WorldWideScience

Sample records for raw coal extracted

  1. Aromatic raw materials from coal

    Energy Technology Data Exchange (ETDEWEB)

    Collin, G

    1982-06-01

    Liquid byproducts of coal carbonization meet some 25% of the world demand for aromatic chemicals, currently at approx. 30 million t/a, in particular 15% of the demand for benzene and over 95% of the demand for condensed aromatics and heteroaromatics. Industrial processing of the aromatic byproducts of coal pressure gasification is carried out to only a minor extent. Other methods that may be employed in future to obtain carbochemical aromatic compounds are solvolysis and supercritical gas extraction, the catalytic liquid-phase hydrogenation and hydropyrolysis of coal, which also permit recovery of benzene and homologues, phenols, and condensed and partially hydrogenated aromatics, and the synthesis of aromatics using methanol as the key compound. As with the present means of obtaining aromatic chemicals from coal, the processes that may in future be applied on an industrial scale to obtain pure aromatics will only be economically feasible if linked with the manufacture of other mass products and combined with the present production of carbochemical aromatics. (In German)

  2. Data extraction from proteomics raw data

    DEFF Research Database (Denmark)

    Mancuso, Francesco; Bunkenborg, Jakob; Wierer, Michael

    2012-01-01

    In shot-gun proteomics raw tandem MS data are processed with extraction tools to produce condensed peak lists that can be uploaded to database search engines. Many extraction tools are available but to our knowledge, a systematic comparison of such tools has not yet been carried out. Using raw data...

  3. NMR investigation of coal extracts

    Energy Technology Data Exchange (ETDEWEB)

    Lang, I; Sebor, G [Ceskoslovenska Akademie Ved, Prague. Hornicky Ustav; Sebor, G Jr; Hajek, M; Mostecky, J [Vysoka Skola Chemicko-Technologicka, Prague (Czechoslovakia)

    1978-07-01

    Proton NMR spectroscopy was used for the evaluation of 10% coal extract solutions in deuterated pyridine. Four types of Czechoslovak coal were analyzed. Agreement was found between the aromaticity of coal extracts calculated from /sup 1/H NMR data using Brown's method and Ladner's and Williams' method and the characterization of an average molecule of the coal extract by the number of non-bridge carbon atoms of aromatic rings, by the overall number of aromatic ring carbon atoms and the number of aromatic rings, determined by the Williams and Ferris methods. The methods for calculating carbon distribution from /sup 1/H NMR data, however, contain some constants theoretically estimated or experimentally found using the method which still remain to be verified.

  4. Extraction of protoactinium from silicaceous raw material

    Energy Technology Data Exchange (ETDEWEB)

    Broda, E.

    1946-07-01

    This report was written by E. Broda and P.K. Wright at the Cavendish Laboratory (Cambridge) in March 1946 and is about the Extraction of protoactinium from a silicaceous raw material. In this report the isolation of Pa on Er carrier is described and it includes the experiment description and the discussion of the results. (nowak)

  5. Producing ashless coal extracts by microwave irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Ozgur Sonmez; Elife Sultan Giray [Mersin University, Mersin (Turkey). Department of Chemistry

    2011-06-15

    To produce ashless coal extracts, three Turkish coals were extracted with N-methyl-2-pyrrolidinone (NMP), NMP/ethylenediamine (EDA) (17/1, vol/vol) mixture and NMP/tetralin (9/1, vol/vol) mixture through thermal extraction and microwave extraction. Solvent extraction by microwave irradiation (MI) was found to be more effective than that by thermal extraction. Extraction yield of coals in NMP enhanced by addition of a little EDA, but tetralin addition showed variances according to extraction method used. While tetralin addition caused a decrease in the thermal extraction yield, it increased the yield of the extraction by MI. Following the extraction, the solid extracts were produced with ash content ranging from 0.11% to 1.1%. Ash content of solid extract obtained from microwave extraction are less than ash contents of solid extracts obtained from thermal extraction. 34 refs., 7 figs., 5 tabs.

  6. Boiler briquette coal versus raw coal: Part I--Stack gas emissions.

    Science.gov (United States)

    Ge, S; Bai, Z; Liu, W; Zhu, T; Wang, T; Qing, S; Zhang, J

    2001-04-01

    Stack gas emissions were characterized for a steam-generating boiler commonly used in China. The boiler was tested when fired with a newly formulated boiler briquette coal (BB-coal) and when fired with conventional raw coal (R-coal). The stack gas emissions were analyzed to determine emission rates and emission factors and to develop chemical source profiles. A dilution source sampling system was used to collect PM on both Teflon membrane filters and quartz fiber filters. The Teflon filters were analyzed gravimetrically for PM10 and PM2.5 mass concentrations and by X-ray fluorescence (XRF) for trace elements. The quartz fiber filters were analyzed for organic carbon (OC) and elemental carbon (EC) using a thermal/optical reflectance technique. Sulfur dioxide was measured using the standard wet chemistry method. Carbon monoxide was measured using an Orsat combustion analyzer. The emission rates of the R-coal combustion (in kg/hr), determined using the measured stack gas concentrations and the stack gas emission rates, were 0.74 for PM10, 0.38 for PM2.5, 20.7 for SO2, and 6.8 for CO, while those of the BB-coal combustion were 0.95 for PM10, 0.30 for PM2.5, 7.5 for SO2, and 5.3 for CO. The fuel-mass-based emission factors (in g/kg) of the R-coal, determined using the emission rates and the fuel burn rates, were 1.68 for PM10, 0.87 for PM2.5, 46.7 for SO2, and 15 for CO, while those of the BB-coal were 2.51 for PM10, 0.79 for PM2.5, 19.9 for SO2, and 14 for CO. The task-based emission factors (in g/ton steam generated) of the R-coal, determined using the fuel-mass-based emission factors and the coal/steam conversion factors, were 0.23 for PM10, 0.12 for PM2.5, 6.4 for SO2, and 2.0 for CO, while those of the BB-coal were 0.30 for PM10, 0.094 for PM2.5, 2.4 for SO2, and 1.7 for CO. PM10 and PM2.5 elemental compositions are also presented for both types of coal tested in the study.

  7. Boiler Briquette Coal versus Raw Coal: Part I-Stack Gas Emissions.

    Science.gov (United States)

    Ge, Su; Bai, Zhipeng; Liu, Weili; Zhu, Tan; Wang, Tongjian; Qing, Sheng; Zhang, Junfeng

    2001-04-01

    Stack gas emissions were characterized for a steam-generating boiler commonly used in China. The boiler was tested when fired with a newly formulated boiler briquette coal (BB-coal) and when fired with conventional raw coal (R-coal). The stack gas emissions were analyzed to determine emission rates and emission factors and to develop chemical source profiles. A dilution source sampling system was used to collect PM on both Teflon membrane filters and quartz fiber filters. The Teflon filters were analyzed gravimetrically for PM 10 and PM 2.5 mass concentrations and by X-ray fluorescence (XRF) for trace elements. The quartz fiber filters were analyzed for organic carbon (OC) and elemental carbon (EC) using a thermal/optical reflectance technique. Sulfur dioxide was measured using the standard wet chemistry method. Carbon monoxide was measured using an Orsat combustion analyzer. The emission rates of the R-coal combustion (in kg/hr), determined using the measured stack gas concentrations and the stack gas emission rates, were 0.74 for PM 10 , 0.38 for PM 25 , 20.7 for SO 2 , and 6.8 for CO, while those of the BB-coal combustion were 0.95 for PM 10 , 0.30 for PM 2 5 , 7.5 for SO 2 , and 5.3 for CO. The fuel-mass-based emission factors (in g/kg) of the R-coal, determined using the emission rates and the fuel burn rates, were 1.68 for PM 10 , 0.87 for PM 25 , 46.7 for SO 2 , and 15 for CO, while those of the BB-coal were 2.51 for PM 10 , 0.79 for PM 2.5 , 19.9 for SO 2 , and 14 for CO. The task-based emission factors (in g/ton steam generated) of the R-coal, determined using the fuel-mass-based emission factors and the coal/ steam conversion factors, were 0.23 for PM 10 , 0.12 for PM 2.5 , 6.4 for SO 2 , and 2.0 for CO, while those of the BB-coal were 0.30 for PM 10 , 0.094 for PM 2.5 , 2.4 for SO 2 , and 1.7 for CO. PM 10 and PM 2.5 elemental compositions are also presented for both types of coal tested in the study.

  8. Effect of acid treatment on thermal extraction yield in ashless coal production

    Energy Technology Data Exchange (ETDEWEB)

    Chunqi Li; Toshimasa Takanohashi; Takahiro Yoshida; Ikuo Saito; Hideki Aoki; Kiyoshi Mashimo [National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan). Institute for Energy Utilization

    2004-04-01

    Coals of different ranks were acid-treated in aqueous methoxyethoxy acetic acid (MEAA), acetic acid (AA), and HCl. The acid-treated coals were extracted with polar N-methyl-2-pyrrolidinone (NMP) and nonpolar 1-methylnaphthalene (1MN) solvents at temperatures from 200 to 360{sup o}C for 10 60 min. The thermal extraction yields with NMP for some acid-treated low-rank coals increased greatly; for example, the extraction yield for Wyodak coal (%C; 75.0%) increased from 58.4% for the raw coal to 82.9% for coal treated in 1.0 M MEAA. Conversely, the extraction yields changed minimally for all the acid-treated coals extracted in 1-MN. The type and concentration of acid affected the extraction yield when NMP was used as the extraction solvent. With increasing MEAA concentration from 0.01 to 0.1 M, the extraction yield for Wyodak coal increased from 66.3 to 81.4%, and subsequently did not change clearly with concentration. Similar changes in the extraction yield with acid concentration were also observed with AA and HCl. The de-ashing ratio for coals acid-treated in MEAA, AA, and HCl also increased greatly with concentration from 0.01 to 0.1 M, which corresponded to the change in the thermal extraction yield in NMP. For the acid-treated coals, high extraction yields were obtained at lower extraction temperatures and shorter extraction times than for the raw coal. The mechanisms for the acid treatment and thermal extraction are discussed. 27 refs., 6 figs., 3 tabs.

  9. Effect of pre-swelling of coal on its solvent extraction and liquefaction properties

    Energy Technology Data Exchange (ETDEWEB)

    Hengfu Shui; Zhicai Wang; Meixia Cao [Anhui University of Technology, Ma' anshan (China). School of Chemistry and Chemical Engineering

    2008-10-15

    Effects of pre-swelling of coal on solvent extraction and liquefaction properties were studied with Shenhua coal. It was found that pre-swelling treatments of the coal in three solvents, i.e., toluene (TOL), N-methyl-2-pyrrolidinone (NMP) and tetralin (THN) increased its extraction yield and liquefaction conversion, and differed the liquefied product distributions. The pre-swollen coals after removing the swelling solvents showed increased conversion in liquefaction compared with that of the swollen coals in the presence of swelling solvents. It was also found that the yields of (oil + gas) in liquefaction of the pre-swollen coals with NMP and TOL dramatically decreased in the presence of swelling solvent. TG and FTIR analyses of the raw coal, the swollen coals and the liquefied products were carried out in order to investigate the mechanism governing the effects of pre-swelling treatment on coal extraction and liquefaction. The results showed that the swelling pre-treatment could disrupt some non-covalent interactions of the coal molecules, relax its network structure and loosened the coal structure. It would thus benefit diffusion of a hydrogen donor solvent into the coal structure during liquefaction, and also enhance the hydrogen donating ability of the hydrogen-rich species derived from the coal. 21 refs., 4 figs., 3 tabs.

  10. Waste pyritic coal as a raw material for energetic industry

    Energy Technology Data Exchange (ETDEWEB)

    Gasiorek, J. [Institute of Inorganic Chemistry, Poznan (Poland). Dept. of Research and Technology

    1997-11-01

    Results are presented of large laboratory studies on coal desulphurisation with foam flotation method improved by application of bioadsorption of Thiobacillus ferrooxidans bacteria to the modification of superficial properties of pyrite particulates from hydrophobic to hydrophillic ones. Results of coal desulfurization with and without bioadsorption have been compared. Bioadsorption improved pyritic sulfur removal by 30% (for coal from `Sierza mine`, coal size 0.3 to 0.102 mm, S pyritic content 1.69%) after 6-week adaptation of bacteria and 30 min of bioadsorption. Bacteria concentration in 5% water suspension of coal reached 22 {mu}g of biomass cm{sup -3}. 12 refs., 4 figs., 1 tab.

  11. Process for the gas extraction of coal

    Energy Technology Data Exchange (ETDEWEB)

    Urquhart, D B

    1976-05-20

    The object of the invention is a process for the hydroextraction of coal is treated with water and carbon monoxide at a temperature in the region of 300 - 380/sup 0/C. After treatment is completed, the gases are separated from the treated gas; the treated coal is then extracted with an extraction medium during the gas phase at a temperature of at least 400/sup 0/C, the remainder is separated from the gas phase and the coal extract is obtained from the extraction medium. Hydrogenation is preferably carried out at a temperature in the region of 320 - 370/sup 0/C and at a pressure of 200 - 400 at. The time required for treatment with carbon monoxide and water is 1/4 - 2 hours, and in special cases 3/4 - 1 1/2 hours. The coal material itself is nutty slack, of which more than 95% of the coal particles pass through a 1.5 mm mesh sieve. After the hydrogenation the extraction is carried out at a temperature in the region of 400 - 450/sup 0/C. The patent claims relate to the types of extraction media used.

  12. RESEARCH ON CARBON PRODUCTS FROM COAL USING AN EXTRACTIVE PROCESS

    Energy Technology Data Exchange (ETDEWEB)

    Peter G. Stansberry; Alfred H. Stiller; John W. Zondlo; Chong Chen; Brian Bland; David Fenton

    2002-03-31

    This report presents the results of a one-year effort directed at the exploration of the use of coal as a feedstock for a variety of industrially-relevant carbon products. The work was basically divided into three focus areas. The first area dealt with the acquisition of laboratory equipment to aid in the analysis and characterization of both the raw coal and the coal-derived feedstocks. Improvements were also made on the coal-extraction pilot plant which will now allow larger quantities of feedstock to be produced. Mass and energy balances were also performed on the pilot plant in an attempt to evaluate the scale-up potential of the process. The second focus area dealt with exploring hydrogenation conditions specifically aimed at testing several less-expensive candidate hydrogen-donor solvents. Through a process of filtration and vacuum distillation, viable pitch products were produced and evaluated. Moreover, a recycle solvent was also isolated so that the overall solvent balance in the system could be maintained. The effect of variables such as gas pressure and gas atmosphere were evaluated. The pitch product was analyzed and showed low ash content, reasonable yield, good coking value and a coke with anisotropic optical texture. A unique plot of coke yield vs. pitch softening point was discovered to be independent of reaction conditions or hydrogen-donor solvent. The third area of research centered on the investigation of alternate extraction solvents and processing conditions for the solvent extraction step. A wide variety of solvents, co-solvents and enhancement additives were tested with varying degrees of success. For the extraction of raw coal, the efficacy of the alternate solvents when compared to the benchmark solvent, N-methyl pyrrolidone, was not good. However when the same coal was partially hydrogenated prior to solvent extraction, all solvents showed excellent results even for extractions performed at room temperature. Standard analyses of the

  13. Study on surface morphology and physicochemical properties of raw and activated South African coal and coal fly ash

    Science.gov (United States)

    Mishra, S. B.; Langwenya, S. P.; Mamba, B. B.; Balakrishnan, M.

    South African coal and coal fly ash were selected as the raw materials to be used for study of their morphology and physicochemical properties and their respective activated carbons for adsorption applications. Coal and fly ash were individually steam activated at a temperature range of 550-1000 °C for 1 h in a muffle furnace using cylindrical stainless steel containers. Scanning electron micrographs revealed a change in surface morphology with more mineral matter available on the surface of the coal particles due to increased devolatilization. However, in the case of fly ash, the macerals coalesced to form agglomerates and the presence of unburnt carbon constituted pores of diameter between 50 and 100 nm. The BET surface area of coal improved significantly from 5.31 to 52.12 m 2/g whereas in case of fly ash the surface area of the raw sample which was originally 0.59 m 2/g and upon activation increased only up to 2.04 m 2/g. The chemical composition of the fly ash confirmed that silica was the major component which was approximately 60% by weight fraction. The impact of this study was to highlight the importance of using raw materials such as coal and a waste product, in the form of coal ash, in order to produce affordable activated carbon that can be used in drinking water treatment. This would therefore ensure that the quality of water supplied to communities for drinking is not contaminated especially by toxic organic compounds.

  14. Production of low ash coal by thermal extraction with N-methyl-2-pyrrolidinone

    Energy Technology Data Exchange (ETDEWEB)

    Do Kim, S.; Woo, K.J.; Jeong, S.K.; Rhim, Y.J.; Lee, S.H. [Korean Institute for Energy Research, Taejon (Republic of Korea). Clean Coal Technological Research Center

    2008-07-15

    Present study was conducted for the purpose of producing low ash coal from LRC (low rank coals) such as lignite and sub-bituminous coal through thermal extraction using polar solvent. Extraction from bituminous coal was also investigated for comparison. NMP as a polar solvent was used. The ratio of coal to solvent was adjusted as 1:10. Experimental conditions were established which include the extraction temperature of 200-430{sup o}C, initial applied pressure of 1-20 bar and extraction time of 0.5-2 hr were used. Extraction yield and ash content of extracted and residual coal were measured. The extraction yield increased with the increase of extraction temperature, and the ash content of extracted coal decreased below 0.4% at 400{sup o}C from the raw coal samples that have the ash contents of 4-6%. According to the analysis of experiments results, fixed carbon and calorific value increased, and H/C and O/C decreased.

  15. Investigation of the remaining major and trace elements in clean coal generated by organic solvent extraction

    Energy Technology Data Exchange (ETDEWEB)

    Jie Wang; Chunqi Li; Kinya Sakanishi; Tetsuya Nakazato; Hiroaki Tao; Toshimasa Takanohashi; Takayuki Takarada; Ikuo Saito [National Institute Advanced Industrial Science and Technology (AIST), Ibaraki (Japan). Energy Technology Research Institute

    2005-09-01

    A sub-bituminous Wyodak coal (WD coal) and a bituminous Illinois No. 6 coal (IL coal) were thermally extracted with 1-methylnaphthalene (1-MN) and N-methyl-2-pyrrolidone (NMP) to produce clean extract. A mild pretreatment with acetic acid was also carried out. Major and trace inorganic elements in the raw coals and resultant extracts were determined by means of inductively coupled plasma optical emission spectrometry (ICP-OES), flow injection inductively coupled plasma mass spectrometry (FI-ICP-MS), and cold vapor atomic absorption spectrometry (CV-AAS). It was found that the extraction with 1-MN resulted in 73-100% reductions in the concentration of Li, Be, V, Ga, As, Se, Sr, Cd, Ba, Hg, and Pb. The extraction with NMP yielded more extract than that with 1-MN, but it retained more organically associated major and trace metals in the extracts. In the extraction of WD coal with NMP, the acid pretreatment not only significantly enhanced the extraction yield but also significantly reduced the concentrations of alkaline earth elements such as Be, Ca, Mg, Sr, and Ba in the extract. In addition, the modes of occurrence of trace elements in the coals were discussed according to their extraction behaviors. 30 refs., 2 figs., 5 tabs.

  16. Washability characteristics of residual coals obtained from solvent extraction: studies towards developing cleaner coal technology

    Energy Technology Data Exchange (ETDEWEB)

    Giri, C.C.; Sharma, D.K. [Indian Institute of Technology, New Delhi (India). Centre for Energy Studies

    2004-07-01

    The washability characteristics of original Indian coals and solvent-extracted residual coals were studied by the float and sink technique. The following conclusions were drawn on the basis of the present study. Anthracene oil-extracted residual coals have lower percentage of reactions in the specific gravity range of 1.4 to 1.6 than the original coals, which indicates that the mineral matter is disassociated from the organic mass, and the anthracene oil-extracted residual coal is more suitable for washing than the original coal. The floatability behaviour of coal increases during NMP (N-methyl-2-pyrrolidone) extraction. This indicates that coal changes its washability character during NMP extractions. As during NMP extraction the surface area of coal increases by creating fissures in the matrix, the chemical leaching technique would be more suitable to remove the mineral matter in the residual coals. 12 refs., 3 figs., 2 tabs.

  17. Caffeine Extraction from Raw and Roasted Coffee Beans.

    Science.gov (United States)

    Chiang, Donyau; Lin, Chih-Yang; Hu, Chen-Ti; Lee, Sanboh

    2018-04-01

    Coffee is a stimulant, psychoactive, popular daily beverage, and its caffeine affects human physiological health and behavior. These important issues prompted us to study caffeine extraction from both the raw and roasted coffee beans of 3 types at different temperatures. A hemispheric model is developed to simulate the extraction process of the caffeine from the coffee beans of hemisphere is proposed. The experimental data are in good agreement with the predicted model. The effective diffusivities of caffeine in both the raw and roasted beans increase with temperature in all 3 types. An incubation period, decreasing with increasing temperature, is observed in all samples studied. Caffeine extraction in roasted beans is more rapid than that for the raw beans and the time difference is significant at low temperatures. In both the raw and roasted samples, caffeine diffusion in the raw beans and the incubation behavior are thermally activated processes. Single activation energies are obtained for diffusion within the extraction temperature range for all beans tested with the exception of one type of the coffee beans, Mandheling, which exhibits 2 activation energies in raw samples. The surface energies of the epidermis of the raw beans and roasted beans obtained from the contact angle measurements are used to interpret the difference of incubation periods. This study has a potential application to the decaffeinated coffee industry.Caffeine affects human physiological health and behavior so that caffeine extraction from coffee beans of different types at different temperatures is important for product refining and customers. © 2018 Institute of Food Technologists®.

  18. Prospects for recovering gallium from extracted coal

    Energy Technology Data Exchange (ETDEWEB)

    Ratynskiy, V M; Reznik, A M; Zekel, L A; Zharov, Yu N

    1979-01-01

    The authors conducted research in order to establish the physical-chemical mechanisms governing the behavior of rare and dispersed elements within the thermal treatment processes used to treat coal and enrichment waste. New means are proposed for obtaining concentrations of gallium. These methods are under consideration primarily for the isolation of gallium as a by-product during the production of aggloporite from coal waste. The authors examine in detail the results of research dealing with the transfer of gallium compounds in a solution, the extraction of gallium from solutions, the separation of impurities from gallium, and the isolation of gallium from extract. Utilizing research results, the authors determine the expenditure coefficient and costs for additives used to extract gallium from waste by-products. The realization of this gallium extraction process from those products having the best prospects for gallium content resulted in economic savings.

  19. To extract gas of the coal

    International Nuclear Information System (INIS)

    Carta Petrolera

    2001-01-01

    The paper analyzes the characteristics and advantages of extracting gas of the coal, idea that from previous years Colombia wanted to develop, and owing to the association contract Rio Rancheria; Colombia decided to carry out it using modern technologies used today in day in the international environment

  20. Extraction of Coal and Gangue Geometric Features with Multifractal Detrending Fluctuation Analysis

    Directory of Open Access Journals (Sweden)

    Kai Liu

    2018-03-01

    Full Text Available The separation of coal and gangue is an important process of the coal preparation technology. The conventional way of manual selection and separation of gangue from the raw coal can be replaced by computer vision technology. In the literature, research on image recognition and classification of coal and gangue is mainly based on the grayscale and texture features of the coal and gangue. However, there are few studies on characteristics of coal and gangue from the perspective of their outline differences. Therefore, the multifractal detrended fluctuation analysis (MFDFA method is introduced in this paper to extract the geometric features of coal and gangue. Firstly, the outline curves of coal and gangue in polar coordinates are detected and achieved along the centroid, thereby the multifractal characteristics of the series are analyzed and compared. Subsequently, the modified local singular spectrum widths Δ h of the outline curve series are extracted as the characteristic variables of the coal and gangue for pattern recognition. Finally, the extracted geometric features by MFDFA combined with the grayscale and texture features of the images are compared with other methods, indicating that the recognition rate of coal gangue images can be increased by introducing the geometric features.

  1. Washability equations of raw coal from some lithostratigraphic units of the Upper Silesian coalfield

    Energy Technology Data Exchange (ETDEWEB)

    1977-12-01

    On the basis of statistical analysis, partial and general washability equations have been calculated for coarse and slack raw coal from the Upper Silesian Coalfield. The equations make it possible to forecast the quantity and quality of saleable products, and to select preparation plant equipment.

  2. Extraction of hydrocarbon products from shales and coals

    Energy Technology Data Exchange (ETDEWEB)

    Reed, V Z

    1918-05-17

    A process is disclosed of extracting hydrocarbon oil matter from petroleum-bearing shales and coals which comprises subjecting a mass of such shale or coal, before distillation to the solvent action of material containing an acid, permitting the solvent material to pass through the mass of shale or coal, and recovering the combined solvent and extracted matter.

  3. Effect of hydrothermal treatment on the extraction of coal in the CS{sub 2}/NMP mixed solvent

    Energy Technology Data Exchange (ETDEWEB)

    Hengfu Shui; Zhicai Wang; Gaoqiang Wang [Anhui University of Technology, Maanshan (China). School of Chemistry and Chemical Engineering

    2006-09-15

    The extraction of four Chinese different rank bituminous coals with the carbon disulfide/N-2-pyrrolidinone (CS2/NMP) mixed solvent (1:1 by volume) was carried out in room temperature. It was found that one of middle bituminous raw coal of the four coals gave more than 74% (daf) extraction yield, suggesting an associative structural model for the coal. The four coals were hydrothermal treated under different conditions, and it was found that the extraction yields of the treated coals obviously increased. This will have great significance for coal liquefaction. FTIR measurements show the removal of minerals after the hydrothermal treatment of coals suggesting the dissociation of the coal aggregation structure due to ionic interactions and/or hydrogen bonds broken because of the removal of oxygen and hydroxyl oxygen proceeded through ionic pathways, resulting in the extraction yields of the treated coals increase. However, breaking of {pi}-cation interactions by hydrothermal treatment may be one of possible mechanisms for the enhancement of extraction yield of higher rank of treated coal. The mechanism of hydrothermal treatment of coal was discussed in the paper. 28 refs., 4 figs., 4 tabs.

  4. Effect of coal extracted with NMP on its aggregation

    Energy Technology Data Exchange (ETDEWEB)

    Hengfu Shui [Anhui University of Technology, Maanshan (China). Department of Chemical Engineering

    2005-05-01

    Tow-step extraction of Upper Freeport (UF) coal, i.e. exhaustive extraction with N-methyl-2-pyrrolidinone (NMP) solvent and subsequent extraction with the CS{sub 2}/NMP mixed solvent (1:1 by volume) with or without additive was compared with the direct extraction of UF coal with the CS{sub 2}/NMP mixed solvent (1:1 by volume) with or without additive. It was found that there is almost no difference of extraction yields between the two-step extraction and direct extraction with or without additive. The result show that NMP can only give external extraction to extract the outside fractions of coal particles, and this will not cause the new aggregation formed in the coal molecules. The interactions between coal molecule and additive are responsible for the extraction yield enhancement by additive. 10 refs., 3 figs., 1 tab.

  5. Increase in extraction yields of coals by water treatment: Beulah-Zap lignite

    Energy Technology Data Exchange (ETDEWEB)

    Masashi Iino; Toshimasa Takanohashi; Takahiro Shishido; Ikuo Saito; Haruo Kumagai [National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan)

    2007-01-15

    In a previous paper, we have reported that water pretreatments of Argonne premium coals, Pocahontas No. 3 (PO), Upper Freeport (UF), and Illinois No. 6 (IL) at 600 K increased greatly the room-temperature extraction yields with a 1:1 carbon disulfide/N-methyl-2-pyrrolidinone (CS{sub 2}/NMP) mixed solvent. In this paper, the water treatment of Beulah-Zap (BZ) lignite has been carried out and the results obtained were compared with those for the three bituminous coals above. The extraction yields of BZ with CS{sub 2}/NMP increased from 5.5% for the raw coal to 21.7% by the water treatment at 600 K. Similar to the other three coals, the water treatments at 500 K gave little increase in the yields. The larger decrease in oxygen content and hydrogen-bonded OH and the increase in the methanol swelling ratio by the water treatment suggest that the yield enhancements for BZ are attributed to the removal of oxygen functional groups and the breaking of hydrogen bonds to a greater extent than that for IL. From the characterizations of the treated coals and the extraction temperature dependency of their extraction yields, it is suggested that, for high-coal-rank coals, PO and UF, the breaking of noncovalent bonds such as {pi}-{pi} interactions between aromatic layers and hydrogen bonds is responsible for the extraction yield enhancements. 14 refs., 3 figs., 2 tabs.

  6. 30 CFR 750.21 - Coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Coal extraction incidental to the extraction of... ENFORCEMENT, DEPARTMENT OF THE INTERIOR INDIAN LANDS PROGRAM REQUIREMENTS FOR SURFACE COAL MINING AND RECLAMATION OPERATIONS ON INDIAN LANDS § 750.21 Coal extraction incidental to the extraction of other minerals...

  7. Environmental impact of coal utilization (from raw material to waste resources): Proceedings

    International Nuclear Information System (INIS)

    Sahu, K.C.

    1991-10-01

    The proceedings contains 27 papers presented at the conference on environmental impact of coal utilization from raw material to waste resources which was held at the Indian Institute of Technology, Bombay, during 14-15 January 1991. The conference was held as a follow-up of the research project to study the impact of coal utilization. The project was undertaken jointly by the Indian Institute of Technology, Bombay and the University of Western Ontario, Canada. The project was funded by the International Development Research Centre, Ottawa (Canada). The principle themes of the conference were : occurrence of trace elements in coal, fate of trace elements during combustion of coal, characterisation of fly ash and its properties and utilization, and environmental impact of ash disposal. (M.G.B.)

  8. Combustion properties, water absorption and grindability of raw/torrefied biomass pellets and Silantek coal

    Science.gov (United States)

    Matali, Sharmeela; Rahman, Norazah Abdul; Idris, Siti Shawaliah; Yaacob, Nurhafizah

    2017-12-01

    Torrefaction, also known as mild pyrolysis, is proven to convert raw biomass into a value-added energy commodity particularly for application in combustion and co-firing systems with improved storage and handling properties. This paper aims to compare the characteristics of Malaysian bituminous coal i.e. Silantek coal with raw and torrefied biomass pellet originated from oil palm frond and fast growing tree species, Leucaena Leucocephala. Biomass samples were initially torrefied at 300 °C for 60 minutes. Resulting torrefied biomass pellets were analysed using a number of standard fuel characterisation analyses i.e. elemental analysis, proximate analysis and calorific content (high heating values) experiments. Investigations on combustion characteristics via dynamic thermogravimetric analysis (TGA), grindability and moisture uptake tests were also performed on the torrefied biomass pellets. Better quality bio-chars were produced as compared to its raw forms and with optimal process conditions, torrefaction may potentially produces a solid fuel with combustion reactivity and porosity equivalent to raw biomass while having compatible energy density and grindability to coal.

  9. 4-MCHM sorption to and desorption from granular activated carbon and raw coal.

    Science.gov (United States)

    Jeter, T Scott; Sarver, Emily A; McNair, Harold M; Rezaee, Mohammad

    2016-08-01

    4-Methylcyclohexanemethanol (4-MCHM) is a saturated higher alicyclic primary alcohol that is used in the froth flotation process for cleaning coal. In early 2014, a large spill of crude chemical (containing primarily 4-MCHM) to the Elk River near Charleston, WV contaminated the local water supply. Carbon filters at the affected water treatment facility quickly became saturated, and the contaminated water was distributed to nearby homes and businesses. Sorption of 4-MCHM to granular activated carbon (GAC) was studied in the laboratory using head space (HS) analysis via gas chromatography with a flame ionization detector (GC-FID). Sorption to raw coal was also investigated, since this material may be of interest as a sorbent in the case of an on-site spill. As expected, sorption to both materials increased with decreased particle size and with increased exposure time; although exposure time proved to be much more important in the case of GAC than for coal. Under similar conditions, GAC sorbed more 4-MCHM than raw coal (e.g., 84.9 vs. 63.1 mg/g, respectively, for 20 × 30 mesh particles exposed to 860 mg/L 4-MCHM solution for 24 h). Desorption from both materials was additionally evaluated. Interestingly, desorption of 4-MCHM on a mass per mass basis was also higher for GAC than for raw coal. Overall, results indicated that GAC readily sorbs 4-MCHM but can also readily release a portion of the chemical, whereas coal sorbs somewhat less 4-MCHM but holds it tightly. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Alkali-assisted coal extraction with polar aprotic solvents

    Energy Technology Data Exchange (ETDEWEB)

    Makgato, M.H.; Moitsheki, L.J.; Shoko, L.; Kgobane, B.L.; Morgan, D.L.; Focke, W.W. [SARChI Chair in Carbon Technology and Materials, Institute of Applied Materials, University of Pretoria, Pretoria 0002 (South Africa)

    2009-04-15

    Coal extraction experiments were conducted using a coal, containing ca. 10% ash, from the Tshikondeni mine in South Africa. This coal dissolves only to a limited extent in pure polar aprotic solvents such as dimethylformamide (DMF) and N-methyl-2-pyrrolidinone (NMP). However, the addition of a strong base, e.g. sodium hydroxide (NaOH) or sodium tert-butoxide increased the degree of coal dissolution in these organic solvents. Depending on the extraction conditions, carbon extraction efficiencies of up to 90% were obtained. Carbon precursor material was recovered from the solution as a gel by precipitation with water. Ash content was reduced from 10% in the coal to less than 1.6% in the coal extracts. Sodium sulfide (Na{sub 2}S) addition further reduced ash content and aided the recovery of carbon precursors that led to graphitizable cokes but the degree of extraction was significantly reduced. (author)

  11. PRODUCTION OF FOAMS, FIBERS AND PITCHES USING A COAL EXTRACTION PROCESS

    Energy Technology Data Exchange (ETDEWEB)

    Chong Chen; Elliot B. Kennel; Liviu Magean; Pete G. Stansberry; Alfred H. Stiller; John W. Zondlo

    2004-06-20

    This Department of Energy National Energy Technology Laboratory sponsored project developed processes for converting coal feedstocks to carbon products, including coal-derived pitch, coke foams and fibers based on solvent extraction processes. A key technology is the use of hydrogenation accomplished at elevated temperatures and pressures to obtain a synthetic coal pitch. Hydrogenation, or partial direct liquefaction of coal, is used to modify the properties of raw coal such that a molten synthetic pitch can be obtained. The amount of hydrogen required to produce a synthetic pitch is about an order of magnitude less than the amount required to produce synthetic crude oil. Hence the conditions for synthetic pitch production consume very little hydrogen and can be accomplished at substantially lower pressure. In the molten state, hot filtration or centrifugation can be used to separate dissolved coal chemicals from mineral matter and insolubles (inertinite), resulting in the production of a purified hydrocarbon pitch. Alternatively, if hydrogenation is not used, aromatic hydrocarbon liquids appropriate for use as precursors to carbon products can obtained by dissolving coal in a solvent. As in the case for partial direct liquefaction pitches, undissolved coal is removed via hot filtration or centrifugation. Excess solvent is boiled off and recovered. The resultant solid material, referred to as Solvent Extracted Carbon Ore or SECO, has been used successfully to produce artificial graphite and carbon foam.

  12. 30 CFR 947.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 947.702 Section 947.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of...

  13. 30 CFR 933.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 933.702 Section 933.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of...

  14. 30 CFR 939.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 939.702 Section 939.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of...

  15. 30 CFR 903.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 903.702 Section 903.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...

  16. 30 CFR 912.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 912.702 Section 912.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...

  17. 30 CFR 937.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 937.702 Section 937.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...

  18. 30 CFR 921.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 921.702 Section 921.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of the chapter, Exemption for Coal Extraction Incidental to the Extraction of...

  19. 30 CFR 905.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 905.702 Section 905.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of...

  20. 30 CFR 942.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 942.702 Section 942.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...

  1. 30 CFR 910.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 910.702 Section 910.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...

  2. 30 CFR 922.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 922.702 Section 922.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of Other...

  3. 30 CFR 941.702 - Exemption for coal extraction incidental to the extraction of other minerals.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Exemption for coal extraction incidental to the extraction of other minerals. 941.702 Section 941.702 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION... other minerals. Part 702 of this chapter, Exemption for Coal Extraction Incidental to the Extraction of...

  4. Changes in thermal plasticity of low grade coals during selective extraction of metals

    Directory of Open Access Journals (Sweden)

    В. Ю. Бажин

    2016-08-01

    Full Text Available As the world oil market tends to be highly volatile, the coal becomes a primary source of organic raw materials for chemical and metallurgical industries. Fossil coals can accumulate high amounts of elements and mixtures quite often reaching commercially valuable concentrations. Reserves of scandium and other rare elements in coal deposits in Siberia alone are sufficient to satisfy the expected global demand for several decades. This study is intended to solve complex tasks associated with extraction of metal oxides using the developed enrichment method to ensure the required thermal plasticity determining the quality and properties of metallurgical coke.Laboratory experiments have been conducted for the enrichment of high-ash coals containing the highest concentrations of metals. Thermal plasticity values have been determined with the help of Gieseler plastometer . Using modern technologies and equipment individual deposits can be turned into profitable production of enriched coking coals with concurrent extraction of rare metals. It has been proven that the highest commercial potential lies with the extraction of scandium and some other rare metals in the form of oxides from the coal.

  5. Supercritical CO2 extraction of raw propolis and its dry ethanolic extract

    Directory of Open Access Journals (Sweden)

    L. C. Paviani

    2012-06-01

    Full Text Available Three types of propolis extract were prepared and analyzed with respect to their global extraction yields and with respect to the concentration of the following markers: 3,5-diprenyl-4-hydroxycinnamic acid; 3-prenyl-4-hydroxycinnamic acid; 4-hydroxycinnamic acid and 4-methoxy-3,5,7-trihydroxyflavone. The extract EEP (ethanolic extract of propolis was obtained by the conventional method from raw propolis using ethanol as solvent. The extracts (SFE were obtained by supercritical solvent extraction from the raw propolis using supercritical carbon dioxide (sc-CO2, with and without the addition of ethanol as a co-solvent. The fractionated supercritical extracts (FSCE were obtained by fractionation (extract and raffinate of the dry EEP with sc-CO2. EEP yields of 39.5% were obtained and maximum global extraction yields were 7.3% for SFE with no co-solvent, 51% for SFE with 15% ethanol and 18% for the FSCE extract fraction. The concentrations of the markers in the different extracts differed as a function of the operational parameters, indicating that the addition of co-solvent and the selectivity of sc-CO2 could be manipulated so as to obtain extracts with the yields and concentrations of interest.

  6. Analysis of waste coal from the enterprises of Kemerovo region as raw materials for production of ceramic materials

    Science.gov (United States)

    Stolboushkin, A. Yu; Akst, D. V.; Fomina, O. A.; Ivanov, A. I.; Syromyasov, V. A.

    2017-09-01

    The analysis of waste coal from mining enterprises of Kemerovo region as raw materials for production of building ceramics is given. The results of studies of material, chemical and mineralogical compositions of waste coal from Abashevskaya processing plant (Novokuznetsk) are presented. It was established that the chemical composition of waste coal refers to aluminosilicate raw materials with a high content of alumina and coloring oxides, the residual carbon content in the wastes is 12-25 %. According to the granulometric composition the waste coal is basically a sandy-dusty fraction with a small amount of clay particles (1-3 %). Additional grinding of coal waste and the introduction of a clay additive in an amount of up to 30 % are recommended. The results of the study of the mineral composition of waste coal are presented. Clay minerals are represented in the descending order by hydromuscovite, montmorillonite and kaolinite, minerals-impurities consist of quartz, feldspar fine-dispersed carbonates. The results of the investigation of ceramic-technological properties of waste coal, which belong to the group of moderately plastic low-melting raw materials, are given. As a result of a comprehensive study it was been established that with chemical, granulometric and mineralogical compositions waste coal with the reduced residual carbon can be used in the production of ceramic bricks.

  7. Raw mix designing for coal as a fuel in cement kiln as a major fuel and its impact on clinker parameters

    International Nuclear Information System (INIS)

    Noor-ul-Amin; Ali, K.

    2011-01-01

    In this paper the use of coal, found at Jabba Taar and Jabba Khushk Khyber Pakhtoon Khwa, in cement manufacturing as a major fuel and its impacts on the raw mix and clinker parameters has been discussed. The maximum amount of coal for pulverizing with raw mix was found to be 10% of the raw mix as calculated from the calorific value and the heat of clinkerization of coal. The coal residue left after burning was utilized in the cement raw material, for which a new raw mix was designed. The new raw mix was converted in to clinker. The resulting clinker was studied for all parameters as per British specification. It was found that the clinker obtained from the newly designed raw mix with coal ash, was in accordance to the British standard specifications. (author)

  8. The increase in extraction yields of coals by water treatment

    Energy Technology Data Exchange (ETDEWEB)

    M. Iino; T. Takanohashi; C. Li; N. Kashimura; K. Masaki; T. Shishido; I. Saito; H. Kumagai [Institute for Energy Utilization, National Institute of Advanced Industrial Science and Technology (AIST), Ibaraki (Japan)

    2005-07-01

    We have reported that the water treatments of bituminous coals at 600 K for 1 h increased their extraction yields greatly (Energy Fuels, 2005, 18, 1414). In this paper the effect of coal rank on the extraction yields enhancement by the water treatment has been investigated using four Argonne Premium coals, i.e., Pocahontas No. 3 (PO), Upper Freeport (UF), Illinois No.6 (IL), and Beulah Zap (BZ) coals with C % (daf) in the range 67 - 90%. All the coals used show that the water treatments at 600 K increased the extraction yields greatly with a 1:1 carbon disulfide / N-methyl-2-pyrrolidinone mixed solvent (CS2 / NMP) at room temperature. While, the water treatments at 500 K or the heat treatments at 600 K without water gave little increase in the yields. Characterizations of the water-treated coals were carried out from ultimate and proximate compositions, FT-IR spectrum, solvent swelling, NMR relaxation time, and viscoelasticity behavior. The effect of extraction temperature on the extraction yield enhancement was also investigated using polar NMP or non-polar 1-MN solvent. From these results it is concluded that for high coal rank coals the loosening of non-covalent bonds is responsible for the extraction yields enhancement by the water treatment. The loosening non-covalent bonds may be {pi}-{pi} interactions between aromatic rings for PO, and both {pi}-{pi} interactions and hydrogen bonds for UF. While, for lower rank IL and BZ, which showed decrease in O% and hydrogen-bonded OH, the yield enhancements may be due to the loosening of hydrogen bonds and the removal of oxygen functional groups. 9 refs., 5 figs., 1 tab.

  9. Swelling kinetics of several residues from Shenhua coal extraction

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Mei-xia; Shui, Heng-fu; Wang, Zhi-cai [Anhui University of Technology, Maanshan (China). School of Chemistry and Chemical Engineering

    2008-08-15

    In order to understand the mechanism of swelling and the relation between swelling behavior and solvent extraction, the swelling kinetics of residues from Shenhua coal extracted by CS{sub 2}/NMP with different mixing ratios were studied in different solvents. The result shows that the swelling rates of extraction residues increase along with swelling temperature. The swelling rate in polar solvent NMP is much higher than that in non-polar solvent THN. Solvent extraction has a great effect on the swelling of extraction residues. The swelling activation energy of extraction residues increases and the swelling rate decreases with the increase of extraction yield. The swelling activation energies of extraction residues in NMP and THN are less than 10 kJ/mol, suggesting that the swelling process is controlled by solvent molecular diffusion in coal structure. 22 refs., 2 figs., 7 tabs.

  10. 179 Extraction of Coal-tar Pitch by Supercritical Carbon Dioxide ...

    African Journals Online (AJOL)

    Meyer

    Several extractions of coal-tar pitch were performed using supercritical fluid ..... pressure and temperature, unlike exhaustive extraction, which involves a change in ... mechanism that is operative on extracting coal-tar pitch components with.

  11. Calculating the flue gas dew point for raw brown coal fired steam generators

    Energy Technology Data Exchange (ETDEWEB)

    Schinkel, W.

    1977-01-01

    The paper analyzes parameters influencing the sulfuric acid dew point in flue gas of steam generators. Sulfur content and alkaline earths content in the fuel air ratio during combustion, fly ash content in the flue gas (which absorbs sulfur dioxide and sulfur trioxide) and combustion conditions in steam generators are relevant parameters in the combustion process. A thermodynamic and reaction kinetic calculation of the sulfuric acid dew point is, however, not yet possible. A statistical evaluation of dew point measurements in steam generators is, therefore, employed. Various diagrams show results of dew point measurements carried out at generators with steam capacities ranging from 40 to 660 t/h, which demonstrate relations of these parameters to flue gas dew points, in particular the relative sulfur content (sulfur content in the raw brown coal compared to coal ash content and alkaline earths content). A function is derived for the conversion of fuel sulfur to sulfur trioxide. A diagram presents the relation of the flue gas dew point to partial pressures of sulfuric acid and steam. Direct calculation of the flue gas dew point was achieved by the proposed method. It is applied in steam generator design. (17 refs.)

  12. Increase in extraction yields of coals by water treatment

    Energy Technology Data Exchange (ETDEWEB)

    Masashi Iino; Toshimasa Takanohashi; Chunqi Li; Haruo Kumagai [National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba (Japan). Institute for Energy Utilization

    2004-10-01

    The effect of water treatment at 500 and 600 K on solvent extractions of Pocahontas No. 3 (PO), Upper Freeport (UF), and Illinois No. 6 (IL) coals was investigated. All the coals used show that the water treatments at 600 K increased the extraction yields greatly in the extractions with a 1:1 carbon disulfide/N-methyl-2-pyrrolidinone (CS{sub 2}/NMP) mixed solvent, NMP, or 1-methylnaphthalene (1-MN). However, the water treatments at 500 K and the heat treatments at 600 K without water gave only a slight increase in the yields. Characterizations of the water-treated coals were performed using ultimate and proximate compositions, Fourier transform infrared analysis, solvent swelling, nuclear magnetic resonance relaxation time, and viscoelasticity behavior. The swelling degree in methanol and toluene was increased by the water treatment at 600 K, suggesting that crosslinks become loosened by the treatment. The results of infrared analysis and the extraction temperature dependency of the extraction yields with NMP and 1-MN suggest that the loosening of {pi} - interactions, and of both {pi} - interactions and hydrogen bonds, are responsible for the yield enhancements for PO and UF coals, respectively. However, for IL coal, which exhibited a decrease in oxygen content and the amount of hydrogen-bonded OH, suggesting the occurrence of some chemical reactions, the yield enhancements may be due to the relaxation of hydrogen bonds and the removal of oxygen functional groups, such as the breaking of ether bonds. 17 refs., 3 figs., 5 tabs.

  13. PRODUCTION OF CARBON PRODUCTS USING A COAL EXTRACTION PROCESS

    Energy Technology Data Exchange (ETDEWEB)

    Dady Dadyburjor; Philip R. Biedler; Chong Chen; L. Mitchell Clendenin; Manoj Katakdaunde; Elliot B. Kennel; Nathan D. King; Liviu Magean; Peter G. Stansberry; Alfred H. Stiller; John W. Zondlo

    2004-08-31

    This Department of Energy National Energy Technology Laboratory sponsored project developed carbon products, using mildly hydrogenated solvents to extract the organic portion of coal to create synthetic pitches, cokes, carbon foam and carbon fibers. The focus of this effort was on development of lower cost solvents, milder hydrogenation conditions and improved yield in order to enable practical production of these products. This technology is needed because of the long-term decline in production of domestic feedstocks such as petroleum pitch and coal tar pitch. Currently, carbon products represents a market of roughly 5 million tons domestically, and 19 million tons worldwide. Carbon products are mainly derived from feedstocks such as petroleum pitch and coal tar pitch. The domestic supply of petroleum pitch is declining because of the rising price of liquid fuels, which has caused US refineries to maximize liquid fuel production. As a consequence, the long term trend has a decline in production of petroleum pitch over the past 20 years. The production of coal tar pitch, as in the case of petroleum pitch, has likewise declined significantly over the past two decades. Coal tar pitch is a byproduct of metallurgical grade coke (metcoke) production. In this industry, modern metcoke facilities are recycling coal tar as fuel in order to enhance energy efficiency and minimize environmental emissions. Metcoke production itself is dependent upon the production requirements for domestic steel. Hence, several metcoke ovens have been decommissioned over the past two decades and have not been replaced. As a consequence sources of coal tar are being taken off line and are not being replaced. The long-term trend is a reduction in coal tar pitch production. Thus import of feedstocks, mainly from Eastern Europe and China, is on the rise despite the relatively large transportation cost. To reverse this trend, a new process for producing carbon products is needed. The process must be

  14. Impacts of Coal Seam Gas (Coal Bed Methane) Extraction on Water Resources in Australia

    Science.gov (United States)

    Post, David

    2017-04-01

    While extraction of methane from shale gas deposits has been the principal source of the recent expansion of the industry in the United States, in Australia extraction of methane from coal bed methane deposits (termed 'coal seam gas' in Australia) has been the focus to date. The two sources of methane share many of the same characteristics including the potential requirement for hydraulic fracturing. However, as coal seam gas deposits generally occur at shallower depths than shale gas, the potential impacts of extraction on surface and groundwater resources may be of even greater concern. In Australia, an Independent Expert Scientific Committee (IESC) has been established to provide scientific advice to federal and state government regulators on the impact that coal seam gas and large coal mining developments may have on water resources. This advice is provided to enable decisions to be informed by the best available science about the potential water-related impacts associated with these developments. To support this advice, the Australian Government Department of the Environment has implemented a programme of research termed 'bioregional assessments' to investigate these potential impacts. A bioregional assessment is defined as a scientific analysis of the ecology, hydrology, geology and hydrogeology of a bioregion with explicit assessment of the potential direct, indirect and cumulative impacts of coal seam gas and large coal mining development on water resources. These bioregional assessments are currently being carried out across large portions of eastern Australia underlain by coal reserves. Further details of the programme and results to date can be found at http://www.bioregionalassessments.gov.au. The bioregional assessment programme has modelled the impacts of coal seam gas development on surface and groundwater resources in three regions of eastern Australia, namely the Clarence-Moreton, Gloucester, and Namoi regions. This presentation will discuss the

  15. Raw-materials mixtures from waste of the coal industry for production of ceramic materials

    Energy Technology Data Exchange (ETDEWEB)

    Galpern, E I [Scientific-Manufacturing Enterprise ` ` Ceramics` ` , Donetsk (Ukraine); Pashchenko, L V [Inst. of Physical, Organic and Coal Chemistry of NASU, Donetsk (Ukraine)

    1998-09-01

    The liquidation of waste dumps on the surface of mining enterprises and realization of measures by environment protection of air and aquatic basins are connected to the complex processing of mining mass. The main directions of utilization of mining rocks and coal wastes realized in Ukraine industry are: - filling of mines worked-out area by grouting solutions; - ceramic brick, porous filling materials and binding materials production; - road-making, construction of hydrostructures and industrial objects; - output of concrete items predominantly for using in mining conditions. The peculiarity of wastes using in above-mentioned fields is the possibility of their mass application in quantities commensurable with valumes of their yields. The experience of enterprises work which process mining rocks into building materials by burning method (ceramic brick, porous aggregates of concretes as aggloporite, expanded clay aggregate) has shown that unconstant and, as the rule, exceeding norms content of carbon and sulphur in the rock results to deterioration of products quality and technological factors of production. Unstability of carbon content in raw material makes the burning process hardly operated. Obtained products having residual carbon in the view of coke residue are often characterized by lower physical-mechanical characteristics. (orig./SR)

  16. Effectiveness of underground coal extraction. Effektivnost' podzemnoy dobychi uglya

    Energy Technology Data Exchange (ETDEWEB)

    Pirskiy, A A

    1982-01-01

    This book examines the possibility of improving the efficiency of underground coal extraction based on the solution to the scientific-technical problem of monitoring and controlling concentration and intensifying mining operations. The problem has been resolved as applied to conditions of working coal fields of the Lvov-Volynskiy basin, West Donbass and other regions which are similar in relation to mining-geological conditions. The main conclusions and recommendations consist of the following: synthesized concept ''concentration of mining operations'' is determined by regulation and concentration, intensification of mining operations by using progressive technology, mechanization and organization of production in order to increase extraction, improve productivity of labor and reduce the net cost of coal. The structure of concentration of mining operations is based on the synthesis of natural, technical and organizational conditions for working coal seams. The problem of monitoring and control of the concentration of mining operations was realized by using the systems method based on the laws of development, principles of comprehensive evaluation and optimization of the level of concentration based on economic-mathematical modeling. The use of the systems approach guarantees a comprehensive solution to the problem. In definite periods of development of the coal industry, between the organizational-technical potentialities, natural conditions and trends determined in the sector for the change in the level of mining operation concentration, disproportions develop. The level of work concentration goes beyond the limits of optimal values, and the effectiveness of coal extraction is reduced. In order to predict and eliminate this phenomenon, it is recommended that the level of mining concentration be controlled.

  17. Microwave-assisted extraction of polycyclic aromatic compounds from coal.

    Science.gov (United States)

    Kerst, M; Andersson, J T

    2001-08-01

    Microwave-assisted extraction (MAE) of polycyclic aromatic compounds (PACs) from coal is shown to give the same pattern of compounds as Soxhlet extraction. MAE requires only 10 mL solvent and 10 min extraction time whereas Soxhlet uses 200 mL and takes 24 h. Although the yields were lower, dichloromethane (DCM) was preferred to pyridine, N-methyl-2-pyrrolidone (NMP), and NMP with CS2 because the pattern of the PACs is shown to be independent of solvent and DCM is a much more convenient solvent to work with.

  18. Effect of Rhodococcus sp. on desulfurization, swelling and extraction of coal

    Energy Technology Data Exchange (ETDEWEB)

    Wang De-qiang; Shui Heng-fu [University of Technology of Anhui, Maanshang (China). School of Chemical Engineering

    2006-08-15

    Bio-desulfurization of coal by rhodococcus sp. was studied. Some kinds of coal were swelled with different organic solvents, and then the swelled coals were treated by rhodococcus sp. The results show that the ratios of desulfurization of coals increase after they are swelled, especially swelled with NMP, the ratio is more than 80%. The swelling and extraction of coal were also studied after the coal had been treated by rhodococcus sp. The results show that the ratios of swelling increase more than 65%, but the extraction yield decreases for the coal treated by rhodococcus sp. 11 refs., 5 tabs.

  19. A comparative study between the coal-biomass briquette and raw coal in SO{sub 2} pollution and adverse effects in rabbits

    Energy Technology Data Exchange (ETDEWEB)

    Cheng Shuqun; Zhou Yanrong; Wang Yi' nan; Wang Xun; Liu Yuanfu; Iwao Uchiyama; Wang Qiangyue; Kazuhiki Sakamoto [Chongqing University of Medical Sciences. Chongqing (China). School of Public Health

    2006-12-15

    This study was conducted to evaluate the adverse health effects on rabbits exposed to SO{sub 2} emitted indoors from burning coals, and compare differences between coal-biomass briquette (BB) and raw coal (RC). Thirty-six male rabbits were divided equally into three groups at random, and then exposed to burning RC, BB, and the third without burning coal (Control) for 90 days. Data showed that the average concentration of SO{sub 2} in 24 h in RC was 13.04 mg m{sup -3}, which was 5-fold greater than BB and 31-fold higher than control (0.41 mg m{sup -3}). After 45 days, the numbers of rabbits, with increased frequency of Comet cell was highest in RC. After 90 days, the % positive Comet cell was significant at 10.36% in RC, 5.42% in BB, and 1.73% in Control. There was a nonlinear dose-effect relationship between % positive Comet cell and the concentration of SO{sub 2}. The incidence of interstitial pneumonia was 6/12 in RC and 4/12 in BB showing severe squamous metaplasia with atypical hyperplasia in bronchial epithelia in RC animals. The results of study indicate that use of BB reduced the emission of SO{sub 2}; but the smoke emitted from burning coal still produced DNA damage.

  20. Analysis preliminary phytochemical raw extract of leaves Nephrolepis pectinata

    Directory of Open Access Journals (Sweden)

    Natally Marreiros Gomes

    2017-06-01

    Full Text Available The Nephrolepis pectinata popularly known as paulista fern, ladder-heaven, cat tail, belongs to the family Davalliaceae. For the beauty of the arrangements of their leaves ferns are quite commercialized in Brazil, however, have not been described in the literature studies on their pharmacological potential. Thus, the objective of this research was to analyze the phytochemical properties of the crude extract of the leaves of Nephrolepis pectinata. To perform the phytochemical analysis were initially made the collection of the vegetable, preparation of voucher specimen, washing, drying and grinding. Then, extraction by percolation method and end the phytochemical analysis. Preliminary results phytochemicals the crude extract of the leaves of Nephrolepis pectinata tested positive for reducing sugars, phenols/tannins (catechins tannins and catechins.

  1. The mine where extracting coal is a bonus

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1993-07-01

    Bowmans Harbour opencast mine is probably unique. Here Clay Colliery is mining an area that was derelict and contaminated land, which became a landfill site. When standards for landfill were raised the Black Country Development Corporation decided to redeposit the waste in a new repository on the same site, using higher standards. New cells for waste are being constructed. In creating these new cells coal is being extracted and sold. Four excavators are involved in this project.

  2. The coupling of coal and nuclear energy for the long-term supply of energy and raw materials

    International Nuclear Information System (INIS)

    Knizia, K.

    1986-10-01

    In view of the limited world reserves of fossil fuels and the increase in demand to be expected because of the continued growth of the world population, coal and nuclear energy will have to make an increasing contribution to the energy supply. Their contribution will range from electricity generation to the heat sector and to the raw materials market via various gases obtained from them. The further development towards this field of tasks will lead first via the gasification of coal. It will be carried out autothermally in the first stage of development. The gas produced is suitable for realising considerable improvements in efficiency as compared to coal-fired power stations of present-day design since it will permit the generation of electricity via combined gas turbine/steam turbine processes. Efforts are being made to take further the processes based on this technology by introducing a sodium circuit in addition to the coal gasification, which will make it possible to keep the plants required for coal gasification small. In later stages, this technology will also be suitable for producing a considerable improvement in the diversion of heat at high temperatures from high-temperature reactor nuclear power stations for several purposes. (author)

  3. Environmental analysis of raw cork extraction in cork oak forests in southern Europe (Catalonia--Spain).

    Science.gov (United States)

    Rives, Jesús; Fernandez-Rodriguez, Ivan; Rieradevall, Joan; Gabarrell, Xavier

    2012-11-15

    Cork oak grows endemically in a narrow region bordering the western Mediterranean, and especially in the Iberian Peninsula. The importance of cork agro-forestry systems lies in the fact that a natural and renewable raw material - cork - can be extracted sustainably without endangering the tree or affecting biodiversity. This paper describes an environmental analysis of the extraction of raw cork in cork oak forests in Catalonia, using data from five representative local forest exploitations. The evaluation was carried out using life cycle assessment (LCA) methodology, and all the forestry management required to obtain a tonne of raw cork was included. The aim of the study was to evaluate the environmental impacts - in terms of global warming, acidification, eutrophication, human toxicity, and so on - caused by cork extraction and determine the carbon dioxide balance of these forestry systems, with a tree lifespan of about 200 years. During the life cycle extraction of cork in Catalonia, 0.2 kg of CO(2) eq. was emitted per kg of raw cork extracted. Moreover, cork cannot be extracted without the tree, which will be fixing carbon dioxide throughout its technological useful life (200 years), despite the fact that the bark is removed periodically: every 13-14 years. If the emission from extraction and the carbon contained in the material is discounted, the carbon dioxide balance indicates that 18 kg of CO(2) are fixed per kg of raw cork extracted. Therefore, cork is a natural, renewable and local material that can replace other non-renewable materials, at local level, to reduce the environmental impacts of products, and particularly to reduce their carbon footprint. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Performance of a diesel engine operating on raw coal-diesel fuel and solvent refined coal-diesel fuel slurries. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Marshall, H.P.

    1980-03-01

    Performance tests using an 11 kW single cylinder diesel engine were made to determine the effects of three different micronized coal-fuel oil slurries being considered as alternative fuels. Slurries containing 20, 32, and 40%-wt micronized raw coal in No. 2 fuel oil were used. Results are presented indicating the changes in the concentrations of SO/sub X/ and NO/sub X/ in the exhaust, exhaust opacity, power and efficiency, and in wear rates relative to operation on fuel oil No. 2. The engine was operated for 10 h at full load and 1400 rpm on al fuels except the 40%-wt slurry. This test was discontinued because of extremely poor performance.

  5. Possibilities of employing saliferous raw brown coal for technical fodder drying

    Energy Technology Data Exchange (ETDEWEB)

    Koerdel, P; Haeusler, W

    1978-09-01

    The successful utilization of saliferous brown coal is demonstrated with a sodium oxide content greater than 0.5% in dry substance, but with high calorific value (2300 to 3000 kcal/kg) for fodder drying (sugar beets and green fodder). Details of the fodder dryer and its performance, and combustion and drying parameters of 11 dryers using saliferous coal are presented. Hot air enters the dryer with temperatures between 300 and 800 C depending on the operation, and dries the fodder to 88-92% dry substance. Chemical analysis showed no significant increase in sulfur dioxide, hydrogen sulfide, chlorine, or sodium content in the dry fodder, which is recognized as safe to feed to ruminants. The substitution of ordinary brown coal by saliferous coal led to a savings of 4.000 Marks/kt coal in drying. (8 refs.) (In German)

  6. Air extraction in gas turbines burning coal-derived gas

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Tah-teh; Agrawal, A.K.; Kapat, J.S.

    1993-11-01

    In the first phase of this contracted research, a comprehensive investigation was performed. Principally, the effort was directed to identify the technical barriers which might exist in integrating the air-blown coal gasification process with a hot gas cleanup scheme and the state-of-the-art, US made, heavy-frame gas turbine. The guiding rule of the integration is to keep the compressor and the expander unchanged if possible. Because of the low-heat content of coal gas and of the need to accommodate air extraction, the combustor and perhaps, the flow region between the compressor exit and the expander inlet might need to be modified. In selecting a compressed air extraction scheme, one must consider how the scheme affects the air supply to the hot section of the turbine and the total pressure loss in the flow region. Air extraction must preserve effective cooling of the hot components, such as the transition pieces. It must also ensure proper air/fuel mixing in the combustor, hence the combustor exit pattern factor. The overall thermal efficiency of the power plant can be increased by minimizing the total pressure loss in the diffusers associated with the air extraction. Therefore, a study of airflow in the pre- and dump-diffusers with and without air extraction would provide information crucial to attaining high-thermal efficiency and to preventing hot spots. The research group at Clemson University suggested using a Griffith diffuser for the prediffuser and extracting air from the diffuser inlet. The present research establishes that the analytically identified problems in the impingement cooling flow are factual. This phase of the contracted research substantiates experimentally the advantage of using the Griffith diffuser with air extraction at the diffuser inlet.

  7. Antioxidant Effect of Extracts from the Coffee Residue in Raw and Cooked Meat

    Directory of Open Access Journals (Sweden)

    Ji-Hee Kim

    2016-07-01

    Full Text Available The residue of ground coffee obtained after the brewing process (spent coffee still contains various functional components with high antioxidant capacity and health benefits, but no attempts have been made to use it as a resource to produce value-added food ingredients. This study evaluates the antioxidant activity of ethanol or hot water extracts from the residues of coffee after brewing. An extraction experiment was carried out using the conventional solid–liquid methods, including ethanol and water as the extraction media at different temperatures and liquid/solid ratios. The antioxidant activity of extracts was tested for total phenolic compound (TPC, 2,2-diphenyl-1-picrylhydrazyl (DPPH, and 2-thiobarbituric acid reactive substances (TBARS using oil emulsion and raw/cooked meat systems. The DPPH radical scavenging activity of the ethanol extracts with heating (HEE and without heating (CEE were higher than that of the hot water extracts (WE. The highest DPPH value of HEE and CEE at 1000 ppm was 91.22% and 90.21%, respectively. In oil emulsion and raw/cooked systems, both the water and ethanol extracts had similar antioxidant effects to the positive control (BHA, but HEE and CEE extracts showed stronger antioxidant activities than WE extract. These results indicated that the ethanol extracts of coffee residue have a strong antioxidant activity and have the potential to be used as a natural antioxidant in meat.

