long used in Asia, may be beneficial candidates for the alleviation of immune diseases. Cervus nippon mantchuricus extract (NGE) is currently sold in the market as coffee and health drinks. However, NGE was not widely investigated and efficacy remain unclear and essentially nothing is known about their potential immune-regulatory properties. As a result, NGE induced the differentiation of RAW264.7 macrophage cells. NGE-stimulated RAW264.7 macrophage cells elevated cytokines levels and NO production. NGE-stimulated RAW264.7 macrophage cells activated MAPKs and NF-κB signaling pathways. NGE encouraged the immuno-enhancing effects in immunosuppressed short-term treated with NGE mice model. NGE or Red ginseng encouraged the immuno-enhancing effects in immunosuppressed long-term treated with NGE mice model. Our data clearly show that NGE contains immune-enhancing activity and can be used to treat immunodeficiency. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Fernandes, Ana Josane Dantas; Ferreira, Magda Rhayanny Assunção; Randau, Karina Perrelli; de Souza, Tatiane Pereira; Soares, Luiz Alberto Lira
2012-01-01
The aim of this work was to evaluate the spectrophotometric methodology for determining the total flavonoid content (TFC) in herbal drug and derived products from Bauhinia monandra Kurz. Several analytical parameters from this method grounded on the complex formed between flavonoids and AlCl₃ were evaluated such as herbal amount (0.25 to 1.25 g); solvent composition (ethanol 40 to 80%, v/v); as well as the reaction time and AlCl₃ concentration (2 to 9%, w/v). The method was adjusted to aqueous extractives and its performance studied through precision, linearity and preliminary robustness. The results showed an important dependence of the method response from reaction time, AlCl₃ concentration, sample amount, and solvent mixture. After choosing the optimized condition, the method was applied for the matrixes (herbal material and extractives), showing precision lower than 5% (for both parameters repeatability and intermediate precision), coefficient of determination higher than 0.99, and no important influence could be observed for slight variations from wavelength or AlCl₃ concentration. Thus, it could be concluded that the evaluated analytical procedure was suitable to quantify the total flavonoid content in raw material and aqueous extractives from leaves of B. monandra.
Sadykov, Raman; Kiponievich Ogay, Evgeniy; Royer, Jean-Jacques; Zhapbasbayev, Uzak; Panfilova, Irina
2015-04-01
Coal Bed Methane (CBM) is gas stored in coal layers. It can be extracted from wells after hydraulic fracturing and/or solvent injection, and secondary recovery techniques such as CO2 injection. Karaganda Basin is a very favorable candidate region to develop CBM production for the following reasons: (i) Huge gas potential; (ii) Available technologies for extracting and commercializing the gas produced by CBM methods; (iii) Experience in degassing during underground mining operations for safety reasons; (iv) Local needs in energy for producing electricity for the industrial and domestic market. The objectives of this work are to model the Taldykuduk block coal layers and their properties focusing on Coal Bed Methane production. It is motivated by the availability of large coal bed methane resources in Karaganda coal basin which includes 4 300 Bm3 equivalent 2 billion tons of coal (B = billion = 109) with gas content 15-25 m3/t of coal (for comparison San Juan basin (USA) has production in a double porosity model considering two domains: the matrix (m) and the fracture (f) for which the initial and boundary conditions are different. The resulting comprehensive 3D models had helped in better understanding the tectonic structures of the region, especially the relationships between the fault systems.
Development of mechanization of extraction in underground coal mining (part I)
Energy Technology Data Exchange (ETDEWEB)
Strzeminski, J
1984-01-01
The history of underground coal mining and history of mechanizing underground operations of cutting, strata control, mine haulage, hoisting and ventilation are discussed. The following development periods are characterized: until 1769 (date of steam engine invention by J. Watt), from 1769 to 1945 (period of partial mechanization of operations in underground coal mining), from 1945 (period of comprehensive mechanization and automation). A general description of mining in the first development period is given. Evaluation of the second development period concentrates on mechanization in underground coal mining. The following equipment types are described: cutting (pneumatic picks and pneumatic drills, coal saws developed by Eickhoff, coal cutters developed after 1870, cutter loaders patented in 1925-1927, coal plows and coal cutter loaders), mine haulage (mine cars, conveyors developed in the United Kingdom, Germany and Russia, Poland), strata control at working faces (timber props, steel friction props, roof bars), strata control in the goaf (room and pillar mining, stowing, minestone utilization for stowing in Upper Silesia, hydraulic stowing in Upper Silesia). 5 references.
Energy Technology Data Exchange (ETDEWEB)
Kapol' i, L
1980-01-01
On the basis of the agreement concerning the creation of a combined organization for conducting geological prospecting operations for petroleum and gas in the Baltic Sea in the area of the continental shelf and the floor of the territorial waters of the signatory states of East Germany, Poland, and the USSR, which was signed in 1975, the Petrolbaltik organization ws created. A long time program of cooperation in the areas of energy, fuel, and raw materials foresees that the SEV member states will carry out prospective scientific developments on the use of new sources of energy, including solar, wind, chemical and geothermal forms of energy. Forty-seven scientific and technical organization of the SEV member states are working under the leadership of the Coordination center concerning the problem, ''New methods on the use of coal,'' on the industrial use of the by-products of hte extraction and enrichment of coal, the methods of their coking, and their liquefaction and gasification. The technique of producing alumina and cement from the ash of energy systems, working on coal, as well as from coal heaps is being successfully applied in Hungary.
Producing synthetic solid fuel from Kansk-Achinsk coal
Energy Technology Data Exchange (ETDEWEB)
Zverev, D.P.; Krichko, A.A.; Smirnova, T.S.; Markina, T.I.
1981-01-01
Studies were conducted by the Soviet Institute of Fossil Fuels in order to develop a technology and equipment configuration for thermal processing of coals using gas heat carriers in swirl chambers. Characteristics of the starting Irsha-Borodinskii coal and those of the products of thermal processing at 290-600 C are given. Testing the method showed that the products of high-speed thermal processing (thermocoal, semicoke, drier products) can be used as raw materials in hydrogenation, combustion, gasification, thermal benefication, briquetting and a series of other processes in metallurgy. (10 refs.) (In Russian)
Changes in brown coal structure caused by coal-solubilizing microorganisms
Energy Technology Data Exchange (ETDEWEB)
Schmiers, H.; Koepsel, R.; Weber, A.; Winkelhoefer, M.; Grosse, S. [Technische Univ. Bergakademie Freiberg (Germany). Inst. fuer Energieverfahrenstechnik und Chemieingenieurwesen
1997-12-31
The phenomenon of coal solubilization caused by microorganisms has been explained by various mechanisms: extraction of non-covalently bonded polar components of the coal substance by biogenic agents (chelating agents, alkaline substances) and enzyme-catalyzed cleavage of covalent bonds by extracellular enzyme systems. For this it is assumed that bond cleavage occurs on the aliphatic carbon (methylene groups, aliphatic bridges or on ester groups). As the coal has usually been treated with oxidizing agents such as H{sub 2}O{sub 2} or HNO{sub 3} before bioconversion, there is a possibility that the result of bioconversion is overlaid with the effect of the chemical treatment. We therefore studied the structural changes in the organic coal substance during pre-oxidation with H{sub 2}O{sub 2}, treatment with MnP and conversion using the fungal strains of Trichoderma and Fusarium oxysporum. (orig.)
Separation of mercury in industrial processes of Polish hard steam coals cleaning
Directory of Open Access Journals (Sweden)
Wierzchowski Krzysztof
2016-01-01
Full Text Available Coal use is regarded as one of main sources of anthropogenic propagation of mercury in the environment. The coal cleaning is listed among methods of the mercury emission reduction. The article concerns the statistical assessment of mercury separation between coal cleaning products. Two industrial processes employed in the Polish coal preparation plants are analysed: coal cleaning in heavy media vessels and coal cleaning in jigs. It was found that the arithmetic mean mercury content in coarse and medium coal size fractions for clean coal from heavy media vessels, amounts 68.9 μg/kg, and most of the results lay below the mean value, while for rejects it amounts 95.5 μg/kg. It means that it is for around 25 μg/kg greater than in the clean coal. The arithmetic mean mercury content in raw coal smalls amounts around 118 mg/kg. The cleaning of smalls in jigs results in clean coal and steam coal blends characterized by mean mercury content 96.8 μg/kg and rejects with mean mercury content 184.5 μg/kg.
Germanium content in Polish hard coals
Directory of Open Access Journals (Sweden)
Makowska Dorota
2016-01-01
Full Text Available Due to the policy of the European Union, it is necessary to search for new sources of scarce raw materials. One of these materials is germanium, listed as a critical element. This semi-metal is widely used in the electronics industry, for example in the production of semiconductors, fibre optics and solar cells. Coal and fly ash from its combustion and gasification for a long time have been considered as a potential source of many critical elements, particularly germanium. The paper presents the results of germanium content determination in the Polish hard coal. 23 coal samples of various coal ranks were analysed. The samples were collected from 15 mines of the Upper Silesian Coal Basin and from one mine of the Lublin Coal Basin. The determination of germanium content was performed with the use of Atomic Absorption Spectrometry with Electrothermal Atomization (GFAAS. The investigation showed that germanium content in the analysed samples was at least twice lower than the average content of this element in the hard coals analysed so far and was in the range of 0.08 ÷ 1.28 mg/kg. Moreover, the content of Ge in the ashes from the studied coals does not exceed 15 mg/kg, which is lower than the average value of Ge content in the coal ashes. The highest content of this element characterizes coals of the Lublin Coal Basin and young coals type 31 from the Vistula region. The results indicate a low utility of the analysed coal ashes as a source of the recovery of germanium. On the basis of the analyses, the lack of the relationship between the content of the element and the ash content in the tested coals was noted. For coals of the Upper Silesian Coal Basin, the relationship between the content of germanium in the ashes and the depth of the seam was observed.
Biological and physiological changes in raw and radiation-processed legumes
International Nuclear Information System (INIS)
El Wakeil, F.A.; Sharabash, M.T.M.; Farag, M. Diaa El-Din H.; Mahrous, S.R.
1994-01-01
Body weight of rats fed on raw kidney beans, soybeans, broad beans, chick peas and lupines suffered from poor growth due to some antinutritional factors. When the studied legumes were exposed to 10 kGy, the rats gained more weight than those kept on raw legumes. When extracts of raw legumes were intraperitoneally injected, the LD 50 were found to be 125, 300 and 1800 mg/kg, for raw kidney beans, raw soybeans, and raw broad beans respectively. However, injecting extracts of raw chick peas and raw lupines did not kill the rats even at higher concentration levels of 3000 mg/kg. Similar results were obtained with irradiated chick peas and lupines (10 kGy). Meanwhile, after irradiation treatment of kidney beans, soybeans and broad beans, the LD 50 were found to be 250, 400 and 2000 mg/kg for the above pulses respectively. Both raw and irradiated kidney beans and raw soybeans were most active in stimulating pancreas and liver growth and reducing spleen weight. Irradiated soybeans showed a moderate but significant increase in liver weight only. However, rats fed on both raw and irradiated broad beans, chick peas and lupines in their diets did not suffer any pancreatic and liver hypertrophy or spleen atrophy. The haematological parameters investigated showed that there was no significant differences between rat groups fed on either raw or irradiated legumes. It could be concluded that irradiation offers a good treatment for legumes as it has a beneficial effect to correct the poor growth for rats fed on raw beans during experimental period without any deleterious physiological effects. (author)
de Oliveira, Jonatas Rafael; de Aguiar Almeida, Rosilene Batista; das Graças Figueiredo Vilela, Polyana; de Oliveira, Felipe Eduardo; da Rocha, Rosilene Fernandes; Jorge, Antonio Olavo Cardoso; de Oliveira, Luciane Dias
2014-08-01
To evaluate the antimicrobial activity of Arctium lappa L. extract on Staphylococcus aureus, S. epidermidis, Streptococcus mutans, Candida albicans, C. tropicalis and C. glabrata. In addition, the cytotoxicity of this extract was analyzed on macrophages (RAW 264.7). By broth microdilution method, different concentrations of the extract (250-0.4 mg/mL) were used in order to determine the minimum microbicidal concentration (MMC) in planktonic cultures and the most effective concentration was used on biofilms on discs made of acrylic resin. The cytotoxicity A. lappa L. extract MMC was evaluated on RAW 264.7 by MTT assay and the quantification of IL-1β and TNF-α by ELISA. The most effective concentration was 250 mg/mL and also promoted significant reduction (log₁₀) in the biofilms of S. aureus (0.438 ± 0.269), S. epidermidis (0.377 ± 0.298), S. mutans (0.244 ± 0.161) and C. albicans (0.746 ± 0.209). Cell viability was similar to 100%. The production of IL-1β was similar to the control group (p>0.05) and there was inhibition of TNF-α (plappa L. extract was microbicidal for all the evaluated strains in planktonic cultures, microbiostatic for biofilms and not cytotoxic to the macrophages. Copyright © 2014 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Nam, Ji Young; Kim, Jae Hun; Lee, Ju Woon; Kim, Jin Kyu [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)
2010-12-15
Recently, Korean traditional raw rice wines (RRW) have received attention because they are a nutritious food with health properties. But the rapid deterioration of fermented RRW is one of the serious problems for brewing and marketing in the world beyond Korea. The goal of this study was to develop a way to enhance the quality and to lengthen the period of circulation of the RRW. A lactic acid bacterium was isolated from RRW. It was identified as Lactobacillus fermentum (98%) based on its biochemical properties, and 16S rRNA sequence. Treatments of RRW with gamma radiation and green tea extracts reduced the bacterial population except for yeasts and Lactobacillus in the RRW. This result suggested that the natural plant extracts and catechin products can be used as an effective natural storage agent.
International Nuclear Information System (INIS)
Nam, Ji Young; Kim, Jae Hun; Lee, Ju Woon; Kim, Jin Kyu
2010-01-01
Recently, Korean traditional raw rice wines (RRW) have received attention because they are a nutritious food with health properties. But the rapid deterioration of fermented RRW is one of the serious problems for brewing and marketing in the world beyond Korea. The goal of this study was to develop a way to enhance the quality and to lengthen the period of circulation of the RRW. A lactic acid bacterium was isolated from RRW. It was identified as Lactobacillus fermentum (98%) based on its biochemical properties, and 16S rRNA sequence. Treatments of RRW with gamma radiation and green tea extracts reduced the bacterial population except for yeasts and Lactobacillus in the RRW. This result suggested that the natural plant extracts and catechin products can be used as an effective natural storage agent
Monitor of ash content of coal with X-ray source
International Nuclear Information System (INIS)
Wawrzonek, L.
1983-01-01
The coal ash monitor is used on-line to measure the ash content of raw, washed and blended coals. The instrument consists of a presentation unit and electronic unit. In the presentation unit a compact layer of coal is formed and there is also a radiation measuring system. A plutonium 238 source is used and the backscattered X-rays are detected by a proportional counter. The count rate is processed in the electronic unit and displayed as the ash percentage in the coal. A wide range of Polish coals was analysed. The monitor was tested in a power plant over the period of one year. The ash content in the coal analysed was in the range 5 to 50%. The gauge readings were compared with the pyrolysis results. An accuracy of 3.2% (95% confidence limit) was reached. These results were not corrected for the free moisture content which varied in the range 5 to 15 %. (author)
Energy Technology Data Exchange (ETDEWEB)
Lewis, B.G.
1983-07-01
Trace element concentrations in shoots of tall fescue (Festuca arundinacea Schreb.) were correlated with extractable element concentrations in five southern Illinois coal-cleaning wastes limed to pH 6.5, in a greenhouse study to determine applicability of soil tests to coal-waste evaluation. There was little or no correlation between shoot concentrations of Fe, and Fe extracted from the wastes by dilute acid (r equals 0.60), DTPA at pH 6.4 (r equals 0.47) or DTPA at pH 8.4 (r equals -0.17). The corresponding r values for Mn were 0.94, 0.97, and 0.96; for Zn, 0.96, 0.96, and 0.88; and for Cu, 0.67, 0.90, and 0.88, respectively. Shoot B correlated well with hot water-soluble B(r equals 0.96) and acid-soluble B(r equals 0.91). Correlations for shoot Na were also good with water-soluble Na and acid-soluble Na (r equals 0.96 in both cases). Concentrations of Al, As, Cd, Ni, Pb, and Se in the shoots were well below reported upper critical levels, and similar to concentrations in the grass grown on a silt loam under the same greenhouse conditions. 21 references.
Panorama 2010: World coal resources
International Nuclear Information System (INIS)
Bessereau, G.; Saniere, A.
2010-01-01
At a time when the international community must face the key challenges posed by global warming as well as sustainability in general and many of our fellow citizens have come to look unfavorably upon fossil energies, the world is still heavily dependent on these energies to cover growing global energy demand. With proved reserves equivalent to more than 120 years at the present rate of extraction, with a better worldwide geographical distribution than petroleum, coal seems like an especially secure energy. While the renewable energies are showing rapid growth but still only represent a small proportion of the world energy mix, coal was the energy whose consumption grew at the fastest rate and for the sixth consecutive year. This gives cause for concern when one realizes that coal is also the most environmentally harmful energy at local level (its extraction generates pollution) and globally (its combustion emits CO 2 ). So how is it possible to reconcile the apparently irreconcilable, especially when, in some countries, coal represents the bulk of the energy resources? Since it is impossible to do without coal, the solution is to develop new 'clean coal' technologies, among which the capture and storage of CO 2 looks like a promising pathway. In the process, it will be necessary to overcome major technical, economic and social challenges. (author)
Polymers for combatting sudden outbursts in coal mines
Energy Technology Data Exchange (ETDEWEB)
Gadzhiev, G P; Sukhanov, V V
1988-02-01
Describes investigations in coal mines in the Donetsk basin (hazardous because of the high methane presence, the risk of outbursts of coal and gas, underground fires and the high dust levels) with the aim of studying the toxic emissions of formaldehyde and methanol produced when a urea formaldehyde resin binder is applied to the coal seam. The measurements taken led to the following recommendations: the amount of free formaldehyde in the binder should be limited to 0.5%; the use of concentrated (50%) solutions should be limited to 10 l per ton of coal in areas where there are geologic faults; underground workings need ventilation of at least 200 m/sup 3//min; the binder should be introduced to the borehole separately from the water and hardener; individual protection measures and wet dusting should be used during coal extraction; a period of not less than 4 months should elapse between application of the resin and commencement of coal extraction; there should be at least 80 m between the point where the binder is applied and the coal face.
Preparation and combustion of coal-water fuel from the Sin Pun coal deposit, southern Thailand
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-05-01
In response to an inquiry by the Department of Mineral Resources in Thailand, the Energy & Environmental Research Center (EERC) prepared a program to assess the responsiveness of Sin Pun lignite to the temperature and pressure conditions of hot-water drying. The results indicate that drying made several improvements in the coal, notably increases in heating value and carbon content and reductions in equilibrium moisture and oxygen content. The equilibrium moisture content decreased from 27 wt% for the raw coal to about 15 wt% for the hot-water-dried (HWD) coals. The energy density for a pumpable coal-water fuel (CWF) indicates an increase from 4500 to 6100 Btu/lb by hot-water drying. Approximately 650 lb of HWD Sin Pun CWF were fired in the EERC`s combustion test facility. The fuel burned extremely well, with no feed problems noted during the course of the test. Fouling and slagging deposits each indicated a very low rate of ash deposition, with only a dusty layer formed on the cooled metal surfaces. The combustor was operated at between 20% and 25% excess air, resulting in a flue gas SO{sub 2} concentration averaging approximately 6500 parts per million.
Sahara Coal: the fine art of collecting fines for profit
Energy Technology Data Exchange (ETDEWEB)
Schreckengost, D.; Arnold, D.
1984-09-01
Because of a change in underground mining methods that caused a considerable increase in the amount of fine sizes in the raw coal, Sahara Coal Co. designed and constructed a unique and simple fine coal system at their Harrisburg, IL prep plant. Before the new system was built, the overload of the fine coal circuit created a cost crunch due to loss of salable coal to slurry ponds, slurry pond cleaning costs, and operating and maintenance costs--each and every one excessive. Motivated by these problems, Sahara designed a prototype system to dewater the minus 28 mesh refuse. The success of the idea permitted fine refuse to be loaded onto the coarse refuse belt. Sahara also realized a large reduction in pond cleaning costs. After a period of testing, an expanded version of the refuse system was installed to dewater and dry the 28 mesh X 0 clean coal. Clean coal output increased about 30 tph. Cost savings justified the expenditures for the refuse and clean coal systems. These benefits, combined with increased coal sales revenue, paid back the project costs in less than a year.
Comprehensive evaluation on low-carbon development of coal enterprise groups.
Wang, Bang-Jun; Wu, Yan-Fang; Zhao, Jia-Lu
2017-12-19
Scientifically evaluating the level of low-carbon development in terms of theoretical and practical significance is extremely important to coal enterprise groups for implementing national energy-related systems. This assessment can assist in building institutional mechanisms that are conducive for the economic development of coal business cycle and energy conservation as well as promoting the healthy development of coal enterprises to realize coal scientific development and resource utilization. First, by adopting systematic analysis method, this study builds low-carbon development evaluation index system for coal enterprise groups. Second, to determine the weight serving as guideline and criteria of the index, analytic hierarchy process (AHP) is applied using integrated linear weighted sum method to evaluate the level of low-carbon development of coal enterprise groups. Evaluation is also performed by coal enterprise groups, and the process comprises field analysis and evaluation. Finally, industrial policies are proposed regarding the development of low-carbon coal conglomerate strategies and measures. This study aims mainly to guide the low-carbon development of coal enterprise groups, solve the problem of coal mining and the destruction of ecological environment, support the conservation of raw materials and various resources, and achieve the sustainable development of the coal industry.
Black coal. Annual report 2009; Steinkohle. Jahresbericht 2009. Globalisierung braucht Sicherheit
Energy Technology Data Exchange (ETDEWEB)
NONE
2010-07-01
The annual report 'Hard coal 2009 ' of the Gesamtverband Steinkohle (Essen, Federal Republic of Germany) contains contributions to the newest developments of Know-How according to the following topics: (a) German black coal; (b) Climate and energy; (c) International market tendencies with energy and raw materials; (d) Strategic risks of the global energy security (a guest contribution of Dr. Frank Umbach); (e) Challenges of the European and German energy policy.
Fungal degradation of coal as a pretreatment for methane production
Haider, Rizwan; Ghauri, Muhammad A.; SanFilipo, John R.; Jones, Elizabeth J.; Orem, William H.; Tatu, Calin A.; Akhtar, Kalsoom; Akhtar, Nasrin
2013-01-01
Coal conversion technologies can help in taking advantage of huge low rank coal reserves by converting those into alternative fuels like methane. In this regard, fungal degradation of coal can serve as a pretreatment step in order to make coal a suitable substrate for biological beneficiation. A fungal isolate MW1, identified as Penicillium chrysogenum on the basis of fungal ITS sequences, was isolated from a core sample of coal, taken from a well drilled by the US. Geological Survey in Montana, USA. The low rank coal samples, from major coal fields of Pakistan, were treated with MW1 for 7 days in the presence of 0.1% ammonium sulfate as nitrogen source and 0.1% glucose as a supplemental carbon source. Liquid extracts were analyzed through Excitation–Emission Matrix Spectroscopy (EEMS) to obtain qualitative estimates of solubilized coal; these analyses indicated the release of complex organic functionalities. In addition, GC–MS analysis of these extracts confirmed the presence of single ring aromatics, polyaromatic hydrocarbons (PAHs), aromatic nitrogen compounds and aliphatics. Subsequently, the released organics were subjected to a bioassay for the generation of methane which conferred the potential application of fungal degradation as pretreatment. Additionally, fungal-mediated degradation was also prospected for extracting some other chemical entities like humic acids from brown coals with high huminite content especially from Thar, the largest lignite reserve of Pakistan.
Study on the hydrothermal treatment of Shenhua coal
Energy Technology Data Exchange (ETDEWEB)
Zhicai Wang; Hengfu Shui; Zhanning Pei; Jinsheng Gao [Anhui University of Technology, Ma' anshan (China). School of Chemistry and Chemical Engineering
2008-04-15
In this paper, the hydrothermal treatment of Shenhua coal was carried out under 0.1 MPa (initial pressure) nitrogen and different temperature. Effects of hydrothermal treatment on the structure and the hydro-liquefaction activity of Shenhua coal were investigated by the ultimate and proximate analyses, the FTIR measurements and TG analyses of hydrothermally treated coals, and the characterizations of extraction and swelling properties, and the batch hydro-liquefaction of treated coal were also carried out. The results indicate that hydrothermal treatment above 200{sup o}C can increase the hydrogen content of treated coal and decrease the yield of volatiles and the content of ash, especially a large amount of CO and CH{sub 4} are found in gas products obtained by the hydrothermal treatment above 250{sup o}C. Hydrothermal treatment disrupts the weak covalent bond such as ether, ester and side-chain substituent by hydrolysis and pyrolysis, and changes the distribution of H-bond in coal. The swelling ratio and the Soxhlet extraction yield of treated coal decrease with the increase of hydrothermal treatment temperature. The conversion of liquefaction and the yield of CS{sub 2}/NMP mixed solvent extraction at ambient temperature are enhanced by hydrothermal treatment at 300{sup o}C. Therefore hydrogen donation reactions and the rupture of non-covalent bond and weak covalent bonds present in the process of hydrothermal treatment resulting in the changes of structure and reactivity of Shenhua coal. The results show that the hydro-liquefaction activity of Shenhua coal can be improved by hydrothermal pretreatment between 250{sup o}C and 300{sup o}C. 15 refs., 5 figs., 4 tabs.
International Nuclear Information System (INIS)
Anon.
1978-01-01
The Arid Lands Ecology Reserve and the Hanford National Environmental Research Park were established to promote the use of the Hanford Site for ecological research, especially studies related to energy technologies and their potential for environmental impacts. Coal is currently regarded as the most dependable interim source of energy in the United States. To meet expected demands, coal needs to be mined in large quantities and may be mined predominantly in locations of sparse precipitation. Often the most economical way to extract coal is through surface mining. It is expected that following coal extraction the pits will be filled with overburden, graded to approximate original contour, native topsoil applied to prescribed depths and planted with climatically adapted herbs, shrubs or trees. Because primary productivity in dry regions is characteristically low, it is realistic to expect, if the above procedure is followed, that the revegetated surfaces will also produce little phytomass in the years following restoration. Appropriate data are needed for accurate estimation of the economic feasibility of a particular restoration practice or its alternative. Research programs are discussed briefly
Grindability and combustion behavior of coal and torrefied biomass blends.
Gil, M V; García, R; Pevida, C; Rubiera, F
2015-09-01
Biomass samples (pine, black poplar and chestnut woodchips) were torrefied to improve their grindability before being combusted in blends with coal. Torrefaction temperatures between 240 and 300 °C and residence times between 11 and 43 min were studied. The grindability of the torrefied biomass, evaluated from the particle size distribution of the ground sample, significantly improved compared to raw biomass. Higher temperatures increased the proportion of smaller-sized particles after grinding. Torrefied chestnut woodchips (280 °C, 22 min) showed the best grinding properties. This sample was blended with coal (5-55 wt.% biomass). The addition of torrefied biomass to coal up to 15 wt.% did not significantly increase the proportion of large-sized particles after grinding. No relevant differences in the burnout value were detected between the coal and coal/torrefied biomass blends due to the high reactivity of the coal. NO and SO2 emissions decreased as the percentage of torrefied biomass in the blend with coal increased. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Yossifova, M.
1995-01-01
This paper is part of a complex petrographic, mineralogical and chemical investigation on Balkan bituminous coals and their solid waste products from coal preparation. The petrographic and phase-mineralogical composition in ten composite samples and four water extracts have been studied by optical microscopy, scanning electron microscopy and X-ray diffraction. 4 refs., 4 tabs
Morgan, T J; Herod, A A; Brain, S A; Chambers, F M; Kandiyoti, R
2005-11-18
Soil from a redundant coke oven site has been examined by extraction of soluble materials using 1-methyl-2-pyrrolidinone (NMP) followed by size exclusion chromatography (SEC) of the extracted material. The extracted material was found to closely resemble a high temperature coal tar pitch. Standard humic and fulvic acids were also examined since these materials are very soluble in NMP and would be extracted with pitch if present in the soil. Humic substances derived from peat samples and NMP-extracts of peats were also examined. The results show that the humic and fulvic substances were not extracted directly by NMP from peats. They were extracted using caustic soda solution and were different from the peat extracts in NMP. These results indicate that humic and fulvic acids were soluble in NMP in the protonated polyelectrolyte form but not in the original native polyelectrolyte form. The extraction of soil using NMP followed by SEC appears to be a promising method for identifying contamination by coal-based industries.
Queensland coal sets new records in 2001
International Nuclear Information System (INIS)
Smith, R.; Coffey, D.; Abbott, E.
2002-01-01
In 2001 the Queensland coal industry consolidated on record expansion in the export market over the past two years and again, increased its sales to overseas customers. New sales records were set in both the export and domestic markets. Unprecedented international demand for Queensland metallurgical coals coupled with improved prices and a favourable A$-US$ exchange rate created strong market conditions for the Queensland coal export industry, boosting confidence for further expansion and new developments. Australian coal exports in 2001 amounted to 194 Mt and are forecast to reach 275 million tonnes per annum (Mtpa) in 2020. The Queensland coal industry is poised to capture a significant share of this market growth. Queensland's large inventory of identified coal, currently estimated at more than 37 billion tonnes (raw coal m situ), is adequate to sustain the industry for many years and allow new opencut and underground mines to develop according to future market demand. Recent coal exploration successes are expected to add significant tonnage to the inventory (Coxhead, Smith and Coffey, 2002). Most of the coal exported from Queensland is mined in the Bowen Basin of central Queensland and additional tonnage of Walloon coal is exported by mines in the Moreton Basin and Surat Basin in south-east Queensland. The Walloon Coal Measures and its equivalents contain large resources of undeveloped opencut, high volatile, clean-burning thermal coal. The environmental advantages in the utilisation of these coals are now recognised and strong growth in production is expected in the near future for supply to both the domestic and export markets. Establishment of new rail transport and civil infrastructure will however, be required to support the development of large scale mining operations in this region
2013-01-01
The coal permeability is an important parameter in mine methane control and coal bed methane (CBM) exploitation, which determines the practicability of methane extraction. Permeability prediction in deep coal seam plays a significant role in evaluating the practicability of CBM exploitation. The coal permeability depends on the coal fractures controlled by strata stress, gas pressure, and strata temperature which change with depth. The effect of the strata stress, gas pressure, and strata temperature on the coal (the coal matrix and fracture) under triaxial stress and strain conditions was studied. Then we got the change of coal porosity with strata stress, gas pressure, and strata temperature and established a coal permeability model under tri-axial stress and strain conditions. The permeability of the No. 3 coal seam of the Southern Qinshui Basin in China was predicted, which is consistent with that tested in the field. The effect of the sorption swelling on porosity (permeability) firstly increases rapidly and then slowly with the increase of depth. However, the effect of thermal expansion and effective stress compression on porosity (permeability) increases linearly with the increase of depth. The most effective way to improve the permeability in exploiting CBM or extracting methane is to reduce the effective stress. PMID:24396293
Center for Coal-Derived Low Energy Materials for Sustainable Construction
Energy Technology Data Exchange (ETDEWEB)
Jewell, Robert; Robl, Tom; Rathbone, Robert
2012-06-30
The overarching goal of this project was to create a sustained center to support the continued development of new products and industries that manufacture construction materials from coal combustion by-products or CCB’s (e.g., cements, grouts, wallboard, masonry block, fillers, roofing materials, etc). Specific objectives includes the development of a research kiln and associated system and the formulation and production of high performance low-energy, low-CO2 emitting calcium sulfoaluminate (CAS) cement that utilize coal combustion byproducts as raw materials.
Directory of Open Access Journals (Sweden)
Ana Josane Dantas Fernandes
2012-01-01
Full Text Available The aim of this work was to evaluate the spectrophotometric methodology for determining the total flavonoid content (TFC in herbal drug and derived products from Bauhinia monandra Kurz. Several analytical parameters from this method grounded on the complex formed between flavonoids and AlCl3 were evaluated such as herbal amount (0.25 to 1.25 g; solvent composition (ethanol 40 to 80%, v/v; as well as the reaction time and AlCl3 concentration (2 to 9%, w/v. The method was adjusted to aqueous extractives and its performance studied through precision, linearity and preliminary robustness. The results showed an important dependence of the method response from reaction time, AlCl3 concentration, sample amount, and solvent mixture. After choosing the optimized condition, the method was applied for the matrixes (herbal material and extractives, showing precision lower than 5% (for both parameters repeatability and intermediate precision, coefficient of determination higher than 0.99, and no important influence could be observed for slight variations from wavelength or AlCl3 concentration. Thus, it could be concluded that the evaluated analytical procedure was suitable to quantify the total flavonoid content in raw material and aqueous extractives from leaves of B. monandra.