  8. Optimizing Transport in Surface Mines, Taking into Account the Quality of Extracted Raw Ore

    Directory of Open Access Journals (Sweden)

    Marian Šofranko

    2012-12-01

    Full Text Available This articles concerns problemacy of appropriate separation of transporting mechanisms for mining minerals from individulalteritories. In the following sections of the article a model solution is presented with the use of newly created program for optimizationof transport, taking into account the required quality of extracted raw ore. This process is being done through computing analysisand programming language Borland C++ Builder

  9. Evaluation of Rare Earth Element Extraction from North Dakota Coal-Related Feed Stocks

    Science.gov (United States)

    Laudal, Daniel A.

    identified that the predominant modes of rare earths occurrence in the lignite coals are associations with the organic matter, primarily as coordination complexes and a lesser amount as ion-exchangeable cations on oxygen functional groups. Overall it appears that about 80-95% of rare earths content in North Dakota lignite is organically associated, and not present in mineral forms, which due to the weak organic bonding, presented a unique opportunity for extraction. The process developed for extraction of rare earths was applied to the raw lignite coals instead of fly ash or other byproducts being investigated extensively in the literature. Rather, the process uses a dilute acid leaching process to strip the organically associated rare earths from the lignite with very high efficiency of about 70-90% at equilibrium contact times. Although the extraction kinetics are quite fast given commercial leaching operations, there is some tradeoff between extraction efficiency and contact time. (Abstract shortened by ProQuest.).

  10. Hydrocracking of coal extracts to highly aromatic petroleum

    Energy Technology Data Exchange (ETDEWEB)

    Kotowski, W; Gorski, R

    1972-07-01

    Coal extracts were hydrocracked at 400 to 450/sup 0/C, 250 atm, 0.8 to 2.0 hr/sup -1/ space velocity, and with 1.5 cu m/l./hr of hydrogen over a bed of fluidized, 0.6 to 0.8 mm granules of nickel-molybdenum zeolite catalyst using the Consolidation Coal Co. process. The 330/sup 0/C bp extract was diluted with the 230 to 320/sup 0/C fraction of the product. At 440/sup 0/C and 1.2 hr/sup -1/ space velocity, the hydrotreatment removed 97% of the sulfur compounds, 95% of oxygen compounds, and 92% of nitrogen compounds. The yield of 35 to 230/sup 0/C gasoline stock decreased with increasing feed space velocity, but that of 230 to 340/sup 0/C gas oils increased. The synthetic crude product contained 48.7% aromatics, 35.1% naphthenes, 13.4% paraffins, 2.8% olefins, 0.14% sulfur, and 1.07% asphaltene. The product is compared with Romashkino crude.

  11. Coal tar phototherapy for psoriasis reevaluated: erythemogenic versus suberythemogenic ultraviolet with a tar extract in oil and crude coal tar

    International Nuclear Information System (INIS)

    Lowe, N.J.; Wortzman, M.S.; Breeding, J.; Koudsi, H.; Taylor, L.

    1983-01-01

    Recent studies have questioned the therapeutic value of coal tar versus ultraviolet (UV) radiation and their relative necessity in phototherapy for psoriasis. In this investigation, different aspects of tar phototherapy have been studied in single-blind bilateral paired comparison studies. The effects of 1% crude coal tar were compared with those of petrolatum in conjunction with erythemogenic and suberythemogenic doses of ultraviolet light (UVB) using a FS72 sunlamp tubed cabinet. Crude coal tar was clinically superior to petrolatum with suberythemogenic ultraviolet. With the erythemogenic UVB, petrolatum was equal in efficacy to crude coal tar. Suberythemogenic UVB was also used adjunctively to compare the effects of a 5% concentration of a tar extract in an oil base to 5% crude coal tar in petrolatum or the oil base without tar. The tar extract in oil plus suberythemogenic UVB produced significantly more rapid improvement than the oil base plus UVB. The direct bilateral comparison of equal concentrations of tar extract in oil base versus crude coal tar in petrolatum in a suberythemogenic UV photo regimen revealed no statistical differences between treatments. In a study comparing tar extract in oil and the oil base without ultraviolet radiation, the tar extract in oil side responded more rapidly

  12. Coal combustion products in Europe valuable raw materials for the construction industry

    Energy Technology Data Exchange (ETDEWEB)

    Berg, W. vom; Feuerborn, H.J. [European Coal Combustion Products Association e.V., Essen (Germany)

    2005-07-01

    Coal combustion products (CCPs) are formed with the production of electricity in coal-fired power plants. The production of these CCPs has been increased by the years due to legal requirements for flue gas cleaning. The utilisation of CCPS is well is established in some European countries, based on long term experience and technical as well as environmental benefits. As CCPs are defined as waste materials by existing legislation the power industry has to handle the stigma put on the products and hamper the beneficial use. (orig.)

  13. Structure determination of small molecular phase in coal by solvent extraction

    Energy Technology Data Exchange (ETDEWEB)

    Feng, J.; Wang, B.; Ye, C.; Li, W.; Xie, K. [Taiyuan University of Technology, Taiyuan (China)

    2004-04-01

    7 typical Chinese coal samples were extracted by NMP/CS{sub 2} system at around 90{degree}C by Soxhlet method. Compared with results from NMP, a higher coal extraction rate was acquired when NMP + CS{sub 2} solvent system was adopted. Except for anthracite extraction rate of about 20% was acquired, particularly 41% for long flame coal. By using the method of retention index of coal extracts analysis by HPLC, it is found that the polar part with less than six-carbon numbers in coal is the active site for coal reactivity, and the inert site belongs to the aromatic hydrocarbon derivation with 3 aromatic rings. 13 refs., 3 figs., 2 tabs.

  14. Method of gamma transmission analysis for controlling the hydraulic transport of raw coal

    International Nuclear Information System (INIS)

    Pepelnik, R.; Boessow, E.; Fanger, H.U.

    1978-01-01

    The capacity of the methods for measuring gamma absorption developed at GKSS to be used for the analysis of conweyer flows of water/coal/refuse mixtures has been studied. As only the absorption properties of the refuse are essentially different from those of water the refuce is detected with higher accuracy than the coal. In this way the sensitivity of the gamma transmission analysis method agrees with the fact that in coal mining the critical mining parameters are influenced by refuse. The results of the investigations indicate that for measuring times of about 10 sec, accounting for realisitic variations of the chemism of the refuse, the volume shares can be determined with an accuracy of about +- 4.7 V/O of coal and about +- . 5 V/O of refuse. The measuring arrangement for the drift velocity is capable to record also the size and the number of the refuse lumps. The methods described therefore are well suited for controlling an optimal conveying operation. (orig.) [de

  15. Effect of hydrothermal treatment on some properties of Shenhua coal

    Energy Technology Data Exchange (ETDEWEB)

    Wang Zhi-cai; Shui Heng-fu; Zhang De-xiang; Gao Jin-sheng [East China University of Science and Technology, Shanghai (China). College of Resource and Environmental Engineering

    2006-10-15

    Effects of hydrothermal treatment on swelling, extraction and liquefaction behavior of Shenhua coal were studied through analyses of element content, ash content, volatile content and IR spectrum of treated coal. The results indicate that hydrogenation of coal is distinctly carried out in the process of hydrothermal pre-treatment and the hydrogen content of treated coal is more than that of raw coal. The contents of ash and volatile matters of treated coal are lower than those of raw coal. With the increase of treatment temperature the volatile content of the hydrothermal treated coal decreases and the ash content of treated coal increases. CO{sub 2} is main gas product and unvaries with the temperature changing, whereas CO and CH{sub 4} are formed when the temperature is above 250{sup o}C and increase with the temperature during hydrothermal treatment. Hydrothermal treatment is not in favor of coal swelling and the swelling ratio of treated coal decreases with the increase of treatment temperature. The swelling ratio of extraction residue by CS{sub 2}/NMP mixed solvent in NMP solvent is lower than that of the corresponding raw coal. The CS{sub 2}/NMP mixed solvent extraction yields of coal treated at appropriate temperature are higher than that of raw coal, but the extraction yields of treated coal obtained by n-hexane, toluene and THF successive Soxhelt extraction are lower. Hydrothermal treatment at 250-300{sup o}C can increase the conversion of treated coal in direct hydro-liquefaction. The gas + oil yield of treated coal is lower than that of raw coal and the preasphaltene yield of treated coal is much higher. IR spectra of treated coals show that the forms of non-covalent bonds are changed by hydrothermal treatment, and the hydrolysis of ester and ether bonds and the pyrolysis of aromatic side chains also maybe occur at high treatment temperature. 21 refs., 3 figs., 4 tabs.

  16. Biological reclamation of coal mine spoils without topsoil: an amendment study with domestic raw sewage and grass-legume mixture

    Energy Technology Data Exchange (ETDEWEB)

    Maiti, S.K.; Saxena, N.C. [Indian School of Mines, Dhanbad (India). Centre of Mining Environment

    1997-12-31

    A range of tree species were successfully established and grown on spoil site irrigated with domestic raw sewage in India. The heavy metals content in leaves, stem wood, stem bark root wood and root bark differ between species. In general, heavy metals like Fe, Zn, Mn, Cu, and Pb were accumulated more in Eucalyptus then Melia, however only Co accumulated maximum in Acacia. Increase trend was reported in respect of Na, K, Fe, Zn, Cu in grass and vegetables which were grown at a sewage fed farm. However, in all the cases micronutrients and heavy metals contents did not reach the critical limits to produce any phytotoxic effect. Irrigation with raw sewage had no adverse effect on chemical properties of spoil over the 3 year period. This study shows that raising vegetation on spoil material in mining areas irrigated with raw sewage is feasible. However, irrigation by raw sewage caused the accumulation of heavy metals in different plant parts. These plants are not of the fodder type and thus are not entering directly into ecological food chains, hence they can act as heavy metals sinks. On the basis of the Grass-legume experimental study, it may be concluded that N accumulation of coal mine spoil related with nature of spoil, prevailing climate and legume used. In a tropical climate N accumulation rate was found higher than in a temperate one. Addition of phosphorus fertilizer is essential for the reclamation of many mine spoils because even after three years available P level can remain deficient. Available K was found to be sufficient after three years.

  17. Evaluation of raw nepodin extraction from Rumex japonicus and R. obtusifolius and their DNA polymorphisms.

    Science.gov (United States)

    Minami, Motoyasu; Mori, Takako; Yonezawa, Takayuki; Saito, Yukiko; Teruya, Toshiaki; Woo, Je-Tae

    2018-01-01

    Nepodin, found in the roots of Rumex japonicus Houtt. (Polygonaceae), inhibits osteoclast differentiation and has an antidiabetic effect. We propose nepodin as an ingredient of new functional foods or as a drug candidate for reducing the risk of reduced locomotion resulting from diseases such as osteoporosis. Although there are no previous reports of R. obtusifolius L., which is found throughout Japan, having roots containing nepodin, we found nepodin in the roots of this species. Therefore, R. obtusifolius as well as R. japonicus was considered a candidate raw material for nepodin extraction. We also discuss the suitability of R. japonicus and R. obtusifolius as sources of raw nepodin for cultivation on the Ryukyu Islands. In this study, all specimens on the Ryukyu Islands were identified as R. japonicus. Conversely, all specimens on mainland Japan were R. obtusifolius. The DNA sequence of the chloroplast trnL-trnF intergenic spacer region and partial nuclear internal transcribed spacer was consistent with the identification of R. japonicus and R. obtusifolius by morphological characteristics of the perianth segments. Therefore, to avoid erroneous identification and misuse of the plant species used for extraction of raw materials, it is preferable to develop DNA markers for these two regions. The content of nepodin varied from undetectable to 0.34% of the fresh weight (%FW) in R. japonicus and from undetectable to 0.21%FW in R. obtusifolius. From a pharmacological perspective, as plants that might be suitable as raw materials for nepodin extraction, it became clear that both R. japonicus and R. obtusifolius can be used with the same expected extraction efficiency. Based on our findings, R. obtusifolius could not be confirmed as inhabiting the Ryukyu Islands. For this reason, to conserve the endemic genetic characteristics of the Ryukyu Islands and to prevent genetic pollution by R. obtusifolius, only R. japonicus should be cultivated on the Ryukyu Islands.

  18. Optimizing Pretreatment of Medicinal Raw Materials by RFC Plasma before Extraction

    Directory of Open Access Journals (Sweden)

    O.Yu. Kuznetsova

    2016-06-01

    Full Text Available Optimization of the RF-plasma treatment modes of chaga raw materials using the Statistica 6.0 software package has been performed. Mathematical design has been carried out to calculate the optimum parameters of RF-plasma treatment using three plasma-forming gases – argon, air, and nitrogen. Plasma treatment of chaga raw materials has been undertaken at the constant parameters: pressure P = 30.0 Pa, anodic current J = 0.7 A, gas consumption G = 0.04 g/s; the variable parameters were power U = 5.0÷7.0 kV and treatment duration at the high-frequency capacitor category of the lowered pressure t = 30÷60 min. Optimization of four key parameters for extraction of chaga raw materials (solid residue, melanin yield, antioxidant activity of both extract and chaga melanin depending on the chosen plasma-forming gas (argon, air, or nitrogen has been achieved. The optimum modes of RF-plasma treatment allowing to obtain the extracts and melanin of chaga mushroom with the improved physicochemical and antioxidant characteristics have been calculated.

  19. SCREENING OF ANTIMICROBIAL PROPERTIES OF ETHANOLIC EXTRACTS FROM SOME KINDS OF RAW MATERIALS WITH QUINONEDERIVATIVES

    Directory of Open Access Journals (Sweden)

    Boyko N.N.

    2014-12-01

    Full Text Available This paper presents data on screening of antimicrobial properties of extracts from some kinds of raw materials (18 plants with hydroquinone, naphtoquinone or anthraquinone derivatives. Some technological parameters of extracts (density and concentration of extraneous substances have been determined. The most appropriate microbiological method of studying antimicrobial properties of extracts, diffusion method of “well”, has been applied; special mathematic method of comparison of antimicrobial properties of extracts vector analysis has been applied in order to study and to compare antimicrobial properties of extracts. Indexes of antimicrobial properties of extracts have been determined: a complex index of medicinal product antimicrobial activity for quantitative estimation of antimicrobial effect - A, and square of correlation coefficient - r², which demonstrates the spectrum of antimicrobial activity of the extracts (degree of similarity to the standard. The most active extracts have been selected; they have antimicrobial properties of medium strength: from the herb of chimaphila umbellata А=2.20; the fruits of rhamnus cathartica А=2.12; the root of rubia tinctorum А=2.11; the bark of frangula alnus А=2.05; the root of rumex confertus А=2.04; the leaf of pyrola rotundifolia А=2.00; and leaf of arctostaphylos uva-ursi А=2.08 (but extract from uva-ursi did not affected on 2 strains of microorganisms r²=0.64. Low levels of antimicrobial activity have been demonstrated by the extract obtained from the leaf of urtica dioica А=0.72, r²=0.34. The mean result of the complex index of antimicrobial activity for the most of extracts from plants containing quinonederivatives is A = 1.77 (on 70% vol. ethanol at a ratio of raw material : extracting agent – 1:7 wt. : vol. and may range from 0.68 to 2.85. The mean result of the correlation coefficient is r = 0.93 and may range from 0.59 to 0.99. The mean result of the concentration of

  20. Target costing as an element of the hard coal extraction cost planning process

    Directory of Open Access Journals (Sweden)

    Katarzyna Segeth-Boniecka

    2017-09-01

    Full Text Available Target costing as an element of the hard coal extraction cost planning process Striving for the efficiency of activities is of great significance in the management of hard coal extractive enterprises, which are constantly subjected to the process of restructuring. Effective cost management is an important condition of the increase in the efficiency of the researched business entities’ activity. One of the tools whose basic objective is conscious influencing cost levels is target costing. The aim of this article is to analyse the conditions of implementing target costing in the planning of hard coal extraction costs in hard coal mines in Poland. The subject area raises a topical and important problem of the scope of solutions concerning cost analysis in hard coal mines in Poland, which has not been thoroughly researched yet. To achieve the abovementioned aim, the theoretical works of the subject area have been referenced. The mine management process is difficult and requires the application of best suited and most modern tools, including those used in the planning process of hard coal extraction costs in order to support the economic efficiency of mining operations. The use of the target costing concept in the planning of hard coal mine operations aims to support the decision-making process, so as to achieve a specified level of economic efficiency of the operations carried out in a territorially designated site of hard coal extraction.

  1. Oil Extraction from “Morelos Rice” Bran: Kinetics and Raw Oil Stability

    Directory of Open Access Journals (Sweden)

    J. Zúñiga-Diaz

    2017-01-01

    Full Text Available “Morelos rice” is a variety of rice with certificate of denomination of origin. It is a large grain of opaque appearance and extra large size that is grown exclusively in Morelos state (Mexico. Thus, the quality and characteristics of its rice bran may affect the kinetic of the extraction process of its oil as well as its stability. Therefore, this work is oriented to determine the extraction kinetics of its oil and its oxidative stability. The latter one is obtained through the proposal of a method based on open-circuit potential measurements. The results showed that the rice bran has 21.44% of raw oil, with a chemical composition (based on fatty acids of 48.48% oleic acid, 35.26% linoleic acid, and 14.54% palmitic acid, as well as a free fatty acid content of 8.15%. A high percentage of its oil content can be recovered in a short time at room temperature, and its extraction kinetics is a function of both the washing and the diffusion of its oil. Under storage conditions the raw oil has a high stability, at least 8 months, and its oxidative stability was of 24, 9, and 7 hours at 50°C, 80°C, and 110°C, respectively.

  2. Preparation and evaluation of coal extracts as precursors for carbon and graphite products

    Energy Technology Data Exchange (ETDEWEB)

    Zondlo, J.W.; Stiller, A.W.; Stansberry, P.G. [West Virginia Univ., Morgantown, WV (United States)] [and others

    1996-08-01

    A coal extraction process coupled with coal hydrotreatment has been shown capable of producing suitable precursors for a variety of commercially important carbon and graphite products. The N-methylpyrolidone (NMP) extracts of hydrotreated coals have been analytically and chemically characterized and shown to have properties acceptable for use as binder and impregnation pitch. Mesophase formation studies have demonstrated their capability for producing both needle and anode grade coke as well as precursors for mesophase pitch fibers. A graphite artifact has been produced using a coal extract as a binder and coke derived from the extract as a filler. Further evaluation of the extract materials is being carried out by industrial members of the Carbon Products Consortium.

  3. BP and NCB to collaborate in coal liquefaction study. [Supercritical gas extraction; dissolution in anthracene oil

    Energy Technology Data Exchange (ETDEWEB)

    1978-02-17

    British Petroleum and NCB are collaborating in a two year study of coal liquefaction which could result in a demonstration plant being built. The two liquefaction techniques which the NCB is developing at present are supercritical extraction, and dissolution in anthracene oil. A disadvantage of the latter process is that high grade coking coals must be used.

  4. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  5. Deer Bone Oil Extract Suppresses Lipopolysaccharide-Induced Inflammatory Responses in RAW264.7 Cells.

    Science.gov (United States)

    Choi, Hyeon-Son; Im, Suji; Park, Yooheon; Hong, Ki-Bae; Suh, Hyung Joo

    2016-01-01

    The aim of this study was to investigate the effect of deer bone oil extract (DBOE) on lipopolysaccharide (LPS)-induced inflammatory responses in RAW264.7 cells. DBOE was fractionated by liquid-liquid extraction to obtain two fractions: methanol fraction (DBO-M) and hexane fraction (DBO-H). TLC showed that DBO-M had relatively more hydrophilic lipid complexes, including unsaturated fatty acids, than DBOE and DBO-H. The relative compositions of tetradecenoyl carnitine, α-linoleic acid, and palmitoleic acid increased in the DBO-M fraction by 61, 38, and 32%, respectively, compared with DBOE. The concentration of sugar moieties was 3-fold higher in the DBO-M fraction than DBOE and DBO-H. DBO-M significantly decreased LPS-induced nitric oxide (NO) production in RAW264.7 cells in a dose-dependent manner. This DBO-M-mediated decrease in NO production was due to downregulation of mRNA and protein levels of inducible nitric oxide synthase (iNOS). In addition, mRNA expression of pro-inflammatory mediators, such as cyclooxygenase (COX-2), interleukin (IL)-1β, and IL-12β, was suppressed by DBO-M. Our data showed that DBO-M, which has relatively higher sugar content than DBOE and DBO-H, could play an important role in suppressing inflammatory responses by controlling pro-inflammatory cytokines and mediators.

  6. Mechanism of Enhancing Extraction of Vanadium from Stone Coal by Roasting with MgO

    Directory of Open Access Journals (Sweden)

    Fang Chen

    2017-02-01

    Full Text Available In this paper, the extraction of vanadium from stone coal by roasting with MgO and leaching with sulfuric acid has been investigated, and the mechanism analysis of stone coal roasting with MgO was studied. The results indicated that under the conditions that the mass fraction of the particles with grain size of 0–0.074 mm in raw ore was 75%, the roasting temperature was 500 °C, the roasting time was 1 h, MgO addition was 3 wt %, the sulfuric acid concentration was 20 vol %, the liquid-to-solid ratio was 1.5 mL/g, the leaching temperature was 95 °C, and leaching time was 2 h, resulting in a vanadium leaching efficiency of 86.63%, which increased by 7.73% compared with that of blank roasting. The mechanism analysis showed that the degree of calcite decomposition was low and, thus, magnesium vanadate was more easily formed than calcium vanadate below 500 °C. Moreover, magnesium vanadate was easier to dissolve than calcium vanadate during the sulfuric acid leaching process. Thus, the vanadium leaching efficiency was enhanced by using MgO as a roasting additive below 500 °C. Additionally, at high temperature the formation of tremolite would consume calcium oxide produced from the decomposition of calcite, thus, the formation of calcium vanadate was hindered, and V2O5 would react with MgO to form magnesium vanadate. Therefore, the vanadium leaching efficiency of roasting with MgO was higher than that of blank roasting at high temperature.

  7. Innovative Extraction Method for a Coal Seam with a Thick Rock-Parting for Supporting Coal Mine Sustainability

    Directory of Open Access Journals (Sweden)

    Meng Li

    2017-10-01

    Full Text Available As thick rock partings delay the efficient mining of coal seams and constrain the sustainable development of coal mines, an innovative extraction method for a coal seam with thick rock parting was proposed. The coal seams were divided into different sub-zones according to the thickness of rock parting and then the sub-zones were mined by separately using three mining schemes involving full-seam mining, combined mining using backfill and caving (CMBC, and reducing height mining. Afterwards, the study introduced the basic mechanism and key devices for the CMBC and analysed the working state of the backfill support in detail. Moreover, the method for calculating the length of the backfill zone was proposed to design the length of backfill zone and the influences of four factors (including bulking coefficient of rock parting on the length of the backfill zone were also explored. By taking the No. 22203 panel, Buertai mine, Inner Mongolia, China as an example, the mined coal resource by using the CMBC extraction method will increase by 1.83 × 106 tons and the recovery ratio will rise from 56.2% to 92.4% compared with mining of the 2-2 upper coal seam alone. Moreover, by applying CMBC, a series of environmental and ecological problems caused by rock parting is reduced, which can improve the environment in mined areas. The research can provide technological guidance for mining panels of a coal seam with a thick rock parting and the disposal thereof under similar conditions.

  8. Predicting the granulometric composition of the coal extracted from a drum cutter loader

    Energy Technology Data Exchange (ETDEWEB)

    Sikora, W; Chodura, J; Siwiec, J

    1983-01-01

    An analysis is presented of the effect of the design parameters of the operational element on the output of the large class on the basis of theoretical calculations of the granulometric composition of the coal extracted by the cutter loaders. The effect of the physical and mechanical properties of the coal being extracted is also taken into consideration. The results of the conducted calculations are cited in a graph.

  9. Water Extraction from Coal-Fired Power Plant Flue Gas

    Energy Technology Data Exchange (ETDEWEB)

    Bruce C. Folkedahl; Greg F. Weber; Michael E. Collings

    2006-06-30

    The overall objective of this program was to develop a liquid disiccant-based flue gas dehydration process technology to reduce water consumption in coal-fired power plants. The specific objective of the program was to generate sufficient subscale test data and conceptual commercial power plant evaluations to assess process feasibility and merits for commercialization. Currently, coal-fired power plants require access to water sources outside the power plant for several aspects of their operation in addition to steam cycle condensation and process cooling needs. At the present time, there is no practiced method of extracting the usually abundant water found in the power plant stack gas. This project demonstrated the feasibility and merits of a liquid desiccant-based process that can efficiently and economically remove water vapor from the flue gas of fossil fuel-fired power plants to be recycled for in-plant use or exported for clean water conservation. After an extensive literature review, a survey of the available physical and chemical property information on desiccants in conjunction with a weighting scheme developed for this application, three desiccants were selected and tested in a bench-scale system at the Energy and Environmental Research Center (EERC). System performance at the bench scale aided in determining which desiccant was best suited for further evaluation. The results of the bench-scale tests along with further review of the available property data for each of the desiccants resulted in the selection of calcium chloride as the desiccant for testing at the pilot-scale level. Two weeks of testing utilizing natural gas in Test Series I and coal in Test Series II for production of flue gas was conducted with the liquid desiccant dehumidification system (LDDS) designed and built for this study. In general, it was found that the LDDS operated well and could be placed in an automode in which the process would operate with no operator intervention or

  10. Analysis of small molecular phase in coal involved in pyrolysis and solvent extraction by PGC

    Energy Technology Data Exchange (ETDEWEB)

    Jie Feng; Wen-Ying Li; Ke-Chang Xie [Taiyuan University of Technology, Taiyuan (China). Key Laboratory of Coal Science and Technology

    2004-06-01

    The small molecular phase, which strongly affects coal's reactivity, is the main part of the structure unit in coal. At present, its composition and structure features have not been clearly understood. In this paper, a flash pyrolysis technique with on-line GC (PGC) was used to investigate the properties of the small molecular phase from six kinds of rank coal in China. Experiments were divided into two parts: one is PGC of parent coal; another is PGC of coal extracts from NMP + CS{sub 2} (75:1) solvent extraction at 373 K. Results show that the small molecular phase mainly consists of C12-C16 compounds that could be integrally released when the heating rate was greater than 10 K/ms and the final pyrolysis temperature was 1373 K; other compounds may be the products of decomposition and polymerization from this small molecular phase during pyrolysis. 13 refs., 7 figs., 1 tab.

  11. Total flavonoids content in the raw material and aqueous extractives from Bauhinia monandra Kurz (Caesalpiniaceae).

    Science.gov (United States)

    Fernandes, Ana Josane Dantas; Ferreira, Magda Rhayanny Assunção; Randau, Karina Perrelli; de Souza, Tatiane Pereira; Soares, Luiz Alberto Lira

    2012-01-01

    The aim of this work was to evaluate the spectrophotometric methodology for determining the total flavonoid content (TFC) in herbal drug and derived products from Bauhinia monandra Kurz. Several analytical parameters from this method grounded on the complex formed between flavonoids and AlCl₃ were evaluated such as herbal amount (0.25 to 1.25 g); solvent composition (ethanol 40 to 80%, v/v); as well as the reaction time and AlCl₃ concentration (2 to 9%, w/v). The method was adjusted to aqueous extractives and its performance studied through precision, linearity and preliminary robustness. The results showed an important dependence of the method response from reaction time, AlCl₃ concentration, sample amount, and solvent mixture. After choosing the optimized condition, the method was applied for the matrixes (herbal material and extractives), showing precision lower than 5% (for both parameters repeatability and intermediate precision), coefficient of determination higher than 0.99, and no important influence could be observed for slight variations from wavelength or AlCl₃ concentration. Thus, it could be concluded that the evaluated analytical procedure was suitable to quantify the total flavonoid content in raw material and aqueous extractives from leaves of B. monandra.

  12. Total Flavonoids Content in the Raw Material and Aqueous Extractives from Bauhinia monandra Kurz (Caesalpiniaceae

    Directory of Open Access Journals (Sweden)

    Ana Josane Dantas Fernandes

    2012-01-01

    Full Text Available The aim of this work was to evaluate the spectrophotometric methodology for determining the total flavonoid content (TFC in herbal drug and derived products from Bauhinia monandra Kurz. Several analytical parameters from this method grounded on the complex formed between flavonoids and AlCl3 were evaluated such as herbal amount (0.25 to 1.25 g; solvent composition (ethanol 40 to 80%, v/v; as well as the reaction time and AlCl3 concentration (2 to 9%, w/v. The method was adjusted to aqueous extractives and its performance studied through precision, linearity and preliminary robustness. The results showed an important dependence of the method response from reaction time, AlCl3 concentration, sample amount, and solvent mixture. After choosing the optimized condition, the method was applied for the matrixes (herbal material and extractives, showing precision lower than 5% (for both parameters repeatability and intermediate precision, coefficient of determination higher than 0.99, and no important influence could be observed for slight variations from wavelength or AlCl3 concentration. Thus, it could be concluded that the evaluated analytical procedure was suitable to quantify the total flavonoid content in raw material and aqueous extractives from leaves of B. monandra.

  13. Analysis of solvent extracts from coal liquefaction in a flowing solvent reactor

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wen-Ying; Feng, Jie; Xie, Ke-Chang [Key Laboratory of Coal Science and Technology, Taiyuan University of Technology, Ministry of Education and Shanxi Province, No. 79 Yingze West Street, Taiyuan 030024 (China); Kandiyoti, R. [Department of Chemical Engineering and Chemical Technology, Imperial College, University of London, London SW7 2BY (United Kingdom)

    2004-10-15

    Point of Ayr coal has been extracted using three solvents, tetralin, quinoline and 1-methyl-2-pyrrolidinone (NMP) at two temperatures 350 and 450 C, corresponding approximately to before and after the onset of massive covalent bond scission by pyrolysis. The three solvents differ in solvent power and the ability to donate hydrogen atoms to stabilise free radicals produced by pyrolysis of the coal. The extracts were prepared in a flowing solvent reactor to minimise secondary thermal degradation of the primary extracts. Analysis of the pentane-insoluble fractions of the extracts was achieved by size exclusion chromatography, UV-fluorescence spectroscopy in NMP solvent and probe mass. With increasing extraction temperature, the ratio of the amount having big molecular weight to that having small molecular weight in tetralin extracts was increased; the tetralin extract yield increased from 12.8% to 75.9%; in quinoline, increasing extraction temperature did not have an effect on the molecular weight of products but there was a big increase in extract yield. The extracts in NMP showed the enhanced solvent extraction power at both temperatures, with a shift in the ratio of larger molecules to smaller molecules with increasing extraction temperature and with the highest conversion of Point of Ayr coal among these three solvents at both temperatures. Solvent adducts were detected in the tetralin and quinoline extracts by probe mass spectrometry; solvent products were formed from NMP at both temperatures.

  14. Investigation of Inonotus obliquus (Pers. Pil. Extracts and Melanins after RF-plasma Treatment of Raw Material

    Directory of Open Access Journals (Sweden)

    O.Yu. Kuznetsova

    2016-03-01

    Full Text Available High-frequency capacitive discharge (RF plasma at low pressure was used as preliminary stage for the intensification of extraction from natural medicinal raw material. RF-plasma treatment was carried out in two modes differed by the nature of plasma-forming gas. Chaga (Inonotus obliquus (Pers. Pil. known as the birch mushroom was selected as a perspective source of raw material. Extraction was carried out in two ways – remaceration and maceration. The analy-sis of chaga extracts and melanins was performed using traditional techniques including determination of physical and chemical, antioxidant and spectral characteristics. The obtained extracts and melanins were compared to the control samples and literature data. RF-plasma treatment of medicinal raw material increased the yield of extractive substances, in particular of the main active component of chaga – melanin. The antioxidant activity of chaga extracts grew, while for melanins it remained at the level similar to that of control samples. The IR spectral characteristics of the studied chaga melanins are similar and agree well with the literature data. Insignificant deviations in the position and intensity of absorption strips were observed for the samples after RF treatment. IR spectra of the studied chaga melanins are similar to those for mushroom melanins, thereby confirming the similarity in their nature. RF-plasma treatment of chaga medicinal raw materials allows to modify them partially. The structural and mechanical properties of melanins modified by RF plasma remain the same.

  15. Phytotoxicity assessment of a methanolic coal dust extract in Lemna minor.

    Science.gov (United States)

    Coronado-Posada, Nadia; Cabarcas-Montalvo, Maria; Olivero-Verbel, Jesus

    2013-09-01

    Coal mining generates negative effects on environment, human health, hydrodynamics of mining areas and biodiversity. However, the impacts of this activity are less known in plants. Lemna minor is one of the most commonly used plants in aquatic toxicity tests due to its ubiquitous distribution in ponds and lakes, culture conditions and the free-floating habitat that exposes it to hydrophobic as well as dissolved compounds. The goal of this research was to evaluate the effects of a methanolic coal dust extract on L. minor. Macrophytes were exposed to six different concentrations of coal extract (from 7.81 to 250 mg/L) for 5 days, following the OECD test guideline 221. The coal extract had a half inhibitory concentration (IC50) of 99.66 (184.95-54.59) mg/L for the number of fronds. Several signs of toxicity such as chlorosis, reduction in the size of the fronds, abscission of fronds and roots, and the presence of necrotic tissues were observed at concentrations lower than the IC50. Preliminary Gas Chromatography-Mass Spectrometry analysis of the coal dust extract revealed the presence of several compounds, including, among others, alkanes, carboxylic acids and polycyclic aromatic hydrocarbons (PAHs), these lasts, may be responsible for some of the observed effects. These results demonstrated that coal dust has phytotoxic effects and should not be considered as an inert material. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Renal Cell Toxicity of Water-Soluble Coal Extracts from the Gulf Coast

    Science.gov (United States)

    Ojeda, A. S.; Ford, S.; Ihnat, M.; Gallucci, R. M.; Philp, P. R.

    2017-12-01

    In the Gulf Coast, many rural residents rely on private well water for drinking, cooking, and other domestic needs. A large portion of this region contains lignite coal deposits within shallow aquifers that potentially leach organic matter into the water supply. It is proposed that the organic matter leached from low-rank coal deposits contributes to the development of kidney disease, however, little work has been done to investigate the toxicity of coal extracts. In this study, human kidney cells (HK-2) were exposed to water-soluble extracts of Gulf Coast Coals to assess toxicity. Cell viability was measured by direct counts of total and necrotic cells. A dose-response curve was used to generate IC50 values, and the extracts showed significant toxicity that ranged from 0.5% w/v to 3% w/v IC50. The most toxic extract was from Louisiana where coal-derived organic material has been previously linked to high incidents of renal pelvic cancer (RPC). Although the toxic threshold measured in this study is significantly higher than the concentration of organic matter in the groundwater, typically affected areas may consume contaminated water over a lifetime. It is possible that the cumulative toxic effects of coal-derived material contribute to the development of disease.

  17. Effects of garlic extract on color, lipid oxidation and oxidative breakdown products in raw ground beef during refrigerated storage

    Directory of Open Access Journals (Sweden)

    XINZHUANG ZHANG

    2016-03-01

    Full Text Available The study aims to investigate the effects of garlic extracts on color, lipid oxidation, and oxidative breakdown products in raw ground beef during refrigerated storage. The two treatments were:control group (C, with no addition and experiment group (D, 50 mg garlic extracts added to 100 g beef. Adding garlic extracts significant increased a* value (PA ≤ 0.05, and significant decreased TBARS and PV values (PA ≤ 0.05. The pH and –SH value of D group had a decreasing tendency (PA=0.0522 and an increasing tendency (PA=0.0636 respectively compared to C group. Garlic extracts protected phospholipids, fatty acids and polypeptides from oxidation. The results indicatethat garlic extracts have the antioxidant activity, helping maintain the meat color, inhibiting lipid oxidation and protein degradation of raw ground beef during refrigerated storage.

  18. Method for quantifying the uncertainty with the extraction of the raw data of a gamma ray spectrum by deconvolution software

    International Nuclear Information System (INIS)

    Vigineix, Thomas; Guillot, Nicolas; Saurel, Nicolas

    2013-06-01

    Gamma ray spectrometry is a passive non destructive assay most commonly used to identify and quantify the radionuclides present in complex huge objects such as nuclear waste packages. The treatment of spectra from the measurement of nuclear waste is done in two steps: the first step is to extract the raw data from the spectra (energies and the net photoelectric absorption peaks area) and the second step is to determine the detection efficiency of the measuring scene. Commercial software use different methods to extract the raw data spectrum but none are optimal in the treatment of spectra containing actinides. Spectra should be handled individually and requires settings and an important feedback part from the operator, which prevents the automatic process of spectrum and increases the risk of human error. In this context the Nuclear Measurement and Valuation Laboratory (LMNE) in the Atomic Energy Commission Valduc (CEA Valduc) has developed a new methodology for quantifying the uncertainty associated with the extraction of the raw data over spectrum. This methodology was applied with raw data and commercial software that need configuration by the operator (GENIE2000, Interwinner...). This robust and fully automated methodology of uncertainties calculation is performed on the entire process of the software. The methodology ensures for all peaks processed by the deconvolution software an extraction of energy peaks closed to 2 channels and an extraction of net areas with an uncertainty less than 5 percents. The methodology was tested experimentally with actinides spectrum. (authors)

  19. Bubble feature extracting based on image processing of coal flotation froth

    Energy Technology Data Exchange (ETDEWEB)

    Wang, F.; Wang, Y.; Lu, M.; Liu, W. [China University of Mining and Technology, Beijing (China). Dept of Chemical Engineering and Environment

    2001-11-01

    Using image processing the contrast ratio between the bubble on the surface of flotation froth and the image background was enhanced, and the edges of bubble were extracted. Thus a model about the relation between the statistic feature of the bubbles in the image and the cleaned coal can be established. It is feasible to extract the bubble by processing the froth image of coal flotation on the basis of analysing the shape of the bubble. By means of processing the 51 group images sampled from laboratory column, it is thought that the use of the histogram equalization of image gradation and the medium filtering can obviously improve the dynamic contrast range and the brightness of bubbles. Finally, the method of threshold value cut and the bubble edge detecting for extracting the bubble were also discussed to describe the bubble feature, such as size and shape, in the froth image and to distinguish the froth image of coal flotation. 6 refs., 3 figs.

  20. Coal

    International Nuclear Information System (INIS)

    Teissie, J.; Bourgogne, D. de; Bautin, F.

    2001-12-01

    Coal world production represents 3.5 billions of tons, plus 900 millions of tons of lignite. 50% of coal is used for power generation, 16% by steel making industry, 5% by cement plants, and 29% for space heating and by other industries like carbo-chemistry. Coal reserves are enormous, about 1000 billions of tons (i.e. 250 years of consumption with the present day rate) but their exploitation will be in competition with less costly and less polluting energy sources. This documents treats of all aspects of coal: origin, composition, calorific value, classification, resources, reserves, production, international trade, sectoral consumption, cost, retail price, safety aspects of coal mining, environmental impacts (solid and gaseous effluents), different technologies of coal-fired power plants and their relative efficiency, alternative solutions for the recovery of coal energy (fuel cells, liquefaction). (J.S.)

  1. IR and NMR characterisation of extraction products of radioactively deuteromethylated coals

    Energy Technology Data Exchange (ETDEWEB)

    Kozlowski, M.; Wachowska, H.; Adriaensens, P.; Gelan, J. [Adam Mickiewicz University, Poznan (Poland). Faculty of Chemistry

    1999-12-01

    Products of reductive methylation and deuteromethylation of two Polish coals of different rank performed in the potassium/liquid ammonia system were subjected to extraction by dichloromethane. Spectral analysis of the extracts was made. A comparison of {sup 1}H and {sup 2}H NMR spectra indicated that the cleavage of C-C bonds in methylene bridges is of substantial importance for the fragmentation of the coal structure taking place under the effect of potassium in liquid ammonia. This finding was confirmed by results of IR analysis. 25 refs., 3 figs., 2 tabs.

  2. Recovery of gallium from coal fly ash by a dual reactive extraction process

    Energy Technology Data Exchange (ETDEWEB)

    Gutierrez, B.; Pazos, C.; Coca, J. [University of Oviedo, Oviedo (Spain). Dept. of Chemical Engineering and Environmental Technology

    1997-08-01

    This paper describes the extraction of gallium from coal fly ash by leaching and extraction with commercial extractants Amerlite LA-2 and LIX-54N dissolved in kerosene. Leaching of gallium and other metals from the fly ash was carried out with 6 M hydrochloric acid. The leaching liquor is first contacted with Amerlite LA-2 which extracts the gallium and iron. The iron is then precipitated with sodium hydroxide, while gallium remains in solution. Gallium is extracted selectively from the base solution with LIX 54; the resulting stripped solution contains 83% of the gallium present in the leaching liquor.

  3. Elemental characterization of coal ash and its leachates using sequential extraction techniques

    International Nuclear Information System (INIS)

    Landsberger, S.; Cerbus, J.F.; Larson, S.

    1995-01-01

    Over 50 million tons of coal ash are produced annually in North America. Technological improvements in air pollution control have decreased stack emissions but have also increased contaminant concentrations in the ash of coal-fired boiler applications. The leaching of heavy metals and other elements during regulatory tests may cause coal ash to be classified as hazardous waste, complicating land disposal. The hazardous nature of coal ash remains unclear because current toxicity tests fail to effectively characterize the elemental distribution and chemical solubility of trace metals in the landfill environment. Leaching characteristics of ash samples can be investigated with various laboratory extraction procedures in association with multi-elemental analytical techniques (e.g., neutron activation analysis and inductively coupled plasma - atomic emission spectroscopy). Such methods provide more thorough analyses of coal ash leaching dynamics than the regulatory assessments can demonstrate. Regulatory elements including Ag, As, Ba, Cd, Cr, Hg, Pb, and Se were shown to remain in largely insoluble forms while elements such as B and S leached at higher levels. Experimental results may assist operators of coal-fired boiler industries in selecting coal types and disposal options to curtail the leaching of potentially toxic inorganic contaminants. (author) 12 refs.; 4 figs.; 3 tabs

  4. Control of the extraction, transport and quality of coal in sections in actual time intervals

    Energy Technology Data Exchange (ETDEWEB)

    Prochazka, P; Sladek, J

    1981-01-01

    This paper describes the design of a system for the automatic, semiautomatic and manual control of the extraction, transport and quality of the coal in two sections of the Severo-Cheshsk brown coal basin using computers. The coal in these sections is transported along a joint transport main line which consists of three conveyor lines to two grinding works and from there to 3 thermoelectric power plants. Based on information about the coal quality in the mining sections of individual excavators, about their productivity and about the throughput of the conveyor lines, the computer determines in a quite short time the maximally possible throughput of the conveyor lines for ensuring the required coal quality. Programs are written in the ALGOL language. The information in the SM-3 computer from the excavators will be transmitted using a Tesla Radom wireless communications apparatus through a JPR-12 computer. A terminal will be mounted on each excavator which will report to the computer the number of ledges subject to mining, the type of coal in them, the distance of the excavator from the coal loading point and the size of required and actual productivity of the excavator.

  5. High temperature solvent extraction of oil shale and bituminous coal using binary solvent mixtures

    Energy Technology Data Exchange (ETDEWEB)

    Goetz, G.K.E. [Lehrstuhl fuer Geologie, Geochemie und Lagerstaetten des Erdoels und der Kohle, RWTH Aachen (Germany)

    1997-12-31

    A high volatile bituminous coal from the Saar Basin and an oil shale from the Messel deposit, both Germany, were extracted with binary solvent mixtures using the Advanced Solvent Extraction method (ASE). Extraction temperature and pressure were kept at 100 C, respectively 150 C, and 20,7 MPa. After the heating phase (5 min) static extractions were performed with mixtures (v:v, 1:3) of methanol with toluene, respectively trichloromethane, for further 5 min. Extract yields were the same or on a higher level compared to those from classical soxhlet extractions (3 days) using the same solvents at 60 C. Comparing the results from ASE with those from supercritical fluid extraction (SFE) the extract yields were similar. Increasing the temperature in ASE releases more soluble organic matter from geological samples, because compounds with higher molecular weight and especially more polar substances were solubilized. But also an enhanced extraction efficiency resulted for aliphatic and aromatic hydrocarbons which are used as biomarkers in Organic Geochemistry. Application of thermochemolysis with tetraethylammonium hydroxide (TEAH) using pyrolysis-gas chromatography-mass spectrometry (Py-GC-MS) on the extraction residues shows clearly that at higher extraction temperatures minor amounts of free fatty acids or their methyl esters (original or produced by ASE) were trapped inside the pore systems of the oil shale or the bituminous coal. ASE offers a rapid and very efficient extraction method for geological samples reducing analysis time and costs for solvents. (orig.)

  6. Mass Transfer Coefficientin Stirred Tank for p -Cresol Extraction Process from Coal Tar

    International Nuclear Information System (INIS)

    Fardhyanti, D S; Tyaningsih, D S; Afifah, S N

    2017-01-01

    Indonesia is a country that has a lot of coal resources. The Indonesian coal has a low caloric value. Pyrolysis is one of the process to increase the caloric value. One of the by-product of the pyrolysis process is coal tar. It contains a lot of aliphatic or aromatic compounds such as p -cresol (11% v/v). It is widely used as a disinfectant. Extractionof p -Cresol increases the economic value of waste of coal. The aim of this research isto study about mass tranfer coefficient in the baffled stirred tank for p -Cresolextraction from coal tar. Mass transfer coefficient is useful for design and scale up of industrial equipment. Extraction is conducted in the baffled stirred tank equipped with a four-bladed axial impeller placed vertically in the vessel. Sample for each time processing (5, 10, 15, 20, 25 and 30minutes) was poured into a separating funnel, settled for an hour and separated into two phases. Then the two phases were weighed. The extract phases and raffinate phases were analyzed by Spectronic UV-Vis. The result showed that mixing speed of p -Cresol extraction increasesthe yield of p -Cresol and the mass transfer coefficient. The highest yield of p -Cresol is 49.32% and the highest mass transfer coefficient is 4.757 x 10 -6 kg/m 2 s. (paper)

  7. Mass Transfer Coefficientin Stirred Tank for p-Cresol Extraction Process from Coal Tar

    Science.gov (United States)

    Fardhyanti, D. S.; Tyaningsih, D. S.; Afifah, S. N.

    2017-04-01

    Indonesia is a country that has a lot of coal resources. The Indonesian coal has a low caloric value. Pyrolysis is one of the process to increase the caloric value. One of the by-product of the pyrolysis process is coal tar. It contains a lot of aliphatic or aromatic compounds such asp-cresol (11% v/v). It is widely used as a disinfectant. Extractionof p-Cresol increases the economic value of waste of coal. The aim of this research isto study about mass tranfer coefficient in the baffled stirred tank for p-Cresolextraction from coal tar. Mass transfer coefficient is useful for design and scale up of industrial equipment. Extraction is conducted inthe baffled stirred tank equipped with a four-bladed axial impeller placed vertically in the vessel. Sample for each time processing (5, 10, 15, 20, 25 and 30minutes) was poured into a separating funnel, settled for an hour and separated into two phases. Then the two phases were weighed. The extract phases and raffinate phases were analyzed by Spectronic UV-Vis. The result showed that mixing speed of p-Cresol extraction increasesthe yield of p-Cresol and the mass transfer coefficient. The highest yield of p-Cresol is 49.32% and the highest mass transfer coefficient is 4.757 x 10-6kg/m2s.

  8. Macroscopic observation of thermal behavior of concentrated solution of coal extracts

    Energy Technology Data Exchange (ETDEWEB)

    Masao Suzuki; Koyo Norinaga; Masashi Iino [Tohoku University, Sendai (Japan). Institute of Multidisciplinary Research for Advanced Materials

    2004-11-01

    The solvent extracts of Upper Freeport and Illinois No.6 coals were mixed with N-methyl-2-pyrolidinone (NMP) and annealed at 353 K to produce the gelatinous materials. Differential scanning calorimetric measurements revealed that the materials can hold significant amounts of nonfreezable NMP (as much as 3 g NMP per 1 g coal extracts) which disperse in the materials on a molecular scale, indicating the materials are not phase separated. The thermal behaviors were measured macroscopically as a function of the extract concentration using a needle penetrometer during heating from 223 to 360 K. The penetration-temperature curves were analyzed to estimate the apparent viscosity ({eta}{sub a}). During the penetrations, {eta}{sub a} was decreased very rapidly, approximately four orders of the magnitude by a temperature increase of 20 K, suggesting that the coal extracts-NMP mixtures undergoes a gel to sol transition. The heats of dissociation of crosslinks ({Delta}H{sub m}) were estimated by applying Eldridge-Ferry equation. The {Delta}H{sub m} of coal extracts-NMP mixtures was relatively small, i.e. approximately 10 kJ/mol, whereas the ?Hm of polyvinyl alcohol-NMP gel in which the hydrogen bonds contribute the formation of the physical network structures, was about 65 kJ/mol. Not the specific interaction such as hydrogen bonds, but weak interactions such as van der Waals force were likely to contribute the formation of the coal extracts-NMP gel. 28 refs., 7 figs., 2 tabs.

  9. Comparison of the associative structure of two different types of rich coals and their coking properties

    Energy Technology Data Exchange (ETDEWEB)

    Hengfu Shui; Changhui Lin; Meng Zhang; Zhicai Wang; Mingdong Zheng [Anhui University of Technology, Maanshan (China). School of Chemistry and Chemical Engineering

    2010-07-15

    Solvent extractions of two different types of Chinese rich coals i.e. Aiweiergou coal (AG) and Zaozhuang coal (ZZ) using the mixed solvent of carbon disulfide/N-methyl-2-pyrrolidinone (CS{sub 2}/NMP) with different mixing ratios were carried out and the caking indexes of the extracted residues were measured. It was found that the extracted residues from the two types of coals showed different changing tendencies of the caking indexes with the extraction yield. When the extraction yield attained about 50% for ZZ coal, the extracted residue had no caking property. However for AG coal, when the extraction yield reached the maximum of 63.5%, the corresponding extracted residue still had considerable caking property with the caking index of 25. This difference indicated the different associative structure of the two coals although they are of the same coalification. Hydro-thermal treatment of the two rich coals gave different extract fractionation distributions for the treated coals compared to those of raw coals respectively. The coking property evaluations of the two coals and their hydro-thermally treated ones were carried out in a crucible coking determination. The results showed that the hydro-thermal treatment could greatly improve the micro-strengths of the resulting coke from the two coals, and the improvement was more significant for the more aggregated AG coal. The reactivities of hydro-thermally treated AG coal blends were almost the same as those of raw coal blends. The higher coke reactivities of AG raw coal and its hydro-thermally treated ones than those of ZZ coal might be attributed to its special ash composition. 20 refs.,4 figs., 5 tabs.

  10. The anti-inflammatory effect of Sonchus oleraceus aqueous extract on lipopolysaccharide stimulated RAW 264.7 cells and mice.

    Science.gov (United States)

    Li, Qi; Dong, Dan-Dan; Huang, Qiu-Ping; Li, Jing; Du, Yong-Yong; Li, Bin; Li, Huan-Qing; Huyan, Ting

    2017-12-01

    Sonchus oleraceus L. (Asteraceae) (SO) is a dietary and traditional medicinal plant in China. However, its underlying mechanism of action as an anti-inflammatory agent is not known. This study evaluates the anti-inflammatory activity of aqueous extract of SO. The extract of SO was used to treat RAW 264.7 cells (in the working concentrations of 500, 250, 125, 62.5, 31.3 and 15.6 μg/mL) for 24 h. Pro-inflammatory cytokines and mediators produced in LPS-stimulated RAW 264.7 cells were assessed. Meanwhile, the expression level of TLR-4, COX-2, pSTATs and NF-κB was tested. Moreover, the anti-inflammatory activity of the extract in vivo was assessed using xylene-induced mouse ear oedema model and the anti-inflammatory compounds in the extracts were analyzed by HPLC-MS. SO extract significantly inhibited the production of pro-inflammatory cytokines and mediators at gene and protein levels with the concentration of 31.3 μg/mL, and suppressed the expression of TLR-4, COX-2, NF-κB and pSTAT in RAW 264.7 cells. The anti-inflammatory activity of SO in vivo has significant anti-inflammatory effects with the concentration of 250 and 125 mg/kg, and less side effect on the weights of the mice at the concentration of 250 mg/kg. Moreover, HPLC-MS analysis revealed that the anti-inflammatory compounds in the extract were identified as villosol, ferulaic acid, β-sitosterol, ursolic acid and rutin. This study indicated that SO extract has anti-inflammatory effects in vitro and in vivo, which will be further developed as novel pharmacological strategies in order to defeat inflammatory diseases.

  11. Chemical kinetics and transport processes in supercritical fluid extraction of coal. Final report, August 10, 1990--December 30, 1992

    Energy Technology Data Exchange (ETDEWEB)

    McCoy, B.J.; Smith, J.M.; Wang, M.; Zhang, C.J.

    1993-02-01

    The overall objective of this project was to study the supercritical fluid extraction of hydrocarbons from coal. Beyond the practical concern of deriving products from coal, the research has provided insights into the structure, properties, and reactivities of coal. Information on engineering fundamentals of coal thermolysis and extraction, including physical and chemical processes, is presented in this final report. To accomplish the goals of the project we developed continuous-flow experiments for fixed-bed samples of coal that allow two types of analysis of the extract: continuous spectrophotometric absorbance measurements of the lumped concentration of extract, and chromatographic determinations of molecular-weight distributions as a function of time. Thermolysis of coal yields a complex mixture of many extract products whose molecular-weight distribution (MWD) varies with time for continuous-flow, semibatch experiments. The flow reactor with a differential, fixed bed of coal particles contacted by supercritical t-butanol was employed to provide dynamic MWD data by means of HPLC gel permeation chromatography of the extract. The experimental results, time-dependent MWDs of extract molecules, were interpreted by a novel mathematical model based on continuous-mixture kinetics for thermal cleavage of chemical bonds in the coal network. The parameters for the MWDs of extractable groups in the coal and the rate constants for one- and two-fragment reaction are determined from the experimental data. The significant effect of temperature on the kinetics of the extraction was explained in terms of one- and two-fragment reactions in the coal.

  12. use of water extract of moringa oleifera seeds (wemos) in raw water

    African Journals Online (AJOL)

    user

    Availability of clean water is a serious problem, especially in developing ... J. C. Agunwamba, Department of Civil Engineering, University of Nigeria, Nsukka, .... Technical. Feasibility of the Treatment of Domestic. Waste and Raw Water.

  13. Optimizing Conditions for Ultrasound Extraction of Fullerenes from Coal Matrices

    Czech Academy of Sciences Publication Activity Database

    Vítek, P.; Jehlička, J.; Frank, Otakar; Hamplová, Věra; Pokorná, Zdeňka; Juha, Libor; Boháček, J.

    2009-01-01

    Roč. 17, č. 2 (2009), s. 109-122 ISSN 1536-383X R&D Projects: GA ČR GA205/07/0772; GA ČR GA205/03/1468 Institutional research plan: CEZ:AV0Z40400503; CEZ:AV0Z10100520 Keywords : fullerene C60 * Ultrasound -assisted extraction * Extraction yield * Fullerene decomposition Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 0.710, year: 2009

  14. Swelling behavior of several bituminous coals and their thermally treated coals

    Energy Technology Data Exchange (ETDEWEB)

    Shui, Heng-fu; Cao, Mei-xia; Wang, Zhi-cai [Anhui University of Technology, Maanshan (China). School of Chemistry & Chemical Engineering

    2007-07-01

    The swelling behavior in different solvents of 4 bituminous coals with different ranks and their residues from extraction by CS{sub 2}/NMP mixed solvent (l:1 in volume) were measured. The change in swelling property of the four coals thermally treated at different temperature was observed. The results show that the swelling ratio decreases with increasing rank of coal. For lower rank bituminous coals the swelling ratios in polar solvent are higher than those in non-polar solvent, and this difference decreases with increasing rank. The cross-linking densities of the four residues decrease, and the swelling ratios increase compared with those of raw coals. The swelling ratios of the four thermally treated coals under 150{sup o}C in CS{sub 2} increase, suggesting the decrease in crosslinking density of them. When the thermal treatment temperature increases to 240{sup o}C, the swelling rations of the other three coals in NMP and CS{sub 2} increase again except gas coal, demonstrating the further decrease in crosslinking density. This result is coincident with the extraction yield change in the mixed solvent of the thermally treated coal. For example, the extraction yield of lean coal treated at 240{sup o}C increases from 6.9% to 17.3%. FT-IR results show the removal of oxygen group of the thermally treated coals. This may explain the increase in swelling ratio and extraction yield in the mixed solvent of coal after thermal treatment. The cross-linking density of the thermally treated coal decreases because of the break of hydrogen bonds due to removal of C = 0 and -OH oxygen groups during the thermal treatment, resulting in the increases of swelling ratio and extraction yield in the mixed solvent of thermally treated coal compared with those of raw coal. 15 refs., 3 figs., 6 tabs.

  15. Evaluation of pitches and cokes from solvent-extracted coal materials

    Energy Technology Data Exchange (ETDEWEB)

    McHenry, E.R.

    1996-12-01

    Three initial coal-extracted (C-E) samples were received from the West Virginia University (WVU) Chemical Engineering Department. Two samples had been hydrogenated to obtain pitches that satisfy Theological requirements. One of the hydrogenated (HC-E) samples had been extracted by toluene to remove ash and higher molecular weight aromatic compounds. We were unable to measure the softening point and viscosity of the non-hydro treated solid extract sample, Positive characteristics in the HC-E materials were softening points of 113-119{degrees}C, low sulfur and ash. The oxygen and nitrogen content of the HC-E samples may limit future usage in premium carbon and graphite products. Coking values were similar to petroleum pitches. Laboratory anode testing indicates that in combination with standard coal-tar pitch, the HC-E material can be used as a binder pitch.

  16. Effect of coal mine dust and clay extracts on the biological activity of the quartz surface

    Energy Technology Data Exchange (ETDEWEB)

    Stone, V.; Jones, R.; Rollo, K.; Duffin, R.; Donaldson, K.; Brown, D.M. [Napier University, Edinburgh (United Kingdom). School of Life Science

    2004-04-01

    Modification of the quartz surface by aluminum salts and metallic iron have been shown to reduce the biological activity of quartz. This study aimed to investigate the ability of water soluble extracts of coal mine dust (CMD), low aluminum clays (hectorite and montmorillonite) and high aluminum clays (attapulgite and kaolin) to inhibit the reactivity of the quartz surface. DQ12 induced significant haemolysis of sheep erythrocytes in vitro and inflammation in vivo as indicated by increases in the total cell numbers, neutrophil cell numbers, MIP-2 protein and albumin content of bronchoalveolar lavage (BAL) fluid. Treatment of DQ12 with CMD extract prevented both haemolysis and inflammation. Extracts of the high aluminum clays (kaolin and attapulgite) prevented inhibition of DQ12 induced haemolysis, and the kaolin extract inhibited quartz driven inflammation. DQ12 induced haemolysis by coal mine dust and kaolin extract could be prevented by pre-treatment of the extracts with a cation chellator. Extracts of the low aluminum clays (montmorillonite and hectorite) did not prevent DQ12 induced haemolysis, although the hectorite extract did prevent inflammation. These results suggest that CMD, and clays both low and rich in aluminum, all contain soluble components (possibly cations) capable of masking the reactivity of the quartz surface.

  17. Stimulation of nitric oxide synthesis by the aqueous extract of Panax ginseng root in RAW 264.7 cells.

    Science.gov (United States)

    Friedl, R; Moeslinger, T; Kopp, B; Spieckermann, P G

    2001-12-01

    1. In this study, we investigated the effect of Panax ginseng root aqueous extracts upon inducible nitric oxide synthesis in RAW 264.7 cells. Panax ginseng root extract has been used in the Asian world for centuries as a traditional herb to enhance physical strength and resistance and is becoming more and more popular in Europe and North America. 2. Incubation of murine macrophages (RAW 264.7 cells) with increasing amounts of aqueous extracts of Panax ginseng (0.05 - 0.8 microg microl(-1)) showed a dose dependent stimulation of inducible nitric oxide synthesis. 3. Polysaccharides isolated from Panax ginseng showed strong stimulation of inducible nitric oxide synthesis, whereas a triterpene-enriched fraction from an aqueous extract of Panax ginseng did not show any stimulation. 4. Inducible nitric oxide synthase protein expression was enhanced in a dose dependent manner as revealed by immunoblotting when cells were incubated with increasing amounts of Panax ginseng extract. This was associated with an incline in inducible nitric oxide synthase mRNA-levels as determined by semiquantitative polymerase chain reaction and electromobility shift assay studies indicated enhanced nuclear factor-kappaB DNA binding activity. 5. As nitric oxide plays an important role in immune function, Panax ginseng treatment could modulate several aspects of host defense mechanisms due to stimulation of the inducible nitric oxide synthase.

  18. Investigations on extraction separation of noble metals from secondary raw materials by means of tracer technique application

    International Nuclear Information System (INIS)

    Urban'ski, T.S.; Migdal, V.; Lada, V.

    1979-01-01

    In laboratory scale equilibrium and kinetics of the liquid extraction of gold, platinum and palladium from chloride and nitrate-chloride solutions were investigated. Experiments were done using model solutions and solutions, obtained in processing of secondary raw materials, for example: solutions in aqua regia of anode slurries after electrical refining of silver and jewelry wastes, as well as solutions after extraction of silver from nitrate mwdia. In investigations for determination of the extraction factor, the radioisotope indicators method have been used. Gold-198, platinum-197, palladium-109, silver-110 m and copper-64 were used. Radioisotope platinum-197 was refined from gold-199 on the ionite Dauex 50VX2 in the medium of hydrobromic acid. Gold was extracted by neutral extraction agents such as tributilphosphate; methylizobutylketone; amylacetate; amil alcohol; 2-ethylhexanol and dibutylcarbitol. In details extraction of palladium and platinum by tri-n-actylamine in different diluents with additions of modifiers, as well as their extraction by aliquat 336 in benzene and by some petroleum products. Influence was determined of the time of phases contact, of application of diluents, influence of extracting agents concentrations on the magnitude of extraction factor and on the separation factor for investigated metals [ru

  19. DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS

    Energy Technology Data Exchange (ETDEWEB)

    Dady B. Dadyburjor; Mark E. Heavner; Manoj Katakdaunde; Liviu Magean; J. Joshua Maybury; Alfred H. Stiller; Joseph M. Stoffa; John W. Zondlo

    2006-08-01

    The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. The largest applications are those which support metals smelting, such as anodes for aluminum smelting and electrodes for arc furnaces. Other carbon products include materials used in creating fuels for the Direct Carbon Fuel Cell, and porous carbon structural material referred to as ''carbon foam'' and carbon fibers. During this reporting period, hydrotreatment of solvent was completed in preparation for pitch fabrication for graphite electrodes. Coal digestion has lagged but is expected to be complete by next quarter. Studies are reported on coal dissolution, pitch production, foam synthesis using physical blowing agents, and alternate coking techniques.

  20. Determination of the coal extraction plan with reduction to a minimum of the outlays for extraction and storage with simultaneous fulfillment of the consumer's orders

    Energy Technology Data Exchange (ETDEWEB)

    Lacheta, A; Stangiewicz, T

    1979-01-01

    The use of dynamic programming of monthly extraction and storage of coal at mines was examined in order to reduce the annual outlays for these operations. In addition, realization of the model simultaneously satisfies the orders of the consumers, despite the seasonal fluctuations in the demand of the customers and the coal shipment capabilities of the mining enterprise.

  1. A comparative study of the antacid effect of raw spinach juice and spinach extract in an artificial stomach model.

    Science.gov (United States)

    Panda, Vandana Sanjeev; Shinde, Priyanka Mangesh

    2016-12-01

    BackgroundSpinacia oleracea known as spinach is a green-leafy vegetable consumed by people across the globe. It is reported to possess potent medicinal properties by virtue of its numerous antioxidant phytoconstituents, together termed as the natural antioxidant mixture (NAO). The present study compares the antacid effect of raw spinach juice with an antioxidant-rich methanolic extract of spinach (NAOE) in an artificial stomach model. MethodsThe pH of NAOE at various concentrations (50, 100 and 200 mg/mL) and its neutralizing effect on artificial gastric acid was determined and compared with that of raw spinach juice, water, the active control sodium bicarbonate (SB) and a marketed antacid preparation ENO. A modified model of Vatier's artificial stomach was used to determine the duration of consistent neutralization of artificial gastric acid for the test compounds. The neutralizing capacity of test compounds was determined in vitro using the classical titration method of Fordtran. Results NAOE (50, 100 and 200 mg/mL), spinach juice, SB and ENO showed significantly better acid-neutralizing effect, consistent duration of neutralization and higher antacid capacity when compared with water. Highest antacid activity was demonstrated by ENO and SB followed by spinach juice and NAOE200. Spinach juice exhibited an effect comparable to NAOE (200 mg/mL). ConclusionsThus, it may be concluded that spinach displays significant antacid activity be it in the raw juice form or as an extract in methanol.

  2. Comparison of different extraction methods and HPLC quantification of prenylated and unprenylated phenylpropanoids in raw Italian propolis.

    Science.gov (United States)

    Taddeo, Vito Alessandro; Epifano, Francesco; Fiorito, Serena; Genovese, Salvatore

    2016-09-10

    In this paper the presence of selected prenylated and unprenylated phenylpropanoids, namely ferulic acid 1, boropinic acid 2, 4'-geranyloxyferulic acid 3, umbelliferone 4, 7-isopentenyloxycoumarin 5, and auraptene 6, have been determined in Italian raw propolis after having been extracted with different methodologies. An aqueous solution of β-cyclodextrin was the best extraction method for ferulic acid 1, treatment with indifferently EtOH or aqueous β-cyclodextrin were the most effective one for umbelliferone 4, boropinic acid 2 gave the best yields either with H2O/β-cyclodextrin or olive oil treatment or in biphasic systems, maceration with biphasic mixtures of aqueous β-cyclodextrin and olive oil was seen to be the most effective procedure for 7-isopentenyloxycoumarin 5, the only method providing significant quantities of 4'-geranyloxyferulic acid 3 was the maceration of raw propolis with olive oil, and finally auraptene 4 was best extracted with absolute EtOH. "Classic" maceration in general performed better than ultrasound-assisted one. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Aspects of the environmental geology of coal extraction in South Africa

    International Nuclear Information System (INIS)

    Thamm, A.G.

    1996-01-01

    Existing areas of regulatory intervention in South Africa, related to coal extraction, are discard and stockpile burning (low level air pollution), acid rock drainage (water pollution) and landscape and mine rehabilitation. These impacts are managed in terms of the Minerals Act (No. 50 of 1991) and its subsequent amendments. Exploration and mining companies (at any scale or size) are required to prepare Environmental Management Programme Reports (EMPR) in terms of existing legislation. The submission and approval of an EMPR results in site-specific legal obligations for which the mining company must make pecuniary provision. Individual coal producers have led the mining industry in the establishment of trusts to fund such rehabilitation. River catchment areas in the Mpumalanga Province and in northern KwaZulu Natal have suffered serious water quality deterioration as a result of polluted water emanating from abandoned coal mines. The relatively small household coal sector has health impacts out of proportion with its size, with the attendant increases in health risk clearly documented. Economic geologists have been concerned with the proving of non-renewable resources and management and production of reserves once mining commences. Mining investment decisions are increasingly influenced by the necessity to rehabilitate mined out areas and manage environmental impact. Understanding potential cost, at the end of the mining project cycle is as significant as understanding the genesis or value of a deposit. Site specific examples of typical South African problems will be presented

  4. Impact of geotechnical factors on the secondary extraction of coal in the Witbank and Northern Highveld Coalfields, specifically related to safety.

    CSIR Research Space (South Africa)

    Jeffrey, JS

    2002-04-01

    Full Text Available This report describes a literature review that identified geotechnical factors impacting on unplanned secondary coal extraction. These factors are grouped into nine broad classes of factors; namely, stratigraphy, rock /coal engineering properties...

  5. A comparison of geochemical features of extracts from coal-seams source rocks with different polarity solvents

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Jianping; Deng, Chunping; Wang, Huitong

    2009-02-15

    There exists a great difference in group-type fractions and biomarker distributions of chloroform extracts from coals and coal-seams oils, which makes the source identification of coal-seams oils in sedimentary basins rather difficult. The experiment, in which four different polarity solvents, n-hexane, benzene, dichloromethane and chloroform, were used to extract 9 coal-seams source rocks and 3 typical lacustrine source rocks, showed that the yield of extracts increased gradually with increasing solvent polarity. The distribution features of their n-alkanes, isoprenoids and sterane and terpane biomarkers remained, in general, similar, showing no distinct enrichment or depletion for a certain fraction by any solvent. The compositional analysis on n-hexane and chloroform extracts showed that the absolute amount (concentration) of biomarkers was relatively low for the n-hexane extract but comparatively high for the chloroform extract, this difference became great among coal-seams source rocks but small among lacustrine mudstones. The statistical analysis on the relative amount of the 18 major biomarkers in n-hexane and chloroform extracts from 10 source rock samples showed that extracts with a proportional error for the same biomarker of less than 5% (including the analytical error) accounted for 84% while those with a proportional error over 10% amounted to below 5%. This suggested that the outcome of oil-source correlation made by these biomarkers will be independent of variations in amounts of saturates and biomarkers arising from solvent polarity. Therefore, biomarkers obtained from organic-rich source rocks including coals by the extraction with the commonly used chloroform solvent can be applied for the oilsource correlation of coal-seams petroliferous basins.

  6. Mass spectrometric and chemometric studies of thermoplastic properties of coals. 1. Chemometry of conventional, solvent swelling and extraction data of coals

    Energy Technology Data Exchange (ETDEWEB)

    Marzec, A.; Czajkowska, S.; Moszynski, J.; Schulten, H.-R. (Polish Academy of Sciences, Gliwice (Poland). Inst. of Coal Chemistry)

    Twenty-seven coals from Carboniferous seams in Poland were studied with the aim to find links between thermoplastic properties and chemical characteristics of the coals. Three sets of data were obtained for all the coals: (1) thermoplastic properties measured using the Gieseler plastometer; (2) yields of pyridine extractables and swelling measurements for pyridine residues; (3) ultimate, proximate, and petrographic analyses. The three data sets were evaluated using chemometric techniques with the purpose of looking for significant correlations between all the data. Temperature of softening is a linear regression of pyridine extractables and hydrogen content in coals as well as of swelling data. Temperatures of maximum fluidity and resolidification are correlated with each other and with oxygen, exinite, and moisture contents of the coals as well as with the swelling data. It has been concluded that temperature of softening is a colligative property and indicates a phase transition resulting in an increase of thermal induced mobility of coal material; the energy demand of the transition is dependent on contents of bulk components of coal system that were specified in this study. Temperatures of maximum fluidity and resolidification appear to have the same chemical background; i.e. the temperatures depend on the content of the same structural units or components. However, the means of chemical characterization of coal material used in this study were not capable of identifying them. Volatile matter and petrographic composition showed rather limited value as predictive means for some (T{sub F(max)} and T{sub R}) and no predictive value for the other thermoplastic properties. 20 refs., 1 fig., 5 tabs.

  7. Effects of natural plant extracts and gamma rays on lactobacillus isolated from Korean traditional raw rice wine

    Energy Technology Data Exchange (ETDEWEB)

    Nam, Ji Young; Kim, Jae Hun; Lee, Ju Woon; Kim, Jin Kyu [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2010-12-15

    Recently, Korean traditional raw rice wines (RRW) have received attention because they are a nutritious food with health properties. But the rapid deterioration of fermented RRW is one of the serious problems for brewing and marketing in the world beyond Korea. The goal of this study was to develop a way to enhance the quality and to lengthen the period of circulation of the RRW. A lactic acid bacterium was isolated from RRW. It was identified as Lactobacillus fermentum (98%) based on its biochemical properties, and 16S rRNA sequence. Treatments of RRW with gamma radiation and green tea extracts reduced the bacterial population except for yeasts and Lactobacillus in the RRW. This result suggested that the natural plant extracts and catechin products can be used as an effective natural storage agent.

  8. Development and inculcation of new methods in the field of exploring, extraction and reprocessing of uranium raw materials

    International Nuclear Information System (INIS)

    Smirnov, Yu.V.; Efimova, Z.I.; Skorovarov, D.I.; Ivanov, G.F.

    1979-01-01

    The situation is briefly overviewed in the field of exploration, prospecting, extraction and processing of uranium raw material and industrial introduction of the recently developed methods. The method of underground leaching, including that from deep-seated deposits, is gaining wide acceptance. Of high importance is the industrial introduction of such promising processes as bacterial leaching, continuous column-sorption with a pseudo-luquefied sorbent layer, direct production of UF 6 in an ore-processing factory. Active works are under way now in the field of multi-purpose utilization of uranium ore. New methods are industrially introduced for the extraction of associated uranium from phosphoric acid solutions, copper ore, sea water

  9. Effects of natural plant extracts and gamma rays on lactobacillus isolated from Korean traditional raw rice wine

    International Nuclear Information System (INIS)

    Nam, Ji Young; Kim, Jae Hun; Lee, Ju Woon; Kim, Jin Kyu

    2010-01-01

    Recently, Korean traditional raw rice wines (RRW) have received attention because they are a nutritious food with health properties. But the rapid deterioration of fermented RRW is one of the serious problems for brewing and marketing in the world beyond Korea. The goal of this study was to develop a way to enhance the quality and to lengthen the period of circulation of the RRW. A lactic acid bacterium was isolated from RRW. It was identified as Lactobacillus fermentum (98%) based on its biochemical properties, and 16S rRNA sequence. Treatments of RRW with gamma radiation and green tea extracts reduced the bacterial population except for yeasts and Lactobacillus in the RRW. This result suggested that the natural plant extracts and catechin products can be used as an effective natural storage agent

  10. Near infrared spectroscopy based monitoring of extraction processes of raw material with the help of dynamic predictive modeling

    Science.gov (United States)

    Wang, Haixia; Suo, Tongchuan; Wu, Xiaolin; Zhang, Yue; Wang, Chunhua; Yu, Heshui; Li, Zheng

    2018-03-01

    The control of batch-to-batch quality variations remains a challenging task for pharmaceutical industries, e.g., traditional Chinese medicine (TCM) manufacturing. One difficult problem is to produce pharmaceutical products with consistent quality from raw material of large quality variations. In this paper, an integrated methodology combining the near infrared spectroscopy (NIRS) and dynamic predictive modeling is developed for the monitoring and control of the batch extraction process of licorice. With the spectra data in hand, the initial state of the process is firstly estimated with a state-space model to construct a process monitoring strategy for the early detection of variations induced by the initial process inputs such as raw materials. Secondly, the quality property of the end product is predicted at the mid-course during the extraction process with a partial least squares (PLS) model. The batch-end-time (BET) is then adjusted accordingly to minimize the quality variations. In conclusion, our study shows that with the help of the dynamic predictive modeling, NIRS can offer the past and future information of the process, which enables more accurate monitoring and control of process performance and product quality.

  11. Genotoxic Evaluation of Mikania laevigata Extract on DNA Damage Caused by Acute Coal Dust Exposure

    Energy Technology Data Exchange (ETDEWEB)

    Freitas, T.P.; Heuser, V.D.; Tavares, P.; Leffa, D.D.; da Silva, G.A.; Citadini-Zanette, V.; Romao, P.R.T.; Pinho, R.A.; Streck, E.L.; Andrade,V.M. [University of Extremo Catarinense, Criciuma, SC (Brazil)

    2009-06-15

    We report data on the possible antigenotoxic activity of Mikania laevigata extract (MLE) after acute intratracheal instillation of coal dust using the comet assay in peripheral blood, bone marrow, and liver cells and the micronucleus test in peripheral blood of Wistar rats. The animals were pretreated for 2 weeks with saline solution (groups 1 and 2) or MLE (100 mg/kg) (groups 3 and 4). On day 15, the animals were anesthetized with ketamine (80 mg/kg) and xylazine (20 mg/kg), and gross mineral coal dust (3 mg/0.3 mL saline) (groups 2 and 4) or saline solution (0.3 mL) (groups 1 and 3) was administered directly in the lung by intratracheal administration. Fifteen days after coal dust or saline instillation, the animals were sacrificed, and the femur, liver, and peripheral blood were removed. The results showed a general increase in the DNA damage values at 8 hours for all treatment groups, probably related to surgical procedures that had stressed the animals. Also, liver cells from rats treated with coal dust, pretreated or not with MLE, showed statistically higher comet assay values compared to the control group at 14 days after exposure. These results could be expected because the liver metabolizes a variety of organic compounds to more polar by-products. On the other hand, the micronucleus assay results did not show significant differences among groups. Therefore, our data do not support the antimutagenic activity of M. laevigata as a modulator of DNA damage after acute coal dust instillation.

  12. The use of solvent extractions and solubility theory to discern hydrocarbon associations in coal, with application to the coal-supercritical CO2 system

    Science.gov (United States)

    Kolak, Jonathan J.; Burruss, Robert A.

    2014-01-01

    Samples of three high volatile bituminous coals were subjected to parallel sets of extractions involving solvents dichloromethane (DCM), carbon disulfide (CS2), and supercritical carbon dioxide (CO2) (40 °C, 100 bar) to study processes affecting coal–solvent interactions. Recoveries of perdeuterated surrogate compounds, n-hexadecane-d34 and four polycyclic aromatic hydrocarbons (PAHs), added as a spike prior to extraction, provided further insight into these processes. Soxhlet-DCM and Soxhlet-CS2 extractions yielded similar amounts of extractable organic matter (EOM) and distributions of individual hydrocarbons. Supercritical CO2 extractions (40 °C, 100 bar) yielded approximately an order of magnitude less EOM. Hydrocarbon distributions in supercritical CO2 extracts generally mimicked distributions from the other solvent extracts, albeit at lower concentrations. This disparity increased with increasing molecular weight of target hydrocarbons. Five- and six-ring ring PAHs generally were not detected and no asphaltenes were recovered in supercritical CO2 extractions conducted at 40 °C and 100 bar. Supercritical CO2 extraction at elevated temperature (115 °C) enhanced recovery of four-ring and five-ring PAHs, dibenzothiophene (DBT), and perdeuterated PAH surrogate compounds. These results are only partially explained through comparison with previous measurements of hydrocarbon solubility in supercritical CO2. Similarly, an evaluation of extraction results in conjunction with solubility theory (Hildebrand and Hansen solubility parameters) does not fully account for the hydrocarbon distributions observed among the solvent extracts. Coal composition (maceral content) did not appear to affect surrogate recovery during CS2 and DCM extractions but might affect supercritical CO2 extractions, which revealed substantive uptake (partitioning) of PAH surrogates into the coal samples. This uptake was greatest in the sample (IN-1) with the highest vitrinite content. These

  13. Sequential solvent extraction for the modes of occurrence of selenium in coals of different ranks from the Huaibei Coalfield, China

    Directory of Open Access Journals (Sweden)

    Wang Lei

    2007-12-01

    Full Text Available Abstract Forms of selenium in bituminous coal, anthracite, and cokeite (natural coke from Huaibei Coalfield, Anhui, China, have been determined by sequential solvent extraction. The selenium content in bulk samples is 4.0, 2.4, and 2.0 μg/g in bituminous coal, anthracite, and cokeite, respectively. The six forms of selenium determined by six-step solvent extraction are water-leachable, ion-exchangeable, organic matter-associated, carbonate-associated, silicate-associated, and sulfide-associated. The predominant forms of selenium in bituminous coal are organic matter-associated (39.0%, sulfide-associated (21.1%, and silicate bound (31.8%; these three forms account for 92% of the total. The organic matter bound-selenium decrease dramatically from bituminous coal (39.0% to anthracite (11.6% and to cokeite (0%, indicating that organic matter bound selenium is converted to other forms during metamorphism of the coal, most likely sulfide-form. The sulfide-associated form increased remarkably from bituminous coal (21.1% to anthracite (50.4% and cokeite (54.5%, indicating the formation of selenium sulfide, possibly in pyrite during the transformation of bituminous coal to anthracite and cokeite. The silicate-associated selenium in bituminous coal (31.8% is much higher than that in anthracite (16.4% and cokeite (15.8%, indicating that silicate-associated selenium is partly converted to sulfide during metamorphism.

  14. PRACTICAL PROPOSALS AS A RESULT OF THEORETICAL AND EXPERIMENTAL STUDIES OF THE PROCESS OF EXTRACTION FROM RAW MATERIALS OF PLANT ORIGIN

    Directory of Open Access Journals (Sweden)

    I. I. Shishatskii

    2014-01-01

    Full Text Available Summary. Theoretical and experimental researches of extraction processes from plant origin raw materials: barley, acorns and chicory with liquid carbon dioxide, as well as lupin with cheese whey were carried out. Quality indicators of extracts and secondary raw materials are defined. It is established that they are perspective raw sources for the enriched and functional products as they contain amino acids, vitamins and microelements. The dairy-vegetative lupine extract, for example, contains 17 amino acids, including the essential as well as vitamins and minerals. The studies of secondary raw materials, barley, acorns, chicory and lupine quality showed the expediency of their use for foods enrichment. Quality indicators of secondary raw materials are presented in the tables form in the given work. It formed the basis for the development of hardware-technological schemes of obtaining СО2-extracts and their use. The hardware-technological scheme of obtaining СО2-extracts from barley, acorns and chicory includes a number of equipment units: motor transport for raw materials delivery to the enterprise, the scraper hydroconveyor, the jet washer, a photoseparator for of poor-quality raw materials and impurities removal, a blowing machine for removing surface moisture from the raw materials, a jet washer for peeling, a cutter, drying and frying device, a crusher, a roller machine tool and an extracting unit. Hardware providing for yoghurt technology enriched with amino acids, microelements and vitamins which are present in a dairy-plant extract differs from the mentioned above one in the following. The extract used is a cheese whey, and the extraction of a target component is carried out in a vibrating extractor. The hardwaretechnological scheme is made according to Russian technology of yoghurt and furnished with the equipment for dairy-vegetative extract feeding into a product. It includes the following: a vibrating extractor (not shown in fig

  15. Comparison of Soxhlet and Shake Extraction of Polycyclic Aromatic Hydrocarbons from Coal Tar Polluted Soils Sampled in the Field

    DEFF Research Database (Denmark)

    Lindhardt, Bo; Holst, Helle; Christensen, Thomas Højlund

    1994-01-01

    This study compares three extraction methods for PAHs in coal tar polluted soil: 3-times repeated shaking of the soil with dichloromethane-methanol (1:1), Soxhlet extraction with dichloromethane, and Soxhlet extraction with dichloromethane followed by Soxhlet extraction with methanol....... The extraction efficiencies were determined for ten selected PAHs in triplicate samples of six soils sampled at former gasworks sites. The samples covered a wide range of PAH concentrations, from 0.6 to 397 mg/kg soil. Soxhlet extraction with dichloromethane followed by Soxhlet extraction with methanol...

  16. Identification of organosulfurs and organonitrogens in the extracts of Pocahontas No. 3 Coal

    Energy Technology Data Exchange (ETDEWEB)

    Jing-Pei Cao; Zhi-Min Zong; Xiao-Yan Zhao; Chang-Cheng Liu; Guang-Feng Liu; Hong Zhang; Chul Wee Lee; Xian-Yong Wei [China University of Mining and Technology, Xuzhou (China). School of Chemical Engineering

    2007-07-01

    Pocahontas No. 3 coal was extracted with CS{sub 2}, n-hexane, benzene, methanol, acetone and acetone/CS{sub 2} (1:1 vol/vol) mixed solvent sequentially. The resulting six extracts were analyzed with GC and GC/MS. Hexathiane, octathiane, twenty-one organosulfurs (OSs) and twenty-one organonitrogens (ONs) were detected in the extracts. OSs detected in the extracts include ethylmethylsulfane, 1,2-dimethyldisulfane, S-ethyl dipropylcarbamothioate, dimexano and its derivatives, dibenzothiophene, mono- and dimethyldibenzothiophenes, benzonaphthothiophene, mono- and dimethyl benzonaphthothiophenes, among which dimexano and dixanthogen were seldom reported in any sediments. Benzene is effective for extracting aromatic-ring-containing OSs, while OSs without aromatic ring tend to dissolve in methanol. Most of ONs detected in the extracts are acridinone, methylacridinones, carbazole, methylcarbazoles, benzocarbazoles, amines, phenanthridinone and piperidinone. Species and amounts of ONs detected in the extracts were increased along with the increasing of solvent polarity. N and O atoms often coexist in the same compounds. 2 figs., 3 tabs.

  17. The effects of pretreatment and the addition of polar compounds on the production of 'HyperCoal' from subbituminous coals

    Energy Technology Data Exchange (ETDEWEB)

    Kensuke Masaki; Takahiro Yoshida; Chunqi Li; Toshimasa Takanohashi; Ikuo Saito [National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba (Japan). Institute for Energy Utilization

    2004-08-01

    The effects of acid and hydrothermal pretreatments and the addition of polar compounds on the production of ashless-coal (HyperCoal) from subbituminous coals using cost-effective industrial solvents were investigated. The extraction yield of Wyodak subbituminous coal (C%, 75.0%) using crude methylnaphthalene oil (CMNO) at 360{sup o}C was increased significantly by 19% following acid pretreatment; it was 41.3% for the raw coal and 60.5% for the acid-treated coal. The addition of strongly polar compounds, such as N-methyl-2-pyrrolidinone (NMP), also increased the extraction yields. For Pasir subbituminous coal (%, 73.0%) the yield increased by 10% from 54.3% for the raw coal to 64.2% when 20% NMP was added to CMNO. The highest extraction yield of 72.2% was obtained for acid-treated Wyodak coal using CMNO with 20% NMP added. The ash content in HyperCoal tended to decrease following acid pretreatment and was less than 200 ppm in some coals. Hydrothermal pretreatment had a negative effect on the thermal extraction at 360{sup o}C, but increased the yield at extraction temperatures below 200{sup o}C. 20 refs., 7 figs., 2 tabs.

  18. Extraction of Fucoxanthin from Raw Macroalgae excluding Drying and Cell Wall Disruption by Liquefied Dimethyl Ether

    Science.gov (United States)

    Kanda, Hideki; Kamo, Yuichi; Machmudah, Siti; Wahyudiono; Goto, Motonobu

    2014-01-01

    Macroalgae are one of potential sources for carotenoids, such as fucoxanthin, which are consumed by humans and animals. This carotenoid has been applied in both the pharmaceutical and food industries. In this study, extraction of fucoxanthin from wet brown seaweed Undaria pinnatifida (water content was 93.2%) was carried out with a simple method using liquefied dimethyl ether (DME) as an extractant in semi-continuous flow-type system. The extraction temperature and absolute pressure were 25 °C and 0.59 MPa, respectively. The liquefied DME was passed through the extractor that filled by U. pinnatifida at different time intervals. The time of experiment was only 43 min. The amount of fucoxanthin could approach to 390 μg/g dry of wet U. pinnatifida when the amount of DME used was 286 g. Compared with ethanol Soxhlet and supercritical CO2 extraction, which includes drying and cell disruption, the result was quite high. Thus, DME extraction process appears to be a good method for fucoxanthin recovery from U. pinnatifida with improved yields. PMID:24796299

  19. Effect of heat reflux extraction on the structure and composition of a high-volatile bituminous coal

    International Nuclear Information System (INIS)

    Tian, Bin; Qiao, Ying-yun; Tian, Yuan-yu; Xie, Ke-chang; Li, Da-wei

    2016-01-01

    Highlights: • A novel HRE process with CYC is proposed to dissolve coal. • Most of the aliphatic compounds in coal are extracted during HRE process. • The carbon crystallite structure of coal changes after HRE process with CYC. • The thermal degradation behavior of ER is significantly different from that of the SFHB. - Abstract: Heat reflux extraction (HRE) process with cyclohexanone (CYC) in a high-performance mass transfer extractor was applied to dissolve Shenmu-Fugu high-volatile bituminous (SFHB) coal for the first time to afford extract (E) and extract residue (ER) from the extraction. SFHB, E, and ER were characterized by elemental analysis, solid-state "1"3C NMR spectrometry, FTIR spectrometry, XRD, SEM, and TG-FTIR to elucidate the effect of HRE on the evolution of functional groups and macromolecular structure of coal during extraction. The soluble portion in SFHB was 24.37% in the course of HRE with CYC. The aromaticity of SFHB derived from both curve-fitting of "1"3C NMR and FTIR spectra was obviously increased after extraction suggesting that most of the aliphatic fractions were extracted during HRE process. It was clarified that the substituted degree of aromatic ring in SFHB became low but the substituents on aromatics were larger after extraction. Due to irreversibly swelling crystal structure of SFHB, its interlayer spacing became larger and the stacking height of crystallite decreased after extraction. Moreover, significant amounts of volatile matters were extracted, which caused relatively lower mass loss rate and contents of gaseous products (CO_2, aliphatic moieties, CH_4, and CO) of ER than SFHB during main pyrolysis stage.

  20. DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS

    Energy Technology Data Exchange (ETDEWEB)

    Elliot B. Kennel; Stephen P. Carpenter; Dady Dadyburjor; Manoj Katakdaunde; Liviu Magean; Peter G. Stansberry; Alfred H. Stiller; John W. Zondlo

    2005-06-08

    The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. These carbon products include materials used in metals smelting, especially in the aluminum and steel industries, as well as porous carbon structural material referred to as ''carbon foam'' and carbon fibers. During this reporting period, efforts have focused on the development of continuous processes for hydrogenation as well as continuous production of carbon foam and coke.

  1. DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS

    Energy Technology Data Exchange (ETDEWEB)

    Elliot B. Kennel; Stephen P. Carpenter; Dady Dadyburjor; Manoj Katakdaunde; Liviu Magean; Madhavi Nallani-Chakravartula; Peter G. Stansberry; Alfred H. Stiller; John W. Zondlo

    2006-03-27

    The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. These carbon products include materials used in metals smelting, especially in the aluminum and steel industries, as well as porous carbon structural material referred to as ''carbon foam'' and carbon fibers. During this reporting period, efforts have focused on the development of continuous processes for hydrogenation as well as continuous production of carbon foam and coke.

  2. DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS

    Energy Technology Data Exchange (ETDEWEB)

    Elliot B. Kennel; Philip L. Biedler; Chong Chen; Dady Dadyburjor; Liviu Magean; Peter G. Stansberry; Alfred H. Stiller; John W. Zondlo

    2005-04-13

    The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. These carbon products include materials used in metals smelting, especially in the aluminum and steel industries, as well as porous carbon structural material referred to as ''carbon foam'' and carbon fibers. A process has been developed which results in high quality binder pitch suitable for use in graphite electrodes or carbon anodes. A detailed description of the protocol is given by Clendenin. Briefly, aromatic heavy oils are hydro-treated under mild conditions in order to increase their ability to dissolve coal. An example of an aromatic heavy oil is Koppers Carbon Black Base (CBB) oil. CBB oil has been found to be an effective solvent and acceptably low cost (i.e., significantly below the market price for binder pitch, or about $280 per ton at the time of this writing). It is also possible to use solvents derived from hydrotreated coal and avoid reliance on coke oven recovery products completely if so desired.

  3. Effect of hydrothermal treatment of coal on its associative structure

    Energy Technology Data Exchange (ETDEWEB)

    Shui Heng-fu; Wang Zhi-cai; Wang Gao-qiang; Niu Min-feng [Anhui University of Technology, Maanshan (China). School of Chemistry & Chemical Engineering

    2006-10-15

    4 bituminous coals with different ranks were thermally and hydrothermally treated under different conditions, and the raw and treated coals were extracted with carbon disulfide/N-2-pyrrolidinone (CS{sub 2}/NMP) mixed solvent (1:1 by volume). It is found that the extraction yields of the thermal or hydrothermal treated coals at proper conditions increase in different extent. The increments of extraction yields for hydrothermal treated coals are higher than those of thermal treated coals. FT-IR shows that the adsorption peaks at 3410 cm{sup -1} attributed to OH group for the hydrothermal treated coals decrease, suggesting the dissociation of the coal aggregation structure due to the breakage of hydrogen bonds, resulting in the increase of extraction yields for the treated coals. For higher rank coal, the removal of minerals and the dissociation of {pi}-cation association after hydrothermal treatment of coal may be responsible for the increase of extraction yield. In addition, the mechanism of hydrothermal treatment of coal was discussed. 15 refs., 2 figs., 5 tabs.

  4. An approach for extracting the vein and heart boundaries from raw NM images

    International Nuclear Information System (INIS)

    Mitrovski, Cvetko D.; Kostov, Mitko B.

    2003-01-01

    In this paper we present our approach on prE.processing chest region dynamical NM images which enables anatomical data extraction of the vena cava and the heart. The aim of the method is developing sophisticated diagnostic software that could automatically offer the optimal positions and the shapes of the regions of interest needed for the heart studies. (Author)

  5. Overall requirements for an advanced underground coal extraction system. [environment effects, miner health and safety, production cost, and coal conservation

    Science.gov (United States)

    Goldsmith, M.; Lavin, M. L.

    1980-01-01

    Underground mining systems suitable for coal seams expoitable in the year 2000 are examined with particular relevance to the resources of Central Appalachia. Requirements for such systems may be summarized as follows: (1) production cost; (2)miner safety; (3) miner health; (4) environmental impact; and (5) coal conservation. No significant trade offs between production cost and other performance indices were found.

  6. Anti-Inflammatory Activity of the Methanol Extract of Moutan Cortex in LPS-Activated Raw264.7 Cells

    Directory of Open Access Journals (Sweden)

    Seung-Chul Chun

    2007-01-01

    Full Text Available Moutan Cortex (MCE has been used in traditional medicine to remove heat from the blood, promote blood circulation and alleviate blood stasis. This study was conducted to evaluate the effects of MCE on regulatory mechanisms of cytokines and nitric oxide (NO involved in immunological activity of Raw264.7 cells. Cells were pretreated with methanolic extracts of MCE, and further cultured for an appropriate time after lipopolyssacharide (LPS addition. During the entire experimental period, 0.1 and 0.3 mg ml−1 of MCE had no cytotoxicity. In these concentrations, MCE inhibited the production of NO and prostaglandin E2 (PGE2, the expression of inducible NO synthase (iNOS, cyclooxygenase-2 (COX-2 and phosphorylated inhibitor of κBα (p-IκBα, and the activation of nuclear factor κB (NF-κB. MCE also reduced the concentration of tumor necrosis factor-α (TNF-α, interleukin-1β (IL-1β and interleukin-6 (IL-6 in the Raw264.7 cells that were activated by LPS. These results demonstrate that MCE has anti-inflammatory effects through the inhibition of iNOS and COX-2 expression by suppressing the phosphorylation of I-κBα and the activation of NF-κB.

  7. The transfer of natural Rhodamine B contamination from raw paprika fruit to capsicum oleoresin during the extraction process.

    Science.gov (United States)

    Wu, Naiying; Gao, Wei; Lian, Yunhe; Du, Jingjing; Tie, Xiaowei

    2017-12-15

    Occurrence of Rhodamine B (RhB) contamination in paprika caused by agricultural materials during the vegetation process has been reported. It may transfer during the process of active compounds extraction, and eventually exist in final products. Herein, the re-distribution of RhB during the extraction process was assessed in terms of RhB contents, as well as mass, color value and capsaicinoids yield of each process. Results revealed that natural RhB contamination at 0.55-1.11µg/kg originated from raw paprika fruit then transferred with the extraction proceeded. About 95.5% of RhB was found in red oleoresin. After separation of red oleoresin, 91.6% of RhB was remained in capsicum oleoresin, only 3.7% in paprika red. These results were consistent with total capsaicinoids recovery of each product. The RhB levels in edible capsicum oleoresin in our present study at 0.01-0.34µg/kg did not exceed the legal limits established by the European Union. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Anti-Inflammatory Effects of Angelica sinensis (Oliv. Diels Water Extract on RAW 264.7 Induced with Lipopolysaccharide

    Directory of Open Access Journals (Sweden)

    Young-Jin Kim

    2018-05-01

    Full Text Available The dry root of Angelica sinensis (Oliv. Diels, also known as “female ginseng”, is a popular herbal drug amongst women, used to treat a variety of health issues and cardiovascular diseases. The aim of this study is to evaluate the detailed molecular mechanism for anti-inflammatory effects of Angelica sinensis root water extract (ASW. The anti-inflammatory effect of ASW on lipopolysaccharide (LPS-induced RAW 264.7 mouse macrophages was evaluated by the tetrazolium-based colorimetric assay (MTT, Griess reagent assay, multiplex cytokine assay, real time reverse transcription polymerase chain reaction (RT-PCR, and Fluo-4 calcium assay. ASW restored cell viability in RAW 264.7 at concentrations of up to 200 µg/mL. ASW showed notable anti-inflammatory effects. ASW exhibited IC50 = 954.3, 387.3, 191.7, 317.8, 1267.0, 347.0, 110.1, 573.6, 1171.0, 732.6, 980.8, 125.0, and 257.0 µg/mL for interleukin (IL-6, tumor necrosis factor (TNF-α, monocyte chemotactic activating factor (MCP-1, regulated on activation, normal T cell expressed and secreted (RANTES, granulocyte colony-stimulating factor (G-CSF, granulocyte macrophage colony-stimulating factor (GM-CSF, vascular endothelial growth factor (VEGF, lipopolysaccharide-induced CXC chemokine (LIX, macrophage inflammatory protein (MIP-1α, MIP-1β, MIP-2, IL-10, and intracellular calcium, respectively. Additionally, ASW inhibited the LPS-induced production of nitric oxide and the LPS-induced mRNA expression of CHOP (GADD153, Janus kinase 2 (JAK2, signal transducers and activators of transcription 1 (STAT1, first apoptosis signal receptor (FAS, and c-Fos, NOS2, and PTGS2 (COX2 in RAW 264.7 significantly (p < 0.05. Data suggest that ASW exerts an anti-inflammatory effect on LPS-induced RAW 264.7 via NO-bursting/calcium-mediated JAK-STAT pathway.

  9. Extracting a respiratory signal from raw dynamic PET data that contain tracer kinetics.

    Science.gov (United States)

    Schleyer, P J; Thielemans, K; Marsden, P K

    2014-08-07

    Data driven gating (DDG) methods provide an alternative to hardware based respiratory gating for PET imaging. Several existing DDG approaches obtain a respiratory signal by observing the change in PET-counts within specific regions of acquired PET data. Currently, these methods do not allow for tracer kinetics which can interfere with the respiratory signal and introduce error. In this work, we produced a DDG method for dynamic PET studies that exhibit tracer kinetics. Our method is based on an existing approach that uses frequency-domain analysis to locate regions within raw PET data that are subject to respiratory motion. In the new approach, an optimised non-stationary short-time Fourier transform was used to create a time-varying 4D map of motion affected regions. Additional processing was required to ensure that the relationship between the sign of the respiratory signal and the physical direction of movement remained consistent for each temporal segment of the 4D map. The change in PET-counts within the 4D map during the PET acquisition was then used to generate a respiratory curve. Using 26 min dynamic cardiac NH3 PET acquisitions which included a hardware derived respiratory measurement, we show that tracer kinetics can severely degrade the respiratory signal generated by the original DDG method. In some cases, the transition of tracer from the liver to the lungs caused the respiratory signal to invert. The new approach successfully compensated for tracer kinetics and improved the correlation between the data-driven and hardware based signals. On average, good correlation was maintained throughout the PET acquisitions.

  10. Extracting a respiratory signal from raw dynamic PET data that contain tracer kinetics

    International Nuclear Information System (INIS)

    Schleyer, P J; Thielemans, K; Marsden, P K

    2014-01-01

    Data driven gating (DDG) methods provide an alternative to hardware based respiratory gating for PET imaging. Several existing DDG approaches obtain a respiratory signal by observing the change in PET-counts within specific regions of acquired PET data. Currently, these methods do not allow for tracer kinetics which can interfere with the respiratory signal and introduce error. In this work, we produced a DDG method for dynamic PET studies that exhibit tracer kinetics. Our method is based on an existing approach that uses frequency-domain analysis to locate regions within raw PET data that are subject to respiratory motion. In the new approach, an optimised non-stationary short-time Fourier transform was used to create a time-varying 4D map of motion affected regions. Additional processing was required to ensure that the relationship between the sign of the respiratory signal and the physical direction of movement remained consistent for each temporal segment of the 4D map. The change in PET-counts within the 4D map during the PET acquisition was then used to generate a respiratory curve. Using 26 min dynamic cardiac NH 3 PET acquisitions which included a hardware derived respiratory measurement, we show that tracer kinetics can severely degrade the respiratory signal generated by the original DDG method. In some cases, the transition of tracer from the liver to the lungs caused the respiratory signal to invert. The new approach successfully compensated for tracer kinetics and improved the correlation between the data-driven and hardware based signals. On average, good correlation was maintained throughout the PET acquisitions. (paper)

  11. GAS AND COAL EXTRACTIVE INDUSTRY DURING THE SOCIALIST INDUSTRIALIZATION PERIOD (1948-1989

    Directory of Open Access Journals (Sweden)

    MARIUS BULEARCA

    2015-12-01

    Full Text Available This article shows that since 1949 the extractive industry has undergone a strong process of restructuring when enterprises were nationalized and a strict control over all components of the economy was established. The new leadership of the country had the intention of developing the industrial sector as well, basically laying the foundations of the new Romanian economy where the industrial sector economy would bring considerable income. This program will lead to the development of the energy sector in Romania also, thus contributing to a great extent to the development and consolidation of coal and gas extraction. Despite of all the economic and social development achieved during the period 1950-1989, at the end of it, Romania ranked a marginal position in the European countries hierarchy since between its level of development and the market economy developed countries large gaps in respect to the main economic and social indicators occurred.

  12. DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS

    Energy Technology Data Exchange (ETDEWEB)

    Elliot B. Kennel; Quentin C. Berg; Stephen P. Carpenter; Dady Dadyburjor; Jason C. Hissam; Manoj Katakdaunde; Liviu Magean; Abha Saddawi; Alfred H. Stiller; John W. Zondlo

    2006-03-07

    The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. The largest applications are those which support metals smelting, such as anodes for aluminum smelting and electrodes for arc furnaces. Other carbon products include materials used in creating fuels for the Direct Carbon Fuel Cell, metals smelting, especially in the aluminum and steel industries, as well as porous carbon structural material referred to as ''carbon foam'' and carbon fibers. During this reporting period, efforts have focused on the development of carbon electrodes for Direct Carbon Fuel Cells (DCFC), and on carbon foam composites used in ballistic armor, as well as the hydrotreatment of solvents used in the basic solvent extraction process. A major goal is the production of 1500 pounds of binder pitch, corresponding to about 3000 pounds of hydrotreated solvent.

  13. DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS

    Energy Technology Data Exchange (ETDEWEB)

    Elliot B. Kennel; R. Michael Bergen; Stephen P. Carpenter; Dady Dadyburjor; Manoj Katakdaunde; Liviu Magean; Alfred H. Stiller; W. Morgan Summers; John W. Zondlo

    2006-05-12

    The purpose of this DOE-funded effort is to develop continuous processes for solvent extraction of coal for the production of carbon products. The largest applications are those which support metals smelting, such as anodes for aluminum smelting and electrodes for arc furnaces. Other carbon products include materials used in creating fuels for the Direct Carbon Fuel Cell, metals smelting, especially in the aluminum and steel industries, as well as porous carbon structural material referred to as ''carbon foam'' and carbon fibers. During this reporting period, coking and composite fabrication continued using coal-derived samples. These samples were tested in direct carbon fuel cells. Methodology was refined for determining the aromatic character of hydro treated liquid, based on Nuclear Magnetic Resonance (NMR) and Fourier Transform Infrared (FTIR). Tests at GrafTech International showed that binder pitches produced using the WVU solvent extraction protocol can result in acceptable graphite electrodes for use in arc furnaces. These tests were made at the pilot scale.

  14. A convenient method for the quantitative determination of elemental sulfur in coal by HPLC analysis of perchloroethylene extracts

    Science.gov (United States)

    Buchanan, D.H.; Coombs, K.J.; Murphy, P.M.; Chaven, C.

    1993-01-01

    A convenient method for the quantitative determination of elemental sulfur in coal is described. Elemental sulfur is extracted from the coal with hot perchloroethylene (PCE) (tetrachloroethene, C2Cl4) and quantitatively determined by HPLC analysis on a C18 reverse-phase column using UV detection. Calibration solutions were prepared from sublimed sulfur. Results of quantitative HPLC analyses agreed with those of a chemical/spectroscopic analysis. The HPLC method was found to be linear over the concentration range of 6 ?? 10-4 to 2 ?? 10-2 g/L. The lower detection limit was 4 ?? 10-4 g/L, which for a coal sample of 20 g is equivalent to 0.0006% by weight of coal. Since elemental sulfur is known to react slowly with hydrocarbons at the temperature of boiling PCE, standard solutions of sulfur in PCE were heated with coals from the Argonne Premium Coal Sample program. Pseudo-first-order uptake of sulfur by the coals was observed over several weeks of heating. For the Illinois No. 6 premium coal, the rate constant for sulfur uptake was 9.7 ?? 10-7 s-1, too small for retrograde reactions between solubilized sulfur and coal to cause a significant loss in elemental sulfur isolated during the analytical extraction. No elemental sulfur was produced when the following pure compounds were heated to reflux in PCE for up to 1 week: benzyl sulfide, octyl sulfide, thiane, thiophene, benzothiophene, dibenzothiophene, sulfuric acid, or ferrous sulfate. A sluury of mineral pyrite in PCE contained elemental sulfur which increased in concentration with heating time. ?? 1993 American Chemical Society.

  15. Solvent extraction of elemental sulfur from coal and a determination of its source using stable sulfur isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Hackley, K.C.; Buchanan, D.H.; Coombs, K.; Chaven, C.; Kruse, C.W. (Eastern Illinois University, Charleston, IL (USA). Chemistry Dept.)

    1990-01-01

    Hot tetrachloroethene (perchloroethylen PCE) extracts significant amounts of elemental sulfur (S{sup o}) from weathered coals but not from pristine coals. The objective of this study was to determine whether S{sup o} extracted by PCE is an oxidation product of pyrite or whether it originates in some way from unstable, organically-bound sulfur. The isotopic composition of the PCE-extracted S{sup o} was compared to the isotopic compositions of the pyritic and the organic sulfur in a coal. The S{sup o} was shown to have an isotopic signature similar to the pyritic sulfur. Additionally, the isotopic differences observed between the pyritic, S{sup o} and sulfatic sulfur were consistent with bacterial mediated oxidation of sulfide sulfur (pyrite) as the source of both the sulfatic and elemental sulfur. 21 refs., 2 tabs.

  16. Solvent extraction of elemental sulfur from coal and a determination of its source using stable sulfur isotopes

    Science.gov (United States)

    Hackley, Keith C.; Buchanan, D.H.; Coombs, K.; Chaven, C.; Kruse, C.W.

    1990-01-01

    Hot tetrachloroethene (perchloroethylene, PCE) extracts significant amounts of elemental sulfur (So) from weathered coals but not from pristine coals. The objective of this study was to determine whether So extracted by PCE is an oxidation product of pyrite or whether it originates in some way from unstable, organically-bound sulfur. The isotopic composition of the PCE-extracted So was compared to the isotopic compositions of the pyritic and the organic sulfur in a coal. The So was shown to have an isotopic signature similar to the pyritic sulfur. Additionally, the isotopic differences observed between the pyritic, So and sulfatic sulfur were consistent with bacterial mediated oxidation of sulfide sulfur (pyrite) as the source of both the sulfatic and elemental sulfur. ?? 1990.

  17. Kombucha fermentation on raw extracts of different cultivars of Jerusalem artichoke

    Directory of Open Access Journals (Sweden)

    Lončar Eva S.

    2007-01-01

    Full Text Available Kombucha is a symbiosis between yeasts and acetic bacteria. It usually grows on sweetened black tea, but cultivation is possible on many other substrates. Jerusalem artichoke tubers extract is one of them. Tubers are suitable for the dietetic nutrition because of the low monosaccharide content and presence of some polyfructan ingredients which act as prebiotic. Five different cultivars of Jerusalem artichoke were used for the preparation of substrates for kombucha fermentation. The aim of this paper was the investigation of the influence of different Jerusalem artichoke cultivars on metabolic activity of kombucha. Composition of carbohydrates was followed using thin-layer chromatography and pH, reducing sugars content and yield of biomass were measured. Most of the samples with Jerusalem artichoke tubers extract contained fructose, probably small amount of glucose, fructo-oligosaccharides with different degree of polymerization and, inulin. Considering TLC chromatograms, Jerusalem artichoke cultivar did not affect significantly the composition of oligosaccharides in the fermentative liquid, as only minor differences were observed.

  18. Mackerel (Scomber Scrombrus Oil Extraction and Evaluation as Raw Materials for Industrial Utilization

    Directory of Open Access Journals (Sweden)

    A. A. BAWA

    2006-01-01

    Full Text Available The extraction, evaluation and refining of fish oil from mackerel (scomber scrombrus has been conducted in this work. The total percentage oil yield using solvent extraction and total moisture content was 28.24% and 56.50 %respectively, which were found to increase linearly with time. The analytical properties of the crude and the refined oil were evaluated. It was observed that the crude oil consist from: acid value 2.5 mg/KOH, peroxide value 2.19 mEq/kg, saponification value 201.6 mgKOH/g, iodine value 108.09 I2/100g, specific gravity 0.911, refractive index 1.485 and reddish brown colour. The refined oil was also evaluated as follows: acid value 2.27 mg/KOH, peroxide 1.00 meq/kg, saponification value 147.84 mgKOH/g, iodine value 106.93 I2 /100g and golden brown colour. These values fall within the acceptable standard values. The refining of the oil brought about a notable improvement in the analytical properties of the oil. Thus, leads to a high quality fish oil in terms of the taste, colour, odours, shelf life and market value. Based on the improved characteristics of the oil, it could be suitable for applications in pharmaceutical and food industries.

  19. Use of raw Euphorbia tirucalli extract for inhibition of ascitic Ehrlich tumor

    Directory of Open Access Journals (Sweden)

    Orlando José dos Santos

    Full Text Available Objective: to evaluate the effect of the Euphorbia tirucalli hydroalcoholic extract (ETHE on the development of Ehrlich Tumor, in its ascitic form. Methods: we intraperitoneally inoculated 15 Swiss mice with 10.44 x 107 cells of Ehrlich Tumor and divided them in two groups one day after: ETHE Group (eight mice, treated with a dosage of 125 mg/kg/day of EHTE for five days; and Control Group (seven mice, treated only with 0.9% isotonic saline solution over the same period. The treatment was done by gavage. Ten days after inoculation, four mice from each group were sacrificed for quantification of tumor cell number, ascitic fluid volume and bone marrow cell number. The remaining animals were maintained to evaluate survival. Results: The ascitic fluid volume and the tumor cell number were decreased in the ETHE group when compared with the control group, but with no statistical significance. On the other hand, survival was higher in the ETHE group, as well as the number of bone marrow cells. Conclusion: Treatment with ETHE after inoculation of Ehrlich Tumor decreases its development and increases survival and the bone marrow cellularity, thus reducing the myelosuppression present in the Ehrlich Tumor bearing mice.

  20. Vadose Zone Fate and Transport Simulation of Chemicals Associated with Coal Seam Gas Extraction

    Science.gov (United States)

    Simunek, J.; Mallants, D.; Jacques, D.; Van Genuchten, M.

    2017-12-01

    The HYDRUS-1D and HYDRUS (2D/3D) computer software packages are widely used finite element models for simulating the one-, and two- or three-dimensional movement of water, heat, and multiple solutes in variably-saturated media, respectively. While the standard HYDRUS models consider only the fate and transport of individual solutes or solutes subject to first-order degradation reactions, several specialized HYDRUS add-on modules can simulate far more complex biogeochemical processes. The objective of this presentation is to provide an overview of the HYDRUS models and their add-on modules, and to demonstrate applications of the software to the subsurface fate and transport of chemicals involved in coal seam gas extraction and water management operations. One application uses the standard HYDRUS model to evaluate the natural soil attenuation potential of hydraulic fracturing chemicals and their transformation products in case of an accidental release. By coupling the processes of retardation, first-order degradation and convective-dispersive transport of the biocide bronopol and its degradation products, we demonstrated how natural attenuation reduces initial concentrations by more than a factor of hundred in the top 5 cm of the vadose zone. A second application uses the UnsatChem module to explore the possible use of coal seam gas produced water for sustainable irrigation. Simulations with different irrigation waters (untreated, amended with surface water, and reverse osmosis treated) provided detailed results regarding chemical indicators of soil and plant health, notably SAR, EC and sodium concentrations. A third application uses the coupled HYDRUS-PHREEQC module to analyze trace metal transport involving cation exchange and surface complexation sorption reactions in the vadose zone leached with coal seam gas produced water following some accidental water release scenario. Results show that the main process responsible for trace metal migration is complexation of

  1. Antioxidant and antidiabetic properties of condensed tannins in acetonic extract of selected raw and processed indigenous food ingredients from Kenya.

    Science.gov (United States)

    Kunyanga, Catherine Nkirote; Imungi, Jasper Kathenya; Okoth, Michael; Momanyi, Clare; Biesalski, Han Konrad; Vadivel, Vellingiri

    2011-05-01

    Recently, tannins have received considerable attention as health-promoting component in various plant foods and several studies have reported on its nutraceutical properties. However, no study has established the role of condensed tannins in indigenous foods of Kenya. Therefore, this study was designed to evaluate the antioxidant activity (DPPH and FRAP) and antidiabetic effects (α-amylase and α-glucosidase inhibition activities) of condensed tannins in some selected raw and traditionally processed indigenous cereals, legumes, oil seeds, and vegetables. The condensed tannin content of the grains and vegetables ranged between 2.55 and 4.35 g/100 g DM and 1.53 and 5.73 g/100 g DM, respectively. The scavenging effect of acetonic extract on DPPH radical ranged from 77% to 90% while the reducing power was found to be 31 to 574 mmol Fe(II)/g DM in all the investigated food ingredients. The condensed tannin extracts of the analyzed samples showed promising antidiabetic effects with potential α-amylase and α-glucosidase inhibition activities of 23% to 44% and 58% to 88%, respectively. Condensed tannins extracted from the amaranth grain, finger millet, field bean, sunflower seeds, drumstick, and amaranth leaves exerted significantly higher antioxidant and antidiabetic activities than other food ingredients. Among the traditional processing methods, roasting of grains and cooking of vegetables were found to be more suitable mild treatments for preserving the tannin compound and its functional properties as opposed to soaking + cooking and blanching treatments. The identified elite sources of optimally processed indigenous food ingredients with promising results could be used as health-promoting ingredients through formulation of therapeutic diets. © 2011 Institute of Food Technologists®

  2. Study of the raw material base for a by-product coke plant by the method of thermal degradation of coal in a centrifugal field

    Energy Technology Data Exchange (ETDEWEB)

    Epimakhov, N.M.; Kardashova, V.F.; Sulimova, E.I.

    1982-01-01

    Coals from the Donbass and Karaganda basins, being supplied to a Bagley by-product coke plant were studied. A sharp distinction between coals of different degrees of metamorphism in respect to the yield of liquid nonvolatile products was demonstrated. A difference in respect to this index was recognized for individual coals from one and the same technological group from a single basin.

  3. Short-term heating reduces the anti-inflammatory effects of fresh raw garlic extracts on the LPS-induced production of NO and pro-inflammatory cytokines by downregulating allicin activity in RAW 264.7 macrophages.

    Science.gov (United States)

    Shin, Jung-Hye; Ryu, Ji Hyeon; Kang, Min Jung; Hwang, Cho Rong; Han, Jaehee; Kang, Dawon

    2013-08-01

    Garlic has a variety of biologic activities, including anti-inflammatory properties. Although garlic has several biologic activities, some people dislike eating fresh raw garlic because of its strong taste and smell. Therefore, garlic formulations involving heating procedures have been developed. In this study, we investigated whether short-term heating affects the anti-inflammatory properties of garlic. Fresh and heated raw garlic extracts (FRGE and HRGE) were prepared with incubation at 25 °C and 95 °C, respectively, for 2 h. Treatment with FRGE and HRGE significantly reduced the LPS-induced increase in the pro-inflammatory cytokine concentration (TNF-α, IL-1β, and IL-6) and NO through HO-1 upregulation in RAW 264.7 macrophages. The anti-inflammatory effect was greater in FRGE than in HRGE. The allicin concentration was higher in FRGE than in HRGE. Allicin treatment showed reduced production of pro-inflammatory cytokines and NO and increased HO-1 activity. The results show that the decrease in LPS-induced NO and pro-inflammatory cytokines in RAW 264.7 macrophages through HO-1 induction was greater for FRGE compared with HRGE. Additionally, the results indicate that allicin is responsible for the anti-inflammatory effect of FRGE. Our results suggest a potential therapeutic use of allicin in the treatment of chronic inflammatory disease. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Comparison of Anti-Inflammatory Effects of Flavonoid-Rich Common and Tartary Buckwheat Sprout Extracts in Lipopolysaccharide-Stimulated RAW 264.7 and Peritoneal Macrophages

    Directory of Open Access Journals (Sweden)

    Tae Gyu Nam

    2017-01-01

    Full Text Available Buckwheat sprouts have been widely consumed all around world due to their great abundance of bioactive compounds. In this study, the anti-inflammatory effects of flavonoid-rich common buckwheat sprout (CBS and tartary buckwheat sprout (TBS extracts were evaluated in lipopolysaccharide- (LPS- stimulated RAW 264.7 murine macrophages and primary peritoneal macrophages from male BALB/c mice. Based on the reversed-phase HPLC analysis, the major flavonoids in CBS were determined to be C-glycosylflavones (orientin, isoorientin, vitexin, and isovitexin, quercetin-3-O-robinobioside, and rutin, whereas TBS contained only high amounts of rutin. The TBS extract exhibited higher inhibitory activity as assessed by the production of proinflammatory mediators such as nitric oxide and cytokines including tumor necrosis factor-α, interleukin- (IL- 6, and IL-12 in LPS-stimulated RAW 264.7 macrophages than CBS extract. In addition, TBS extract suppressed nuclear factor-kappa B activation by preventing inhibitor kappa B-alpha degradation and mitogen-activated protein kinase phosphorylation in LPS-stimulated RAW 264.7 macrophages. Moreover, the TBS extract markedly reduced LPS-induced cytokine production in peritoneal macrophages. Taken together, these findings suggest that TBS extract can be a potential source of anti-inflammatory agents that may influence macrophage-mediated inflammatory disorders.

  5. Structural characteristics and gasification reactivity of chars prepared from K{sub 2}CO{sub 3} mixed HyperCoals and coals

    Energy Technology Data Exchange (ETDEWEB)

    Atul Sharma; Hiroyuki Kawashima; Ikuo Saito; Toshimasa Takanohashi [National Institute of Advanced Industrial Science and Technology, Ibaraki (Japan). Advanced Fuel Group

    2009-04-15

    HyperCoal is a clean coal with mineral matter content <0.05 wt %. Oaky Creek (C = 82%), and Pasir (C = 68%) coals were subjected to solvent extraction method to prepare Oaky Creek HyperCoal, and Pasir HyperCoal. Experiments were carried out to compare the gasification reactivity of HyperCoals and parent raw coals with 20, 40, 50 and 60% K{sub 2}CO{sub 3} as a catalyst at 600, 650, 700, and 775{sup o}C with steam. Gasification rates of coals and HyperCoals were strongly influenced by the temperature and catalyst loading. Catalytic steam gasification of HyperCoal chars was found to be chemical reaction controlled in the 600-700{sup o}C temperature range for all catalyst loadings. Gasification rates of HyperCoal chars were found to be always higher than parent coals at any given temperature for all catalyst loadings. However, X-ray diffraction results showed that the microstructures of chars prepared from coals and HyperCoals were similar. Results from nuclear magnetic resonance spectroscopy show no significant difference between the chemical compositions of the chars. Significant differences were observed from scanning electron microscopy images, which showed that the chars from HyperCoals had coral-reef like structures whereas dense chars were observed for coals. 26 refs., 8 figs., 2 tabs.

  6. Properties of Residue from Olive Oil Extraction as a Raw Material for Sustainable Construction Materials. Part I: Physical Properties

    Directory of Open Access Journals (Sweden)

    Almudena Díaz-García

    2017-01-01

    Full Text Available Action on climate, the environment, and the efficient use of raw materials and resources are important challenges facing our society. Against this backdrop, the construction industry must adapt to new trends and environmentally sustainable construction systems, thus requiring lines of research aimed at keeping energy consumption in new buildings as low as possible. One of the main goals of this research is to efficiently contribute to reducing the amount of residue from olive oil extraction using a two-phase method. This can be achieved by producing alternative structural materials to be used in the construction industry by means of a circular economy. The technical feasibility of adding said residue to ceramic paste was proven by analyzing the changes produced in the physical properties of the paste, which were then compared to the properties of the reference materials manufactured with clay without residue. Results obtained show that the heating value of wet pomace can contribute to the thermal needs of the sintering process, contributing 30% of energy in pieces containing 3% of said material. Likewise, adding larger amounts of wet pomace to the clay body causes a significant decrease in bulk density values.

  7. Valorization of functional properties of extract and powder of olive leaves in raw and cooked minced beef meat.

    Science.gov (United States)

    Aouidi, Fathia; Okba, Aicha; Hamdi, Moktar

    2017-08-01

    Olive leaves (OL), available in huge amounts from pruning, are known to be a useful source of biologically active compounds. This study investigated the potential application of OL as a supplement to minced beef meat in order to develop a functional product. The effect of OL extract or powder (100 and 150 µg phenols g -1 meat) on the quality and stability of raw and cooked meat during refrigerated storage was examined. Microwave drying at 600 W gave OL with the highest antioxidant quality (evaluated by TEAC/[phenols] (mg mg -1 ) and DPPH/[phenols] (mg mg -1 )) compared with other methods. OL showed an ability to inhibit (P production was 43-65% in control samples and 14-35% in treated samples). OL also improved the technological quality of the meat, decreasing (P functional meat products of good technological quality that remain stable during storage. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  8. The physicochemical properties and antioxidative potential of raw thigh meat from broilers fed a dietary medicinal herb extract mixture

    Directory of Open Access Journals (Sweden)

    K. Shirzadegan

    2014-07-01

    Full Text Available A 6-wk feeding study was conducted to evaluate the antioxidative potential, indices such as quality of the thigh meat and liver of broiler chickens fed with a dietary medicinal herb extract mixture (HEM, consisting: Iranian green tea, cinnamon, garlic and chicory at a ratio of 25:15:45:15. A total of 320, one-d-old Ross (male broiler chickens were used to investigate the effects of 0.0, 2.5, 5.0 and 7.5 g/kg HEM in the diet, on aforementioned factors. The HEM supplementation did not influence the composition of raw thigh meat except for the total phenols and crude ash (P<0.05. Furthermore, pH, water-holding capacity (WHC and acceptability of thigh meat were affecting by administration of HEM in diets (P<0.05. Meat flavor increased in the supplemented groups (P<0.05. According to our data, HEM supplementation decreased the amount of thiobarbituric acid reactive substance (TBARS in various times of storage and improved the liver lipid peroxides and superoxide dismutase (SOD activities at week 6 (P<0.05, but did not influence the catalase activity. Our results reveal that the addition of 7.5 g/kg or higher HEM in diet could be sufficient to increase the antioxidative activity and 2.5 g/kg for meat taste of broilers in maximum levels.

  9. Properties of Residue from Olive Oil Extraction as a Raw Material for Sustainable Construction Materials. Part I: Physical Properties.

    Science.gov (United States)

    Díaz-García, Almudena; Martínez-García, Carmen; Cotes-Palomino, Teresa

    2017-01-25

    Action on climate, the environment, and the efficient use of raw materials and resources are important challenges facing our society. Against this backdrop, the construction industry must adapt to new trends and environmentally sustainable construction systems, thus requiring lines of research aimed at keeping energy consumption in new buildings as low as possible. One of the main goals of this research is to efficiently contribute to reducing the amount of residue from olive oil extraction using a two-phase method. This can be achieved by producing alternative structural materials to be used in the construction industry by means of a circular economy. The technical feasibility of adding said residue to ceramic paste was proven by analyzing the changes produced in the physical properties of the paste, which were then compared to the properties of the reference materials manufactured with clay without residue. Results obtained show that the heating value of wet pomace can contribute to the thermal needs of the sintering process, contributing 30% of energy in pieces containing 3% of said material. Likewise, adding larger amounts of wet pomace to the clay body causes a significant decrease in bulk density values.

  10. CHANGE OF PARADIGM IN UNDERGROUND HARD COAL MINING THROUGH EXTRACTION AND CAPITALIZATION OF METHANE FOR ENERGY PRODUCTION

    Directory of Open Access Journals (Sweden)

    Valeriu PLESEA

    2014-05-01

    Full Text Available Besides oil and gas, coal is the most important fossil fuel for energy production. Of the energy mixture of our country, the internal production gas share is 80% of the required annual consumption, of about 14 billion cubic meters, the rest of 20% being insured by importing, by the Russian company Gazprom. The share of coal in the National Power System (NPS is of 24% and is one of the most profitable energy production sources, taking into account the continuous increase of gas price and its dependence on external suppliers. Taking into account the infestation of the atmosphere and global warming as effect of important release of greenhouse gas and carbon dioxide as a result of coal burning for energy production in thermal power plants, there is required to identify new solutions for keeping the environment clean. Such a solution is presented in the study and analysis shown in the paper and is the extraction and capitalization of methane from the coal deposits and the underground spaces remaining free after mine closures. Underground methane extraction is considered even more opportune because, during coal exploitation, large quantities of such combustible gas are released and exhausted into the atmosphere by the degasification and ventilation stations from the surface, representing and important pollution factor for the environment, as greenhouse gas with high global warming potential (high GWP of about 21 times higher than carbon dioxide.

  11. Extractive de-sulfurization and de-ashing of high sulfur coals by oxidation with ionic liquids

    International Nuclear Information System (INIS)

    Saikia, Binoy K.; Khound, Kakoli; Baruah, Bimala P.

    2014-01-01

    Highlights: • Extractive de-sulfurization and de-ashing process for cleaning high sulfur coals. • The process removes inorganic as well as organic sulfur components from high sulfur coals. • The process has less risk to chemists and other surroundings. - Abstract: The environmental consequences of energy production from coals are well known, and are driving the development of desulfurization technologies. In this investigation, ionic liquids were examined for extractive desulfurization and de-ashing in industrially important high sulfur sub-bituminous Indian coals. The ionic liquids, namely, 1-n-butyl-3-methylimidazolium tetrafluoroborate (IL1) and 1-n-butyl 3-methylimidazolium chloride (IL2) were employed for desulfurization of a few Indian coal samples in presence of HCOOH/H 2 O 2 and V 2 O 5 . Results show the maximum removal of 50.20% of the total sulfur, 48.00% of the organic sulfur, and 70.37 wt% of the ash in this process. The ionic liquids were recovered and subsequently used for further desulfurization. FT-IR spectra reveal the transformation of organic sulfur functionalities into the sulfoxides (S=O) and sulfones (-SO 2 ) due to the oxidative reactions. The sulfate, pyrite and sulfides (aryls) signals in the near edge X-ray absorption fine structure (NEXAFS) of the oxidized coal samples showed sulfur transformation during the desulfurization process. The study demonstrates the removal of significant amount of inorganic as well as organic sulfur (aryls) components from the original high sulfur coal samples to make them cleaner

  12. Coal and Oil: The Dark Monarchs of Global Energy: Understanding Supply and Extraction Patterns and their Importance for Future Production

    International Nuclear Information System (INIS)

    Hoeoek, Mikael

    2010-01-01

    The formation of modern society has been dominated by coal and oil, and together these two fossil fuels account for nearly two thirds of all primary energy used by mankind. This makes future production a key question for future social development and this thesis attempts to answer whether it is possible to rely on an assumption of ever increasing production of coal and oil. Both coal and oil are finite resources, created over long time scales by geological processes. It is thus impossible to extract more fossil fuels than geologically available. In other words, there are limits to growth imposed by nature. The concept of depletion and exhaustion of recoverable resources is a fundamental question for the future extraction of coal and oil. Historical experience shows that peaking is a well established phenomenon in production of various natural resources. Coal and oil are no exceptions, and historical data shows that easily exploitable resources are exhausted while more challenging deposits are left for the future. For oil, depletion can also be tied directly to the physical laws governing fluid flows in reservoirs. Understanding and predicting behaviour of individual fields, in particularly giant fields, are essential for understanding future production. Based on comprehensive databases with reserve and production data for hundreds of oilfields, typical patterns were found. Alternatively, depletion can manifest itself indirectly through various mechanisms. This has been studied for coal. Over 60% of the global crude oil production is derived from only around 330 giant oilfields, where many of them are becoming increasingly mature. The annual decline in existing oil production has been determined to be around 6% and it is unrealistic that this will be offset by new field developments, additional discoveries or unconventional oil. This implies that the peak of the oil age is here. For coal a similar picture emerges, where 90% of the global coal production originates

  13. Development of Continuous Solvent Extraction Processes For Coal Derived Carbon Products

    Energy Technology Data Exchange (ETDEWEB)

    Elliot B. Kennel; Dady B. Dadyburjor; Gregory W. Hackett; Manoj Katakdaunde; Liviu Magean; Alfred H. Stiller; Robert C. Svensson; John W. Zondlo

    2006-09-30

    In this reporting period, tonnage quantities of coal extract were produced but solid separation was not accomplished in a timely manner. It became clear that the originally selected filtration process would not be effective enough for a serious commercial process. Accordingly, centrifugation was investigated as a superior means for removing solids from the extract. Results show acceptable performance. Petrographic analysis of filtered solids was carried out by R and D Carbon Petrography under the auspices of Koppers and consultant Ken Krupinski. The general conclusion is that the material appears to be amenable to centrifugation. Filtered solids shows a substantial pitch component as well as some mesophase, resulting in increased viscosity. This is likely a contributing reason for the difficulty in filtering the material. Cost estimates were made for the hydotreatment and digestion reactors that would be needed for a 20,000 ton per year demonstration plants, with the aid of ChemTech Inc. The estimates show that the costs of scaling up the existing tank reactors are acceptable. However, a strong recommendation was made to consider pipe reactors, which are thought to be more cost effective and potentially higher performance in large scale systems. The alternate feedstocks for coke and carbon products were used to fabricate carbon electrodes as described in the last quarterly report. Gregory Hackett successfully defended his MS Thesis on the use of these electrodes in Direct Carbon Fuel Cell (DCFC), which is excerpted in Section 2.4 of this quarterly report.