Energy Technology Data Exchange (ETDEWEB)
Yang, K.; Batts, B.D.; Wilson, M.A.; Gorbaty, M.L.; Maa, P.S.; Long, M.A.; He, S.J.X.; Attala, M.I. [Macquarie University, Macquarie, NSW (Australia). School of Chemistry
1997-10-01
A study of the reactivities of Australian coals and one American coal with methane or methane-hydrogen mixtures, in the range 350-400{degree}C and a range of pressures (6.0-8.3 MPa, cold) is reported. The effects of aluminophosphates (AIPO) or zeolite catalysts, with and without exchanged metals, on reactivity have also been examined. Yields of dichloromethane extractable material are increased by using a methane rather than a nitrogen atmosphere and different catalysts assist dissolution to various extends. It appears that surface exchanged catalysts are effective, but incorporating metals during AIPO lattice formation is detrimental. Aluminium phosphate catalysts are unstable to water produced during coal conversion, but are still able to increase extraction yields. For the American coal, under methane-hydrogen and a copper exchanged zeolite, 51.5% conversion was obtained, with a product selectivity close to that obtained under hydrogen alone, and with only 2% hydrogen consumption. The conversion under methane-hydrogen was also to that obtained under hydrogen alone, while a linear dependence of conversion on proportion of methane would predict a 43% conversion under methane-hydrogen. This illustrates a synergistic effect of the methane-hydrogen atmosphere for coal liquefaction using this catalyst systems. 31 refs., 5 figs., 7 tabs.
Ge, Lichao; Feng, Hongcui; Xu, Chang; Zhang, Yanwei; Wang, Zhihua
2018-02-01
This study investigates the influence of microwave irradiation on coal composition, pore structure, coal rank, and combustion characteristics of typical brown coals in China. Results show that the upgrading process significantly decreased the inherent moisture, and increased calorific value and fixed carbon content. After upgrading, pore distribution extended to micropore region, oxygen functional groups were reduced and destroyed, and the apparent aromaticity increased suggesting an improvement in the coal rank. Based on thermogravimetric analysis, the combustion processes of upgraded coals were delayed toward the high temperature region, and the temperatures of ignition, peak and burnout increased. Based on the average combustion rate and comprehensive combustion parameter, the upgraded coals performed better compared with raw brown coals and a high rank coal. In ignition and burnout segments, the activation energy increased but exhibited a decrease in the combustion stage.
Energy Technology Data Exchange (ETDEWEB)
NONE
1993-09-01
Discussions were given on the possibility of development as a coal supply source for Japan on the area centering around the Bowen coal field, whose coal exploration right was made open by the state government of Queensland, Australia in March 1993. Surveys were performed on information about the release of restrictions and the bid on the coal exploration right area RA55, the current status of the coal industry in Queensland, infrastructures, and the coal related government organizations. The following conclusions were arrived as a result of the surveys: the RA55 area to which the coal exploration right was made open has mining areas remaining, which are possible of supplying coals for an extended period of time from both of quantity and quality aspects; particularly in the 12 mining areas under the open bid, high-quality ordinary coal and raw material coal are in existence, whose potential is high; the state government and the related organizations are enthusiastic in promoting the development because the coal industry is the largest industry in the state; for new coal development, such assistance is expected as improvement in the infrastructures, deregulation, and favorable taxation system; and implementations are desired on acquisition of the exploration right, and exploration activities for new coal development. (NEDO)
Development, testing, and demonstration of an optimal fine coal cleaning circuit
International Nuclear Information System (INIS)
Mishra, M.; Placha, M.; Bethell, P.
1995-01-01
The overall objective of this project is to improve the efficiency of fine coal cleaning. The project will be completed in two phases: bench-scale testing and demonstration of four advanced flotation cells and; in-plant proof-of-concept (POC) pilot plant testing of two flotation cells individually and in two-stage combinations. The goal is to ascertain if a two-stage circuit can result in reduced capital and operating costs while achieving improved separation efficiency. The plant selected for this project, Cyprus Emerald Coal Preparation plant, cleans 1200 tph of raw coal. The plant produces approximately 4 million tonnes of clean coal per year at an average as received energy content of 30.2 MJ/Kg (13,000 Btu/lb)
Development, testing, and demonstration of an optimal fine coal cleaning circuit
Energy Technology Data Exchange (ETDEWEB)
Mishra, M.; Placha, M.; Bethell, P. [and others
1995-11-01
The overall objective of this project is to improve the efficiency of fine coal cleaning. The project will be completed in two phases: bench-scale testing and demonstration of four advanced flotation cells and; in-plant proof-of-concept (POC) pilot plant testing of two flotation cells individually and in two-stage combinations. The goal is to ascertain if a two-stage circuit can result in reduced capital and operating costs while achieving improved separation efficiency. The plant selected for this project, Cyprus Emerald Coal Preparation plant, cleans 1200 tph of raw coal. The plant produces approximately 4 million tonnes of clean coal per year at an average as received energy content of 30.2 MJ/Kg (13,000 Btu/lb).
Energy Technology Data Exchange (ETDEWEB)
Bellmann, H J; Schuettler, J; Jakisch, E
1981-11-01
This paper discusses the occurrence of silicified tree trunks and stumps in the Boehlen brown coal field. The trees, mainly Taxodium and Sequoia 25 million years old, are located within the top brown coal seam of the deposit and present a major obstacle to excavator operation, together with other forms of so-called 'brown coal quartzite'. The quartz of the silicified trees occurs as opal, cryptocrystalline quartz and low temperature quartz. The separate removal and disposal of this wood as well as efforts made to use selected wood as raw material are briefly summarized. Various products for interior house decoration have been manufactured from the wood. (4 refs.)
Energy Technology Data Exchange (ETDEWEB)
NONE
1987-03-01
The purpose of the present study is to elucidate coal quality features of different types of coals and identify the relationship between the coal quality features and the liquefaction characteristics by performing liquefaction characteristic evaluation tests. Based on the result therefrom, a method is established for coal field assessment that can estimate yield of liquefaction in coal fields and coal mines to serve for selection of coal types suitable for liquefaction. Coal quality feature surveys and liquefaction characteristics evaluation tests under the standard conditions have been completed on 48 coal types including Canadian, Australian and American coals. Elucidating the coal quality features of different coals can specify parameters for the coal quality features related to the liquefaction characteristics. Coal ranks elucidate the vitrinite reflectance, structure constituent factors the vitrinite content, composite factors the volatile matter content, quantity of heat generation, and number of H/C and O/C atoms. Investigating the relationship between the coal quality features and the liquefaction characteristics can provide fundamental data for primary screening of raw material coals for liquefaction. The result of the liquefaction characteristics evaluation test under the standard conditions can be the detailed comparative data relative to data derived from the simplified liquefaction characteristics test that is performed to estimate liquefaction yield of specific coal field and coal mine. (NEDO)
Preliminary Study on Benzoic Acid Adsorption from Crude Active Coals and Bentonite
Directory of Open Access Journals (Sweden)
Abbes Boucheta
2016-04-01
Full Text Available We studied the adsorption of pollutant benzoic acid by the modified bentonite of Maghnia (west of Algeria, and coal (Coal from the mines, southwest of Algeria, Bechar area under three forms, crude and activated. Kinetic data show that the balance of bentonite (as amended adsorbs organic acids better than activated and raw coal. Indeed, the intercalation of bentonite with benzoic acid causes an improvement in the texture of porous material, which allows its use in the adsorption of organic compounds. The adsorption isotherms (Langmuir and Freundlich indicate that the adsorption of benzoic acid by the coal and bentonite yielded results favorably. The results obtained showed the practical value of using the activated coal and bentonite (as amended in the field of remediation of water contaminated with organic pollutants
Kus, Jolanta; Meyer, Uwe; Ma, Jianwei; Chen-Brauchler, Dai
2010-05-01
At the coalfield of Wuda (Inner Mongolia, PR China) extensive underground coal fires cause widespread thermal and oxidative effects in coal seams. Within phase B of the Coal Fire Research Project of the Sino-German Initiative, methods for innovative fire-extinguishing technologies were investigated in multifaceted research approaches. Extensive investigations of oxidative and thermally affected coal seams in coal fire zone 18 were conducted in 2008 prior to application of new fire-extinguishing methods. We present results from the outcrop of coal seam No. 4 in the fire zone 18. The coal of seam No. 4 is of Early Permian age and belongs stratigraphically to the Shanxi Formation. The unaffected coal displays a high volatile bituminous A rank with a background value of random vitrinite reflectance ranging from 0.90 to 0.96 % Rr. Coal channel samples were coallected at actively extracted coal faces along multiple profiles with surface temperatures ranging from about 50° to 600°C. Microscopic examinations revealed a variety of products of coal exposure to the fire. Within coal samples, a marked rise in vitrinite reflectance from background values to 5.55% Rr (6.00 % Rmax) is encountered. In addition, a number of coal samples showed suppressed vitrinite reflectances ranging between 0.82 to 0.88% Rr. Further, seemingly heat unaffected coal samples display intensive development of oxidations rims at coal grain edges and cracks as well as shrinkage cracks and formation of iron oxides/hydroxides. Instead, thermally affected coal samples with higher coalification grade are further characterised by development of macropores (devolatilisation pores) in vitrinitic streaks, transformation of liptinite to meta-liptinite and micrinite as well as by natural coke particles of mostly porous nature and fine to coarse grained anisotropic mosaic. Coal petrographic investigations confirmed a hypothesis that both, oxidations as well as low temperature carbonisation govern the thermal
Coal business heats up in the US
Energy Technology Data Exchange (ETDEWEB)
Mohan, M. [CN Rail (United States)
2002-03-01
The fact that CN's Coal Business Unit moved just under 50 million t of coal in 2001 would have been unimaginable just a year earlier, as CN's coal franchise faced a number of challenges last year. On the metallurgical side, where bituminous coal is used in steel production, rising extraction costs in relation to national and international values forced the closure of three CN-served mines in 2000: TeckCominco's Quinteet mine in British Columbia; Smoky River Coal's Smoky River facility and Luscar's Gregg River mine, Alberta. As for thermal coal, utilities had been moving to alternative fuels, maintaining only low coal inventories, and there were few plans for new coal plants. The article explains how North America's railroad helps fuel growing demand for thermal and metallurgical coal. 5 photos.
Reactivity of mechanical activated coals for special utilization
Energy Technology Data Exchange (ETDEWEB)
Turcaniova, L.; Kadarova, J.; Imrich, P.; Liptaj, T.; Vidlar, J.; Vasek, J.; Foldyna, F.; Sitek, J.; Balaz, P. [Slovak Academy of Science, Kosice (Slovakia). Inst. of Geotechnology
2004-09-01
The paper presents the coal activation effect as disintegration in the nano-submicron range and destruction carbon structure. The Slovak brown coal activated in planetary mill is characterised by destruction of organic structure of coal. The biggest activation effect connected with the destruction of C-C bonds of sp{sup 3} carbons has been confirmed by {sup 13}C NMR spectroscopy in the chemical structure of humic acids extracted from the coal sample activated for a period of 60 min. The specific surface of humic acids is much smaller then that of mechanically activated sample from which they were extracted. The black Czech coal was activated by two stage disintegration. In the first stage of mechanochemical activation using Grinding Aqueous Caustic Leaching, GACL method, a fine dispersed semiproduct is formed with the size of particles from 2.5 to 9000 nm. The additional disintegration using water jet increases the effect of disintegration in the submicron area of the coal product. The volume distribution maximum achieves in this stage about 60 wt% of 750 nm grains.
Energy Technology Data Exchange (ETDEWEB)
Penner, Tara J.; Foght, Julia M. [Department of Biological Sciences, University of Alberta, Edmonton, Alberta (Canada); Budwill, Karen [Carbon and Energy Management, Alberta Innovates-Technology Futures, 250 Karl Clark Road, Edmonton, Alberta (Canada)
2010-05-01
Coalbed methane is an unconventional fuel source associated with certain coal seams. Biogenic methane can comprise a significant portion of the gas found in coal seams, yet the role of microbes in methanogenesis in situ is uncertain. The purpose of this study was to detect and identify major bacterial and archaeal species associated with coal sampled from sub-bituminous methane-producing coal beds in western Canada, and to examine the potential for methane biogenesis from coal. Enrichment cultures of coal samples were established to determine how nutrient amendment influenced the microbial community and methane production in the laboratory. 16S rRNA gene clone libraries were constructed using DNA extracted and amplified from uncultured coal samples and from methanogenic coal enrichment cultures. Libraries were screened using restriction fragment length polymorphism, and representative clones were sequenced. Most (> 50%) of the bacterial sequences amplified from uncultured coal samples were affiliated with Proteobacteria that exhibit nitrate reduction, nitrogen fixation and/or hydrogen utilization activities, including Pseudomonas, Thauera and Acidovorax spp., whereas enrichment cultures were dominated by Bacteroidetes, Clostridia and/or Lactobacillales. Archaeal 16S rRNA genes could not be amplified from uncultured coal, suggesting that methanogens are present in coal below the detection levels of our methods. However, enrichment cultures established with coal inocula produced significant volumes of methane and the archaeal clone libraries were dominated by sequences closely affiliated with Methanosarcina spp. Enrichment cultures incubated with coal plus organic nutrients produced more methane than either nutrient or coal supplements alone, implying that competent methanogenic consortia exist in coal beds but that nutrient limitations restrict their activity in situ. This report adds to the scant literature on coal bed microbiology and suggests how microbes may be
Directory of Open Access Journals (Sweden)
Young-Jin Kim
2018-05-01
Full Text Available The dry root of Angelica sinensis (Oliv. Diels, also known as “female ginseng”, is a popular herbal drug amongst women, used to treat a variety of health issues and cardiovascular diseases. The aim of this study is to evaluate the detailed molecular mechanism for anti-inflammatory effects of Angelica sinensis root water extract (ASW. The anti-inflammatory effect of ASW on lipopolysaccharide (LPS-induced RAW 264.7 mouse macrophages was evaluated by the tetrazolium-based colorimetric assay (MTT, Griess reagent assay, multiplex cytokine assay, real time reverse transcription polymerase chain reaction (RT-PCR, and Fluo-4 calcium assay. ASW restored cell viability in RAW 264.7 at concentrations of up to 200 µg/mL. ASW showed notable anti-inflammatory effects. ASW exhibited IC50 = 954.3, 387.3, 191.7, 317.8, 1267.0, 347.0, 110.1, 573.6, 1171.0, 732.6, 980.8, 125.0, and 257.0 µg/mL for interleukin (IL-6, tumor necrosis factor (TNF-α, monocyte chemotactic activating factor (MCP-1, regulated on activation, normal T cell expressed and secreted (RANTES, granulocyte colony-stimulating factor (G-CSF, granulocyte macrophage colony-stimulating factor (GM-CSF, vascular endothelial growth factor (VEGF, lipopolysaccharide-induced CXC chemokine (LIX, macrophage inflammatory protein (MIP-1α, MIP-1β, MIP-2, IL-10, and intracellular calcium, respectively. Additionally, ASW inhibited the LPS-induced production of nitric oxide and the LPS-induced mRNA expression of CHOP (GADD153, Janus kinase 2 (JAK2, signal transducers and activators of transcription 1 (STAT1, first apoptosis signal receptor (FAS, and c-Fos, NOS2, and PTGS2 (COX2 in RAW 264.7 significantly (p < 0.05. Data suggest that ASW exerts an anti-inflammatory effect on LPS-induced RAW 264.7 via NO-bursting/calcium-mediated JAK-STAT pathway.
Tribal communities and coal in Northeast India: The politics of imposing and resisting mining bans
International Nuclear Information System (INIS)
McDuie-Ra, Duncan; Kikon, Dolly
2016-01-01
Bans on coal mining have been implemented in two tribal majority states in India's north-east frontier; Nagaland and Meghalaya. In Nagaland the state government imposed the ban in an attempt to capture control of coal extraction and trade, while in Meghalaya India's National Green Commission imposed the ban over concern for the environment and labour conditions. In both cases local communities have opposed the bans, and in some areas resumed mining under the authority of tribal councils and powerful civil society actors. In this paper we explore the politics of coal extraction that resulted in these bans and the response of communities and authorities. In doing so we made three main arguments that contribute to understanding of coal and communities in frontier regions where state control is partial and the legacy of armed conflict is powerful. First, in both locations the majority of the coal mining activity has been initiated and managed by members of tribal communities rather than profit-driven outsiders. Second, in contrast to other contexts in India (notably Orissa and Jharkhand) where large state or private enterprises seek to modify the law to enable coal extraction, in Nagaland and Meghalaya it has been communities that resent and challenge state and national laws being applied to their lands. Third, the right to extract coal is connected to the right of tribal communities to determine what happens on their lands. - Highlights: • Tribal communities initiate and manage coal mining in Nagaland and Meghalaya. • Laws banning coal extraction have been challenged and resisted by local communities. • The right to extract coal is tied to protecting tribal land rights. • Tribal autonomy in coal policy is progressive, yet enables capture by local elites. • Where there has been regulation of coal mining it has come from unexpected sources.
Application of infiltrated LSCM-GDC oxide anode in direct carbon/coal fuel cells.
Yue, Xiangling; Arenillas, Ana; Irvine, John T S
2016-08-15
Hybrid direct carbon/coal fuel cells (HDCFCs) utilise an anode based upon a molten carbonate salt with an oxide conducting solid electrolyte for direct carbon/coal conversion. They can be fuelled by a wide range of carbon sources, and offer higher potential chemical to electrical energy conversion efficiency and have the potential to decrease CO2 emissions compared to coal-fired power plants. In this study, the application of (La, Sr)(Cr, Mn)O3 (LSCM) and (Gd, Ce)O2 (GDC) oxide anodes was explored in a HDCFC system running with two different carbon fuels, an organic xerogel and a raw bituminous coal. The electrochemical performance of the HDCFC based on a 1-2 mm thick 8 mol% yttria stabilised zirconia (YSZ) electrolyte and the GDC-LSCM anode fabricated by wet impregnation procedures was characterized and discussed. The infiltrated oxide anode showed a significantly higher performance than the conventional Ni-YSZ anode, without suffering from impurity formation under HDCFC operation conditions. Total polarisation resistance (Rp) reached 0.8-0.9 Ω cm(2) from DCFC with an oxide anode on xerogel and bituminous coal at 750 °C, with open circuit voltage (OCV) values in the range 1.1-1.2 V on both carbon forms. These indicated the potential application of LSCM-GDC oxide anode in HDCFCs. The chemical compatibility of LSCM/GDC with carbon/carbonate investigation revealed the emergence of an A2BO4 type oxide in place of an ABO3 perovskite structure in the LSCM in a reducing environment, due to Li attack as a result of intimate contact between the LSCM and Li2CO3, with GDC being stable under identical conditions. Such reaction between LSCM and Li2CO3 was not observed on a LSCM-YSZ pellet treated with Li-K carbonate in 5% H2/Ar at 700 °C, nor on a GDC-LSCM anode after HDCFC operation. The HDCFC durability tests of GDC-LSCM oxide on a xerogel and on raw bituminous coal were performed under potentiostatic operation at 0.7 V at 750 °C. The degradation mechanisms were
Shin, Jung-Hye; Ryu, Ji Hyeon; Kang, Min Jung; Hwang, Cho Rong; Han, Jaehee; Kang, Dawon
2013-08-01
Garlic has a variety of biologic activities, including anti-inflammatory properties. Although garlic has several biologic activities, some people dislike eating fresh raw garlic because of its strong taste and smell. Therefore, garlic formulations involving heating procedures have been developed. In this study, we investigated whether short-term heating affects the anti-inflammatory properties of garlic. Fresh and heated raw garlic extracts (FRGE and HRGE) were prepared with incubation at 25 °C and 95 °C, respectively, for 2 h. Treatment with FRGE and HRGE significantly reduced the LPS-induced increase in the pro-inflammatory cytokine concentration (TNF-α, IL-1β, and IL-6) and NO through HO-1 upregulation in RAW 264.7 macrophages. The anti-inflammatory effect was greater in FRGE than in HRGE. The allicin concentration was higher in FRGE than in HRGE. Allicin treatment showed reduced production of pro-inflammatory cytokines and NO and increased HO-1 activity. The results show that the decrease in LPS-induced NO and pro-inflammatory cytokines in RAW 264.7 macrophages through HO-1 induction was greater for FRGE compared with HRGE. Additionally, the results indicate that allicin is responsible for the anti-inflammatory effect of FRGE. Our results suggest a potential therapeutic use of allicin in the treatment of chronic inflammatory disease. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Tadahiro Etoh
2013-06-01
Full Text Available ABSTRACTBackground: Formulated Citrus Peel Extract (GL made from the peels of six citrus fruits available in Japan, namely navel oranges, citrus hassaku, citrus limon, citrus natsudaidai, citrus miyauchi and satsuma, was initially developed as a cosmetic product to protect skin from UV irradiation. Anecdotal evidences of anti-cancer property of GL have been reported by consumers based on the cases such as topical application for melanoma, and oral ingestion for prostate, lung and liver cancers.Those anecdotal reports stimulated us to investigate anti-tumorigenesis activity of GL. In the previous study, we reported that the topical application of GL inhibited DMBA/TPA-induced skin tumor formation by decreasing inflammatory gene parameters.Objective: In this study, we mainly investigated the effect of GL on translocation of NF-kB together with production of nitric-oxide and TNF-α induced by LPS in RAW 264.7 cells.Results: This investigation showed that GL decreased the release of TNF-α and nitric oxide from macrophage RAW264.7 cells stimulated by LPS in a dose-dependent manner. In addition, GL suppressed the expression of iNOS and nuclear translocation of NF-kB in RAW264.7 cells, inhibited the degradation of IκB-α, and scavenged hydroxyl radicals (DMPO/OH adduct in vitro.Conclusions: Our findings suggest that GL suppresses the inflammation in vitro, and exerts chemopreventive activity through the inhibition of production of TNF-α and iNOS proteins due to the inhibition of nuclear translocation of NF-kB and oxidative stress. GL appears to be a novel functional natural product capable of preventing inflammation and inflammation-associated tumorigenesis.Keywords: GL, Citrus peel extract, anti-inflammation, Nitric oxide, iNOS, NF-kB, TNF-α
Energy Technology Data Exchange (ETDEWEB)
Zubkova, Valentina [Jan Kochanowski University of Humanities and Sciences, Institute of Chemistry, Kielce (Poland)
2011-03-15
The use of chromatography in studies of coals, their progenitors and coal-related products was reviewed. The specificity of the coal structure was discussed. The use of extraction in preparing study samples was discussed paying special attention to the occurrence of undesirable phenomena such as aggregation of coal derivate molecules, resulting from the formation of their dimers and trimers, and degradation of polar solvents at temperatures above 350 C. The following ways of fractionating samples of coal materials were considered: thermal, solvent, column with the use of preparative size exclusive chromatography and preparative thin layer chromatography as well as membrane separation. The use of chromatography coupled with experimental techniques such as mass spectrometry, infrared spectroscopy, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and pyrolysis was analysed. (orig.)
Ha, Sang Keun; Sung, Jeehye; Choi, Inwook; Kim, Yoonsook
2016-01-01
Rice ( Oryza sativa ) is a major cereal crop in many Asian countries and an important staple food source. Rice hulls have been reported to possess antioxidant activities. In this study, we evaluated the antiinflammatory effects of rice hull extract and associated signal transduction mechanisms in lipopolysaccharide (LPS)-stimulated RAW 264.7 macrophages. We found that rice hull extract inhibited nitric oxide (NO) and prostaglandin E 2 by suppressing the expression of inducible NO synthase and cyclooxygenase-2, respectively. The release of interleukin-1β and tumor necrosis factor-α was also reduced in a dose-dependent manner. Furthermore, rice hull extract attenuated the activation of nuclear factor-kappa B (NF-κB), as well as the phosphorylation of mitogen-activated protein kinases, extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase (JNK), in LPS-stimulated RAW264.7 cells. This suggests that rice hull extract decreases the production of inflammatory mediators by downregulating ERK and JNK and the NF-κB signal pathway in RAW 264.7 cells. Rice hull extract inhibits the lipopolysaccharide-induced inflammatory response in RAW264.7 macrophages.Rice hull extract inhibited nitric oxide and prostaglandin E 2 by suppressing the expression of inducible NO synthase and cyclooxygenase-2, respectively.Rice hull extract exerted anti-inflammatory effect through inhibition of nuclear factor-kappa B, extracellular signal-regulated kinase and c-Jun N-terminal kinase signaling pathways.Rice hull extract may provide a potential therapeutic approach for inflammatory diseases. Abbreviations used: COX-2: cyclooxygenase-2, ERK: extracellular signal-regulated kinase, IκB: inhibitory kappa B, IL-1β: interleukin-1β, iNOS: inducible NO synthase, JNK: c-Jun N-terminal kinase, LPS: lipopolysaccharide, MAPKs: mitogen-activated protein kinases, NF-κB: nuclear factor-κB, NO: nitric oxide, PGE2: prostaglandin E2, RHE: rice hull extract, ROS: reactive oxygen species
STUDY OF SOLVENT AND CATALYST INTERACTIONS IN DIRECT COAL LIQUEFACTION; FINAL
International Nuclear Information System (INIS)
Michael T. Klein; William H. Calkins; Jasna Tomic
2000-01-01
To provide a better understanding of the roles of a solid catalyst and the solvent in Direct Coal Liquefaction, a small reactor was equipped with a porous-walled basket which was permeable to the solvent but was not permeable to the coal or solid catalyst. With this equipment and a high volatile bituminous coal it was found that direct contact between the catalyst in the basket and the coal outside the basket is not required for catalyzed coal liquefaction. The character of the solvent in this system makes a significant difference in the conversion of the coal, the better solvents being strong donor solvents. Because of the extensive use of thermogravimetric analysis in this laboratory, it was noted that the peak temperature for volatiles evolution from coal was a reliable measure of coal rank. Because of this observation, a variety of coals of a range of ranks was investigated. It was shown in this work that measuring the peak temperature for volatiles evolution was a quite precise indicator of rank and correlated closely with the rank value obtained by measuring vitrinite reflectance, a more difficult measurement to make. This prompted the desire to know the composition of the volatile material evolved as a function of coal rank. This was then measured by coupling a TGA to a mass spectrometer using laser activation and photoionization detection TG-PI-MS. The predominant species in volatiles of low rank coal turned out to be phenols with some alkenes. As the rank increases, the relative amounts of alkene and aromatic hydrocarbons increases and the oxygenated species decrease. It was shown that these volatiles were actually pyrolytic products and not volatilization products of the coal. Solvent extraction experiments coupled with Thermogravimetric-photoionization-mass spectrometry (TG-PI-MS) indicated that the low boiling and more extractable material are essentially similar in chemical types to the non-extractable portions but apparently higher molecular weight
Interrelating the breakage and composition of mined and drill core coal
Wilson, Terril Edward
Particle size distribution of coal is important if the coal is to be beneficiated, or if a coal sales contract includes particle size specifications. An exploration bore core sample of coal ought to be reduced from its original cylindrical form to a particle size distribution and particle composition that reflects, insofar as possible, a process stream of raw coal it represents. Often, coal cores are reduced with a laboratory crushing machine, the product of which does not match the raw coal size distribution. This study proceeds from work in coal bore core reduction by Australian investigators. In this study, as differentiated from the Australian work, drop-shatter impact breakage followed by dry batch tumbling in steel cylinder rotated about its transverse axis are employed to characterize the core material in terms of first-order and zeroth-order breakage rate constants, which are indices of the propensity of the coal to degrade during excavation and handling. Initial drop-shatter and dry tumbling calibrations were done with synthetic cores composed of controlled low-strength concrete incorporating fly ash (as a partial substitute for Portland cement) in order to reduce material variables and conserve difficult-to-obtain coal cores. Cores of three different coalbeds--Illinois No. 6, Upper Freeport, and Pocahontas No. 5 were subjected to drop-shatter and dry batch tumbling tests to determine breakage response. First-order breakage, characterized by a first-order breakage index for each coal, occurred in the drop-shatter tests. First- and zeroth-order breakage occurred in dry batch tumbling; disappearance of coarse particles and creation of fine particles occurred in a systematic way that could be represented mathematically. Certain of the coal cores available for testing were dry and friable. Comparison of coal preparation plant feed with a crushed bore core and a bore core prepared by drop-shatter and tumbling (all from the same Illinois No.6 coal mining
Bennett, Barbara Ellen
The effects of calcination heating rate and ultimate calcination temperature upon calcined coke and subsequent graphitic material microstructures were studied for materials prepared from three different precursors. The pitch precursors used were Mitsubishi AR pitch (a synthetic, 100% mesophase pitch), the NMP-extracted portion of a raw coal, and the NMP-extracted fraction of a coal liquefaction residue obtained from an HTI pilot plant. These materials were all green-coked under identical conditions. Optical microscopy confirmed that the Mitsubishi coke was very anisotropic and the HTI coke was nearly as anisotropic. The coke produced from the direct coal extract was very isotropic. Crystalline development during calcination heating was verified by high-temperature x-ray diffraction. Experiments were performed to ascertain the effects of varying calcination heating rate and ultimate temperature. It was determined that calcined coke crystallite size increased with increasing temperature for all three materials but was found to be independent of heating rate. The graphene interplanar spacing decreased with increasing temperature for the isotropic NMP-extract material but increased with increasing temperature for the anisotropic materials---Mitsubishi and HTI cokes. Graphene interplanar spacing was also found to be independent of heating rate. Calcined coke real densities were, likewise, found to be independent of heating rate. The anisotropic cokes (Mitsubishi and HTI) exhibited increasing real density with increasing calcination temperature. The NMP-extract coke increased in density up to 1050°C and then suffered a dramatic reduction in real density when heated to 1250°C. This is indicative of puffing. Since there was no corresponding disruption in the crystalline structure, the puffing phenomena was determined to be intercrystalline rather than intracrystalline. After the calcined cokes were graphitized (under identical conditions), the microstructures were re
Awang, Abd. Rahim; Marto, Aminaton; Makhtar, Ahmad Maher
2012-01-01
In Malaysia, coal has been used as a raw material to generate electricity since 1988. In the past, most of the wastage of coal burning especially the bottom ash was not managed properly as it was dumped in the waste pond and accumulated drastically.This paper focuses on some properties of coal ash mixtures (fly ash and bottom ash mixtures) from Tanjung Bin power plant. The characteristics studied were morphological properties, compaction behaviour and strength properties. Strength properties...
Environmental Impacts Of Zirab Coal Washing Plant, Mazandaran, Iran
Moore, F.; Esmaeili, A.
2009-04-01
Extraction and beneficiation operations associated with coal mining increase the rate of chemical reaction of waste material to air and water media. Zirab coal washing plant is located on the bank of the Cherat stream in Mazandaran province, Iran. coal Mined from central Alborz coalfield mines is not suitable for use in Iranian Steel Corporation. Hence, coal ash content is reduced by physical and chemical processes in this plant. These processes leave a large quantity of liquid and solid wastes that accumulate in waste dump and tailing dam. sediment and water samples taken from Sheshrudbar and Cherat streams and also from Talar river show high concentration of Cd, Mo and As in water samples of coal washing plant and the associated drainage. Eh-pH diagrams revealed the chemical species of elements in water. The enrichment factor and geoaccumulation index show that Cd, Hg, Mo and V are enriched in bottom sediments of the coal washing plant and decrease with increasing distance from the plant. Sequential extraction analysis Results of three sediment samples of Cherat stream show that silicate bound is the major phase in samples taken before and after the plant, but adjacent to the plant, organic bound is dominant. The high concentration of Cd and Mo in the water soluble phase, is noticeable and may result in high mobility and bioavailability of these elements. Mann-Whitney and Wilcoxon tests on six samples, before and after the coal washing plant support the obtained results. Keywords: Zirab; coal washing plant; Sequential extraction analysis; Mann-whitney; Wilcoxon; Enrichment factor; Geoaccumulation index.
Characterization of the coal derived humic acids from Mukah, Sarawak as soil conditioner
Directory of Open Access Journals (Sweden)
Fong Sim Siong
2006-01-01
Full Text Available In Malaysia, abundant coal resources were found in Sarawak and Sabah. The utilization of coal resources, to date, is emphasized on the energy productions. The non-energy utilization as soil conditioner is unexplored. Therefore, this study attempted to characterize the coal humic acids extracted from Mukah coal and to evaluate its properties as soil conditioner. The coal humic acids from the regenerated sample were also assessed. The results revealed that different extractants and concentrations influenced the properties of humic acids. The extraction with KOH at 0.5 mol L-1 produced humic acids with low ash content and high acidic functional groups, which are substantial as soil conditioner. However, the yield was low. Regeneration of coal sample with 10% nitric acids improved the yield to an average of 83.45%. The acidic functional groups of nitrohumic acids were improved with the ash content remained at a low level.
Energy Technology Data Exchange (ETDEWEB)
Garg, D.; Givens, E.N.; Schweighardt, F.K.; Curtis, C.W.; Guin, J.A.; Huang, W.J.; Shridharani, K.
1981-04-01
Results from screening studies showed that the pyrite samples separated from various coal seams had similar catalytic activity. The addition of all the pyrite samples to feed slurry increased conversion of coal and production of oil. A sample of fusinite was also tested for its liquefaction behavior with and without added pyrite. The addition of pyrite increased the conversion of fusinite and production of oil. These results show that pyrite catalyzes the conversion of fusinite and therefore improves overall coal conversion. Conversion of coal and oil production increased by impregnating coal with iron and molybdenum compounds. Coal conversion and oil production also increased with increasing concentration of both iron and molybdenum impregnated on coal. Addition of various transition metal sulfides increased coal conversion and oil production. Dramatic improvements were noted with nickel, vanadium, and tin sulfides. Addition of transition metal naphthenates produced mixed results; some of them improved coal conversion and others had no effect. The effect of metal concentration on coal conversion was also not clear. Deep cleaning of coal did not affect coal conversion, but it significantly reduced oil production. Addition of pyrite separated from coal to deep cleaned coal sample regained the oil production to the original value, i.e., oil produced from liquefaction of raw coal.Coal cleaned by oil agglomeration gave highest coal conversion and oil production. Basic and non-basic nitrogen compounds reduced the naphthalene hydrogenation activity of both Co-Mo-Al and sulfided Fe/sub 2/O/sub 3/. Sulfided Fe/sub 2/O/sub 3/ was inactive for denitrogenation of quinoline, and the reaction product mainly consisted of hydrogenated and hydrocracked quinoline. On the contrary, Co-Mo-Al was active for denitrogenation of quinoline, resulting in lower quinoline poisoning.
The reclamation of former coal mines and steelworks
International Nuclear Information System (INIS)
Richards, I.G.; Palmer, J.P.; Barratt, P.A.
1993-01-01
The book is a result of studies undertaken on behalf of the European Commission and examines the current 'state of the art' techniques for the restoration of despoiled lands arising from the coal and steel industries. Chapters are entitled: introduction; site assessment; investigation and treatment of mine workings and unstable ground; demolition and site clearance; colliery spoil heap characteristics; colliery spoil heap stability; colliery spoil heap combustion; colliery spoil washing; steel industry raw materials and wastes; coal carbonisation; treatment of contaminated soils; water quality; landform and earthworks; the establishment and care of vegetation; management of reclaimed land; a framework for site generation; and case studies. 266 refs
Energy Technology Data Exchange (ETDEWEB)
Freitas, T.P.; Silveira, P.C.; Rocha, L.G.; Rezin, G.T.; Rocha, J.; Citadini-Zanette, V.; Romao, P.T.; Dal-Pizzol, F.; Pinho, R.A.; Andrade, V.M.; Streck, E.L. [University Extremo Catarinense, Criciuma (Brazil)
2008-12-15
Several studies have reported biological effects of Mikania glomerata and Mikania laevigata, used in Brazilian folk medicine for respiratory diseases. Pneumoconiosis is characterized by pulmonary inflammation caused by coal dust exposure. In this work, we evaluated the effect of pretreatment with M. glomerata and M. laevigata extracts (MGE and MLE, respectively) (100 mg/kg, s.c.) on inflammatory and oxidative stress parameters in lung of rats subjected to a single coal dust intratracheal instillation. Rats were pretreated for 2 weeks with saline solution, MGE, or MLE. On day 15, the animals were anesthetized, and gross mineral coal dust or saline solutions were administered directly in the lung by intratracheal instillation. Fifteen days after coal dust instillation, the animals were killed. Bronchoalveolar lavage (BAL) was obtained; total cell count and lactate dehydrogenase (LDH) activity were determined. In the lung, myeloperoxidase activity, thiobarbituric acid-reactive substances (TBARS) level, and protein carbonyl and sulfhydryl contents were evaluated. In BAL of treated animals, we verified an increased total cell count and LDH activity. MGE and MLE prevented the increase in cell count, but only MLE prevented the increase in LDH. Myeloperoxidase and TBARS levels were not affected, protein carbonylation was increased, and the protein thiol levels were decreased by acute coal dust intratracheal administration. The findings also suggest that both extracts present an important protective effect on the oxidation of thiol groups. Moreover, pretreatment with MGE and MLE also diminished lung inflammatory infiltration induced by coal dust, as assessed by histopathologic analyses.
Coal conversion process by the United Power Plants of Westphalia
Energy Technology Data Exchange (ETDEWEB)
1974-08-01
The coal conversion process used by the United Power Plants of Westphalia and its possible applications are described. In this process, the crushed and predried coal is degassed and partly gasified in a gas generator, during which time the sulfur present in the coal is converted into hydrogen sulfide, which together with the carbon dioxide is subsequently washed out and possibly utilized or marketed. The residual coke together with the ashes and tar is then sent to the melting chamber of the steam generator where the ashes are removed. After desulfurization, the purified gas is fed into an external circuit and/or to a gas turbine for electricity generation. The raw gas from the gas generator can be directly used as fuel in a conventional power plant. The calorific value of the purified gas varies from 3200 to 3500 kcal/cu m. The purified gas can be used as reducing agent, heating gas, as raw material for various chemical processes, or be conveyed via pipelines to remote areas for electricity generation. The conversion process has the advantages of increased economy of electricity generation with desulfurization, of additional gas generation, and, in long-term prospects, of the use of the waste heat from high-temperature nuclear reactors for this process.
Energy Technology Data Exchange (ETDEWEB)
Machado, Maria Elisabete; Cappelli Fontanive, Fernando; Bastos Caramao, Elina; Alcaraz Zini, Claudia [Universidade Federal do Rio Grande do Sul, Instituto de Quimica, Porto Alegre, RS (Brazil); Oliveira, Jose Vladimir de [URI, Universidade Regional Integrada do Alto Uruguai e das Missoes, Erechim, RS (Brazil)
2011-11-15
The determination of organic sulfur compounds (OSC) in coal is of great interest. Technically and operationally these compounds are not easily removed and promote corrosion of equipment. Environmentally, the burning of sulfur compounds leads to the emission of SO{sub x} gases, which are major contributors to acid rain. Health-wise, it is well known that these compounds have mutagenic and carcinogenic properties. Bitumen can be extracted from coal by different techniques, and use of gas chromatography coupled to mass spectrometric detection enables identification of compounds present in coal extracts. The OSC from three different bitumens were tentatively identified by use of three different extraction techniques: accelerated solvent extraction (ASE), ultrasonic extraction (UE), and supercritical-fluid extraction (SFE). Results obtained from one-dimensional gas chromatography (1D GC) coupled to quadrupole mass spectrometric detection (GC-qMS) and from two-dimensional gas chromatography with time-of-flight mass spectrometric detection (GC x GC-TOFMS) were compared. By use of 2D GC, a greater number of OSC were found in ASE bitumen than in SFE and UE bitumens. No OSC were identified with 1D GC-qMS, although some benzothiophenes and dibenzothiophenes were detected by use of EIM and SIM modes. GC x GC-TOFMS applied to investigation of OSC in bitumens resulted in analytical improvement, as more OSC classes and compounds were identified (thiols, sulfides, thiophenes, naphthothiophenes, benzothiophenes, and benzonaphthothiophenes). The roof-tile effect was observed for OSC and PAH in all bitumens. Several co-elutions among analytes and with matrix interferents were solved by use of GC x GC. (orig.)
Environmental evaluation for sustainable development of coal mining in Qijiang, Western China
Energy Technology Data Exchange (ETDEWEB)
Si, Hu; Bi, Haipu [College of Resource and Environment Science, Chongqing University, Chongqing 400030 (China); Key Lab for the Exploitation of Southwestern Resource and the Environment Disaster Control Engineering, the Ministry of Education, Chongqing University, Chongqing 400030 (China); Li, Xiaohong; Yang, Chunhe [Key Lab for the Exploitation of Southwestern Resource and the Environment Disaster Control Engineering, the Ministry of Education, Chongqing University, Chongqing 400030 (China)
2010-03-01
Environmental degradation associated with mining activities may seriously threaten the health of local people and the sustainable development of coal mining, which may need to be addressed by improved environmental evaluation system. Based on analyzing environmental pollution from coal mining and the increasing need for raw coal, this paper establishes an environmental evaluation system, covering environmental situation, resource protection and economic benefit, for sustainable development in coal mining. This paper proposes methods for calculating the weight of each index and the environmental sustainable capability taking into account the method of Analytic Hierarchy Process (AHP). Finally, the index system is used to evaluate the environmental sustainability of coal mining in the Qijiang area, Western China, which has demonstrated the validity of the index system. It may also be useful as a tool to assess the environmental impact of mining areas, as well as a measure to promote sustainable development in coal mining. (author)
Energy Technology Data Exchange (ETDEWEB)
Maki, T.; Mae, K.; Okutsu, H.; Miura, K. [Kyushu University, Fukuoka (Japan). Faculty of Engineering
1996-10-28
In order to develop a high-efficiency coal pyrolysis method, flash pyrolysis was experimented on slurry prepared by using liquid-phase oxidation reformed coal and a methanol-based solvent mixture. Australian Morwell coal was used for the experiment. The oxidized coal, into which carboxyl groups have been introduced, has the condensation structure relaxed largely, and becomes highly fluid slurry by means of the solvent. Char production can be suppressed by making the oxidation-pretreated coal into slurry, resulting in drastically improved pyrolytic conversion. The slurry was divided into dissolved solution, dried substance, extracted residue, and residual slurry, which were pyrolized independently. The dissolved solution showed very high conversion. Improvement in the conversion is contributed by separating the dissolved substances (coal macromolecules) at molecular levels, coagulating the molecules, suppressing cross-link formation, and reducing molecular weight of the dissolved substances. Oxidized coal can be dissolved to 80% or higher by using several kinds of mixed solvents. As a result of the dissolution, a possibility was suggested on pyrolysis which is easy in handling and high in conversion. 7 refs., 6 figs., 2 tabs.
Prospects for coal and clean coal technologies in Vietnam
Energy Technology Data Exchange (ETDEWEB)
Baruya, P. [IEA Clean Coal Centre, London (United Kingdom)
2010-02-15
Vietnam's energy economy is largely served by traditional biofuels and oil products. Within the power generating sector, hydropower and gas-fired power dominate. However, Vietnam still maintains a 40 Mt/y coal industry, parts of which have recently undergone a long overdue programme of renovation and expansion. Vietnam has been a successful exporter of anthracite, with more than half of the country's production being shipped or barged to steel mills in Japan or power stations in southern China, as well as most other Far Eastern coal importers. The industry is due to take a different form. Opencast mining has recently accounted for around 60% of production but this mining method could be phased out as reserves become more difficult and costly to extract. A shift to underground mining is expected, with a greater emphasis on more modern and mechanised production techniques. Coal is located mainly in the coalfields in Quang Ninh in the north easternmost province of Vietnam. The lower rank reserves located within the Red River coalfields, close to the existing anthracite operations, may yield many more millions of tonnes of coal for exploitation. Underground coal gasification could possibly be exploited in the deeper reserves of the Red River Basin. While coal production could rapidly change in future years, the power generation sector is also transforming with the country's 12,000 MWe development programme for new coal-fired power capacity. The economy suffers from a threat of power shortages due to a lack of generating and transmission capacity, while inefficiencies blight both energy production and end-users. Delivering power to the regions of growth remains difficult as the economy and the demand for power outpaces power generation. While hydroelectric power is being pursued, coal is therefore becoming a growing factor in the future prosperity of the Vietnamese economy. 111 refs., 33 figs., 11 tabs.
Wang, Ning; Ingersoll, Christopher G.; Kunz, James L.; Brumbaugh, William G.; Kane, Cindy M.; Evans, R. Brian; Alexander, Steven; Walker, Craig; Bakaletz, Steve
2013-01-01
Sediment toxicity tests were conducted to assess potential effects of contaminants associated with coal mining or natural gas extraction activities in the upper Tennessee River basin and eastern Cumberland River basin in the United States. Test species included two unionid mussels (rainbow mussel, Villosa iris, and wavy-rayed lampmussel, Lampsilis fasciola, 28-d exposures), and the commonly tested amphipod, Hyalella azteca (28-d exposure) and midge, Chironomus dilutus (10-d exposure). Sediments were collected from seven test sites with mussel communities classified as impacted and in proximity to coal mining or gas extraction activities, and from five reference sites with mussel communities classified as not impacted and no or limited coal mining or gas extraction activities. Additional samples were collected from six test sites potentially with high concentrations of polycyclic aromatic hydrocarbons (PAHs) and from a test site contaminated by a coal ash spill. Mean survival, length, or biomass of one or more test species was reduced in 10 of 14 test samples (71%) from impacted areas relative to the response of organisms in the five reference samples. A higher proportion of samples was classified as toxic to mussels (63% for rainbow mussels, 50% for wavy-rayed lampmussels) compared with amphipods (38%) or midge (38%). Concentrations of total recoverable metals and total PAHs in sediments did not exceed effects-based probable effect concentrations (PECs). However, the survival, length, or biomasses of the mussels were reduced significantly with increasing PEC quotients for metals and for total PAHs, or with increasing sum equilibrium-partitioning sediment benchmark toxic units for PAHs. The growth of the rainbow mussel also significantly decreased with increasing concentrations of a major anion (chloride) and major cations (calcium and magnesium) in sediment pore water. Results of the present study indicated that (1) the findings from laboratory tests were generally
International Nuclear Information System (INIS)
Lewis, B.G.; Gnanapragasam, N.; Stevens, M.L.
1994-01-01
Solid residue from fossil fuel mining and utilization generally present little hazard to human health. However, because of the high volumes generated, they do pose unique disposal problems in terms of land use and potential degradation of soil and water. In the specific case of wastes from precombustion coal cleaning, the materials include sulfur compounds that undergo oxidation when exposed to normal atmospheric conditions and microbial action and then produce sulfuric acid. The wastes also contain compounds of metals and nonmetals at concentrations many times those present in the original raw coal. Additionally, the residues often contain coal particles and fragments that combust spontaneously if left exposed to the air, thus contributing to the air pollution that the coal cleaning process was designed to prevent. Federal and state efforts in the United States to ameliorate the thousands of hectares covered with these wastes have focused on neutralizing the acidity with limestone and covering the material with soil. The latter procedure creates additional degraded areas, which were originally farmland or wildlife habitat. It would seem preferable to reclaim the coal refuse areas without earth moving. The authors describe here experiments with neutralization of coal waste acidity using an alkaline waste derived from the extraction of oil from oil shale to grow soya beans (Glycine max. [L]) on a mixture of wastes and sewage sludge. Yield of plant material and content of nutrients an potentially toxic elements in the vegetation and in the growth mixtures were determined; results were compared with those for plants grown on an agricultural soil, with particular focus on boron
Directory of Open Access Journals (Sweden)
David Lloyd
2013-01-01
Full Text Available Using a recent case study of community reaction to proposed coal-seam gas mining in eastern Australia, we illustrate the role of community views in issues of natural resource use. Drawing on interviews, observations and workshops, the paper explores the anti-coal-seam gas social movement from its stages of infancy through to being a national debate linking community groups across and beyond Australia. Primary community concerns of inadequate community consultation translate into fears regarding potential impacts on farmland and cumulative impacts on aquifers and future water supply, and questions regarding economic, social and environmental benefits. Many of the community activists had not previously been involved in such social action. A recurring message from affected communities is concern around perceived insufficient research and legislation for such rapid industrial expansion. A common citizen demand is the cessation of the industry until there is better understanding of underground water system interconnectivity and the methane extraction and processing life cycle. Improved scientific knowledge of the industry and its potential impacts will, in the popular view, enable better comparison of power generation efficiency with coal and renewable energy sources and better comprehension of the industry as a transition energy industry. It will also enable elected representatives and policy makers to make more informed decisions while developing appropriate legislation to ensure a sustainable future.
Patra, Santanu; Roy, Ekta; Madhuri, Rashmi; Sharma, Prashant K.
2017-05-01
The present work represents the preparation of imprinted magnetic reduced graphene oxide and applied it for the selective removal of Eu (III) from local coal mines area. A simple solid phase extraction method was used for this purpose. The material shows a very high adsorption as well as removal efficiency towards Eu (III), which suggest that the material have potential to be used in future for their real time applications in removal of Eu (III) from complex matrices.
Dry processing versus dense medium processing for preparing thermal coal
CSIR Research Space (South Africa)
De Korte, GJ
2013-10-01
Full Text Available of the final product. The separation efficiency of dry processes is, however, not nearly as good as that of dense medium and, as a result, it is difficult to effectively beneficiate coals with a high near-dense content. The product yield obtained from some raw...
Wu, Naiying; Gao, Wei; Lian, Yunhe; Du, Jingjing; Tie, Xiaowei
2017-12-15
Occurrence of Rhodamine B (RhB) contamination in paprika caused by agricultural materials during the vegetation process has been reported. It may transfer during the process of active compounds extraction, and eventually exist in final products. Herein, the re-distribution of RhB during the extraction process was assessed in terms of RhB contents, as well as mass, color value and capsaicinoids yield of each process. Results revealed that natural RhB contamination at 0.55-1.11µg/kg originated from raw paprika fruit then transferred with the extraction proceeded. About 95.5% of RhB was found in red oleoresin. After separation of red oleoresin, 91.6% of RhB was remained in capsicum oleoresin, only 3.7% in paprika red. These results were consistent with total capsaicinoids recovery of each product. The RhB levels in edible capsicum oleoresin in our present study at 0.01-0.34µg/kg did not exceed the legal limits established by the European Union. Copyright © 2017 Elsevier Ltd. All rights reserved.
Research on the Composition and Distribution of Organic Sulfur in Coal.
Zhang, Lanjun; Li, Zenghua; Yang, Yongliang; Zhou, Yinbo; Li, Jinhu; Si, Leilei; Kong, Biao
2016-05-13
The structure and distribution of organic sulfur in coals of different rank and different sulfur content were studied by combining mild organic solvent extraction with XPS technology. The XPS results have shown that the distribution of organic sulfur in coal is related to the degree of metamorphism of coal. Namely, thiophenic sulfur content is reduced with decreasing metamorphic degree; sulfonic acid content rises with decreasing metamorphic degree; the contents of sulfate sulfur, sulfoxide and sulfone are rarely related with metamorphic degree. The solvent extraction and GC/MS test results have also shown that the composition and structure of free and soluble organic sulfur small molecules in coal is closely related to the metamorphic degree of coal. The free organic sulfur small molecules in coal of low metamorphic degree are mainly composed of aliphatic sulfides, while those in coal of medium and high metamorphic degree are mainly composed of thiophenes. Besides, the degree of aromatization of organic sulfur small molecules rises with increasing degree of coalification.
Biological and physiological changes in rats fed some raw and irradiated legumes
International Nuclear Information System (INIS)
Elwakeil, F.A.; Farag, H.; Sharabash, M.T.M.; Diaa Eldin, M.; Mahrous, S.R.
1995-01-01
Body weight of rats fed on raw kidney beans, soybeans, broad beans, chick peas and lupines suftered from poor growth due to the presence of some anti nutritional factors in these pulses. The processed soybeans, kidney beans, bread beans and lupines at 10 KGy could not correct the growth of rats kept on their diets for 8 weeks while irradiated chick beans at 10 KGy indicating some effect of the irradiation in this respect. When extracts of raw legumes were injected by intraperitoneal route, Ld 5 0 were found to be 125, 300, and 1800 mg/kg, for raw kidney beans, raw soybeans, and raw broad beans respectively. However, injecting the extracts of raw chick peas and raw lupines did not kill the rats even at higher concentration levels of 300 mg/kg. Similar results were obtained with irradiated chick peas and lupines (10 KGy). Meanwhile, post irradiation treatment of kidney beans, soybeans, and broad beans caused the Ld 5 0 to be 250,400, and 2000 mg/kg for the above pulses respectively. Both raw and irradiated kidney beans and raw soybeans were most active in stimulating pancreas and liver growth and reducing spleen weight. Irradiated soybeans showed a moderate, but significant, increase in liver weight only. However, rats which received both raw and irradiated broad beans, chick peas and lupins in their diets did not suffer any pancreatic, liver hypertrophy or spleen atrophy. The hematological parameters investigated showed that there was no significant differences between rat groups fed on either the raw or the irradiated legumes. 5 tabs
International Nuclear Information System (INIS)
Saginov, A.S.; Adilov, K.N.; Akhmetbekov, Sh.U.
1997-01-01
Non-mine technology of coal gas seams exploitation is new geological technological method of complex exploitation of coal gas deposits. The method allows sequentially to extract hydrocarbon resources in technological aggregative-mobile condensed states. According to natural methane content in seams the technology includes: methane extraction from sorption volume where it is bounded up with coal; gas output intensification of coal is due to structural changes of substance at the cost of physico-chemical treatment of seam; increase of seam permeability by the methods of active physical and physico-chemical actions on coal seam (hydro-uncovering, pneumatic hydro action etc.). Pilot testing shows efficiency of well mastering with help of depth pumps. In this case works of action of pumping out of operating liquid and gas extraction from coal seam are integrated
Result of design and test operation of a coal boiler at Hyogo Refinery
Energy Technology Data Exchange (ETDEWEB)
Miura, Yasuhiko; Sato, Noriyuki
1987-05-01
This boiler is the first coal boiler for the oil refineries in Japan (Installed in Oct., 1986 at Idemitsu Petrochemical Co.) Causes for using coal as a fuel are a conversion to less expensive fuel and offering a technical service to the users of coal through the combustion of coal and learning of a handling technique. The type of boiler is Babcock single barrel radiant type and has 150 t/d capacity with single fuel combustion of coal. Auxiliary equipments are a pulverizer, a transportation and storage unit, a denitration unit, a dust collector, a desulfurization unit, and an ash disposal unit. Main considerations in the design are measures for the security of finely pulverized coal, clogging prevention for coal and ash. A test operation revealed 7 % of combustible loss and 160 - 250 ppm of NOx content at a charge inlet of denitration unit. Actual operation exhibited no clogging at the denitration unit of troubles due to scaling. Design for raw materials is to blend 4 imported coals (from Australia and Canada, etc) and 3 Japanese ones. (7 figs, 2 tabs)
Coking coal of Checua Lenguazaque area
International Nuclear Information System (INIS)
Arboleda Otalora, Carlos Ariel
1987-06-01
In this report a summary of the main characteristics of the coal of the area of Checua-Samaca is presented. Using the main works carried out on this area, the most important geologic, physical-chemical, technological and petrographic aspects are compiled that are considered essential to carry out a technical evaluation of these coal and all the analyses they take to conclude that in this area, bituminous coal are presented with very good coking properties, on the other hand, it is demonstrated by the use that is given to the coal extracted by the small existent mining. However, keeping in mind the demands of the international market of the coking coal, it becomes necessary to improve the existent geologic information to be able to make reliable stratigraphic correlations
Quarterly coal statistics of OECD countries
Energy Technology Data Exchange (ETDEWEB)
1992-04-27
These quarterly statistics contain data from the fourth quarter 1990 to the fourth quarter 1991. The first set of tables (A1 to A30) show trends in production, trade, stock change and apparent consumption data for OECD countries. Tables B1 to B12 show detailed statistics for some major coal trade flows to and from OECD countries and average value in US dollars. A third set of tables, C1 to C12, show average import values and indices. The trade data have been extracted or derived from national and EEC customs statistics. An introductory section summarizes trends in coal supply and consumption, deliveries to thermal power stations; electricity production and final consumption of coal and tabulates EEC and Japanese steam coal and coking coal imports to major countries.
Possibilities of production of smokeless fuel via carbonization of Czech coals
Energy Technology Data Exchange (ETDEWEB)
Buchtele, J.; Straka, P. [Inst. of Rock Structure and Mechanics, Prague (Czechoslovakia)
1995-12-01
It was consumed 48 -51 % of hard coal (total output 28 - 30 Mt/year) in a long period for the production of coke. It appears to be anomaly in comparison with other coke producers in Europe and in the world, it was predeterminated by {open_quotes}steel conception{close_quotes} of state`s economics. The production of coke reached 10-11 Mt/year in former Czechoslovakia in the period 1970-1990. A considerable quantity 1.2 - 1.7 Mt/year of produced coke was utilized for heating. In comparison, 7-5.4 Mt coke/year was it in Poland for the heating. Al coke production is realized on the basis of Czech hard coals mined in the southern part of Upper Silesian Coal District. The coke production is operated in multi-chamber system with full recovery of chemical products (gas, raw tar, raw benzene, amonium etc.). The future trend of smokeless fuel production in Czech Republic makes for to the non-recovery coke oven, it means to two-product processes (coke + reduction gas, coke + electricity and so on). Jewell--Thompson coke oven (hard coal) and Salem oven (ignites) represent nonrecovery nowadays. The possibility of it`s application in Czech Republic are discussed. Jumbo coking reactor system (European project No. 500 to the Eureka programme) produces primarily metallurgical coke. The strong Clean Air Act suspends the production of smokeless fuel in multi-chamber system also in Czech Republic for the future period 2010-2020.
Partial oxidation of methane to methanol over catalyst ZSM-5 from coal fly ash and rice husk ash
Directory of Open Access Journals (Sweden)
Mirda Yanti Fusia
2017-01-01
Full Text Available Methane is one of the greenhouse gases that can be converted into liquid fuels such as methanol to retain most of the energy of methane and produce a cleaner environment. The conversion of methane to methanol using ZMS-5 represents a breakthrough in the utilization of methane. However, material sources for zeolite synthesis as catalyst usually are pro-analysis grade materials, which are expensive. Therefore, in this research, coal fly ash and rice husk ash were used as raw materials for mesoporous ZSM-5 zeolite synthesis. First, coal fly ash and rice husk were subjected to pre-treatment to extract silicate (SiO44− and aluminate (AlO45− and impurities separation. The ZSM-5 zeolite was synthesized through hydrothermal treatment using two types of templates. After ZSM-5 was synthesized, it was modified with Cobalt through impregnation method. The catalytic activity of both ZSM-5 and Co/ZSM-5 zeolites as heterogeneous catalysts in partial oxidation of methane were preliminary tested and compared with that commercial one. The result showed that the zeolite catalyst ZSM-5 from fly ash coal and rice husk ash has the potential to be used as catalysts in the partial oxidation of methane to methanol.
Reflections on prospective raw materials and materials with regard to the Czech Republic
International Nuclear Information System (INIS)
Schejbal, C.; Palas, M.
1997-01-01
Reflections on prospective mineral raw materials and materials must rest upon the expected demographic evolution, the evaluation of economic development and the development of manufacturing technologies and materials corresponding to them, trends in the consumption of mineral raw materials and possibilities of securing them. The evaluation of the given factors under conditions of the Czech Republic shows that one of the decisive prerequisites to transforming the Czech economy is to assure the fuel and energy security of the state. In addition to emphasis put on traditional and newly developed technologies of utilization of domestic resources of coal and the development of nuclear power, a diversification of supplies of oil and gas is necessary. Moreover, it is necessary to ensure domestic resources of raw materials to some prospective material areas, or to provide these raw materials by means of imports and/or entrepreneurial activity abroad. As far as raw materials for building and industrial rocks are concerned, it is necessary to support the exploitation and home utilization through laws and suitable economic tools at respecting environmental limitations. With non-traditional prospective raw materials, it will be desirable to promote exploration and mining especially in those cases when a precondition exists for the securing of sufficient reserves or when reserves are already known
Richaud, R; Lazaro, M J; Lachas, H; Miller, B B; Herod, A A; Dugwell, D R; Kandiyoti, R
2000-01-01
1-Methyl-2-pyrrolidinone (NMP) was used to extract samples of wood (forest residue) and coal; the extracts were analysed by inductively coupled plasma mass spectrometry (ICP-MS) using two different sample preparation methods, in order to identify trace elements associated with the organic part of the samples. A sample of fly ash was similarly extracted and analysed in order to assess the behaviour of the mineral matter contained within the wood and coal samples. 32% of the biomass was extracted at the higher temperature and 12% at room temperature while only 12% of the coal was extracted at the higher temperature and 3% at room temperature. Less than 2% of the ash dissolved at the higher temperature. Size exclusion chromatograms of the extracts indicated the presence of significant amounts of large molecular mass materials (>1000 mu) in the biomass and coal extracts but not in the ash extract. Trace element analyses were carried out using ICP-MS on the acid digests prepared by 'wet ashing' and microwave extraction. Sixteen elements (As, Ba, Be, Cd, Co, Cr, Cu, Ga, Mn, Mo, Ni, Pb, Sb, Se, V and Zn) were quantified, in the samples before extraction, in the extracts and in the residues. Concentrations of trace elements in the original biomass sample were lower than in the coal sample while the concentrations in the ash sample were the highest. The major trace elements in the NMP extracts were Ba, Cu, Mn and Zn from the forest residue; Ba, Cu, Mn, Pb and Zn from the coal; Cu and Zn from the ash. These elements are believed to be associated with the organic extracts from the forest residue and coal, and also from the ash. Be and Sb were not quantified in the extracts because they were present at too low concentrations; up to 40% of Mn was extracted from the biomass sample at 202 degrees C, while Se was totally extracted from the ash sample. For the forest residue, approximately 7% (at room temperature) and 45% (at 202 degrees C) of the total trace elements studied were
International Nuclear Information System (INIS)
Watson, A.P.
1982-01-01
In spite of steadily expanding coal development in this decade in the USA, there has been little systematic assessment of occupational and public health implications of increased production in specific regions of the USA. Preliminary analysis of a prototype Appalachian area is presented. Anderson County, Tennessee, the prototype area chosen for evaluation, lies in the Upper East Tennessee Coalfield. This county is uniquely suited for study since every process of the coal fuel cycle (extraction, transport, combustion, power production and waste disposal) takes place within the county boundary. By extensive exploitation of both surface and underground methods of extraction, this county has maintained a leading position in Tennessee's coal production for several years. Concepts of energy analysis and systematized data presentation were used to convert information gathered from diverse sources into comparable energy units (kcal). Concepts and methodology implemented in the analysis can be applied most appropriately to existing conditions in other counties of the Appalachian Coal Basin. Findings are presented for calendar year 1978. For the year of study, the major energy loss to the county was depletion of the coal resource base by use of inefficient mining techniques (a loss of 10.5x10 12 kcal fuel equivalents). Another loss is to community health, which is depleted by lost productivity of, and compensation payments to, victims of mining accidents and occupational disease such as 'black lung' (15x10 9 kcal). Another countywide depletion process is roadbed and bridge deterioration caused by large volumes of heavy coal-haul vehicular traffic (10x10 9 kcal). These losses are being borne mainly by residents of the Appalachian host region, with little systematic compensation by consumers of the coal resource. It is expected that these losses will increase in magnitude as national coal use increases. (author)
A brief introduction to the Tavan Tolgoi coking coal deposit
Energy Technology Data Exchange (ETDEWEB)
1992-01-01
The Tavan Tolgoi coal field is located near the settlement Tsogttsetsii in the South Gobi province, 540 km south of Ulaanbaatar and 96 km east of Dalan Zadgad. The nearest railway stations are Choir, Khar-Airag and Sainshand and are located a distance of about 390 to 450 km, to the northeast of the coal field. An unimproved road connects the property with the railway stations at this time. The Tavan Tolgoi coal field covers 220 square km of land. The coal bearing strata contains 16 coal seams from 3 to 30 m thick with a total average thickness of 165 m. As per the geological survey, the proven and probable reserves of the Tavan Tolgoi coal field are estimated at 5 billion tonnes. Of the 5 billion tonnes, 77.5% or 3.9 billion tonnes are expected to be washed and will produce 2.16 billion tonnes (55% wash recovery) of clean coking coal. 1.41 billion tonnes or 36% of the washed coal will be middlings and available for steam coal, and 9% or 0.33 billion tonnes will be washed or gob. The remaining 1.2 billion tonnes can be mined and sold raw as steam coal. Water, electricity supplies and transportation will have to be developed. Research on this has been done. Markets are envisaged to be within Mongolia, and in the Asia Pacific region. Foreign investment will be needed. 5 figs., 6 tabs.