  14. Trends of recent coal science. Extracted from essays presented at 1989-ICCS; Saikin no sekitan kagaku no doko. 1989 ICCS no ronbun happyo yori

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-03-01

    The 5th IEA (International Energy Agency) International Conference on Coal Science (1989-ICCS) was held in Tokyo in October 1989. A number of essays relative to the basics and applications of the coal science were presented at the event, and recent trends of the coal science have been extracted from these essays and complied into this survey report. In the field of basic coal reaction, it is stated that basic studies relating to the coal structure, physical properties, and chemistry are necessary for the future coal science and that it will be very difficult to construct a database covering various types of coals conserved under different circumstances. In the field of basics of coal combustion and gasification, essays are introduced, titled 'Gasification reactivity and coal structure' and 'Role of catalysts in gasification reaction.' Furthermore, future trends of the science are predicted from the viewpoint of 'Problems of global environment and research on coal gasification.' In the field of coal liquefaction, essays are introduced which discuss the improvement of the coal process, enhancement of cost effectiveness, and higher efficiency, and point to the subjects of research in the future. (NEDO)

  15. Trends of recent coal science. Extracted from essays presented at 1989-ICCS; Saikin no sekitan kagaku no doko. 1989 ICCS no ronbun happyo yori

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-03-01

    The 5th IEA (International Energy Agency) International Conference on Coal Science (1989-ICCS) was held in Tokyo in October 1989. A number of essays relative to the basics and applications of the coal science were presented at the event, and recent trends of the coal science have been extracted from these essays and complied into this survey report. In the field of basic coal reaction, it is stated that basic studies relating to the coal structure, physical properties, and chemistry are necessary for the future coal science and that it will be very difficult to construct a database covering various types of coals conserved under different circumstances. In the field of basics of coal combustion and gasification, essays are introduced, titled 'Gasification reactivity and coal structure' and 'Role of catalysts in gasification reaction.' Furthermore, future trends of the science are predicted from the viewpoint of 'Problems of global environment and research on coal gasification.' In the field of coal liquefaction, essays are introduced which discuss the improvement of the coal process, enhancement of cost effectiveness, and higher efficiency, and point to the subjects of research in the future. (NEDO)

  16. PLANT RAW MATERIAL EXTRACTS AS COMPONENTS OF COSMETIC PRODUCTS AND FORMULATIONS FOR TOPICAL ADMINISTRATION: THE PRODUCT RANGE, THE PRODUCTION CHARACTERISTICS (REVIEW

    Directory of Open Access Journals (Sweden)

    S. B. Evseeva

    2016-01-01

    Full Text Available In contemporary pharmaceutical practice extracts are used as a separate cosmetic product and as an intermediate for external medicinal forms (ointments, gels, liniments and cosmetic forms. Their range is highly diverse.The aim is an overview of the scientific and technical information concerning plant  raw materials extracts using in the external drug and cosmetic products.Methods. To describe the range of extracts proposed for external use the analysis of the proposals of Russian and foreign producers submitted their official websites and online trading platforms was used. The specificity of extraction of biologically active substances of plant extracting agents: water, ethyl alcohol, glycols, vegetable oils, carbon dioxide used to obtain extracts was described on the basis of available scientific literature (eLIBRARY, PubMed, Cyberleninca, Google Books. Results. Examples of external drugs and cosmetic products based on plant raw materials extracts from a range of pharmaceutical organizations are given. It was found that from the extracting solvent used the range is presented by hydrophilic, such as glycol (propylene glycol, glycerin, water, alcoholic extracts; lipophilic (oil, CO2-extracts, and two-phase (caprylic/caprate triglyceride/water extracts. The main features of the extracting solvent used for this category of extracts: the specifics of the use in cosmetics (the skin specific effect, in particular selectivity to groups of biologically active plant substances, microbiological purity, are noted. Results of research data on the study of the prospects for the use of cosmetic ingredients – silicones, caprylic/ capric triglyceride, isopropyl myristate both solvents. The extraction techniques: classical (maceration, percolation and intensified (electro-plasma dynamic extraction, vacuum extraction circulation, CO2 supercritical extraction used in industry to produce cosmetic extracts are described

  17. Examination of the role of CS{sub 2} in the CS{sub 2}/NMP mixed solvents to coal extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shui, Hengfu; Wang, Zhicai [School of Chemistry and Chemical Engineering, Anhui University of Technology, 243002 Maanshan Anhui (China); Gao, Jinsheng [Department of Energy Resources and Chemical Engineering, East China University of Science & amp; Technology, 200237 Shanghai (China)

    2006-02-15

    The roles of CS{sub 2} in the CS{sub 2}/NMP mixed solvent to coal extraction and solubilization were investigated in this study. There was little effect of removing of CS{sub 2} from the solutions on the solubilities of UF coal extract and pyridine insoluble (PI) of the extract in the NMP/CS{sub 2} mixed solvent, suggesting that NMP has high enough solubilities to the UF coal extract and PI. Six Argonne different rank coals were extracted with the CS{sub 2}/NMP mixed solvent and NMP, respectively. It was found that the extraction yield difference between NMP and CS{sub 2}/NMP mixed solvent for UF coal is largely deviated from the curve obtained for the other 5 coals, suggesting that the pre-swelling of CS{sub 2} in the mixed solvent may be one of important roles for high extraction yield of UF coal in the CS{sub 2}/NMP mixed solvent. FTIR indicated that there was a strong interaction between CS{sub 2} and NMP in the CS{sub 2}/NMP mixed solvent of 1:1 volume ratio, which made the strong absorbance at 2156 cm{sup -1} in the FTIR spectra, and this interaction may disrupt the dipole based association of NMP thus making the CS{sub 2}/NMP mixed solvent lower viscosity, to penetrate more quickly into the network structure of coal, resulting in the larger solvent partner (NMP) to enter and break the stronger coal-coal interactions. (author)

  18. Maintenance of raw and cooked ready-to-eat product quality of infused poultry meats with selected plant extracts during electron beam irradiation and after storage

    Science.gov (United States)

    Rababah, Taha

    The purpose of this study included: preparing plant extracts and evaluating these extracts for total phenolics and antioxidant activities (AA); infusing extract/combination that demonstrates superior AA into chicken breast and irradiating at 3.0 kGy; evaluating the physicochemical properties of irradiated and non-irradiated raw and cooked chicken breast at 5°C for 12 days and -20°C for 9 months; and selecting the extracts that demonstrated desirable AA, infusing these extracts into chicken breast and evaluating head-space volatiles, and conducting sensory evaluation. The total phenolic content and AA of the plant extracts ranged from 24.8 to 92.5 mg/g dry material (conjugated diene of methyl linoleate) and 3.4 to 86.3%, respectively. The AA of plant extracts using oxidative stability instrument were 4.6 to 10.2 h (Induction time). Green tea and grape seed extracts had the highest AA within several plant extracts, and were selected to retard lipid oxidation in further studies. Fresh boneless and skinless chicken breast meats were vacuum infused with varying concentrations of antioxidants: Green tea and grape seed extracts alone/in combination and tert-butylhydroquinone. The results showed that irradiation had no significant effect on pH, water holding capacity, but increased the redness and carbonyls in raw meats (p extracts into meats increased lightness and decreased redness as well as hardness and shear force. Irradiation increased TBARS, hexanal, and pentanal values in raw and cooked meats. Addition of plant extracts decreased the amount of TBARS, hexanal, pentanal, and carbonyl values. Similar results were observed when the samples were stored at -20°C for 9 months. Descriptive sensory flavor results showed that irradiation did not affect the flavor attributes. Consumer, descriptive, and instrumental results showed that irradiation increased toughness, green tea improved the meat color, and the panel indicated that irradiation decreased the tenderness of the

  19. Converting coal

    Energy Technology Data Exchange (ETDEWEB)

    Avigliano, A. [Bedeschi (Italy)

    2006-10-15

    In September 2005, Bedeschi was commissioned to design and supply a coal unloading, conveying and storage facility for a new raw coal line system within Hatien II Cement Co. The new plant is composed of a grab unloader, a conveyor system, a storage shed with stacking and reclaiming facilities, a complete dedusting system and civil and steel structure engineering. The scope of supply includes a local fabrication portion; however, main components will be imported. The project will be completed in 21 months. The paper looks into the mechanics of loading and unloading coal. 4 figs., 4 photos.

  20. Microwave assisted aqua regia extraction of thallium from sediment and coal fly ash samples and interference free determination by continuum source ETAAS after cloud point extraction.

    Science.gov (United States)

    Meeravali, Noorbasha N; Madhavi, K; Kumar, Sunil Jai

    2013-01-30

    A simple cloud point extraction method is described for the separation and pre-concentration of thallium from the microwave assisted aqua regia extracts of sediment and coal fly ash samples. The method is based on the formation of extractable species of thallium and its interaction with hydrophobic solubilizing sites of Triton X-114 micelles in the presence of aqua regia and electrolyte NaCl. These interactions of micelles are used for extraction of thallium from a bulk aqueous phase into a small micelles-rich phase. The potential chloride interferences are eliminated effectively, which enabled interference free determination of thallium from aqua regia extracts using continuum source ETAAS. The parameters affecting the extraction process are optimized. Under the optimized conditions, pre-concentration factor and limit of detection are 40 and 0.2 ng g(-1), respectively. The recoveries are in the range of 95-102%. A characteristic mass, 13 pg was obtained. The accuracy of the method is verified by analyzing certified reference materials such as NIST 1633b coal fly ash, NIST 1944 marine sediment and GBW 07312 stream sediments. The results obtained are in good agreement with the certified values and method is also applied to real samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Preparation and extraction of sloping seams without leaving inter-drift coal pillars

    Energy Technology Data Exchange (ETDEWEB)

    Artamonov, N S; Bormotov, I N; Brovko, I I

    1977-10-01

    A description is given of mining three coal seams in the Kuznetsk Basin without leaving coal pillars because they could not withstand the stress of the induced reference pressure. This system reduced coal losses in 1976 in comparison to 1970 and eliminated local accumulations of methane by withdrawing it through the excavated area. The system was noted to have the disadvantage of additional expenditures for timber supports. 2 figures.

  2. Ultravitrinite coals from Chukotka

    Energy Technology Data Exchange (ETDEWEB)

    Lapo, A.V.; Letushova, I.A.

    1979-03-01

    Chemical and petrographic analysis was conducted on coals from the Anadyrya and Bukhti Ugol'noi deposits. Characteristics of the most prevalent type of vitrinite coals in both regions are presented here. Anadyrya coals belong to a transitional phase between brown coal and long flame. Ultravitrinite coals predominate. Gas coals from Bukti Ugol'noi have a higher carbon content than Anadyrya coals. They also have a higher hydrogen content and yield of initial resin. In several cases there was also a higher yield of volatile substances. Chukotka coals are characterized by a 10 percent higher initial resin yield than equally coalified Donetsk coals, other indicators were equal to those of Donetsk coals. Because of this, Chukotka coals are suitable for fuel in power plants and as raw materials in the chemical industry. (15 refs.) (In Russian)

  3. Preparation and Properties of Asphalt Binders Modified by THFS Extracted From Direct Coal Liquefaction Residue

    Directory of Open Access Journals (Sweden)

    Jie Ji

    2017-11-01

    Full Text Available This paper aims to study the preparation and viscoelastic properties of asphalt binder modified by tetrahydrofuran soluble fraction (THFS extracted from direct coal liquefaction residue. The modified asphalt binders, which blended with SK-90 (control asphalt binder and 4%, 6%, 8% and 10% THFS (by weight of SK-90, were fabricated. The preparation process for asphalt binder was optimized in terms of the orthogonal array test strategy and gray correlation analysis results. The properties of asphalt binder were measured by applying Penetration performance grade and Superpave performance grade specifications. In addition, the temperature step and frequency sweep test in Dynamic Shear Rheometer were conducted to predict the rheological behavior, temperature and frequency susceptibility of asphalt binder. The test results suggested the optimal preparation process, such as 150 °C shearing temperature, 45 min shearing time and 4000 rpm shearing rate. Subsequently, the addition of THFS was beneficial in increasing the high-temperature properties but decreased the low-temperature properties and resistance to fatigue. The content analysis of THFS showed the percentage of 4~6% achieved a balance in the high-and-low temperature properties of asphalt binder. The asphalt binder with higher THFS content exhibited higher resistance to rutting and less sensitivity to frequency and temperature.

  4. Molecular composition of light portion from CS{sub 2}/NMP-extractable fraction of Hami and Lingwu coals

    Energy Technology Data Exchange (ETDEWEB)

    Ji-Xian Jia; Zhi-Min Zong; Xin Jin; Chan-Min Liu; Hong Zhang; Yan Li; Bin Huang; Xian-Yong Wei [China University of Mining and Technology, Xuzhou (China). School of Chemical Engineering

    2007-07-01

    Hami and Lingwu coals were extracted with a CS{sub 2}/NMP mixed solvent (1:1 by vol) under ultrasonic irradiation at room temperature. After removing most of CS{sub 2} and NMP by distillation under ambient and reduced pressures, respectively, from the extraction solution, the extract was extracted with petroleum ether (PE) in a Soxhlet extractor. Two layers appeared after concentrating the PE-extractable solution. GC/MS analysis shows that the upper layer mainly consists of normal and branched alkanes along with cyclanes, whereas main components in the lower layer are non-substituted and substituted arenes along with heteroatom-containing organic compounds. 15 refs., 2 figs., 1 tab.

  5. Supercritical gas extracts from low-quality coals. On the search of new precursors for carbon materials

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, Roberto; Arenillas, Ana; Rubiera, Fernando; Moinelo, Sabino R. [Instituto Nacional del Carbon INCAR, CSIC, Apartado 73, 33080, Oviedo (Spain)

    2004-11-25

    This paper studies the chemical composition of several supercritical gas (SCG) extracts and its influence on the thermal behaviour under carbonisation conditions. The extracts were obtained from a Spanish lignite (Mequinenza), a low-quality coal from the point of view of energy applications. The lignite was treated with toluene, ethanol (EtOH) and tetrahydrofuran (THF) as solvents under different supercritical temperature and pressure conditions. The extracts display high aliphatic nature and enhanced concentrations of oxygen functional groups, aided by the contribution of hydrogenation and oxygen incorporation reactions occurring in the SCG extraction with EtOH and THF. Thiophenic compounds are also present in great concentrations derived from the exceptionally high organic sulphur content of the parent coal. The carbonisation of the extracts renders anisotropic material with fine mosaic texture, as a consequence of the significant thermal reactivity inferred by the aliphatic and oxygenated groups. The size of the mosaic increases with the temperature of the SCG extraction and varies with the supercritical solvent in the order: toluene

  6. Imprinted magnetic graphene oxide for the mini-solid phase extraction of Eu (III) from coal mine area

    Science.gov (United States)

    Patra, Santanu; Roy, Ekta; Madhuri, Rashmi; Sharma, Prashant K.

    2017-05-01

    The present work represents the preparation of imprinted magnetic reduced graphene oxide and applied it for the selective removal of Eu (III) from local coal mines area. A simple solid phase extraction method was used for this purpose. The material shows a very high adsorption as well as removal efficiency towards Eu (III), which suggest that the material have potential to be used in future for their real time applications in removal of Eu (III) from complex matrices.

  7. Control of microorganisms of oral health interest with Arctium lappa L. (burdock) extract non-cytotoxic to cell culture of macrophages (RAW 264.7).

    Science.gov (United States)

    de Oliveira, Jonatas Rafael; de Aguiar Almeida, Rosilene Batista; das Graças Figueiredo Vilela, Polyana; de Oliveira, Felipe Eduardo; da Rocha, Rosilene Fernandes; Jorge, Antonio Olavo Cardoso; de Oliveira, Luciane Dias

    2014-08-01

    To evaluate the antimicrobial activity of Arctium lappa L. extract on Staphylococcus aureus, S. epidermidis, Streptococcus mutans, Candida albicans, C. tropicalis and C. glabrata. In addition, the cytotoxicity of this extract was analyzed on macrophages (RAW 264.7). By broth microdilution method, different concentrations of the extract (250-0.4 mg/mL) were used in order to determine the minimum microbicidal concentration (MMC) in planktonic cultures and the most effective concentration was used on biofilms on discs made of acrylic resin. The cytotoxicity A. lappa L. extract MMC was evaluated on RAW 264.7 by MTT assay and the quantification of IL-1β and TNF-α by ELISA. The most effective concentration was 250 mg/mL and also promoted significant reduction (log₁₀) in the biofilms of S. aureus (0.438 ± 0.269), S. epidermidis (0.377 ± 0.298), S. mutans (0.244 ± 0.161) and C. albicans (0.746 ± 0.209). Cell viability was similar to 100%. The production of IL-1β was similar to the control group (p>0.05) and there was inhibition of TNF-α (plappa L. extract was microbicidal for all the evaluated strains in planktonic cultures, microbiostatic for biofilms and not cytotoxic to the macrophages. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Prospects For Coal And Clean Coal Technologies In Kazakhstan

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-12-15

    The coal sector in Kazakhstan is said to have enough reserves to last over 100 years, but the forecasted reserves are expected to last several hundreds of years. This makes investing in the fuel and energy sector of the country an attractive option for many international and private organisations. The proven on-shore reserves will ensure extraction for over 30 years for oil and 75 years for gas. The future development of the domestic oil sector depends mainly on developing the Kazakh sector of the Caspian Sea. The coal sector, while not a top priority for the Kazakh government, puts the country among the world's top ten coal-rich countries. Kazakhstan contains Central Asia's largest recoverable coal reserves. In future, the development of the raw materials base will be achieved through enriching and improving the quality of the coal and the deep processing of coal to obtain fluid fuel and synthetic substances. Developing shale is also topical. The high concentration of methane in coal layers makes it possible to extract it and utilise it on a large scale. However, today the country's energy sector, which was largely established in the Soviet times, has reached its potential. Kazakhstan has about 18 GW of installed electricity capacity, of which about 80% is coal fired, most of it built before 1990. Being alert to the impending problems, the government is planning to undertake large-scale modernisation of the existing facilities and construct new ones during 2015-30. The project to modernise the national electricity grid aims to upgrade the power substations to ensure energy efficiency and security of operation. The project will result in installation of modern high-voltage equipment, automation and relay protection facilities, a dispatch control system, monitoring and data processing and energy management systems, automated electricity metering system, as well as a digital corporate telecommunication network.

  9. Experimental use of road header (AM-50) as face cutting machine for extraction of coal in longwall panel

    Energy Technology Data Exchange (ETDEWEB)

    Passi, K.K.; Kumar, C.R.; Prasad, P. [DGMS, Dhanbad (India)

    2001-07-01

    The scope of this paper has been limited to the use of available machines and techniques for attaining higher and more efficient production in underground coal mines. Under certain conditions of strata and higher degree of gassiness, the longwall method with hydraulic sand stowing is the only appropriate method of work for extraction of thick seam. In Moonidih Jitpur Colliery of M/S IISCO, No. 14 seam, Degree III gassy seam, 9.07 m thick, is extracted in multilift system with hydraulic sand stowing. In general, the bottom lift is extracted by Single Ended Ranging Arm Shearer and the middle and top lift are extracted by conventional method. However, in one of the panels spare road header machine was used as face cutting machine in bottom lift, on an experimental basis. This paper presents a successful case study of extraction of bottom lift coal by the longwall method with hydraulic sand stowing using road header (AM 50) as the face cutting machines. 9 figs.

  10. Development of mechanization of extraction in underground coal mining (part I)

    Energy Technology Data Exchange (ETDEWEB)

    Strzeminski, J

    1984-01-01

    The history of underground coal mining and history of mechanizing underground operations of cutting, strata control, mine haulage, hoisting and ventilation are discussed. The following development periods are characterized: until 1769 (date of steam engine invention by J. Watt), from 1769 to 1945 (period of partial mechanization of operations in underground coal mining), from 1945 (period of comprehensive mechanization and automation). A general description of mining in the first development period is given. Evaluation of the second development period concentrates on mechanization in underground coal mining. The following equipment types are described: cutting (pneumatic picks and pneumatic drills, coal saws developed by Eickhoff, coal cutters developed after 1870, cutter loaders patented in 1925-1927, coal plows and coal cutter loaders), mine haulage (mine cars, conveyors developed in the United Kingdom, Germany and Russia, Poland), strata control at working faces (timber props, steel friction props, roof bars), strata control in the goaf (room and pillar mining, stowing, minestone utilization for stowing in Upper Silesia, hydraulic stowing in Upper Silesia). 5 references.

  11. Organic substances in produced and formation water from unconventional natural gas extraction in coal and shale

    Science.gov (United States)

    Orem, William H.; Tatu, Calin A.; Varonka, Matthew S.; Lerch, Harry E.; Bates, Anne L.; Engle, Mark A.; Crosby, Lynn M.; McIntosh, Jennifer

    2014-01-01

    Organic substances in produced and formation water from coalbed methane (CBM) and gas shale plays from across the USA were examined in this study. Disposal of produced waters from gas extraction in coal and shale is an important environmental issue because of the large volumes of water involved and the variable quality of this water. Organic substances in produced water may be environmentally relevant as pollutants, but have been little studied. Results from five CBM plays and two gas shale plays (including the Marcellus Shale) show a myriad of organic chemicals present in the produced and formation water. Organic compound classes present in produced and formation water in CBM plays include: polycyclic aromatic hydrocarbons (PAHs), heterocyclic compounds, alkyl phenols, aromatic amines, alkyl aromatics (alkyl benzenes, alkyl biphenyls), long-chain fatty acids, and aliphatic hydrocarbons. Concentrations of individual compounds range from gas shale unimpacted by production chemicals have a similar range of compound classes as CBM produced water, and TOC levels of about 8 mg/L. However, produced water from the Marcellus Shale using hydraulic fracturing has TOC levels as high as 5500 mg/L and a range of added organic chemicals including, solvents, biocides, scale inhibitors, and other organic chemicals at levels of 1000 s of μg/L for individual compounds. Levels of these hydraulic fracturing chemicals and TOC decrease rapidly over the first 20 days of water recovery and some level of residual organic contaminants remain up to 250 days after hydraulic fracturing. Although the environmental impacts of the organics in produced water are not well defined, results suggest that care should be exercised in the disposal and release of produced waters containing these organic substances into the environment because of the potential toxicity of many of these substances.

  12. Insights into the coal extractive solvent N-methyl-2-pyrrolidone + carbon disulfide

    Energy Technology Data Exchange (ETDEWEB)

    Santiago Aparicio; Mara J. Davila; Rafael Alcalde [University of Burgos, Burgos (Spain). Department of Chemistry

    2009-03-15

    A wide set of experimental and computational tools were used to characterize the N-methyl-2-pyrrolidone (NMP) + carbon disulfide mixed solvent in the full composition range. The interest in this solvent rose from its very efficient use for coal extraction through a mechanism still not fully understood. Thermophysical properties at ambient pressure together with pressure-volume-temperature (PVT) behavior were measured with the objective of providing the required data for the industrial use of the mixed fluid and to get insight into the fluid structure at the molecular level. NMR, FTIR, and solvatochromic studies were performed together with microwave dielectric relaxation spectroscopy (DRS) measurements, thus providing more information on the fluid's structure and allowing one to relate the molecular level behavior with the measured macroscopic properties. Moreover, density functional theory (DFT) and classical molecular dynamics simulations (MD) were used to obtain a detailed picture of the intermolecular interactions within the fluid, at short and long ranges, and of other relevant features leading to the structure of the studied system. The whole study leads to a fluid's picture in which carbon disulfide hinders the development of NMP/NMP intermolecular dipolar interactions, thus increasing the monomer population. We should remark that some properties reported in this work are in remarkable disagreement with previously reported studies, the most important one being the positive excess molar volume in the whole pressure-temperature range studied, which contrasts with the negative values reported in the literature. Previously reported properties are hardly justified with a coherent molecular level picture, whereas the whole collection of properties reported in this work leads to a more reasonable fluid's structure. 56 refs., 17 figs., 2 tabs.

  13. Coal extraction causes sediment toxicity in aquatic environments in Santa Catarina, Brazil

    Directory of Open Access Journals (Sweden)

    Lucimaira Amaral de Freitas

    2017-08-01

    Full Text Available This study evaluated water parameters in ponds affected by coal extraction. Allium cepa assay was used to measure genotoxicity/mutagenicity of the sediment. Samples were collected from four ponds in the southern state of Santa Catarina. Water temperature, pH, dissolved oxygen, conductivity and turbidity were measured. Sediments were analyzed for heavy metals. Elutriate samples were prepared at a ratio of 1:4 sediment:water. Allium cepa bulbs were placed in samples prepared from each pond, with ultrapure water used as negative control and methyl methane sulfonate as positive control. Root length, mitotic index, chromosomal aberrations, micronuclei, and nuclear abnormalities were measured. The pH of two ponds, as well as electrical conductivity and dissolved oxygen of all ponds were below the minimum limits set by Brazilian regulation. All heavy metals analyzed were found in all sediment samples, but only Cd concentration was above the legal limit set by Brazilian law. Allium cepa root growth for samples from Ponds 1, 2, and 4 was significantly lower than the negative control. Meristematic cells exposed to elutriate samples showed no significant changes in cell division. There was a significant increase in total chromosomal aberrations in all treated samples in comparison with the negative control. This study demonstrates that even low concentrations of heavy metals can damage exposed biota, possibly due to synergistic effects. We also found the A. cepa bioassay to be a simple and useful tool for genotoxicity/mutagenicity analyses, and recommend its use for environmental monitoring and management in areas influenced by mining activities.

  14. Extracts of Porphyra tenera (Nori Seaweed) Activate the Immune Response in Mouse RAW264.7 Macrophages via NF-κB Signaling.

    Science.gov (United States)

    Song, Ji-Hye; Kang, Hee-Bum; Park, Seung-Ho; Jeong, Ji-Hoon; Park, Jeongjin; You, Yanghee; Lee, Yoo-Hyun; Lee, Jeongmin; Kim, Eungpil; Choi, Kyung-Chul; Jun, Woojin

    2017-12-01

    Porphyra tenera, also known as nori, is a red algal species of seaweed. It is cultivated in Asia for culinary purposes. We report that P. tenera extract (PTE) enhances the immune response in mouse macrophages. We found that P. tenera extract regulates the NF-κB IκB kinase (IKK) signaling pathway, and we assessed the expression and translocation of p65, a subunit of NF-κB, in RAW264.7 mouse macrophage cells after treatment with PTE. We also investigated the effects of 10% ethanol PTE (PTE10) in RAW264.7 cells. The production of IL-10, IL-6, TNF-α, and IFN-γ was induced by PTE treatment of the macrophages, and PTE also enhanced p-IκB and p-AKT. PTE10 showed no cytotoxicity at 10-20 μg/mL in RAW264.7 cells. PTE10, in fact, increased cell viability at 24 h, stimulated macrophage cells, and induced the phosphorylation of Akt. Akt stimulates IKK activity through the phosphorylation of IKKα and enhances immune activity through the activation of NF-κB. In this study, NF-κB activation was induced by increasing p-NF-κB and p-IKK. A subunit of NF-κB, p65, was located in the nucleus and increased the expression of various cytokines. PTE thus enhanced the immune response through IκB-α immunostimulation signaling in RAW264.7 cells. PTE10 has potential therefore for development of future treatments requiring immune system stimulation.

  15. Rock Mechanics Studies During Continuous Miner Bases Coal Pillar Extraction in Indian Coalfields

    Czech Academy of Sciences Publication Activity Database

    Ram, S.; Kumar, D.; Koníček, Petr; Singh, A. K.; Kumar, R.; Singh, A. Kr.; Singh, R.

    2015-01-01

    Roč. 111, April 2014-March 2015 (2015), s. 89-104 ISSN 0254-8003 Institutional support: RVO:68145535 Keywords : mining * mechanized depillaring scenario * rock mechanics Subject RIV: DH - Mining, incl. Coal Mining

  16. Stress-state monitoring of coal pillars during room and pillar extraction

    Czech Academy of Sciences Publication Activity Database

    Waclawik, Petr; Ptáček, Jiří; Koníček, Petr; Kukutsch, Radovan; Němčík, J.

    2016-01-01

    Roč. 15, č. 2 (2016), s. 49-56 ISSN 2300-3960 R&D Projects: GA MŠk(CZ) LO1406; GA MŠk ED2.1.00/03.0082 Institutional support: RVO:68145535 Keywords : stress-state monitoring * room and pillar * coal pillar Subject RIV: DH - Mining , incl. Coal Mining http://www.sciencedirect.com/science/article/pii/S2300396016300180

  17. Self-scrubbing coal

    International Nuclear Information System (INIS)

    Kindig, J.K.

    1992-01-01

    More than 502 million tons - 65 percent of all coal shipped to utilities in 1990 - were above 1.2 pounds of sulfur dioxide per million Btu. Most of the coal, even though cleaned in conventional coal preparation plants, still does not meet the emission limitation the Clean Air Act Amendments mandate for the year 2000. To cope with this fact, most utilities plan to switch to low sulfur (western U.S. or Central Appalachian) coal or install scrubbers. Both solutions have serous drawbacks. Switching puts local miners out of work and weakens the economy in the utility's service territory. Scrubbing requires a major capital expenditure by the utility. Scrubbers also increase the operating complexity and costs of the generating station and produce yet another environmental problem, scrubber sludge. Employing three new cost-effective technologies developed by Customer Coals International (CCl), most non-compliance coals east of the Mississippi River can be brought into year-2000 compliance. The compliance approach employed, depends upon the characteristics of the raw coal. Three types of raw coal are differentiated, based upon the amount of organic sulfur in the coals and the ease (or difficultly) of liberating the pyrite. They are: Low organic sulfur content and pyrite that liberates easily. Moderate organic sulfur content and pyrite that liberates easily. High organic sulfur content or the pyrite liberates with difficulty. In this paper examples of each type of raw coal are presented below, and the compliance approach employed for each is described. The names of the beneficiated coal products produced from each type of raw coal give above are: Carefree Coal, Self-Scrubbing Coal and Dry-Scrubbing Coal

  18. Study on Al2O3 extraction from activated coal gangue under different calcination atmospheres

    Science.gov (United States)

    Dong, Ling; Liang, Xinxing; Song, Qiang; Gao, Gewu; Song, Lihua; Shu, Yuanfeng; Shu, Xinqian

    2017-12-01

    Coal gangue was calcinated under air, nitrogen, carbon dioxide, air-hydrogen, and hydrogen atmospheres. The effects of different calcination temperatures and atmospheres on the mineral composition of activated coal gangue were investigated by X-ray diffraction. Moreover, the acid leaching kinetics of aluminum oxide from coal gangue was investigated with sulfuric acid. It showed that the air atmosphere promoted kaolinite decomposition during coal gangue calcination. The hydrogen atmosphere promoted the activation and decomposition of kaolinite at reaction temperatures exceeding 650°C. The carbon dioxide atmosphere eliminated the influence of residual carbon on coal gangue. When the ratio of acid/coal gangue was 1.5 and reaction temperature was 650°C, the sulfuric acid leaching rate under air, air-hydrogen, carbon dioxide, hydrogen and nitrogen atmospheres were 93.66%, 90.90%, 84.06%, 81.91% and 77.54% respectively. The acid leaching reaction process conformed to unreacted shrinking core model of particle unchanged, and was controlled by the interfacial chemical reaction. The reaction kinetic equation for the leaching process was 1-(1-x)1/3=kt with an apparent activation energy of 48.97 kJ/mol.

  19. Sewage sludge as a fuel and raw material for phosphorus recovery: Combined process of gasification and P extraction.

    Science.gov (United States)

    Gorazda, K; Tarko, B; Werle, S; Wzorek, Z

    2018-03-01

    Increasing problems associated with sewage sludge disposal are observed nowadays. As the thermal conversion of sewage sludge (combustion, co-combustion, gasification and pyrolysis) appears to be the most promising alternative for its management, the solid residues left after gasification were examined. The present study evaluates the potential of this waste as an alternative phosphorus source in the context of phosphorus recovery. The obtained solid gasification residues were characterised (chemical and phase composition, thermal properties, surface properties and technological parameters used for phosphorus raw materials) and compared to commercial phosphate raw materials. It was revealed that gasification residue is a valuable source of phosphorus and microelements, comparable to sewage sludge ash (SSA) considered nowadays as secondary phosphorus raw materials. Chemical properties as well as technological parameters characteristic for natural phosphate ores are different. Solid gasification residue was leached with mineral acids (phosphoric and nitric) according to the patented method of phosphorus recovery - PolFerAsh, developed by Cracow University of Technology. It was revealed that phosphorus can be selectively leached from solid gasification residue with high efficiency (73-82%); moreover, most of the iron and heavy metals stay in the solid phase due to the low concentration of acids and proper solid to liquid phase ratio. The obtained leachates are valuable products that can be considered for the production of fertilisers. Combining the gasification process with nutrient recovery provides the opportunity for more environmentally efficient technologies driven by sustainable development rules. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. New Approach of Feature Extraction Method Based on the Raw Form and his Skeleton for Gujarati Handwritten Digits using Neural Networks Classifier

    Directory of Open Access Journals (Sweden)

    K. Moro

    2014-12-01

    Full Text Available This paper presents an optical character recognition (OCR system for Gujarati handwritten digits. One may find so much of work for latin writing, arabic, chines, etc. but Gujarati is a language for which hardly any work is traceable especially for handwritten characters. Here in this work we have proposed a method of feature extraction based on the raw form of the character and his skeleton and we have shown the advantage of using this method over other approaches mentioned in this article.

  1. The immune-enhancing activity of Cervus nippon mantchuricus extract (NGE) in RAW264.7 macrophage cells and immunosuppressed mice.

    Science.gov (United States)

    Hong, Se Hyang; Ku, Jin Mo; In Kim, Hyo; Ahn, Chang-Won; Park, Soo-Hyun; Seo, Hye Sook; Shin, Yong Cheol; Ko, Seong-Gyu

    2017-09-01

    Chemotherapeutics are often used to inhibit the proliferation of cancer cells. However, they can also harm healthy cells and cause side effects such as immunosuppression. Especially traditional oriental medicines long used in Asia, may be beneficial candidates for the alleviation of immune diseases. Cervus nippon mantchuricus extract (NGE) is currently sold in the market as coffee and health drinks. However, NGE was not widely investigated and efficacy remain unclear and essentially nothing is known about their potential immune-regulatory properties. As a result, NGE induced the differentiation of RAW264.7 macrophage cells. NGE-stimulated RAW264.7 macrophage cells elevated cytokines levels and NO production. NGE-stimulated RAW264.7 macrophage cells activated MAPKs and NF-κB signaling pathways. NGE encouraged the immuno-enhancing effects in immunosuppressed short-term treated with NGE mice model. NGE or Red ginseng encouraged the immuno-enhancing effects in immunosuppressed long-term treated with NGE mice model. Our data clearly show that NGE contains immune-enhancing activity and can be used to treat immunodeficiency. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Surface tension of a coal extract in an organic solvent; Sekitan chushutsu seibun no kaigo to hyomen choryoku

    Energy Technology Data Exchange (ETDEWEB)

    Kikuchi, T.; Hayasaka, K.; Takanohashi, T.; Iino, M. [Tohoku University, Sendai (Japan). Institute for Chemical Reaction Science

    1996-10-28

    The behavior and properties of associated bodies were studied through measurement of surface tension considering acetone-soluble fraction relatively light among various solvent extracts of coal. In experiment, the acetone-soluble fraction was extracted from the substances extracted from Upper Freeport coal as standard specimen using the mixed solvent of carbon disulfide (CS2) and N-methyl-2-pyrrolidinone (NMP), and it was dissolved into NMP after drying. Surface tension was measured by Wilhelmy method. The experimental results are as follows. Equilibrium surface tension is equal to the surface tension of pure solvent in a low concentration range of solution, and decreases with an increase in concentration approaching a fixed value at 0 in log concentration, nearly showing an S curve. Adsorption of species with non-polar aromatic ring of the acetone-soluble fraction on a solution surface probably decreases surface tension. Change with time in surface tension is observed which suggests fast initial reaction and slow subsequent reaction. 4 figs.

  3. A sequential approach to control gas for the extraction of multi-gassy coal seams from traditional gas well drainage to mining-induced stress relief

    International Nuclear Information System (INIS)

    Kong, Shengli; Cheng, Yuanping; Ren, Ting; Liu, Hongyong

    2014-01-01

    Highlights: • The gas reservoirs characteristics are measured and analyzed. • A sequential approach to control gas of multi-gassy coal seams is proposed. • The design of gas drainage wells has been improved. • The utilization ways of different concentrations of gas production are shown. - Abstract: As coal resources become exhausted in shallow mines, mining operations will inevitably progress from shallow depth to deep and gassy seams due to increased demands for more coal products. However, during the extraction process of deeper and gassier coal seams, new challenges to current gas control methods have emerged, these include the conflict between the coal mine safety and the economic benefits, the difficulties in reservoirs improvement, as well as the imbalance between pre-gas drainage, roadway development and coal mining. To solve these problems, a sequential approach is introduced in this paper. Three fundamental principles are proposed: the mining-induced stress relief effect of the first-mined coalbed should be sufficient to improve the permeability of the others; the coal resource of the first-mined seams must be abundant to guarantee the economic benefits; the arrangement of the vertical wells must fit the underground mining panel. Tunlan coal mine is taken as a typical example to demonstrate the effectiveness of this approach. The approach of integrating surface coalbed methane (CBM) exploitation with underground gas control technologies brings three major benefits: the improvement of underground coal mining safety, the implementation of CBM extraction, and the reduction of greenhouse gas emissions. This practice could be used as a valuable example for other coal mines having similar geological conditions

  4. Report of activities of the advanced coal extraction systems definition project, 1979 - 1980

    Science.gov (United States)

    Lavin, M. L.; Isenberg, L.

    1981-01-01

    During this period effort was devoted to: formulation of system performance goals in the areas of production cost, miner safety, miner health, environmental impact, and coal conservation, survey and in depth assessment of promising technology, and characterization of potential resource targets. Primary system performance goals are to achieve a return on incremental investment of 150% of the value required for a low risk capital improvement project and to reduce deaths and disability injuries per million man-hour by 50%. Although these performance goals were developed to be immediately applicable to the Central Appalachian coal resources, they were also designed to be readily adaptable to other coals by appending a geological description of the new resource. The work done on technology assessment was concerned with the performance of the slurry haulage system.

  5. Community perspectives of natural resource extraction: coal-seam gas mining and social identity in Eastern Australia

    Directory of Open Access Journals (Sweden)

    David Lloyd

    2013-01-01

    Full Text Available Using a recent case study of community reaction to proposed coal-seam gas mining in eastern Australia, we illustrate the role of community views in issues of natural resource use. Drawing on interviews, observations and workshops, the paper explores the anti-coal-seam gas social movement from its stages of infancy through to being a national debate linking community groups across and beyond Australia. Primary community concerns of inadequate community consultation translate into fears regarding potential impacts on farmland and cumulative impacts on aquifers and future water supply, and questions regarding economic, social and environmental benefits. Many of the community activists had not previously been involved in such social action. A recurring message from affected communities is concern around perceived insufficient research and legislation for such rapid industrial expansion. A common citizen demand is the cessation of the industry until there is better understanding of underground water system interconnectivity and the methane extraction and processing life cycle. Improved scientific knowledge of the industry and its potential impacts will, in the popular view, enable better comparison of power generation efficiency with coal and renewable energy sources and better comprehension of the industry as a transition energy industry. It will also enable elected representatives and policy makers to make more informed decisions while developing appropriate legislation to ensure a sustainable future.

  6. Raw Materials Market of China

    Directory of Open Access Journals (Sweden)

    Dmitry Alexandrovich Izotov

    2013-12-01

    Full Text Available Deficit of raw materials is becoming an important concern for the Chinese economy as it continues to grow. This deficit is amended with imports, which – in their own turn – are limited by the high level of global prices. The build-up issue of raw materials imports is going to solve by the measures of monetary policy (RMB’s revaluation against the USD. Analysis of China’s market of raw materials reveals that the largest increase in the physical volume of imports is concentrated in crude oil, LNG, iron ore and coal. As for Russia, its supplies and share in total Chinese imports of raw materials tend to increase. Author employs regression equations based on international statistics data to show that RMB’s revaluation, ceteris paribus, increases physical volumes of raw materials imports. However, the main factor of coal and LNG imports growth is energy consumption by Chinese heavy industry; imports of oil products – producers’ prices; meanwhile imports of steel products tend to decrease with the growth of steel exports. RMB’s revaluation increases physical volumes of imports of low value added raw materials from Russia (coal, crude oil, iron ore

  7. Effect of Three-spot Seahorse Petroleum Ether Extract on Lipopolysaccharide Induced Macrophage RAW264.7 Inflammatory Cytokine Nitric Oxide and Composition Analysis.

    Science.gov (United States)

    Chen, LiPing; Shen, XuanRi; Chen, GuoHua; Cao, XianYing; Yang, Jian

    2015-01-01

    Three-Spot seahorse is a traditional medicine in Asian countries. However, the alcohol extract is largely unknown for its anti-inflammatory activity. This study aimed at elucidating fraction of potent anti-inflammatory activity of seahorse. A systematic solvent extraction method of liquid-liquid fractionation of ethanol crude extract gave four fractions petroleum ether (PE), and ethyl acetate (EtOAc), water saturated butanol (n-BuOH), water (H2O). In this study, PE extract was selected for further study after preliminary screening test, and was connected to silica column chromatography and eluted with different polarity of mobile phases, and obtained four active fractions (Fr I, Fr II, Fr III, Fr IV). Effect of separated fractions on inflammation was investigated in lipopolysaccharide (LPS) stimulated murine RAW264.7 cells in vitro. The result shows that seahorse extract was capable of inhibiting the production of nitric oxide (NO) significantly in a dose dependent manner and exhibited no notable cytotoxicity on cell viability. IC50 of fraction IV was 36.31 μg/mL, indicating that separated fraction possessed potent NO inhibitory activity against LPS-induced inflammatory response, thus, demonstrated its in vitro anti-inflammatory potentiality, it may be at least partially explained by the presence of anti-inflammation active substances, phenolic compounds, phospholipids and polyunsaturated fatty acids, especially phospholipids and polyunsaturated fatty acids. It could be suggested that seahorse lipid-soluble components could be used in functional food and anti-inflammatory drug preparations.

  8. Inhibitory effect of a formulated extract from multiple citrus peels on LPS-induced inflammation in RAW 246.7 macrophages

    Directory of Open Access Journals (Sweden)

    Tadahiro Etoh

    2013-06-01

    Full Text Available ABSTRACTBackground: Formulated Citrus Peel Extract (GL made from the peels of six citrus fruits available in Japan, namely navel oranges, citrus hassaku, citrus limon, citrus natsudaidai, citrus miyauchi and satsuma, was initially developed as a cosmetic product to protect skin from UV irradiation. Anecdotal evidences of anti-cancer property of GL have been reported by consumers based on the cases such as topical application for melanoma, and oral ingestion for prostate, lung and liver cancers.Those anecdotal reports stimulated us to investigate anti-tumorigenesis activity of GL. In the previous study, we reported that the topical application of GL inhibited DMBA/TPA-induced skin tumor formation by decreasing inflammatory gene parameters.Objective: In this study, we mainly investigated the effect of GL on translocation of NF-kB together with production of nitric-oxide and TNF-α induced by LPS in RAW 264.7 cells.Results: This investigation showed that GL decreased the release of TNF-α and nitric oxide from macrophage RAW264.7 cells stimulated by LPS in a dose-dependent manner. In addition, GL suppressed the expression of iNOS and nuclear translocation of NF-kB in RAW264.7 cells, inhibited the degradation of IκB-α, and scavenged hydroxyl radicals (DMPO/OH adduct in vitro.Conclusions: Our findings suggest that GL suppresses the inflammation in vitro, and exerts chemopreventive activity through the inhibition of production of TNF-α and iNOS proteins due to the inhibition of nuclear translocation of NF-kB and oxidative stress. GL appears to be a novel functional natural product capable of preventing inflammation and inflammation-associated tumorigenesis.Keywords: GL, Citrus peel extract, anti-inflammation, Nitric oxide, iNOS, NF-kB, TNF-α

  9. Ability of certain plant extracts traditionally used to treat ciguatera fish poisoning to inhibit nitric oxide production in RAW 264.7 macrophages.

    Science.gov (United States)

    Kumar-Roiné, Shilpa; Matsui, Mariko; Reybier, Karine; Darius, Hélène Taiana; Chinain, Mireille; Pauillac, Serge; Laurent, Dominique

    2009-06-25

    Ciguatera fish poisoning (CFP) is an intertropical ichthyosarcotoxism that manifests in complex assortment of symptoms in humans. Ciguatoxins (CTXs), issued from Gambierdicus spp., are causative agents of this intoxication. We have recently demonstrated that a Pacific CTX (P-CTX-1B) strongly modulated iNOS expression, leading to overproduction of nitric oxide (NO) in RAW 264.7 murine macrophage cells. NO produced in large amounts is involved in a wide range of pathophysiological processes. Many traditional remedies are commonly used in the Pacific against CFP. In this context, bioassay-guided screening was carried out to study NO inhibiting capacity of 28 selected plant extracts. We prepared aqueous extracts of plants used in New Caledonia in the treatment of CFP and screened their NO inhibitory activity in lipopolysaccharide (LPS)-activated RAW 264.7 macrophages. Among 28 plants tested, Euphorbia hirta (Euphorbiaceae), Syzygium malaccense (Myrtaceae), Schinus terebenthifolius (Anacardiaceae), Punica granatum (Punicaceae), Cerbera manghas (Apocynaceae), Vitex trifolia (Labiateae) and Ximenia americana (Olacaceae) showed inhibitory activity, validating their use as traditional remedies in CFP, and the potential for use in the treatment of conditions accompanied by NO overproduction. These plants are promising candidates for further screening of their active compounds through activity-guided fractionation.

  10. Annual report 1997. Energies and raw materials

    International Nuclear Information System (INIS)

    1997-01-01

    This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)

  11. Toxicity of sediments potentially contaminated by coal mining and natural gas extraction to unionid mussels and commonly tested benthic invertebrates

    Science.gov (United States)

    Wang, Ning; Ingersoll, Christopher G.; Kunz, James L.; Brumbaugh, William G.; Kane, Cindy M.; Evans, R. Brian; Alexander, Steven; Walker, Craig; Bakaletz, Steve

    2013-01-01

    Sediment toxicity tests were conducted to assess potential effects of contaminants associated with coal mining or natural gas extraction activities in the upper Tennessee River basin and eastern Cumberland River basin in the United States. Test species included two unionid mussels (rainbow mussel, Villosa iris, and wavy-rayed lampmussel, Lampsilis fasciola, 28-d exposures), and the commonly tested amphipod, Hyalella azteca (28-d exposure) and midge, Chironomus dilutus (10-d exposure). Sediments were collected from seven test sites with mussel communities classified as impacted and in proximity to coal mining or gas extraction activities, and from five reference sites with mussel communities classified as not impacted and no or limited coal mining or gas extraction activities. Additional samples were collected from six test sites potentially with high concentrations of polycyclic aromatic hydrocarbons (PAHs) and from a test site contaminated by a coal ash spill. Mean survival, length, or biomass of one or more test species was reduced in 10 of 14 test samples (71%) from impacted areas relative to the response of organisms in the five reference samples. A higher proportion of samples was classified as toxic to mussels (63% for rainbow mussels, 50% for wavy-rayed lampmussels) compared with amphipods (38%) or midge (38%). Concentrations of total recoverable metals and total PAHs in sediments did not exceed effects-based probable effect concentrations (PECs). However, the survival, length, or biomasses of the mussels were reduced significantly with increasing PEC quotients for metals and for total PAHs, or with increasing sum equilibrium-partitioning sediment benchmark toxic units for PAHs. The growth of the rainbow mussel also significantly decreased with increasing concentrations of a major anion (chloride) and major cations (calcium and magnesium) in sediment pore water. Results of the present study indicated that (1) the findings from laboratory tests were generally

  12. Extractable trace elements and sodium in Illinois coal-cleaning wastes: correlation with concentrations in tall fescue

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, B.G.

    1983-07-01

    Trace element concentrations in shoots of tall fescue (Festuca arundinacea Schreb.) were correlated with extractable element concentrations in five southern Illinois coal-cleaning wastes limed to pH 6.5, in a greenhouse study to determine applicability of soil tests to coal-waste evaluation. There was little or no correlation between shoot concentrations of Fe, and Fe extracted from the wastes by dilute acid (r equals 0.60), DTPA at pH 6.4 (r equals 0.47) or DTPA at pH 8.4 (r equals -0.17). The corresponding r values for Mn were 0.94, 0.97, and 0.96; for Zn, 0.96, 0.96, and 0.88; and for Cu, 0.67, 0.90, and 0.88, respectively. Shoot B correlated well with hot water-soluble B(r equals 0.96) and acid-soluble B(r equals 0.91). Correlations for shoot Na were also good with water-soluble Na and acid-soluble Na (r equals 0.96 in both cases). Concentrations of Al, As, Cd, Ni, Pb, and Se in the shoots were well below reported upper critical levels, and similar to concentrations in the grass grown on a silt loam under the same greenhouse conditions. 21 references.

  13. Comparative antioxidant effect of BHT and water extracts of banana and sapodilla peels in raw poultry meat.

    Science.gov (United States)

    Devatkal, Suresh K; Kumboj, Ritu; Paul, Devosmita

    2014-02-01

    Antioxidant properties of banana (Musa paradisiaca) and Sapodilla/Chikoo (Manilkara zapota) peel extracts in chicken patties were evaluated. Four treatments viz., I. Control (meat + 2% salt), II.BHT (meat + 2% salt + 0.1% BHT), III. BPE (meat + 2% salt + 2% banana peel extract) and IV. SPE (meat + 2% salt + 2% sapodilla/chikoo peel extract) were compared for changes in colour and lipid oxidation during 8 days refrigerated storage (4 ± °C). The average phenolic content was 550.2 and 550.8 mg gallic acid equivalent per 10 g peel in BPE and SPE respectively. Free radical scavenging activity was 66.9 and 67.8% in BPE and SPE respectively. Banana peel extract had significantly (P peel extract (0.91). During refrigerated storage period, all color parameters decreased significantly in all treatments. Observation on lipid oxidation showed a significantly (P banana and sapodilla peels could be explored as natural antioxidants in poultry meat and meat products.

  14. The fate of injectant coal in blast furnaces: The origin of extractable materials of high molecular mass in blast furnace carryover dusts

    Energy Technology Data Exchange (ETDEWEB)

    Dong, S.N.; Wu, L.; Paterson, N.; Herod, A.A.; Dugwell, D.R.; Kandiyoti, R. [University of London Imperial College of Science & Technology, London (United Kingdom). Dept. of Chemical Engineering

    2005-07-01

    The aim of the work was to investigate the fate of injectant coal in blast furnaces and the origin of extractable materials in blast furnace carryover dusts. Two sets of samples including injectant coal and the corresponding carryover dusts from a full sized blast furnace and a pilot scale rig have been examined. The samples were extracted using 1-methyl-2-pyrrolidinone (NMP) solvent and the extracts studied by size exclusion chromatography (SEC). The blast furnace carryover dust extracts contained high molecular weight carbonaceous material, of apparent mass corresponding to 10{sup 7}-10{sup 8} u, by polystyrene calibration. In contrast, the feed coke and char prepared in a wire mesh reactor under high temperature conditions did not give any extractable material. Meanwhile, controlled combustion experiments in a high-pressure wire mesh reactor suggest that the extent of combustion of injectant coal in the blast furnace tuyeres and raceways is limited by time of exposure and very low oxygen concentration. It is thus likely that the extractable, soot-like material in the blast furnace dust originated in tars is released by the injectant coal. Our results suggest that the unburned tars were thermally altered during the upward path within the furnace, giving rise to the formation of heavy molecular weight (soot-like) materials.

  15. Simultaneous determination of superoxide and hydrogen peroxide in macrophage RAW 264.7 cell extracts by microchip electrophoresis with laser-induced fluorescence detection.

    Science.gov (United States)

    Li, Hongmin; Li, Qingling; Wang, Xu; Xu, Kehua; Chen, Zhenzhen; Gong, Xiaocong; Liu, Xin; Tong, Lili; Tang, Bo

    2009-03-15

    A method for the first time to simultaneously determine superoxide and hydrogen peroxide in macrophage RAW 264.7 cell extracts by microchip electrophoresis with laser-induced fluorescence detection (MCE-LIF) was developed. 2-Chloro-1,3-dibenzothiazolinecyclohexene (DBZTC) and bis(p-methylbenzenesulfonyl) dichlorofluorescein (FS), two probes that can be specifically derivatized by superoxide and hydrogen peroxide, respectively, were synthesized and used. Parameters influencing the derivatization and on-chip separation were optimized. With the use of a HEPES (20 mM, pH 7.4) running buffer, a 50 mm long separation channel, and a separation voltage of 1800 V, baseline separation was achieved within 48 s for the two derivatization products, DBZTC-oxide (DBO) and 2,7-dichlorofluorescein (DCF). The linearity ranges of the method were 0.08-5.0 and 0.02-5.0 microM with detection limits (signal-to-noise ratio = 3) of 10 nM (1.36 amol) and 5.6 nM (0.76 amol) for superoxide and hydrogen peroxide, respectively. The relative standard deviations (RSDs) of migration time and peak area were less than 2.0% and 5.0%, respectively. The recoveries of the cell extract samples spiked with 1.0 microM standard solutions were 96.1% and 93.0% for superoxide and hydrogen peroxide, respectively. With the use of this method, superoxide and hydrogen peroxide in phorbol myristate acetate (PMA)-stimulated macrophage RAW 264.7 cell extracts were found to be 0.78 and 1.14 microM, respectively. The method has paved a way for simultaneously determining two or more reactive oxygen species (ROS) in a biological system with high resolution.

  16. Effects of Mikania glomerata Spreng. and Mikania laevigata Schultz Bip. ex Baker (Asteraceae) extracts on pulmonary inflammation and oxidative stress caused by acute coal dust exposure

    Energy Technology Data Exchange (ETDEWEB)

    Freitas, T.P.; Silveira, P.C.; Rocha, L.G.; Rezin, G.T.; Rocha, J.; Citadini-Zanette, V.; Romao, P.T.; Dal-Pizzol, F.; Pinho, R.A.; Andrade, V.M.; Streck, E.L. [University Extremo Catarinense, Criciuma (Brazil)

    2008-12-15

    Several studies have reported biological effects of Mikania glomerata and Mikania laevigata, used in Brazilian folk medicine for respiratory diseases. Pneumoconiosis is characterized by pulmonary inflammation caused by coal dust exposure. In this work, we evaluated the effect of pretreatment with M. glomerata and M. laevigata extracts (MGE and MLE, respectively) (100 mg/kg, s.c.) on inflammatory and oxidative stress parameters in lung of rats subjected to a single coal dust intratracheal instillation. Rats were pretreated for 2 weeks with saline solution, MGE, or MLE. On day 15, the animals were anesthetized, and gross mineral coal dust or saline solutions were administered directly in the lung by intratracheal instillation. Fifteen days after coal dust instillation, the animals were killed. Bronchoalveolar lavage (BAL) was obtained; total cell count and lactate dehydrogenase (LDH) activity were determined. In the lung, myeloperoxidase activity, thiobarbituric acid-reactive substances (TBARS) level, and protein carbonyl and sulfhydryl contents were evaluated. In BAL of treated animals, we verified an increased total cell count and LDH activity. MGE and MLE prevented the increase in cell count, but only MLE prevented the increase in LDH. Myeloperoxidase and TBARS levels were not affected, protein carbonylation was increased, and the protein thiol levels were decreased by acute coal dust intratracheal administration. The findings also suggest that both extracts present an important protective effect on the oxidation of thiol groups. Moreover, pretreatment with MGE and MLE also diminished lung inflammatory infiltration induced by coal dust, as assessed by histopathologic analyses.

  17. Niobium, tantalum and titanium extraction from natural and technogenic raw materials of the Kola Peninsula by liquid-liquid extraction methods

    International Nuclear Information System (INIS)

    Kassikova, N.I.; Kassikov, A.G.; Balabanov, Yu.I.; Petrov, V.B.; Kalinnikov, V.T.

    2003-01-01

    Such rare metals as niobium and tantalum are important strategic materials underlying many of the modern advanced technologies. Since the extraction and processing of rare metal concentrates from own deposits has diminished abruptly in recent years, it is essential to look into the possibility of extracting these elements from various production wastes. This work discusses liquid-liquid extraction and purification of niobium, tantalum and titanium from process solutions of loparite, perovskite and sphene concentrate decomposition with sulphuric and hydrochloric acids; niobium from lithium niobate production wastes decomposed by hydrochloric acid; and tantalum from tantalum capacitor and heat-resistant alloy wastes. (Original)

  18. Characterization and comparison of key aroma compounds in raw and dry porcini mushroom (Boletus edulis) by aroma extract dilution analysis, quantitation and aroma recombination experiments.

    Science.gov (United States)

    Zhang, Huiying; Pu, Dandan; Sun, Baoguo; Ren, Fazheng; Zhang, Yuyu; Chen, Haitao

    2018-08-30

    A study was carried out to determine and compare the key aroma compounds in raw and dry porcini mushroom (Boletus edulis). The volatile fractions were prepared by solvent-assisted flavor evaporation (SAFE), and aroma extract dilution analysis (AEDA) combined with gas chromatography-mass spectrometry (GC-MS) was employed to identify the odorants. Selected aroma compounds were quantitated and odor activity values (OAVs) were calculated revealing OAVs ≥ 1 for 12 compounds in raw porcini, among which 1-octen-3-one showed the highest OAV. In addition to compounds with eight carbon atoms, 3-methylbutanal, (E,E)-2,4-decadienal and (E,E)-2,4-nonadienal were also responsible for the unique aroma profile. In dry mushroom OAVs ≥ 1 were obtained for 20 odorants. Among them, 3-(methylthio)propanal, 1-octen-3-one and pyrazines were determined as predominant odorants. Overall, drying increased complexity of volatile compounds, thus significantly changing the aroma profile of porcini, providing more desirable roasted and seasoning-like flavor and less grass-like and earthy notes. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Supercritical fluid extraction of grape seeds: extract chemical composition, antioxidant activity and inhibition of nitrite production in LPS-stimulated Raw 264.7 cells.

    Science.gov (United States)

    Pérez, Concepción; Ruiz del Castillo, María Luisa; Gil, Carmen; Blanch, Gracia Patricia; Flores, Gema

    2015-08-01

    Grape by-products are a rich source of bioactive compounds having broad medicinal properties, but are usually wasted from juice/wine processing industries. The present study investigates the use of supercritical fluid extraction (SFE) for obtaining an extract rich in bioactive compounds. First, some variables involved in the extraction were applied. SFE conditions were selected based on the oil mass yield, fatty acid profile and total phenolic composition. As a result, 40 °C and 300 bar were selected as operational conditions. The phenolic composition of the grape seed oil was determined using LC-DAD. The antioxidant activity was determined by ABTS and DPPH assays. For the anti-inflammatory activity the inhibition of nitrite production was assessed. The grape seed oil extracted was rich in phenolic compounds and fatty acids with significant antioxidant and anti-inflammatory activities. From these results, added economic value to this agroindustrial residue is proposed using environmentally friendly techniques.

  20. Exploitation and use of coal field gas

    Energy Technology Data Exchange (ETDEWEB)

    Wang, K; Li, Z; Sun, Q

    1982-04-25

    There are slightly more than 440 mine shafts in the world from which gas is pumped at the same time coal is being mined, the volume pumped being 3.125 billion cubic meters. All the countries of the world today widely use gas as a fuel and as a raw material for the chemical industry. In China 40 percent of the total number of mine shafts are high gas mine shafts. In China, gas is used largely as fuel by the people, to fire boilers, to make formaldehyde, and to make carbon ink. Prospects are good for the exploitation of mine shaft gas that is produced in association with coal. Mine shaft gas is a top quality energy source with an extraction life that is longer than coals. (DP)

  1. Strategic raw materials. Risk management

    International Nuclear Information System (INIS)

    Bertau, Martin; Matschullat, Joerg; Kausch, Peter

    2014-01-01

    This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [de

  2. Water extraction of coals - potential for estimating low molecular weight organic acids as carbon feedstock for the deep terrestrial biosphere

    Energy Technology Data Exchange (ETDEWEB)

    Vieth, A.; Mangelsdorf, K.; Sykes, R.; Horsfield, B. [Geoforschungszentrum Potsdam, Potsdam (Germany)

    2008-08-15

    With the recent increasing interest in the deep biosphere, the question arises as to where the carbon sources that support deep microbial communities are derived from. Our research was focussed on the water-soluble, low molecular weight (LMW) organic acids that are potentially available from different sedimentary lithologies to serve as a carbon source to feed the deep biosphere. A series of Eocene-Pleistocene coals, mudstones and sandstones of varying rank (maturity) and total organic carbon (TOC) content from the Waikato Basin, New Zealand, has been Soxhlet-extracted using water. The combined concentration of recovered formate, acetate and oxalate range from 366 to 2499 {mu} g/g sediment and appear to be dependent on rank, organofacies and TOC. The yields indicate the potential of carbonaceous sediments to feed the local deep terrestrial biosphere over geological periods of time. The existence of living microbial organisms in the mudstones and sandstones was proved by the identification of intact phospholipids (PLs).

  3. DEVELOPMENT OF CONTINUOUS SOLVENT EXTRACTION PROCESSES FOR COAL DERIVED CARBON PRODUCTS

    Energy Technology Data Exchange (ETDEWEB)

    Elliot Kennel; Chong Chen; Dady Dadyburjor; Mark Heavner; Manoj Katakdaunde; Liviu Magean; James Mayberry; Alfred Stiller; Joseph Stoffa; Christopher Yurchick; John Zondlo

    2009-12-31

    This NETL sponsored effort seeks to develop continuous technologies for the production of carbon products, which may be thought of as the heavier products currently produced from refining of crude petroleum and coal tars obtained from metallurgical grade coke ovens. This effort took binder grade pitch, produced from liquefaction of West Virginia bituminous grade coal, all the way to commercial demonstration in a state of the art arc furnace. Other products, such as crude oil, anode grade coke and metallurgical grade coke were demonstrated successfully at the bench scale. The technology developed herein diverged from the previous state of the art in direct liquefaction (also referred to as the Bergius process), in two major respects. First, direct liquefaction was accomplished with less than a percent of hydrogen per unit mass of product, or about 3 pound per barrel or less. By contrast, other variants of the Bergius process require the use of 15 pounds or more of hydrogen per barrel, resulting in an inherent materials cost. Second, the conventional Bergius process requires high pressure, in the range of 1500 psig to 3000 psig. The WVU process variant has been carried out at pressures below 400 psig, a significant difference. Thanks mainly to DOE sponsorship, the WVU process has been licensed to a Canadian Company, Quantex Energy Inc, with a commercial demonstration unit plant scheduled to be erected in 2011.

  4. An Effective Method to Detect Volatile Intermediates Generated in the Bioconversion of Coal to Methane by Gas Chromatography-Mass Spectrometry after In-Situ Extraction Using Headspace Solid-Phase Micro-Extraction under Strict Anaerobic Conditions.