International Nuclear Information System (INIS)
Colley, Peter
1997-01-01
The Australian coal industry has frequently been described as a perpetual case of 'profitless prosperity'. Industry literature on the subject usually sources this problem to government charges on the industry and to labour costs. However, these alleged problems do not appear to have diminished the enthusiasm for new investment in the industry. This study argues that a more complete explanation must look at who is investing in the Australian coal industry, what the rationale for those investments is, how they are financed and what their specific profitability is. The particular examination made here is of the quasi-integration investment practices of Japanese trading, steel and power companies -easily the largest group of buyers in the international coal trade. The close co-operation between Japanese government and business in this strategic raw materials industry is documented, as are the methods of subsidised investment. An examination of the financial performance of these companies' Australian coal investments shows that the profitability of their investments is significantly below that of most other investors in Australian mining over a recent 5-year period. Taken together, there is significant support for the conclusion that a process of co-ordinated quasi-integration has taken place and that the principal aim of such investments has not been to make profits from coal-mining. (author)
Coal cleaning: a viable strategy for reduced carbon emissions and improved environment in China?
International Nuclear Information System (INIS)
Glomsroed, Solveig; Wei Taoyuan
2005-01-01
China is a dominant energy consumer in global context and current energy forecasts emphasise that China's future energy consumption also will rely heavily on coal. The coal use is the major source of the greenhouse gas CO 2 and particles causing serious health damage. This paper looks into the question if coal washing might work as low cost strategy for both CO 2 and particle emission reductions. Coal washing removes dirt and rock from raw coal, resulting in a coal product with higher thermal energy and less air pollutants. Coal cleaning capacity has so far not been developed in line with the market potential. In this paper an emerging market for cleaned coal is studied within a CGE model for China. The macro approach catches the repercussions of coal cleaning through increased energy efficiency, lower coal transportation costs and crowding out effect of investments in coal washing plants. Coal cleaning stimulates economic growth and reduces particle emissions, but total energy use, coal use and CO 2 emissions increase through a rebound effect supported by the vast reserve of underemployed labourers. A carbon tax on fossil fuel combustion has a limited effect on total emissions. The reason is a coal leakage to tax exempted processing industries
Directory of Open Access Journals (Sweden)
Guangmeng Wang
2015-12-01
Full Text Available In this study, an extraction method and environmental scanning electron microscopy (SEM are employed to reveal the changes in the occurrence mode of fluorine in a coal-fired power plant in Inner Mongolia, China. The different occurrence states of fluorine during coal combustion and emission show that fluorine in coal mainly assumes insoluble inorganic mineral forms. The results illustrate that the three typical occurrence modes in coal are CaF2, MgF2 and AlF3. The fluorine in fly ash can be captured by an electrostatic precipitator (EPS or a bag filter. In contrast, the gaseous fluorine content in flue gas is only in the range of several parts per million; thus, it cannot be used in this study. The occurrence mode of fluorine in bottom ash and slag is inorganic villiaumite (e.g., soluble NaF, KF and insoluble CaF2 which is difficult to break down even at high temperatures. The occurrence mode of fluorine with the highest content in fly ash is physically adsorbed fluorine along the direction of the flue gas flow. The insoluble inorganic mineral fluoride content in fly ash is also high, but the gradually increasing fluorine content in fly ash is mainly caused by physical adsorption. Fluorine in the coal-fired power plant discharges mostly as solid products; however, very little fluorine emitted into the environment as gas products (HF, SiF4 cannot be captured. The parameters used in this study may provide useful references in developing a monitoring and control system for fluorine in coal-fired power plants.
The role of the MHTGR in coal gasification processes
International Nuclear Information System (INIS)
McDonald, C.F.
1988-01-01
The nation will likely become more and more dependent on natural gas and while this will stimulate new exploration and increased production, the time will surely come when global depletion of this resource will require the use of synthetic natural gas (SNG) to support the established nationwide infrastructure. The U.S. is estimated to have coal reserves nearing 500 billion tons that are mineable on an economic base. The Modular High Temperature Gas-Cooled Reactor (MHTGR) steam cycle plant can play an important role in the process of producing SNG from coal to supplement natural gas supplies. Coal-to-gas plants need heat (predominantly steam) and electricity for operation. This energy can be supplied by combustion of coal (autothermal process), but this results in a loss of more than 40% of the coal energy input. From the resource conservation standpoint, using an MHTGR heat source is attractive since much of the valuable fossil raw material can be substituted by clean nuclear energy. Also, air pollution is lowered drastically. This paper highlights how a near-term steam cycle MHTGR plant, based on proven technology and operating in a cogeneration mode, could be coupled with existing coal gasification processes to meet the projected increase in gas consumption in an environmentally acceptable manner
Preparation and extraction of sloping seams without leaving inter-drift coal pillars
Energy Technology Data Exchange (ETDEWEB)
Artamonov, N S; Bormotov, I N; Brovko, I I
1977-10-01
A description is given of mining three coal seams in the Kuznetsk Basin without leaving coal pillars because they could not withstand the stress of the induced reference pressure. This system reduced coal losses in 1976 in comparison to 1970 and eliminated local accumulations of methane by withdrawing it through the excavated area. The system was noted to have the disadvantage of additional expenditures for timber supports. 2 figures.
Posibility for application of froth separation process in beneficiation of raw minerals
Directory of Open Access Journals (Sweden)
František Tichánek
2005-11-01
Full Text Available Froth separation belongs to newer flotation methods that are suitable for the separation of fine-grained raw materials whose size is too big for regular flotation. The technology of coarse-grained flotation has a significant economical effect because it allows a decrease in the costs for mineral processing. The article concerneds the posibility of using the froth separation process during the mineral processing of bituminous coal.
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-10-01
Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in October 1997: primary energy total consumption has increased (mobile year) of 0.8%, at the same rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 8.1%), slight increase for petroleum products (+ 1.3%), slowing down increase for gas (+ 2.1%) and moderate increase for electricity (+ 1.4%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a high energy cost level with + 22% on one year, reaching 87.8 billions Francs, to be compared to 72.0 in October 1996
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-09-01
Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in September 1997: primary energy total consumption has increased (mobile year) of 1.1%, at the same rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 5.9%), slight increase for petroleum products (+ 0.8%), strong increase for gas (+ 3.2%) and moderate increase for electricity (+ 1.7%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a record energy cost level with + 30% on one year, reaching 89.2 billions Francs, to be compared to 68.5 in September 1996
Preparation of sintered foam materials by alkali-activated coal fly ash.
Zhao, Yelong; Ye, Junwei; Lu, Xiaobin; Liu, Mangang; Lin, Yuan; Gong, Weitao; Ning, Guiling
2010-02-15
Coal fly ash from coal fired power stations is a potential raw material for the production of ceramic tiles, bricks and blocks. Previous works have demonstrated that coal fly ash consists mainly of glassy spheres that are relatively resistant to reaction. An objective of this research was to investigate the effect of alkali on the preparation process of the foam material. Moreover, the influence of foam dosage on the water absorption, apparent density and compressive strength was evaluated. The experimental results showed that homogenous microstructures of interconnected pores could be obtained by adding 13 wt.% foaming agent at 1050 degrees C, leading to foams presenting water absorption, apparent density and compressive strength values of about 126.5%, 0.414 g/cm(3), 6.76 MPa, respectively.
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-06-01
The feasibility study was conducted on a model project in Vietnam, aimed at solving the environmental pollution problems resulting from use of coal by demonstrating and disseminating the Japan's environmental technologies in the Southeast Asian countries. The feasibility study was conducted for the Cua Ong Coal Preparation Enterprise, which has the largest coal preparation capacity in Vietnam and port facilities. It is treating raw coal from 10 coal mines for classification and preparation, and shipping coal of various types that meet the standards for domestic use and export. The survey results point out that unrecovered coal remains in waste water discharged from the coal preparation plants to pollute the sea area, and that quantity of the refuse increases because of the unrecovered coal it contains. The environmental technologies needed to introduce include modification to variable wave pattern type jigging separator, refuse height measuring instrument and automatic controller, circulating heavy medium gravimeter, highly functional settling pond, and flocculent facilities. (NEDO)
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-12-31
The 1996 annual progress report, from the French Department of Energy, reviews the key points of the French policy for energy and raw materials: competitiveness, environmental protection, long term supply safety, and public service. 1996 was marked by positive results for the French energy industry, difficulties for the oil refining industry, and a new impetus for renewable energies. Five surveys are presented: nuclear safety in Eastern Europe, the european directive on electric power domestic market, evolution of the oil market, conditions of refining in France, and restructuring of the Mine bureau (BRGM). 40 prominent facts are briefly reviewed, concerning sustainable energy development, nuclear energy, electric power and gas, coal, oil products, raw materials. Diagrams on energy and raw materials are also included
Energy Technology Data Exchange (ETDEWEB)
NONE
1996-12-31
The 1996 annual progress report, from the French Department of Energy, reviews the key points of the French policy for energy and raw materials: competitiveness, environmental protection, long term supply safety, and public service. 1996 was marked by positive results for the French energy industry, difficulties for the oil refining industry, and a new impetus for renewable energies. Five surveys are presented: nuclear safety in Eastern Europe, the european directive on electric power domestic market, evolution of the oil market, conditions of refining in France, and restructuring of the Mine bureau (BRGM). 40 prominent facts are briefly reviewed, concerning sustainable energy development, nuclear energy, electric power and gas, coal, oil products, raw materials. Diagrams on energy and raw materials are also included
Viscosity change of coal during carbonization; Sekitan tanka hannochu no nendo henka
Energy Technology Data Exchange (ETDEWEB)
Matsuoka, K.; Hayashi, J.; Kumagai, H.; Chiba, T. [Hokkaido University, Sapporo (Japan). Center for Advanced Research of Energy Technology
1996-10-28
In relation to softening, melting and solidification of coal during heating, the effect of heating rate and nitrogen gas pressure on viscosity change, and change with time in the yield of pyridine extract were measured to study the mechanism of viscosity change. In experiment, six kinds of coals were used, and their needle penetration and dilatation were measured using compacted disk coal pellets. The coking and slight coking coal heat-treated under the same condition as the above experiment were used for pyridine extraction. As the experimental result, the apparent viscosity during coal heating was dependent on heating rate, nitrogen pressure and coal kinds. The minimum apparent viscosity decreased with an increase in heating rate and nitrogen pressure, and approached to a constant value. Like apparent viscosity change, the yield of pyridine extract was also dependent on heating rate, and its temperature range nearly agreed with that of apparent viscosity change. It was suggested that the viscosity is dependent on not only the mass fraction of plastic intermediate but also temperature and the relation between plastic intermediate and other components. 3 refs., 5 figs., 1 tab.
Analysis of polynuclear aromatic hydrocarbons from coal fly ash
International Nuclear Information System (INIS)
Purushothama, S.; Pan, W.-P.; Riley, J.T.; Lloyd, W.G.
1998-01-01
The objective of this work is to compare various extraction and quantification techniques for the determination of adsorbed polynuclear aromatic hydrocarbons (PAHs) on coal ash. Aliquots of a 'clean' fly ash from coal combustion doped with four PAHs have been extracted, using three solvents, three methods and three GC/MS programs. Factorial analysis shows solvent to extert the greatest primary effect: CH 2 Cl 2 > toluene much-gt o-xylene. Highest recoveries were obtained using the reflux slurry extraction procedure with CH 2 Cl 2 and a relatively fast (20 degree C/min) temperature ramp to 310 degree C. With both CH 2 Cl 2 and toluene solvents, ultrasonic assisted extraction affords the best repeatability
Prevention and forecasting of coal, rock and gas bursts in mines of Donets Coal Basin in USSR
Energy Technology Data Exchange (ETDEWEB)
Swidzinski, A
1977-11-01
Coal and methane bursts as well as sandstone and methane bursts are typical for the Donets Coal Basin. The most effective way of forecasting coal and methane bursts is drilling holes (3.5 m long, 45 mm diameter) and measuring the initial speed of gas outflow (5 litres/min gas outflow is a critical value). Additional parameters in this method are: coal firmness and porosity as well as thickness of coal bed. Forecasting sandstone and gas bursts is based on taking rock samples while drilling. When a sample 1 meter long consists of 30 to 40 so called discs, the danger of outburst is substantial, with the decreasing number of discs the probability of bursts also decreases. The following methods of prevention are used in the Donets Coal Basin: preparatory extraction of a layer protecting another layer below or above, where there is a danger of gas burst. This method is effective in 50% of all cases. Other methods include: filling coal beds with water under high pressure (average norm 25 1 water per 1 m
Directory of Open Access Journals (Sweden)
Martin Ernesto Kalaw
2016-07-01
Full Text Available Geopolymers are inorganic polymers formed from the alkaline activation of amorphous alumino-silicate materials resulting in a three-dimensional polymeric network. As a class of materials, it is seen to have the potential of replacing ordinary Portland cement (OPC, which for more than a hundred years has been the binder of choice for structural and building applications. Geopolymers have emerged as a sustainable option vis-à-vis OPC for three reasons: (1 their technical properties are comparable if not better; (2 they can be produced from industrial wastes; and (3 within reasonable constraints, their production requires less energy and emits significantly less CO2. In the Philippines, the use of coal ash, as the alumina- and silica- rich geopolymer precursor, is being considered as one of the options for sustainable management of coal ash generation from coal-fired power plants. However, most geopolymer mixes (and the prevalent blended OPC use only coal fly ash. The coal bottom ash, having very few applications, remains relegated to dumpsites. Rice hull ash, from biomass-fired plants, is another silica-rich geopolymer precursor material from another significantly produced waste in the country with only minimal utilization. In this study, geopolymer samples were formed from the mixture of coal ash, using both coal fly ash (CFA and coal bottom ash (CBA, and rice hull ash (RHA. The raw materials used for the geopolymerization process were characterized using X-ray fluorescence spectroscopy (XRF for elemental and X-ray diffraction (XRD for mineralogical composition. The raw materials’ thermal stability and loss on ignition (LOI were determined using thermogravimetric analysis (TGA and reactivity via dissolution tests and inductively-coupled plasma mass spectrometry (ICP analysis. The mechanical, thermal and microstructural properties of the geopolymers formed were analyzed using compression tests, Fourier transform infra-red spectroscopy (FTIR
Kalaw, Martin Ernesto; Culaba, Alvin; Hinode, Hirofumi; Kurniawan, Winarto; Gallardo, Susan; Promentilla, Michael Angelo
2016-07-15
Geopolymers are inorganic polymers formed from the alkaline activation of amorphous alumino-silicate materials resulting in a three-dimensional polymeric network. As a class of materials, it is seen to have the potential of replacing ordinary Portland cement (OPC), which for more than a hundred years has been the binder of choice for structural and building applications. Geopolymers have emerged as a sustainable option vis-à-vis OPC for three reasons: (1) their technical properties are comparable if not better; (2) they can be produced from industrial wastes; and (3) within reasonable constraints, their production requires less energy and emits significantly less CO₂. In the Philippines, the use of coal ash, as the alumina- and silica- rich geopolymer precursor, is being considered as one of the options for sustainable management of coal ash generation from coal-fired power plants. However, most geopolymer mixes (and the prevalent blended OPC) use only coal fly ash. The coal bottom ash, having very few applications, remains relegated to dumpsites. Rice hull ash, from biomass-fired plants, is another silica-rich geopolymer precursor material from another significantly produced waste in the country with only minimal utilization. In this study, geopolymer samples were formed from the mixture of coal ash, using both coal fly ash (CFA) and coal bottom ash (CBA), and rice hull ash (RHA). The raw materials used for the geopolymerization process were characterized using X-ray fluorescence spectroscopy (XRF) for elemental and X-ray diffraction (XRD) for mineralogical composition. The raw materials' thermal stability and loss on ignition (LOI) were determined using thermogravimetric analysis (TGA) and reactivity via dissolution tests and inductively-coupled plasma mass spectrometry (ICP) analysis. The mechanical, thermal and microstructural properties of the geopolymers formed were analyzed using compression tests, Fourier transform infra-red spectroscopy (FTIR), scanning
Trace and major element pollution originating from coal ash suspension and transport processes.
Popovic, A; Djordjevic, D; Polic, P
2001-04-01
Coal ash obtained by coal combustion in the "Nikola Tesla A" power plant in Obrenovac, near Belgrade, Yugoslavia, is mixed with water of the Sava river and transported to the dump. In order to assess pollution caused by leaching of some minor and major elements during ash transport through the pipeline, two sets of samples (six samples each) were subjected to a modified sequential extraction. The first set consisted of coal ash samples taken immediately after combustion, while the second set was obtained by extraction with river water, imitating the processes that occur in the pipeline. Samples were extracted consecutively with distilled water and a 1 M solution of KCl, pH 7, and the differences in extractability were compared in order to predict potential pollution. Considering concentrations of seven trace elements as well as five major elements in extracts from a total of 12 samples, it can be concluded that lead and cadmium do not present an environmental threat during and immediately after ash transport to the dump. Portions of zinc, nickel and chromium are released during the ash transport, and arsenic and manganese are released continuously. Copper and iron do not present an environmental threat due to element leaching during and immediately after the coal ash suspension and transport. On the contrary, these elements, as well as chromium, become concentrated during coal ash transport. Adsorbed portions of calcium, magnesium and potassium are also leached during coal ash transport.
Is There Any Future For Coal Power Plants In Europe?
Directory of Open Access Journals (Sweden)
A. V. Zimakov
2017-01-01
Full Text Available The article deals with the policies of EU countries towards coal power plants as well as practical steps taken by their governments. Coal power plants are widely considered to be environmentally harmful which confronts with environmental policies of the EU suggesting Europe-wide cuts of greenhouse gas emissions. Based on that assumption a number of EU countries such asBelgium,Austria,Portugal,Dania,Finland,SwedenandUKare striving to phase out coal power plants and achieved significant progress on this path replacing coal with other generation sources. On the other hand, other EU members are lagging behind as coal phase-out is not an urgent item of their political agenda. This situation is typical forIreland,Netherlands,Italy,Croatia,SloveniaandSlovakia. Domestic coal extracting industry can pose a significant hindering factor for a coal power plants phase-out and can effectively block the process. This is the case inBulgaria,Romania,Hungary,CzechRepublic,GreeceandPoland. ButGermany, which also has a well-developed coal industry, transforms its energy sector towards a green one cutting the share of coal in the generation mix. If this effort of the German government proves successful it will deliver a positive transformation model for other EU countries with a large share of coal in generation-mix due to domestic coal extraction industry. The analysis of the political and economic (both macro and micro processes leads to conclusion that there is no unity among EU member states in their approach towards coal fired power plants phase-out. This will allow for coal power plants to retain their market share in a short to medium term. But in the longer run one can expect a significant decrease of coal fired generation inEurope, even in the countries traditionally dependent on coal.
Barnhart, Elliott; Davis, Katherine; Varonka, Matthew; Orem, William; Fields, Matthew
2016-04-01
Coal bed methane (CBM) is a relatively clean source of energy but current CBM production techniques have not sustained long-term production or produced enough methane to remain economically practical with lower natural gas prices. Enhancement of the in situ microbial community that actively generates CBM with the addition of specific nutrients could potentially sustain development. CBM production more than doubled from native microbial populations from Powder River Basin (PRB) coal beds, when yeast extract and several individual components of yeast extract (proteins and amino acids) were added to laboratory microcosms. Microbial populations capable of hydrogenotrophic (hydrogen production/utilization) methanogenesis were detected in situ and under non-stimulated conditions. Stimulation with yeast extract caused a shift in the community to microorganisms capable of acetoclastic (acetate production/utilization) methanogenesis. Previous isotope analysis from CBM production wells indicated a similar microbial community shift as observed in stimulation experiments: hydrogenotrophic methanogenesis was found throughout the PRB, but acetoclastic methanogenesis dominated major recharge areas. In conjunction, a high proportion of cyanobacterial and algal SSU rRNA gene sequences were detected in a CBM well within a major recharge area, suggesting that these phototrophic organisms naturally stimulate methane production. In laboratory studies, adding phototrophic (algal) biomass stimulated CBM production by PRB microorganisms similarly to yeast extract (~40μg methane increase per gram of coal). Analysis of the British thermal unit (BTU) content of coal from long-term incubations indicated >99.5% of BTU content remained after CBM stimulation with either algae or yeast extract. Biomimicry of in situ algal CBM stimulation could lead to technologies that utilize coupled biological systems (photosynthesis and methane production) that sustainably enhance CBM production and generate
Effect of hydrothermal dewatering on the slurryability of brown coals
International Nuclear Information System (INIS)
Yu Yujie; Liu Jianzhong; Wang Ruikun; Zhou Junhu; Cen Kefa
2012-01-01
Highlights: ► Brown coals are upgraded by hydrothermal dewatering. ► The moisture content and oxygen functional groups decrease during the process. ► The point of zero charge and the contact angle rise as the temperature increases. ► The products were highly hydrophobic. ► The improvement on slurryability of solid products were examined. - Abstract: Two brown coals from China were dewatered under hydrothermal dewatering (HTD) conditions at 250–320 °C for 1 h in a 2 L autoclave. The hydrothermally dewatered products were used to prepare coal water slurry (CWS) with a lower viscosity than brown raw coal slurry. Moreover, the coal rank and heat value of the brown coal increased as the inherent moisture and oxygen content decreased during the HTD process. The maximum solid concentration of CWS prepared from XiMeng coal increased from 45.7% to 59.3%, whereas that of CWS prepared from BaoTou coal increased from 53.7% to 62.1%, after being dewatered at 320 °C. The improvement in the slurryability of brown coal significantly depended on the final temperature of the HTD process, the mechanism of which can be explained by the chemical analysis of oxygen functional groups, zeta potential, and the contact angle of the surface between coal and water. The oxygen functional groups, the oxygen/carbon ratio and hydrogen/carbon ratio in brown coal decreased, indicating that the coal rank was upgraded during the HTD process. As a result, both the point of zero charge and the contact angle increased, implying that the HTD products were highly hydrophobic.
Geomechanics of subsidence above single and multi-seam coal mining
Directory of Open Access Journals (Sweden)
A.M. Suchowerska Iwanec
2016-06-01
Full Text Available Accurate prediction of surface subsidence due to the extraction of underground coal seams is a significant challenge in geotechnical engineering. This task is further compounded by the growing trend for coal to be extracted from seams either above or below previously extracted coal seams, a practice known as multi-seam mining. In order to accurately predict the subsidence above single and multi-seam longwall panels using numerical methods, constitutive laws need to appropriately represent the mechanical behaviour of coal measure strata. The choice of the most appropriate model is not always straightforward. This paper compares predictions of surface subsidence obtained using the finite element method, considering a range of well-known constitutive models. The results show that more sophisticated and numerically taxing constitutive laws do not necessarily lead to more accurate predictions of subsidence when compared to field measurements. The advantages and limitations of using each particular constitutive law are discussed. A comparison of the numerical predictions and field measurements of surface subsidence is also provided.
Energy Technology Data Exchange (ETDEWEB)
NONE
1995-03-01
Focusing on the present status and future of coal demand in Central/South American countries and the coal trade between Central/South American countries and the U.S., the paper described the present status and future of coal demand there and the effects on Japan. Export of Colombian coal will amount to approximately 30-35 million tons in 2000. Venezuelan coal 10-20 million tons. The U.S. imported good-quality general coal low in sulfur content, 3.08 tons from Columbia and 1.39 tons from Venezuela. Coal export from the U.S. to Central/South America was mostly of raw material coal, 5 million tons in 1993 and 5.39 million tons in 1994. General coal was 180,000 tons. The U.S. has no plans of increasing US coal export to Central/South America. But it is safely predicted that Columbia and Venezuela will increase coal export to Europe in the future. It will bring about decrease in export of US coal to Europe, which connects with increasing pressure for the coal trade amount of Japan. 21 figs., 47 tabs.
Development of Continuous Solvent Extraction Processes For Coal Derived Carbon Products
Energy Technology Data Exchange (ETDEWEB)
Elliot B. Kennel; Dady B. Dadyburjor; Gregory W. Hackett; Manoj Katakdaunde; Liviu Magean; Alfred H. Stiller; Robert C. Svensson; John W. Zondlo
2006-09-30
In this reporting period, tonnage quantities of coal extract were produced but solid separation was not accomplished in a timely manner. It became clear that the originally selected filtration process would not be effective enough for a serious commercial process. Accordingly, centrifugation was investigated as a superior means for removing solids from the extract. Results show acceptable performance. Petrographic analysis of filtered solids was carried out by R and D Carbon Petrography under the auspices of Koppers and consultant Ken Krupinski. The general conclusion is that the material appears to be amenable to centrifugation. Filtered solids shows a substantial pitch component as well as some mesophase, resulting in increased viscosity. This is likely a contributing reason for the difficulty in filtering the material. Cost estimates were made for the hydotreatment and digestion reactors that would be needed for a 20,000 ton per year demonstration plants, with the aid of ChemTech Inc. The estimates show that the costs of scaling up the existing tank reactors are acceptable. However, a strong recommendation was made to consider pipe reactors, which are thought to be more cost effective and potentially higher performance in large scale systems. The alternate feedstocks for coke and carbon products were used to fabricate carbon electrodes as described in the last quarterly report. Gregory Hackett successfully defended his MS Thesis on the use of these electrodes in Direct Carbon Fuel Cell (DCFC), which is excerpted in Section 2.4 of this quarterly report.
Literature survey of properties of synfuels derived from coal
Reynolds, T. W.; Niedzwiecki, R. W.; Clark, J. S.
1980-02-01
A literature survey of the properties of synfuels for ground-based gas turbine applications is presented. Four major concepts for converting coal into liquid fuels are described: solvent extraction, catalytic liquefaction, pyrolysis, and indirect liquefaction. Data on full range syncrudes, various distillate cuts, and upgraded products are presented for fuels derived from various processes, including H-coal, synthoil, solvent-refined coal, donor solvent, zinc chloride hydrocracking, co-steam, and flash pyrolysis. Some typical ranges of data for coal-derived low Btu gases are also presented.
Literature survey of properties of synfuels derived from coal
Reynolds, T. W.; Niedzwiecki, R. W.; Clark, J. S.
1980-01-01
A literature survey of the properties of synfuels for ground-based gas turbine applications is presented. Four major concepts for converting coal into liquid fuels are described: solvent extraction, catalytic liquefaction, pyrolysis, and indirect liquefaction. Data on full range syncrudes, various distillate cuts, and upgraded products are presented for fuels derived from various processes, including H-coal, synthoil, solvent-refined coal, donor solvent, zinc chloride hydrocracking, co-steam, and flash pyrolysis. Some typical ranges of data for coal-derived low Btu gases are also presented.
Anti-Inflammatory Activity of the Methanol Extract of Moutan Cortex in LPS-Activated Raw264.7 Cells
Directory of Open Access Journals (Sweden)
Seung-Chul Chun
2007-01-01
Full Text Available Moutan Cortex (MCE has been used in traditional medicine to remove heat from the blood, promote blood circulation and alleviate blood stasis. This study was conducted to evaluate the effects of MCE on regulatory mechanisms of cytokines and nitric oxide (NO involved in immunological activity of Raw264.7 cells. Cells were pretreated with methanolic extracts of MCE, and further cultured for an appropriate time after lipopolyssacharide (LPS addition. During the entire experimental period, 0.1 and 0.3 mg ml−1 of MCE had no cytotoxicity. In these concentrations, MCE inhibited the production of NO and prostaglandin E2 (PGE2, the expression of inducible NO synthase (iNOS, cyclooxygenase-2 (COX-2 and phosphorylated inhibitor of κBα (p-IκBα, and the activation of nuclear factor κB (NF-κB. MCE also reduced the concentration of tumor necrosis factor-α (TNF-α, interleukin-1β (IL-1β and interleukin-6 (IL-6 in the Raw264.7 cells that were activated by LPS. These results demonstrate that MCE has anti-inflammatory effects through the inhibition of iNOS and COX-2 expression by suppressing the phosphorylation of I-κBα and the activation of NF-κB.
Natural Dyeing and UV Protection of Raw and Bleached/Mercerised Cotton
Directory of Open Access Journals (Sweden)
Čuk Nina
2017-05-01
Full Text Available Dyeing with natural dyes extracted from curcuma, green tea, avocado seed, pomegranate peel and horse chestnut bark was studied to evaluate the dyeability and ultraviolet (UV blocking properties of raw and bleached/mercerised cotton fabrics. 20 g/l of powdered plant material was extracted in distilled water and used as a dyeing bath. No mordants were used to obtain ecologically friendly finishing. The colour of samples was measured on a refl ectance spectrophotometer, while UV-blocking properties were analysed with UV-Vis spectrophotometer. The results showed that dyeing increased UV protection factor (UPF to all samples, however much higher UPF values were measured for the dyed raw cotton samples. The highest UPF values were obtained on both cotton fabrics dyed with pomegranate peel and green tea extracts, giving them excellent protective properties (UPF 50+. The lowest UPF values were obtained by dyeing cotton with avocado seed extract and curcumin. Dyeing with selected dyes is not stable to washing, so the UV-blocking properties worsen after repetitive washing. However, raw cotton samples retain their very good Uvblocking properties, while bleached/mercerised cotton fabrics do not provide even satisfactory UV-blocking properties. No correlation between CIE L*a*b*, K/S and UPF values were found.
Stress-state monitoring of coal pillars during room and pillar extraction
Czech Academy of Sciences Publication Activity Database
Waclawik, Petr; Ptáček, Jiří; Koníček, Petr; Kukutsch, Radovan; Němčík, J.
2016-01-01
Roč. 15, č. 2 (2016), s. 49-56 ISSN 2300-3960 R&D Projects: GA MŠk(CZ) LO1406; GA MŠk ED2.1.00/03.0082 Institutional support: RVO:68145535 Keywords : stress-state monitoring * room and pillar * coal pillar Subject RIV: DH - Mining , incl. Coal Mining http://www.sciencedirect.com/science/article/pii/S2300396016300180
Caballero-Gallardo, Karina; Wirbisky-Hershberger, Sara E; Olivero-Verbel, Jesus; de la Rosa, Jesus; Freeman, Jennifer L
2018-03-01
Coal mining is one of the economic activities with the greatest impact on environmental quality. At all stages contaminants are released as particulates such as coal dust. The first aim of this study was to obtain an aqueous coal dust extract and characterize its composition in terms of trace elements by ICP-MS. In addition, the developmental toxicity of the aqueous coal extract was evaluated using zebrafish (Danio rerio) after exposure to different concentrations (0-1000 ppm; μg mL -1 ) to establish acute toxicity, morphology and transcriptome changes. Trace elements within the aqueous coal dust extract present at the highest concentrations (>10 ppb) included Sr, Zn, Ba, As, Cu and Se. In addition, Cd and Pb were found in lower concentrations. No significant difference in mortality was observed (p > 0.05), but a delay in hatching was found at 0.1 and 1000 ppm (p 0.05). Transcriptomic results of zebrafish larvae revealed alterations in 77, 61 and 1376 genes in the 1, 10, and 100 ppm groups, respectively. Gene ontology analysis identified gene alterations associated with the development and function of connective tissue and the hematological system, as well as pathways associated with apoptosis, the cell cycle, transcription, and oxidative stress including the MAPK signaling pathway. In addition, altered genes were associated with cancer; connective tissue, muscular, and skeletal disorders; and immunological and inflammatory diseases. Overall, this is the first study to characterize gene expression alterations in response to developmental exposure to aqueous coal dust residue from coal mining with transcriptome results signifying functions and systems to target in future studies.
Automatic crack detection method for loaded coal in vibration failure process.
Directory of Open Access Journals (Sweden)
Chengwu Li
Full Text Available In the coal mining process, the destabilization of loaded coal mass is a prerequisite for coal and rock dynamic disaster, and surface cracks of the coal and rock mass are important indicators, reflecting the current state of the coal body. The detection of surface cracks in the coal body plays an important role in coal mine safety monitoring. In this paper, a method for detecting the surface cracks of loaded coal by a vibration failure process is proposed based on the characteristics of the surface cracks of coal and support vector machine (SVM. A large number of cracked images are obtained by establishing a vibration-induced failure test system and industrial camera. Histogram equalization and a hysteresis threshold algorithm were used to reduce the noise and emphasize the crack; then, 600 images and regions, including cracks and non-cracks, were manually labelled. In the crack feature extraction stage, eight features of the cracks are extracted to distinguish cracks from other objects. Finally, a crack identification model with an accuracy over 95% was trained by inputting the labelled sample images into the SVM classifier. The experimental results show that the proposed algorithm has a higher accuracy than the conventional algorithm and can effectively identify cracks on the surface of the coal and rock mass automatically.
Subtask 3.9 - Direct Coal Liquefaction Process Development
Energy Technology Data Exchange (ETDEWEB)
Aulich, Ted; Sharma, Ramesh
2012-07-01
The Energy and Environmental Research Center (EERC), in partnership with the U.S. Department of Energy (DOE) and Accelergy Corporation, an advanced fuels developer with technologies exclusively licensed from ExxonMobil, undertook Subtask 3.9 to design, build, and preliminarily operate a bench-scale direct coal liquefaction (DCL) system capable of converting 45 pounds/hour of pulverized, dried coal to a liquid suitable for upgrading to fuels and/or chemicals. Fabrication and installation of the DCL system and an accompanying distillation system for off-line fractionation of raw coal liquids into 1) a naphtha middle distillate stream for upgrading and 2) a recycle stream was completed in May 2012. Shakedown of the system was initiated in July 2012. In addition to completing fabrication of the DCL system, the project also produced a 500-milliliter sample of jet fuel derived in part from direct liquefaction of Illinois No. 6 coal, and submitted the sample to the Air Force Research Laboratory (AFRL) at Wright Patterson Air Force Base, Dayton, Ohio, for evaluation. The sample was confirmed by AFRL to be in compliance with all U.S. Air Force-prescribed alternative aviation fuel initial screening criteria.
FY 1981 report on the Coal Kind Survey Committee; 1981 nendo tanshu chosa iinkai hokokusho
Energy Technology Data Exchange (ETDEWEB)
NONE
1982-03-01
For the purpose of establishing coal liquefaction/gasification technology, investigational survey on the usable coal resource in Japan was made to collect/file the data on the state of coal existence, coal kind, etc. by the Coal Kind Survey Committee and the section. In the 1st committee meeting, an idea of the coal kind survey was discussed, and in the 2nd committee meeting, a summary of activities in this fiscal year was reported. In the section meeting, the following were carried out: discussion of a course of the coal kind survey in the 1st meeting; discussion about how to proceed with the coal kind survey/items of data filing in the 2nd meeting; examinational study of items of data filing in the 3rd meeting; summary of activities in this fiscal year in the 4th meeting. As examples of the coal kind survey, the following were cited: special study report on coal resource and gasification/liquefaction characteristics by Science and Technology Agency; results of the survey by Joint Coal Board and Queensland Coal Board in Australia; Report of 1978 by The Fuel Society of Japan; Report of 1976 by Pennsylvania State University; data on process raw coal by The Iron and Steel Institute of Japan, etc. (NEDO)
Energy Technology Data Exchange (ETDEWEB)
Lazaroiu, G.; Frentiu, T.; Maescu, L.; Mihaltan, A.; Ponta, M.; Frentiu, M.; Cordos, E. [Universitatea Politehnica din Bucuresti, Bucharest (Romania)
2009-05-15
This paper focuses on the study of the synergistic effect in coal/biomass blend briquettes combustion on behavior of Al, As, Ba, Cd, Co. Cr, Cu, Fe, Ga, K, Mn, Mo, Ni, P, Pb, Si, V, W, Zn, Zr and characterization of raw materials and bottom ashes. The manufacturing of coal/biomass briquettes although not commonly used is an attractive approach, as briquettes combustion is more technologically advantageous than the fluidized bed combustion. In the same time this technology is a way to render valuable materials of low calorific power and results in diminishing polluting emission. Raw materials and briquettes from different blends of pitcoal/sawdust were subjected to combustion in a 55 kW-boiler. The total content of elements after digestion in the HNO{sub 3} - HF mixture and the content in water leachate at a solid/liquid ratio of 1:2 were determined both in raw materials and bottom ash by ICP-OES. The total content of elements was higher in pitcoal than in sawdust. The synergistic effect depends both on coal/biomass ratio in blend and element nature. The water leachable fraction of elements from ash decreased along with the increase of sawdust weight excepting macronutrients (K, P) and Si.
Dewatering behaviour of ultrafine hard coal particles
Energy Technology Data Exchange (ETDEWEB)
Fischer, D.; Alizadeh, A.; Simonis, W.
1986-03-01
With decreasing particle diameter distribution the dewatering behaviour of coal gets increasingly complicated. A correlation between final moisture and content of particles below 25..mu..m in the course of centrifuging can be verified. This behaviour of the particles below 25..mu..m can be explained by the great specific surface, on the one hand, and by the distribution of the surface charge density, on the other hand. The charge density depends on the type of coal, on the minerals content and their make-up, as well as on the characteristics of the surrounding medium. The surface charge can be measured indirectly. Varying electrophoretic mobilities of the particles are observed in dependence on the type of raw material. In the neutral pH-range, minerals have a negative surface charge, while coal has a positive one. By way of adding reagents it is possible to invert the negative charges with complicated dewatering characteristics into positive charges. A similar influence will be exerted by changing the pH-value. 6 references.
International Nuclear Information System (INIS)
Ryu, Changkook; Khor, Adela; Sharifi, Vida N.; Swithenbank, Jim
2008-01-01
Due to the growing market for sustainable energy, in order to increase the quality of the fuels, pellets are being produced from various materials such as wood and other biomass energy crops, and municipal waste. This paper presents the results from an economic feasibility study for pellet production using blends of two residue materials: coal tailings from coal cleaning and spent mushroom compost (SMC) from mushroom production. Key variables such as the mixture composition, raw material haulage and plant scale were considered and the production costs were compared to coal and biomass energy prices. For both wet materials, the moisture content was the critical parameter that influenced the fuel energy costs. The haulage distance of the raw materials was another factor that can pose a high risk. The results showed that the pellet production from the above two materials can be viable when a less energy-intensive drying process is utilised. Potential market outlets and ways to lower the costs are also discussed in this paper. (author)
Kumar-Roiné, Shilpa; Matsui, Mariko; Reybier, Karine; Darius, Hélène Taiana; Chinain, Mireille; Pauillac, Serge; Laurent, Dominique
2009-06-25
Ciguatera fish poisoning (CFP) is an intertropical ichthyosarcotoxism that manifests in complex assortment of symptoms in humans. Ciguatoxins (CTXs), issued from Gambierdicus spp., are causative agents of this intoxication. We have recently demonstrated that a Pacific CTX (P-CTX-1B) strongly modulated iNOS expression, leading to overproduction of nitric oxide (NO) in RAW 264.7 murine macrophage cells. NO produced in large amounts is involved in a wide range of pathophysiological processes. Many traditional remedies are commonly used in the Pacific against CFP. In this context, bioassay-guided screening was carried out to study NO inhibiting capacity of 28 selected plant extracts. We prepared aqueous extracts of plants used in New Caledonia in the treatment of CFP and screened their NO inhibitory activity in lipopolysaccharide (LPS)-activated RAW 264.7 macrophages. Among 28 plants tested, Euphorbia hirta (Euphorbiaceae), Syzygium malaccense (Myrtaceae), Schinus terebenthifolius (Anacardiaceae), Punica granatum (Punicaceae), Cerbera manghas (Apocynaceae), Vitex trifolia (Labiateae) and Ximenia americana (Olacaceae) showed inhibitory activity, validating their use as traditional remedies in CFP, and the potential for use in the treatment of conditions accompanied by NO overproduction. These plants are promising candidates for further screening of their active compounds through activity-guided fractionation.
Interregional differences of coal carbon dioxide emissions in China
International Nuclear Information System (INIS)
Chen, Jiandong; Cheng, Shulei; Song, Malin; Wang, Jia
2016-01-01
Coal is one of the main fuel sources in China. This paper sheds light on the evolution of China's interregional differences in CO 2 emissions from coal by constructing a Gini coefficient and decoupling elasticity index for emissions from 1997 to 2012 and explains why emission differences deviate from economic growth differences. The study decomposed the Gini coefficient of CO 2 emissions from coal by source, incremental source, and region. It also divided the decoupling elasticity of carbon emissions into two components: effects of environmental expenditure and effects of emission reduction policy. The findings of the study are as follows: First, interregional differences in China's overall CO 2 emissions from coal are characterized by periodic fluctuation. Second, the differences in emissions from raw coal, the concentration effect of emissions, and the emission differences within regions are the three main factors in the overall difference changes in coal's carbon emissions in China. Last but not least, the decoupling between provincial CO 2 emissions from coal and economic growth is on the whole weak. Based on the above findings, the author offers four suggestions for emission reduction. - Highlights: •We focus on interregional differences in China's coal carbon dioxide emissions. •We construct an emission decoupling elasticity index. •Expenditure on environmental protection is the intermediate variable for the index. •We use the Gini coefficient to decompose emissions by source and incremental source. •Interregional emission and economic growth differences deviate due to govt. policy.
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-11-01
Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in November 1997: primary energy total consumption has increased (mobile year) of 0.6%, at a slightly inferior rate than the rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 9.3%), slight increase for petroleum products (+ 1.2%), markedly slowing down increase for gas (+ 1.4%) and moderate increase for electricity (+ 1.3%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a maintained high energy cost level with + 14% on one year, reaching 86.8 billions Francs, to be compared to 76.1 in November 1996
Rational use of coal from the Kansk-Achinsk basin
Energy Technology Data Exchange (ETDEWEB)
Andreeva, I.A.; Antonova, L.I.; Khapaeva, O.K.
1983-02-01
Brown coal from the Kansk-Achinsk basin will be used as fuel in power plants as well as raw material for production of coke and smokeless fuel. Production of semicoke should amount to 9 Mt/year, 4 Mt of which will be smokeless fuel. A method for coking brown coal from the Kansk-Achinsk basin developed by the MGI Institute is described: semicoke mixed with coal tar used as a binder and polymers (from 2 to 4%), playing the role of a modifier, is carbonized at 850 to 900 C. Briquets produced from brown coal semicoke are characterized by a high carbon content up to 94.7%, emission of volatile matter down to 9.0%, ash content of 8.8% and good mechanical properties. A method for production of coke for removal of sulfurous anhydride from coal power plant emission is described: semicoke is granulated using the heavy fraction of coal tar formed during semicoking, granules are carbonized and activated at a temperature of 900 C. Volume of mesopores and micropores in coke amounts to 0.4 cm/sup 3//g and the specific surface is 28 to 600 m/sup 2//g (with a combustion loss of of 20 to 24 %). This sorbent is also used as carrier for catalysts in metallurgy and for collecting and recovering solvents from industrial gases.
Economic evaluation of coal deposits. Ekonomicheskaya otsenka ugolinykh mestorozhdenii
Energy Technology Data Exchange (ETDEWEB)
Raikhel' , B L
1979-01-01
A presentation is made of theoretical problems, methods, and criteria for the economic evaluation of coal deposits. An examination is made of factors which influence the formation of magnitudes that are utilized in economic evaluations as well as problems whose solution requires the consideration of the economic evaluation of coal deposits (evaluation of useful mineral losses, substantiation for the extraction of reserves under various conditions, sectioning off reserves to an operating mine, the completeness of reserve extraction, and technico-economic substantiation for quality). Extensive experience in planning is summarized and data are illustrated by examples. The book is intended for engineering-technical personnel of enterprises, organizations, planning, and scientific-research institutes of the coal industry as well as geological organizations. 29 references, 27 tables.
Losses in the coal supply chain
Energy Technology Data Exchange (ETDEWEB)
NONE
2012-12-15
This report examines the way coal can change as it passes along the coal chain. A great deal of the change is intended, through separation and sizing, to ensure the coal being mined matches the specification demanded by the customer. This report attempts to identify these changes and presents some of the issues faced by the coal supplier and user. Much of the change leads to a loss of mass in the coal. Some of the coal is left in the ground (intentionally and unintentionally), while elsewhere, full extraction might occur with the addition of non-coal materials from the surrounding rocks. In both cases, the mined coal often requires further processing. Coal processing by separation at preparation plants refines coal further and is where most of the mass loss occurs. Value is added by reducing ash content and improving heating value, thus providing a much more saleable product for the market. As soon as the coal leaves the mine, mass loss can occur either through natural deterioration of the fuel, through spillage or dust, or in extreme cases theft. In all cases measuring the amount of coal as it passes through the supply chain is required to verify that the coal reaching the consumer is of satisfactory quality and quantity. This can be done crudely by measuring stockpiles, to more sophisticated weighing systems at various points along the supply chain, and even measuring the volume held in a ship. Measurement is subject to error which must be minimised. Biomass needs to be processed in much the same way as coal, such as removing mineral matter and taking care in avoiding contamination.
International Nuclear Information System (INIS)
Jenner, Steffen; Lamadrid, Alberto J.
2013-01-01
The aim of this paper is to examine the major environmental impacts of shale gas, conventional gas and coal on air, water, and land in the United States. These factors decisively affect the quality of life (public health and safety) as well as local and global environmental protection. Comparing various lifecycle assessments, this paper will suggest that a shift from coal to shale gas would benefit public health, the safety of workers, local environmental protection, water consumption, and the land surface. Most likely, shale gas also comes with a smaller GHG footprint than coal. However, shale gas extraction can affect water safety. This paper also discusses related aspects that exemplify how shale gas can be more beneficial in the short and long term. First, there are technical solutions readily available to fix the most crucial problems of shale gas extraction, such as methane leakages and other geo-hazards. Second, shale gas is best equipped to smoothen the transition to an age of renewable energy. Finally, this paper will recommend hybrid policy regulations. - Highlights: ► We examine the impacts of (un)conventional gas and coal on air, water, and land. ► A shift from coal to shale gas would benefit public health. ► Shale gas extraction can affect water safety. ► We discuss technical solutions to fix the most crucial problems of shale gas extraction. ► We recommend hybrid regulations.
International Nuclear Information System (INIS)
Mirsaidov, U.M.; Kurbonov, A.S.; Mamatov, E.D.
2015-01-01
Present article is devoted to kinetics of hydrochloric-acid decomposition of calcined concentrate of boron raw material of Ak-Arkhar Deposit. The experimental data of dependence of hydrochloric-acid decomposition of calcined boron raw material for boron oxide extraction on temperature (20-80 deg C) and process duration (15-60 min) were considered. It was defined that at temperature increasing the boron oxide extraction from borosilicate raw material increases from 24.1 till 86.8%. The constants of decomposition rate of boron raw material were calculated.
Power-generating process of obtaining gas-energy carrier and reducer from coal
International Nuclear Information System (INIS)
Tleugabulov, S.; Duncheva, E.; Zubkevich, M.
1999-01-01
The manufacture of power-generating gas has the important economic value for Kazakhstan having large territory, raw and fuel resources especially power coal and clean coal wastes. The technology of reception of gas-energy carrier and reducer from power coal is developed. The basic product of technological process is heated reducing gas. Reducing potential of the gas is characterized by a volumetric share of components (CO+H 2 )-RC in relation to volume of whole mix of gases received with gasification of coal. The value of parameter RC is regulated by a degree of enrichment of air by oxygen r 0 , and the temperature - by the charge of a parity of endothermic reaction in the chamber of gas regeneration. The dependence of the gas structure and temperature on the degree of enrichment of air by oxygen is shown and the circuit of the gas generator is given. (author)
Survey to determine why people drink raw milk.
Mullin, Gerard E; Belkoff, Stephen M
2014-11-01
Fragility fractures associated with osteoporosis extract a large financial and personal toll on society. Pharmaceutical or dietary calcium intake is needed to increase bone mineral density to prevent fragility fractures. Although dairy products are a good source of calcium, patients who are unable to digest lactose tend to avoid them and are put at a greater risk for fracture than the general population. Anecdotal reports suggest that lactose maldigesters, when consuming raw milk, have a dramatic reduction in symptoms relative to pasteurized milk. The mechanism of the reported reduction in symptoms, if true, is unknown. The purpose of the current study was to survey raw milk drinkers to ascertain their health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. An online survey regarding raw milk was completed by 153 of 1527 members of a raw milk-buying community. The primary reason the respondents cited for drinking raw milk was that they believed it was more healthful; 30% reported some gastrointestinal discomfort when drinking pasteurized milk, yet almost all (99%) reported consuming raw milk without discomfort. Despite the reports of gastrointestinal discomfort, only 5% of respondents had been diagnosed as lactose intolerant by a medical professional, and only 1% had been diagnosed as lactose intolerant via the gold-standard hydrogen breath test. The primary motivation for drinking raw milk is its perceived health value, not its digestibility. Although raw milk appears to be more easily digested than pasteurized milk in our survey sample, the mechanism of digestibility remains unknown.
Mineral and tar oils and paraffin and mineral waxes, extracting
Energy Technology Data Exchange (ETDEWEB)
1927-09-01
In the extraction of soluble bodies from coal and the like carbonaceous material, the coal is preheated in a closed vessel and then heated under pressure with the solvent. The pressure in either or both stages may be increased by gases or vapours more or less inert under the conditions, e.g. hydrogen, steam, carbon monoxide, and nitrogen. In an example, brown coal is maintained at 300/sup 0/C for 10 hours, thus producing a pressure of 100 atmospheres, and is then extracted for 10 hours at 300/sup 0/C and 100 atmospheres with benzene in a closed vessel. Over 60 per cent of the coal is dissolved. After separation of the undissolved coal and removal of the solvent the soluble products may be treated with either to extract resinous matter, and then with cyclohexane to extract wax-like matters. Alternatively the soluble products, alone or in solution or with the undissolved coal, may be destructively hydrogenated, or be cracked in presence of activated aluminium and hydrogen chloride.
Coal background paper. Coal demand
International Nuclear Information System (INIS)
1997-01-01
Statistical data are presented on coal demands in IEA and OECD member countries and in other countries. Coal coaking and coaking coal consumption data are tabulated, and IEA secretariat's coal demand projections are summarized. Coal supply and production data by countries are given. Finally, coal trade data are presented, broken down for hard coal, steam coal, coking coal (imports and export). (R.P.)
Microbially-Enhanced Coal Bed Methane: Strategies for Increased Biogenic Production
Davis, K.; Barhart, E. P.; Schweitzer, H. D.; Cunningham, A. B.; Gerlach, R.; Hiebert, R.; Fields, M. W.
2014-12-01
Coal is the largest fossil fuel resource in the United States. Most of this coal is deep in the subsurface making it costly and potentially dangerous to extract. However, in many of these deep coal seams, methane, the main component of natural gas, has been discovered and successfully harvested. Coal bed methane (CBM) currently accounts for approximately 7.5% of the natural gas produced in the U.S. Combustion of natural gas produces substantially less CO2 and toxic emissions (e.g. heavy metals) than combustion of coal or oil thereby making it a cleaner energy source. In the large coal seams of the Powder River Basin (PRB) in southeast Montana and northeast Wyoming, CBM is produced almost entirely by biogenic processes. The in situ conversion of coal to CBM by the native microbial community is of particular interest for present and future natural gas sources as it provides the potential to harvest energy from coal seams with lesser environmental impacts than mining and burning coal. Research at Montana State University has shown the potential for enhancing the subsurface microbial processes that produce CBM. Long-term batch enrichments have investigated the methane enhancement potential of yeast extract as well as algal and cyanobacterial biomass additions with increased methane production observed with all three additions when compared to no addition. Future work includes quantification of CBM enhancement and normalization of additions. This presentation addresses the options thus far investigated for increasing CBM production and the next steps for developing the enhanced in situ conversion of coal to CBM.
Coal liquefaction with preasphaltene recycle
Weimer, Robert F.; Miller, Robert N.
1986-01-01
A coal liquefaction system is disclosed with a novel preasphaltene recycle from a supercritical extraction unit to the slurry mix tank wherein the recycle stream contains at least 90% preasphaltenes (benzene insoluble, pyridine soluble organics) with other residual materials such as unconverted coal and ash. This subject process results in the production of asphaltene materials which can be subjected to hydrotreating to acquire a substitute for No. 6 fuel oil. The preasphaltene-predominant recycle reduces the hydrogen consumption for a process where asphaltene material is being sought.
Thermovolumetric investigations of steam gasification of coals and their chars
Directory of Open Access Journals (Sweden)
Porada Stanisław
2017-01-01
Full Text Available The process of steam gasification of three coals of various rank and three chars obtained from these coals by the ex-situ method at 900 °C was compared. In the coal gasification process, the pyrolysis stage plays a very important part, which is connected with its direct impact on the kinetics of gasification of the resulting char. What is more, taking into consideration the impact of pyrolysis conditions on char properties, it should be anticipated that the gasification kinetics of coal and char, formed from it by the ex situ method, will be different. In order to examine and compare the process of gasification of coals and chars, an isothermal thermovolumetric method, designed by the authors, was applied. For all the examined samples the measurements were performed at three temperatures, i.e. 850, 900, and 950 °C, and at the pressure of 0.1 MPa. An evaluation of the impact of raw material on the steam gasification of the examined samples was made. The carbon conversion degree and the kinetic parameters of CO and H2 formation reaction were calculated. It was observed that the course of gasification is different for coals and chars obtained from them and it can be concluded that coals are more reactive than chars. Values of kinetic parameters of carbon monoxide and hydrogen formation calculated for coals and corresponding chars are also different. Due to the observed differences the process of gasification of coals and of chars with steam should not be equated.
Geological and Rock Mechanics Perspectives for Underground Coal Gasification in India
Singh, Ajay K.; Singh, Rajendra
2017-07-01
The geological resources of coal in India are more than 308 billion tonnes upto a depth of 1200 m, out of which proved reserve has been reported at around 130 billion tonnes. There is an increasing requirement to increase the energy extraction efficiency from coal as the developmental prospects of India increase. Underground coal gasification (UCG) is a potential mechanism which may be utilized for extraction of deep-seated coal reserves. Some previous studies suggest that lignites from Gujarat and Rajasthan, along with tertiary coals from northeastern India can be useful from the point of view of UCG. We discuss some geological literature available for these areas. Coming to the rock mechanics perspectives, during UCG the rock temperature is considerable high. At this temperature, most empirical models of rock mechanics may not be applied. In this situation, the challenges for numerical modelling of UCG sites increases manifold. We discuss some of the important modelling geomechanical issues related to UCG in India.
Trace and major element pollution originating from coal ash suspension and transport processes
Energy Technology Data Exchange (ETDEWEB)
Popovic, A.; Djordjevic, D.; Polic, P. [University of Belgrade, Belgrade (Yugoslavia). Faculty of Science, Dept. of Chemistry
2001-07-01
Coal ash obtained from Nikola Tesla A power plant in Obrenovac, near Belgrade, Yugoslavia, is mixed with water of the Sava river and transported to the dump. In order to assess pollution caused by leaching of some minor and major elements during ash transport through the pipeline, two sets of samples (six samples each) were subjected to a modified sequential extraction. The first set consisted of coal ash samples taken immediately after combustion, while the second set was obtained by extraction with river water, imitating the processes that occur in the pipeline. Samples were extracted consecutively with distilled water and a 1 M solution of KCl, pH 7, and the differences in extractability were compared in order to predict potential pollution. It is concluded that lead and cadmium do not present an environmental threat during and immediately after ash transport to the dump. Portions of zinc, nickel and chromium are released during the ash transport, and arsenic and manganese are released continuously. Copper and iron do not present an environmental threat due to element leaching during and immediately after the coal ash suspension and transport. On the contrary, these elements, as well as chromium, become concentrated during coal ash transport. Adsorbed portions of calcium, magnesium and potassium are also leached during coal ash transport.
Processing of uranium-containing coal
International Nuclear Information System (INIS)
Cordero Alvarez, M.
1987-01-01
A direct storage of uranium-bearing coal requires the processing of large amounts of raw materials while lacking guarantee of troublefree process cycles. With the example of an uranium-bearing bituminous coal from Stockheim, it was aimed at the production of an uranium ore concentrate by means of mechanical, thermal and chemical investigations. Above all, amorphous pitch blende was detected as a uranium mineralization which occurs homogeneously distributed in the grain size classes of the comminuted raw material with particle diameters of a few μm and, after the combustion, enriches in the field of finest grain of the axis. Heterogeneous and solid-state reactions in the thermal decarburization above 700deg C result in the development of hardly soluble uranium oxides and and calcium uranates as well as in enclosures in mineral glass. Thus, the pre-enrichment has to take place in a temperature range below 600deg C. By means of a sorting classification of the ash at ± 2.0 mm, it is possible to achieve an enrichment of up to factor 15 for a mineral of a mainly low carbonate content and, for a mineral of a rich carbonate content, up to the factor 4. The separation of the uranium from the concentrates produced is possible with a yield of 95% by means of leaching with sulphuric acid at a temperature of 20deg C. As far as their reproducibility was concerned, the laboratory tests were verified on a semi-industrial scale. A processing method is suggested on the basis of the data obtained. (orig.) [de
Health impacts of coal: facts and fallacies
Energy Technology Data Exchange (ETDEWEB)
Finkelman, R.B. [University of Texas, Dallas, TX (United States)
2007-02-15
Coal has contributed enormously to the advance of civilization by providing an abundant, inexpensive, and convenient source of energy. Concurrent with its contributions, coal has extracted a high cost in terms of environmental damage and human health impacts. Unfortunately, the links between coal use and human health are distorted by a great deal of ignorance and misinformation. This paper discusses the facts and fallacies of the direct health impacts caused by coal. These include health problems caused by arsenic, fluorine, mercury and selenium released in coal use in the residential sector. The trace element iodine however may help prevent iodine deficiency disorder. Lignite in the ground in some Balkan areas has been associated with a urinary tract cancer known as Balkan endemic nephropathy (BEN). Uncontrolled burning coal seams and coal waste piles contribute to global warming and to respiratory problems. The 10-fold enrichment of trace elements in fly ash and the fine particles released from power plants could present a health threat but where good pollution control technology and disposal practices are applied the health threat is probably minimal. Radioactivity levels in coal are thought to be too low to cause concern. 27 refs., 2 figs.
Coal structure and reactivity changes induced by chemical demineralisation
Energy Technology Data Exchange (ETDEWEB)
Rubiera, F.; Arenillas, A.; Pevida, C.; Garcia, R.; Pis, J.J. [Department of Energy and Environment, Instituto Nacional del Carbon, CSIC, Apartado 73, 33080 Oviedo (Spain); Steel, K.M.; Patrick, J.W. [Fuel Technology Group, School of Chemical, Environmental and Mining Engineering, Nottingham University, University Park, NG7 2RD Nottingham (United Kingdom)
2002-12-01
The aim of this work was to determine the influence that an advanced demineralisation procedure has on the combustion characteristics of coal. A high-volatile bituminous coal with 6.2% ash content was treated in a mixture of hydrofluoric and fluorosilicic acids (HF/H{sub 2}SiF{sub 6}). Nitric acid was used either as a pretreatment, or as a washing stage after HF/H{sub 2}SiF{sub 6} demineralisation, with an ash content as low as 0.3% being attained in the latter case. The structural changes produced by the chemical treatment were evaluated by comparison of the FTIR spectra of the raw and treated coal samples. The devolatilisation and combustibility behaviour of the samples was studied by using a thermobalance coupled to a mass spectrometer (TGA-MS) for evolved gas analysis. The combustibility characteristics of the cleaned samples were clearly improved, there being a decrease in SO{sub 2} emissions.
Method of extraction under pressure of fossil material
Energy Technology Data Exchange (ETDEWEB)
Fredenmark, G L
1942-02-24
A method is described of extraction under pressure of fossil material, such as coal, brown coal (lignite), peat, oil shale. It is characterized by carrying out the process of extraction by utilization of fractions of shale oils and/or peat tar with a boiling point above 170/sup 0/C and under such as pressure that the medium of extraction is in a liquid state.
Aromatic chemical feedstocks from coal
Energy Technology Data Exchange (ETDEWEB)
Collin, G
1982-06-01
Liquid byproducts of coal carbonization meet some 25% of the world demand for aromatic chemicals, currently at approx. 30 million t/a, in particular 15% of the demand for benzene and over 95% of the demand for condensed aromatics and heteroaromatics. Industrial processing of the aromatic byproducts of coal pressure gasification is carried out to only a minor extent. Other methods that may be employed in future to obtain carbochemical aromatic compounds are solvolysis and supercritical gas extraction, the catalytic liquid-phase hydrogenation and hydropyrolysis of coal, which also permit recovery of benzene and homologues, phenols, and condensed and partially hydrogenated aromatics, and the synthesis of aromatics using methanol as the key compound. As with the present means of obtaining aromatic chemicals from coal, the processes that may in the future be applied on an industrial scale to obtain pure aromatics will only be economically feasible if linked with the manufacture of other mass products and combined with the present production of carbochemical aromatics.
Application of Acidithiobacillus Ferrooxidans in coal flotation
Energy Technology Data Exchange (ETDEWEB)
Amini, E.; Hosseini, T.R.; Oliazadeh, M.; Kolahdoozan, M. [University of Queensland, Brisbane, Qld. (Australia)
2009-07-01
Bioflotation is a potential method for removing pyritic sulphur from coal. Sodium cyanide is a well-known depressant for pyrite in flotation of sulphide minerals; however, for coal this reagent is unacceptable from the environmental point of view. This study investigates an alternate to sodium cyanide, Acidithiobacillus Ferrooxidans, a nonharmful bacterial reagent as a pyrite depressant. The flotation behavior of pyrite and other gangue particles using the sodium cyanide and the Ferrooxidans is compared by applying the general first-order flotation model. The kinetic parameters extracted from the model demonstrated that the modified flotation rate of pyrite was reduced, and the selectivity between coal and gangue was improved using the bacteria. These results indicate that Acidithiobacillus Ferrooxidans has potential in removing pyritic sulfur from coal.
Olah, G.
1980-01-01
We were interested in applying superacid catalyzed cleavage-depolymerization and ionic hydrogenation low temperature conversion of coal to liquid hydrocarbon, as well as obtaining information about the reactions involved and the structure of intermediates of the coal liquefaction process. In order to show the feasibility of our proposed research we have carried out preliminary investigation in these areas. Preceding our work there was no practical application of a superacid system to coal liquefaction. We carried out an extensive study of the potential of the HF:BF{sub 3}/H{sub 2} system for coal hydroliquefaction. Under varying conditions of reactant ratio, reaction time and temperature, we were able to obtain over 95% pyridine extractible product by treating coal in HF:BF{sub 3}:H{sub 2} system at approx. 100 degrees C for 4 hours. The coal to acid ratio was 1:5 and FB{sub 3} at 900 psi and H{sub 2} at 500 psi were used. These are extremely encouraging results in that the conditions used are drastically milder than those used in any known process, such as Exxon donor solvent and related processes. The cyclohexane extractibility of the treated coal was as high as 27% and the yield of liquid distillate at 400 degrees C/5 x 10{sup -3}/sup torr/ was approx. 30%. The infrared spectrum of product coal, extracts and distillates were distinctly different from the starting coal and show a significant increase in the amount of saturates. The {sup 1}H NMR spectrum of cyclohexane extract of the treated coal shows essentially all aliphatic photons. The spectra of other treated coal extracts show increased amounts and types of aliphatic protons as well as significant amounts of protons bound to unsaturated sites. This again indicates that the HF-BF{sub 3} system is depolymerizing the coal to small fragments which are soluble in non-polar solvents.
Geology in coal resource utilization
International Nuclear Information System (INIS)
Peters, D.C.
1991-01-01
The 37 papers in this book were compiled with an overriding theme in mind: to provide the coal industry with a comprehensive source of information on how geology and geologic concepts can be applied to the many facets of coal resource location, extraction, and utilization. The chapters have been arranged to address the major coal geology subfields of Exploration and Reserve Definition, Reserve Estimation, Coalbed Methane, Underground Coal Gasification, Mining, Coal Quality Concerns, and Environmental Impacts, with papers distributed on the basis of their primary emphasis. To help guide one through the collection, the author has included prefaces at the beginning of each chapter. They are intended as a brief lead-in to the subject of the chapter and an acknowledgement of the papers' connections to the subject and contributions to the chapter. In addition, a brief cross-reference section has been included in each preface to help one find papers of interest in other chapters. The subfields of coal geology are intimately intertwined, and investigations in one area may impact problems in another area. Some subfields tend to blur at their edges, such as with reserve definition and reserve estimation. Papers have been processed separately for inclusion on the data base
Fine coke production from brown coal (Report on ECSC contract 6220-72/1/102)
Energy Technology Data Exchange (ETDEWEB)
1977-01-01
The possibility of producing a dry brown coal suitable for the production of fine coke and the development of a suitable carbonization process were studied. To prepare the coal it should be screened at 1 mm with the oversize going to fine coke production and the undersize going to briquette production. To increase fine coke production it is necessary to screen the raw smalls less than 2 mm and to pelletize, dry and carbonize them with the coarser constituents. The planning and construction of a hearth oven furnace plant was begun and this is now in operation. A fluidized bed can be used to preheat the coal to improve the oven performance. (In German)
Basarygin, Maksim
2017-11-01
In this article the subject of enhancement of operating efficiency of the central coal-preparation plant of OOO "MMK-UGOL" is encompassed. Modern trends in the development of technologies and equipment for coal beneficiation are due to the following requirements: improving competitiveness of coal products, improvement of quality of marketable products, reduction of coal production cost, environmental requirements: polluting emission abatement, prepared coal saving, improvement of the effectiveness of resource conservation; complex mechanization and beneficiation process automation. In the article the contemporary problems of raw coal benefication under current conditions of the increased dilution of withdrawable coals with rock fractions are considered. Comparative analysis of efficiency of application of modern concentrating equipment under the conditions of the CCPP of OOO "MMK-UGOL" is carried out on the basis of research works. Particular attention is paid to dehydration of produced coal concentrate with content of volatile agents of more than 35.0% and content of fine-dispersed particles in flotation concentrate of more than 50.0%. Comparative analysis of the coal concentrate dehydration technologies is conducted.