    Science.gov (United States)

    Liu, Jianmin; Wang, Baoyu; Tai, Chao; Wu, Li; Zhao, Han; Guan, Jiadong; Chen, Linyong

    2016-01-01

    Bioconversion of coal to methane has gained increased attention in recent decades because of its economic and environmental advantages. However, the mechanism of this process is difficult to study in depth, partly because of difficulties associated with the analysis of intermediates generated in coal bioconversion. In this investigation, we report on an effective method to analyze volatile intermediates generated in the bioconversion of coal under strict anaerobic conditions. We conduct in-situ extraction of intermediates using headspace solid-phase micro-extraction followed by detection by gas chromatography-mass spectrometry. Bioconversion simulation equipment was modified and combined with a solid-phase micro-extraction device. In-situ extraction could be achieved by using the combined units, to avoid a breakdown in anaerobic conditions and to maintain the experiment continuity. More than 30 intermediates were identified qualitatively in the conversion process, and the variation in trends of some typical intermediates has been discussed. Volatile organic acids (C2-C7) were chosen for a quantitative study of the intermediates because of their importance during coal bioconversion to methane. Fiber coating, extraction time, and solution acidity were optimized in the solid-phase micro-extraction procedure. The pressure was enhanced during the bioconversion process to investigate the influence of headspace pressure on analyte extraction. The detection limits of the method ranged from 0.0006 to 0.02 mmol/L for the volatile organic acids and the relative standard deviations were between 4.6% and 11.5%. The volatile organic acids (C2-C7) generated in the bioconversion process were 0.01-1.15 mmol/L with a recovery range from 80% to 105%. The developed method is useful for further in-depth research on the bioconversion of coal to methane.

  5. Flavonoid content in ethanolic extracts of selected raw and traditionally processed indigenous foods consumed by vulnerable groups of Kenya: antioxidant and type II diabetes-related functional properties.

    Science.gov (United States)

    Kunyanga, Catherine N; Imungi, Jasper K; Okoth, Michael W; Biesalski, Hans K; Vadivel, Vellingiri

    2011-08-01

    The present study evaluated the flavonoid content, antioxidant as well as type II diabetes-related enzyme inhibition activities of ethanolic extract of certain raw and traditionally processed indigenous food ingredients including cereals, legumes, oil seeds, tubers, vegetables and leafy vegetables, which are commonly consumed by vulnerable groups in Kenya. The vegetables exhibited higher flavonoid content (50-703 mg/100 g) when compared with the grains (47-343 mg/100 g). The ethanolic extract of presently studied food ingredients revealed 33-93% DPPH radical scavenging capacity, 486-6,389 mmol Fe(II)/g reducing power, 19-43% α-amylase inhibition activity and 14-68% α-glucosidase inhibition activity. Among the different food-stuffs, the drumstick and amaranth leaves exhibited significantly higher flavonoid content with excellent functional properties. Roasting of grains and cooking of vegetables were found to be suitable processing methods in preserving the functional properties. Hence, such viable processing techniques for respective food samples will be considered in the formulation of functional supplementary foods for vulnerable groups in Kenya.

  6. Moringa oleifera Flower Extract Suppresses the Activation of Inflammatory Mediators in Lipopolysaccharide-Stimulated RAW 264.7 Macrophages via NF-κB Pathway

    Directory of Open Access Journals (Sweden)

    Woan Sean Tan

    2015-01-01

    Full Text Available Aim of Study. Moringa oleifera Lam. (M. oleifera possess highest concentration of antioxidant bioactive compounds and is anticipated to be used as an alternative medicine for inflammation. In the present study, we investigated the anti-inflammatory activity of 80% hydroethanolic extract of M. oleifera flower on proinflammatory mediators and cytokines produced in lipopolysaccharide- (LPS- induced RAW 264.7 macrophages. Materials and Methods. Cell cytotoxicity was conducted by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. Nitric oxide (NO production was quantified through Griess reaction while proinflammatory cytokines and other key inflammatory markers were assessed through enzyme-linked immunosorbent assay (ELISA and immunoblotting. Results. Hydroethanolic extract of M. oleifera flower significantly suppressed the secretion and expression of NO, prostaglandin E2 (PGE2, interleukin- (IL- 6, IL-1β, tumor necrosis factor-alpha (TNF-α, nuclear factor-kappa B (NF-κB, inducible NO synthase (iNOS, and cyclooxygenase-2 (COX-2. However, it significantly increased the production of IL-10 and IκB-α (inhibitor of κB in a concentration dependent manner (100 μg/mL and 200 μg/mL. Conclusion. These results suggest that 80% hydroethanolic extract of M. oleifera flower has anti-inflammatory action related to its inhibition of NO, PGE2, proinflammatory cytokines, and inflammatory mediator’s production in LPS-stimulated macrophages through preventing degradation of IκB-α in NF-κB signaling pathway.

  7. Moringa oleifera Flower Extract Suppresses the Activation of Inflammatory Mediators in Lipopolysaccharide-Stimulated RAW 264.7 Macrophages via NF-κB Pathway

    Science.gov (United States)

    Tan, Woan Sean; Arulselvan, Palanisamy; Karthivashan, Govindarajan; Fakurazi, Sharida

    2015-01-01

    Aim of Study. Moringa oleifera Lam. (M. oleifera) possess highest concentration of antioxidant bioactive compounds and is anticipated to be used as an alternative medicine for inflammation. In the present study, we investigated the anti-inflammatory activity of 80% hydroethanolic extract of M. oleifera flower on proinflammatory mediators and cytokines produced in lipopolysaccharide- (LPS-) induced RAW 264.7 macrophages. Materials and Methods. Cell cytotoxicity was conducted by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Nitric oxide (NO) production was quantified through Griess reaction while proinflammatory cytokines and other key inflammatory markers were assessed through enzyme-linked immunosorbent assay (ELISA) and immunoblotting. Results. Hydroethanolic extract of M. oleifera flower significantly suppressed the secretion and expression of NO, prostaglandin E2 (PGE2), interleukin- (IL-) 6, IL-1β, tumor necrosis factor-alpha (TNF-α), nuclear factor-kappa B (NF-κB), inducible NO synthase (iNOS), and cyclooxygenase-2 (COX-2). However, it significantly increased the production of IL-10 and IκB-α (inhibitor of κB) in a concentration dependent manner (100 μg/mL and 200 μg/mL). Conclusion. These results suggest that 80% hydroethanolic extract of M. oleifera flower has anti-inflammatory action related to its inhibition of NO, PGE2, proinflammatory cytokines, and inflammatory mediator's production in LPS-stimulated macrophages through preventing degradation of IκB-α in NF-κB signaling pathway. PMID:26609199

  8. Raw data

    DEFF Research Database (Denmark)

    Walford, Antonia

    2017-01-01

    . Although science and technology studies (STS) makes a strong case for associating relationality with certainty, the article argues that a particular form of data, ‘raw data’, complicates this association. It further argues that scientific data is not simply composed out of relations, but is a relation......This article takes scientific ‘raw data’ as its ethnographic object in order to investigate the co-implication of nature and culture in scientific knowledge practices. The article traces out some of the activities that are involved in producing numerical climate data from the Brazilian Amazon...... itself. The article ends with a brief reflection on the possible repercussions of shifting from thinking of science as producing multiple natures and cultures to thinking of it as producing the potential for relations....

  9. COAL OF THE FUTURE (Supply Prospects for Thermal Coal by 2030-2050)

    OpenAIRE

    2007-01-01

    The report, produced by Messrs. Energy Edge Ltd. (the U.K.) for the JRC Institute for Energy, aims at making a techno-economic analysis of novel extraction technologies for coal and their potential contribution to the global coal supply. These novel extraction technologies include: advanced coal mapping techniques, improved underground coal mining, underground coal gasification and utilisation of coalmine methane gas.

  10. Coal background paper. Coal demand

    International Nuclear Information System (INIS)

    1997-01-01

    Statistical data are presented on coal demands in IEA and OECD member countries and in other countries. Coal coaking and coaking coal consumption data are tabulated, and IEA secretariat's coal demand projections are summarized. Coal supply and production data by countries are given. Finally, coal trade data are presented, broken down for hard coal, steam coal, coking coal (imports and export). (R.P.)

  11. Characterization of Key Aroma Compounds in Raw and Thermally Processed Prawns and Thermally Processed Lobsters by Application of Aroma Extract Dilution Analysis.

    Science.gov (United States)

    Mall, Veronika; Schieberle, Peter

    2016-08-24

    Application of aroma extract dilution analysis (AEDA) to an aroma distillate of blanched prawn meat (Litopenaeus vannamei) (BPM) revealed 40 odorants in the flavor dilution (FD) factor range from 4 to 1024. The highest FD factors were assigned to 2-acetyl-1-pyrroline, 3-(methylthio)propanal, (Z)-1,5-octadien-3-one, trans-4,5-epoxy-(E)-2-decenal, (E)-3-heptenoic acid, and 2-aminoacetophenone. To understand the influence of different processing conditions on odorant formation, fried prawn meat was investigated by means of AEDA in the same way, revealing 31 odorants with FD factors between 4 and 2048. Also, the highest FD factors were determined for 2-acetyl-1-pyrroline, 3-(methylthio)propanal, and (Z)-1,5-octadien-3-one, followed by 4-hydroxy-2,5-dimethyl-3(2H)-furanone, (E)-3-heptenoic acid, and 2-aminoacetophenone. As a source of the typical marine, sea breeze-like odor attribute of the seafood, 2,4,6-tribromoanisole was identified in raw prawn meat as one of the contributors. Additionally, the aroma of blanched prawn meat was compared to that of blanched Norway and American lobster meat, respectively (Nephrops norvegicus and Homarus americanus). Identification experiments revealed the same set of odorants, however, with differing FD factors. In particular, 3-hydroxy-4,5-dimethyl-2(5H)-furanone was found as the key aroma compound in blanched Norway lobster, whereas American lobster contained 3-methylindole with a high FD factor.

  12. Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Zarzycki, Pawel K., E-mail: pawel_k_z@hotmail.com [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland); Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J. [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland)

    2011-03-04

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  13. Reprint of: Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Zarzycki, Pawel K., E-mail: pawel_k_z@hotmail.com [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland); Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J. [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland)

    2012-02-24

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  14. Reprint of: Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    International Nuclear Information System (INIS)

    Zarzycki, Paweł K.; Ślączka, Magdalena M.; Zarzycka, Magdalena B.; Włodarczyk, Elżbieta; Baran, Michał J.

    2012-01-01

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds’ feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5–8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  15. Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    International Nuclear Information System (INIS)

    Zarzycki, Pawel K.; Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J.

    2011-01-01

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  16. Fish oil extracted from fish-fillet by-products is weakly linked to the extraction temperatures but strongly linked to the omega-3 content of the raw material

    DEFF Research Database (Denmark)

    Honold, Philipp; Nouard, Marie-Louise; Jacobsen, Charlotte

    2016-01-01

    Rainbow trout (Oncorhynchus mykiss) is the mainspecies produced in Danish fresh water farming. Therefore, a large amount of fileting by-products like heads, bones, and tails (HBT) and intestines are available and can be used to produce high quality fish oil. The main aim in this study was to inve......Rainbow trout (Oncorhynchus mykiss) is the mainspecies produced in Danish fresh water farming. Therefore, a large amount of fileting by-products like heads, bones, and tails (HBT) and intestines are available and can be used to produce high quality fish oil. The main aim in this study...... products, % free fatty acids as well as content of omega-3 PUFA. Furthermore, an experiment was carried out to elucidate the effect of extraction temperature on oil produced from raw materials with a different content of omega-3 fatty acids. For this purpose filleting by-products from conventional (low...

  17. BARZAS DEPOSIT SAPROPELITE COALS: PROSPECTS OF INTEGRATED DEVELOPMENT

    Directory of Open Access Journals (Sweden)

    L. V. Kuznetsova

    2018-03-01

    the enterprises for extraction of coal, semi-coking plant, boiler room, the chemical enterprise for processing of ash-slag from burning of waste of pyrolysis. The enterprise for receiving ore raw materials and construction materials are also among them. Summary. The organization of the main processes (from coal mining to commercial production within the framework of the energy chemical cluster will create an efficient, environmentally friendly and low-waste production. The consumer value of the obtained commodity products (resin, pyrogenetic water, fuel gas, thermal energy, ore concentrate and building materials will be much higher than the cost of raw high-ash coal.

  18. Process for the extraction of valuable products from coals, pitches, mineral oils, and the like

    Energy Technology Data Exchange (ETDEWEB)

    1936-06-05

    A process is described for the treating of coke, lignite, peat, etc., and mineral oils with the help of hydrogen or other reducing gases and under pressure to recover valuable hydrocarbons, characterized by the carbonaceous substances and the reducing gas coming together already heated totally or in part at least from 350/sup 0/C to the temperature necessary for the reaction. The substances to be treated becoming extracted in the form of paste or liquid from the reaction chamber and then returned to it and being reacted outside the reaction zone in the presence of the reducing gases at the temperature necessary for the reaction.

  19. 29 CFR 779.357 - May qualify as exempt 13(a)(2) establishments; classification of coal sales.

    Science.gov (United States)

    2010-07-01

    ... principal raw material, such as sales of coal for the production of coke, coal gas, coal tar, or electricity... production of coke, coal gas, coal tar, or electricity. This is distinguished from sales of coal for use in...; classification of coal sales. 779.357 Section 779.357 Labor Regulations Relating to Labor (Continued) WAGE AND...

  20. Modes of Occurrence of Fluorine by Extraction and SEM Method in a Coal-Fired Power Plant from Inner Mongolia, China

    Directory of Open Access Journals (Sweden)

    Guangmeng Wang

    2015-12-01

    Full Text Available In this study, an extraction method and environmental scanning electron microscopy (SEM are employed to reveal the changes in the occurrence mode of fluorine in a coal-fired power plant in Inner Mongolia, China. The different occurrence states of fluorine during coal combustion and emission show that fluorine in coal mainly assumes insoluble inorganic mineral forms. The results illustrate that the three typical occurrence modes in coal are CaF2, MgF2 and AlF3. The fluorine in fly ash can be captured by an electrostatic precipitator (EPS or a bag filter. In contrast, the gaseous fluorine content in flue gas is only in the range of several parts per million; thus, it cannot be used in this study. The occurrence mode of fluorine in bottom ash and slag is inorganic villiaumite (e.g., soluble NaF, KF and insoluble CaF2 which is difficult to break down even at high temperatures. The occurrence mode of fluorine with the highest content in fly ash is physically adsorbed fluorine along the direction of the flue gas flow. The insoluble inorganic mineral fluoride content in fly ash is also high, but the gradually increasing fluorine content in fly ash is mainly caused by physical adsorption. Fluorine in the coal-fired power plant discharges mostly as solid products; however, very little fluorine emitted into the environment as gas products (HF, SiF4 cannot be captured. The parameters used in this study may provide useful references in developing a monitoring and control system for fluorine in coal-fired power plants.

  1. Influence of stabilizer on the environment and their use as possible secondary raw material

    International Nuclear Information System (INIS)

    Jelenova, M.

    2001-01-01

    In this paper author deals with the environmental impact of coal combustion in coal fired power plants and with influence of ash and stabilizer on the environment and their use as possible secondary raw material

  2. Create a Consortium and Develop Premium Carbon Products from Coal

    Energy Technology Data Exchange (ETDEWEB)

    Frank Rusinko; John Andresen; Jennifer E. Hill; Harold H. Schobert; Bruce G. Miller

    2006-01-01

    The objective of these projects was to investigate alternative technologies for non-fuel uses of coal. Special emphasis was placed on developing premium carbon products from coal-derived feedstocks. A total of 14 projects, which are the 2003 Research Projects, are reported herein. These projects were categorized into three overall objectives. They are: (1) To explore new applications for the use of anthracite in order to improve its marketability; (2) To effectively minimize environmental damage caused by mercury emissions, CO{sub 2} emissions, and coal impounds; and (3) To continue to increase our understanding of coal properties and establish coal usage in non-fuel industries. Research was completed in laboratories throughout the United States. Most research was performed on a bench-scale level with the intent of scaling up if preliminary tests proved successful. These projects resulted in many potential applications for coal-derived feedstocks. These include: (1) Use of anthracite as a sorbent to capture CO{sub 2} emissions; (2) Use of anthracite-based carbon as a catalyst; (3) Use of processed anthracite in carbon electrodes and carbon black; (4) Use of raw coal refuse for producing activated carbon; (5) Reusable PACs to recycle captured mercury; (6) Use of combustion and gasification chars to capture mercury from coal-fired power plants; (7) Development of a synthetic coal tar enamel; (8) Use of alternative binder pitches in aluminum anodes; (9) Use of Solvent Extracted Carbon Ore (SECO) to fuel a carbon fuel cell; (10) Production of a low cost coal-derived turbostratic carbon powder for structural applications; (11) Production of high-value carbon fibers and foams via the co-processing of a low-cost coal extract pitch with well-dispersed carbon nanotubes; (12) Use of carbon from fly ash as metallurgical carbon; (13) Production of bulk carbon fiber for concrete reinforcement; and (14) Characterizing coal solvent extraction processes. Although some of the

  3. Polymeric proanthocyanidins from Sicilian pistachio (Pistacia vera L.) nut extract inhibit lipopolysaccharide-induced inflammatory response in RAW 264.7 cells.

    Science.gov (United States)

    Gentile, C; Allegra, M; Angileri, F; Pintaudi, A M; Livrea, M A; Tesoriere, L

    2012-04-01

    Positive effects of pistachio nut consumption on plasma inflammatory biomarkers have been described; however, little is known about molecular events associated with these effects. We studied the anti-inflammatory activity of a hydrophilic extract from Sicilian Pistacia L. (HPE) in a macrophage model and investigated bioactive components relevant to the observed effects. HPE oligomer/polymer proanthocyanidin fractions were isolated by adsorbance chromatography, and components quantified as anthocyanidins after acidic hydrolysis. Isoflavones were measured by gradient elution HPLC analysis. RAW 264.7 murine macrophages were pre-incubated with either HPE (1- to 20-mg fresh nut equivalents) or its isolated components for 1 h, then washed before stimulating with lipopolysaccharide (LPS) for 24 h. Cell viability and parameters associated with Nuclear Factor-κB (NF-κB) activation were assayed according to established methods including ELISA, Western blot, or cytofluorimetric analysis. HPE suppressed nitric oxide (NO) and tumor necrosis factor-α (TNF-α) production and inducible NO-synthase levels dose dependently, whereas inhibited prostaglandin E2 (PGE2) release and decreased cyclo-oxygenase-2 content, the lower the HPE amount the higher the effect. Cytotoxic effects were not observed. HPE also caused a dose-dependent decrease in intracellular reactive oxygen species and interfered with the NF-κB activation. Polymeric proanthocyanidins, but not isoflavones, at a concentration comparable with their content in HPE, inhibited NO, PGE2, and TNF-α formation, as well as activation of IκB-α. Oligomeric proanthocyanidins showed only minor effects. Our results provide molecular evidence of anti-inflammatory activity of pistachio nut and indicate polymeric proanthocyanidins as the bioactive components. The mechanism may involve the redox-sensitive transcription factor NF-κB. Potential effects associated with pistachio nut consumption are discussed in terms of the

  4. Research on mechanism of and catalysts for extraction liquefaction of coal using coal-based solvents; Sekitankei yozai ni yoru sekitan no chushutsu ekika kiko to shokubai no kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1981-07-01

    Papers of Professor Yoshio Kamiya of Tokyo University are compiled into this report. The list of the papers includes (1) Synthesis of heavy fuel oils from coal; (2) Research and development of coal liquefaction; (3) Dissolution reaction of coal by hydrogen-donating aromatic solvents (I); (4) Effect of hydrogen-donor solvent on the liquefaction of coal; (5) Recent studies on the chemical structure of solvent refined coal; (6) Dissolution reaction of coal by hydrogen-donating aromatic solvents (II); (7) Future of coal as energy material; (8), (9), (10) same as (6) in the subject discussed; (11) Recent studies on coal liquefaction catalysts; (12) Environmental problems and drain treatment to accompany processes of converting fossil resources into fuels; (13) Chemistry of coal oxidation; (14) Fractionation and analysis of solvent refined coal by gel permeation chromatography; (15) Current state of research and development of coal liquefaction; (16) Properties and components of coal oils from coal liquefaction processes under development; (17) Solvent effect of coal derived aromatic compounds on the liquefaction of Akabira coal; (18) Chemistry of coal liquefaction; (19) Research and development of coal liquefaction in the U.S.; (20) Thermal treatment of coal-related aromatic ethers in tetralin solution; (21) Recent technology of utilizing heavy carbon resources; (22) Chemical properties and reactivity of coal; (23) Current state and future of development of coal liquefaction processes; and (24) Development of overseas coal liquefaction projects. (NEDO)

  5. Oryza sativa (Rice) Hull Extract Inhibits Lipopolysaccharide-Induced Inflammatory Response in RAW264.7 Macrophages by Suppressing Extracellular Signal-regulated Kinase, c-Jun N-terminal Kinase, and Nuclear Factor-κB Activation.

    Science.gov (United States)

    Ha, Sang Keun; Sung, Jeehye; Choi, Inwook; Kim, Yoonsook

    2016-01-01

    Rice ( Oryza sativa ) is a major cereal crop in many Asian countries and an important staple food source. Rice hulls have been reported to possess antioxidant activities. In this study, we evaluated the antiinflammatory effects of rice hull extract and associated signal transduction mechanisms in lipopolysaccharide (LPS)-stimulated RAW 264.7 macrophages. We found that rice hull extract inhibited nitric oxide (NO) and prostaglandin E 2 by suppressing the expression of inducible NO synthase and cyclooxygenase-2, respectively. The release of interleukin-1β and tumor necrosis factor-α was also reduced in a dose-dependent manner. Furthermore, rice hull extract attenuated the activation of nuclear factor-kappa B (NF-κB), as well as the phosphorylation of mitogen-activated protein kinases, extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase (JNK), in LPS-stimulated RAW264.7 cells. This suggests that rice hull extract decreases the production of inflammatory mediators by downregulating ERK and JNK and the NF-κB signal pathway in RAW 264.7 cells. Rice hull extract inhibits the lipopolysaccharide-induced inflammatory response in RAW264.7 macrophages.Rice hull extract inhibited nitric oxide and prostaglandin E 2 by suppressing the expression of inducible NO synthase and cyclooxygenase-2, respectively.Rice hull extract exerted anti-inflammatory effect through inhibition of nuclear factor-kappa B, extracellular signal-regulated kinase and c-Jun N-terminal kinase signaling pathways.Rice hull extract may provide a potential therapeutic approach for inflammatory diseases. Abbreviations used: COX-2: cyclooxygenase-2, ERK: extracellular signal-regulated kinase, IκB: inhibitory kappa B, IL-1β: interleukin-1β, iNOS: inducible NO synthase, JNK: c-Jun N-terminal kinase, LPS: lipopolysaccharide, MAPKs: mitogen-activated protein kinases, NF-κB: nuclear factor-κB, NO: nitric oxide, PGE2: prostaglandin E2, RHE: rice hull extract, ROS: reactive oxygen species

  6. Raw materials for energy generation in Canada

    Energy Technology Data Exchange (ETDEWEB)

    Robertson, D S

    1976-03-01

    Canada is self-sufficient in energy. The energy demand in Canada up to the end of the century is predicted, and the present and future of the oil, gas, coal and uranium industries are considered. Since it is now Canadian policy to restrict export of energy sources, in the future Canada will probably make more domestic use of its coal reserves. An increase is forecast in the use of coal for electricity generation and as a feedstock for synthetic gas. A long lead time and large capital expenditure will be needed before coal can be transported from western Canada to markets in the east of the country. A relatively small amount of the coal reserves are extractable by surface mining, and new underground mining techniques will be needed to extract the extremely friable coal from the deformed seams in the mountains.

  7. Mineral raw materials for power production in legislation of the Republic of Croatia

    International Nuclear Information System (INIS)

    Matisa, Z.

    1999-01-01

    According to the Constitution of the Republic of Croatia, mineral wealth is a public good of legal interest to the Republic of Croatia and enjoys its special protection. The Mining Law establishes that mineral wealth (including mineral resources that are used for power production) is the property of the Republic of Croatia. Among other mineral raw materials, this refers to mineral raw materials that are used for power production: coal, oil, natural gas, radioactive mineral raw materials and geothermal waters. These mineral resources are as almost all other mineral raw materials with the exception of geothermal waters, an unrecoverable natural resource. The right to use that natural resource may be granted only by a concession. The mining legislation provides for exploration and exploitation of mineral raw materials. Exploration of oil and gas is considered to comprise operations and testing with the aim to establish the existence, position and form of oil and natural gas deposits, their quality and quantity, as well as exploitation conditions. Exploitation of oil and natural gas is considered to comprise extraction from deposits, refining and transport, as well as disposal in geological structures. Mineral raw materials used in power production amount to 63% of national total primary energy production, and they cover 33% of total power consumption in the country. Legislation in the Republic of Croatia, which refers to exploration and exploitation of oil and natural gas, allows economic utilization of that unrecoverable natural wealth to run smoothly and in compliance with practices in our European environment. (author)

  8. Coal geopolitics

    International Nuclear Information System (INIS)

    Giraud, P.N.; Suissa, A.; Coiffard, J.; Cretin, D.

    1991-01-01

    This book divided into seven chapters, describes coal economic cycle. Chapter one: coals definition; the principle characteristics and properties (origin, calorific power, international classification...) Chapter two: the international coal cycle: coal mining, exploration, coal reserves estimation, coal handling coal industry and environmental impacts. Chapter three: the world coal reserves. Chapter four: the consumptions, productions and trade. Chapter five: the international coal market (exporting mining companies; importing companies; distributors and spot market operators) chapter six: the international coal trade chapter seven: the coal price formation. 234 refs.; 94 figs. and tabs [fr

  9. Inhibition of Reactive Oxygen Species (ROS) and Nitric Oxide (NO) by Gelidium elegans Using Alternative Drying and Extraction Conditions in 3T3-L1 and RAW 264.7 Cells.

    Science.gov (United States)

    Jeon, Hui-Jeon; Choi, Hyeon-Son; Lee, Ok-Hwan; Jeon, You-Jin; Lee, Boo-Yong

    2012-06-01

    Gelidium (G.) elegans is a red alga inhabiting intertidal areas of North East Asia. We examined anti-oxidative and anti-inflammatory effects of G. elegans, depending on drying and extraction conditions, by determining reactive oxygen species (ROS) and nitric oxide (NO) in 3T3-L1 and RAW 264.7 cells. Extraction yields of samples using hot air drying (HD) and far-infrared ray drying (FID) were significantly higher than those using natural air drying (ND). The 70% ethanol extracts showed the highest total phenol and flavonoid contents compared to other extracts (0, 30, and 50% ethanol) under tested drying conditions. The scavenging activity on 2,2-diphenyl-1-picrylhydrazyl (DPPH) and nitrite correlated with total phenol or flavonoid content in the extracts. The greatest DPPH scavenging effect was observed in 70% ethanol extract from FID and HD conditions. The production of ROS and NO in 3T3-L1 and macrophage cells greatly decreased with the 70% ethanol extraction derived from FID. This study suggests that 70% ethanol extraction of G. elegans dried by FID is the most optimal condition to obtain efficiently antioxidant compounds of G. elegans.

  10. Inhibition of LDL oxidation and oxidized LDL-induced foam cell formation in RAW 264.7 cells show anti-atherogenic properties of a foliar methanol extract of Scoparia dulcis.

    Science.gov (United States)

    Nambiar, Sinjitha S; Shetty, Nandini Prasad; Bhatt, Praveena; Neelwarne, Bhagyalakshmi

    2014-04-01

    Oxidation of low density lipoproteins and their further uptake by macrophages is known to result in the formation of foam cells, which are critical in the initiation of atherosclerosis through activation of inflammatory signalling cascades. Thus, powerful dietary antioxidants are receiving attention for the reversal of such pathological states. Extracts of Scoparia dulcis have been used as tea and health drinks with various health promoting effects. In the present study, we examined the reactive oxygen scavenging potential as well as anti-inflammatory and anti-atherogenic efficacies, using leaf extracts obtained after successive extraction with various solvents. A methanol extract showed potent antioxidant activity with an IC50 value of 570 μg/ml, caused hydrogen peroxide scavenging (28.9 µg/ml) and anti-inflammatory effects by improving human erythrocyte membrane stabilisation (about 86%). The methanol extract also efficiently inhibited lipid peroxidation and oxidation of low density lipoproteins, thus preventing foam cell formation in cultured RAW 264.7 cells. Furthermore, phytochemical screening of the extracts showed high accumulation of flavonoids. The foliar methanol extract of Scoparia dulcis has a strong anti-atherogenic potential and this property could be attributed maybe due to presence of flavonoids since HPLC analysis showed high concentrations of myricetin and rutin in the methanol extract.

  11. Factors influencing the organic matter extraction from the coal by using the process of liquefaction in static system; Fatores que influenciam a extracao da materia organica do carvao mineral atraves do processo de liequefacao em sistema estatico

    Energy Technology Data Exchange (ETDEWEB)

    Assis, Livia Mari; Lancas, Fernando Mauro

    1996-07-01

    This work describes the liquefaction process for extraction of the organic matter from coal, presently researched in Brazil, particularly with supercritical fluids. The extraction can be a future economically viable and environmentally correct alternative for supplying the emerging necessities of fuels, pharmaceuticals and chemicals sources.

  12. Effect of pre-swelling of coal on its liquefaction properties

    Energy Technology Data Exchange (ETDEWEB)

    Hengfu Shui; Zhicai Wang; Meixia Cao [Anhui University of Technology, Ma' anshan (China). School of Chemistry & Chemical Engineering

    2007-07-01

    The effects of pre-swelling of Shenhua coal on its liquefaction property were studied in this paper. It was found that pre-swelling treatments of Shenhua coal in three solvents, i.e toluene (TOL), N-methyl-2-pyrrolidinone (NMP) and tetralin (THN) increased its liquefaction conversion, and the liquefied product distributions were also quite different. Removal of the pre-swelling solvent from the swollen coals further increased the liquefaction conversion compared to that of the swollen coals with the swelling solvent existed in them. It was found that oil and gas yields for the liquefaction of swollen coals in NMP and TOL with swelling solvent existed dramatically decreased. Pre-swelling in THN at 120{sup o}C gave the highest liquefaction conversion, however the liquefaction conversion decreased with the increase of pre-swelling temperature in the case of NMP. TG and FTIR analyses of raw coal, the swollen coals and liquefied products were carried out and the mechanism of the effects of pre-swelling of coal on its extraction and liquefaction behaviors were probed in the paper. 12 refs., 6 figs., 3 tabs.

  13. Coal development potential in Pakistan

    Energy Technology Data Exchange (ETDEWEB)

    Khan, M N; Pelofsky, A H [eds.

    1986-01-01

    A total of 48 papers were presented, and covered the following topics: the current situation in Pakistan with respect to development and utilization of coal resources; the policies that have been responsible for the development and utilization of coal resources in Pakistan; coal development and utilization in other developing nations e.g. Indonesia, Greece, Philippines, China, Thailand and Haiti; and technological developments in coal exploration; extraction, handling, transport and utilization which could accelerate future development of Pakistan's coal resources. Specific subjects covered include the use of coal in the cement industry of Pakistan; the production of briquettes for domestic use, development and training of personnel for the coal industry; and sources of finance for coal development projects. Particular emphasis is given throughout the conference to the Lakhra coal mine/power plant project which aims to develop and effectively utilize the lignite reserves of Sind Province. 47 papers have been abstracted separately.

  14. Non-covalent associative structure of coal

    Energy Technology Data Exchange (ETDEWEB)

    Shui, H. [Anhui University of Technology, Maanshan (China). School of Chemistry and Chemical Engineering

    2004-06-01

    The recent progress of non-covalent associative structure of coal and the mechanisms of the carbon disulphide-N-methyl-2-pyrrolidone (CS{sub 2}/NMP) are mixed solvent and the additive addition enhancing the extraction yield of coals are reviewed, and the aggregation behaviour of coal in solid and solution states are presented, and the aggregation behavior of coal in solid and solution states are introduced in this paper. Coal extraction and swelling in organic solvents at room temperature were the most useful methods to understand the associative structure of coal. CS{sub 2}/NMP is a unique solvent to give high extraction yields for some bituminous coals. Some additives such as tetracyanoethylene (TCNE) can dissociate the stronger interactions among coal molecules and enhance the extraction yields of coal in the mixed solvent. 37 refs., 1 fig.

  15. An efficient chemical analysis of phenolic acids and flavonoids in raw propolis by microwave-assisted extraction combined with high-performance liquid chromatography using the fused-core technology.

    Science.gov (United States)

    Pellati, Federica; Prencipe, Francesco Pio; Bertelli, Davide; Benvenuti, Stefania

    2013-01-01

    A closed-vessel microwave-assisted extraction (MAE) technique was optimized for the first time for the extraction of polyphenols from raw propolis. The results obtained by means of response surface experimental design methodology showed that the best global response was reached when the extraction temperature was set at 106 °C, the solvent composition close to EtOH-H2O 80:20 (v/v), with an extraction time of 15 min. In comparison with other techniques, such as maceration, heat reflux extraction (HRE) and ultrasound-assisted extraction (UAE), the extraction with MAE was improved by shorter extraction time and lower volume of solvent needed. The HPLC analyses of propolis extracts were carried out on a fused-core Ascentis Express C18 column (150 mm × 3.0 mm I.D., 2.7 μm), with a gradient mobile phase composed by 0.1% formic acid in water and acetonitrile. Detection was performed by DAD and MS. The method validation indicated that the correlation coefficients were >0.999; the limit of detection was in the range 0.5-0.8 μg/ml for phenolic acids and 1.2-3.0 μg/ml for flavonoids; the recovery range was 95.3-98.1% for phenolic acids and 94.1-101.3% for flavonoids; the intra- and inter-day %RSD values for retention times and peak areas were ≤ 0.3 and 2.2%, respectively. The quali- and quantitative analysis of polyphenols in Italian samples of raw propolis was performed with the validated method. Total phenolic acids ranged from 5.0 to 120.8 mg/g and total flavonoids from 2.5 to 168.0mg/g. The proposed MAE procedure and HPLC method can be considered reliable and useful tools for the comprehensive multi-component analysis of polyphenols in propolis extracts to be used in apitherapy. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. National Coal Quality Inventory (NACQI)

    Energy Technology Data Exchange (ETDEWEB)

    Robert Finkelman

    2005-09-30

    The U.S. Geological Survey (USGS) conducted the National Coal Quality Inventory (NaCQI) between 1999 and 2005 to address a need for quality information on coals that will be mined during the next 20-30 years. Collaboration between the USGS, State geological surveys, universities, coal burning utilities, and the coal mining industry plus funding support from the Electric Power Research Institute (EPRI) and the U.S. Department of Energy (DOE) permitted collection and submittal of coal samples for analysis. The chemical data (proximate and ultimate analyses; major, minor and trace element concentrations) for 729 samples of raw or prepared coal, coal associated shale, and coal combustion products (fly ash, hopper ash, bottom ash and gypsum) from nine coal producing States are included. In addition, the project identified a new coal reference analytical standard, to be designated CWE-1 (West Elk Mine, Gunnison County, Colorado) that is a high-volatile-B or high-volatile-A bituminous coal with low contents of ash yield and sulfur, and very low, but detectable contents of chlorine, mercury and other trace elements.

  17. China's coal export and inspection

    International Nuclear Information System (INIS)

    Xiaodong Li

    1993-01-01

    With the development of world's business and trade, coal has become a large part of the import and export goods in the international market. The total amount of coal trade has risen a lot. China is rich in coal resources. According to the estimate made by some experts, the reserve which has been explored recently could be exploited hundreds of years. China's output of raw coal has risen a lot during the past forty years. China coal industry has developed rapidly since the 1980s. It is possible for China to become a big coal export country since it has rich resources and increasing output. The paper suggests four steps which must be taken to expand coal exports in China: improve the level of management and administration of coal mines so as to raise the economic benefit; the follow-up production capacity of the present mines must be enhanced rapidly; step up construction of new large-scale mines; and China's coal washing capacity must be improved speedily since the low capacity has seriously influenced the improvement of coal quality. The paper describes the inspection bureaus and companies that have developed to perform inspection of exports in order to guarantee the quality of export coal

  18. Achievement report for fiscal 1982 on Sunshine Program. Research and development of coal liquefaction technology (Conceptual designs for coal liquefaction pilot plants - Solvent extraction liquefaction process); 1982 nendo sekitan ekika gijutsu no kenkyu kaihatsu seika hokokusho. Sekitan ekika pilot plant no gainen sekkei (yozai chushutsu ekikaho)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1983-03-01

    This research aims to prepare conceptual designs for a 250t/d-class and 500t/d-class coal liquefaction pilot plants based on the achievement of research on solvent extraction liquefaction of coal. It also aims to define the solvent extraction process and provide decision-making material relative to the development and promotion of coal liquefaction technologies in the future. Development started in 1978 of the technology of solvent extraction liquefaction of coal, and a 1t/d PDU (process development unit) was completed in 1981. Studies through its operation have continued for more than 3000 hours already, and technical data are being accumulated steadily. Techniques acquired through operating the 1t/d PDU have been put together, and rough process conditions are established. A rough process result is achieved of the same conditions. In these two respects, the newly developed process is equal to other processes. The phenomena in this process are roughly grasped. It is deemed that, with the existing technique combined with the technique acquired here, a technological level has been reached where conceptual designs of large pilot plants may be worked out for solvent extraction liquefaction of coal. Under the circumstances, with a view to developing a commercial plant whose main products will be fuel oils, conceptual designs are prepared for large pilot plants, and are compiled into this report. (NEDO)

  19. Report on the surveys in fiscal 1984. Surveys on the possibility of using coal liquefied oil as a raw material, and technological development thereon; 1984 nendo sekitan ekikayu no genryoka no kanosei oyobi sono gijutsu kaihatsu ni kansuru chosa hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1985-03-01

    With an objective to establish an optimal method for utilizing coal liquefied oil, surveys were performed on the current status of applicable separation technologies for effective utilization of the hetero compounds of O and N contained in liquefied oil, the possibility of hetero compound utilization and issues in technological development for the utilization thereof. Since coal liquefied oil reflects greatly the coal composition and its structure, it contains generally a greater amount of hetero compounds, such as nitrogen and sulfur, as well as aromatic compounds than petroleum. If the hetero compounds could be removed from the liquefied oil more effectively before reforming as a result of progress in separation technologies, hydrogen consumption may be reduced. In addition, economic performance of the coal liquefaction business can be relatively improved by establishing a technology to utilize more effectively these by-products. The current fiscal year has performed surveys on the current status of technologies to separate oxygen and nitrogen in liquefied oil, the possibility of utilizing these hetero compounds, and issues in technological development for the utilization thereof. At the same time, surveys were carried out on the compositions, contents, and separation and analysis methods of hetero compounds in oil obtained by using the coal liquefaction systems being practically used. (NEDO)

  20. In vitro evaluation of the antimicrobial effect of a raw bacteriocin extract in combination with chemical preservatives employed in meat industry

    Directory of Open Access Journals (Sweden)

    Luis A. Aguado Bautista

    2010-12-01

    Full Text Available Biopreservation can be defined as the foods shelf life extension employing antibacterial products like bacteriocins. The objective of this work was to determinate the efficacy of E. faecium MXVK29 bacteriocin in combination with chemical preservatives against spoilage and pathogens microorganisms. Bacteriocin raw extrac antimicrobial activity was 46.34 UA/g of protein. Growth of Pseudomonas putida was not affected by the preservatives employed at the conditions employed. Antimicrobial response was different for other microorganisms since a synergetic effect of the preservatives combination inhibited Brochothrix thermosphacta and Escherichia coli growth. Sodium lactate had additive effect only against Listeria innocua.

  1. Integrated analysis of COX-2 and iNOS derived inflammatory mediators in LPS-stimulated RAW macrophages pre-exposed to Echium plantagineum L. bee pollen extract.

    Directory of Open Access Journals (Sweden)

    Eduarda Moita

    Full Text Available Oxidative stress and inflammation play important roles in disease development. This study intended to evaluate the anti-inflammatory and antioxidant potential of Echium plantagineum L. bee pollen to support its claimed health beneficial effects. The hydromethanol extract efficiently scavenged nitric oxide ((•NO although against superoxide (O2(•- it behaved as antioxidant at lower concentrations and as pro-oxidant at higher concentrations. The anti-inflammatory potential was evaluated in LPS-stimulated macrophages. The levels of (•NO and L-citrulline decreased for all extract concentrations tested, while the levels of prostaglandins, their metabolites and isoprostanes, evaluated by UPLC-MS, decreased with low extract concentrations. So, E. plantagineum bee pollen extract can exert anti-inflammatory activity by reducing (•NO and prostaglandins. The extract is able to scavenge the reactive species (•NO and O2(•- and reduce markers of oxidative stress in cells at low concentrations.

  2. The increase of the efficiency for comprehensive utilization of the fuel and energetic resources (The use coal enterprises of Kazakhstan as example)

    International Nuclear Information System (INIS)

    Satova, R.K.

    1999-01-01

    In Kazakhstan during the period of transition to the market economy in the condition of reduction of coal production and increasing expenditures in coal branch, the problem of of the rational utilization of coal resources becomes the most vital issue. In the thesis theoretical and methodological aspects of socio-economic efficiency of utilization of the fuel and energetic resources are investigated. Different fields of usage of coal and coal wastes are studied, economic evaluation of mechanic and thermo-chemical methods of producing coal in process of bringing resources saving technologies; the national efficiency of using products in the quantity of technological raw and energetic fuel is brought out; the influence refining for the widening of the raw-base of industry, promoting the economic results of production and the lowering environmental pollution. It was estimated that the extracted coal of the region includes 1020 thousand tonne of aluminium oxide and 996 thousand tonne of sulphur; in the course of extracting and coal processing 3650 thousand tonne of firm wastes appeared; during the extracting of Ehkibastuz coal - 90970 thousand tonne, and the Karaganda coal - 40040 thousand tonne.The coal components and wastes mentioned above should be considered not only as source of environment pollution but also as potential resource for the production of industrial goods according to their qualitative characteristics and the availability of technical ideas of the processing. The implementation of the mentioned pre-sup-positions in the conditions of the forming market economy will allow to use the organic part of coal more competently, to involve the other useful components of coal in the sphere of production consumption, to utilize gaseous and firm wastes and to gain of the basis the expansion of resource base of same branches of industry and the reduction of environment pollution. It will be also accompanied by the needs in capital investments for the industrial

  3. 30 CFR 206.459 - Allocation of washed coal.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Allocation of washed coal. 206.459 Section 206... MANAGEMENT PRODUCT VALUATION Indian Coal § 206.459 Allocation of washed coal. (a) When coal is subjected to washing, the washed coal must be allocated to the leases from which it was extracted. (b) When the net...

  4. 30 CFR 206.260 - Allocation of washed coal.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Allocation of washed coal. 206.260 Section 206... MANAGEMENT PRODUCT VALUATION Federal Coal § 206.260 Allocation of washed coal. (a) When coal is subjected to washing, the washed coal must be allocated to the leases from which it was extracted. (b) When the net...

  5. Embryonic exposure to an aqueous coal dust extract results in gene expression alterations associated with the development and function of connective tissue and the hematological system, immunological and inflammatory disease, and cancer in zebrafish.

    Science.gov (United States)

    Caballero-Gallardo, Karina; Wirbisky-Hershberger, Sara E; Olivero-Verbel, Jesus; de la Rosa, Jesus; Freeman, Jennifer L

    2018-03-01

    Coal mining is one of the economic activities with the greatest impact on environmental quality. At all stages contaminants are released as particulates such as coal dust. The first aim of this study was to obtain an aqueous coal dust extract and characterize its composition in terms of trace elements by ICP-MS. In addition, the developmental toxicity of the aqueous coal extract was evaluated using zebrafish (Danio rerio) after exposure to different concentrations (0-1000 ppm; μg mL -1 ) to establish acute toxicity, morphology and transcriptome changes. Trace elements within the aqueous coal dust extract present at the highest concentrations (>10 ppb) included Sr, Zn, Ba, As, Cu and Se. In addition, Cd and Pb were found in lower concentrations. No significant difference in mortality was observed (p > 0.05), but a delay in hatching was found at 0.1 and 1000 ppm (p 0.05). Transcriptomic results of zebrafish larvae revealed alterations in 77, 61 and 1376 genes in the 1, 10, and 100 ppm groups, respectively. Gene ontology analysis identified gene alterations associated with the development and function of connective tissue and the hematological system, as well as pathways associated with apoptosis, the cell cycle, transcription, and oxidative stress including the MAPK signaling pathway. In addition, altered genes were associated with cancer; connective tissue, muscular, and skeletal disorders; and immunological and inflammatory diseases. Overall, this is the first study to characterize gene expression alterations in response to developmental exposure to aqueous coal dust residue from coal mining with transcriptome results signifying functions and systems to target in future studies.

  6. Use of moist run-of-mine coal for gasification

    Energy Technology Data Exchange (ETDEWEB)

    Sowka, K.; Duerlich, M.; Rabe, W. (VEB Gaskombinat Fritz Selbmann, Schwarze Pumpe (German Democratic Republic))

    1988-01-01

    A Series of experiments was performed in 1982 and 1986 to assess the feasibility of substituting brown coal briquets by raw brown coal in the fixed bed gasification plant for producing town gas at Schwarze Pumpe, GDR. Raw brown coal (50% coal moisture, screened coal of fractions 20 to 80 mm) had to be mixed with dry briquets to maintain a maximum 35% coal charge moisture. Briquet substitution degree varied from 20 to 50%. Short-term gasification tests were also carried out at an experimental generator examining 80 to 100% substitution degrees. Parameters of generator operation that were achieved are provided. Experiments proved that 50% briquet substitution is technologically feasible in industrial plant operation employing unscreened coal containing all coal fines. An economic assessment is further made that shows substantial energy savings in coal drying and briquetting.

  7. New approach to brown coal pricing using internal rate of return methodology

    International Nuclear Information System (INIS)

    Bejbl, Jan; Bemš, Julius; Králík, Tomáš; Starý, Oldřich; Vastl, Jaromír

    2014-01-01

    Highlights: • We showed that brown coal is the substitute for black coal only at the time of the investment decision. • We compiled the model used in a calculation of the economically justified price for the productive and extractive component. • The resulting economically justified price is on a par with the current black coal price. • The proposed methodological approach is applicable to solve similar tasks not only in the energy sector. - Abstract: Brown coal is one of the dominant local strategic raw materials in Europe, used, to a large extent, in the power-generating industry. The current situation, where the price of gas and electricity precludes the efficient use of gas sources, leads to the extraction of older sources, chiefly brown coal ones. In tandem with a turning away from nuclear power, brown coal is experiencing a renaissance and the issue of brown coal price setting is, and will be, relevant. This paper deals with a proposal of a new method for determining the base price, consisting of defining the reference fuel chain for electricity and heat production based on brown coal. It builds on the notion that the degree of risk of the involved parties should be reflected in the modified amount of revenue per capital invested. The resulting price is then an economically justified price which encourages a respect for the specific features of the market in question and set the base price of the commodity in a way that is acceptable for both the extractive and the productive components of the fuel chain

  8. 1988 coal price negotiation

    Energy Technology Data Exchange (ETDEWEB)

    Senmura, Akira

    1988-12-01

    In the negotiation on raw coal price for 1988, which began at the end of 1987, Australia requested price rise of 4 - 5 dollars for the reason of rise of Australian dollars, conditions of mines, price drop in the past five years, and world supply/demand of coal. Japan insisted to maintain the price of preceding year. The talk ended in a dead lock which could last a long time. Negotiation on the Canadian coal price also encountered difficulties but an agreement was obtained in March as Japan accepted the increased price. After which, Japan and Australia agreed to raise the price by 2.90 dollars and an increase over last year. Producing countries also requested a wide price rise as 7.50 dollars for general coal, making in this area very difficult to progress. Finally, they agreed to raise the price by 6.30 dollars and the electric power utility in Japan responded by importing of U.S. coal, which has a lower heat output but is also cheaper. It depends on Australia for 70% of coal supply but started to diversify the source. 3 tabs.

  9. Integrated coal preparation

    International Nuclear Information System (INIS)

    Buchanan, D.J.; Jones, T.F.

    1992-01-01

    Perceptions of quality have changed over the years. The attributes of a certain coal (its rank, slagging propensity, ash content etc) are traditionally referred to as its quality. However, the subject of this paper is quality in a much wider sense: quality as fitness for purpose: and all that such a wide definition entails. British Standard BS 5750 (ISO 9000) Quality Systems defines a systems approach to quality, and includes both the supplier of raw materials and the final customer within this boundary. Coal preparation starts at the production face. The greater the proportion of dirt in run-of-mine product the greater the challenge in satisfying the customer's needs. Significant advances have been made in minimizing mined dirt. For example, the sue of vertical steering on longwall faces improves productivity and quality. Unfortunately modern mining methods produce large quantities of fines, despite efforts to reduce them at the point of production and during transportation to the surface. Coal preparation also produces further fines. It has been estimated that fine coal costs 2.5 times as much to clean as large coal, and the costs of handing wet fine coal product will inflate this estimate. Handling considerations rightly concern our customers and are part of the wider meaning of quality. In this paper the authors address some novel solutions to the challenge posed by fines

  10. A reactive transport modelling approach to assess the leaching potential of hydraulic fracturing fluids associated with coal seam gas extraction

    Science.gov (United States)

    Mallants, Dirk; Simunek, Jirka; Gerke, Kirill

    2015-04-01

    Coal Seam Gas production generates large volumes of "produced" water that may contain compounds originating from the use of hydraulic fracturing fluids. Such produced water also contains elevated concentrations of naturally occurring inorganic and organic compounds, and usually has a high salinity. Leaching of produced water from storage ponds may occur as a result of flooding or containment failure. Some produced water is used for irrigation of specific crops tolerant to elevated salt levels. These chemicals may potentially contaminate soil, shallow groundwater, and groundwater, as well as receiving surface waters. This paper presents an application of scenario modelling using the reactive transport model for variably-saturated media HP1 (coupled HYDRUS-1D and PHREEQC). We evaluate the fate of hydraulic fracturing chemicals and naturally occurring chemicals in soil as a result of unintentional release from storage ponds or when produced water from Coal Seam Gas operations is used in irrigation practices. We present a review of exposure pathways and relevant hydro-bio-geo-chemical processes, a collation of physico-chemical properties of organic/inorganic contaminants as input to a set of generic simulations of transport and attenuation in variably saturated soil profiles. We demonstrate the ability to model the coupled processes of flow and transport in soil of contaminants associated with hydraulic fracturing fluids and naturally occurring contaminants.

  11. Raw material versus processing

    International Nuclear Information System (INIS)

    Berg, E.A.T.

    1989-01-01

    Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt

  12. Coal blending preparation for non-carbonized coal briquettes

    Science.gov (United States)

    Widodo; Fatimah, D.; Estiaty, L. M.

    2018-02-01

    Referring to the national energy policy targets for the years 2025, the government has launched the use of coal briquettes as an alternative energy replacement for kerosene and firewood. Non-carbonized briquettes in the form of coal briquettes as well as bio-coal briquettes are used in many small-medium industries and households, and are rarely used by large industries. The standard quality of coal briquettes used as raw material for non-carbonized briquettes is a minimum calorific value of 4,400 kcal/kg (adb); total sulfur at a maximum of 1% (adb), and water content at plants), the environment of deposition, and the geological conditions of the surrounding area, so that the coal deposits in each region will be different as well as the amount and also the quality. Therefore, the quantity and the quality of coal in each area are different to be eligible in the making of briquettes to do blending. In addition to the coal blending, it is also necessary to select the right materials in the making of coal briquettes and bio-coal briquettes. The formulation of the right mixture of material in the making of briquettes, can be produced of good quality and environmental friendly.

  13. New coal

    Energy Technology Data Exchange (ETDEWEB)

    1979-07-01

    Specially dedicated to coal, this edition comprises a series of articles of general interest dealing with the position of the French coalmining industry (interview with M.P. Gardent), the coal market in France, the work of CERCHAR, etc. New techniques, in-situ gasification of deep coal, gasification of coal by nuclear methods, the conversion of coal into petrol, the Emile Huchet power plant of Houilleres du Bassin de Lorraine, etc., are dealt with.

  14. Coal upgrading

    Energy Technology Data Exchange (ETDEWEB)

    Nunes, S. [IEA Clean Coal Centre, London (United Kingdom)

    2009-10-15

    This report examines current technologies and those likely to be used to produce cleaner coal and coal products, principally for use in power generation and metallurgical applications. Consideration is also given to coal production in the leading coal producing countries, both with developed and developing industries. A range of technologies are considered. These include the coal-based liquid fuel called coal water mixture (CWM) that may compete with diesel, the production of ultra-clean coal (UCC) and coal liquefaction which competes with oil and its products. Technologies for upgrading coal are considered, especially for low rank coals (LRC), since these have the potential to fill the gap generated by the increasing demand for coal that cannot be met by higher quality coals. Potential advantages and downsides of coal upgrading are outlined. Taking into account the environmental benefits of reduced pollution achieved through cleaner coal and reduced transport costs, as well as other positive aspects such as a predictable product leading to better boiler design, the advantages appear to be significant. The drying of low rank coals improves the energy productively released during combustion and may also be used as an adjunct or as part of other coal processing procedures. Coal washing technologies vary in different countries and the implications of this are outlined. Dry separation technologies, such as dry jigging and electrostatic separation, are also described. The demonstration of new technologies is key to their further development and demonstrations of various clean coal technologies are considered. A number of approaches to briquetting and pelletising are available and their use varies from country to country. Finally, developments in upgrading low rank coals are described in the leading coal producing countries. This is an area that is developing rapidly and in which there are significant corporate and state players. 81 refs., 32 figs., 3 tabs.

  15. Effect of coal soluble constituents on caking property of coal

    Energy Technology Data Exchange (ETDEWEB)

    Hengfu Shui; Mingdong Zheng; Zhicai Wang; Xunming Li [Anhui University of Technology, Maanshan (China). School of Chemistry and Chemical Engineering, Key Laboratory of Anhui Educational Department

    2007-07-15

    Three cokemaking bituminous coals were extracted by the CS{sub 2}/NMP mixed solvents with different content of NMP, and the effect of the amount and the component of coal soluble constituents on the caking property of the extracted residues of coals were investigated in this study. The CS{sub 2}/NMP mixed solvent (1:1 by volume) was found to give the maximal extraction yields for the three coals, and the fat coal gave the highest extraction yield of 78.6% (daf) corresponding to its highest caking index of 101. It was found that for coking coal, when the extraction yield got to the maximum of 25.3% in the 1:1 by volume of CS{sub 2}/NMP mixed solvent, the residue extracted still had caking property with the caking index of 19. This means parts of the caking constituents of coal are un-extractible because of covalent bonding or strong associative cross-links. The soluble components extracted by the CS{sub 2}/NMP mixed solvent and their effects on the caking indexes of the residues at a similar extraction yield quite differed depending on the NMP content in the mixed solvent. The coal solubles extracted by the CS{sub 2}/NMP mixed solvent with NMP less than 50% contained less light constituents with less of oxygen groups. This may lead to the decrease in the caking indexes for the residues obtained at the similar extraction yields compared to those of the CS{sub 2}/NMP mixed solvent with NMP more than 50%. 11 refs., 5 figs., 3 tabs.

  16. Examination of soil contaminated by coal-liquids by size exclusion chromatography in 1-methyl-2-pyrrolidinone solution to evaluate interference from humic and fulvic acids and extracts from peat.

    Science.gov (United States)

    Morgan, T J; Herod, A A; Brain, S A; Chambers, F M; Kandiyoti, R

    2005-11-18

    Soil from a redundant coke oven site has been examined by extraction of soluble materials using 1-methyl-2-pyrrolidinone (NMP) followed by size exclusion chromatography (SEC) of the extracted material. The extracted material was found to closely resemble a high temperature coal tar pitch. Standard humic and fulvic acids were also examined since these materials are very soluble in NMP and would be extracted with pitch if present in the soil. Humic substances derived from peat samples and NMP-extracts of peats were also examined. The results show that the humic and fulvic substances were not extracted directly by NMP from peats. They were extracted using caustic soda solution and were different from the peat extracts in NMP. These results indicate that humic and fulvic acids were soluble in NMP in the protonated polyelectrolyte form but not in the original native polyelectrolyte form. The extraction of soil using NMP followed by SEC appears to be a promising method for identifying contamination by coal-based industries.

  17. Determination of phenolic acids and flavonoids in raw propolis by silica-supported ionic liquid-based matrix solid phase dispersion extraction high performance liquid chromatography-diode array detection.

    Science.gov (United States)

    Wang, Zhibing; Sun, Rui; Wang, Yuanpeng; Li, Na; Lei, Lei; Yang, Xiao; Yu, Aimin; Qiu, Fangping; Zhang, Hanqi

    2014-10-15

    The silica-supported ionic liquid (S-SIL) was prepared by impregnation and used as the dispersion adsorbent of matrix solid phase dispersion (MSPD) for the simultaneous extraction of eight phenolic acids and flavonoids, including caffeic acid, ferulic acid, morin, luteolin, quercetin, apigenin, chrysin, and kaempferide in raw propolis. High performance liquid chromatography with a Zorbax SB-C18 column (150mm×4.6mm, 3.5μm) was used for separation of the analytes. The mobile phase consisted of 0.2% phosphoric acid aqueous solution and acetonitrile and the flow rate of the mobile phase was 0.5mL/min. The experimental conditions for silica-supported ionic liquid-based matrix solid phase dispersion (S-SIL-based MSPD) were optimized. S-SIL containing 10% [C6MIM]Cl was used as dispersant, 20mL of n-hexane as washing solvent and 15mL of methanol as elution solvent. The ratio of S-SIL to sample was selected to be 4:1. The standard curves showed good linear relationship (r>0.9995). The limits of detection and quantification were in the range of 5.8-22.2ngmL(-1) and 19.2-74.0ngmL(-1), respectively. The relative standard deviations (RSDs) of intra-day and inter-day determination were lower than 8.80% and 11.19%, respectively. The recoveries were between 65.51% and 92.32% with RSDs lower than 8.95%. Compared with ultrasound-assisted extraction (UAE) and soxhlet extraction, the present method consumed less sample, organic solvent, and extraction time, although the extraction yields obtained by S-SIL-based MSPD are slightly lower than those obtained by UAE. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Coal-92

    International Nuclear Information System (INIS)

    Hillring, B.; Sparre, C.

    1992-11-01

    Swedish consumption of coal and coke during 1991 and trends in technology, environment and market aspects of coal use are reported. Steam coal use in the heating sector was unchanged from 1991, 1.2 Mtons. Reduced consumption in smaller district heating units (due to conversion to biofuels and gas) was compensated by increased use for power generation in cogeneration plants. Coal consumption in industry fell 0.10 Mton to 0.84 Mton due to lower production in one industry branch. Import of steam coal was 1.1 Mton (down 0.5 Mton from 1990) since new rules for strategic reserves allowed a reduction of stocks. During the last five years stocks have been reduced by 2 Mtons. Import of metallurgical coal was 1.6 Mton, unchanged from 1990. The report also gives statistics for the coal using plants in Sweden, on coal R and D, and on emission laws for coal firing. (9 tabs., 2 figs.)

  19. Study on standard coal preparation plant for coking coal in Jharia Coalfield

    Energy Technology Data Exchange (ETDEWEB)

    Winiewski, J; Sarkar, G G

    1975-10-01

    The proposed standardization of coal preparation plant will be based on three standard types of crushing station, a standard jig washery or cyclone washery, and three standard types of slurry water treatment section. Some large installations, and some existing washeries after modification, may incorporate heavy media baths for coarse coal and jigs for slack coal, where coal is easy or moderately easy to wash. Flow sheets are given for the standard types of crushing plant, washery, and slurry water circuit. The storage of raw coal and saleable products is briefly discussed.

  20. Food Safety and Raw Milk

    Science.gov (United States)

    ... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...

  1. Detecting the effects of coal mining, acid rain, and natural gas extraction in Appalachian basin streams in Pennsylvania (USA) through analysis of barium and sulfate concentrations.

    Science.gov (United States)

    Niu, Xianzeng; Wendt, Anna; Li, Zhenhui; Agarwal, Amal; Xue, Lingzhou; Gonzales, Matthew; Brantley, Susan L

    2018-04-01

    To understand how extraction of different energy sources impacts water resources requires assessment of how water chemistry has changed in comparison with the background values of pristine streams. With such understanding, we can develop better water quality standards and ecological interpretations. However, determination of pristine background chemistry is difficult in areas with heavy human impact. To learn to do this, we compiled a master dataset of sulfate and barium concentrations ([SO 4 ], [Ba]) in Pennsylvania (PA, USA) streams from publically available sources. These elements were chosen because they can represent contamination related to oil/gas and coal, respectively. We applied changepoint analysis (i.e., likelihood ratio test) to identify pristine streams, which we defined as streams with a low variability in concentrations as measured over years. From these pristine streams, we estimated the baseline concentrations for major bedrock types in PA. Overall, we found that 48,471 data values are available for [SO 4 ] from 1904 to 2014 and 3243 data for [Ba] from 1963 to 2014. Statewide [SO 4 ] baseline was estimated to be 15.8 ± 9.6 mg/L, but values range from 12.4 to 26.7 mg/L for different bedrock types. The statewide [Ba] baseline is 27.7 ± 10.6 µg/L and values range from 25.8 to 38.7 µg/L. Results show that most increases in [SO 4 ] from the baseline occurred in areas with intensive coal mining activities, confirming previous studies. Sulfate inputs from acid rain were also documented. Slight increases in [Ba] since 2007 and higher [Ba] in areas with higher densities of gas wells when compared to other areas could document impacts from shale gas development, the prevalence of basin brines, or decreases in acid rain and its coupled effects on [Ba] related to barite solubility. The largest impacts on PA stream [Ba] and [SO 4 ] are related to releases from coal mining or burning rather than oil and gas development.

  2. Chemical processing of raw florets of dyer's saffron and successful extraction of a resulting product (carthamin: an approach to improve conventional methods

    Directory of Open Access Journals (Sweden)

    Koshi Saito

    2014-01-01

    Full Text Available Efficacy of KMnO4 on processing red florets of dyer's saffron was examined in the presence of micromolar concentrations of the metal salts. Apparent value for KMnO4 determined by double-reciprocal plots was 126 µM, whose value corresponds to a 1/154-fold of dried florets. Successful extraction of red carthamin was performed by using the processed matters with various solvent systems. HCl/NaOH, acetic acid/ammonia water and pyridine/methanol were found to be effective. For purification of carthamin, the cellulose adsorption technique was very promising. The data are assessed to standarize the new technique.

  3. Fast and reliable DNA extraction protocol for identification of species in raw and processed meat products sold on the commercial market

    Directory of Open Access Journals (Sweden)

    Alvarado Pavel Espinoza

    2017-08-01

    Full Text Available In this work a protocol for the extraction of DNA from the meat of different animals (beef, pork, and horse was established. The protocol utilized TE lysis buffer with varying concentrations of phenol and chloroform as a base reagent. Reactions were carried out for verying time periods and under differing temperatures. All samples analyzed were obtained from commercial grade meat sourced from the local region. 12 samples were used for methodological optimization with 30 repetitions per sample. Once optimized, purity results for the three species were 1.7 with a concentration (determined spectrophotometrically at 260 nm of 100 μl/ml of DNA. The protocol was tested using 465 different meat samples from different animal species. All meat used was fresh and processed. Results showed a purity of 1.35 ± 0.076 and a DNA concentration of 70 ± 0.31 μl for a time duration of 1.5 hours. These results were tested by polymerase chain reaction (PCR as reported by several authors. The extracts were tested using different PCR reactions using specific primers for horses. Results suggest that there was 39 positive samples. The proposed methodology provides an efficient way to detect DNA concentration and purity, suitable for amplification with PCR.