Energy Technology Data Exchange (ETDEWEB)
NONE
1981-07-01
Papers of Professor Yoshio Kamiya of Tokyo University are compiled into this report. The list of the papers includes (1) Synthesis of heavy fuel oils from coal; (2) Research and development of coal liquefaction; (3) Dissolution reaction of coal by hydrogen-donating aromatic solvents (I); (4) Effect of hydrogen-donor solvent on the liquefaction of coal; (5) Recent studies on the chemical structure of solvent refined coal; (6) Dissolution reaction of coal by hydrogen-donating aromatic solvents (II); (7) Future of coal as energy material; (8), (9), (10) same as (6) in the subject discussed; (11) Recent studies on coal liquefaction catalysts; (12) Environmental problems and drain treatment to accompany processes of converting fossil resources into fuels; (13) Chemistry of coal oxidation; (14) Fractionation and analysis of solvent refined coal by gel permeation chromatography; (15) Current state of research and development of coal liquefaction; (16) Properties and components of coal oils from coal liquefaction processes under development; (17) Solvent effect of coal derived aromatic compounds on the liquefaction of Akabira coal; (18) Chemistry of coal liquefaction; (19) Research and development of coal liquefaction in the U.S.; (20) Thermal treatment of coal-related aromatic ethers in tetralin solution; (21) Recent technology of utilizing heavy carbon resources; (22) Chemical properties and reactivity of coal; (23) Current state and future of development of coal liquefaction processes; and (24) Development of overseas coal liquefaction projects. (NEDO)
Energy Technology Data Exchange (ETDEWEB)
NONE
1999-03-01
As a part of the project for internationalization of coal liquefaction technology, this paper reported on the potential survey for location of Indonesian low grade coal liquefaction (study of applicability of the improved BCL process and survey of hydrogen production technology using coal gasification). The survey was conducted of a locational possibility of a coal liquefaction commercial plant to be located at mine site in South Sumatra for Banko coal raw material. The improved BCL process was applied in which the results of the study by NBCL Takasago Research Institute were reflected. Further, the hydrogen production was studied by gasification of Banko coal, and the comparison was made with the conventional natural gas reforming method. As a result of the study using information/knowledge obtained during the conceptual design of Australian brown coal, the construction cost of commercial scale liquefaction plant with the Banko coal processing amount of 30,000 tons/day became 549.8 billion yen in the case of using natural gas as raw material for hydrogen production. This construction cost is the lowest as compared with 601.7 billion yen in the demonstrative BCL process and with 577.1 billion yen in the advanced BCL process. This is a process making use of features of Banko coal. The process for hydrogen production by the steam reforming method using natural gas has an advantage of increasing the production amount of coal-derived liquid the most of the three other methods. (NEDO)
Energy Technology Data Exchange (ETDEWEB)
NONE
1999-03-01
As a part of the project for internationalization of coal liquefaction technology, this paper reported on the potential survey for location of Indonesian low grade coal liquefaction (study of applicability of the improved BCL process and survey of hydrogen production technology using coal gasification). The survey was conducted of a locational possibility of a coal liquefaction commercial plant to be located at mine site in South Sumatra for Banko coal raw material. The improved BCL process was applied in which the results of the study by NBCL Takasago Research Institute were reflected. Further, the hydrogen production was studied by gasification of Banko coal, and the comparison was made with the conventional natural gas reforming method. As a result of the study using information/knowledge obtained during the conceptual design of Australian brown coal, the construction cost of commercial scale liquefaction plant with the Banko coal processing amount of 30,000 tons/day became 549.8 billion yen in the case of using natural gas as raw material for hydrogen production. This construction cost is the lowest as compared with 601.7 billion yen in the demonstrative BCL process and with 577.1 billion yen in the advanced BCL process. This is a process making use of features of Banko coal. The process for hydrogen production by the steam reforming method using natural gas has an advantage of increasing the production amount of coal-derived liquid the most of the three other methods. (NEDO)
Surface chemical properties of novel high surface area solids synthesized from coal fly ash
CSIR Research Space (South Africa)
Pretorius, PJ
2003-07-23
Full Text Available The zeolite, Na-P1, was synthesized from fly ash samples originating from coal-fired power stations in South Africa by hydrothermal treatment of the raw ash with concentrated aqueous NaOH solutions. The zeolite was then further modified by acid...
The chemical transformation of calcium in Shenhua coal during combustion in a muffle furnace
Energy Technology Data Exchange (ETDEWEB)
Tian, Sida [North China Electric Power Univ., Beijing (China). School of Energy, Power and Mechanical Engineering; Ministry of Education, Beijing (China). Key Lab. of Condition Monitoring and Control for Power Plant Equipment; Zhuo, Yuqun; Chen, Changhe [Tsinghua Univ., Beijing (China). Dept. of Thermal Engineering; Ministry of Education, Beijing (China). Key Lab. for Thermal Science and Power Engineering; Shu, Xinqian [China Univ. of Mining and Technology, Beijing (China). School of Chemical and Environmental Engineering
2013-07-01
The chemical reaction characteristics of calcium in three samples of Shenhua coal, i.e. raw sample, hydrochloric acid washed sample and hydrochloric acid washed light fraction, during combustion in a muffle furnace have been investigated in this paper. Ca is bound by calcite and organic matter in Shenhua coal. X ray diffraction (XRD) phase analysis has been conducted to these samples' combustion products obtained by heating at different temperatures. It has been found that the organically-bound calcium could easily react with clays and transform into gehlenite and anorthite partially if combusted under 815 C, whilst the excluded minerals promoted the conversion of gehlenite to anorthite. Calcite in Shenhua coal decomposed into calcium oxide and partially transformed into calcium sulfate under 815 C, and formed gehlenite and anorthite under 1,050 C. Calcite and other HCl-dissolved minerals in Shenhua coal were responsible mainly for the characteristic that the clay minerals in Shenhua coal hardly became mullite during combustion.
Application of EMD-Based SVD and SVM to Coal-Gangue Interface Detection
Directory of Open Access Journals (Sweden)
Wei Liu
2014-01-01
Full Text Available Coal-gangue interface detection during top-coal caving mining is a challenging problem. This paper proposes a new vibration signal analysis approach to detecting the coal-gangue interface based on singular value decomposition (SVD techniques and support vector machines (SVMs. Due to the nonstationary characteristics in vibration signals of the tail boom support of the longwall mining machine in this complicated environment, the empirical mode decomposition (EMD is used to decompose the raw vibration signals into a number of intrinsic mode functions (IMFs by which the initial feature vector matrices can be formed automatically. By applying the SVD algorithm to the initial feature vector matrices, the singular values of matrices can be obtained and used as the input feature vectors of SVMs classifier. The analysis results of vibration signals from the tail boom support of a longwall mining machine show that the method based on EMD, SVD, and SVM is effective for coal-gangue interface detection even when the number of samples is small.
50 years of brown coal open cast ''Konin''
International Nuclear Information System (INIS)
Wlodarczyk, B.
1995-01-01
The history as well as present condition of brown coal mine ''Konin'' located in Central Poland are presented. In 1994 about 13380 million tons of coal were extracted from this open cast and 95% of it was burnt in power plants. The prognosis of future production up to 2020 is given and the program of mine restructurization is described. 3 ills
European initiative on cdio in raw material programmes
Edelbro, Catrin; Hulthén, Erik; Clausen, Elisabeth; Tanner, David; Herrera Herbert, Juan; Jonsson, Kristina; Bealieu, Stephan; Kamp, A.; Försth, Michael
2017-01-01
One of five Knowledge and Innovation Communities (KICs), was launched in Europe in 2014 and has its focus on exploration, extraction, mineral processing, metallurgy, recycling and material substitution of raw materials. To reach the vision, where the European Union’s industrial strength is based on
Pellati, Federica; Prencipe, Francesco Pio; Bertelli, Davide; Benvenuti, Stefania
2013-01-01
A closed-vessel microwave-assisted extraction (MAE) technique was optimized for the first time for the extraction of polyphenols from raw propolis. The results obtained by means of response surface experimental design methodology showed that the best global response was reached when the extraction temperature was set at 106 °C, the solvent composition close to EtOH-H2O 80:20 (v/v), with an extraction time of 15 min. In comparison with other techniques, such as maceration, heat reflux extraction (HRE) and ultrasound-assisted extraction (UAE), the extraction with MAE was improved by shorter extraction time and lower volume of solvent needed. The HPLC analyses of propolis extracts were carried out on a fused-core Ascentis Express C18 column (150 mm × 3.0 mm I.D., 2.7 μm), with a gradient mobile phase composed by 0.1% formic acid in water and acetonitrile. Detection was performed by DAD and MS. The method validation indicated that the correlation coefficients were >0.999; the limit of detection was in the range 0.5-0.8 μg/ml for phenolic acids and 1.2-3.0 μg/ml for flavonoids; the recovery range was 95.3-98.1% for phenolic acids and 94.1-101.3% for flavonoids; the intra- and inter-day %RSD values for retention times and peak areas were ≤ 0.3 and 2.2%, respectively. The quali- and quantitative analysis of polyphenols in Italian samples of raw propolis was performed with the validated method. Total phenolic acids ranged from 5.0 to 120.8 mg/g and total flavonoids from 2.5 to 168.0mg/g. The proposed MAE procedure and HPLC method can be considered reliable and useful tools for the comprehensive multi-component analysis of polyphenols in propolis extracts to be used in apitherapy. Copyright © 2013 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Tomita, H.; Isoda, T.; Kusakabe, K.; Morooka, S. [Kyushu University, Fukuoka (Japan). Faculty of Engineering; Hayashi, J. [Hokkaido University, Sapporo (Japan). Center for Advanced Research of Energy Technology
1996-10-28
Change in depolymerization degree and coal structure was studied for depolymerization treatment of coal in various alcohol containing aqueous hydrogen peroxide. In experiment, the mixture of Yallourn coal, alcohol and aqueous hydrogen peroxide was agitated in nitrogen atmosphere of normal pressure at 70{degree}C for 12 hours. As the experimental result, the methanol solubility of only 5% of raw coal increased up to 35.2% by hydrogen peroxide treatment, while the yield of insoluble matters also decreased from 94% to 62%. Most of the gas produced during treatment was composed of inorganic gases such as CO and CO2, and its carbon loss was extremely decreased by adding alcohol. From the analytical result of carbon loss in hydrogen peroxide treatment, it was clarified that alkylation advances with introduction of alkyl group derived from alcohol into coal by hydrogen peroxide treatment under a coexistence of alcohol, and depolymerization reaction of coal itself is thus promoted by alcohol. 4 refs., 7 figs., 1 tab.
Bioremediation potential of coal-tar-oil-contaminated soil
International Nuclear Information System (INIS)
Lajoie, C.A.
1991-01-01
The bioremediation of coal tar oil contaminated soil was investigated in 90 day laboratory simulation experiments. The effect of soil moisture, humic acid amendment, and coal tar oil concentration on the rate of disappearance of individual coal tar oil constituents (PAHs and related compounds) was determined by methylene chloride extraction and gas chromatography. Mass balance experiments determined the fate of both the individual 14 C-labeled PAHs phenanthrene, pyrene, and benzo(a)pyrene, and the total coal tar oil carbon. Mineralization, volatilization, incorporation into microbial biomass, disappearance of individual coal tar oil constitutents, and the distribution of residual 14 C-activity in different soil fractions were measured. The rate of disappearance of coal tar oil constituents increased with increasing soil moisture over the experimental range. Humic acid amendment initially enhanced the rate of disappearance, but decreased the extent of disappearance. The amount of contamination removed decreased at higher coal tar oil concentrations. The practical limit for biodegradation in the system tested appeared to be between 1.0 and 2.5% coal tar oil. Mineralization accounted for 40 to 50% of the applied coal tar oil. Volatilization was a minor pathway of disappearance
Vadose Zone Fate and Transport Simulation of Chemicals Associated with Coal Seam Gas Extraction
Simunek, J.; Mallants, D.; Jacques, D.; Van Genuchten, M.
2017-12-01
The HYDRUS-1D and HYDRUS (2D/3D) computer software packages are widely used finite element models for simulating the one-, and two- or three-dimensional movement of water, heat, and multiple solutes in variably-saturated media, respectively. While the standard HYDRUS models consider only the fate and transport of individual solutes or solutes subject to first-order degradation reactions, several specialized HYDRUS add-on modules can simulate far more complex biogeochemical processes. The objective of this presentation is to provide an overview of the HYDRUS models and their add-on modules, and to demonstrate applications of the software to the subsurface fate and transport of chemicals involved in coal seam gas extraction and water management operations. One application uses the standard HYDRUS model to evaluate the natural soil attenuation potential of hydraulic fracturing chemicals and their transformation products in case of an accidental release. By coupling the processes of retardation, first-order degradation and convective-dispersive transport of the biocide bronopol and its degradation products, we demonstrated how natural attenuation reduces initial concentrations by more than a factor of hundred in the top 5 cm of the vadose zone. A second application uses the UnsatChem module to explore the possible use of coal seam gas produced water for sustainable irrigation. Simulations with different irrigation waters (untreated, amended with surface water, and reverse osmosis treated) provided detailed results regarding chemical indicators of soil and plant health, notably SAR, EC and sodium concentrations. A third application uses the coupled HYDRUS-PHREEQC module to analyze trace metal transport involving cation exchange and surface complexation sorption reactions in the vadose zone leached with coal seam gas produced water following some accidental water release scenario. Results show that the main process responsible for trace metal migration is complexation of
Li, Hongmin; Li, Qingling; Wang, Xu; Xu, Kehua; Chen, Zhenzhen; Gong, Xiaocong; Liu, Xin; Tong, Lili; Tang, Bo
2009-03-15
A method for the first time to simultaneously determine superoxide and hydrogen peroxide in macrophage RAW 264.7 cell extracts by microchip electrophoresis with laser-induced fluorescence detection (MCE-LIF) was developed. 2-Chloro-1,3-dibenzothiazolinecyclohexene (DBZTC) and bis(p-methylbenzenesulfonyl) dichlorofluorescein (FS), two probes that can be specifically derivatized by superoxide and hydrogen peroxide, respectively, were synthesized and used. Parameters influencing the derivatization and on-chip separation were optimized. With the use of a HEPES (20 mM, pH 7.4) running buffer, a 50 mm long separation channel, and a separation voltage of 1800 V, baseline separation was achieved within 48 s for the two derivatization products, DBZTC-oxide (DBO) and 2,7-dichlorofluorescein (DCF). The linearity ranges of the method were 0.08-5.0 and 0.02-5.0 microM with detection limits (signal-to-noise ratio = 3) of 10 nM (1.36 amol) and 5.6 nM (0.76 amol) for superoxide and hydrogen peroxide, respectively. The relative standard deviations (RSDs) of migration time and peak area were less than 2.0% and 5.0%, respectively. The recoveries of the cell extract samples spiked with 1.0 microM standard solutions were 96.1% and 93.0% for superoxide and hydrogen peroxide, respectively. With the use of this method, superoxide and hydrogen peroxide in phorbol myristate acetate (PMA)-stimulated macrophage RAW 264.7 cell extracts were found to be 0.78 and 1.14 microM, respectively. The method has paved a way for simultaneously determining two or more reactive oxygen species (ROS) in a biological system with high resolution.
Chemical analyses in the World Coal Quality Inventory
Tewalt, Susan J.; Belkin, Harvey E.; SanFilipo, John R.; Merrill, Matthew D.; Palmer, Curtis A.; Warwick, Peter D.; Karlsen, Alexander W.; Finkelman, Robert B.; Park, Andy J.
2010-01-01
The main objective of the World Coal Quality Inventory (WoCQI) was to collect and analyze a global set of samples of mined coal during a time period from about 1995 to 2006 (Finkelman and Lovern, 2001). Coal samples were collected by foreign collaborators and submitted to country specialists in the U.S. Geological Survey (USGS) Energy Program. However, samples from certain countries, such as Afghanistan, India, and Kyrgyzstan, were collected collaboratively in the field with USGS personnel. Samples were subsequently analyzed at two laboratories: the USGS Inorganic Geochemistry Laboratory located in Denver, CO and a commercial laboratory (Geochemical Testing, Inc.) located in Somerset, PA. Thus the dataset, which is in Excel (2003) format and includes 1,580 samples from 57 countries, does not have the inter-laboratory variability that is present in many compilations. Major-, minor-, and trace-element analyses from the USGS laboratory, calculated to a consistent analytical basis (dry, whole-coal) and presented with available sample identification information, are sorted alphabetically by country name. About 70 percent of the samples also have data from the commercial laboratory, which are presented on an as-received analytical basis. The USGS initiated a laboratory review of quality assurance in 2008, covering quality control and methodology used in inorganic chemical analyses of coal, coal power plant ash, water, and sediment samples. This quality control review found that data generated by the USGS Inorganic Geochemistry Laboratory from 1996 through 2006 were characterized by quality practices that did not meet USGS requirements commonly in use at the time. The most serious shortcomings were (1) the adjustment of raw sample data to standards when the instrument values for those standards exceeded acceptable limits or (2) the insufficient use of multiple standards to provide adequate quality assurance. In general, adjustment of raw data to account for instrument
Energy Technology Data Exchange (ETDEWEB)
Kniess, C.T.; Prates, P.B.; Brys, M.; Martins, G.J.; Riella, H.G., E-mail: kniesscl@gmail.com [Universidade Federal de Santa Catarina (UFSC), SC (Brazil); Bernardin, A. [Universidade do Extremo Sul de Santa Catarina (UNESC), SC (Brazil)
2011-07-01
The physical, chemical and mineralogical properties of mineral coal bottom ash derived from thermoelectric power plants are compatible with various raw materials used in ceramic industries, which indicates a possibility of partial or fully substitution of raw materials by this residue. This work intends to obtain and characterize ceramic products with additions of different percentages of bottom ash coal. For this, was used a commercial ceramic body (CI) made by an industry in the state of Santa Catarina. The formulations of the ceramics products were obtained by the mixture design (planning network Simplex). The byproduct of coal bottom ash was found to be an attractive raw material source of SiO{sub 2} and Al{sub 2}O{sub 3} to obtain ceramic materials. Was demonstrated the possibility of developing a ceramic materials classified as semi-porous (6
Coal conversion processes. Quarterly report, December 13, 1983-March 12, 1984
Energy Technology Data Exchange (ETDEWEB)
Cobb, J.T. Jr.; Biloen, P.; Holder, G.D.; Klinzing, G.E.; Tierney, J.W.
1984-05-01
Experimental work is continuing on four separate projects related to coal conversion processes. The direct digital control of exothermic multiphase reactions is being studied in an experimental adiabatic flow reactor. The existence of two stable steady states for the Fischer-Tropsch reaction network at the same temperature and feed condition has been verified and quantified. Various absorbents for SO/sub 2/ and NO/sub X/ are being studied. The absorption of NO/sub 2/ by methanol and N-cyclohexyl-2-pyrrolidone has been extensively examined. Preliminary data have been obtained with triethylene-tetraamine. Hindered amines will be studied next. Procedures for the preparation of liquid membranes have been tested and the incorporation of hindered amines in them will now be examined. Isotopic switching is being used to study the way in which promoters affect supported metal catalysts. With improved resolution from the mass spectrometer, early quantitative results give indications of three different surface species and of non-statistical ingrowth of /sup 13/C into the product molecules. A program for the study of the extraction of coal and oil shale using supercritical fluids is being carried out. The effect of the presence of piperidine on the amount of toluene solubles produced by supercritical extraction of coal with toluene/piperidine mixture has been determined. A new kinetic model for the extraction/liquefaction of coal by supercritical toluene and THF has been developed and proven satisfactory. Bruceton coal and Hi Na lignite have been extracted with supercritical water. 3 references, 7 figures, 6 tables.
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-12-01
The paper reported training in the fiscal 1997 coal engineer training course. The training was made in a period from June 9 to November 12 in terms of actual training, English training, joint seminar, visits to the related facilities in Japan, overseas training, etc. for 10 engineers from mining companies, oil companies and electric power companies. In the actual training, the following lectures were given at International Resource University in Akita prefecture: coal exploration technology, coal situation of Australia, physical/chemical characteristics of coal and the application, coal preparation technology, coal situation in India, coal situation in the U.S., trend of general coal demand, coal situation in China, coal mining technology, actual surface mining technology, coal situation in Canada, commercial English, trend of raw coal demand, coal geology, environmental protection technology related to coal utilization, etc. Overseas training, which was divided into an Australia group and a Canada/America group, was conducted for about a month. Training in Indonesia was canceled because of a large scale forest fire which broke out immediately before the start. 88 figs., 52 tabs.
Bujak-Pietrek, Stella; Mikołajczyk, Urszula; Szadkowska-Stańczyk, Irena
2011-01-01
Non-coal mining includes the extraction of materials for construction (stone, gravel, sand and clay), chemical industry (salt and sulfur), metallurgy (metal ores, uranium and thorium) and other mining and quarrying. Regardless of the type of mining company one of the most common health hazards in this sector is exposure to high concentrations of dust occurring during the extraction of materials. Such activities as drilling, use of blasting agents, processing of raw material, its transportation and loading are the source of large amounts of dust containing crystalline silica. Data on exposure to dust, collected by industrial hygiene laboratories on the basis of dust concentration measurements in the work environment, were obtained from the sanitary inspection service. The analysis of dust concentrations at workplaces in non-coal mining covered the years 2001-2005. The average concentration of inhalable and respirable dust and the degree of results dispersion at workposts in different branches of non-coal mining (according to NACE rev1.1) were evaluated. Also there was estimated the percentage of surveys indicating dust concentrations above hygiene standards. Almost 5000 measurements of dust concentrations were performed in the years under study. The highest concentration of inhalable dust was noted for the production of salt (5.51 mg/m3), other mining and quarrying (4.30 mg/m3) and quarrying of slate (3.77 mg/m3). For respirable dust the highest concentrations were noted in other mining and quarrying (1.10 mg/m3), quarrying of slate (1.09 mg/m3) and quarrying of stone (0.81 mg/m3). Exposure to high concentrations of dust during the extraction of non-carbon is still an important hazard to human health. Almost for all workposts under study the excess of hygiene standards were observed.
Analysis of gas migration patterns in fractured coal rocks under actual mining conditions
Directory of Open Access Journals (Sweden)
Gao Mingzhong
2017-01-01
Full Text Available Fracture fields in coal rocks are the main channels for gas seepage, migration, and extraction. The development, evolution, and spatial distribution of fractures in coal rocks directly affect the permeability of the coal rock as well as gas migration and flow. In this work, the Ji-15-14120 mining face at the No. 8 Coal Mine of Pingdingshan Tian’an Coal Mining Co. Ltd., Pingdingshan, China, was selected as the test site to develop a full-parameter fracture observation instrument and a dynamic fracture observation technique. The acquired video information of fractures in the walls of the boreholes was vectorized and converted to planarly expanded images on a computer-aided design platform. Based on the relative spatial distances between the openings of the boreholes, simultaneous planar images of isolated fractures in the walls of the boreholes along the mining direction were obtained from the boreholes located at various distances from the mining face. Using this information, a 3-D fracture network under mining conditions was established. The gas migration pattern was calculated using a COMSOL computation platform. The results showed that between 10 hours and 1 day the fracture network controlled the gas-flow, rather than the coal seam itself. After one day, the migration of gas was completely controlled by the fractures. The presence of fractures in the overlying rock enables the gas in coal seam to migrate more easily to the surrounding rocks or extraction tunnels situated relatively far away from the coal rock. These conclusions provide an important theoretical basis for gas extraction.
Energy Technology Data Exchange (ETDEWEB)
Li, W.Y.; Feng, J.; Xie, K.C.; Kandiyoti, R. [Taiyuan University of Technology, Taiyuan (China)
2005-08-01
Point of Ayr coal has been extracted using three solvents: tetralin, quinoline and 1-methyl-2-pyrrolidinone (NMP); at two temperatures: 350 {sup o}C and 450{sup o}C, corresponding approximately to before and after the onset of massive covalent bond scission by pyrolysis. These solvents differ in solvent power and the ability to donate hydrogen atoms to stabilize free radicals produced by pyrolysis of the coal. Analysis of the fresh solvents and recovered solvents from coal liquefaction was achieved by size exclusion chromatography and UV-fluorescence spectroscopy. In the blank run, it was testified that the filling material sand and the steel powder did not react with solvent with increasing reaction temperature. The role of hydrogen donation in the tetralin extracts was to increase the proportion of large molecules with increasing extraction temperature. Quinoline and NMP both have the powerful extracting capability to get more materials out of coal with increasing extraction temperature.
Energy Technology Data Exchange (ETDEWEB)
Wen-Ying Li; Jie Feng; Ke-Chang Xie; R. Kandiyoti [Taiyuan University of Technology, Taiyuan (China). Key Laboratory of Coal Science and Technology for Ministry of Education and Shanxi Province
2005-08-01
Point of Ayr coal has been extracted using three solvents: tetralin, quinoline and 1-methyl-2-pyrrolidinone (NMP); at two temperatures: 350{sup o}C and 450{sup o}C, corresponding approximately to before and after the onset of massive covalent bond scission by pyrolysis. These solvents differ in solvent power and the ability to donate hydrogen atoms to stabilize free radicals produced by pyrolysis of the coal. Analysis of the fresh solvents and recovered solvents from coal liquefaction was achieved by size exclusion chromatography and UV-fluorescence spectroscopy. In the blank run, it was testified that the filling material sand and the steel powder did not react with solvent with increasing reaction temperature. The role of hydrogen donation in the tetralin extracts was to increase the proportion of large molecules with increasing extraction temperature. Quinoline and NMP both have the powerful extracting capability to get more materials out of coal with increasing extraction temperature.
Biosolubilization of raw and gamma irradiated lignite by trichoderma asperellum
International Nuclear Information System (INIS)
Sugoro, I.; Astuti, D.I.; Aditiawati, P.; Sasongko, D.
2012-01-01
Biosolubilization is a promising technology for converting solid coal to liquid oil by addition of microorganism. Aim of this research is to compare between gamma irradiated lignite (10 kGy) with raw lignite in biosolubilization by selected fungi Trichoderma asperellum. Treatments were A (MSS + gamma irradiated lignite 5% + T. asperellum) and B (MSS + raw lignite 5% + T. asperellum) with sub-merged culture. There were two parameters observed i.e. biosolubilization product based on absorbance value at λ 250nm and λ 450nm and metal analysis by neutron activation analysis (NAA). The highest biosolubilization will be analyzed by FTIR and GCMS. The results showed that biosolubilization of raw lignite (B) was higher than sterilized lignite (A) based on absorbance value at λ 250nm and λ 450nm . The metal of lignite was decreased after incubation. FTIR analysis showed that both of treatment had similar spectra on biosolubilization products. GCMS analysis showed that both of treatment had different number of hydrocarbon, i.e. C 6 - C 35 (A) and C 10 - C 35 (B) and dominated by aromatic acids, aliphatic and phenylethers. Both of treatment product had the potency as oil substituted but its recommended to deoxygenate for higher quality. (author)
A New Tree-Type Fracturing Method for Stimulating Coal Seam Gas Reservoirs
Directory of Open Access Journals (Sweden)
Qian Li
2017-09-01
Full Text Available Hydraulic fracturing is used widely to stimulate coalbed methane production in coal mines. However, some factors associated with conventional hydraulic fracturing, such as the simple morphology of the fractures it generates and inhomogeneous stress relief, limit its scope of application in coal mines. These problems mean that gas extraction efficiency is low. Conventional fracturing may leave hidden pockets of gas, which will be safety hazards for subsequent coal mining operations. Based on a new drilling technique applicable to drilling boreholes in coal seams, this paper proposes a tree-type fracturing technique for stimulating reservoir volumes. Tree-type fracturing simulation experiments using a large-scale triaxial testing apparatus were conducted in the laboratory. In contrast to the single hole drilled for conventional hydraulic fracturing, the tree-type sub-boreholes induce radial and tangential fractures that form complex fracture networks. These fracture networks can eliminate the “blank area” that may host dangerous gas pockets. Gas seepage in tree-type fractures was analyzed, and gas seepage tests after tree-type fracturing showed that permeability was greatly enhanced. The equipment developed for tree-type fracturing was tested in the Fengchun underground coal mine in China. After implementing tree-type fracturing, the gas extraction rate was around 2.3 times greater than that for traditional fracturing, and the extraction rate remained high for a long time during a 30-day test. This shortened the gas drainage time and improved gas extraction efficiency.
Ye, Cui-Ping; Feng, Jie; Li, Wen-Ying
2012-07-01
Coal structure, especially the macromolecular aromatic skeleton structure, has a strong influence on coke reactivity and coal gasification, so it is the key to grasp the macromolecular aromatic skeleton coal structure for getting the reasonable high efficiency utilization of coal. However, it is difficult to acquire their information due to the complex compositions and structure of coal. It has been found that the macromolecular aromatic network coal structure would be most isolated if small molecular of coal was first extracted. Then the macromolecular aromatic skeleton coal structure would be clearly analyzed by instruments, such as X-ray diffraction (XRD), fluorescence spectroscopy with synchronous mode (Syn-F), Gel permeation chromatography (GPC) etc. Based on the previous results, according to the stepwise fractional liquid extraction, two Chinese typical power coals, PS and HDG, were extracted by silica gel as stationary phase and acetonitrile, tetrahydrofuran (THF), pyridine and 1-methyl-2-pyrollidinone (NMP) as a solvent group for sequential elution. GPC, Syn-F and XRD were applied to investigate molecular mass distribution, condensed aromatic structure and crystal characteristics. The results showed that the size of aromatic layers (La) is small (3-3.95 nm) and the stacking heights (Lc) are 0.8-1.2 nm. The molecular mass distribution of the macromolecular aromatic network structure is between 400 and 1 130 amu, with condensed aromatic numbers of 3-7 in the structure units.
Energy Technology Data Exchange (ETDEWEB)
Jankuloska, V.; Cadikovska, V. (Rudnici i Zelezarnica, Skopje (Yugoslavia))
1990-01-01
Describes laboratory briquetting of lignite from the Lavci coal deposit in Macedonia, Yugoslavia. The deposit has 21.4 Mt of lignite reserves. Coal samples from cores of exploratory boreholes were evaluated. Chemical composition and properties of the coal are presented. The coal has a 60.8% moisture, 7.8% ash and 0.82% sulfur content. The calorific value of coal is between 5,881 and 7,828 kJ/kg. Coal samples were comminuted and briquetted without binders, due to the favorable petrographic composition of the lignite. Resulting laboratory briquets weighing 45 g were tested for compression strength, water resistance and abrasion (Micum test). Briquet combustion properties were also determined. Briquet quality was of Yugoslav class B[sub 1] and B[sub 2] with the lowest calorific value being 16,427 kJ/kg, which is 2.79 times higher than that of the raw coal. 3 refs.
Energy Technology Data Exchange (ETDEWEB)
Rydkevich, M.I.; Tselik, M.P.; Belkina, T.V.
1985-06-01
Subjects covered in the all-union coordinating conference on coking and chemical by-products of coking, which took place on 13-15 July 1984, are discussed. One hundred forty eight on-going and new research themes accepted as research projects for 1985-86 were discussed. Areas of research include coals from the eastern deposits and Pechora basin as raw materials for coking; coals from the southern deposits as coking raw materials; technology of coal preparation for coking; technology for producing blast furnace coke and methods of assessing its quality; technology for producing other kinds of coke and carbon graphite materials; methods for extraction processing and producing chemical products from coking.
Directory of Open Access Journals (Sweden)
Jianhua Ping
Full Text Available Coal mining is one of the core industries that contribute to the economic development of a country but deteriorate the environment. Being the primary source of energy, coal has become essential to meet the energy demand of a country. It is excavated by both opencast and underground mining methods and affects the environment, especially hydrological cycle, by discharging huge amounts of mine water. Natural hydrological processes have been well known to be vulnerable to human activities, especially large scale mining activities, which inevitably generate surface cracks and subsidence. It is therefore valuable to assess the impact of mining on river runoff for the sustainable development of regional economy. In this paper, the impact of coal mining on river runoff is assessed in one of the national key coal mining sites, Gujiao mining area, Shanxi Province, China. The characteristics of water cycle are described, the similarities and differences of runoff formation are analyzed in both coal mining and pre-mining periods. The integrated distributed hydrological model named MIKE SHE is employed to simulate and evaluate the influence of coal mining on river runoff. The study shows that mining one ton of raw coal leads to the reduction of river runoff by 2.87 m3 between 1981 and 2008, of which the surface runoff decreases by 0.24 m3 and the baseflow by 2.63 m3. The reduction degree of river runoff for mining one ton of raw coal shows an increasing trend over years. The current study also reveals that large scale coal mining initiates the formation of surface cracks and subsidence, which intercepts overland flow and enhances precipitation infiltration. Together with mine drainage, the natural hydrological processes and the stream flows have been altered and the river run off has been greatly reduced.
Ping, Jianhua; Yan, Shiyan; Gu, Pan; Wu, Zening; Hu, Caihong
2017-01-01
Coal mining is one of the core industries that contribute to the economic development of a country but deteriorate the environment. Being the primary source of energy, coal has become essential to meet the energy demand of a country. It is excavated by both opencast and underground mining methods and affects the environment, especially hydrological cycle, by discharging huge amounts of mine water. Natural hydrological processes have been well known to be vulnerable to human activities, especially large scale mining activities, which inevitably generate surface cracks and subsidence. It is therefore valuable to assess the impact of mining on river runoff for the sustainable development of regional economy. In this paper, the impact of coal mining on river runoff is assessed in one of the national key coal mining sites, Gujiao mining area, Shanxi Province, China. The characteristics of water cycle are described, the similarities and differences of runoff formation are analyzed in both coal mining and pre-mining periods. The integrated distributed hydrological model named MIKE SHE is employed to simulate and evaluate the influence of coal mining on river runoff. The study shows that mining one ton of raw coal leads to the reduction of river runoff by 2.87 m3 between 1981 and 2008, of which the surface runoff decreases by 0.24 m3 and the baseflow by 2.63 m3. The reduction degree of river runoff for mining one ton of raw coal shows an increasing trend over years. The current study also reveals that large scale coal mining initiates the formation of surface cracks and subsidence, which intercepts overland flow and enhances precipitation infiltration. Together with mine drainage, the natural hydrological processes and the stream flows have been altered and the river run off has been greatly reduced.
Energy Technology Data Exchange (ETDEWEB)
1992-08-01
CAER/UK: Detail coal and starting solvents from Wilsonville were analyzed to develop the data necessary to conduct process studies in the CO Pretreatment and Catalyst Evaluation segment of this program. A comparison of the solvent separation analysis with the distillation/separation used at Wilsonville showed that the residual solvent components contained a large amount of residual pentane soluble products. The ashy resid contained 3% iron and 400 ppM molybdenum. Although the iron content in the distillate and deashed resid was much less, namely about 200 ppM., the molybdenum concentrations in these fractions were not significantly reduced over the concentration in the ashy resid, i.e., 200 ppM in each. The pretreatment of coal with CO/H{sub 2}O in the presence of NaOH and Na{sub 2}CO{sub 3} has been shown to give a product which is lower in oxygen content and higher in hydrogen content compared to the raw coal. The atomic H/C ratios of the H{sub 2}O-insolubles, THF insolubles and the PA+A fractions of the products-together with the hydrogen consumption data suggested that the raw coal has been substantially depolymerized and hydrogenated via the WGS reaction during the pretreatment process. The extensive amount of molecular reconstruction that has occurred in the solid product was evident from the ease of solubilization of the product into pyridine. The result of the pretreatment process is a product which is highly reactive under hydroliquefaction conditions at 400{degrees}C. Reaction rates seem to be much faster than the raw coal, especially at shorter reaction times, providing the opportunity for major reductions in plant vessel sizes, and preliminary data has led us to believe that better efficiency in hydrogen utilization is achieved.
Coal Mine Accidents in Bangladesh: Its Causes and Remedial Measures
Directory of Open Access Journals (Sweden)
MD. MINHAJ UDDIN MONIR
2012-12-01
Full Text Available Barapukuria coal mine (BCM is located at Dinajpur district, NW Bangladesh. Total area is about 6.68 km2 and coal was encountered at a depth ranging between 118 and 509 m. Six major coal seams (seam I to seam VI were identified at BCM, of which, thickest one is the seam-VI (~36 m. The estimated coal reserves is about 390 million tons and of this, nearly 64 million tons of coal is extractable. The annual production of coal is about 1 million ton. In this study several parameters were used to explore minimization of accidents and improvement of coal production in BCM. Considering the geological, hydrological and other technical parameters, longwall mining method is applied for extraction of coal. Longwall retreating mining method is also applied for extraction of coal from single face with the operational area protected by self-advancing hydraulic powered roof support (HPRS system. These supports are moved forward causing the roof behind them to form an extensive abandoned area named goaf, which may lead to collapse with air blast. Coal in BCM is extracted from seam VI, using a multislice Longwall top coal caving method. Average ventilated air composition is ~20.94% oxygen, ~79.00% nitrogen, ~0.04% carbon monoxide, and minor water steam with huge dust. Production of coal was completed from 12 Longwall faces of 1st slice from seam VI. During production period several accidents and troubles within BCM have occurred. Poisonous gases such as carbon monoxide were detected during/after development of 1110 Longwall face, which increases up to 6000 ppm, therefore, sealed-off the face with mining equipments. During the development of belt gate roadway of 1101 Longwall face, maximum temperature and humidity increases up to 37 oC and 100%, respectively. Miners of BCM experienced some difficulties to work in that adverse environment. Air return roadway temperature was always 40 to 41oC in 1101 Longwall face during production period, faces temperature 46o
A method for processing peat or brown coal
Energy Technology Data Exchange (ETDEWEB)
Belkevich, P.I.; Lishtvan, I.I.; Prokhorov, G.M.; Tolstikov, G.A.
1983-01-01
A method is patented for extraction of peat and brown coal using dimethylformamide or dimethylsulfoxide in order to increase the output of bitumen and to produce dyes and acids from it and to utilize the debituminized fuel. The extraction is conducted at a solvent to raw material ratio of 1 to 5 at a temperature of 95 to 160 degrees for 0.5 to 3 hours. The extract is processed by hydroxides or carbonates of alkaline metals at a ratio of extract to the bitumen of 0.1 to 0.5 at 95 to 160 degrees for 0.5 to 2 hours with isolation of the salts of carbonic acids and recrystallization of them from the hydroxide with the acquisition of the target product of humic acids. The solvent is distilled from the extraction residue and after drying the sediment, a dye D is produced, while the debituminized fuel is processed by hydroxides of alkaline metals in a 0.1 to 1 to 1 ratio at 100 to 150 degrees for 0.5 to 2 hours with the acquisition of thinner for cement solutions. Example. A suspension of 180 grams of peat with a particle size of 0.25 to 10 millimeters with indicators (in percent) of the degree of breakdown of 40, moisture level of 20, ash content of 3.1 and bitumen content of 4.2, is mixed with 810 grams of dimethylformamide (an extraction agent to peat ratio of 4.5) and is heated at 95 degrees for three hours. Eight hundred and seventy grams of the extract (the bitumen output is 33 percent) are acquired, along with 120 grams of debituminized peat. Thirty grams of NaOH (an alkaline to bitumen ratio of 0.5) is gradually added to the bitumen extract at 90 to 100 degrees. The reaction mixture is heated to 160 degrees and is cured at this temperature for 2 hours and subsequently cooled to 20 degrees, filtered off and the salts of the carbonic acids are washed out by a fresh portion of dimethylsulfoxide with the production of 21.3 grams of salts with a melting point of 122 to 175 degrees.
Japanese steel mills update and expectations to Canadian coal industry
International Nuclear Information System (INIS)
Yamaguchi, I.
2008-01-01
Kobe Steel's (Kobelco) corporate strategy includes expanding from only-one product such as high tensile strength steel sheet, and enlarging overseas production capacity through joint ventures and technical alliances. A new steel making process from low quality iron ore and steaming coal called ITmk3 has been developed by Kobe Steel that does not require any coke, reduces carbon dioxide emissions by 20 per cent, and reduces the cost of transporting slag. This strategy and technology was presented along with the changes surrounding the Japanese steel industry and raw materials market. These changes include the rise of emerging oil-producing countries; world steel production and exports; the rise in prices of resources; and the slowdown of the United States economy. The current situation of Japanese crude steel production, pig-iron production, and coke expansion plans were also presented. The presentation also outlined expectation's of the Canadian coal industry with reference to Canadian coal imports to Japan. tabs., figs
Camilo Hernán Cruz Vélez; Magally González; Héctor Mario Gutiérrez; Luz Edith Barba; Juan Carlos Escobar; Luis Germán Delgado; Patricia Torres
2008-01-01
Reducing chemical risk in raw water from the River Cauca (caused by the presence of pentachlorophenol and organic matter (real color, UV254 absorbance)) was evaluated at bench scale by using three treatment sequences: adsorption with powdered ac-tivated coal (PAC); adsorption – coagulation; and, adsorption – disinfection – coagulation. The results showed that although PAC is appropriate for pentachlorophenol removal, and its use together with the coagulant (aluminium sulphate) significantly i...
Klishin, V.; Nikitenko, S.; Opruk, G.
2018-05-01
The paper discusses advanced top coal caving technologies for thick coal seams and addresses some issues of incomplete coal extraction, which can result in the environmental damage, landscape change, air and water pollution and endogenous fires. The authors put forward a fundamentally new, having no equivalent and ecology-friendly method to difficult-to-cave roof coal – directional hydraulic fracturing and nonexplosive disintegration.
Energy Technology Data Exchange (ETDEWEB)
NONE
1981-03-01
This program is aimed at establishing the techniques for solvent-extraction type coal liquefaction plant by constructing and operating a 1 T/D test plant to obtain the technical data for the efficient plant. The test plant is operated to confirm the effects of temperature and coal slurry concentration on liquefaction conversion by the solvent-extraction for a short time in the furnace for the extraction unit. The extraction type coal liquefaction tests can be conducted for a reaction time of around 1 hour by the test plant. The recycled solvent purification unit is installed, to regenerate the hydrogen donor solvent. For researches on the solvent-extraction type coal liquefaction process, the continuous extraction is conducted, to investigate the effects of extraction reaction rate at relatively low pressure. The optimum hydrogenation conditions are studied for the test plant. It is confirmed that a Mo-based catalyst is suitable for the hydrogenation. The batch type reaction system is operated to investigate the liquid yield of Wandoan coal, and recycled solvent balances and compositions. (NEDO)
Water Extraction from Coal-Fired Power Plant Flue Gas
Energy Technology Data Exchange (ETDEWEB)
Bruce C. Folkedahl; Greg F. Weber; Michael E. Collings
2006-06-30
The overall objective of this program was to develop a liquid disiccant-based flue gas dehydration process technology to reduce water consumption in coal-fired power plants. The specific objective of the program was to generate sufficient subscale test data and conceptual commercial power plant evaluations to assess process feasibility and merits for commercialization. Currently, coal-fired power plants require access to water sources outside the power plant for several aspects of their operation in addition to steam cycle condensation and process cooling needs. At the present time, there is no practiced method of extracting the usually abundant water found in the power plant stack gas. This project demonstrated the feasibility and merits of a liquid desiccant-based process that can efficiently and economically remove water vapor from the flue gas of fossil fuel-fired power plants to be recycled for in-plant use or exported for clean water conservation. After an extensive literature review, a survey of the available physical and chemical property information on desiccants in conjunction with a weighting scheme developed for this application, three desiccants were selected and tested in a bench-scale system at the Energy and Environmental Research Center (EERC). System performance at the bench scale aided in determining which desiccant was best suited for further evaluation. The results of the bench-scale tests along with further review of the available property data for each of the desiccants resulted in the selection of calcium chloride as the desiccant for testing at the pilot-scale level. Two weeks of testing utilizing natural gas in Test Series I and coal in Test Series II for production of flue gas was conducted with the liquid desiccant dehumidification system (LDDS) designed and built for this study. In general, it was found that the LDDS operated well and could be placed in an automode in which the process would operate with no operator intervention or
Energy Technology Data Exchange (ETDEWEB)
Andersen, Palle; Bendtsen, Jan Dimon; Mortensen, Jan Henrik; Just Nielsen, Rene; Soendergaard Pedersen, Tom [Aalborg Univ. (Denmark). Dept. of Control Engineering
2005-01-01
This report describes an attempt to improve the existing control of coal mills used at the Danish power plant Nordjyllandsvaerket Unit 3. The coal mills pulverize raw coal to a fine-grained powder, which is injected into the furnace of the power plant. In the furnace the coal is combusted, producing heat, which is used for steam production. With better control of the coal mills, the power plant can be controlled more efficiently during load changes, thus improving the overall availability and efficiency of the plant. One of the main difficulties from a control point of view is that the coal mills are not equipped with sensors that detect how much coal is injected into the furnace. During the project, a fairly detailed, non-linear differential equation model of the furnace and the steam circuit was constructed and validated against data obtained at the plant. It was observed that this model was able to capture most of the important dynamics found in the data. Based on this model, it is possible to extract linearized models in various operating points. The report discusses this approach and illustrates how the model can be linearized and reduced to a lower-order linear model that is valid in the vicinity of an operating point by removing states that have little influence on the overall response. A viable adaptive control strategy would then be to design controllers for each of these simplified linear models, i.e., the control loop that sets references to the coal mills and feedwater, and use the load as a separate input to the control. The control gains should then be scheduled according to the load. However, the variations and uncertainties in the coal mill are not addressed directly in this approach. Another control approach was taken in this project, where a Kalman filter based on measurements of air flow blown into the furnace and the oxygen concentration in the flue gas is designed to estimate the actual coal flow injected into the furnace. With this estimate
Energy audit: a case study of a coal mining area
Energy Technology Data Exchange (ETDEWEB)
Chattoraj, P.; Sinha, S.K.; Pradhan, G.K. [PCRA-ER, Kolkata (India)
2009-07-01
Coal continues to be the prime source of energy in India. In the process of exploration, mine development, extraction, beneficiation, handling, and so on, an enormous amount of energy is used in the form of both electrical and thermal energy. The coal industry in India also accounts for employing the largest workforce in its operations. The energy consumed by the employees in the coal sector alone will run into a few hundred megawatts. 7 refs., 7 tabs.
Goldsmith, M.; Lavin, M. L.
1980-01-01
Underground mining systems suitable for coal seams expoitable in the year 2000 are examined with particular relevance to the resources of Central Appalachia. Requirements for such systems may be summarized as follows: (1) production cost; (2)miner safety; (3) miner health; (4) environmental impact; and (5) coal conservation. No significant trade offs between production cost and other performance indices were found.
Retort for distilling coal oil
Energy Technology Data Exchange (ETDEWEB)
Gibbon, J
1865-12-20
The construction of a retort for extracting or distilling coal oil or other products from cannel coal, shale, or schist, and more particularly of small coal or dust technically called slack, consists in applying self-acting feed and discharge apparatus to a revolving cylindrical wrought or cast iron retort, and constructing the inner surface of the cylindrical retort with a projecting ridge which encircles the interior of the retort in a spiral manner, the same as the interior of a female screw, and the ridge may be either cast upon or riveted on the internal surface, and is so arranged to cause the material to be operated upon to advance from one end of the retort to the other, as the retort revolves by following the course of the spiral screw or worm formed by the projecting ridge.
Study of Coal Burst Source Locations in the Velenje Colliery
Directory of Open Access Journals (Sweden)
Goran Vižintin
2016-06-01
Full Text Available The Velenje coal mine (VCM is situated on the largest Slovenian coal deposit and in one of the thickest layers of coal known in the world. The thickness of the coal layer causes problems for the efficiency of extraction, since the majority of mining operations is within the coal layer. The selected longwall coal mining method with specific geometry, increasing depth of excavations, changes in stress state and naturally given geomechanical properties of rocks induce seismic events. Induced seismic events can be caused by caving processes, blasting or bursts of coal or the surrounding rock. For 2.5D visualization, data of excavations, ash content and calorific value of coal samples, hanging wall and footwall occurrence, subsidence of the surface and coal burst source locations were collected. Data and interpolation methods available in software package Surfer®12 were statistically analyzed and a Kriging (KRG interpolation method was chosen. As a result 2.5D visualizations of coal bursts source locations with geomechanical properties of coal samples taken at different depth in the coal seam in the VCM were made with data-visualization packages Surfer®12 and Voxler®3.
Directory of Open Access Journals (Sweden)
K. Moro
2014-12-01
Full Text Available This paper presents an optical character recognition (OCR system for Gujarati handwritten digits. One may find so much of work for latin writing, arabic, chines, etc. but Gujarati is a language for which hardly any work is traceable especially for handwritten characters. Here in this work we have proposed a method of feature extraction based on the raw form of the character and his skeleton and we have shown the advantage of using this method over other approaches mentioned in this article.
Energy Technology Data Exchange (ETDEWEB)
Chan-Min Liu; Zhi-Min Zong; Ji-Xian Jia; Yao-Guo Huang; Hong Zhang; Bin Huang; Xian-Yong Wei [China University of Mining and Technology, Xuzhou (China). School of Chemical Engineering
2007-07-01
Five Chinese coals were subject to water treatment (WT) at 75{sup o}C under ultrasonic irradiation (UI). The resulting water-extractable fraction (WEF) in the aqueous solution was extracted with benzene. The treated and untreated coals were extracted with a CS{sub 2}/NMP mixed solvent (1:1 by vol) under UI at room temperature. The results show that only small amount of WEF is extractable with benzene and that WT increases coal solubility in the CS{sub 2}/NMP mixed solvent only to small extent. 6 refs., 2 figs., 1 tab.
International Coal Report's coal year 1991
Energy Technology Data Exchange (ETDEWEB)
McCloskey, G [ed.
1991-05-31
Following introductory articles on factors affecting trade in coal and developments in the freight market, tables are given for coal exports and coal imports for major countries worldwide for 1989 and 1990. Figures are also included for coal consumption in Canada and the Eastern bloc,, power station consumption in Japan, coal supply and demand in the UK, electric utility coal consumption and stocks in the USA, coal production in Australia, Canada and USA by state, and world hard coal production. A final section gives electricity production and hard coal deliveries in the EEC, sales of imported and local coal and world production of pig iron and steel.
An overview of coal preparation initiatives with application to coal conversion in South Africa
International Nuclear Information System (INIS)
Reinecke, C.F.; Bunt, J.R.
1999-01-01
Coal has for many years been the most important energy resource in South Africa and has contributed to more than 70 % of South Africa's energy needs in 1998. The large in-situ coal deposits (in excess of 120 x 10 9 t) and relatively large recoverable reserves (about 33.5 x 10 9 t) will ensure that coal will for many a year still be South Africa's single biggest energy resource. Biomass burning consumes approximately 11 Mt/a of which 8 Mt/a is natural wood. This equals natural wood production. The use of firewood is considered to be unsustainable. Of the 225 Mt/a of coal extracted in South Africa in 1998, 67.0 Mt/a was exported. Of this, 62.9 Mt/a were exported as steam coal, 2.1 Mt/a as metallurgical coal, and the rest as anthracite. Current exports are conducted via the Richards Bay terminal (63.6 Mt/a), Durban (2.0 Mt/a) and a small amount via Maputo. The Richards Bay terminal is to be expanded to 72 Mt/a by 1999. It is also very important to note that most of the coal resources possess calorific values of below 25 MJ/kg, which limits its utilization to power generation (Eskom) and processes such as fixed bed dry bottom gasification (Sasol). A break-down of production and usage of coal by the various controlling groups in South Africa shows that Sasol (54.2 Mt/a) and Escom (91.0 Mt/a) are major consumers of coal. It has been proposed earlier by Horsfall (1993) that for power generation and coal conversion, the in-situ quality is generally regarded as satisfactory for use. All that is required in the way of processing is crushing to an appropriate top size and, for conversion, screening of the unwashed coal. Most other consumers require some degree of beneficiation, which generally entails the removal of stone/shale and low quality coal. More recently, the introduction of destoning plants at Duvha Colliery (Larcodems) and New Vaal Colliery (Drewboy washers) has significantly reduced the abrasiveness content of these local thermal coals, together with an increase
Release of microspherolites and metals extraction from energetical fly ashes by Bacillus isolates
Directory of Open Access Journals (Sweden)
tyriaková Iveta
2000-09-01
Full Text Available The amorphous secondary silicate mineral components formed in the process of coal combustion dominate in the composition of energy fly-ash. Depending on the composition of coal concentrate, this secondary raw material source also contains the industrially interesting components, e.g. titanium (eventually iron and aluminium and can be considered as a non-metallic material suitable for the construction industry.The main secondary mineral components of the energy fly-ash formed during the coal combustion were studied using SEM (scanning electronic microscope. They can be divided into four groups:1. Amorphous spherical alumocilicate particles in allotriomorphic aluminosilicate grains they represent a main mineral component of fly-ash, which is formed from the accompanying rocks of coal containing silicate minerals,2. Quartz which formed a substantial component of accompanying rocks of coal or accompanying accessory mineral of coal together with kaolinite and mica, was transformed into tridymite at the temperature exceeding 870°C and into cristobalite at the temperature exceeding 1470°C. The spherical particles are products of reaction between cristobalite and aluminosilicate, which is a frequent phenomenon occurring during the formation of volcanic rocks. These particles form together a main amorphous phase of fly-ash.3. Mullite represents a secondary component of fly-ash, which is formed from accompanying clay minerals of coal (kaolinite, mica together with cristobalite under the effect of temperature exceeding 1150°C,4. Non-combusted residue consists of organic substance, represents a non-combusted ratio of coal as a secondary component of fly-ash.Heterotrophic bacteria of Bacillus genus are capable to remove 66 % of titanium and 33 % of iron from non-deposited fly-ash from Opatovice after 35 days of leaching of samples. The content of solid phase in fly-ash influences the extraction of elements, mainly iron and titatnium, because
Release of inorganic trace elements from high-temperature gasification of coal
Energy Technology Data Exchange (ETDEWEB)
Blaesing, Marc
2012-05-30
The development of cleaner, more efficient techniques in next-generation coal power plants is becoming increasingly important, especially regarding to the discussion of the influence of CO{sub 2} emissions on global warming. A promising coal utilisation process is the integrated gasification combined cycle process. The direct use of the raw gas requires gas clean-up to prevent downstream parts of the gasifier from several problems. An increased efficiency and a decreased amount of harmful species can be achieved through hot fuel gas cleaning. This clean-up technique requires a comprehensive knowledge of the release characteristics of inorganic coal constituents. The aim of this thesis was to provide enhanced knowledge of the effect of key process parameters and of the chemical constitution of coal on the release of Na, K, S, and Cl species from high-temperature coal gasification. The experimental setup consisted of atmospheric flow tube furnaces and a pressurised furnace. In-situ analysis of the product gas was carried out using molecular beam mass spectrometry. A broad spectrum of different coals with assumed qualitative and quantitative differences in the release characteristics was investigated. Additionally, experiments with model substances were performed. The results of the experimental investigation were compared with thermodynamic calculations. Finally, recommendations, for the operation of a high-temperature gasifier are formulated. (orig.)
Impact on indoor air quality during burning of Pakistani coal briquettes
International Nuclear Information System (INIS)
Gammage, R.B.; Wachter, E.A.; Wade, J.; Wilson, D.L.; Ahmad, N.; Sibtain, F.; Raza, M.Z.
1993-01-01
A comparison was made of airborne emissions from combustion of new types of Pakistani coal briquettes and traditional fuels. A mud-lined Angethi stove was operated under the standard nominal conditions of burning 200 g charges of fuel inside a 12 m 3 shed with a forced rate of air exchange of 14/hr. Coal was cold briquetted with lime, clay, and oxidant. Traditional fuels were wood, charcoal, and animal dung. Compared to raw coal, the amended coal gave fourfold reduced emission of respirable-size particles (RSP) while dramatically reducing overall SO 2 release. Initial burning was restricted to the outer layers of the briquettes during which time reaction of SO 2 with lime was incomplete and early emissions of SO 2 were substantial. The measurements overall indicated that, with respect to CO, SO 2 , NO x , and RSP, substitution of amended coal briquettes for traditional fuels will not worsen indoor air quality during domestic cooking. The traditional fuels and coal briquettes emit elevated peak amounts of CO (100-250μL/L), SO 2 (2-5 μL/L), and NO x (1-5 μL/L) in the early phase of volatiles burning with much reduced emissions in the later char-burning phase. Stove operators can substantially lower exposures by lighting the fuel outside and later moving the stove inside
Model of environmental life cycle assessment for coal mining operations.
Burchart-Korol, Dorota; Fugiel, Agata; Czaplicka-Kolarz, Krystyna; Turek, Marian
2016-08-15
This paper presents a novel approach to environmental assessment of coal mining operations, which enables assessment of the factors that are both directly and indirectly affecting the environment and are associated with the production of raw materials and energy used in processes. The primary novelty of the paper is the development of a computational environmental life cycle assessment (LCA) model for coal mining operations and the application of the model for coal mining operations in Poland. The LCA model enables the assessment of environmental indicators for all identified unit processes in hard coal mines with the life cycle approach. The proposed model enables the assessment of greenhouse gas emissions (GHGs) based on the IPCC method and the assessment of damage categories, such as human health, ecosystems and resources based on the ReCiPe method. The model enables the assessment of GHGs for hard coal mining operations in three time frames: 20, 100 and 500years. The model was used to evaluate the coal mines in Poland. It was demonstrated that the largest environmental impacts in damage categories were associated with the use of fossil fuels, methane emissions and the use of electricity, processing of wastes, heat, and steel supports. It was concluded that an environmental assessment of coal mining operations, apart from direct influence from processing waste, methane emissions and drainage water, should include the use of electricity, heat and steel, particularly for steel supports. Because the model allows the comparison of environmental impact assessment for various unit processes, it can be used for all hard coal mines, not only in Poland but also in the world. This development is an important step forward in the study of the impacts of fossil fuels on the environment with the potential to mitigate the impact of the coal industry on the environment. Copyright © 2016 Elsevier B.V. All rights reserved.
Applications of micellar enzymology to clean coal technology. [Laccase
Energy Technology Data Exchange (ETDEWEB)
Walsh, C.T.
1990-04-27
This project is designed to develop methods for pre-combustion coal remediation by implementing recent advances in enzyme biochemistry. The novel approach of this study is incorporation of hydrophilic oxidative enzymes in reverse micelles in an organic solvent. Enzymes from commercial sources or microbial extracts are being investigated for their capacity to remove organic sulfur from coal by oxidation of the sulfur groups, splitting of C-S bonds and loss of sulfur as sulfuric acid. Dibenzothiophene (DBT) and ethylphenylsulfide (EPS) are serving as models of organic sulfur-containing components of coal in initial studies.
Directory of Open Access Journals (Sweden)
Fangtian Wang
2017-09-01
Full Text Available A thin coal seam mined as a protective coal seam above a gas outburst coal seam plays a central role in decreasing the degree of stress placed on a protected seam, thus increasing gas permeability levels and desorption capacities to dramatically eliminate gas outburst risk for the protected seam. However, when multiple layers of coal seams are present, stress-relieved gas from adjacent coal seams can cause a gas explosion. Thus, the post-drainage of gas from fractured and de-stressed strata should be applied. Comprehensive studies of gas permeability evolution mechanisms and gas seepage rules of protected seams close to protective seams that occur during protective seam mining must be carried out. Based on the case of the LongWall (LW 23209 working face in the Hancheng coal mine, Shaanxi Province, this paper presents a seepage model developed through the FLAC3D software program (version 5.0, Itasca Consulting Group, Inc., Minneapolis, MI, USA from which gas flow characteristics can be reflected by changes in rock mass permeability. A method involving theoretical analysis and numerical simulation was used to analyze stress relief and gas permeability evolution mechanisms present during broken rock mass compaction in a goaf. This process occurs over a reasonable amount of extraction time and in appropriate locations for comprehensive gas extraction technologies. In using this comprehensive gas drainage technological tool, the safe and efficient co-extraction of thin coal seams and gas resources can be realized, thus creating a favorable environment for the safe mining of coal and gas outburst seams.
Energy Technology Data Exchange (ETDEWEB)
NONE
1984-03-01
This paper describes the achievements in the Sunshine Project in fiscal 1993 in the investigation for coal type selection. The investigation is purposed to elucidate the status of existence and resources of coals as the raw material for coal gasification and liquefaction, the coal quality features, and the gasification and liquefaction characteristics. The results will be used as the fundamental materials for technological development. Discussions will also be given on the coal applicability to the composite gasification power generation system in which liquefied residue generated in the process are mixed with the supplied coal. Coal quality analysis and a liquefaction test under the standard condition were completed on 389 test samples composed of 136 kinds of coals produced in Canada, Australia, the U.S.A., China and Indonesia. Coal types were enumerated according to the oil yield. A gasification test was performed on the specific gravity separated coals of Chinese coals to discuss the effect of change in the ash amount on the gasification characteristics. A partial coal combustion test revealed that fuel ratio, oxygen partial pressure, and oxygen molar fraction parameters affect the combustion characteristics. The micro-gravity field is effective in discussing the combustion characteristics of particulate groups of dust coal. A coal oxidizing test was performed, wherein oxidizing characteristics and spontaneous ignition performance were estimated successfully from temperature rise of heat stored in coal. The coal type matrix data were prepared. (NEDO)
Resinous constituent extracting process
Energy Technology Data Exchange (ETDEWEB)
Sayer, W F
1947-10-07
The method of recovering oily constituents from coal or oil shale comprising the saturation of coal or oil shale in a sealed vessel with an organic solution having a boiling point at atmospheric pressure of not exceeding 220/sup 0/C, elevating the temperature within the vessel to a temperature below the cracking temperature of the constituents and maintaining the pressure within the vessel below 51 pounds, to extract the oily material from the coal or oil shale and subsequently separating the solvent from the oily material.
Xu, Changqing; Hong, Jinglan; Ren, Yixin; Wang, Qingsong; Yuan, Xueliang
2015-08-01
This study aims at qualifying air pollutants and environmental impacts generated from coal-based power plants and providing useful information for decision makers on the management of coal-based power plants in China. Results showed that approximately 9.03, 54.95, 62.08, and 12.12% of the national carbon dioxide, sulfur dioxide, nitrogen oxides, and particulate matter emissions, respectively, in 2011were generated from coal-based electricity generation. The air pollutants were mainly generated from east China because of the well-developed economy and energy-intensive industries in the region. Coal-washing technology can simply and significantly reduce the environmental burden because of the relativity low content of coal gangue and sulfur in washed coal. Optimizing the efficiency of raw materials and energy consumption is additional key factor to reduce the potential environmental impacts. In addition, improving the efficiency of air pollutants (e.g., dust, mercury, sulfur dioxide, nitrogen oxides) control system and implementing the strict requirements on air pollutants for power plants are important ways for reducing the potential environmental impacts of coal-based electricity generation in China.
International Nuclear Information System (INIS)
Mirsaidov, U.M.; Kurbonov, A.S.; Mamatov, E.D.
2015-01-01
Present article is devoted to kinetics of nitric acid decomposition of calcined borosilicate raw material of Ak-Arkhar Deposit. The dependence of nitric acid decomposition of calcined boric raw material for extraction of boron oxide on temperature (20-100 deg C) and process duration (15-60 minutes) was defined. It was defined that at temperature increasing the extraction rate of boron oxide increases from 20.8 to 78.6%.
use of water extract of moringa oleifera seeds (wemos) in raw water
African Journals Online (AJOL)
user
Availability of clean water is a serious problem, especially in developing ... J. C. Agunwamba, Department of Civil Engineering, University of Nigeria, Nsukka, .... Technical. Feasibility of the Treatment of Domestic. Waste and Raw Water.
Development of Real-Time Coal Monitoring Instrument
Energy Technology Data Exchange (ETDEWEB)
Rajan Gurjar, Ph.D.