  4. Atividade potencialmente alelopática de extratos brutos e hidroalcoólicos de feijão-de-porco (Canavalia ensiformis Potential allelopathic activity in hydroalcoholic and raw extracts of Canavalia ensiformis

    Directory of Open Access Journals (Sweden)

    A.P.S. Souza Filho

    2002-12-01

    Full Text Available Extratos hidroalcoólicos de parte aérea, raízes e sementes e extratos brutos de sementes de Canavalia ensiformis foram preparados, visando identificar e caracterizar os efeitos potencialmente alelopáticos sobre a germinação de sementes e o alongamento da radícula das plantas daninhas Mimosa pudica, Urena lobata, Senna obtusifolia e Senna occidentalis. Os trabalhos foram desenvolvidos em condições controladas de 25 ºC de temperatura e fotoperíodo de 12 horas, para o bioensaio de germinação, e 24 horas, para o de alongamento da radícula. Os efeitos foram aquilatados tendo por contraste (testemunha a água destilada. Os resultados variaram em função da espécie receptora, da concentração e da parte da planta utilizada no preparo dos extratos. A inibição da germinação das sementes e do alongamento da radícula foi diretamente proporcional à concentração do extrato, com as mais intensas inibições observadas na concentração de 4%. Independentemente da espécie receptora, as sementes, seguidas das raízes, foram as principais fontes de substâncias químicas com atividades potencialmente alelopáticas no feijão-de-porco. A análise dos diferentes extratos brutos revelou que as substâncias químicas com atividades potencialmente alelopáticas presentes nas sementes do feijão-de-porco têm polaridade compreendida entre o acetato de etila e o metanol. Para o extrato bruto metanólico, concentrações a partir de 0,4% inibiram completamente a germinação das espécies receptoras, enquanto para M. pudica e S. occidentalis concentrações de 0,6 e 0,8% proporcionaram inibições da ordem de 100% para a germinação das sementes dessas espécies. A sensibilidade das espécies aos efeitos potencialmente alelopáticos variou na seguinte ordem decrescente: M. pudica > S. occidentalis > S. obtusifolia > U. lobata.Hydroalcoholic extracts from shoot, roots and seeds and seed raw extracts from Canavalia ensiformis were prepared to

  5. A study on the hydrotreating of coal hydro liquefaction residue and its kinetics

    Energy Technology Data Exchange (ETDEWEB)

    Huang, J.; Lu, X.; Zhang, D.; Gao, J. [Department of Chemical Engineering for Energy Resources, East China University of Science and Technology, Shanghai (China)

    2010-09-15

    Hydro-conversion of coal hydro liquefaction residue obtained from a 6 t/day pilot plant of Shenhua Group in Shanghai was carried out under the hydrotreating condition. The coal hydro liquefaction residue and its product were extracted in sequence with n-hexane, toluene and tetrahydrofuran in a Soxhlet apparatus. The n-hexane soluble fractions increased with the increase of reaction temperature and time. Its amount increased from 14.14% to a maximum of 40.86% under the conditions of 470 {sup o}C and 30 min, which meant that moderate extension of coal residence time in the coal hydro liquefaction reactor is beneficial to the increase of oil yield. A 4-lumped kinetic model of coal hydro liquefaction residue hydro-conversion was performed using solubility-based lumped fractions. In the model, the tetrahydrofuran insoluble fractions were classified into two parts: easily reactive part and unreactive part. The kinetic parameters were estimated by a fourth-order Runge-Kutta method and a nonlinear least squares method, and the apparent activation energies were calculated according to the Arrhenius Equation. A large quantity of total catalyst consisting of remained liquefaction catalyst, part of the mineral from raw coal and additive Fe-based catalyst could considerably reduce the apparent activation energy of hydro-conversion for the toluene insoluble/tetrahydrofuran insoluble fractions to 36.79 kJ-mol{sup -1}. The calculated values of the model coincided well with the experimental values. (authors)

  6. A Study on the Hydrotreating of Coal Hydroliquefaction Residue and its Kinetics

    Directory of Open Access Journals (Sweden)

    Jinsheng Gao

    2010-09-01

    Full Text Available Hydro-conversion of coal hydroliquefaction residue obtained from a 6t/day pilot plant of Shenhua Group in Shanghai was carried out under the hydrotreating condition. The coal hydroliquefaction residue and its product were extracted in sequence with n-hexane, toluene and tetrahydrofuran in a Soxhlet apparatus. The n-hexane soluble fractions increased with the increase of reaction temperature and time. Its amount increased from 14.14% to a maximum of 40.86% under the conditions of 470 °C and 30 min, which meant that moderate extension of coal residence time in the coal hydroliquefaction reactor is beneficial to the increase of oil yield. A 4-lumped kinetic model of coal hydroliquefaction residue hydro-conversion was performed using solubility-based lumped fractions. In the model, the tetrahydrofuran insoluble fractions were classified into two parts: easily reactive part and unreactive part. The kinetic parameters were estimated by a fourth-order Runge-Kutta method and a nonlinear least squares method, and the apparent activation energies were calculated according to the Arrhenius Equation. A large quantity of total catalyst consisting of remained liquefaction catalyst, part of the mineral from raw coal and additive Fe-based catalyst could considerably reduce the apparent activation energy of hydro-conversion for the toluene insoluble/tetrahydrofuran insoluble fractions to 36.79 kJ•mol-1. The calculated values of the model coincided well with the experimental values.

  7. Coal 1992

    Energy Technology Data Exchange (ETDEWEB)

    1992-01-01

    ACR's Coal 1992, the successor to the ACR Coal Marketing Manual, contains a comprehensive set of data on many aspects of the Australian coal industry for several years leading up to 1992. Tables and text give details of coal production and consumption in New South Wales, Queensland and other states. Statistics of the Australian export industry are complemented by those of South Africa, USA, New Zealand, Canada, Indonesia, China, Colombia, Poland and ex-USSR. Also listed are prices of Australian coking and non-coking coal, Australian coal stocks (and those of other major countries), loading port capacities, freight rates and coal quality requirements (analysis of coals by brand and supplier). A listing of Australian coal exporting companies is provided. A description of the spot Coal Screen Dealing System is given. World hard coal imports are listed by country and coal imports by major Asian countries tabulated. A forecast of demand by coal type and country up to the year 2000 is included.

  8. Coal pump

    Science.gov (United States)

    Bonin, John H.; Meyer, John W.; Daniel, Jr., Arnold D.

    1983-01-01

    A device for pressurizing pulverized coal and circulating a carrier gas is disclosed. This device has utility in a coal gasification process and eliminates the need for a separate collection hopper and eliminates the separate compressor.

  9. Rapid detection of peptide markers for authentication purposes in raw and cooked meat using ambient liquid extraction surface analysis mass spectrometry.

    Science.gov (United States)

    Montowska, Magdalena; Alexander, Morgan R; Tucker, Gregory A; Barrett, David A

    2014-10-21

    In this Article, our previously developed ambient LESA-MS methodology is implemented to analyze five types of thermally treated meat species, namely, beef, pork, horse, chicken, and turkey meat, to select and identify heat-stable and species-specific peptide markers. In-solution tryptic digests of cooked meats were deposited onto a polymer surface, followed by LESA-MS analysis and evaluation using multivariate data analysis and tandem electrospray MS. The five types of cooked meat were clearly discriminated using principal component analysis and orthogonal partial least-squares discriminant analysis. 23 heat stable peptide markers unique to species and muscle protein were identified following data-dependent tandem LESA-MS analysis. Surface extraction and direct ambient MS analysis of mixtures of cooked meat species was performed for the first time and enabled detection of 10% (w/w) of pork, horse, and turkey meat and 5% (w/w) of chicken meat in beef, using the developed LESA-MS/MS analysis. The study shows, for the first time, that ambient LESA-MS methodology displays specificity sufficient to be implemented effectively for the analysis of processed and complex peptide digests. The proposed approach is much faster and simpler than other measurement tools for meat speciation; it has potential for application in other areas of meat science or food production.

  10. Annual report 1997. Energies and raw materials; Rapport annuel 1997. Energies et matieres premieres

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-12-31

    This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)

  11. Annual report 1997. Energies and raw materials; Rapport annuel 1997. Energies et matieres premieres

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-12-31

    This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)

  12. Coal business heats up in the US

    Energy Technology Data Exchange (ETDEWEB)

    Mohan, M. [CN Rail (United States)

    2002-03-01

    The fact that CN's Coal Business Unit moved just under 50 million t of coal in 2001 would have been unimaginable just a year earlier, as CN's coal franchise faced a number of challenges last year. On the metallurgical side, where bituminous coal is used in steel production, rising extraction costs in relation to national and international values forced the closure of three CN-served mines in 2000: TeckCominco's Quinteet mine in British Columbia; Smoky River Coal's Smoky River facility and Luscar's Gregg River mine, Alberta. As for thermal coal, utilities had been moving to alternative fuels, maintaining only low coal inventories, and there were few plans for new coal plants. The article explains how North America's railroad helps fuel growing demand for thermal and metallurgical coal. 5 photos.

  13. New coal-based energy systems

    International Nuclear Information System (INIS)

    Barnert, H.

    1986-01-01

    Conversion of coal into liquid fuels or into coal gas is considered and the use of high temperature nuclear reactors whose waste heat can be used for remote (district) heating mentioned. The use of high temperature reactors as energy source for coal gasification is also examined and, finally, the extraction of heat from combined coal, steel and high temperature nuclear reactors is suggested. (G.M.E.)

  14. Thallium in mineral resources extracted in Poland

    Directory of Open Access Journals (Sweden)

    Bojakowska I.

    2013-04-01

    Full Text Available Thallium concentrations in primary mineral commodities extracted in Poland and processed in high temperatures were determined by ICP-MS method. Samples of hard and brown coal, copper-silver and zinclead ores, argillaceous and calcareous rocks of different genesis and age were analyzed. The highest thallium concentrations occur in the zinc-lead ores, the average content being of 52.1 mg/kg. The copper ores contain in average 1.4 mg/kg of thallium. Hard coals from the Upper Silesian Coal Basin display higher thallium content than those exploited in the Lublin Coal Basin. Brown coals from Turow deposit distinguish by much higher values, 0.7 mg/kg Tl, than those from huge Bełchatów and smaller Konin-Turek region deposits. Average thallium concentrations in clays used for ceramic materials are lower than 1 mg/kg, except of Mio-Pliocene Slowiany deposit. The average content of thallium in the studied limestone and dolomite raw materials for cement, lime, and metallurgical flux, and refractories is very low in comparison to the average amounts in the world carbonate rocks.

  15. Map of critical raw material deposits in Europe

    Science.gov (United States)

    Guillaume, Bertrand

    2016-04-01

    common interoperable EU Geological Knowledge Base. Such a Knowledge Base will support exploration for indigenous mineral resources and strengthen policy and decision making. In 2010, the European Commission identified 14 non energy non-agricultural raw materials as being critical. Criticality is based on both the scarcity of supply and the importance to European industry. This list was updated in 2014 to include 7 new commodities with one being dropped from the original list. The list now comprises: antimony, beryllium, borates, chromium, cobalt, coking coal, fluorspar, gallium, germanium, graphite, indium, magnesite, magnesium, niobium, phosphate rock, platinum group metals, light and heavy rare earth elements (separately), silicon metal and tungsten. ProMine was a European Union (EU) co-funded project, which had as its main objective the stimulation of the extractive industry to deliver new products to manufacturing industry. A major deliverable of the project was the ProMine Mineral Deposit (MD) database that contains information related to almost 13,000 mineral deposits in Europe. In order to extract data to be displayed on the CRM map of Europe, the ProMine MD database was queried for all commodities on the EC CRM list which were in the medium to super-large deposit size. Following this, the dataset was circulated to MREG in order to verify, validate and update the list.

  16. Germanium content in Polish hard coals

    Directory of Open Access Journals (Sweden)

    Makowska Dorota

    2016-01-01

    Full Text Available Due to the policy of the European Union, it is necessary to search for new sources of scarce raw materials. One of these materials is germanium, listed as a critical element. This semi-metal is widely used in the electronics industry, for example in the production of semiconductors, fibre optics and solar cells. Coal and fly ash from its combustion and gasification for a long time have been considered as a potential source of many critical elements, particularly germanium. The paper presents the results of germanium content determination in the Polish hard coal. 23 coal samples of various coal ranks were analysed. The samples were collected from 15 mines of the Upper Silesian Coal Basin and from one mine of the Lublin Coal Basin. The determination of germanium content was performed with the use of Atomic Absorption Spectrometry with Electrothermal Atomization (GFAAS. The investigation showed that germanium content in the analysed samples was at least twice lower than the average content of this element in the hard coals analysed so far and was in the range of 0.08 ÷ 1.28 mg/kg. Moreover, the content of Ge in the ashes from the studied coals does not exceed 15 mg/kg, which is lower than the average value of Ge content in the coal ashes. The highest content of this element characterizes coals of the Lublin Coal Basin and young coals type 31 from the Vistula region. The results indicate a low utility of the analysed coal ashes as a source of the recovery of germanium. On the basis of the analyses, the lack of the relationship between the content of the element and the ash content in the tested coals was noted. For coals of the Upper Silesian Coal Basin, the relationship between the content of germanium in the ashes and the depth of the seam was observed.

  17. Preliminary experimental studies of waste coal gasification

    Energy Technology Data Exchange (ETDEWEB)

    Su, S.; Jin, Y.G.; Yu, X.X.; Worrall, R. [CSIRO, Brisbane, QLD (Australia). Advanced Coal Technology

    2013-07-01

    Coal mining is one of Australia's most important industries. It was estimated that coal washery rejects from black coal mining was approximately 1.82 billion tonnes from 1960 to 2009 in Australia, and is projected to produce another one billion tonnes by 2018 at the current production rate. To ensure sustainability of the Australian coal industry, we have explored a new potential pathway to create value from the coal waste through production of liquid fuels or power generation using produced syngas from waste coal gasification. Consequently, environmental and community impacts of the solid waste could be minimized. However, the development of an effective waste coal gasification process is a key to the new pathway. An Australian mine site with a large reserve of waste coal was selected for the study, where raw waste coal samples including coarse rejects and tailings were collected. After investigating the initial raw waste coal samples, float/sink testing was conducted to achieve a desired ash target for laboratory-scale steam gasification testing and performance evaluation. The preliminary gasification test results show that carbon conversions of waste coal gradually increase as the reaction proceeds, which indicates that waste coal can be gasified by a steam gasification process. However, the carbon conversion rates are relatively low, only reaching to 20-30%. Furthermore, the reactivity of waste coal samples with a variety of ash contents under N{sub 2}/air atmosphere have been studied by a home-made thermogravimetric analysis (TGA) apparatus that can make the sample reach the reaction temperature instantly.

  18. Black coal. Australian statistics for 1984-85

    Energy Technology Data Exchange (ETDEWEB)

    1986-06-01

    According to the Joint Coal Board, production of raw black coal in Australia in 1984-85 was 145,137,000 tonnes - 12.1% more than in 1983-84. Saleable coal production was 118,261,000 tonnes, 12% more than the previous year. Raw coal production from open cut mines rose by 20.3% to 96,523,000 tonnes, whilst underground mine production fell by 1.1% to 48,614,000 tonnes. As in the previous year, the growth in coal production was the result of further strong expansion of exports of both metallurgical and steaming coals. Significant production increases were achieved for the year in both coal exporting states: New South Wales and Queensland.

  19. Distribution of trace elements in Western Canadian coal ashes

    Energy Technology Data Exchange (ETDEWEB)

    Kronberg, B I; Brown, J R; Fyfe, W S; Peirce, M; Winder, C G

    1981-01-01

    Concentrations of 52 minor elements in coal ash were determined using spark source mass spectroscopy. Hg levels in raw coal were investigated by cold vapour atomic absorption spectrophotometry. The concentration of elements are compared to other available data and to levels in the Earth's crust. F levels in coal ash exceed 500/sub g-1/ and may be greater than 1 wt% om raw coal. Approximately half the elements (B, S, Ni, Zn, Ga, Se, Sr, Y, Mo, Sn, Sb, I, Ba, Pr, Nd, Sm, Eu, Ho, Hf, Pt, Hg, Pb, Tl, Bi, U) investigated are enriched in the coal ash with respect to the Earth's crust. The ranges in minor element concentrations in coal ash and coal from different global regions are very similar.

  20. Identification of organic sulfur compounds in coal bitumen obtained by different extraction techniques using comprehensive two-dimensional gas chromatography coupled to time-of-flight mass spectrometric detection

    Energy Technology Data Exchange (ETDEWEB)

    Machado, Maria Elisabete; Cappelli Fontanive, Fernando; Bastos Caramao, Elina; Alcaraz Zini, Claudia [Universidade Federal do Rio Grande do Sul, Instituto de Quimica, Porto Alegre, RS (Brazil); Oliveira, Jose Vladimir de [URI, Universidade Regional Integrada do Alto Uruguai e das Missoes, Erechim, RS (Brazil)

    2011-11-15

    The determination of organic sulfur compounds (OSC) in coal is of great interest. Technically and operationally these compounds are not easily removed and promote corrosion of equipment. Environmentally, the burning of sulfur compounds leads to the emission of SO{sub x} gases, which are major contributors to acid rain. Health-wise, it is well known that these compounds have mutagenic and carcinogenic properties. Bitumen can be extracted from coal by different techniques, and use of gas chromatography coupled to mass spectrometric detection enables identification of compounds present in coal extracts. The OSC from three different bitumens were tentatively identified by use of three different extraction techniques: accelerated solvent extraction (ASE), ultrasonic extraction (UE), and supercritical-fluid extraction (SFE). Results obtained from one-dimensional gas chromatography (1D GC) coupled to quadrupole mass spectrometric detection (GC-qMS) and from two-dimensional gas chromatography with time-of-flight mass spectrometric detection (GC x GC-TOFMS) were compared. By use of 2D GC, a greater number of OSC were found in ASE bitumen than in SFE and UE bitumens. No OSC were identified with 1D GC-qMS, although some benzothiophenes and dibenzothiophenes were detected by use of EIM and SIM modes. GC x GC-TOFMS applied to investigation of OSC in bitumens resulted in analytical improvement, as more OSC classes and compounds were identified (thiols, sulfides, thiophenes, naphthothiophenes, benzothiophenes, and benzonaphthothiophenes). The roof-tile effect was observed for OSC and PAH in all bitumens. Several co-elutions among analytes and with matrix interferents were solved by use of GC x GC. (orig.)

  1. Energies and raw materials. The energy situation

    International Nuclear Information System (INIS)

    1997-11-01

    Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in November 1997: primary energy total consumption has increased (mobile year) of 0.6%, at a slightly inferior rate than the rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 9.3%), slight increase for petroleum products (+ 1.2%), markedly slowing down increase for gas (+ 1.4%) and moderate increase for electricity (+ 1.3%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a maintained high energy cost level with + 14% on one year, reaching 86.8 billions Francs, to be compared to 76.1 in November 1996

  2. Energies and raw materials. The energy situation

    International Nuclear Information System (INIS)

    1997-09-01

    Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in September 1997: primary energy total consumption has increased (mobile year) of 1.1%, at the same rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 5.9%), slight increase for petroleum products (+ 0.8%), strong increase for gas (+ 3.2%) and moderate increase for electricity (+ 1.7%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a record energy cost level with + 30% on one year, reaching 89.2 billions Francs, to be compared to 68.5 in September 1996

  3. Raw material uranium

    International Nuclear Information System (INIS)

    Arnold, O.

    1975-01-01

    In this paper some aspects are being considered, in as far as they can contribute to a better understanding of uranium as a raw material and an energy carrier, and as they can indicate the possible ways and means open to the German Federal Republic for securing this highly desirable raw material, without becoming even more dependent on the economic and political views of the producing countries, than it is the case in respect of oil. (orig.) [de

  4. Equations describing contamination of run of mine coal with dirt in the Upper Silesian Coalfield

    Energy Technology Data Exchange (ETDEWEB)

    Winiewski, J J

    1977-12-01

    Statistical analysis proved that contamination with dirt of run of mine coal from seams in the series 200 to 600 of the Upper Silesian Coalfield depends on the average ash content of a given raw coal. A regression equation is deduced for coarse and fine sizes of each coal. These equations can be used to predict the degree of contamination of run of mine coal to an accuracy sufficient for coal preparation purposes.

  5. Australian coal

    Energy Technology Data Exchange (ETDEWEB)

    1985-11-01

    Total export shipments of coal in Australia in the year ending June 30 1985 reached a record of 83.8 Mt. The export trade is expected to bring in an income of 4 billion Australian dollars in the current year making coal Australia's biggest revenue-earning export commodity. This article presents a brief overview of the Australian coal industry with production and export statistics and information on major open pit and underground mines.

  6. Coal - 96

    International Nuclear Information System (INIS)

    Sparre, C.

    1996-09-01

    The report deals mainly with coal consumption, but also gives some information about technology, environmental aspects and markets. Data have been collected by questionnaires or via telephone. The use of steam coal for heating was 0.8 Mtons (down 20% from 1994). Cogeneration plants were the main users. Taxes and environmental reasons cause a reduction of the coal use that will probably continue the next years. Use of steam coal in industry has been constant at a level of 0.7 Mtons. The import of metallurgical coal rests constant at a level of 1.6 Mtons. 1.2 Mtons of coke was produced, and 0.3 Mtons imported. The PFBC-plant at Vaertan, Stockholm used 0.13 Mtons of coal, while some coal fired power plants have been converted to peat and wood fuels. The average price of steam coal imported to Sweden in 1995 was 333 SEK/ton, 6% higher than in 1994. The contract prices for delivery 1996 are about the same as at the end of 1995. All cogeneration plants have some sort of SO 2 removal system, mostly wet-dry. The largest plant, at Vaesteraas, has recently invested in a SCR system for NO x removal. Most other plants are using low NO x burners or SNCR systems, based on ammonia or urea, which reduce the emissions 50 - 70%. Some statistic about the world coal market is also given in the report

  7. Venezuelan coal

    International Nuclear Information System (INIS)

    Vazquez, L.U.

    1991-01-01

    The existence of coal deposits in Venezuela has been known since the early nineteenth century, when the Naricual Mines were discovered in the State of Anzoategui Eastern Venezuela. Through the years the Venezuelan coal business had its ups and downs, but it was not until 1988 that we could properly say that our coal began to play a role in the international market. This paper reports that it is only now, in the nineties, that Venezuelan coal projects have come under a planning, promotional and developmental policy preparing the ground for the great projects Venezuela will have in the not-too-distant future

  8. Activated carbons from Mongolian coals by thermal treatment

    Directory of Open Access Journals (Sweden)

    A Ariunaa

    2014-09-01

    Full Text Available Mongolian different rank coals were used as raw material to prepare activatedcarbons by physical activation method. The coal derived carbons were oxidized with nitric acid in order to introduce surface oxygen groups. The ultimate elemental analysis, scanning electron microscopy, surface area, pore size distribution analysis and selective neutralization method were used to characterize the surface properties of activated carbons, oxidizedcarbons and raw coals. The effect of coal grade on the adsorption properties of the carbons were studied. It was concluded that Naryn sukhait bituminous coal could be serve as suitable raw material for production of activated carbons for removal of heavy metal ions from solution.DOI: http://dx.doi.org/10.5564/mjc.v12i0.174 Mongolian Journal of Chemistry Vol.12 2011: 60-64

  9. EXTRACT

    DEFF Research Database (Denmark)

    Pafilis, Evangelos; Buttigieg, Pier Luigi; Ferrell, Barbra

    2016-01-01

    The microbial and molecular ecology research communities have made substantial progress on developing standards for annotating samples with environment metadata. However, sample manual annotation is a highly labor intensive process and requires familiarity with the terminologies used. We have the...... and text-mining-assisted curation revealed that EXTRACT speeds up annotation by 15-25% and helps curators to detect terms that would otherwise have been missed.Database URL: https://extract.hcmr.gr/......., organism, tissue and disease terms. The evaluators in the BioCreative V Interactive Annotation Task found the system to be intuitive, useful, well documented and sufficiently accurate to be helpful in spotting relevant text passages and extracting organism and environment terms. Comparison of fully manual...

  10. Coal summit II

    Energy Technology Data Exchange (ETDEWEB)

    1983-01-01

    Various papers were presented on world coal trade. Papers include: Poland as a producer and exporter of coal; the dynamics of world coal trade; Cerrejon coal production perspectives; present state of the Australian coal industry; present state of the EC coal market and future prospects; prospects of US coal exports to Europe; forecast of Italian coal supply and demand through 1990; statistics from coal transportation outlook; status of world coal ports.

  11. FY 1980 Report on results of Sunshine Project. Development of coal liquefaction techniques (Development of 1 T/D test plant, and researches on the solvent-extraction type liquefaction process); 1980 nendo sekitan ekika gijutsu no kaihatsu, yozai chushutsu ekika plant no kaihatsu seika hokokusho. 1t/nichi jikken plant no kaihatsu, yozai chushutsu ekika process no kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1981-03-01

    This program is aimed at establishing the techniques for solvent-extraction type coal liquefaction plant by constructing and operating a 1 T/D test plant to obtain the technical data for the efficient plant. The test plant is operated to confirm the effects of temperature and coal slurry concentration on liquefaction conversion by the solvent-extraction for a short time in the furnace for the extraction unit. The extraction type coal liquefaction tests can be conducted for a reaction time of around 1 hour by the test plant. The recycled solvent purification unit is installed, to regenerate the hydrogen donor solvent. For researches on the solvent-extraction type coal liquefaction process, the continuous extraction is conducted, to investigate the effects of extraction reaction rate at relatively low pressure. The optimum hydrogenation conditions are studied for the test plant. It is confirmed that a Mo-based catalyst is suitable for the hydrogenation. The batch type reaction system is operated to investigate the liquid yield of Wandoan coal, and recycled solvent balances and compositions. (NEDO)

  12. Raw and renewable polymers

    CSIR Research Space (South Africa)

    Joseph, S

    2010-01-01

    Full Text Available in the permeability of the membrane and HO H3C H3C H2C H2C HO OH NH NH OH O OC C n O O O O Fig. 4 Structure of Chitin Raw and Renewable Polymers promoting internal osmotic imbalances. This results in leaching of electrolytes and proteins. 2... is often lost. In most cases this denaturation is not reversible. R-CH-COOH NH2 w Amino acid H2N COOHR a Amino acid Fig. 5 Structure of amino acid Raw and Renewable Polymers The solubilities of proteins vary considerably based on compositions...

  13. Reduced emissions from inexpensive high-sulphur coal briquettes

    International Nuclear Information System (INIS)

    Gammage, R.B.; Wachter, E.A.; Wade, J.; Wilson, D.L.; Haas, J.W.; Ahmad, N.; Siltain, F.; Raza, M.Z.

    1992-01-01

    Airborne emissions were measured during the combustion of Pakistani high-sulphur coal, cold briquetted with lime and clay; comparison was made to emissions from raw coal and traditional fuels burnt in a native, mud-lined Angethi stove. Compared to raw coal, the amended coal gave fourfold reduced emission of respirable-size particles (RSP) and threefold reduced total releases of SO 2 . In domestic cooking, substitution of the amended coal briquettes for traditional fuels will not worsen indoor air quality with respect to CO, SO 2 , NO x , and RSP. The high peak amounts of CO (100--250 ppm), SO 2 (2--5 ppm), and NO x (1--5 ppm) were limited to the early phase of burning. The high thermal value of the coal briquettes together with a simple briquetting technology, make this fuel an attractive energy alternative in countries that are underdeveloped, developing, or experiencing major restructuring

  14. International Coal Report's coal year 1991

    Energy Technology Data Exchange (ETDEWEB)

    McCloskey, G [ed.

    1991-05-31

    Following introductory articles on factors affecting trade in coal and developments in the freight market, tables are given for coal exports and coal imports for major countries worldwide for 1989 and 1990. Figures are also included for coal consumption in Canada and the Eastern bloc,, power station consumption in Japan, coal supply and demand in the UK, electric utility coal consumption and stocks in the USA, coal production in Australia, Canada and USA by state, and world hard coal production. A final section gives electricity production and hard coal deliveries in the EEC, sales of imported and local coal and world production of pig iron and steel.

  15. Initiative hard coal; Initiative Steinkohle

    Energy Technology Data Exchange (ETDEWEB)

    Leonhardt, J.

    2007-08-02

    In order to decrease the import dependence of hard coal in the European Union, the author has submitted suggestions to the director of conventional sources of energy (directorate general for energy and transport) of the European community, which found a positive resonance. These suggestions are summarized in an elaboration 'Initiative Hard Coal'. After clarifying the starting situation and defining the target the presupposition for a better use of hard coal deposits as raw material in the European Union are pointed out. On that basis concrete suggestions for measures are made. Apart from the conditions of the deposits it concerns thereby also new mining techniques and mining-economical developments, connected with tasks for the mining-machine industry. (orig.)

  16. Dangerous Raw Oysters

    Centers for Disease Control (CDC) Podcasts

    2013-08-05

    Dr. Duc Vugia, chief of the Infectious Diseases Branch at the California Department of Public Health, discusses the dangers of eating raw oysters.  Created: 8/5/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 8/7/2013.

  17. Role of complex utilization of mineral raw materials In geological research

    Energy Technology Data Exchange (ETDEWEB)

    Takacs, P.; Varju, G.

    1979-01-01

    Presents Hungarian research efforts on ways of utilizing the secondary raw materials alunite, pumice and slate coal from various mines. The slate coal is separated from brown coal and disposed of at spoil banks of brown coal mines, due to its high ash content (up to 56.8% under dry conditions), silicate content up to 58.2% and low calorific value between 1500 and 2780 kcal/kg. The research proposal for utilizing slate coal is directed at partial separation of the mineral and coal content by comminution, peptization and hydrocentrifugal separation. The larger part of the silicate content is held in the colloid suspension, which could be used for conditioning drilling mud or foundry sand. The produced coal concentrate has a reduced ash content and higher calorific value (between 500 and 800 kcal/kg) and could be employed in soil amelioration or combustion. (10 refs.) (In German)

  18. Report on diagnosis and survey on research cooperation in the research cooperation promotion project in fiscal 1994. Research cooperation on manufacturing clean fuel for consumer use from gasified coal gas / Research cooperation on a method for pulp manufacturing of low-pollution and energy saving type by using non-wood raw materials; 1994 nendo kenkyu kyoryoku suishin jigyo 'kenkyu kyoryoku shindan chosa' hokokusho. Sekitan gas ka gas kara no minseiyo clean nenryo seizo ni kansuru kenkyu kyoryoku / himokuzaikei genryo wo mochiita teikogai shoenegata pulp seizoho ni kansuru kenkyu kyoryoku

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-03-01

    In solving the problems in developing technologies peculiar to developing countries, Japan will provide cooperation. This paper describes the achievements in diagnosis and survey in fiscal 1994. Development will be made on a manufacturing process for dimethylether (DME), a synthesizable and portable clean fuel, by using coal produced in China. Annual DME production of 10,000 tons will make it possible to supply 50,000 households with the fuel of one year consumption, whereas return on the construction investment and profit can be expected. At the Shanxi Coal Chemistry Research Institute, a 500 tons a year plant making DME from gasified coal gas is scheduled to begin operation. Development will be made on a pulp manufacturing technology in China, in which environmental pollution due to waste water is largely reduced, and operation cost is reduced. Application of the oxygen-alkaline evaporation and decomposition process developed in Japan will be considered, which uses non-wood raw material such as rice straw, wheat straw and megass). The raw materials are immersed continually in low-concentration alkaline solution, dehydrated, and then lignin is oxidized and decomposed by using oxygen in a continuous oxidation reactor to make the material into pulp. China uses non-wood materials as paper raw materials at 80%, whereas effects are expected in waste water pollution prevention, energy saving, resource saving and economics. (NEDO)

  19. Possibility of chemical products from coal

    Energy Technology Data Exchange (ETDEWEB)

    Harris, G A; Sinnett, C E; Swift, H E

    1982-01-01

    An account of the SRC-II plant, which produces solvent refined coal (SRC), a liquid product. SRC is a raw material with potential as a new source of hydrocarbons. Topics discussed include the possibilities of its use as a petrochemical feedstock; derivatives and the amounts obtained; economic assessments and expected prices. The translator of this article puts forward the view that, due to the difficulty of obtaining the type of coal needed for SRC-II, the best policy for Japanese coal liquefaction is methanol synthesis.

  20. The long term means coal market improvements

    Energy Technology Data Exchange (ETDEWEB)

    Soras, C.G.; Stodden, J.R.

    1988-01-01

    Statistical data for the US coal industry in 1987 are presented - coal production, energy consumption, inventories, exports, operating rate, employment, hours worked, wages, electric power output, raw steel production, new orders for blast furnaces and steel mills, and fuel oil prices - and contrasted with the situation a year before. The US economy and trade figures are discussed. It is believed that the coal industry stands to benefit from the changing mix of economic activity but must strive to keep competitive. 1 tab., 1 fig.

  1. Coal Moisture Estimation in Power Plant Mills

    DEFF Research Database (Denmark)

    Andersen, Palle; Bendtsen, Jan Dimon; Pedersen, Tom S.

    2009-01-01

    Knowledge of moisture content in raw coal feed to a power plant coal mill is of importance for efficient operation of the mill. The moisture is commonly measured approximately once a day using offline chemical analysis methods; however, it would be advantageous for the dynamic operation...... of the plant if an on-line estimate were available. In this paper we such propose an on-line estimator (an extended Kalman filter) that uses only existing measurements. The scheme is tested on actual coal mill data collected during a one-month operating period, and it is found that the daily measured moisture...

  2. Power generation from chemically cleaned coals: do environmental benefits of firing cleaner coal outweigh environmental burden of cleaning?

    DEFF Research Database (Denmark)

    Ryberg, Morten W.; Owsianiak, Mikolaj; Laurent, Alexis

    2015-01-01

    Power generation from high-ash coals is a niche technology for power generation, but coal cleaning is deemed necessary to avoid problems associated with low combustion efficiencies and to minimize environmental burdens associated with emissions of pollutants originating from ash. Here, chemical...... beneficiation of coals using acid and alkali–acid leaching procedures is evaluated as a potential coal cleaning technology employing life cycle assessment (LCA). Taking into account the environmental benefits from firing cleaner coal in pulverized coal power plants and the environmental burden of the cleaning...... itself, it is demonstrated that for a wide range of cleaning procedures and types of coal, chemical cleaning generally performs worse than combustion of the raw coals and physical cleaning using dense medium separation. These findings apply for many relevant impact categories, including climate change...

  3. Report on the achievements in the Sunshine Project in fiscal 1986. Surveys on coal type selection (coal type survey); 1986 nendo tanshu sentei chosa seika hokokusho. Tanshu chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1987-03-01

    The purpose of the present study is to elucidate coal quality features of different types of coals and identify the relationship between the coal quality features and the liquefaction characteristics by performing liquefaction characteristic evaluation tests. Based on the result therefrom, a method is established for coal field assessment that can estimate yield of liquefaction in coal fields and coal mines to serve for selection of coal types suitable for liquefaction. Coal quality feature surveys and liquefaction characteristics evaluation tests under the standard conditions have been completed on 48 coal types including Canadian, Australian and American coals. Elucidating the coal quality features of different coals can specify parameters for the coal quality features related to the liquefaction characteristics. Coal ranks elucidate the vitrinite reflectance, structure constituent factors the vitrinite content, composite factors the volatile matter content, quantity of heat generation, and number of H/C and O/C atoms. Investigating the relationship between the coal quality features and the liquefaction characteristics can provide fundamental data for primary screening of raw material coals for liquefaction. The result of the liquefaction characteristics evaluation test under the standard conditions can be the detailed comparative data relative to data derived from the simplified liquefaction characteristics test that is performed to estimate liquefaction yield of specific coal field and coal mine. (NEDO)

  4. Profit from plant experience in specifying coal conveyors

    Energy Technology Data Exchange (ETDEWEB)

    Rajter, L C

    1985-09-01

    Most coal conveyors in operation today were designed to handle raw unwashed coal and are experiencing difficulties when dealing with fine, wet coal which has been cleaned. Conveyor designers should base their designs for new systems on the worst possible materials. Design criteria are discussed in detail and recommendations made for chute liners and radii, skirt system, belt speed, transfer points, belt wipers, weather protection and access. 3 references.

  5. Efficiency of Low-Profile External Dumping at Open Pit Coal Mining in Kemerovo Region

    Science.gov (United States)

    Selyukov, Alexey; Ermolaev, Vyacheslav; Kostinez, Irina

    2017-11-01

    Kemerovo region is one of the largest industrial regions of Russia, with a raw material specialization. The rapid growth of the coal industry in recent years has been greatly facilitated by the expansion and development of open pit mining for coal seams extraction, accompanied by an increase in the volumes of overburden and the height of the dumps. There are about 400 objects in the Russian Federation Government Register of Waste Disposal Facilities 80% of which are dumps. Approaches both to external dumping and to the technical stage of reclamation currently contribute to the growth of geomorphic system's instability. Thus, it is proposed to slightly change the approaches to external dumping: the essence consists in the formation of an external dump of overburden, which in future would represent a favorable landscape unit of a flat surface relief used for subsequent differently directed purposes.

  6. Efficiency of Low-Profile External Dumping at Open Pit Coal Mining in Kemerovo Region

    Directory of Open Access Journals (Sweden)

    Selyukov Alexey

    2017-01-01

    Full Text Available Kemerovo region is one of the largest industrial regions of Russia, with a raw material specialization. The rapid growth of the coal industry in recent years has been greatly facilitated by the expansion and development of open pit mining for coal seams extraction, accompanied by an increase in the volumes of overburden and the height of the dumps. There are about 400 objects in the Russian Federation Government Register of Waste Disposal Facilities 80% of which are dumps. Approaches both to external dumping and to the technical stage of reclamation currently contribute to the growth of geomorphic system's instability. Thus, it is proposed to slightly change the approaches to external dumping: the essence consists in the formation of an external dump of overburden, which in future would represent a favorable landscape unit of a flat surface relief used for subsequent differently directed purposes.

  7. Queensland coal sets new records in 2001

    International Nuclear Information System (INIS)

    Smith, R.; Coffey, D.; Abbott, E.

    2002-01-01

    In 2001 the Queensland coal industry consolidated on record expansion in the export market over the past two years and again, increased its sales to overseas customers. New sales records were set in both the export and domestic markets. Unprecedented international demand for Queensland metallurgical coals coupled with improved prices and a favourable A$-US$ exchange rate created strong market conditions for the Queensland coal export industry, boosting confidence for further expansion and new developments. Australian coal exports in 2001 amounted to 194 Mt and are forecast to reach 275 million tonnes per annum (Mtpa) in 2020. The Queensland coal industry is poised to capture a significant share of this market growth. Queensland's large inventory of identified coal, currently estimated at more than 37 billion tonnes (raw coal m situ), is adequate to sustain the industry for many years and allow new opencut and underground mines to develop according to future market demand. Recent coal exploration successes are expected to add significant tonnage to the inventory (Coxhead, Smith and Coffey, 2002). Most of the coal exported from Queensland is mined in the Bowen Basin of central Queensland and additional tonnage of Walloon coal is exported by mines in the Moreton Basin and Surat Basin in south-east Queensland. The Walloon Coal Measures and its equivalents contain large resources of undeveloped opencut, high volatile, clean-burning thermal coal. The environmental advantages in the utilisation of these coals are now recognised and strong growth in production is expected in the near future for supply to both the domestic and export markets. Establishment of new rail transport and civil infrastructure will however, be required to support the development of large scale mining operations in this region

  8. Method for selecting raw materials to preparing ceramic masses: application to raw material for red ceramic

    International Nuclear Information System (INIS)

    Moreno, Maria Margarita Torres; Rocha, Rogers Raphael da; Zanard, Antenor

    2012-01-01

    We studied the raw materials used in a factory building blocks, located in Cesario Lange city (SP). It extracts raw materials from various sources in the region to make the dough. The mixtures were prepared from dry milled powders based on data related to the plasticity of the raw materials. It was obtained with the apparatus Vicat-cone in order to obtain similar levels of water absorption of the samples burned at 900 deg C for all compositions. To quantify the proportion of each clay was used the Lever Rule. In this firing temperature, where sintering is mainly by diffusion from a solid state, different compositions of the same set of four raw materials resulted in similar values. (author)

  9. Steam versus coking coal and the acid rain program

    International Nuclear Information System (INIS)

    Lange, Ian

    2010-01-01

    The Clean Air Act of 1990 initiated a tradable permit program for emissions of sulfur dioxide from coal-fired power plants. One effect of this policy was a large increase in the consumption of low-sulfur bituminous coal by coal-fired power plants. However, low-sulfur bituminous coal is also the ideal coking coal for steel production. The analysis presented here will attempt to determine how the market responded to the increased consumption of low-sulfur bituminous coal by the electricity generation sector. Was there a decrease in the quality and/or quantity of coking coal consumption or did extraction increase? Most evidence suggests that the market for coking coal was unaffected, even as the extraction and consumption of low-sulfur bituminous coal for electricity generation increased substantially.

  10. Report on 1980 result of R and D under Sunshine Project. Development of solvent extraction liquefaction technology and demonstrative investigation on development of brown coal liquefaction technology (studies on high-temperature in-oil pulverization); 1980 nendo yozai chushutsu ekika gijutsu no kaihatsu / kattan ekika gijutsu kaihatsu jissho chosa seika hokokusho. Koon'yuchu funsai no kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1981-03-01

    This paper explains the results of development of coal liquefaction technology under the Sunshine Project in fiscal 1980. As a part of the development of brown coal liquefaction technology, pulverization of the first-dehydration brown coal was technologically established, as were adjustment of slurry and equipment for the second-dehydration process. A 20kg/h high temperature in-oil pulverizer was designed, constructed and made ready for the studies. A high temperature mill was a wet type ball mill, 500mm{phi}(diameter) x 1,500 mm length and 2.2kw. Coal was fully pulverized even in a solvent such as creosote oil and anthracene oil freed from crystal, and was adjustable to a prescribed particle size distribution. The wet type slurry adjustment method offered prospects that solvent/coal slurry moisture could be controlled to a prescribed value. An analysis was made on the mill outlet gas and drain collection liquid at the time of high temperature in-oil pulverization, which provided knowledge of securing safety. An analysis was also made on the influence of the heating temperature rise of the mill on the strength, which provided basic data for examining the strength of the mill. Using brown coal as the raw material, slurry was prepared, which confirmed that the device had functions as planned. (NEDO)

  11. Coal competitiveness?

    International Nuclear Information System (INIS)

    Rogeaux, B.

    2006-01-01

    Will coal electrical plants be more competitive in the coming years? Answering this one cannot be limited to merely comparing estimates based on reference electricity production costs. The competitiveness of coal will indeed depend on the final product marketed, as the MWhs are not equal: is the purpose to produce base, half-base MWh? Does the electrical equipment structure require flexible MWh (for instance in the event of significant intermittent renewable energy amounts), and therefore plants able to adjust their power rapidly? But the competitiveness of coal will also depend on many factors that will correct reference cost estimates: uncertainties, risks, externalities. These factors will need to be appreciated on a case by case basis. We introduce some of the reasoning used to better appreciate the future competitiveness of coal, and the main factors conditioning it in three contrasting regions of the world: Europe, USA, china. (author)

  12. Coal technology in a sustainable society

    International Nuclear Information System (INIS)

    Anon

    2000-01-01

    Coal is a major world energy resource. For many countries it is the primary fuel in electricity generation. As world energy demand increases so also will the demand for coal. Steel and aluminium-essential elements in the fabric of modern society -also rely heavily on coal. This article points out that the Australian coal industry is responding to the challenges facing coal by investigating a sustainable development strategy and examining the full life cycle outcomes of coal as fuel and reductant. The challenge is to deliver much more efficient ways of extracting energy from coal. The most effective strategies are seen to be: ash displacement credits, synergies with renewables and integration with other industries

  13. Coal - 97

    International Nuclear Information System (INIS)

    Sparre, C.

    1997-01-01

    The report deals with the use of coal and coke during 1996. Some information about techniques, environmental questions and markets are also given. Data have been collected by questionnaires to major users and by telephone to minor users. Preliminary statistical data from SCB have also been used. The use of steam coal for heating purposes during 1996 was 1,2 mill tons and 50% higher than in 1995. The increase is probably temporary and due to high prices of electricity because of lack of water power. The co-generation plants were the main users of coal. The minor plants have increased their use of forest fuels. Probably the use of steam coal will go down in the immediate years both in the heat generating and the co-generation plants. During the top year 1987 coal was used in 18 hotwater plants and 11 co-generation plants. 1996 these figures are 3 and 12. Taxes and environmental reasons explain this trend. The use of steam coal in the industry has been constant at the level 700 000 tons. This level is supposed to be constant or to vary with business cycles. The import of metallurgical coal in 1996 was 1,6 mill tons like the year before. 1,2 mill tons coke were produced. The coke consumption in the industry was 1,5 mill tons. 0,3 mill tons of coke were imported. The average price of steam coal imported in Sweden in 1996 was 340 SEK/ton or 2% higher than in 1995. For the world, the average import price was 51,5 USD/ton, nearly the same as the year before. The contract prices for delivery during 1997 are about equal as the end of 1996. All Swedish plants meet their emission limits of dust, SO 2 and NO x given by county administrations or concession boards

  14. Investigation on pyrolysis of some organic raw materials

    Directory of Open Access Journals (Sweden)

    Purevsuren B

    2017-02-01

    Full Text Available We have been working on pyrolysis of some organic raw materials including different rank coals, oil shale, wood waste, animal bone, cedar shell, polypropylene waste, milk casein and characterization of obtained hard residue, tar and pyrolytic water and gas after pyrolysis. The technical characteristics of these organic raw materials have been determined and the thermal stability characteristics such as thermal stability indices (T5% and T25% determined by using thermogravimetric analysis. The pyrolysis experiments were performed at different heating temperatures and the yields of hard residue, tar, pyrolysis water and gaseous products were determined and discussed. The main technical characteristics of hard residue of organic raw materials after pyrolysis have been determined and the adsorption ability of pyrolysis hard residue and its activated carbon of organic raw materials also determined. The pyrolysis tars of organic raw materials were distilled in air condition and determined the yields of obtained light, middle and heavy fractions and bitumen like residue with different boiling temperature. This is the first time to investigate the curing ability of pyrolysis tars of organic raw materials for epoxy resin and the results of these experiments showed that only tar of milk casein has the highest (95.0%, tar of animal bone has certain (18.70% and tars of all other organic raw materials have no curing ability for epoxy resin.

  15. Coal -98

    International Nuclear Information System (INIS)

    Sparre, C.

    1998-01-01

    The following report deals with the use of coal and coke during 1997. Some information about technic, environmental questions and markets are also given. Data have been collected by questionnaires to major users and by telephone to minor users. Preliminary statistical data from SCB have also been used. The use of steam coal for heating purposes during 1997 was 730 000 tons and about 500 000 tons lower than in 1996. The extremely high figures of 1996 were due to twice the production of electricity because of lack of hydro power. The co-generation plants were the main users of coal. The minor plants have increased their use of forest fuels. Probably the use of steam coal will go down in the immediate years both in the heat generating and the co-generating plants. Some foreign analysts, however, estimate a doubled use of coal for energy use after 2020 because of the plans to phase out the nuclear power. During the top year 1987 coal was used in 18 hot water plants and 11 co-generation plants. 1997 these figures are 2 and 8. Taxes and environmental reasons explain this trend. The use of steam coal in the industry has been constant at the level 700 000 tons. This level is supposed to be constant or to vary with business cycles. The import of metallurgical coal in 1997 was 1.6 mill tons like the year before. 1.2 mill tons coke were produced. The coke consumption in the industry was 1.5 Mill tons. 0.3 mill tons of coke were imported. Several other plants have plans to replace the coal with forest fuels, waste fuels and NG. Even the biggest plant, Vaesteraas, has plans to build a block for bio fuels. Helsingborg has started to use wood pellets. The pellets replace most of the coal for the heat production in the co-generation plant. Norrkoeping Kraft AB has taken a fluid bed boiler for different fuels in operation, leading to more than half the coal consumption compared with previous years. They have also rebuilt one of their travelling grates for bio fuels. Stockholm

  16. Coal 95

    International Nuclear Information System (INIS)

    Sparre, C.

    1995-01-01

    The report deals with the use of coal and coke in Sweden during 1994. Some information about technology, environmental questions and markets are also given. Data have been collected by questionnaires to major users and by telephone to minor users. Preliminary statistical data from Statistics Sweden have also been used.The use of steam coal for heating purposes has been unchanged during 1994 at a level of 1 Mtons. The production in the cogeneration plants has been constant, but has increased for electricity production. The minor plants have increased their use of forest fuels. The use of steam coal will probably go down in the next years both for heat and cogeneration plants. During the top year 1987 coal was used in 18 hot water and 11 cogeneration plants. 1994 these figures are 3 and 12. Taxes and environmental reasons explain this trend. The use of steam coal in industry has been constant at the level 0.7 Mtons. The import of metallurgical coal in 1993 was 1.6 Mtons, like 1992. Import of 0.3 Mtons of coke gives the total consumption of coke in industry as 1.5 Mtons. the average price of steam coal imported to Sweden was 317 SEK/ton, 3% higher than 1993. All Swedish plants meet their emission limit of dust, SO 2 and NO x as given by county administrations or concession boards. The cogeneration plants all have some SO 2 removal system. The biggest cogeneration plant (Vaesteraas) has recently invested in a SCR NO x cleaning system. Most other plants use low NO x burners or SNR injection systems based on ammonia or urea. 2 figs, 13 tabs

  17. Coal on the shovel. Choice for coal is choosing for expensive, scarce and unreliable

    International Nuclear Information System (INIS)

    2008-01-01

    Researchers of Peak oil warn about imminent worldwide coal shortages as of 2025. Countries that fully depend on coal import, such as the Netherlands, run great risks due to strongly rising prices and insecurity of supply. How large is the supply of extractable coal? How long will extraction and export continue undisturbed under increasing demand? What effect will this have on the coal price? The real data on supply, demand, price and export mainly tell a tale of unreliable reserves and high prices according to Greenpeace. [mk] [nl

  18. Panorama 2010: World coal resources

    International Nuclear Information System (INIS)

    Bessereau, G.; Saniere, A.

    2010-01-01

    At a time when the international community must face the key challenges posed by global warming as well as sustainability in general and many of our fellow citizens have come to look unfavorably upon fossil energies, the world is still heavily dependent on these energies to cover growing global energy demand. With proved reserves equivalent to more than 120 years at the present rate of extraction, with a better worldwide geographical distribution than petroleum, coal seems like an especially secure energy. While the renewable energies are showing rapid growth but still only represent a small proportion of the world energy mix, coal was the energy whose consumption grew at the fastest rate and for the sixth consecutive year. This gives cause for concern when one realizes that coal is also the most environmentally harmful energy at local level (its extraction generates pollution) and globally (its combustion emits CO 2 ). So how is it possible to reconcile the apparently irreconcilable, especially when, in some countries, coal represents the bulk of the energy resources? Since it is impossible to do without coal, the solution is to develop new 'clean coal' technologies, among which the capture and storage of CO 2 looks like a promising pathway. In the process, it will be necessary to overcome major technical, economic and social challenges. (author)

  19. Alkaloid-derived molecules in low rank Argonne premium coals.

    Energy Technology Data Exchange (ETDEWEB)

    Winans, R. E.; Tomczyk, N. A.; Hunt, J. E.

    2000-11-30

    Molecules that are probably derived from alkaloids have been found in the extracts of the subbituminous and lignite Argonne Premium Coals. High resolution mass spectrometry (HRMS) and liquid chromatography mass spectrometry (LCMS) have been used to characterize pyridine and supercritical extracts. The supercritical extraction used an approach that has been successful for extracting alkaloids from natural products. The first indication that there might be these natural products in coals was the large number of molecules found containing multiple nitrogen and oxygen heteroatoms. These molecules are much less abundant in bituminous coals and absent in the higher rank coals.

  20. Microbial diversity of western Canadian subsurface coal beds and methanogenic coal enrichment cultures

    Energy Technology Data Exchange (ETDEWEB)

    Penner, Tara J.; Foght, Julia M. [Department of Biological Sciences, University of Alberta, Edmonton, Alberta (Canada); Budwill, Karen [Carbon and Energy Management, Alberta Innovates-Technology Futures, 250 Karl Clark Road, Edmonton, Alberta (Canada)

    2010-05-01

    Coalbed methane is an unconventional fuel source associated with certain coal seams. Biogenic methane can comprise a significant portion of the gas found in coal seams, yet the role of microbes in methanogenesis in situ is uncertain. The purpose of this study was to detect and identify major bacterial and archaeal species associated with coal sampled from sub-bituminous methane-producing coal beds in western Canada, and to examine the potential for methane biogenesis from coal. Enrichment cultures of coal samples were established to determine how nutrient amendment influenced the microbial community and methane production in the laboratory. 16S rRNA gene clone libraries were constructed using DNA extracted and amplified from uncultured coal samples and from methanogenic coal enrichment cultures. Libraries were screened using restriction fragment length polymorphism, and representative clones were sequenced. Most (> 50%) of the bacterial sequences amplified from uncultured coal samples were affiliated with Proteobacteria that exhibit nitrate reduction, nitrogen fixation and/or hydrogen utilization activities, including Pseudomonas, Thauera and Acidovorax spp., whereas enrichment cultures were dominated by Bacteroidetes, Clostridia and/or Lactobacillales. Archaeal 16S rRNA genes could not be amplified from uncultured coal, suggesting that methanogens are present in coal below the detection levels of our methods. However, enrichment cultures established with coal inocula produced significant volumes of methane and the archaeal clone libraries were dominated by sequences closely affiliated with Methanosarcina spp. Enrichment cultures incubated with coal plus organic nutrients produced more methane than either nutrient or coal supplements alone, implying that competent methanogenic consortia exist in coal beds but that nutrient limitations restrict their activity in situ. This report adds to the scant literature on coal bed microbiology and suggests how microbes may be

  1. Cleaning of Egyptian coal by using column flotation to minimize the environmental pollution

    Energy Technology Data Exchange (ETDEWEB)

    Khalek, M.A.A. [CMRDI, Cairo (Egypt)

    2002-07-01

    This work aims to decrease the sulfur content of the Egyptian coal by using column flotation technology to be suitable for various applications. In this study, the column flotation parameters as air flow-rate, wash water, frother dosage and feed rate with its solid percent were studied. A clean coal was obtained containing 1.01 % total sulfur with a yield of 82 %, from Maghara coal (Sinai-Egypt) which contains 3.3 % total sulfur as raw coal.

  2. Coal preparation

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    The acid rain control legislation has prompted the Department of Energy (DOE) to seek new technology using the Clean Coal Technology program solicitation. The main goal of the program is to reduce SO 2 emissions below 9 Mt/a (10 million stpy) and NO x emission below 5.4 Mt/a (6 million stpy) by the year 2000. This would be accomplished by using precombustion, combustion, post combustion and conversion technology. Utilities are considering installing new scrubbers, switching fuel or possibly deep clean. However, the time required to implement the control technology is short. Due to the legislation, about 110 plants will have to adopt one of the approaches. This paper reports that in characterization of coal, Ames Laboratory used a scanning electron microscope- based, automated image analysis (SEM-AIA) technique to identify coal and mineral matter association. Various forms of organic sulfur were identified using peroxyacetic acid oxidation of coal. This was followed by subsequent microscopic, GC-MS, and HRMS analysis by Southern Illinois University. In ultrafine grinding of coal, it was reported by the Mining and Mineral Institute of Alabama that silica sand or flint shot used less energy compared to steel ball mills

  3. Cooperation of the member states of the SEV in the field of energy, fuel and raw material resources, and the problems of developing of new sources of energy

    Energy Technology Data Exchange (ETDEWEB)

    Kapol' i, L

    1980-01-01

    On the basis of the agreement concerning the creation of a combined organization for conducting geological prospecting operations for petroleum and gas in the Baltic Sea in the area of the continental shelf and the floor of the territorial waters of the signatory states of East Germany, Poland, and the USSR, which was signed in 1975, the Petrolbaltik organization ws created. A long time program of cooperation in the areas of energy, fuel, and raw materials foresees that the SEV member states will carry out prospective scientific developments on the use of new sources of energy, including solar, wind, chemical and geothermal forms of energy. Forty-seven scientific and technical organization of the SEV member states are working under the leadership of the Coordination center concerning the problem, ''New methods on the use of coal,'' on the industrial use of the by-products of hte extraction and enrichment of coal, the methods of their coking, and their liquefaction and gasification. The technique of producing alumina and cement from the ash of energy systems, working on coal, as well as from coal heaps is being successfully applied in Hungary.

  4. Pragmatics of Raw Art

    DEFF Research Database (Denmark)

    Wilson, Alexander

    2014-01-01

    , and a contemporary zeitgeist marked by a general relativisation of aesthetic values has emerged, exploding into a plethora of parallel discourses on art. Perhaps there is no longer such a thing (if there ever was) as Culture with a capital C, which Dubuffet so vehemently opposed in his championing of art brut......’s adolescence without hypostatizing distinctions between inside and outside, or between culture and its raw or primitive origins, while nevertheless not conflating the dissolution of boundaries and hierarchies with a possible end to territoriality and control, nor promoting a resignation of thought...

  5. Book review: Economic geology: Principles and practice: Metals, minerals, coal and hydrocarbons—Introduction to formation and sustainable exploitation of mineral deposits

    Science.gov (United States)

    Anderson, Eric

    2013-01-01

    This volume, available in both hardcover and paperback, is an English translation of the fifth edition of the German language text Mineralische und Energie-Rohstoffe. The book provides an extensive overview of natural resources and societal issues associated with extracting raw materials. The comprehensive list of raw materials discussed includes metals, industrial minerals, coal, and hydrocarbons. The book is divided into four parts: (1) “Metalliferous ore deposits,” (2) “Nonmetallic minerals and rocks,” (3) “Practice of economic geology,” and (4) “Fossil energy raw materials—coal, oil, and gas.” These sections are bound by a brief introduction and an extensive list of up-to-date references as well as an index. Each chapter begins with a concise synopsis and concludes with a summary that contains useful suggestions for additional reading. All figures are grayscale images and line drawings; however, several have been grouped together and reproduced as color plates. Also included is a companion website (www.wiley.com/go/pohl/geology) that contains additional resources, such as digital copies of figures, tables, and an expanded index, all available for download in easy-to-use formats.Economic Geology: Principles and Practice: Metals, Minerals, Coal and Hydrocarbons—Introduction to Formation and Sustainable Exploitation of Mineral Deposits. Walter l. Pohl. 2011. Wiley-Blackwell. Pp. 663. ISBN 978-1-4443-3663-4 (paperback).

  6. Distilling coal

    Energy Technology Data Exchange (ETDEWEB)

    Blythe, F C

    1914-09-14

    In the destructive distillation of bituminous coal, heavy hydrocarbon oil, such as petroleum, kerosine, shale oil, and heavy tar oil, obtained in some cases during the process, is added to the coal, which is then distilled under pressure and at a comparatively low temperature regulated so as to produce a large proportion of hydrocarbon oils and a small proportion of permanent gas. In one method, about 5 to 10 parts of hydrocarbon oil are mixed with 100 parts of crushed or ground coal, and the mixture is heated in a closed vessel, provided in some cases with an agitator, under a pressure of about 60 lb/in/sup 2/, and the temperature may be gradually raised to 350/sup 0/C and then to about 500/sup 0/C. The heating may be by means of superheated steam with or without external heat.

  7. Coal cleaning: A viable strategy for reduced carbon emissions and improved environment in China?

    OpenAIRE

    Glomsrød, Solveig; Taoyuan, Wei

    2003-01-01

    Abstract: China is a dominant energy consumer in a global context and current energy forecasts emphasise that China’s future energy consumption also will rely heavily on coal. The coal use is the major source of the greenhouse gas CO2 and particles causing serious health damage. This paper looks into the question if coal washing might work as low cost strategy for both CO2 and particle emission reductions. Coal washing removes dirt and rock from raw coal, resulting in a coal pr...

  8. Combustion characteristics of intensively cleaned coal fractions. Effect of mineral matter

    Energy Technology Data Exchange (ETDEWEB)

    Rubiera, F.; Arenillas, A.; Fuente, E.; Pis, J.J. [Inst. Nacional de Carbon, Oviedo (Spain); Ivatt, S. [ETSU, Harwell, Didcot (United Kingdom)

    1997-12-31

    The purpose of this work has been to assess the effect that intensive coal cleaning exerts on the combustion behaviour of different density-separated coal fractions. Samples with ash contents varying from 39% for the raw coal, to 2% for the cleanest fraction were obtained after density separation. Temperature-programmed combustion and isothermal gasification in air were used to measure the reactivities of the parent coal and the cleaned fractions. Coal and char reactivities increased with increasing ash content of the samples. Thermal analysis-mass spectrometry of the low-temperature ashes was also carried out in order to study the reactions of coal minerals under combustion conditions. (orig.)

  9. E-commerce finally finds the coal industry

    Energy Technology Data Exchange (ETDEWEB)

    Hudson, M.

    2000-12-01

    In the last few months, new web sites have come online which are not only showcase for coal mining products and equipment but also act as sales platforms. A large set of sites deal with the purchase of coal and other raw materials. Most of them offer 24-hour news updates, a coal library and a reference section to help with financing, insurance and transportation of purchased coal. Another group focuses on the sale of equipment. Short writeups are given of 18 web sites. 1 photo.

  10. Survey to determine why people drink raw milk.

    Science.gov (United States)

    Mullin, Gerard E; Belkoff, Stephen M

    2014-11-01

    Fragility fractures associated with osteoporosis extract a large financial and personal toll on society. Pharmaceutical or dietary calcium intake is needed to increase bone mineral density to prevent fragility fractures. Although dairy products are a good source of calcium, patients who are unable to digest lactose tend to avoid them and are put at a greater risk for fracture than the general population. Anecdotal reports suggest that lactose maldigesters, when consuming raw milk, have a dramatic reduction in symptoms relative to pasteurized milk. The mechanism of the reported reduction in symptoms, if true, is unknown. The purpose of the current study was to survey raw milk drinkers to ascertain their health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. An online survey regarding raw milk was completed by 153 of 1527 members of a raw milk-buying community. The primary reason the respondents cited for drinking raw milk was that they believed it was more healthful; 30% reported some gastrointestinal discomfort when drinking pasteurized milk, yet almost all (99%) reported consuming raw milk without discomfort. Despite the reports of gastrointestinal discomfort, only 5% of respondents had been diagnosed as lactose intolerant by a medical professional, and only 1% had been diagnosed as lactose intolerant via the gold-standard hydrogen breath test. The primary motivation for drinking raw milk is its perceived health value, not its digestibility. Although raw milk appears to be more easily digested than pasteurized milk in our survey sample, the mechanism of digestibility remains unknown.

  11. Pre-Concentration of Vanadium from Stone Coal by Gravity Using Fine Mineral Spiral

    Directory of Open Access Journals (Sweden)

    Xin Liu

    2016-08-01

    Full Text Available Due to the low grade of V2O5 in stone coal, the existing vanadium extraction technologies face challenges in terms of large handling capacity, high acid consumption and production cost. The pre-concentration of vanadium from stone coal before the extraction process is an effective method to reduce cost. In this study, detailed mineral characterization of stone coal was investigated. It has been confirmed that the vanadium mainly occurs in muscovite and illite. A significant demand for an effective pre-concentration process with simple manipulation for discarding quartz and other gangue minerals is expected. Based on the mineralogical study, a new vanadium pre-concentration process using a fine mineral spiral was investigated. The experimental results showed that the separation process, which was comprised of a rougher and scavenger, could efficiently discard quartz, pyrite and apatite. A final concentrate with V2O5 grade of 1.02% and recovery of 89.6% could be obtained, with 26.9% of the raw ore being discarded as final tailings.

  12. Losses in the coal supply chain

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-12-15

    This report examines the way coal can change as it passes along the coal chain. A great deal of the change is intended, through separation and sizing, to ensure the coal being mined matches the specification demanded by the customer. This report attempts to identify these changes and presents some of the issues faced by the coal supplier and user. Much of the change leads to a loss of mass in the coal. Some of the coal is left in the ground (intentionally and unintentionally), while elsewhere, full extraction might occur with the addition of non-coal materials from the surrounding rocks. In both cases, the mined coal often requires further processing. Coal processing by separation at preparation plants refines coal further and is where most of the mass loss occurs. Value is added by reducing ash content and improving heating value, thus providing a much more saleable product for the market. As soon as the coal leaves the mine, mass loss can occur either through natural deterioration of the fuel, through spillage or dust, or in extreme cases theft. In all cases measuring the amount of coal as it passes through the supply chain is required to verify that the coal reaching the consumer is of satisfactory quality and quantity. This can be done crudely by measuring stockpiles, to more sophisticated weighing systems at various points along the supply chain, and even measuring the volume held in a ship. Measurement is subject to error which must be minimised. Biomass needs to be processed in much the same way as coal, such as removing mineral matter and taking care in avoiding contamination.

  13. Coal Mines Security System

    OpenAIRE

    Ankita Guhe; Shruti Deshmukh; Bhagyashree Borekar; Apoorva Kailaswar; Milind E.Rane

    2012-01-01

    Geological circumstances of mine seem to be extremely complicated and there are many hidden troubles. Coal is wrongly lifted by the musclemen from coal stocks, coal washeries, coal transfer and loading points and also in the transport routes by malfunctioning the weighing of trucks. CIL —Coal India Ltd is under the control of mafia and a large number of irregularities can be contributed to coal mafia. An Intelligent Coal Mine Security System using data acquisition method utilizes sensor, auto...