2010-06-17
Relying on coal for energy requires optimizing the extraction of heat content from various blends of coal fuel and reducing harmful constituents and byproducts. Having a real-time measurement instrument provides relevant information about toxic constituents released in the atmosphere from burning coal and optimizes the performance of a power plant. A few commercial instruments exist and have been in operation for more than a decade. However, most of these instruments are based on radioactive sources and are bulky, expensive and time-consuming. The proposed instrument is based on the Laser Induced Breakdown Spectroscopy (LIBS). The advantage of LIBS is that it is a standoff instrument, does not require sample preparation and provides precise information about sample constituents.
STUDY OF SOLVENT AND CATALYST INTERACTIONS IN DIRECT COAL LIQUEFACTION; SEMIANNUAL
International Nuclear Information System (INIS)
Michael T. Klein
2000-01-01
temperature for volatile evolution from coal was a reliable measure of coal rank. Because of this observation, a wide variety of coals of a wide range of ranks was investigated. It was shown in this work that measuring the peak temperature for volatile evolution was quite a precise indicator of rank and correlated closely wit the rank values obtained by measuring vitrinite reflectance, a more difficult measurement to make. This prompted the desire to know the composition of the volatile materials evolved as a function of coal rank. This was then measured by coupling a TGA to a mass spectrometer using laser activation and photoionization detection TG-PI-MS. The predominant species in volatiles of low rank coal turned out to be phenols with some alkenes. As the rank increases, the relative amount of alkenes and aromatic hydrocarbons increases and the oxygenated species decrease. It was shown that these volatiles were actually pyrolitic products and not volatilization products of coal. Solvent extraction experiments coupled with TG-PI-MS indicates that the low oiling and more extractable material are essentially similar in chemical types to the non-extractable portions but apparently higher molecular weight and therefor less extractable
Energy Technology Data Exchange (ETDEWEB)
NONE
2000-07-01
This project was aimed at proving the technical feasibility of the use of coal mining wastes in the manufacturing of paving materials: floor-tiles, flags, paving-stones, grit stones, etc. The study proved that coal mining wastes in a mixture with other raw materials can be used in the manufacturing of paving materials: floor-tiles, paving-stones, grit stones.
Coal-bed methane water effects on dill and essential oils
Pumping water from coal seams decreases the pressure in the seam and in turn releases trapped methane; this is the most common and economic way of methane extraction. The water that is pumped out is known as coal-bed methane water (CBMW), which is high in sodium and other salts. In past 25 years, th...
Studies of coal structure using carbene chemistry
Energy Technology Data Exchange (ETDEWEB)
1990-01-01
The object of this grant was to react coal, derivatized forms of coal, and solvent swelled coal with carbenes (divalent carbon species) under mild conditions. These carbenes were to be prepared by treating the coal with several diazo compounds and then thermally decomposing them at relatively low temperatures (80--130{degree}C). The carbenes were to be chosen to show varying selectively toward aromatic rings containing heteroatom functionalities and toward polynuclear aromatic systems. In some instances, where selectivities toward aromatic and heteroaromatic ring systems were not known, model studies were to be carried out. Because of the generally mild conditions employed and the good selectivity anticipated, and actually observed with one particular system, it was expected that this methodology would provide structural information about the coal, along with data on the extent of occurrence and type of aromatic systems. After carbene reactions, treatment of the coal samples was to include extractions and thermolysis. Physical studies included thermogravimetric analysis, diffuse reflectance FT-IR spectroscopy, NMR ({sup 1}H and {sup 13}C) spectroscopy, gas chromatography, GC/MS and GC/FT-IR. 7 figs., 10 tabs.
Basic studies on coal liquefaction reaction, reforming and utilization of liquefaction products
Energy Technology Data Exchange (ETDEWEB)
Shiraishi, M. (National Institute for Resources and Environment, Tsukuba (Japan))
1993-09-01
This report describes the achievement of research and development of coal liquefaction technologies in the Sunshine Project for FY 1992, regarding the coal liquefaction reaction, reforming and utilization of liquefaction products. For the fundamental study on coal liquefaction reaction, were investigated effect of asphaltene in petroleum residue on coprocessing, pretreatment effect in coprocessing of Taiheiyo coal and tarsand bitumen using oil soluble catalyst, solubilization and liquefaction of Taiheiyo coal at mild conditions with the aid of super acid, and flash hydropyrolysis of finely pulverized swollen coal under high hydrogen pressure. On the other hand, for the study on hydrotreatment of coal derived liquid, were investigated catalytic hydroprocessing of Wandoan coal liquids, production of gasoline from coal liquids by fluid catalytic cracking, solvent extraction of phenolic compounds from coal liquids, and separation of hetero compounds in coal liquid by means of high pressure crystallization. Further progress in these studies has been confirmed. 9 figs., 6 tabs.
Ritchie, W. J.; Dowlatabadi, H.
2016-12-01
Twenty years ago, global coal assessments indicated reserve-to-production (R-P) ratios of more than 300 years. Consequently, most studies of energy futures established coal as a virtually unlimited backstop to meet the world's projected energy needs. Coal was modeled to offset oil and gas production declines and provide a source of energy which renewables and lower carbon supply strategies needed to outcompete. Over the past two decades, increasingly consistent methodologies have been applied globally to assess recoverable coal. Coal production has also witnessed significant mechanization to meet higher demand. Each of these has led to a significant reduction in estimates of economically recoverable coal reserves despite a doubling of market prices over this period. The current reserve to production ratio for coal is now around 100 years. It is time to reconsider coal as the inexhaustible energy backstop The energy models which develop long-term estimates of renewable energy needs and projections of greenhouse gas (GHG) emissions still adopt the characteristics of vintage coal assessments. By convention, baseline GHG emissions used by the IPCC and others, project combustion of most known coal reserves before the year 2100. When vintage assessments are used, this involves extraction of all currently known coal reserves plus twice again from resources invalidated as recoverable for geologic, environmental, social, legal, technical or economic reasons. We provide evidence for rejecting these projections of unbounded growth in coal consumption. Legacy pathways of implausibly high coal use upwardly bias long-term scenarios for total cumulative GHG emissions and subsequent research on climate change. This bias has precluded consideration of much more ambitious climate mitigation targets without significant socio-economic dislocation and unnecessarily diminishes possible future contributions from renewables.
Efficiency and emissions of coal combustion in two unvented cookstoves
International Nuclear Information System (INIS)
Kaoma, J.; Kasali, G.B.; Ellegaard, A.
1994-01-01
An improved chamber method was employed in the evaluation of the energy conversion and emission characteristics of coal in two unvented cookstoves known as the clay stove and the Maamba stove. Burn rate and stove efficiency were determined together with mission factors for carbon monoxide (CO), nitric oxide (NO) and respirable suspended particulates (RSP). Compared to Maamba stove, the clay stove exhibited a lower burn rate but higher efficiency. The clay stove recorded mean CO, SO 2 , NO 2 , NO and RSP emission factors of 200, 47, 10, 0.4 and 2.4 g/kg, respectively. The Maamba stove emission factors for the same pollutants were 170, 36, n.d., 1.2 and 8.0 g/kg, respectively. The emissions and concentrations of carbon monoxide were less than those previously found with charcoal use, but still exceeded air pollution guidelines by orders of magnitude. Thus the use of coal would not constitute any appreciable improvement over the present charcoal use. Sulphur dioxide emissions and concentrations are quite high, and would constitute a new pollutant in residential areas of Zambia. Particulate emissions and concentrations from coal are higher than from charcoal. In view of specific health risks associated with particulates from coal smoke the domestic use of raw coal is not recommended. 16 refs, 8 figs, 20 tabs
Anti-inflammatory Potential of Petiveria alliacea on Activated RAW264.7 Murine Macrophages.
Gutierrez, Rosa Martha Perez; Hoyo-Vadillo, Carlos
2017-07-01
Defense and protection to multiple harmful stimuli are the inflammation, when is self-amplified and uncontrolled is the basis of the pathogenesis of a wide variety of inflammatory illness. The aim of this study was to evaluate if Petiveria alliacea could attenuate inflammation in a murine model of RAW264 macrophages the involved model and its involved mechanism. The ethanol extract from P. alliacea was precipitated with water and supernatant was used for this study (PW). The anti-inflammatory effects of PW were investigated through evaluating of the production of several cytokines, chemokines, and expression of nuclear factor-kappa B (NF-κB) in lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages. Also was determined the ability to decrease the oxidative stress in RAW264.7 cells with carboxy-2',7'-dichloro-dihydro-fluorescein diacetate. PW significantly suppress the secretion of prostaglandin E 2 , leukotriene C 4 , interleukin (IL)-1 β, IL-6, IL-10, interferon gamma nitric oxide (NO), inducible NO synthase, IL-1 β, IL-4, in RAW264.7 cells in a dose-dependent manner. In addition, PW also markedly inhibited the transcriptional activity of NF-κB. PW produced significant anti-inflammatory activity through inhibiting the production of inflammatory mediators through the NF-κB inactivation in the LPS-stimulated RAW24.7 cells. PW exerts significant antioxidant and anti-inflammatory activities, and this effect can be attributed in part, to the presence of dibenzyl disulfide, dibenzyl trisulfide pinitol, coumarin, myricetin, glutamyl-S-benzyl cysteine, and petiveriins A and B. Treatment with ethanol extract from Petiveria alliacea which was previously precipitated with water and supernatant (PE) was tested in LPS-stimulated RAW264.7 cells. PE suppressed the level of oxidative stress and the induction of proinflammatory mediators, as PGE2, LTC4, IL-1 ß, IL-6, IL-10, IFN- NO, iNOS, IL-1 ß, IL-4, in RAW264.7 macrophages through NF-B inactivation. These findings
International Nuclear Information System (INIS)
Thuemmel, H.W.; Koerner, G.; Leonhardt, J.
1986-01-01
The total r.m.s. ash error of the 2-energy transmission on-stream ash gauges KRAS-2 (CIIRR, GDR) and SIROASH (Australia) are 4 weight percentage for raw lignite and 0.5 weight percentage for black coal, respectively. A detailed error analysis shows that this difference is due to the high water content and to strong variations in the ash composition of raw lignite. Both gauges show essentially the same radiometric performance. (author)
Energy Technology Data Exchange (ETDEWEB)
None
1977-12-01
This report reviews the technology and environmental impacts of the solvent refined coal process to produce clean solid fuel (SRC-I). Information on SRC-I pilot plant operation, process design, and economics is presented. A bibliography of current available literature in this technology area, divided into fourteen categories with abstracts of the references, is appended. The history, current operations, and future plans for the SRC pilot plants at Fort Lewis and Wilsonville are reviewed. Process data generated at these pilot plants for various coals are used as a basis for a conceptual commercial plant design with a capacity to process 20,000 tons per day (TPD) of prepared coal. Block flow diagrams, material balances, an energy balance, and a list of raw materials for the plant are also provided. Capital cost estimates for a 20,000 TPD coal feed plant derived from four prior economic studies range from $706 million to $1093 million in 1976 dollars. The annual net operating cost is estimated at $238.6 million (1976 dollars) and the average product cost at $2.71/MM Btu based on utility financing (equity 25:debt 75) with $25/ton as the delivered price of the dry coal. The report also discusses special technical considerations associated with some of the process operations and major equipment items and enumerates technical risks associated with the commercialization of the SRC-I process.
Model of environmental life cycle assessment for coal mining operations
Energy Technology Data Exchange (ETDEWEB)
Burchart-Korol, Dorota, E-mail: dburchart@gig.eu; Fugiel, Agata, E-mail: afugiel@gig.eu; Czaplicka-Kolarz, Krystyna, E-mail: kczaplicka@gig.eu; Turek, Marian, E-mail: mturek@gig.eu
2016-08-15
This paper presents a novel approach to environmental assessment of coal mining operations, which enables assessment of the factors that are both directly and indirectly affecting the environment and are associated with the production of raw materials and energy used in processes. The primary novelty of the paper is the development of a computational environmental life cycle assessment (LCA) model for coal mining operations and the application of the model for coal mining operations in Poland. The LCA model enables the assessment of environmental indicators for all identified unit processes in hard coal mines with the life cycle approach. The proposed model enables the assessment of greenhouse gas emissions (GHGs) based on the IPCC method and the assessment of damage categories, such as human health, ecosystems and resources based on the ReCiPe method. The model enables the assessment of GHGs for hard coal mining operations in three time frames: 20, 100 and 500 years. The model was used to evaluate the coal mines in Poland. It was demonstrated that the largest environmental impacts in damage categories were associated with the use of fossil fuels, methane emissions and the use of electricity, processing of wastes, heat, and steel supports. It was concluded that an environmental assessment of coal mining operations, apart from direct influence from processing waste, methane emissions and drainage water, should include the use of electricity, heat and steel, particularly for steel supports. Because the model allows the comparison of environmental impact assessment for various unit processes, it can be used for all hard coal mines, not only in Poland but also in the world. This development is an important step forward in the study of the impacts of fossil fuels on the environment with the potential to mitigate the impact of the coal industry on the environment. - Highlights: • A computational LCA model for assessment of coal mining operations • Identification of
Model of environmental life cycle assessment for coal mining operations
International Nuclear Information System (INIS)
Burchart-Korol, Dorota; Fugiel, Agata; Czaplicka-Kolarz, Krystyna; Turek, Marian
2016-01-01
This paper presents a novel approach to environmental assessment of coal mining operations, which enables assessment of the factors that are both directly and indirectly affecting the environment and are associated with the production of raw materials and energy used in processes. The primary novelty of the paper is the development of a computational environmental life cycle assessment (LCA) model for coal mining operations and the application of the model for coal mining operations in Poland. The LCA model enables the assessment of environmental indicators for all identified unit processes in hard coal mines with the life cycle approach. The proposed model enables the assessment of greenhouse gas emissions (GHGs) based on the IPCC method and the assessment of damage categories, such as human health, ecosystems and resources based on the ReCiPe method. The model enables the assessment of GHGs for hard coal mining operations in three time frames: 20, 100 and 500 years. The model was used to evaluate the coal mines in Poland. It was demonstrated that the largest environmental impacts in damage categories were associated with the use of fossil fuels, methane emissions and the use of electricity, processing of wastes, heat, and steel supports. It was concluded that an environmental assessment of coal mining operations, apart from direct influence from processing waste, methane emissions and drainage water, should include the use of electricity, heat and steel, particularly for steel supports. Because the model allows the comparison of environmental impact assessment for various unit processes, it can be used for all hard coal mines, not only in Poland but also in the world. This development is an important step forward in the study of the impacts of fossil fuels on the environment with the potential to mitigate the impact of the coal industry on the environment. - Highlights: • A computational LCA model for assessment of coal mining operations • Identification of
Energy Technology Data Exchange (ETDEWEB)
NONE
2008-07-01
Researchers of Peak oil warn about imminent worldwide coal shortages as of 2025. Countries that fully depend on coal import, such as the Netherlands, run great risks due to strongly rising prices and insecurity of supply. How large is the supply of extractable coal? How long will extraction and export continue undisturbed under increasing demand? What effect will this have on the coal price? The real data on supply, demand, price and export mainly tell a tale of unreliable reserves and high prices according to Greenpeace. (mk) [Dutch] Onderzoekers van Peakoil waarschuwen dat vanaf 2025 wereldwijd kolentekorten dreigen. Landen die volledig afhankelijk zijn van de import van kolen, zoals Nederland, lopen een groot risico door sterk stijgende prijzen en onzekere levering. Hoe groot is de winbare kolenvoorraad? Hoe lang gaan winning en export ongestoord door bij een groeiende vraag? Wat betekent dit voor de kolenprijs? De werkelijke gegevens over voorraad, vraag, prijs en export vertellen volgens Greenpeace vooral een verhaal van onbetrouwbare reserves en hoge prijzen.
Reducing Heavy Metal Element from Coal Bottom Ash by Using Citric Acid Leaching Treatment
Directory of Open Access Journals (Sweden)
Yahya Ahmad Asyari
2017-01-01
Full Text Available Coal ash is the residue that is produced during coal combustion for instance fly ash, bottom ash or boiler slag which was primarily produced from the combustion of coal. With growth in coal burning power station, huge amount of coal bottom ash (CBA considered as hazardous material which are normally disposed in an on-site disposal system without any commercialization purpose. Previous researchers have studied the extraction of silica from agricultural wastes such as palm ash and rice husk ash (RHA and CBA by using leaching treatment method. In this study, the weaker acid, citric acid solution was used to replace the strong acid in leaching treatment process. Result showed that the heavy metal content such as Copper (Cu, Zinc (Zn and Lead (Pb can be decrease. Meanwhile the silica can be extracted up to 44% from coal bottom ash using citric acid leaching treatment under the optimum reaction time of 60 minutes with solution temperature of 60°C and concentration of citric acid more than 2%.
Identification of predominant aroma components of raw, dry roasted and oil roasted almonds.
Erten, Edibe S; Cadwallader, Keith R
2017-02-15
Volatile components of raw, dry roasted and oil roasted almonds were isolated by solvent extraction/solvent-assisted flavor evaporation and predominant aroma compounds identified by gas chromatography-olfactometry (GCO) and aroma extract dilutions analysis (AEDA). Selected odorants were quantitated by GC-mass spectrometry and odor-activity values (OAVs) determined. Results of AEDA indicated that 1-octen-3-one and acetic acid were important aroma compounds in raw almonds. Those predominant in dry roasted almonds were methional, 2- and 3-methylbutanal, 2-acetyl-1-pyrroline and 2,3-pentanedione; whereas, in oil roasted almonds 4-hydroxy-2,5-dimethyl-3(2H)-furanone, 2,3-pentanedione, methional and 2-acetyl-1-pyrroline were the predominant aroma compounds. Overall, oil roasted almonds contained a greater number and higher abundance of aroma compounds than either raw or dry roasted almonds. The results of this study demonstrate the importance of lipid-derived volatile compounds in raw almond aroma. Meanwhile, in dry and oil roasted almonds, the predominant aroma compounds were derived via the Maillard reaction, lipid degradation/oxidation and sugar degradation. Copyright © 2016 Elsevier Ltd. All rights reserved.
Nanometre-sized pores in coal: Variations between coal basins and coal origin
Sakurovs, Richard; Koval, Lukas; Grigore, Mihaela; Sokolava, Anna; Ruppert, Leslie F.; Melnichenko, Yuri B.
2018-01-01
We have used small angle neutron scattering (SANS) to investigate the differences in methane and hexane penetration in pores in bituminous coal samples from the U.S., Canada, South Africa, and China, and maceral concentrates from Australian coals. This work is an extension of previous work that showed consistent differences between the extent of penetration by methane into 10–20 nm size pores in inertinite in bituminous coals from Australia, North America and Poland.In this study we have confirmed that there are differences in the response of inertinite to methane and hexane penetration in coals sourced from different coal basins. Inertinite in Permian Australian coals generally has relatively high numbers of pores in the 2.5–250 nm size range and the pores are highly penetrable by methane and hexane; coals sourced from Western Canada had similar penetrability to these Australian coals. However, the penetrability of methane and hexane into inertinite from the Australian Illawarra Coal Measures (also Permian) is substantially less than that of the other Australian coals; there are about 80% fewer 12 nm pores in Illawarra inertinite compared to the other Australian coals examined. The inertinite in coals sourced from South Africa and China had accessibility intermediate between the Illawarra coals and the other Australian coals.The extent of hexane penetration was 10–20% less than CD4 penetration into the same coal and this difference was most pronounced in the 5–50 nm pore size range. Hexane and methane penetrability into the coals showed similar trends with inertinite content.The observed variations in inertinite porosity between coals from different coal regions and coal basins may explain why previous studies differ in their observations of the relationships between gas sorption behavior, permeability, porosity, and maceral composition. These variations are not simply a demarcation between Northern and Southern Hemisphere coals.
Acoustic Emission Characteristics of Gas-Containing Coal during Loading Dilation Process
Directory of Open Access Journals (Sweden)
Z. Q. Yin
2015-12-01
Full Text Available Raw coal was used as the study object in this paper to identify the evolution characteristics of acoustic emission (AE during the dilation process of gas-containing coal. The coal specimens were stored in gas seal devices filled with gas at different pressures (0, 0.5, 1.0, and 1.5 MPa for 24 h prior to testing. Then, the specimens were tested in a rock-testing machine, and the deformation and crack fracture patterns were recorded by using strain gauges and an AE system. The axial and volumetric strains–stress curves were analyzed in relation to the AE and the failure mode. Results show that as gas pressure increases, the uniaxial compression strength and elasticity modulus of gas-containing coal decreases, whereas the Poisson’s ratio increases. In all the coal specimens, the dilation initiation stress decreases, and the dilation degree increases. During the dilation process, before the loaded coal specimens reach peak stress, and as the load increases, the changes in the specimens and in the AE energy parameter of specimens can be divided into four phases: crack closure deformation, elastic deformation, stable crack propagation, and unstable crack propagation (dilation process. Across the four phases, the AE energy increases evidently during crack closure and elastic deformation but decreases during stable crack propagation. As the gas pressure increases, the AE signal frequency increases from 4.5 KHz to 8.1 KHz during the dilation process. Thus, the gas presence in coal specimens exerts a significant influence on the closure of sample cracks and dilation damage.
Study on Al2O3 extraction from activated coal gangue under different calcination atmospheres
Dong, Ling; Liang, Xinxing; Song, Qiang; Gao, Gewu; Song, Lihua; Shu, Yuanfeng; Shu, Xinqian
2017-12-01
Coal gangue was calcinated under air, nitrogen, carbon dioxide, air-hydrogen, and hydrogen atmospheres. The effects of different calcination temperatures and atmospheres on the mineral composition of activated coal gangue were investigated by X-ray diffraction. Moreover, the acid leaching kinetics of aluminum oxide from coal gangue was investigated with sulfuric acid. It showed that the air atmosphere promoted kaolinite decomposition during coal gangue calcination. The hydrogen atmosphere promoted the activation and decomposition of kaolinite at reaction temperatures exceeding 650°C. The carbon dioxide atmosphere eliminated the influence of residual carbon on coal gangue. When the ratio of acid/coal gangue was 1.5 and reaction temperature was 650°C, the sulfuric acid leaching rate under air, air-hydrogen, carbon dioxide, hydrogen and nitrogen atmospheres were 93.66%, 90.90%, 84.06%, 81.91% and 77.54% respectively. The acid leaching reaction process conformed to unreacted shrinking core model of particle unchanged, and was controlled by the interfacial chemical reaction. The reaction kinetic equation for the leaching process was 1-(1-x)1/3=kt with an apparent activation energy of 48.97 kJ/mol.
National symposium on raw materials and energy management of mineral based industries
International Nuclear Information System (INIS)
2009-09-01
Mineral Resources are very essential for industrialization and hence facilitating socioeconomic developments. Resources like coal, iron ore, Bauxite, chromite, limestone, ilmenite and many other ores and minerals are the raw materials for development of various thermal, metallurgical, chemical and refractory industries. The mineral resources are being harnessed from their respective mines and the mining industries have expanded rapidly to meet their growing demands of various 'mineral based industries. The energy and reductants required for these industries are met from both - coking and non coking coal. Nearly 70% of the energy requirement of India is met from coal. In recent years, with the increasing demand of metals, alloys, refractories and thermal energy, most of the high-grade ores and minerals have been consumed. Unfortunately most of the low grade ores and minerals are left at the mine sites as wastes. As a matter of fact, these low grade ores are much larger in quantities compared to the high grade ones. Therefore, it has been essential to mine and beneficiate the low grade ores which can be suitably-utilized in the respective industries. It has also been necessary to develop more efficient technology to utilize these raw materials more effectively producing minimum amount of wastes and also conserving the energy resources as far as possible. Time has come to develop environment friendly most suitable technology to utilize all types of low grade and complex ores and minerals in order to meet the requirements of rapidly expanding mineral based industries of India. Unless effective programmes are made in this regard and implement those in time, India is bound to face a disastrous situation both in industrial and economic sectors. The conference is organised keeping these in view to take a stock of new and economically viable processes for mining and beneficiating low and complex ores and minerals and utilizing these judiciously in the industries. Papers
Energy Technology Data Exchange (ETDEWEB)
Shetser, M G; Spitsyn, Yu G
1985-01-01
This report deals with conditions and prospects for intensifying extraction of level and inclined seams and improving extraction technology. Reviews mechanization of excavation of stables with automatic cutter-loaders (KA80 in conjunction with KD80); coal extraction using two cutter-loaders in seams 0.9 - 1.9 m thick and up to 20 degrees inclination (pillar mining); reciprocating method of coal cutting; one-sided method of coal extraction (KMK97 cutter loaders). Discusses strengthening of junctions of faces with gate roads (KSU and KSU3M props); improved types of props (hydraulic props SUG-30, SUG-V and GVD); roof control methods (induced caving, advance torpedoing or using KM87UMP and KMT power supports). Deals in detail with introduction of new extraction technology and strengthening of unstable rock by injecting polyurethene compounds, extraction of seams with wide-web cutter-loaders (Kirovets, IK101) and plowing. (3 refs.)
Coal mine subsidence and structures
International Nuclear Information System (INIS)
Gray, R.E.
1988-01-01
Underground coal mining has occurred beneath 32 x 10 9 m 2 (8 million acres) of land in the United States and will eventually extend beneath 162 x 10 9 m 2 (40 million acres). Most of this mining has taken place and will take place in the eastern half of the United States. In areas of abandoned mines where total extraction was not achieved, roof collapse, crushing of coal pillars, or punching of coal pillars into softer mine floor or roof rock is now resulting in sinkhole or trough subsidence tens or even hundreds of years after mining. Difference in geology, in mining, and building construction practice between Europe and the United States preclude direct transfer of European subsidence engineering experience. Building damage cannot be related simply to tensile and compressive strains at the ground surface. Recognition of the subsidence damage role played by ground-structure interaction and by structural details is needed
Interaction of organic solvent with a subbituminous coal below pyrolysis temperature
Energy Technology Data Exchange (ETDEWEB)
Lindsey, D.; Grens, E.A.
1978-06-01
The interactions of a subbituminous coal with certain binary organic solvent mixtures have been studied at 250/sup 0/C. Mixtures of pyridine, quinoline, piperidine, tetrahydroquinoline, and ethylenediamine with either toluene or tetralin were contacted with coal in a successive batch, stirred reactor, the extractions being carried to near completion. Two distinct behaviors of extraction yield as a function of composition have been identified. In the majority of the solvent mixtures the extraction yield increases linearly with increasing concentration of the more active solvent. When the active solvent is ethylenediamine, however, the extraction yield increases rapidly when small concentrations of ethylenediamine are used but then levels out close to its maximum value in a 50 to 50 mix. This behavior is an indication that, except in the case of ethylenediamine, the activity of solvent mixtures is a function of bulk solution properties.
Acute Toxicity of Castor Oil Bean Extract and Tolerance Level of ...
African Journals Online (AJOL)
The experiment was carried out to determine the acute toxicity of raw castor oil bean (Ricinus communis) extract and the tolerance level of raw castor oil bean by broilers. The seeds were ground, defatted with petroleum ether and the residue was subjected to extraction with phosphate-buffered saline. The extract volume ...
Wu, Yingpeng; Ma, Yanfeng; Wang, Yan; Huang, Lu; Li, Na; Zhang, Tengfei; Zhang, Yi; Wan, Xiangjian; Huang, Yi; Chen, Yongsheng
2013-02-01
Coal, which is abundant and has an incompact structure, is a good candidate to replace graphite as the raw material for the production of graphene. Here, a new solution phase technique for the preparation of graphene from coal has been developed. The precursor: graphene oxide got from coal was examined by atomic force microscopy, dynamic light scattering and X-ray diffraction, the results showed the GO was a small and single layer sheet. The graphene was examined by X-ray photoelectron spectroscopy, and Raman spectroscopy. Furthermore, graphene films have been prepared using direct solution process and the electrical conductivity and Hall effect have been studied. The results showed the conductivity of the films could reach as high as 2.5 x 10(5) Sm(-1) and exhibited an n-type behavior.
van Niekerk, Daniel
the kinetic parameters and it was found that the swelling was governed by relaxation of the coal structure (super-Case II swelling). X-ray computed tomography was conducted confirming anisotropic swelling. The petrographic transitions (maceral-group composition and reflectance) with solvent swelling and extraction were quantified. No changes in the maceral compositions were found, but changes in some coal particles were observed. Random reflectance analysis showed that, for both vitrinite and inertinite, there is a decrease in reflectance values with solvent treatment. Vitrinite reflectograms showed a shift from the dominant reflecting V-types to lower V-types. The inertinite reflectograms exhibited an increase in number of I-types (broadening of reflectrograms). Molecular simulation and visualization approaches to solvent swelling and extraction were performed on the proposed molecular models of vitrinite-rich and inertinite-rich coals. A theoretical extraction yield was determined using solubility parameters and showed agreement with experimental extraction yield trends. Statistical Associating Fluid Theory (SAFT) modeling was explored to test whether this method could predict swelling extent. The predicted swelling trends of SAFT were comparable to that of the experimental swelling results. SAFT was found to be a promising tool for solvent-coal interaction predictions. Partially solvent swollen structures were constructed by the addition of solvent molecules to the original coal molecules using a amorphous building approach. This method showed that coal-coal non-bonding interaction changed with the introduction of solvent. A disruption in the van der Waals interaction energies and a change in hydrogen bond distributions were observed in the swollen coal models and quantified. It was concluded that small changes in coal structure translates to significant changes in solvent interaction behavior. These changes were successfully visualized and simulated using
A new approach to group separation of coals
Energy Technology Data Exchange (ETDEWEB)
Zhi-Hong Qin; Zhi-Min Zong; Chun Jiang; Hao Sun; Li-Li Zhou; Xian-Yong Wei [China University of Mining and University, Jiangsu (China). School of Chemical Engineering
2005-07-01
Three coal samples were extracted with carbon disulfide/N-methyl-2-pyrrolidinone (CS{sub 2}/NMP) mixed solvent. The extraction solutions were separated to three layers: insoluble fraction (under layer), CS{sub 2} solution (middle layer) and water/NMP solution (upper layer) by water addition. Most of NMP was concentrated to the upper layer. 7 refs., 3 figs., 3 tabs.
Proceedings of the workshop on radioactivity associated with coal use
International Nuclear Information System (INIS)
1981-12-01
A workshop on radioactivity in coal use was held on September 15 through 17, 1981, under the auspices of the US Department of Energy, Office of Environmental Programs, and the Los Alamos National Laboratory. The purpose of the workshop was to identify research issues associated with radioactivity resulting from the use of coal for electric power generation. The concensus of the 10 scientists participating in the workshop was that a moderate to strong need exists for research in solubility of fly ash in different fluids and for determination of radioactivity in construction materials. Several additional research issues were identified but were given a lower priority. Summaries of each presentation are included. Titles are: some effects of coal combustion on the radiation environment; radionuclides in western coal at Mound; low-level radiation in coals utilized and ashes produced at New York State electric utilities; radioactivity from coal use - where are the problems; chemistry of radionuclides in coal preparation; uranium daughters in natural atmospheric aerosols and coal-fired power plant emissions; possible contributions of coal extraction and utilization to radioactivity contributions in drinking water; and impact on water quality from radionuclides in coal. One paper has been abstracted separately for inclusion in the Energy Data Base
Pyrolysis and Combustion Kinetics of Raw and Carbonized Cottonwood and Switchgrass Agroforests
Directory of Open Access Journals (Sweden)
Sammy Sadaka
2015-06-01
Full Text Available Raw biomass is not commonly suitable as feedstock for existing power plants, mainly because of the substantial required infrastructural changes. As a result, most raw feedstock requires pre-treatment to improve its physical and thermal characteristics. Biomass carbonization is one of the pre-treatments that produces charcoal-like feedstock. This paper explores the effects of the carbonization process on the physiochemical characteristics of biomass produced from two cottonwood clones, S7C20 and ST66, and switchgrass (var. Alamo. Additionally, it studies the thermal degradation kinetics of raw and carbonized agroforestry products in nitrogen and air environments. Feedstock samples were carbonized in a batch reactor at 400 °C in an oxygen-free environment for 2 hours. Carbonization decreased biomass bulk density, moisture content, and volatile solids while increasing fixed carbon, ash content, pH, and heating values. The heating value of S7C20, ST66, and switchgrass increased by 58.6%, 60.3%, and 69.7%, respectively. Carbonization increased the activation energy values under the condition of pyrolysis and decreased these values under the condition of combustion. The carbonization process produced a charcoal-like feedstock that may be processed with coal or even replace it.