  14. Coal at the crossroads

    International Nuclear Information System (INIS)

    Scaroni, A.W.; Davis, A.; Schobert, H.; Gordon, R.L.; Ramani, R.V.; Frantz, R.L.

    1992-01-01

    Worldwide coal reserves are very large but coal suffers from an image of being an environmentally unfriendly and inconvenient fuel. Aspects discussed in the article include: coal's poor image; techniques for coal analysis, in particular instrumented techniques; developments in clean coal technology e.g. coal liquefaction, fluidized bed combustion, co-generation and fuel slurries; the environmental impact of mining and land reclamation; and health aspects. It is considered that coal's future depends on overcoming its poor image. 6 photos

  15. Prospects for coal and clean coal technologies in Vietnam

    Energy Technology Data Exchange (ETDEWEB)

    Baruya, P. [IEA Clean Coal Centre, London (United Kingdom)

    2010-02-15

    Vietnam's energy economy is largely served by traditional biofuels and oil products. Within the power generating sector, hydropower and gas-fired power dominate. However, Vietnam still maintains a 40 Mt/y coal industry, parts of which have recently undergone a long overdue programme of renovation and expansion. Vietnam has been a successful exporter of anthracite, with more than half of the country's production being shipped or barged to steel mills in Japan or power stations in southern China, as well as most other Far Eastern coal importers. The industry is due to take a different form. Opencast mining has recently accounted for around 60% of production but this mining method could be phased out as reserves become more difficult and costly to extract. A shift to underground mining is expected, with a greater emphasis on more modern and mechanised production techniques. Coal is located mainly in the coalfields in Quang Ninh in the north easternmost province of Vietnam. The lower rank reserves located within the Red River coalfields, close to the existing anthracite operations, may yield many more millions of tonnes of coal for exploitation. Underground coal gasification could possibly be exploited in the deeper reserves of the Red River Basin. While coal production could rapidly change in future years, the power generation sector is also transforming with the country's 12,000 MWe development programme for new coal-fired power capacity. The economy suffers from a threat of power shortages due to a lack of generating and transmission capacity, while inefficiencies blight both energy production and end-users. Delivering power to the regions of growth remains difficult as the economy and the demand for power outpaces power generation. While hydroelectric power is being pursued, coal is therefore becoming a growing factor in the future prosperity of the Vietnamese economy. 111 refs., 33 figs., 11 tabs.

  16. Geology in coal resource utilization

    International Nuclear Information System (INIS)

    Peters, D.C.

    1991-01-01

    The 37 papers in this book were compiled with an overriding theme in mind: to provide the coal industry with a comprehensive source of information on how geology and geologic concepts can be applied to the many facets of coal resource location, extraction, and utilization. The chapters have been arranged to address the major coal geology subfields of Exploration and Reserve Definition, Reserve Estimation, Coalbed Methane, Underground Coal Gasification, Mining, Coal Quality Concerns, and Environmental Impacts, with papers distributed on the basis of their primary emphasis. To help guide one through the collection, the author has included prefaces at the beginning of each chapter. They are intended as a brief lead-in to the subject of the chapter and an acknowledgement of the papers' connections to the subject and contributions to the chapter. In addition, a brief cross-reference section has been included in each preface to help one find papers of interest in other chapters. The subfields of coal geology are intimately intertwined, and investigations in one area may impact problems in another area. Some subfields tend to blur at their edges, such as with reserve definition and reserve estimation. Papers have been processed separately for inclusion on the data base

  17. Cardiotoxic Effects of Raw Opium.

    Science.gov (United States)

    Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj

    2018-01-01

    While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.

  18. Cardiotoxic Effects of Raw Opium

    OpenAIRE

    Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj

    2018-01-01

    While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.

  19. Reaction of methane with coal

    Energy Technology Data Exchange (ETDEWEB)

    Yang, K.; Batts, B.D.; Wilson, M.A.; Gorbaty, M.L.; Maa, P.S.; Long, M.A.; He, S.J.X.; Attala, M.I. [Macquarie University, Macquarie, NSW (Australia). School of Chemistry

    1997-10-01

    A study of the reactivities of Australian coals and one American coal with methane or methane-hydrogen mixtures, in the range 350-400{degree}C and a range of pressures (6.0-8.3 MPa, cold) is reported. The effects of aluminophosphates (AIPO) or zeolite catalysts, with and without exchanged metals, on reactivity have also been examined. Yields of dichloromethane extractable material are increased by using a methane rather than a nitrogen atmosphere and different catalysts assist dissolution to various extends. It appears that surface exchanged catalysts are effective, but incorporating metals during AIPO lattice formation is detrimental. Aluminium phosphate catalysts are unstable to water produced during coal conversion, but are still able to increase extraction yields. For the American coal, under methane-hydrogen and a copper exchanged zeolite, 51.5% conversion was obtained, with a product selectivity close to that obtained under hydrogen alone, and with only 2% hydrogen consumption. The conversion under methane-hydrogen was also to that obtained under hydrogen alone, while a linear dependence of conversion on proportion of methane would predict a 43% conversion under methane-hydrogen. This illustrates a synergistic effect of the methane-hydrogen atmosphere for coal liquefaction using this catalyst systems. 31 refs., 5 figs., 7 tabs.

  20. Rare and Rare-Earth Metals in Coal Processing Waste

    Science.gov (United States)

    Cherkasova, Tatiana; Cherkasova, Elizaveta; Tikhomirova, Anastasia; Bobrovni-kova, Alyona; Goryunova, Irina

    2017-11-01

    An urgent issue for power plants operating on solid fuels (coal) is the issue of utilization or use of accumulated production waste - ash and slag materials - in the related production. Ash-slag materials are classified as "waste", usually grade 5; tens of millions of tons of them being pro-duced annually in the Kemerovo region, which threatens the ecology of the region. At the same time, ash and slag is a very promising raw material. The use of this material as a base for the final product allows us to signifi-cantly expand the possibilities of using coal. The most widespread is the system of ash and slag involving in construction or as a replacement for sand in road construction, or as an additive to building mixtures. However, there are both industrially valuable and environmentally dangerous ele-ments in ash-slag materials. Ash-slag materials can be considered as inde-pendent ore deposits located on the surface and requiring the costs of their extraction.

  1. Rare and Rare-Earth Metals in Coal Processing Waste

    Directory of Open Access Journals (Sweden)

    Cherkasova Tatiana

    2017-01-01

    Full Text Available An urgent issue for power plants operating on solid fuels (coal is the issue of utilization or use of accumulated production waste - ash and slag materials - in the related production. Ash-slag materials are classified as “waste”, usually grade 5; tens of millions of tons of them being pro-duced annually in the Kemerovo region, which threatens the ecology of the region. At the same time, ash and slag is a very promising raw material. The use of this material as a base for the final product allows us to signifi-cantly expand the possibilities of using coal. The most widespread is the system of ash and slag involving in construction or as a replacement for sand in road construction, or as an additive to building mixtures. However, there are both industrially valuable and environmentally dangerous ele-ments in ash-slag materials. Ash-slag materials can be considered as inde-pendent ore deposits located on the surface and requiring the costs of their extraction.

  2. Oxidation and carbonisation of coals: a case study of coal fire affected coals from the Wuda coalfield, Inner Mongolia, China

    Science.gov (United States)

    Kus, Jolanta; Meyer, Uwe; Ma, Jianwei; Chen-Brauchler, Dai

    2010-05-01

    At the coalfield of Wuda (Inner Mongolia, PR China) extensive underground coal fires cause widespread thermal and oxidative effects in coal seams. Within phase B of the Coal Fire Research Project of the Sino-German Initiative, methods for innovative fire-extinguishing technologies were investigated in multifaceted research approaches. Extensive investigations of oxidative and thermally affected coal seams in coal fire zone 18 were conducted in 2008 prior to application of new fire-extinguishing methods. We present results from the outcrop of coal seam No. 4 in the fire zone 18. The coal of seam No. 4 is of Early Permian age and belongs stratigraphically to the Shanxi Formation. The unaffected coal displays a high volatile bituminous A rank with a background value of random vitrinite reflectance ranging from 0.90 to 0.96 % Rr. Coal channel samples were coallected at actively extracted coal faces along multiple profiles with surface temperatures ranging from about 50° to 600°C. Microscopic examinations revealed a variety of products of coal exposure to the fire. Within coal samples, a marked rise in vitrinite reflectance from background values to 5.55% Rr (6.00 % Rmax) is encountered. In addition, a number of coal samples showed suppressed vitrinite reflectances ranging between 0.82 to 0.88% Rr. Further, seemingly heat unaffected coal samples display intensive development of oxidations rims at coal grain edges and cracks as well as shrinkage cracks and formation of iron oxides/hydroxides. Instead, thermally affected coal samples with higher coalification grade are further characterised by development of macropores (devolatilisation pores) in vitrinitic streaks, transformation of liptinite to meta-liptinite and micrinite as well as by natural coke particles of mostly porous nature and fine to coarse grained anisotropic mosaic. Coal petrographic investigations confirmed a hypothesis that both, oxidations as well as low temperature carbonisation govern the thermal

  3. Coal industry annual 1997

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-12-01

    Coal Industry Annual 1997 provides comprehensive information about US coal production, number of mines, prices, productivity, employment, productive capacity, and recoverable reserves. US Coal production for 1997 and previous years is based on the annual survey EIA-7A, Coal Production Report. This report presents data on coal consumption, coal distribution, coal stocks, coal prices, and coal quality for Congress, Federal and State agencies, the coal industry, and the general public. Appendix A contains a compilation of coal statistics for the major coal-producing States. This report includes a national total coal consumption for nonutility power producers that are not in the manufacturing, agriculture, mining, construction, or commercial sectors. 14 figs., 145 tabs.

  4. Coal industry annual 1997

    International Nuclear Information System (INIS)

    1998-12-01

    Coal Industry Annual 1997 provides comprehensive information about US coal production, number of mines, prices, productivity, employment, productive capacity, and recoverable reserves. US Coal production for 1997 and previous years is based on the annual survey EIA-7A, Coal Production Report. This report presents data on coal consumption, coal distribution, coal stocks, coal prices, and coal quality for Congress, Federal and State agencies, the coal industry, and the general public. Appendix A contains a compilation of coal statistics for the major coal-producing States. This report includes a national total coal consumption for nonutility power producers that are not in the manufacturing, agriculture, mining, construction, or commercial sectors. 14 figs., 145 tabs

  5. Coal marketing manual 1987

    Energy Technology Data Exchange (ETDEWEB)

    1987-01-01

    This manual provides information on the international coal market in tabulated format. Statistics are presented for the Australian coal industry, exports, currency movements, world coal production, coal and coke imports and exports. Detailed information is provided on the Australian coal industry including mine specific summaries. Pricing summaries for thermal and coking coal in 1987, coal quality standards and specifications, trends in coal prices and stocks. Imports and exports for World coal and coke, details of shipping, international ports and iron and steel production. An exporters index of Australian and overseas companies with industry and government contacts is included. 15 figs., 67 tabs.

  6. Coal industry annual 1996

    International Nuclear Information System (INIS)

    1997-11-01

    This report presents data on coal consumption, coal distribution, coal stocks, coal prices, and coal quality, and emissions for Congress, Federal and State agencies, the coal industry, and the general public. Appendix A contains a compilation of coal statistics for the major coal-producing States.This report does not include coal consumption data for nonutility power producers that are not in the manufacturing, agriculture, mining, construction, or commercial sectors. Consumption for nonutility power producers not included in this report is estimated to be 24 million short tons for 1996. 14 figs., 145 tabs

  7. Coal industry annual 1996

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-11-01

    This report presents data on coal consumption, coal distribution, coal stocks, coal prices, and coal quality, and emissions for Congress, Federal and State agencies, the coal industry, and the general public. Appendix A contains a compilation of coal statistics for the major coal-producing States.This report does not include coal consumption data for nonutility power producers that are not in the manufacturing, agriculture, mining, construction, or commercial sectors. Consumption for nonutility power producers not included in this report is estimated to be 24 million short tons for 1996. 14 figs., 145 tabs.

  8. Coal Industry Annual 1995

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-10-01

    This report presents data on coal consumption, coal distribution, coal stocks, coal prices, coal quality, and emissions for Congress, Federal and State agencies, the coal industry, and the general public. Appendix A contains a compilation of coal statistics for the major coal-producing States. This report does not include coal consumption data for nonutility power producers that are not in the manufacturing, agriculture, mining, construction, or commercial sectors. Consumption for nonutility power producers not included in this report is estimated to be 21 million short tons for 1995.

  9. Coal Industry Annual 1995

    International Nuclear Information System (INIS)

    1996-10-01

    This report presents data on coal consumption, coal distribution, coal stocks, coal prices, coal quality, and emissions for Congress, Federal and State agencies, the coal industry, and the general public. Appendix A contains a compilation of coal statistics for the major coal-producing States. This report does not include coal consumption data for nonutility power producers that are not in the manufacturing, agriculture, mining, construction, or commercial sectors. Consumption for nonutility power producers not included in this report is estimated to be 21 million short tons for 1995

  10. Petrographic and mineral characterization of Balkan coals and their solid waste products from coal preparation

    International Nuclear Information System (INIS)

    Yossifova, M.

    1995-01-01

    This paper is part of a complex petrographic, mineralogical and chemical investigation on Balkan bituminous coals and their solid waste products from coal preparation. The petrographic and phase-mineralogical composition in ten composite samples and four water extracts have been studied by optical microscopy, scanning electron microscopy and X-ray diffraction. 4 refs., 4 tabs

  11. Effects of microwave irradiation treatment on physicochemical characteristics of Chinese low-rank coals

    International Nuclear Information System (INIS)

    Ge, Lichao; Zhang, Yanwei; Wang, Zhihua; Zhou, Junhu; Cen, Kefa

    2013-01-01

    Highlights: • Typical Chinese lignites with various ranks are upgraded through microwave. • The pore distribution extends to micropore region, BET area and volume increase. • FTIR show the change of microstructure and improvement in coal rank after upgrading. • Upgraded coals exhibit weak combustion similar to Da Tong bituminous coal. • More evident effects are obtained for raw brown coal with relative lower rank. - Abstract: This study investigates the effects of microwave irradiation treatment on coal composition, pore structure, coal rank, function groups, and combustion characteristics of typical Chinese low-rank coals. Results showed that the upgrading process (microwave irradiation treatment) significantly reduced the coals’ inherent moisture, and increased their calorific value and fixed carbon content. It was also found that the upgrading process generated micropores and increased pore volume and surface area of the coals. Results on the oxygen/carbon ratio parameter indicated that the low-rank coals were upgraded to high-rank coals after the upgrading process, which is in agreement with the findings from Fourier transform infrared spectroscopy. Unstable components in the coal were converted into stable components during the upgrading process. Thermo-gravimetric analysis showed that the combustion processes of upgraded coals were delayed toward the high-temperature region, the ignition and burnout temperatures increased, and the comprehensive combustion parameter decreased. Compared with raw brown coals, the upgraded coals exhibited weak combustion characteristics similar to bituminous coal. The changes in physicochemical characteristics became more notable when processing temperature increased from 130 °C to 160 °C or the rank of raw brown coal was lower. Microwave irradiation treatment could be considered as an effective dewatering and upgrading process

  12. Coal and Energy.

    Science.gov (United States)

    Bryant, Reba; And Others

    This teaching unit explores coal as an energy resource. Goals, student objectives, background information, and activity options are presented for each major section. The sections are: (1) an introduction to coal (which describes how and where coal was formed and explains the types of coal); (2) the mining of coal (including the methods and ways of…

  13. Radiant-and-plasma technology for coal processing

    Directory of Open Access Journals (Sweden)

    Vladimir Messerle

    2012-12-01

    Full Text Available Radiant-and-plasma technology for coal processing is presented in the article. Thermodynamic computation and experiments on plasma processing of bituminous coal preliminary electron-beam activated were fulfilled in comparison with plasma processing of the coal. Positive influence of the preliminary electron-beam activation of coal on synthesis gas yield was found. Experiments were carried out in the plasma gasifier of 100 kW power. As a result of the measurements of material and heat balance of the process gave the following integral indicators: weight-average temperature of 2200-2300 K, and carbon gasification degree of 82,4-83,2%. Synthesis gas yield at thermochemical preparation of raw coal dust for burning was 24,5% and in the case of electron-beam activation of coal synthesis gas yield reached 36,4%, which is 48% higher.

  14. Gasification of coal with steam using heat from HTRs

    International Nuclear Information System (INIS)

    Juentgen, H.; Heek, K.H. van

    1975-01-01

    In existing coal gasification processes a substantial part of the coal is used to provide the heat for the reaction, for the generation and superheating of steam and for the production of oxygen. By using heat from HTRs to substitute this part, the coal is then completely used as raw material for gas production. This offers the following advantages compared with the existing processes: a saving of coal, less CO 2 emission and, in countries with high coal costs, lower gas production costs. A survey is given of the state of the project, discussing the first design of a commercial gasifier, the influence of the helium outlet temperature of the HTR, kinds of products, and the overall efficiency of the plant. The aim of the development is to demonstrate the use of heat from an HTR for full scale coal gasification, starting in 1985. (Auth.)

  15. Report on the achievements in development of a coal liquefaction technology (a solvent extraction and liquefaction technology) in the Sunshine Project in fiscal 1981. Data 1. Development of a brown coal based solvent extraction plant (50 t/d pilot plant); 1981 nendo sekitan ekika gijutsu no kaihatsu seika hokokusho (shiryo 1). Yozai chushutsu ekika gijutsu no kaihatsu (kattankei yozai chushutsu plant no kaihatsu (50ton/nichi pilot plant no kaihatsu))

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1982-03-01

    This paper describes the data-1 for developing a brown coal based solvent extraction plant in the Sunshine Project in fiscal 1981. The data are for the development of a liquefaction plant for Victoria brown coal produced in Australia (a 50-t/d pilot plant). Fiscal 1981 has performed detailed design on the primary hydrogenation system by using the process conception and the design data obtained in the element studies. Part of the machines and devices was procured, and the site construction was begun. Detailed design documents and drawings were prepared. The data collected in relation with the plant design included the followings: device lists, entire factory layout drawings, device arrangement drawings, process flow sheets, utility flow sheets (fuel gas and fuel oil systems, steam and condensate systems, air for instrumentation, plant air, cooling water supply and return, industrial water and treated water, a waste water treatment system, a nitrogen system, and a waste gas system), public pollution preventing facilities, hazardous location classifying plans, and material balances. The data collected in relation with the machine design included pressure vessel engineering specifications, heat exchanger engineering specifications, and device purchase specifications. (NEDO)

  16. Coal liquefaction with preasphaltene recycle

    Science.gov (United States)

    Weimer, Robert F.; Miller, Robert N.

    1986-01-01

    A coal liquefaction system is disclosed with a novel preasphaltene recycle from a supercritical extraction unit to the slurry mix tank wherein the recycle stream contains at least 90% preasphaltenes (benzene insoluble, pyridine soluble organics) with other residual materials such as unconverted coal and ash. This subject process results in the production of asphaltene materials which can be subjected to hydrotreating to acquire a substitute for No. 6 fuel oil. The preasphaltene-predominant recycle reduces the hydrogen consumption for a process where asphaltene material is being sought.

  17. Utilization of silicifed Tertiary wood as raw material for the natural stone industry. [German Democratic Republic

    Energy Technology Data Exchange (ETDEWEB)

    Bellmann, H J; Schuettler, J; Jakisch, E

    1981-11-01

    This paper discusses the occurrence of silicified tree trunks and stumps in the Boehlen brown coal field. The trees, mainly Taxodium and Sequoia 25 million years old, are located within the top brown coal seam of the deposit and present a major obstacle to excavator operation, together with other forms of so-called 'brown coal quartzite'. The quartz of the silicified trees occurs as opal, cryptocrystalline quartz and low temperature quartz. The separate removal and disposal of this wood as well as efforts made to use selected wood as raw material are briefly summarized. Various products for interior house decoration have been manufactured from the wood. (4 refs.)

  18. Coal -94

    International Nuclear Information System (INIS)

    Sparre, C.

    1994-05-01

    This report deals with use of coal and coke during 1993; information about techniques, environmental questions and markets are also given. Use of steamcoal for heating purposes has been reduced about 3 % during 1993 to 1,0 mill tons. This is the case especially for the heat generating boilers. Production in co-generation plants has been constant and has increased for electricity production. Minor plants have increased their use of forest fuels, LPG and NG. Use of steamcoal will probably go down in the immediate years both in heat generating and co-generating plants. Coal-based electricity has been imported from Denmark during 1993 corresponding to about 400 000 tons of coal, when several of our nuclear plants were stopped. Use of steamcoal in the industry has been constant at 700 000 tons. This level is supposed to be constant or to vary with business cycles. The import of metallurgical coal in 1993 was 1,6 mill tons like the year before. 1,2 mill tons coke were produced. Coke consumption in industry was 1,4 mill tons. 0,2 mill tons of coke were imported. Average price of steamcoal imported to Sweden in 1993 was 308 SEK/ton or 13 % higher than in 1992; this can be explained by the dollar price level increasing 34% in 1993. For the world, the average import price was 50,0 USD/ton, a decrease of 6 %. The coal market during 1993 was affected by less consumption in Europe, shut downs of European mines and decreasing prices. High freight price raises in Russia has affected the Russian export and the market in northern Europe. The prices have been stabilized recently. All Swedish plants meet emission limits of dust, SO 2 and NO x . Co-generation plants all have some sort of SO 2 -removal system; the wet-dry method is mostly used. A positive effect of the recently introduced NO x -duties is a 40% reduction

  19. Coal statistics 1977

    Energy Technology Data Exchange (ETDEWEB)

    Statistical Office of the European Communities

    1978-01-01

    Presents tables of data relating to the coal market in the European Community in 1977. The tables cover hard coal production, supply and trade; briquettes; cokes; lignite, brown coal briquettes and peat; and mines and coke ovens.

  20. Australian coal yearbook 1989

    Energy Technology Data Exchange (ETDEWEB)

    Aylward, A [ed.

    1989-01-01

    This yearbook contains a mine directory; details of coal export facilities and ports; annual coal statistics; a buyers' guide; names and addresses of industry organisations and an index of coal mine owners.

  1. Coal industry annual 1993

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-06

    Coal Industry Annual 1993 replaces the publication Coal Production (DOE/FIA-0125). This report presents additional tables and expanded versions of tables previously presented in Coal Production, including production, number of mines, Productivity, employment, productive capacity, and recoverable reserves. This report also presents data on coal consumption, coal distribution, coal stocks, coal prices, coal quality, and emissions for a wide audience including the Congress, Federal and State agencies, the coal industry, and the general public. In addition, Appendix A contains a compilation of coal statistics for the major coal-producing States. This report does not include coal consumption data for nonutility Power Producers who are not in the manufacturing, agriculture, mining, construction, or commercial sectors. This consumption is estimated to be 5 million short tons in 1993.

  2. Coal industry annual 1993

    International Nuclear Information System (INIS)

    1994-01-01

    Coal Industry Annual 1993 replaces the publication Coal Production (DOE/FIA-0125). This report presents additional tables and expanded versions of tables previously presented in Coal Production, including production, number of mines, Productivity, employment, productive capacity, and recoverable reserves. This report also presents data on coal consumption, coal distribution, coal stocks, coal prices, coal quality, and emissions for a wide audience including the Congress, Federal and State agencies, the coal industry, and the general public. In addition, Appendix A contains a compilation of coal statistics for the major coal-producing States. This report does not include coal consumption data for nonutility Power Producers who are not in the manufacturing, agriculture, mining, construction, or commercial sectors. This consumption is estimated to be 5 million short tons in 1993

  3. Australian black coal statistics 1990

    Energy Technology Data Exchange (ETDEWEB)

    1991-01-01

    This second edition of Australian black coal statistics replaces the Joint Coal Board's publication 'Black coal in Australia'. It includes an expanded international coal trade supplement. Sections cover resources of black coal, coal supply and demand, coal production, employment and productivity of mines, export data, coal consumption and a directory of producers.

  4. Automation of technological processes at surface mines in the GDR as one of the main directions of increased coal extraction effectiveness by surface mining

    Energy Technology Data Exchange (ETDEWEB)

    Jona, U.

    1987-12-01

    In the GDR, about 53% of brown coal is mined with the use of overburden conveyor bridges, 27% with the use of belt conveyors, and 20% with the use of rail transport. Compares efficiency and cost per 1 m/sup 3/ of these transport methods. The overburden conveyor bridges, their specifications and microcomputer control are described. Describes utilization of microcomputer techniques, especially the stereochart system of Carl Zeiss Jena, for automated processing of data on surface mine geometry. Other computer applications are also presented, e.g. for surveying, slope stability calculation, and conveyor bridge control. Maintains that application of the KED/KEM microcomputer system for overburden conveyor bridge control increases its effectiveness by 10%, i.e. by 8 million m/sup 3//a.

  5. 1982 Australian coal conference papers

    Energy Technology Data Exchange (ETDEWEB)

    1982-01-01

    This third Australian coal conference included papers discussing the market for coal, finance and investment, use of computers, mining, coal research, coal preparation and waste disposal, marketing and trade, and the transport of coal. All papers have been individually abstracted.

  6. Distilling coal, shale, etc

    Energy Technology Data Exchange (ETDEWEB)

    Bussey, C C

    1916-07-17

    In the extraction of vovolatile ingredients from coal, shale, lignite, and other hydrocarbonaceous materials by passing through the material a heating-agent produced by burning at the base of the charge a portion of the material from which the volatile ingredients have been extracted, the temperature of the heating agent is maintained constant by continuously removing the residue from the bottom of the apparatus. The temperature employed is 800/sup 0/F or slightly less, so as to avoid any breaking-down action. As shown the retort is flared downwardly, and is provided at the base with a fireplace, which is in communication with the interior of the retort through flues fitted with screens and dampers. Beneath the bottom of the retort is mounted a movable grate carried on endless sprocket chains, which are preferably set so that the grate inclines downwardly towards the coke, etc.

  7. Abundances of polycyclic aromatic hydrocarbons (PAHs) in 14 chinese and american coals and their relation to coal rank and weathering

    Science.gov (United States)

    Wang, R.; Liu, Gaisheng; Zhang, Jiahua; Chou, C.-L.; Liu, J.

    2010-01-01

    The abundances of 16 polycyclic aromatic hydrocarbons (PAHs) on the priority list of the United States Environmental Protection Agency (U.S. EPA) have been determined in 14 Chinese and American coals. The ranks of the samples range from lignite, bituminous coal, anthracite, to natural coke. Soxhlet extraction was conducted on each coal for 48 h. The extract was analyzed on a gas chromatograph-mass spectrometer (GC-MS). The results show that the total PAH content ranged from 0.31 to 57.6 ??g/g of coal (on a dry basis). It varied with coal rank and is highest in the maturity range of bituminous coal rank. High-molecular-weight (HMW) PAHs are predominant in low-rank coals, but low-molecular-weight (LMW) PAHs are predominant in high-rank coals. The low-sulfur coals have a higher PAH content than high-sulfur coals. It may be explained by an increasing connection between disulfide bonds and PAHs in high-sulfur coal. In addition, it leads us to conclude that the PAH content of coals may be related to the depositional environment. ?? 2010 American Chemical Society.

  8. Coal mine subsidence and structures

    International Nuclear Information System (INIS)

    Gray, R.E.

    1988-01-01

    Underground coal mining has occurred beneath 32 x 10 9 m 2 (8 million acres) of land in the United States and will eventually extend beneath 162 x 10 9 m 2 (40 million acres). Most of this mining has taken place and will take place in the eastern half of the United States. In areas of abandoned mines where total extraction was not achieved, roof collapse, crushing of coal pillars, or punching of coal pillars into softer mine floor or roof rock is now resulting in sinkhole or trough subsidence tens or even hundreds of years after mining. Difference in geology, in mining, and building construction practice between Europe and the United States preclude direct transfer of European subsidence engineering experience. Building damage cannot be related simply to tensile and compressive strains at the ground surface. Recognition of the subsidence damage role played by ground-structure interaction and by structural details is needed

  9. Retort for distilling coal oil

    Energy Technology Data Exchange (ETDEWEB)

    Gibbon, J

    1865-12-20

    The construction of a retort for extracting or distilling coal oil or other products from cannel coal, shale, or schist, and more particularly of small coal or dust technically called slack, consists in applying self-acting feed and discharge apparatus to a revolving cylindrical wrought or cast iron retort, and constructing the inner surface of the cylindrical retort with a projecting ridge which encircles the interior of the retort in a spiral manner, the same as the interior of a female screw, and the ridge may be either cast upon or riveted on the internal surface, and is so arranged to cause the material to be operated upon to advance from one end of the retort to the other, as the retort revolves by following the course of the spiral screw or worm formed by the projecting ridge.

  10. A brief introduction to the Tavan Tolgoi coking coal deposit

    Energy Technology Data Exchange (ETDEWEB)

    1992-01-01

    The Tavan Tolgoi coal field is located near the settlement Tsogttsetsii in the South Gobi province, 540 km south of Ulaanbaatar and 96 km east of Dalan Zadgad. The nearest railway stations are Choir, Khar-Airag and Sainshand and are located a distance of about 390 to 450 km, to the northeast of the coal field. An unimproved road connects the property with the railway stations at this time. The Tavan Tolgoi coal field covers 220 square km of land. The coal bearing strata contains 16 coal seams from 3 to 30 m thick with a total average thickness of 165 m. As per the geological survey, the proven and probable reserves of the Tavan Tolgoi coal field are estimated at 5 billion tonnes. Of the 5 billion tonnes, 77.5% or 3.9 billion tonnes are expected to be washed and will produce 2.16 billion tonnes (55% wash recovery) of clean coking coal. 1.41 billion tonnes or 36% of the washed coal will be middlings and available for steam coal, and 9% or 0.33 billion tonnes will be washed or gob. The remaining 1.2 billion tonnes can be mined and sold raw as steam coal. Water, electricity supplies and transportation will have to be developed. Research on this has been done. Markets are envisaged to be within Mongolia, and in the Asia Pacific region. Foreign investment will be needed. 5 figs., 6 tabs.

  11. Basic studies on coal liquefaction reaction, reforming and utilization of liquefaction products

    Energy Technology Data Exchange (ETDEWEB)

    Shiraishi, M. (National Institute for Resources and Environment, Tsukuba (Japan))

    1993-09-01

    This report describes the achievement of research and development of coal liquefaction technologies in the Sunshine Project for FY 1992, regarding the coal liquefaction reaction, reforming and utilization of liquefaction products. For the fundamental study on coal liquefaction reaction, were investigated effect of asphaltene in petroleum residue on coprocessing, pretreatment effect in coprocessing of Taiheiyo coal and tarsand bitumen using oil soluble catalyst, solubilization and liquefaction of Taiheiyo coal at mild conditions with the aid of super acid, and flash hydropyrolysis of finely pulverized swollen coal under high hydrogen pressure. On the other hand, for the study on hydrotreatment of coal derived liquid, were investigated catalytic hydroprocessing of Wandoan coal liquids, production of gasoline from coal liquids by fluid catalytic cracking, solvent extraction of phenolic compounds from coal liquids, and separation of hetero compounds in coal liquid by means of high pressure crystallization. Further progress in these studies has been confirmed. 9 figs., 6 tabs.

  12. Pyritic waste from precombustion coal cleaning: Amelioration with oil shale retort waste and sewage sludge for growth of soya beans

    International Nuclear Information System (INIS)

    Lewis, B.G.; Gnanapragasam, N.; Stevens, M.L.

    1994-01-01

    Solid residue from fossil fuel mining and utilization generally present little hazard to human health. However, because of the high volumes generated, they do pose unique disposal problems in terms of land use and potential degradation of soil and water. In the specific case of wastes from precombustion coal cleaning, the materials include sulfur compounds that undergo oxidation when exposed to normal atmospheric conditions and microbial action and then produce sulfuric acid. The wastes also contain compounds of metals and nonmetals at concentrations many times those present in the original raw coal. Additionally, the residues often contain coal particles and fragments that combust spontaneously if left exposed to the air, thus contributing to the air pollution that the coal cleaning process was designed to prevent. Federal and state efforts in the United States to ameliorate the thousands of hectares covered with these wastes have focused on neutralizing the acidity with limestone and covering the material with soil. The latter procedure creates additional degraded areas, which were originally farmland or wildlife habitat. It would seem preferable to reclaim the coal refuse areas without earth moving. The authors describe here experiments with neutralization of coal waste acidity using an alkaline waste derived from the extraction of oil from oil shale to grow soya beans (Glycine max. [L]) on a mixture of wastes and sewage sludge. Yield of plant material and content of nutrients an potentially toxic elements in the vegetation and in the growth mixtures were determined; results were compared with those for plants grown on an agricultural soil, with particular focus on boron

  13. Coking coal of Checua Lenguazaque area

    International Nuclear Information System (INIS)

    Arboleda Otalora, Carlos Ariel

    1987-06-01

    In this report a summary of the main characteristics of the coal of the area of Checua-Samaca is presented. Using the main works carried out on this area, the most important geologic, physical-chemical, technological and petrographic aspects are compiled that are considered essential to carry out a technical evaluation of these coal and all the analyses they take to conclude that in this area, bituminous coal are presented with very good coking properties, on the other hand, it is demonstrated by the use that is given to the coal extracted by the small existent mining. However, keeping in mind the demands of the international market of the coking coal, it becomes necessary to improve the existent geologic information to be able to make reliable stratigraphic correlations

  14. Quarterly coal statistics of OECD countries

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-27

    These quarterly statistics contain data from the fourth quarter 1990 to the fourth quarter 1991. The first set of tables (A1 to A30) show trends in production, trade, stock change and apparent consumption data for OECD countries. Tables B1 to B12 show detailed statistics for some major coal trade flows to and from OECD countries and average value in US dollars. A third set of tables, C1 to C12, show average import values and indices. The trade data have been extracted or derived from national and EEC customs statistics. An introductory section summarizes trends in coal supply and consumption, deliveries to thermal power stations; electricity production and final consumption of coal and tabulates EEC and Japanese steam coal and coking coal imports to major countries.

  15. Report on the achievements in research and development of a coal liquefaction technology in the Sunshine Project in fiscal 1981. Development of a solvent extraction and liquefaction plant (research and development of solid-liquid separation process); Sekitan ekika gijutsu no kenkyu kaihatsu, yozai chushutsu ekika plant no kaihatsu, koeki bunriho no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1982-03-01

    Among researches on solvent extraction and liquefaction technologies in the Sunshine Project in fiscal 1981, this paper describes the achievements in development of a solid-liquid separation technology. In the research of operation of a centrifugal separation device, a solid-liquid separation test was performed on slurry extracted from the Australian Wandoan coal being sub-bituminous coal. The deliming rate has reached 99% equilibrium at an addition rate of 20% by weight of anti-solvent (a kind of normal paraffin, which reduces solubility of part of coal extracts and enhances removal rates of ash and solids by utilizing coagulating action of the extracts). Asphaltene among the liquefaction formed materials may be recovered nearly completely, but the recovery rate for pre-asphaltene was lower. An operation test was also carried out by using slurry extracted in a 1 t/d experimental plant. In the study on operation of a 5-l/h continuous sedimentation and separation device, a maximum effect was derived with addition of anti-solvent at 25% by weight and at a stirring rate of 700 rpm. The solid-liquid separability changes depending on the kind of slurry. The low conversion rate slurry becomes difficult of separation because its viscosity is high and the difference in density between solids and liquid is small. Furthermore, the high conversion rate slurry has become difficult of separation due to small particle size of the solids. (NEDO)

  16. Coal Tar and Coal-Tar Pitch

    Science.gov (United States)

    Learn about coal-tar products, which can raise your risk of skin cancer, lung cancer, and other types of cancer. Examples of coal-tar products include creosote, coal-tar pitch, and certain preparations used to treat skin conditions such as eczema, psoriasis, and dandruff.

  17. Influence of the microwave irradiation dewatering on the combustion characteristics of Chinese brown coals

    Science.gov (United States)

    Ge, Lichao; Feng, Hongcui; Xu, Chang; Zhang, Yanwei; Wang, Zhihua

    2018-02-01

    This study investigates the influence of microwave irradiation on coal composition, pore structure, coal rank, and combustion characteristics of typical brown coals in China. Results show that the upgrading process significantly decreased the inherent moisture, and increased calorific value and fixed carbon content. After upgrading, pore distribution extended to micropore region, oxygen functional groups were reduced and destroyed, and the apparent aromaticity increased suggesting an improvement in the coal rank. Based on thermogravimetric analysis, the combustion processes of upgraded coals were delayed toward the high temperature region, and the temperatures of ignition, peak and burnout increased. Based on the average combustion rate and comprehensive combustion parameter, the upgraded coals performed better compared with raw brown coals and a high rank coal. In ignition and burnout segments, the activation energy increased but exhibited a decrease in the combustion stage.

  18. Land use and coal technology

    International Nuclear Information System (INIS)

    Anon.

    1978-01-01

    The Arid Lands Ecology Reserve and the Hanford National Environmental Research Park were established to promote the use of the Hanford Site for ecological research, especially studies related to energy technologies and their potential for environmental impacts. Coal is currently regarded as the most dependable interim source of energy in the United States. To meet expected demands, coal needs to be mined in large quantities and may be mined predominantly in locations of sparse precipitation. Often the most economical way to extract coal is through surface mining. It is expected that following coal extraction the pits will be filled with overburden, graded to approximate original contour, native topsoil applied to prescribed depths and planted with climatically adapted herbs, shrubs or trees. Because primary productivity in dry regions is characteristically low, it is realistic to expect, if the above procedure is followed, that the revegetated surfaces will also produce little phytomass in the years following restoration. Appropriate data are needed for accurate estimation of the economic feasibility of a particular restoration practice or its alternative. Research programs are discussed briefly

  19. Report for fiscal 1993 on feasibility study for development of overseas coal. Bowen coal field, Australia; 1993 nendo kaigaitan kaihatsu kanosei chosa hokokusho. Australia koku Bowen tanden

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1993-09-01

    Discussions were given on the possibility of development as a coal supply source for Japan on the area centering around the Bowen coal field, whose coal exploration right was made open by the state government of Queensland, Australia in March 1993. Surveys were performed on information about the release of restrictions and the bid on the coal exploration right area RA55, the current status of the coal industry in Queensland, infrastructures, and the coal related government organizations. The following conclusions were arrived as a result of the surveys: the RA55 area to which the coal exploration right was made open has mining areas remaining, which are possible of supplying coals for an extended period of time from both of quantity and quality aspects; particularly in the 12 mining areas under the open bid, high-quality ordinary coal and raw material coal are in existence, whose potential is high; the state government and the related organizations are enthusiastic in promoting the development because the coal industry is the largest industry in the state; for new coal development, such assistance is expected as improvement in the infrastructures, deregulation, and favorable taxation system; and implementations are desired on acquisition of the exploration right, and exploration activities for new coal development. (NEDO)

  20. Raw materials for aluminium production

    International Nuclear Information System (INIS)

    Galushkin, N.V.

    1995-01-01

    This chapter of monograph is devoted to to raw materials which used in aluminium production. Therefore, the using of alumina, and fluoride salts in aluminium production was considered. The physical properties of alumina were studied.

  1. OZONE ABSORPTION IN RAW WATERS

    Directory of Open Access Journals (Sweden)

    LJILJANA TAKIĆ

    2008-03-01

    Full Text Available The ozone absorption in raw water entering the main ozonization step at the Belgrade drinking water supply plant was investigated in a continuous stirred tank reactor (CSTR. A slow chemical reaction rate of dissolved ozone and pollutants present in raw water have been experimentally determined. The modified Hatta number was defined and calculated as a criterion which determines whether and to which extent the reactions of ozone and pollutants influence the rate of the pure physical ozone absorption.

  2. Coal cleaning: a viable strategy for reduced carbon emissions and improved environment in China?

    International Nuclear Information System (INIS)

    Glomsroed, Solveig; Wei Taoyuan

    2005-01-01

    China is a dominant energy consumer in global context and current energy forecasts emphasise that China's future energy consumption also will rely heavily on coal. The coal use is the major source of the greenhouse gas CO 2 and particles causing serious health damage. This paper looks into the question if coal washing might work as low cost strategy for both CO 2 and particle emission reductions. Coal washing removes dirt and rock from raw coal, resulting in a coal product with higher thermal energy and less air pollutants. Coal cleaning capacity has so far not been developed in line with the market potential. In this paper an emerging market for cleaned coal is studied within a CGE model for China. The macro approach catches the repercussions of coal cleaning through increased energy efficiency, lower coal transportation costs and crowding out effect of investments in coal washing plants. Coal cleaning stimulates economic growth and reduces particle emissions, but total energy use, coal use and CO 2 emissions increase through a rebound effect supported by the vast reserve of underemployed labourers. A carbon tax on fossil fuel combustion has a limited effect on total emissions. The reason is a coal leakage to tax exempted processing industries

  3. Record coking coal settlements

    Energy Technology Data Exchange (ETDEWEB)

    Macdonald, C.

    2005-02-01

    The US$100/tonne psychological barrier in coking coal prices has been well and truly smashed. The article examines developments in coal pricing. It includes quotes from many senior executives in the coal industry as collected at McCloskey's Australian Coal.04 conference held in Sydney, 18-19 November 2004. 2 photos.

  4. COAL Conference Poster

    OpenAIRE

    Brown, Taylor Alexander; McGibbney, Lewis John

    2017-01-01

    COAL Conference Poster This archive contains the COAL conference poster for the AGU Fall Meeting 2017 by Taylor Alexander Brown. The Inkscape SVG source is available at https://github.com/capstone-coal/coal-conference-poster/ under the Creative Commons Attribution-ShareAlike 4.0 International license.

  5. Observer-Based Fuel Control Using Oxygen Measurement. A study based on a first-principles model of a pulverized coal fired Benson Boiler

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, Palle; Bendtsen, Jan Dimon; Mortensen, Jan Henrik; Just Nielsen, Rene; Soendergaard Pedersen, Tom [Aalborg Univ. (Denmark). Dept. of Control Engineering

    2005-01-01

    This report describes an attempt to improve the existing control of coal mills used at the Danish power plant Nordjyllandsvaerket Unit 3. The coal mills pulverize raw coal to a fine-grained powder, which is injected into the furnace of the power plant. In the furnace the coal is combusted, producing heat, which is used for steam production. With better control of the coal mills, the power plant can be controlled more efficiently during load changes, thus improving the overall availability and efficiency of the plant. One of the main difficulties from a control point of view is that the coal mills are not equipped with sensors that detect how much coal is injected into the furnace. During the project, a fairly detailed, non-linear differential equation model of the furnace and the steam circuit was constructed and validated against data obtained at the plant. It was observed that this model was able to capture most of the important dynamics found in the data. Based on this model, it is possible to extract linearized models in various operating points. The report discusses this approach and illustrates how the model can be linearized and reduced to a lower-order linear model that is valid in the vicinity of an operating point by removing states that have little influence on the overall response. A viable adaptive control strategy would then be to design controllers for each of these simplified linear models, i.e., the control loop that sets references to the coal mills and feedwater, and use the load as a separate input to the control. The control gains should then be scheduled according to the load. However, the variations and uncertainties in the coal mill are not addressed directly in this approach. Another control approach was taken in this project, where a Kalman filter based on measurements of air flow blown into the furnace and the oxygen concentration in the flue gas is designed to estimate the actual coal flow injected into the furnace. With this estimate

  6. Morphological and Strength Properties of Tanjung Bin Coal Ash Mixtures for Applied in Geotechnical Engineering Work

    OpenAIRE

    Awang, Abd. Rahim; Marto, Aminaton; Makhtar, Ahmad Maher

    2012-01-01

    In Malaysia, coal has been used as a raw material to generate electricity since 1988. In the past, most of the wastage of coal burning especially the bottom ash was not managed properly as it was dumped in the waste pond and accumulated drastically.This paper focuses on some properties of coal ash mixtures (fly  ash and bottom ash mixtures) from Tanjung Bin power plant. The characteristics studied were morphological properties, compaction behaviour and strength properties. Strength properties...

  7. Interaction and the structures of coal

    Science.gov (United States)

    Opaprakasit, Pakorn

    The origin of a decrease in the amount of soluble material from coal upon a reflux treatment has been investigated in an attempt to obtain insight into the nature of the interaction in the macromolecular network structure of coal. This decrease in the extractable material is a result of an increase in the amount of physical cross-links associated with secondary interactions. The alternate possibility of covalent cross-link formation by ether linkage was found to be unlikely because the coal hydroxyl content remains unchanged upon heat treatment. The functional groups responsible for forming these physical cross-links and their contents vary from coal to coal with coal rank. Carboxylate/cation complexes, similar to those found in ionomers, dominate in low rank coal. In high rank coal, the clusters involving pi-cation interactions were observed. Both mechanisms seem to play a role in mid rank coals. These physical cross-links are responsible for a lowering of the extraction yield of coal, but are disrupted by a treatment with acid solution, resulting in an increase in the extraction yield. As a consequence, the cross-links in coal structure should be classified into two types; a "permanent" covalent cross-link, which break under extreme conditions such as chemical reaction and pyrolysis, and "reversible" cross-links, largely associated with ionomer-like structure and pi-cation interactions. The interaction between a "magic" solvent of N-methylpyrollidone and carbon disulfide (NMP/CS2) and its role in the unusual extractability enhancement of Upper Freeport coal has also been investigated. The results strongly suggest that NMP/CS2 mixed solvents form complexes with cations. These mixed solvents are capable of forming a solid complex with cations from NaOH and some simple salts, such as NaCl and LiCl. Given that Upper Freeport coal contains a large amount of mineral matter, it is not surprising that these types of complexes could be formed in the present of the mixed

  8. Is There Any Future For Coal Power Plants In Europe?

    Directory of Open Access Journals (Sweden)

    A. V. Zimakov

    2017-01-01

    Full Text Available The article deals with the policies of EU countries towards coal power plants as well as practical steps taken by their governments. Coal power plants are widely considered to be environmentally harmful which confronts with environmental policies of the EU suggesting Europe-wide cuts of greenhouse gas emissions. Based on that assumption a number of EU countries such asBelgium,Austria,Portugal,Dania,Finland,SwedenandUKare striving to phase out coal power plants and achieved significant progress on this path replacing coal with other generation sources. On the other hand, other EU members are lagging behind as coal phase-out is not an urgent item of their political agenda. This situation is typical forIreland,Netherlands,Italy,Croatia,SloveniaandSlovakia. Domestic coal extracting industry can pose a significant hindering factor for a coal power plants phase-out and can effectively block the process. This is the case inBulgaria,Romania,Hungary,CzechRepublic,GreeceandPoland. ButGermany, which also has a well-developed coal industry, transforms its energy sector towards a green one cutting the share of coal in the generation mix. If this effort of the German government proves successful it will deliver a positive transformation model for other EU countries with a large share of coal in generation-mix due to domestic coal extraction industry. The analysis of the political and economic (both macro and micro processes leads to conclusion that there is no unity among EU member states in their approach towards coal fired power plants phase-out. This will allow for coal power plants to retain their market share in a short to medium term. But in the longer run one can expect a significant decrease of coal fired generation inEurope, even in the countries traditionally dependent on coal.

  9. Coal option. [Shell Co

    Energy Technology Data Exchange (ETDEWEB)

    1978-01-01

    This paper notes the necessity of developing an international coal trade on a very large scale. The role of Shell in the coal industry is examined; the regions in which Shell companies are most active are Australia, Southern Africa, Indonesia; Europe and North America. Research is being carried out on marketing and transportation, especially via slurry pipelines; coal-oil emulsions; briquets; fluidized-bed combustion; recovery of coal from potential waste material; upgrading of low-rank coals; unconventional forms of mining; coal conversion (the Shell/Koppers high-pressure coal gasification process). Techniques for cleaning flue gas (the Shell Flue Gas Desulfurization process) are being examined.

  10. Concerning coal: an anthology

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, M.; Hawse, M.L.; Maloney, P.J. [eds.

    1997-12-31

    The anthology takes a humanistic look at coal mining in Illinois. One of its goals is to increase public awareness of coal in American society; it also seeks to enhance understanding of the historical aspects of coal and to study the impact of coal on mining families. Many of the 25 selections in the anthology come from Coal Research Center publications, `Concerning coal` and `Mineral matters`. Articles are arranged in three parts entitled: life in the mining community; mining in folklore, story telling, literature, art and music; and technology as it affected the people of the coal fields. 117 refs., 25 photos. 1 map.

  11. Health impacts of coal: facts and fallacies

    Energy Technology Data Exchange (ETDEWEB)

    Finkelman, R.B. [University of Texas, Dallas, TX (United States)

    2007-02-15

    Coal has contributed enormously to the advance of civilization by providing an abundant, inexpensive, and convenient source of energy. Concurrent with its contributions, coal has extracted a high cost in terms of environmental damage and human health impacts. Unfortunately, the links between coal use and human health are distorted by a great deal of ignorance and misinformation. This paper discusses the facts and fallacies of the direct health impacts caused by coal. These include health problems caused by arsenic, fluorine, mercury and selenium released in coal use in the residential sector. The trace element iodine however may help prevent iodine deficiency disorder. Lignite in the ground in some Balkan areas has been associated with a urinary tract cancer known as Balkan endemic nephropathy (BEN). Uncontrolled burning coal seams and coal waste piles contribute to global warming and to respiratory problems. The 10-fold enrichment of trace elements in fly ash and the fine particles released from power plants could present a health threat but where good pollution control technology and disposal practices are applied the health threat is probably minimal. Radioactivity levels in coal are thought to be too low to cause concern. 27 refs., 2 figs.

  12. Coal preparation and coal cleaning in the dry process; Kanshiki sentaku to coal cleaning

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Z; Morikawa, M; Fujii, Y [Okayama University, Okayama (Japan). Faculty of Engineering

    1996-09-01

    Because the wet process has a problem such as waste water treatment, coal cleaning in the dry process was discussed. When a fluidized bed (using glass beads and calcium carbonate) is utilized instead of the heavy liquid, the fluidized bed will have apparent density as the liquid does, whereas the relative relationship therewith determines whether a substance having been put into the fluidized bed will float or sink. This is utilized for coals. In addition, two powder constituents of A and B may be wanted to be separated using the fluidized extraction process (similar to the liquid-liquid extraction process). In such a case, a fluidized bed in which both constituents are mixed is added with a third constituent C (which will not mix with A, but mix well with B), where the constituents are separated into A and (B + C), and the (B + C) constituent is separated further by using a sieve. If coal has the coal content mixed with ash content and pulverized, it turns into particle groups which have distributions in grain size and density. Groups having higher density may contain more ash, and those having lower density less ash. In addition, the ash content depends also on the grain size. The ash content may be classified by using simultaneously wind classification (for density and grain size) and a sieve (for grain size). This inference may be expanded to consideration of constructing a multi-stage fluidized bed classification tower. 12 figs., 5 tabs.

  13. 1996 Activities report on energies and raw materials

    International Nuclear Information System (INIS)

    1996-01-01

    The 1996 activity survey of the French General Directory for Energy and Raw Materials, which main objectives are to preserve the competitiveness of French economy, enhance environmental protection, secure the long term supply safety and maintain the public service basis for energy supply, is presented. The main themes of the survey are: the nuclear safety in Eastern Europe, the electric power inland market, the evolution of the oil market in 1996, the situation of refining in France, restructuring the BRGM (Mining and Geological Research Bureau), followed by brief facts concerning the sustainable energy development, nuclear energy, electric power, electricity and gas common issues, gas, coal, petroleum products, raw materials and underground materials. A series of global diagrams concludes the survey

  14. Coal information 1995

    International Nuclear Information System (INIS)

    1996-01-01

    This volume is a comprehensive reference book on current world coal market trends and long-term prospects to 2010. It contains an in-depth analysis of the 1995 international coal market covering prices, demand, trade, supply and production capacity as well as over 450 pages of country specific statistics on OECD and key non-OECD coal producing and consuming countries. The book also includes a summary of environmental policies on climate change and on coal-related air quality issues as well as essential facts on coal-fired power stations in coal-importing regions, on coal ports world-wide and on emission standards for coal-fired boilers in OECD countries. Coal Information is one of a series of annual IEA statistical publications on major energy sources; other reports are Oil and Gas Information and Electricity Information. Coal Information 1995 is published in July 1996. (author)

  15. Coal yearbook 1993

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    This book is the first coal yearbook published by ATIC (France). In a first chapter, economical context of coal worldwide market is analyzed: comparative evaluations on coal exports and imports, coal industry, prices, production in USA, Australia, South Africa, China, former USSR, Poland, Colombia, Venezuela and Indonesia are given. The second chapter describes the french energy context: national coal production, imports, sectorial analysis, maritime transport. The third chapter describes briefly the technologies of clean coal and energy saving developed by Charbonnages de France: fossil-fuel power plants with combined cycles and cogeneration, fluidized beds for the recovery of coal residues, recycling of agricultural wastes (sugar cane wastes) in thermal power plant, coal desulfurization for air pollution abatement. In the last chapter, statistical data on coal, natural gas and crude oil are offered: world production, world imports, world exports, french imports, deliveries to France, coal balance, french consumption of primary energy, power generation by fuel type

  16. Determination of barium and strontium in Basub(x)Srsub(1-x)Nbsub(2)Osub(6) monocrystals and raw materials after their solvent ' extraction separation with 1-phenyl-3-methyl-4-benzoylpyrazolone-5

    International Nuclear Information System (INIS)

    Sizonenko, N.T.; Egorova, L.A.

    1981-01-01

    The extraction of milligram amounts of barium and strontium by 1-phenyl-3-methyl-4-benzoylpyrazolone-5 solutions in various diluents has been examined. The possibility has been shown of using the reagent for extraction separation of the elements for determining the stoichiometric composition of barium- and strontium-based compounds. Conditions have been studied for separation of barium and strontium at their different ratios by the chromate method in the presence of EDTA. A procedure has been worked out of determining barium and strontium in the estimation of stoichiometric composition of charge and single crystals of barium-strontium niobates of different composition

  17. ACR coal 1992

    Energy Technology Data Exchange (ETDEWEB)

    1992-01-01

    This publication is a comprehensive reference document on production, exports, prices and demand of coal in world markets. A forecast of demand by coal type and country up to the year 2000 is provided. Statistics of the Australian export industry are complemented by those of South Africa, USA, Canada, Indonesia, China, C.I.S. and Colombia. A very comprehensive coal quality specification for nearly all the coal brands exported from Australia, as well as leading non-Australian coal brands, is included.

  18. Assessing coal burnout

    Energy Technology Data Exchange (ETDEWEB)

    Lowe, A. [Pacific Power, Sydney, NSW (Australia)

    1999-11-01

    Recent research has allowed a quantitative description of the basic process of burnout for pulverized coals to be made. The Cooperative Research Centre for Black Coal Utilization has built on this work to develop a coal combustion model which will allow plant engineers and coal company representatives to assess their coals for combustion performance. The paper describes the model and its validation and outlines how it is run. 2 figs.

  19. Study of Coal Burst Source Locations in the Velenje Colliery

    Directory of Open Access Journals (Sweden)

    Goran Vižintin

    2016-06-01

    Full Text Available The Velenje coal mine (VCM is situated on the largest Slovenian coal deposit and in one of the thickest layers of coal known in the world. The thickness of the coal layer causes problems for the efficiency of extraction, since the majority of mining operations is within the coal layer. The selected longwall coal mining method with specific geometry, increasing depth of excavations, changes in stress state and naturally given geomechanical properties of rocks induce seismic events. Induced seismic events can be caused by caving processes, blasting or bursts of coal or the surrounding rock. For 2.5D visualization, data of excavations, ash content and calorific value of coal samples, hanging wall and footwall occurrence, subsidence of the surface and coal burst source locations were collected. Data and interpolation methods available in software package Surfer®12 were statistically analyzed and a Kriging (KRG interpolation method was chosen. As a result 2.5D visualizations of coal bursts source locations with geomechanical properties of coal samples taken at different depth in the coal seam in the VCM were made with data-visualization packages Surfer®12 and Voxler®3.

  20. Determination of extraction equilibria for several metals in the development of a process designed to recover aluminum and other metals from coal combustion ash

    Energy Technology Data Exchange (ETDEWEB)

    Seeley, F.G.; McDowell, W.J.; Felker, L.K.; Kelmers, A.D.; Egan, B.Z.

    1981-01-01

    Laboratory-scale tests of several methods for the recovery of resource materials from fly ash have led to the development of a sinter/dilute acid leach method (Calsinter process) in which fly ash is sintered with a source of calcium oxide (CaCO/sub 3/, CaSO/sub 4/, CaO, and/or limestone flue-gas desulfurization scrubber sludge) at 1000 to 1200/sup 0/C, followed by a two-stage leach of the sintered solids with dilute sulfuric acid. Recovery of aluminum from this leach solution in a relatively pure form requires that several contaminants, particularly iron, must be separated from the aluminum before it can be precipitated. Therefore, distribution coefficients for iron (III) and 16 other metal ions have been determined in the liquid-liquid extraction system: Primene JM-T - toluene versus aqueous ammonium sulfate (and sodium sulfate) as a function of sulfate, acid, metal ion, and amine sulfate concentration. A study of iron (III) loading equilibria as a function of time indicated that equilibrium was essentially achieved in 1 h; however, some changes, probably in the nature of the extracted species, occurred over a period of approximately 20 h. Iron (III) extraction results obtained under various sulfate concentration matrix conditions suggested the formation of an aqueous complex of ferric ammonium sulfate, which depressed iron distribution to the organic phase. Extraction isotherms for Ag, As, Cd, Cr, and Fe all exhibit linearity at low loading conditions with unit slopes, including the same degree of association of the metal ion species in both the organic and the aqueous phase. Other metal ions for which distribution coefficients are reported are: Ba, Mg, Mn, Na, K, P, Pb, Th, Ti, and U.

  1. European initiative on cdio in raw material programmes

    NARCIS (Netherlands)

    Edelbro, Catrin; Hulthén, Erik; Clausen, Elisabeth; Tanner, David; Herrera Herbert, Juan; Jonsson, Kristina; Bealieu, Stephan; Kamp, A.; Försth, Michael

    2017-01-01

    One of five Knowledge and Innovation Communities (KICs), was launched in Europe in 2014 and has its focus on exploration, extraction, mineral processing, metallurgy, recycling and material substitution of raw materials. To reach the vision, where the European Union’s industrial strength is based on

  2. Sahara Coal: the fine art of collecting fines for profit

    Energy Technology Data Exchange (ETDEWEB)

    Schreckengost, D.; Arnold, D.

    1984-09-01

    Because of a change in underground mining methods that caused a considerable increase in the amount of fine sizes in the raw coal, Sahara Coal Co. designed and constructed a unique and simple fine coal system at their Harrisburg, IL prep plant. Before the new system was built, the overload of the fine coal circuit created a cost crunch due to loss of salable coal to slurry ponds, slurry pond cleaning costs, and operating and maintenance costs--each and every one excessive. Motivated by these problems, Sahara designed a prototype system to dewater the minus 28 mesh refuse. The success of the idea permitted fine refuse to be loaded onto the coarse refuse belt. Sahara also realized a large reduction in pond cleaning costs. After a period of testing, an expanded version of the refuse system was installed to dewater and dry the 28 mesh X 0 clean coal. Clean coal output increased about 30 tph. Cost savings justified the expenditures for the refuse and clean coal systems. These benefits, combined with increased coal sales revenue, paid back the project costs in less than a year.

  3. Advanced physical fine coal cleaning spherical agglomeration. Final report

    Energy Technology Data Exchange (ETDEWEB)

    1990-09-01

    The project included process development, engineering, construction, and operation of a 1/3 tph proof-of-concept (POC) spherical agglomeration test module. The POC tests demonstrated that physical cleaning of ultrafine coal by agglomeration using heptane can achieve: (1) Pyritic sulfur reductions beyond that possible with conventional coal cleaning methods; (2) coal ash contents below those which can be obtained by conventional coal cleaning methods at comparable energy recoveries; (3) energy recoveries of 80 percent or greater measured against the raw coal energy content; (4) complete recovery of the heptane bridging liquid from the agglomerates; and (5) production of agglomerates with 3/8-inch size and less than 30 percent moisture. Test results met or exceeded all of the program objectives. Nominal 3/8-inch size agglomerates with less than 20 percent moisture were produced. The clean coal ash content varied between 1.5 to 5.5 percent by weight (dry basis) depending on feed coal type. Ash reductions of the run-of-mine (ROM) coal were 77 to 83 percent. ROM pyritic sulfur reductions varied from 86 to 90 percent for the three test coals, equating to total sulfur reductions of 47 to 72 percent.

  4. Experimental investigations on drying behaviour of Bulgarian brown coal in steam fluidized bed

    International Nuclear Information System (INIS)

    Buschsieweke, F.; Koenig, J.

    1999-01-01

    The main targets were: to investigate the parameters for optimizing the drying process as steam pressure, fluidization velocity and particle size; to identify the cost of drying and combustion processes considering the necessity of milling the coal (raw or dried). Test series with Bulgarian brown coal from Maritsa-East has been made. Two fractions with different particle size was got: A from 0 to 1.6 mm (0.5 mm average) and B, resp. 1.6 to 6.3 (1.7 mm). The particle size is depending on the coal moisture. The fluidized bed process with the both fractions was performed at variations of the following parameters: steam velocity (0.07 to 1.7 m/s); raw coal feed rate (4 to 16 kg/h); raw moisture (18 to 43 wt %) and pressure (1.3 and 5 bar). Also the shrinking behaviour of the coal in different pore sizes was tested. Comparing pore size of the oven dried coal to the fluidized bed dried coal, significantly higher inner surface for the oven dried coal was established. To indicate the pore size of raw coal samples were made by freeze drying. Ice expanding should cause higher inner surface compared to oven drying method but no significant difference was established. A significant increase of heat transfer of the particles from A fraction (300 to 350 W/m 2 K0 compared to B (200 to 230 W/m 2 K) was determined. The heat transfer coefficient increased at increasing of the raw coal feed rate, mostly significant for A, due to higher particle contact. In conclusion: the particle convective mechanism is predominant for the heat transfer; development of pressurized fluidized bed drying is not of interest and the question about the total expenditure for crushing and milling remains open

  5. A simple micro-batch ion-exchange resin extraction method coupled with reverse-phase HPLC (MBRE-HPLC) to quantify lactoferrin in raw and heat-treated bovine milk.

    Science.gov (United States)

    Pochet, Sylvie; Arnould, Céline; Debournoux, Perrine; Flament, Jocelyne; Rolet-Répécaud, Odile; Beuvier, Eric

    2018-09-01

    Lactoferrin is an iron-binding cationic glycoprotein (pI = 8.7) beneficial for mammal health, especially udder and milk preservation. A new simple two-step method of quantification was developed. Lactoferrin in 1 mL of bovine skim milk was first adsorbed onto 100 mg of macroporous sulfonated-resin at pH 6.8 by rotary stirring for 90 min at 20-25 °C. After washing the resin, lactoferrin was desorbed using 1 mL of 2 M NaCl containing phenylalanine as a dilution marker, then fully resolved and quantified by RP-HPLC at 220 nm using a wide-bore C4 silica column. This robust, inexpensive and flexible method improves selectivity (no protein interference) and sensitivity compared to previous HPLC methods. In-laboratory validation demonstrated its linearity (25 to 514 µg Lf mL -1 ), accuracy (110 to 98% recovery), and precision (<4%), which were comparable to immuno-based methods. The results for individual raw cow's milk were strongly correlated with results using an ELISA test. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Manufacturing of ashless coal by using solvent de-ashing technology

    Energy Technology Data Exchange (ETDEWEB)

    Sang-Do Kim; Kwang-Jae Woo; Soon-Kwan Jeong; Young-Jun Rhim; Si-Huyn Lee [Korea Institute of Energy Research, Daejeon (Republic of Korea). Clean Energy Research Center

    2007-07-01

    Maintenance of a high oil value has an influence to energy crisis and national security in South Korea which does not have energy resources. The coals which have characterized by the abundant reserves and the inexpensive price can be said to be the alternative energy source. Hyper-coal process, which has been developed in Japan since 1999, is a new effective process to produce a clean coal by using the solvent de-ashing technology. When coal is extracted with organic solvent, only the organic portion of coal is dissolved in the solvents. That is possible to apply the low rank coal. This study was performed to produce ashless coal by using the solvent de-ashing technology. The experiment was conducted in the batch(or semi-batch) type reactor with two solvents such as NMP(N-methyl-2-pyrrolidinone) and 1-MN(1-methylnaphthalene) and various coals such as Kideko coal, Roto South coal and Sunhwa coal at 200-400{sup o}C. As a result of the test, extraction yield of coals was more than 60% on daf. Ash concentration which contains the extracted coal was 0.11-1.0wt%. The heat value was increased from 5,400 kcal/kg to 7,920 kcal/kg in the Roto South coal. 10 refs., 4 figs., 2 tabs.

  7. FY 1981 Report on the results of Sunshine Project. Research and development of techniques for liquefaction of coal (Development of extraction type liquefaction plant using brown coal-based solvent and researches on milling at high temperature in oil); 1981 nendo sekitan ekika gijutsu no kenkyu kaihatsu, kattankei yozai chushutsu ekika plant no kaihatsu seika hokokusho. Koon yuchu funsai no kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1982-03-01

    This program is aimed at establishment of the techniques for milling of brown coal treated by primary dehydration and slurry adjustment, and secondary hydration plant, as part of the project for developing the techniques for liquefaction of brown coal. Brown coal (Australian Yallourn coal) treated by primary dehydration, solvents (creosote and decrystallized anthracene), and catalysts are used as the stock samples, to investigate the coal characteristics with respect to milling crushability, dehydration and liquefaction reactivity, and the slurries are prepared by changing coal charge rate, solvent and preparation temperature, to collect the data regarding, e.g., coal concentration, coal particle size, moisture level and liquefaction reactivity. It is found that milling crushability tends to decrease as coal charge rate or solvent/coal ratio increases whether creosote or decrystallized anthracene is used as the solvent. Milling crushability is unaffected by slurry preparation temperature. Content of residual moisture in the slurry decreases to 1% or less, when slurry preparation temperature is increased to 100 degrees C or higher. Liquefaction reactivity of the slurry shows slight dependence on slurry preparation temperature, when it is increased to 180 degrees C. (NEDO)

  8. Role of non-ferrous coal minerals and by-product metallic wastes in coal liquefaction. Technical progress report, December 1, 1980-February 28, 1981

    Energy Technology Data Exchange (ETDEWEB)

    Garg, D.; Givens, E.N.; Schweighardt, F.K.; Curtis, C.W.; Guin, J.A.; Huang, W.J.; Shridharani, K.

    1981-04-01

    Results from screening studies showed that the pyrite samples separated from various coal seams had similar catalytic activity. The addition of all the pyrite samples to feed slurry increased conversion of coal and production of oil. A sample of fusinite was also tested for its liquefaction behavior with and without added pyrite. The addition of pyrite increased the conversion of fusinite and production of oil. These results show that pyrite catalyzes the conversion of fusinite and therefore improves overall coal conversion. Conversion of coal and oil production increased by impregnating coal with iron and molybdenum compounds. Coal conversion and oil production also increased with increasing concentration of both iron and molybdenum impregnated on coal. Addition of various transition metal sulfides increased coal conversion and oil production. Dramatic improvements were noted with nickel, vanadium, and tin sulfides. Addition of transition metal naphthenates produced mixed results; some of them improved coal conversion and others had no effect. The effect of metal concentration on coal conversion was also not clear. Deep cleaning of coal did not affect coal conversion, but it significantly reduced oil production. Addition of pyrite separated from coal to deep cleaned coal sample regained the oil production to the original value, i.e., oil produced from liquefaction of raw coal.Coal cleaned by oil agglomeration gave highest coal conversion and oil production. Basic and non-basic nitrogen compounds reduced the naphthalene hydrogenation activity of both Co-Mo-Al and sulfided Fe/sub 2/O/sub 3/. Sulfided Fe/sub 2/O/sub 3/ was inactive for denitrogenation of quinoline, and the reaction product mainly consisted of hydrogenated and hydrocracked quinoline. On the contrary, Co-Mo-Al was active for denitrogenation of quinoline, resulting in lower quinoline poisoning.

  9. FY 2000 Feasibility study on the environmentally-friendly coal utilization systems as part of the international project for coal utilization measures. Feasibility study on supporting introduction of the environmentally-friendly coal utilization systems in Vietnam (Model project for introduction of advanced coal preparation systems); 2000 nendo kokusai sekitan riyo taisaku jigyo chosa hokokusho. Kankyo chowagata sekitan riyo system kanosei chosa jigyo Vietnam ni okeru kankyo chowagata sekitan riyo system donyu shien jigyo (kodo sentan system donyu model jigyo kanosei chosa jigyo)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-06-01

    The feasibility study was conducted on a model project in Vietnam, aimed at solving the environmental pollution problems resulting from use of coal by demonstrating and disseminating the Japan's environmental technologies in the Southeast Asian countries. The feasibility study was conducted for the Cua Ong Coal Preparation Enterprise, which has the largest coal preparation capacity in Vietnam and port facilities. It is treating raw coal from 10 coal mines for classification and preparation, and shipping coal of various types that meet the standards for domestic use and export. The survey results point out that unrecovered coal remains in waste water discharged from the coal preparation plants to pollute the sea area, and that quantity of the refuse increases because of the unrecovered coal it contains. The environmental technologies needed to introduce include modification to variable wave pattern type jigging separator, refuse height measuring instrument and automatic controller, circulating heavy medium gravimeter, highly functional settling pond, and flocculent facilities. (NEDO)

  10. Report on the achievements in the Sunshine Project in fiscal 1993 on development of a jet flow bed gasification electric power plant. Investigative research on a technology to treat coals used for coal gasification (investigation for coal type selection); 1993 nendo funryusho gas ka hatsuden plant kaihatsu seika hokokusho. Sekitan gas kayotan no shori gijutsu ni kansuru chosa kenkyu (tanshu sentei chosa)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1984-03-01

    This paper describes the achievements in the Sunshine Project in fiscal 1993 in the investigation for coal type selection. The investigation is purposed to elucidate the status of existence and resources of coals as the raw material for coal gasification and liquefaction, the coal quality features, and the gasification and liquefaction characteristics. The results will be used as the fundamental materials for technological development. Discussions will also be given on the coal applicability to the composite gasification power generation system in which liquefied residue generated in the process are mixed with the supplied coal. Coal quality analysis and a liquefaction test under the standard condition were completed on 389 test samples composed of 136 kinds of coals produced in Canada, Australia, the U.S.A., China and Indonesia. Coal types were enumerated according to the oil yield. A gasification test was performed on the specific gravity separated coals of Chinese coals to discuss the effect of change in the ash amount on the gasification characteristics. A partial coal combustion test revealed that fuel ratio, oxygen partial pressure, and oxygen molar fraction parameters affect the combustion characteristics. The micro-gravity field is effective in discussing the combustion characteristics of particulate groups of dust coal. A coal oxidizing test was performed, wherein oxidizing characteristics and spontaneous ignition performance were estimated successfully from temperature rise of heat stored in coal. The coal type matrix data were prepared. (NEDO)

  11. Innovation Developments of Coal Chemistry Science in L.M. Litvinenko Institute of Physical-Organic Chemistry and Coal Chemistry of NAS of Ukraine

    Directory of Open Access Journals (Sweden)

    Shendrik, T.G.

    2015-11-01

    Full Text Available The article presents short historical review and innovation developments of Coal Chemistry Department of L.M. Litvinenko Institute, NAS of Ukraine connected with coal mine exploitation problems, search for decisions toward prevention of spontaneous combustion, dust control in mines, establishing structural chemical features of coal with different genesis and stages of metamorphism with the aim to develop new methods of their modification and rational use. The methods of obtaining inexpensive sorbents from Ukrainian raw materials (including carbon containing waste are proposed. The problems of modern coal chemistry science in IPOCC of NAS of Ukraine are outlined.

  12. Combustion and environmental performance of clean coal end products

    Energy Technology Data Exchange (ETDEWEB)

    Skodras, G.; Sakellaropoulos, G. [Centre for Research and Technology, Hellas, Ptolemaidas-Kozanis, Ptolemaida (Greece). Inst. for Solid Fuel Technolgy and Applications]|[Aristotle Univ. of Thessaloniki, Thessaloniki (Greece). Dept. of Chemical Engineering, Chemical Process Engineering Lab]|[Chemical Process Engineering Research Inst., Thessaloniki (Greece). Lab. of Solid Fuels and Environment; Someus, E. [Thermal Desorption Technology Group (Greece); Grammelis, P.; Amarantos, P.S. [Centre for Research and Technology, Hellas, Ptolemaidas-Kozanis, Ptolemaida (Greece). Inst. for Solid Fuel Technolgy and Applications; Palladas, A.; Basinas, P.; Natas, P.; Prokopidou, M.; Diamantopoulou, I.; Sakellaropoulos, G. [Aristotle Univ. of Thessaloniki, Thessaloniki (Greece). Dept. of Chemical Engineering, Chemical Process Engineering Lab

    2006-07-01

    Clean and affordable power production is needed in order to achieve sustainable economic development. This paper focused on clean coal technologies in which coal-fired power plants are used in conjunction with large amounts of renewable energy sources to offer a high level of process safety and long term management of all residual operation streams. Thermal Desorption Recycle-Reduce-Reuse Technology (TDT-3R) was described as being a promising solid fuel pretreatment process for clean energy production up to 300 MWe capacities. TDT-3R is based on low temperature carbonisation fuel pre-treatment principles, which produce cleansed anthracite type fuels from coal and other carbonaceous material such as biomass and organic wastes. The combustion efficiency of such clean coals and the environmental performance of the TDT-3R process were investigated in this study via pilot scale tests of clean fuel production. Tests included flue gas emissions monitoring, raw fuel and product characterisation and thermogravimetric tests, polychlorinated dibenzo-p-dioxins and dibenzo-furans, and heavy metals analyses, and toxicity tests. Raw material included coal and biomass, such as willow, straw and demolition wood. The fuels were heated in a rotary kiln operating at 550 degrees C under slightly vacuum conditions. Clean coals were tested either alone or in conjunction with biomass fuels in a pilot scale combustion facility at Dresden, Germany. The clean coal samples were shown to have higher fixed carbon and ash content and lower volatiles compared to the respective raw coal samples. The major advantage of the TDT-3R process is the production of fuels with much lower pollutants content. Low nitrogen, sulphur, chlorine and heavy metal contents result in produced fuels that have excellent environmental performance, allow boiler operation in higher temperatures and overall better efficiency. Moreover, the use of clean fuels reduces deposition problems in the combustion chamber due to the

  13. Energy audit: a case study of a coal mining area

    Energy Technology Data Exchange (ETDEWEB)

    Chattoraj, P.; Sinha, S.K.; Pradhan, G.K. [PCRA-ER, Kolkata (India)

    2009-07-01

    Coal continues to be the prime source of energy in India. In the process of exploration, mine development, extraction, beneficiation, handling, and so on, an enormous amount of energy is used in the form of both electrical and thermal energy. The coal industry in India also accounts for employing the largest workforce in its operations. The energy consumed by the employees in the coal sector alone will run into a few hundred megawatts. 7 refs., 7 tabs.

  14. Influence of the hydrothermal dewatering on the combustion characteristics of Chinese low-rank coals

    International Nuclear Information System (INIS)

    Ge, Lichao; Zhang, Yanwei; Xu, Chang; Wang, Zhihua; Zhou, Junhu; Cen, Kefa

    2015-01-01

    This study investigates the influence of hydrothermal dewatering performed at different temperatures on the combustion characteristics of Chinese low-rank coals with different coalification maturities. It was found that the upgrading process significantly decreased the inherent moisture and oxygen content, increased the calorific value and fixed carbon content, and promoted the damage of the hydrophilic oxygen functional groups. The results of oxygen/carbon atomic ratio indicated that the upgrading process converted the low-rank coals near to high-rank coals which can also be gained using the Fourier transform infrared spectroscopy. The thermogravimetric analysis showed that the combustion processes of upgraded coals were delayed toward the high temperature region, and the upgraded coals had higher ignition and burnout temperature. On the other hand, based on the higher average combustion rate and comprehensive combustion parameter, the upgraded coals performed better compared with raw brown coals and the Da Tong bituminous coal. In ignition segment, the activation energy increased after treatment but decreased in the combustion stage. The changes in coal compositions, microstructure, rank, and combustion characteristics were more notable as the temperature in hydrothermal dewatering increased from 250 to 300 °C or coals of lower ranks were used. - Highlights: • Typical Chinese lignites with various ranks are upgraded by hydrothermal dewatering. • Upgraded coals exhibit chemical compositions comparable with that of bituminous coal. • FTIR show the change of microstructure and improvement in coal rank after upgrading. • Upgraded coals exhibit difficulty in ignition but combust easily. • More evident effects are obtained for raw brown coal with relative lower rank.

  15. Dry processing versus dense medium processing for preparing thermal coal

    CSIR Research Space (South Africa)

    De Korte, GJ

    2013-10-01

    Full Text Available of the final product. The separation efficiency of dry processes is, however, not nearly as good as that of dense medium and, as a result, it is difficult to effectively beneficiate coals with a high near-dense content. The product yield obtained from some raw...

  16. FY 1981 report on the Coal Kind Survey Committee; 1981 nendo tanshu chosa iinkai hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1982-03-01

    For the purpose of establishing coal liquefaction/gasification technology, investigational survey on the usable coal resource in Japan was made to collect/file the data on the state of coal existence, coal kind, etc. by the Coal Kind Survey Committee and the section. In the 1st committee meeting, an idea of the coal kind survey was discussed, and in the 2nd committee meeting, a summary of activities in this fiscal year was reported. In the section meeting, the following were carried out: discussion of a course of the coal kind survey in the 1st meeting; discussion about how to proceed with the coal kind survey/items of data filing in the 2nd meeting; examinational study of items of data filing in the 3rd meeting; summary of activities in this fiscal year in the 4th meeting. As examples of the coal kind survey, the following were cited: special study report on coal resource and gasification/liquefaction characteristics by Science and Technology Agency; results of the survey by Joint Coal Board and Queensland Coal Board in Australia; Report of 1978 by The Fuel Society of Japan; Report of 1976 by Pennsylvania State University; data on process raw coal by The Iron and Steel Institute of Japan, etc. (NEDO)

  17. Coal information 1996

    International Nuclear Information System (INIS)

    1997-01-01

    Coal Information (1997 edition) is the latest edition of a publication that has been produced annually by the IEA since 1983. The report is intended to provide both Member countries of the OECD and those employed in all sectors of the coal industry with information on current world coal market trends and long-term prospects. It includes information on coal prices, demand, trade, supply, production capacity, transport, environmental issues (including emission standards for coal-fired boilers), coal ports, coal-fired power stations and coal used in non -OECD countries. Part I of the publication contains a wide ranging review of world coal market developments in 1996 and current prospects to 2010. The review is based on historical data of OECD energy supply and demand, data on other world regions, projections of OECD coal supply, demand and trade and information provided by the CIAB. Part II provides, in tabular and graphical form, a more detailed and comprehensive statistical picture of coal developments and future prospects for coal in the OECD, by region and for individual Member countries. Readers interested in projections are strongly advised to read the notes for individual countries in Principles and Definitions in Part II. Coal statistics for non-OECD countries are presented in Part III of the book. Summary data are available on hard coal supply and end-use statistics for about 40 countries and regions world-wide. Data are based on official national submissions to the United Nations in Geneva and New York, national energy publications, information provided to the IEA Secretariat by national statistical offices as well as other unofficial Secretariat sources. Further information on coal used in non-OECD countries is published annually by the IEA in Energy Statistics and Balances of Non-OECD Countries. Also included in Part III are the Survey of Coal Ports world-wide and the Survey of Coal-fired Power Stations in coal-importing countries

  18. Fungal degradation of coal as a pretreatment for methane production

    Science.gov (United States)

    Haider, Rizwan; Ghauri, Muhammad A.; SanFilipo, John R.; Jones, Elizabeth J.; Orem, William H.; Tatu, Calin A.; Akhtar, Kalsoom; Akhtar, Nasrin

    2013-01-01

    Coal conversion technologies can help in taking advantage of huge low rank coal reserves by converting those into alternative fuels like methane. In this regard, fungal degradation of coal can serve as a pretreatment step in order to make coal a suitable substrate for biological beneficiation. A fungal isolate MW1, identified as Penicillium chrysogenum on the basis of fungal ITS sequences, was isolated from a core sample of coal, taken from a well drilled by the US. Geological Survey in Montana, USA. The low rank coal samples, from major coal fields of Pakistan, were treated with MW1 for 7 days in the presence of 0.1% ammonium sulfate as nitrogen source and 0.1% glucose as a supplemental carbon source. Liquid extracts were analyzed through Excitation–Emission Matrix Spectroscopy (EEMS) to obtain qualitative estimates of solubilized coal; these analyses indicated the release of complex organic functionalities. In addition, GC–MS analysis of these extracts confirmed the presence of single ring aromatics, polyaromatic hydrocarbons (PAHs), aromatic nitrogen compounds and aliphatics. Subsequently, the released organics were subjected to a bioassay for the generation of methane which conferred the potential application of fungal degradation as pretreatment. Additionally, fungal-mediated degradation was also prospected for extracting some other chemical entities like humic acids from brown coals with high huminite content especially from Thar, the largest lignite reserve of Pakistan.

  19. Chromatographic methods and techniques used in studies of coals, their progenitors and coal-derived materials

    Energy Technology Data Exchange (ETDEWEB)

    Zubkova, Valentina [Jan Kochanowski University of Humanities and Sciences, Institute of Chemistry, Kielce (Poland)

    2011-03-15

    The use of chromatography in studies of coals, their progenitors and coal-related products was reviewed. The specificity of the coal structure was discussed. The use of extraction in preparing study samples was discussed paying special attention to the occurrence of undesirable phenomena such as aggregation of coal derivate molecules, resulting from the formation of their dimers and trimers, and degradation of polar solvents at temperatures above 350 C. The following ways of fractionating samples of coal materials were considered: thermal, solvent, column with the use of preparative size exclusive chromatography and preparative thin layer chromatography as well as membrane separation. The use of chromatography coupled with experimental techniques such as mass spectrometry, infrared spectroscopy, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and pyrolysis was analysed. (orig.)

  20. Investigation on the activation of coal gangue by a new compound method.

    Science.gov (United States)

    Li, Chao; Wan, Jianhua; Sun, Henghu; Li, Longtu

    2010-07-15

    In order to comprehensively utilize coal gangue as the main raw material in cementitious materials, improving its cementitious activity is a question of fundamental importance. In this paper, we present a new compound mechanical-hydro-thermal activation (CMHTA) technology to investigate the activation effect of coal gangue, and the traditional mechanical-thermal activation (TMTA) technology was used as reference. The purpose of this study is to give a detailed comparison between these two methods with regard to the mineral composition, crystal structure and microstructure, by XRD, IR, MAS NMR, XPS and mechanical property analysis. The prepared coal gangue based blended cement, containing 52% of activated coal gangue C (by CMHTA technology), has a better mechanical property than activated coal gangue T (by TMTA technology) and raw coal gangue. The results show that both of the TMTA and CMHTA technologies can improve the cementitious activity of raw gangue greatly. Moreover, compared with TMTA, the mineral phases such as feldspar and muscovite in raw coal gangue were partially decomposed, and the crystallinity of quartz decreased, due to the effect of adding CaO and hydro-thermal process of CMHTA technology. 2010 Elsevier B.V. All rights reserved.

  1. Effect of hydrothermal dewatering on the slurryability of brown coals

    International Nuclear Information System (INIS)

    Yu Yujie; Liu Jianzhong; Wang Ruikun; Zhou Junhu; Cen Kefa

    2012-01-01

    Highlights: ► Brown coals are upgraded by hydrothermal dewatering. ► The moisture content and oxygen functional groups decrease during the process. ► The point of zero charge and the contact angle rise as the temperature increases. ► The products were highly hydrophobic. ► The improvement on slurryability of solid products were examined. - Abstract: Two brown coals from China were dewatered under hydrothermal dewatering (HTD) conditions at 250–320 °C for 1 h in a 2 L autoclave. The hydrothermally dewatered products were used to prepare coal water slurry (CWS) with a lower viscosity than brown raw coal slurry. Moreover, the coal rank and heat value of the brown coal increased as the inherent moisture and oxygen content decreased during the HTD process. The maximum solid concentration of CWS prepared from XiMeng coal increased from 45.7% to 59.3%, whereas that of CWS prepared from BaoTou coal increased from 53.7% to 62.1%, after being dewatered at 320 °C. The improvement in the slurryability of brown coal significantly depended on the final temperature of the HTD process, the mechanism of which can be explained by the chemical analysis of oxygen functional groups, zeta potential, and the contact angle of the surface between coal and water. The oxygen functional groups, the oxygen/carbon ratio and hydrogen/carbon ratio in brown coal decreased, indicating that the coal rank was upgraded during the HTD process. As a result, both the point of zero charge and the contact angle increased, implying that the HTD products were highly hydrophobic.

  2. Aromatic chemical feedstocks from coal

    Energy Technology Data Exchange (ETDEWEB)

    Collin, G

    1982-06-01

    Liquid byproducts of coal carbonization meet some 25% of the world demand for aromatic chemicals, currently at approx. 30 million t/a, in particular 15% of the demand for benzene and over 95% of the demand for condensed aromatics and heteroaromatics. Industrial processing of the aromatic byproducts of coal pressure gasification is carried out to only a minor extent. Other methods that may be employed in future to obtain carbochemical aromatic compounds are solvolysis and supercritical gas extraction, the catalytic liquid-phase hydrogenation and hydropyrolysis of coal, which also permit recovery of benzene and homologues, phenols, and condensed and partially hydrogenated aromatics, and the synthesis of aromatics using methanol as the key compound. As with the present means of obtaining aromatic chemicals from coal, the processes that may in the future be applied on an industrial scale to obtain pure aromatics will only be economically feasible if linked with the manufacture of other mass products and combined with the present production of carbochemical aromatics.

  3. 50 years of brown coal open cast ''Konin''

    International Nuclear Information System (INIS)

    Wlodarczyk, B.

    1995-01-01

    The history as well as present condition of brown coal mine ''Konin'' located in Central Poland are presented. In 1994 about 13380 million tons of coal were extracted from this open cast and 95% of it was burnt in power plants. The prognosis of future production up to 2020 is given and the program of mine restructurization is described. 3 ills

  4. Trends in Japanese coal trade

    Energy Technology Data Exchange (ETDEWEB)

    Nakajima, S

    1986-01-01

    The author discusses 1) the latest forecast for coal demand in Japan; 2) trends in Japanese steam coal demand, with breakdown by industry; 3) the organization of steam coal supply, with details of the distribution network and of the new coal cartridge system; 4) the demand for metallurgical coal. Other topics outlined include the current status of Japanese coal production, Japanese coal trade, and the development of overseas coal resources. 1 figure, 5 tables.

  5. An overview of coal preparation initiatives with application to coal conversion in South Africa

    International Nuclear Information System (INIS)

    Reinecke, C.F.; Bunt, J.R.

    1999-01-01

    Coal has for many years been the most important energy resource in South Africa and has contributed to more than 70 % of South Africa's energy needs in 1998. The large in-situ coal deposits (in excess of 120 x 10 9 t) and relatively large recoverable reserves (about 33.5 x 10 9 t) will ensure that coal will for many a year still be South Africa's single biggest energy resource. Biomass burning consumes approximately 11 Mt/a of which 8 Mt/a is natural wood. This equals natural wood production. The use of firewood is considered to be unsustainable. Of the 225 Mt/a of coal extracted in South Africa in 1998, 67.0 Mt/a was exported. Of this, 62.9 Mt/a were exported as steam coal, 2.1 Mt/a as metallurgical coal, and the rest as anthracite. Current exports are conducted via the Richards Bay terminal (63.6 Mt/a), Durban (2.0 Mt/a) and a small amount via Maputo. The Richards Bay terminal is to be expanded to 72 Mt/a by 1999. It is also very important to note that most of the coal resources possess calorific values of below 25 MJ/kg, which limits its utilization to power generation (Eskom) and processes such as fixed bed dry bottom gasification (Sasol). A break-down of production and usage of coal by the various controlling groups in South Africa shows that Sasol (54.2 Mt/a) and Escom (91.0 Mt/a) are major consumers of coal. It has been proposed earlier by Horsfall (1993) that for power generation and coal conversion, the in-situ quality is generally regarded as satisfactory for use. All that is required in the way of processing is crushing to an appropriate top size and, for conversion, screening of the unwashed coal. Most other consumers require some degree of beneficiation, which generally entails the removal of stone/shale and low quality coal. More recently, the introduction of destoning plants at Duvha Colliery (Larcodems) and New Vaal Colliery (Drewboy washers) has significantly reduced the abrasiveness content of these local thermal coals, together with an increase

  6. Low temperature oxidation and spontaneous combustion characteristics of upgraded low rank coal

    Energy Technology Data Exchange (ETDEWEB)

    Choi, H.K.; Kim, S.D.; Yoo, J.H.; Chun, D.H.; Rhim, Y.J.; Lee, S.H. [Korea Institute of Energy Research, Daejeon (Korea, Republic of)

    2013-07-01

    The low temperature oxidation and spontaneous combustion characteristics of dried coal produced from low rank coal using the upgraded brown coal (UBC) process were investigated. To this end, proximate properties, crossing-point temperature (CPT), and isothermal oxidation characteristics of the coal were analyzed. The isothermal oxidation characteristics were estimated by considering the formation rates of CO and CO{sub 2} at low temperatures. The upgraded low rank coal had higher heating values than the raw coal. It also had less susceptibility to low temperature oxidation and spontaneous combustion. This seemed to result from the coating of the asphalt on the surface of the coal, which suppressed the active functional groups from reacting with oxygen in the air. The increasing upgrading pressure negatively affected the low temperature oxidation and spontaneous combustion.

  7. Distribution of Clay Minerals in Light Coal Fractions and the Thermal Reaction Products of These Clay Minerals during Combustion in a Drop Tube Furnace

    Directory of Open Access Journals (Sweden)

    Sida Tian

    2016-06-01

    Full Text Available To estimate the contribution of clay minerals in light coal fractions to ash deposition in furnaces, we investigated their distribution and thermal reaction products. The light fractions of two Chinese coals were prepared using a 1.5 g·cm−3 ZnCl2 solution as a density separation medium and were burned in a drop-tube furnace (DTF. The mineral matter in each of the light coal fractions was compared to that of the relevant raw coal. The DTF ash from light coal fractions was analysed using hydrochloric acid separation. The acid-soluble aluminium fractions of DTF ash samples were used to determine changes in the amorphous aluminosilicate products with increasing combustion temperature. The results show that the clay mineral contents in the mineral matter of both light coal fractions were higher than those in the respective raw coals. For the coal with a high ash melting point, clay minerals in the light coal fraction thermally transformed more dehydroxylation products compared with those in the raw coal, possibly contributing to solid-state reactions of ash particles. For the coal with a low ash melting point, clay minerals in the light coal fraction produced more easily-slagging material compared with those in the raw coal, playing an important role in the occurrence of slagging. Additionally, ferrous oxide often produces low-melting substances in coal ash. Due to the similarities of zinc oxide and ferrous oxide in silicate reactions, we also investigated the interactions of clay minerals in light coal fractions with zinc oxide introduced by a zinc chloride solution. The extraneous zinc oxide could react, to a small extent, with clay minerals in the coal during DTF combustion.

  8. Resinous constituent extracting process

    Energy Technology Data Exchange (ETDEWEB)

    Sayer, W F

    1947-10-07

    The method of recovering oily constituents from coal or oil shale comprising the saturation of coal or oil shale in a sealed vessel with an organic solution having a boiling point at atmospheric pressure of not exceeding 220/sup 0/C, elevating the temperature within the vessel to a temperature below the cracking temperature of the constituents and maintaining the pressure within the vessel below 51 pounds, to extract the oily material from the coal or oil shale and subsequently separating the solvent from the oily material.

  9. Topical papers on raw materials

    International Nuclear Information System (INIS)

    1978-01-01

    In the papers of this working group, the availability of uranium and the long-term supply situation for this raw material are discussed. A problem closely connected with uranium supply are the commercial contracts and their particularities. The points of view of the reporting countries of Great Britain, South Africa, Switzerland, Australia, Japan, and Korea are made clear

  10. Application of Acidithiobacillus Ferrooxidans in coal flotation

    Energy Technology Data Exchange (ETDEWEB)

    Amini, E.; Hosseini, T.R.; Oliazadeh, M.; Kolahdoozan, M. [University of Queensland, Brisbane, Qld. (Australia)

    2009-07-01

    Bioflotation is a potential method for removing pyritic sulphur from coal. Sodium cyanide is a well-known depressant for pyrite in flotation of sulphide minerals; however, for coal this reagent is unacceptable from the environmental point of view. This study investigates an alternate to sodium cyanide, Acidithiobacillus Ferrooxidans, a nonharmful bacterial reagent as a pyrite depressant. The flotation behavior of pyrite and other gangue particles using the sodium cyanide and the Ferrooxidans is compared by applying the general first-order flotation model. The kinetic parameters extracted from the model demonstrated that the modified flotation rate of pyrite was reduced, and the selectivity between coal and gangue was improved using the bacteria. These results indicate that Acidithiobacillus Ferrooxidans has potential in removing pyritic sulfur from coal.

  11. Nitrogen in Chinese coals

    Science.gov (United States)

    Wu, D.; Lei, J.; Zheng, B.; Tang, X.; Wang, M.; Hu, Jiawen; Li, S.; Wang, B.; Finkelman, R.B.

    2011-01-01

    Three hundred and six coal samples were taken from main coal mines of twenty-six provinces, autonomous regions, and municipalities in China, according to the resource distribution and coal-forming periods as well as the coal ranks and coal yields. Nitrogen was determined by using the Kjeldahl method at U. S. Geological Survey (USGS), which exhibit a normal frequency distribution. The nitrogen contents of over 90% Chinese coal vary from 0.52% to 1.41% and the average nitrogen content is recommended to be 0.98%. Nitrogen in coal exists primarily in organic form. There is a slight positive relationship between nitrogen content and coal ranking. ?? 2011 Science Press, Institute of Geochemistry, CAS and Springer Berlin Heidelberg.

  12. Coal marketing manual 1986

    Energy Technology Data Exchange (ETDEWEB)

    1986-01-01

    This manual presents information for the use of marketers, consumers, analysts and investors. The information is presented in a series of tables and figures. Statistics are given for: Australian export tonnages and average export values for 1978-1985; international pig iron production 1976 to 1985; and international crude steel production 1979 to 1985. Trends in Australian export tonnages and prices of coal are reviewed. Details of international loading and discharge ports are given, together with a historical summary of shipping freight-rates since 1982. Long term contract prices for thermal and coking coal to Japan are tabulated. A review of coal and standards is given, together with Australian standards for coal and coke. A section on coal quality is included containing information on consumer coal quality preferences and Australian and Overseas coal brands and qualities. Finally an index is given of contact details of Australian and Overseas exporting companies, government departments, and the Australian Coal Association.

  13. Coal worker's pneumoconiosis

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000130.htm Coal worker's pneumoconiosis To use the sharing features on this page, please enable JavaScript. Coal worker's pneumoconiosis (CWP) is a lung disease that ...

  14. Uranium in phosphorus-bearing raw materials and technological problems of its recovery

    Energy Technology Data Exchange (ETDEWEB)

    Gorecki, H; Gorecka, H [Politechnika Wroclawska (Poland)

    1981-01-01

    A problem of uranium recovery from phosphorus-bearinq raw materials is discussed. The different methods of uranium recovery from extractive phosphoric acid are briefly described. The information on their applications in the industry is also given.

  15. Biotransformation of Spanish coals by microorganisms; Biotransformacion de Carbones Espanoles por Microorganismos

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-07-01

    some newly isolated microorganisms could solubilized different kinds of Spanish coals (hard coal, subbituminous coal and lignite). Certain fungi and bacteria could solubilized lignite when growing in a mineral medium. However, to solubilized higher rank coals (hard coal and subbituminous coal) microorganisms require a complete medium. Microorganisms, which showed higher capacity to solubilized coal, were incubated in the presence of coal (hard coal, subbituminous coal and lignite) at the optimal conditions to get coal liquefaction/solubilization. The resultant products were analysed by IR and UV/visible spectrometry. No major differences among the original coal, solubilized/liquefied coal and residual coal were detected. However, an increase in metallic carboxylate and a decrease in OH'- carboxylic groups were observed in the liquefied lignite. Humic acids derived from original lignite residual lignite and liquefied/solubilized lignite by microorganisms were analysed. Several differences were observed in the humic acids extracted from the liquefied lignite, such as an increase in the total acidity and in the proportion of the phenolic groups. Differences on the humic acid molecular weight were observed too. Several fungal and bacterial strains were able to grow using humic acids as sole carbon source. Microorganisms growing in humic acid were observed by Scanning Electron Microscopy. Besides, the coal solubilization capacity of several fungal strains (M2, m$ and AGI) growing in different culture media was assayed. In order to get some insight into the mechanisms of the liquefaction/solubilization of Spanish coals (hard coal, subbituminous coal and lignite) by these microorganisms, some features in the culture supernatants were studied: pH values; extracellular specific proteins; enzyme activities possibly related with coal solubilization and the presence of oxalate. M2 and M4 fungal strains grown in the presence of coal produced some specific extracellular proteins

  16. Biotransformation of Spanish coals by microorganisms; Biotransformacion de Carbones Espanoles por Microorganismos

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-07-01

    some newly isolated microorganisms could solubilized different kinds of Spanish coals (hard coal, subbituminous coal and lignite). Certain fungi and bacteria could solubilized lignite when growing in a mineral medium. However, to solubilized higher rank coals (hard coal and subbituminous coal) microorganisms require a complete medium. Microorganisms, which showed higher capacity to solubilized coal, were incubated in the presence of coal (hard coal, subbituminous coal and lignite) at the optimal conditions to get coal liquefaction/solubilization. The resultant products were analysed by IR and UV/visible spectrometry. No major differences among the original coal, solubilized/liquefied coal and residual coal were detected. However, an increase in metallic carboxylate and a decrease in OH'- carboxylic groups were observed in the liquefied lignite. Humic acids derived from original lignite residual lignite and liquefied/solubilized lignite by microorganisms were analysed. Several differences were observed in the humic acids extracted from the liquefied lignite, such as an increase in the total acidity and in the proportion of the phenolic groups. Differences on the humic acid molecular weight were observed too. Several fungal and bacterial strains were able to grow using humic acids as sole carbon source. Microorganisms growing in humic acid were observed by Scanning Electron Microscopy. Besides, the coal solubilization capacity of several fungal strains (M2, m$ and AGI) growing in different culture media was assayed. In order to get some insight into the mechanisms of the liquefaction/solubilization of Spanish coals (hard coal, subbituminous coal and lignite) by these microorganisms, some features in the culture supernatants were studied: pH values; extracellular specific proteins; enzyme activities possibly related with coal solubilization and the presence of oxalate. M2 and M4 fungal strains grown in the presence of coal produced some specific extracellular

  17. Differential behaviour of combustion and gasification fly ash from Puertollano Power Plants (Spain) for the synthesis of zeolites and silica extraction

    International Nuclear Information System (INIS)

    Font, O.; Moreno, N.; Diez, S.; Querol, X.; Lopez-Soler, A.; Coca, P.; Garcia Pena, F.

    2009-01-01

    Coal gasification (IGCC) and pulverised coal combustion (PCC) fly ashes (FAs), obtained from two power plants fed with the carboniferous bituminous coal from Puertollano (Spain), were characterised and used as raw materials for zeolite synthesis by direct conversion (DC) and by alkaline fusion (Fu), and SiO 2 extraction (Si-Ex) at laboratory scale. The Puertollano FAs are characterised by a high SiO 2 content (59%) with respect to EU coal FAs. High zeolite synthesis yields were obtained from both FAs by using conventional alkaline activation. However, the Si extraction yields were very different. The results of the zeolite synthesis from the Si-bearing extracts from both FAs demonstrated that high purity zeolites with high cation exchange capacity (CEC, between 4.3 and 5.3 meq/g) can be produced. The solid residue arising from Si-Ex is also a relatively high NaP1 zeolite product (CEC 2.4-2.7 meq/g) equivalent to the DC products. The zeolitic materials synthesised from both FAs by Fu showed an intermediate (between the high purity zeolites and the DC products) zeolite content with CEC values from 3.4 to 3.7 meq/g. Low leachable metal contents were obtained from high purity A and X zeolites and zeolite material synthesised by Fu for PCC FA.

  18. Coal Enrichment Methods by Using Microorganisms and Their Metabolites

    Directory of Open Access Journals (Sweden)

    Małgorzata Deska

    2018-03-01

    Full Text Available The aim of this study is to review the literature on the methods of low-rank coal enrichment by using microorganisms and their metabolites. Effective bio-beneficiation technologies for low-rank coals in the future are also suggested throughout this paper. An extensive literature review highlights recent advances in bio-beneficiation technologies for low rank coals. This paper presents the state of the art in the field of the bio-beneficiation technology - carbon leaching with the aid of microorganisms, especially fungi. The knowledge of the low-rank coals leaching is an important step to meet the carbon eco-requirements and improve the economics of mining companies. There are several reasons to investigate microbial activities towards coal. This paper presents the current state of knowledge concerning bioleaching of coal. Thus, in view of the increasing importance of hard coal as a raw material and energy source, it seems hopeful to study the potential of microorganisms to modify the low-rank coal structure.

  19. A brief petrographic review on Nigerian coal resources

    International Nuclear Information System (INIS)

    Obaje, N. G.; Abaa, S. I.; Najime, T.; Suh, C. E.

    2000-01-01

    The coal resources of Nigeria are located mainly within the Benue Trough. In the lower Benue, subbituminous coals occur within the Maastrichtian Mamu Formation. High - volatile bituminous coals are found within the Turonian - Santonian Awgu Formation in the middle Benue while the upper Benue contains lignites and sub-bituminous coals in the Maastrichtian Gombe Sandstone Formation. Maceral analyses show that himinite dominates in the petrographic composition of the lower and upper Benue Trough coals with vitrinite reflectance values ranging from 0.30 to 0.63% Rm. In coals from the middle Benue, vitrinite macerals predominate and Rm values range from 0.74 to 1.25%. The present review suggests that the sub-bituminous coals in the lower and upper Benue are optimum for combustion and sub-optimum for liquefaction; while the high-volatile bituminous coals in the middle Benue, apart form being optimum for liquefaction, are the most suitable as raw material for coke making (carbonization) in steel manufacture

  20. Biological and physiological changes in raw and radiation-processed legumes

    International Nuclear Information System (INIS)

    El Wakeil, F.A.; Sharabash, M.T.M.; Farag, M. Diaa El-Din H.; Mahrous, S.R.

    1994-01-01

    Body weight of rats fed on raw kidney beans, soybeans, broad beans, chick peas and lupines suffered from poor growth due to some antinutritional factors. When the studied legumes were exposed to 10 kGy, the rats gained more weight than those kept on raw legumes. When extracts of raw legumes were intraperitoneally injected, the LD 50 were found to be 125, 300 and 1800 mg/kg, for raw kidney beans, raw soybeans, and raw broad beans respectively. However, injecting extracts of raw chick peas and raw lupines did not kill the rats even at higher concentration levels of 3000 mg/kg. Similar results were obtained with irradiated chick peas and lupines (10 kGy). Meanwhile, after irradiation treatment of kidney beans, soybeans and broad beans, the LD 50 were found to be 250, 400 and 2000 mg/kg for the above pulses respectively. Both raw and irradiated kidney beans and raw soybeans were most active in stimulating pancreas and liver growth and reducing spleen weight. Irradiated soybeans showed a moderate but significant increase in liver weight only. However, rats fed on both raw and irradiated broad beans, chick peas and lupines in their diets did not suffer any pancreatic and liver hypertrophy or spleen atrophy. The haematological parameters investigated showed that there was no significant differences between rat groups fed on either raw or irradiated legumes. It could be concluded that irradiation offers a good treatment for legumes as it has a beneficial effect to correct the poor growth for rats fed on raw beans during experimental period without any deleterious physiological effects. (author)

  1. Fording Canadian Coal Trust

    Energy Technology Data Exchange (ETDEWEB)

    Popowich, J.; Millos, R. [Elk Valley Coal Corporation, Calgary, AB (Canada)

    2004-07-01

    This is the first of five slide/overhead presentations presented at the Fording Canadian Coal Trust and Tech Cominco Ltd. investor day and mine tour. The Fording Canadian Coal Trust is described. The Trust's assets comprise six Elk Valley metallurgical coal mines and six wollastonite operations (in the NYCO Group). Trust structure, corporate responsibility, organizational structure, reserves and resources, management philosophy, operating strategies, steel market dynamics, coal market, production expansion, sales and distribution are outlined. 15 figs., 5 tabs.

  2. Coal. [1987 and 1989

    Energy Technology Data Exchange (ETDEWEB)

    1988-06-01

    Despite increases in recently negotiated coal prices in US dollar terms, unit export returns for Australian coal are expected to rise only marginally in 1988-89 due to the anticipated appreciation of the Australian dollar. Australian coal production is expected to recover in 1988-89, after falling in 1987-88. A table summarising coal statistics in 1985-87 is presented. 2 figs., 1 tab.

  3. Review biodepyritisation of coal

    Energy Technology Data Exchange (ETDEWEB)

    Acharya, C.; Sukla, L.B.; Misra, V.N. [Regional Research Lab., Orissa (India)

    2004-01-01

    This review provides a detailed summary of the recent and past research activities in the area of biodesulfurisation of coal. It provides information about microorganisms important for biodesulfurisation of coal, with the emphasis on Thiobacillus ferrooxidans. The review presents an insight into various methods of desulfurisation of coal combining physical and biological methods. Also, there are discussions on coal structure, distribution, mechanism and kinetics of pyrite oxidation and jarosite precipitation. Finally, areas requiring further research are identified.

  4. Coal dust symposium

    Energy Technology Data Exchange (ETDEWEB)

    1981-03-01

    This paper gives a report of the paper presented at the symposium held in Hanover on 9 and 10 February 1981. The topics include: the behaviour of dust and coal dust on combustion and explosion; a report on the accidents which occurred at the Laegerdorf cement works' coal crushing and drying plant; current safety requirements at coal crushing and drying plant; and coal crushing and drying. Four papers are individually abstracted. (In German)

  5. Coal world market

    International Nuclear Information System (INIS)

    Anon.

    1996-01-01

    A brief analysis of major tendencies in the world market of coal is presented. It is pointed out that recent years, by and large, were favourable for the development of the world coal industry. Prices for coal (both for power-grade and coking one) in 1995 after many years of depressive state increased by nearly 20 % and reached a maximum of the last decade. International coal trading continues to grow and the tendency may persist in the mext two years

  6. Inorganic Constituents in Coal

    Directory of Open Access Journals (Sweden)

    Rađenović A.

    2006-02-01

    Full Text Available Coal contains not only organic matter but also small amounts of inorganic constituents. More thanone hundred different minerals and virtually every element in the periodic table have been foundin coal. Commonly found group minerals in coal are: major (quartz, pyrite, clays and carbonates,minor, and trace minerals. Coal includes a lot of elements of low mass fraction of the orderof w=0.01 or 0.001 %. They are trace elements connected with organic matter or minerals comprisedin coal. The fractions of trace elements usually decrease when the rank of coal increases.Fractions of the inorganic elements are different, depending on the coal bed and basin. A varietyof analytical methods and techniques can be used to determine the mass fractions, mode ofoccurrence, and distribution of organic constituents in coal. There are many different instrumentalmethods for analysis of coal and coal products but atomic absorption spectroscopy – AAS is theone most commonly used. Fraction and mode of occurrence are one of the main factors that haveinfluence on transformation and separation of inorganic constituents during coal conversion.Coal, as an important world energy source and component for non-fuels usage, will be continuouslyand widely used in the future due to its relatively abundant reserves. However, there is aconflict between the requirements for increased use of coal on the one hand and less pollution onthe other. It’s known that the environmental impacts, due to either coal mining or coal usage, canbe: air, water and land pollution. Although, minor components, inorganic constituents can exert asignificant influence on the economic value, utilization, and environmental impact of the coal.

  7. From Raw Data to Physics Results course

    CERN Multimedia

    CERN. Geneva HR-RFA

    2006-01-01

    It would be helpful for students to know: a) How measurements are made in physical detectors, for example how a tracking chamber "sees" a charged particle or how a calorimeter measures energy. b) That physics processes result in photons, leptons, etc., which we then want to detect and analyze. These series of lectures describes the work that lies between the raw data taken by the detector elements and the physics variables used to study particular reactions. We start with an example analysis to show the kinds of information needed. We then describe the fitting process used to extract values from the observed patterns in typical detectors. This is followed by a discussion of the various problems of pattern recognition in tracking, calorimetry and particle identification detectors. The role of Monte Carlo simulation in understanding the quality of the obtained information is examined. We discuss how the use of "composite" observables is required due to what our instrumentation and reconstruction can achieve. Th...

  8. From Raw Data to Physics Results

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    These series of lectures describes the work that lies between the raw data taken by the detector elements and the physics variables used to study particular reactions. We start by defining some simple physics variables of interest, then describe the fitting process used to extract values from the observed patterns in typical detectors. This is followed by a discussion of the various problems of pattern recognition in tracking, calorimetry and particle identification detectors. The process of calibration and alignment is surveyed, with emphasis on getting "reasonable" results in the absence of formally complete information. Finally, the role of Monte Carlo simulation in understanding the quality of the obtained information is examined. Throughout, we emphasize how the use of "composite" observables is required due to what our instrumentation and reconstruction can achieve.

  9. A method for processing peat or brown coal

    Energy Technology Data Exchange (ETDEWEB)

    Belkevich, P.I.; Lishtvan, I.I.; Prokhorov, G.M.; Tolstikov, G.A.

    1983-01-01

    A method is patented for extraction of peat and brown coal using dimethylformamide or dimethylsulfoxide in order to increase the output of bitumen and to produce dyes and acids from it and to utilize the debituminized fuel. The extraction is conducted at a solvent to raw material ratio of 1 to 5 at a temperature of 95 to 160 degrees for 0.5 to 3 hours. The extract is processed by hydroxides or carbonates of alkaline metals at a ratio of extract to the bitumen of 0.1 to 0.5 at 95 to 160 degrees for 0.5 to 2 hours with isolation of the salts of carbonic acids and recrystallization of them from the hydroxide with the acquisition of the target product of humic acids. The solvent is distilled from the extraction residue and after drying the sediment, a dye D is produced, while the debituminized fuel is processed by hydroxides of alkaline metals in a 0.1 to 1 to 1 ratio at 100 to 150 degrees for 0.5 to 2 hours with the acquisition of thinner for cement solutions. Example. A suspension of 180 grams of peat with a particle size of 0.25 to 10 millimeters with indicators (in percent) of the degree of breakdown of 40, moisture level of 20, ash content of 3.1 and bitumen content of 4.2, is mixed with 810 grams of dimethylformamide (an extraction agent to peat ratio of 4.5) and is heated at 95 degrees for three hours. Eight hundred and seventy grams of the extract (the bitumen output is 33 percent) are acquired, along with 120 grams of debituminized peat. Thirty grams of NaOH (an alkaline to bitumen ratio of 0.5) is gradually added to the bitumen extract at 90 to 100 degrees. The reaction mixture is heated to 160 degrees and is cured at this temperature for 2 hours and subsequently cooled to 20 degrees, filtered off and the salts of the carbonic acids are washed out by a fresh portion of dimethylsulfoxide with the production of 21.3 grams of salts with a melting point of 122 to 175 degrees.

  10. Direct measurement of oxygen in brown coals and carbochemical products by means of fast neutron analysis

    International Nuclear Information System (INIS)

    Raeppel, P.; Foerster, H.

    1990-01-01

    Analyses of elemental oxygen by means of fast neutron activation permit high-accuracy measurements of oxygen concentrations in East German brown coal; this applies to run-of-mine brown coal as well as to demineralized brown coal. The relative error was 4% in the first case and 2% in the latter case. Pre-washing with 1n ammonium acetate solution permits direct analyses of the oxygen bonded to the coal minerals. The method is applicable to other carbonaceous materials, e.g. coal ashes, solid hydrogenation residues, cokes, coal extracts, asphaltenes, oils, etc., at oxygen concentrations of 1-50%. (orig.) [de

  11. Partial oxidation of methane to methanol over catalyst ZSM-5 from coal fly ash and rice husk ash

    Directory of Open Access Journals (Sweden)

    Mirda Yanti Fusia

    2017-01-01

    Full Text Available Methane is one of the greenhouse gases that can be converted into liquid fuels such as methanol to retain most of the energy of methane and produce a cleaner environment. The conversion of methane to methanol using ZMS-5 represents a breakthrough in the utilization of methane. However, material sources for zeolite synthesis as catalyst usually are pro-analysis grade materials, which are expensive. Therefore, in this research, coal fly ash and rice husk ash were used as raw materials for mesoporous ZSM-5 zeolite synthesis. First, coal fly ash and rice husk were subjected to pre-treatment to extract silicate (SiO44− and aluminate (AlO45− and impurities separation. The ZSM-5 zeolite was synthesized through hydrothermal treatment using two types of templates. After ZSM-5 was synthesized, it was modified with Cobalt through impregnation method. The catalytic activity of both ZSM-5 and Co/ZSM-5 zeolites as heterogeneous catalysts in partial oxidation of methane were preliminary tested and compared with that commercial one. The result showed that the zeolite catalyst ZSM-5 from fly ash coal and rice husk ash has the potential to be used as catalysts in the partial oxidation of methane to methanol.

  12. Literature survey of properties of synfuels derived from coal

    Science.gov (United States)

    Reynolds, T. W.; Niedzwiecki, R. W.; Clark, J. S.

    1980-02-01

    A literature survey of the properties of synfuels for ground-based gas turbine applications is presented. Four major concepts for converting coal into liquid fuels are described: solvent extraction, catalytic liquefaction, pyrolysis, and indirect liquefaction. Data on full range syncrudes, various distillate cuts, and upgraded products are presented for fuels derived from various processes, including H-coal, synthoil, solvent-refined coal, donor solvent, zinc chloride hydrocracking, co-steam, and flash pyrolysis. Some typical ranges of data for coal-derived low Btu gases are also presented.

  13. Literature survey of properties of synfuels derived from coal

    Science.gov (United States)

    Reynolds, T. W.; Niedzwiecki, R. W.; Clark, J. S.

    1980-01-01

    A literature survey of the properties of synfuels for ground-based gas turbine applications is presented. Four major concepts for converting coal into liquid fuels are described: solvent extraction, catalytic liquefaction, pyrolysis, and indirect liquefaction. Data on full range syncrudes, various distillate cuts, and upgraded products are presented for fuels derived from various processes, including H-coal, synthoil, solvent-refined coal, donor solvent, zinc chloride hydrocracking, co-steam, and flash pyrolysis. Some typical ranges of data for coal-derived low Btu gases are also presented.

  14. Hard coal; Steinkohle

    Energy Technology Data Exchange (ETDEWEB)

    Loo, Kai van de; Sitte, Andreas-Peter [Gesamtverband Steinkohle e.V., Herne (Germany)

    2013-04-01

    The year 2012 benefited from a growth of the consumption of hard coal at the national level as well as at the international level. Worldwide, the hard coal still is the number one energy source for power generation. This leads to an increasing demand for power plant coal. In this year, the conversion of hard coal into electricity also increases in this year. In contrast to this, the demand for coking coal as well as for coke of the steel industry is still declining depending on the market conditions. The enhanced utilization of coal for the domestic power generation is due to the reduction of the nuclear power from a relatively bad year for wind power as well as reduced import prices and low CO{sub 2} prices. Both justify a significant price advantage for coal in comparison to the utilisation of natural gas in power plants. This was mainly due to the price erosion of the inexpensive US coal which partly was replaced by the expansion of shale gas on the domestic market. As a result of this, the inexpensive US coal looked for an outlet for sales in Europe. The domestic hard coal has continued the process of adaptation and phase-out as scheduled. Two further hard coal mines were decommissioned in the year 2012. RAG Aktiengesellschaft (Herne, Federal Republic of Germany) running the hard coal mining in this country begins with the preparations for the activities after the time of mining.

  15. Coal economics and taxation

    Energy Technology Data Exchange (ETDEWEB)

    1978-01-01

    These proceedings contain opening remarks, the luncheon and dinner addresses, list of delegates and the papers presented at the four sessions on Coal Mines cost money - for what.; Coal mines cost money - Where the money comes from; taxation and royalty policies; and the coal industry view on operating costs. Sixteen papers are abstracted separately.

  16. Report on the achievements in research and development of a coal liquefaction technology in the Sunshine Project in fiscal 1981 for development of a solvent extraction and liquefaction technology. Development of a brown coal based solvent extraction plant (Research on a primary hydrogenation technology, research on a deliming technology, research on a secondary hydrogenation technology, research on a dehydrogenation technology, and research on liquefaction from catalytic aspect); 1981 nendo sekitan ekika gijutsu no kenkyu kaihatsu seika hokokusho. Yozai chushutsu ekika gijutsu no kaihatsu (kattankei yozai chushutsu plant no kaihatsu (ichiji suiten gijutsu no kenkyu, dakkai gijutsu no kenkyu, niji suiten gijutsu no kenkyu, shokubaimen kara no ekika kenkyu))

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1982-03-01

    This paper describes the achievements in development of brown coal based solvent extraction in the Sunshine Project in fiscal 1981. Element researches were performed to complement and support the development of a liquefaction technology for brown coal produced in Victoria, Australia by using a 50-T/D pilot plant. For the primary hydrogenation technology, a manufacturing experiment was completed by means of nine cycles using a brown coal balancing solvent in a 0.1-t/day bench scale test. Distribution of the formed materials, the solvent properties, and the SRC properties have become nearly constant after 5 to 6 cycles. A test using a batch type device was performed to derive the relationship among dissolution parameters, SRC recovery rates, and deliming rates by using different solvents. For the secondary hydrogenation technology, SRC being the heavy fraction in a primary hydrogenation system (+420 degrees C) was hydrogenated by using an Ni{center_dot}Mo based catalyst at 360 degrees C and 250 kg/cm{sup 2}. A prospect was attained that the processing is possible by using a fixed bed reactor. A test using a small continuous dehydration testing device was carried out by using creosote oil as the solvent and by varying the evaporator operating conditions. Dehydration rate of 90 to 95% was obtained. Discussions were given on selecting catalysts for the secondary hydrogenation of the fixed bed method, and on factors of activity deterioration. A secondary hydrogenation test reactor of the suspended bed method was completed. (NEDO)

  17. Separation of mercury in industrial processes of Polish hard steam coals cleaning

    Directory of Open Access Journals (Sweden)

    Wierzchowski Krzysztof

    2016-01-01

    Full Text Available Coal use is regarded as one of main sources of anthropogenic propagation of mercury in the environment. The coal cleaning is listed among methods of the mercury emission reduction. The article concerns the statistical assessment of mercury separation between coal cleaning products. Two industrial processes employed in the Polish coal preparation plants are analysed: coal cleaning in heavy media vessels and coal cleaning in jigs. It was found that the arithmetic mean mercury content in coarse and medium coal size fractions for clean coal from heavy media vessels, amounts 68.9 μg/kg, and most of the results lay below the mean value, while for rejects it amounts 95.5 μg/kg. It means that it is for around 25 μg/kg greater than in the clean coal. The arithmetic mean mercury content in raw coal smalls amounts around 118 mg/kg. The cleaning of smalls in jigs results in clean coal and steam coal blends characterized by mean mercury content 96.8 μg/kg and rejects with mean mercury content 184.5 μg/kg.

  18. Trends on the international coal markets; Trends auf den internationalen Steinkohlenmaerkten

    Energy Technology Data Exchange (ETDEWEB)

    Wedig, Martin; Luebke, Roland [Gesamtverband Steinkohle e.V., Herne (Germany)

    2011-01-15

    Following the worldwide financial and economic crisis the international coal markets are again well on the road to recovery and are currently exhibiting clear growth and boom trends, particularly in the Asian consumption regions. In most OECD countries, however, the recovery process to achieve the status quo at the pre-crisis level is still far from concluded, so that the certain catching-up effect can still be anticipated. Because of the high Asian demand - meanwhile not only in PR China, but also in India - the upward trend in the raw material sector as a whole is intact and the global raw material supercycle is continuing on an increasingly wider scale. The prices of raw materials have risen sharply. This applies essentially to the energy raw materials (e.g. oil and coal), but also to the many metallic raw materials. (orig.)

  19. Biosolubilization of raw and gamma irradiated lignite by trichoderma asperellum

    International Nuclear Information System (INIS)

    Sugoro, I.; Astuti, D.I.; Aditiawati, P.; Sasongko, D.

    2012-01-01

    Biosolubilization is a promising technology for converting solid coal to liquid oil by addition of microorganism. Aim of this research is to compare between gamma irradiated lignite (10 kGy) with raw lignite in biosolubilization by selected fungi Trichoderma asperellum. Treatments were A (MSS + gamma irradiated lignite 5% + T. asperellum) and B (MSS + raw lignite 5% + T. asperellum) with sub-merged culture. There were two parameters observed i.e. biosolubilization product based on absorbance value at λ 250nm and λ 450nm and metal analysis by neutron activation analysis (NAA). The highest biosolubilization will be analyzed by FTIR and GCMS. The results showed that biosolubilization of raw lignite (B) was higher than sterilized lignite (A) based on absorbance value at λ 250nm and λ 450nm . The metal of lignite was decreased after incubation. FTIR analysis showed that both of treatment had similar spectra on biosolubilization products. GCMS analysis showed that both of treatment had different number of hydrocarbon, i.e. C 6 - C 35 (A) and C 10 - C 35 (B) and dominated by aromatic acids, aliphatic and phenylethers. Both of treatment product had the potency as oil substituted but its recommended to deoxygenate for higher quality. (author)

  20. Australian Coal Company Risk Factors: Coal and Oil Prices

    OpenAIRE

    M. Zahid Hasan; Ronald A. Ratti

    2014-01-01

    Examination of panel data on listed coal companies on the Australian exchange over January 1999 to February 2010 suggests that market return, interest rate premium, foreign exchange rate risk, and coal price returns are statistically significant in determining the excess return on coal companies’ stock. Coal price return and oil price return increases have statistically significant positive effects on coal company stock returns. A one per cent rise in coal price raises coal company returns ...

  1. Longwall top coal caving (LTCC) mining technologies with roof softening by hydraulic fracturing method

    Science.gov (United States)

    Klishin, V.; Nikitenko, S.; Opruk, G.

    2018-05-01

    The paper discusses advanced top coal caving technologies for thick coal seams and addresses some issues of incomplete coal extraction, which can result in the environmental damage, landscape change, air and water pollution and endogenous fires. The authors put forward a fundamentally new, having no equivalent and ecology-friendly method to difficult-to-cave roof coal – directional hydraulic fracturing and nonexplosive disintegration.

  2. The effect of solvent swelling for the production of ashless coal

    Energy Technology Data Exchange (ETDEWEB)

    Aylin Kurman; Sultan Giray; Ozgur Sonmez [Cukurova University, Adana (Turkey). Chemistry Department, Art& Science Faculty

    2005-07-01

    Two Turkish coal (a bituminous and a brown coal) were extracted with NMP-CS2 (1:1 v/v) and NMP-EDA (1:17, v/v) at room conditions and with NMP and NMP/EDA under reflux. To obtain any effect of solvent swelling on extraction yield coals were also extracted at same conditions after swelling with NMP and EDA. The extraction yield was maximum in the NMP-CS2 mixed solvent for higher ranked coal, suggesting a synergistic effect of the system. It was possible to extract over 35 % of sub-bituminous coal by using NMP- CS2. The extraction of same coal with NMP under reflux gave an extraction yield of 33% suggesting the useful effect of solvent swelling and heat during the reflux period. A positive effect of pre-swelling with NMP and EDA on extraction yield and recovery of solid extracts were observed , especially for brown coal sample. Following the extraction, solid extracts were produced with less than 0.12 % in ash content for almost all extraction conditions.

  3. Ethyl acetate extract from Asparagus cochinchinensis exerts anti-inflammatory effects in LPS-stimulated RAW264.7 macrophage cells by regulating COX-2/iNOS, inflammatory cytokine expression, MAP kinase pathways, the cell cycle and anti-oxidant activity

    Science.gov (United States)

    Lee, Hyun Ah; Koh, Eun Kyoung; Sung, Ji Eun; Kim, Ji Eun; Song, Sung Hwa; Kim, Dong Seob; Son, Hong Joo; Lee, Chung Yeoul; Lee, Hee Seob; Bae, Chang Joon; Hwang, Dae Youn

    2017-01-01

    Asparagus cochinchinesis (A. cochinchinesis) is a medicine traditionally used to treat fever, cough, kidney disease, breast cancer, inflammatory disease and brain disease in northeast Asian countries. Although numerous studies of the anti-inflammatory effects of A. cochinchinesis have been conducted, the underlying mechanisms of such effects in macrophages remain to be demonstrated. To investigate the mechanism of suppressive effects on the inflammatory response in macrophages, alterations of the nitric oxide (NO) level, the cell viability, inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) expression levels, inflammatory cytokine expression, the mitogen-activated protein kinase (MAPK) signaling pathway, cell cycle arrest and reactive oxygen species (ROS) levels were measured in lipopolysaccharide (LPS)-activated RAW264.7 cells following treatment with ethyl acetate extract from A. cochinchinesis root (EaEAC). RAW264.7 cells pretreated two different concentrations of EaEAC prior to LPS treatment exhibited no significant toxicity. The concentration of NO was significantly decreased in the EaEAC + LPS treated group compared with the vehicle + LPS treated group. A similar decrease in mRNA transcript level of COX-2, iNOS, pro-inflammatory cytokines [tumor necrosis factor-α and interleukin (IL)-1β] and anti-inflammatory cytokines (IL-6 and IL-10) was detected in the EaEAC + LPS treated group compared with the vehicle + LPS treated group, although the decrease rate varied. Enhancement of the phosphorylation of MAPK family members following LPS treatment was partially rescued in the EaEAC pretreated group, and the cell cycle was arrested at the G2/M phase. Furthermore, the EaEAC pretreated group exhibited a reduced level of ROS generation compared with the vehicle + LPS treated group. Taken together, these results suggest that EaEAC suppresses inflammatory responses through inhibition of NO production, COX-2 expression and ROS production, as well as

  4. Ethyl acetate extract from Asparagus cochinchinensis exerts anti‑inflammatory effects in LPS‑stimulated RAW264.7 macrophage cells by regulating COX‑2/iNOS, inflammatory cytokine expression, MAP kinase pathways, the cell cycle and anti-oxidant activity.

    Science.gov (United States)

    Lee, Hyun Ah; Koh, Eun Kyoung; Sung, Ji Eun; Kim, Ji Eun; Song, Sung Hwa; Kim, Dong Seob; Son, Hong Joo; Lee, Chung Yeoul; Lee, Hee Seob; Bae, Chang Joon; Hwang, Dae Youn

    2017-04-01

    Asparagus cochinchinesis (A. cochinchinesis) is a medicine traditionally used to treat fever, cough, kidney disease, breast cancer, inflammatory disease and brain disease in northeast Asian countries. Although numerous studies of the anti‑inflammatory effects of A. cochinchinesis have been conducted, the underlying mechanisms of such effects in macrophages remain to be demonstrated. To investigate the mechanism of suppressive effects on the inflammatory response in macrophages, alterations of the nitric oxide (NO) level, the cell viability, inducible nitric oxide synthase (iNOS) and cyclooxygenase‑2 (COX‑2) expression levels, inflammatory cytokine expression, the mitogen-activated protein kinase (MAPK) signaling pathway, cell cycle arrest and reactive oxygen species (ROS) levels were measured in lipopolysaccharide (LPS)-activated RAW264.7 cells following treatment with ethyl acetate extract from A. cochinchinesis root (EaEAC). RAW264.7 cells pretreated two different concentrations of EaEAC prior to LPS treatment exhibited no significant toxicity. The concentration of NO was significantly decreased in the EaEAC + LPS treated group compared with the vehicle + LPS treated group. A similar decrease in mRNA transcript level of COX‑2, iNOS, pro-inflammatory cytokines [tumor necrosis factor‑α and interleukin (IL)‑1β] and anti‑inflammatory cytokines (IL‑6 and IL‑10) was detected in the EaEAC + LPS treated group compared with the vehicle + LPS treated group, although the decrease rate varied. Enhancement of the phosphorylation of MAPK family members following LPS treatment was partially rescued in the EaEAC pretreated group, and the cell cycle was arrested at the G2/M phase. Furthermore, the EaEAC pretreated group exhibited a reduced level of ROS generation compared with the vehicle + LPS treated group. Taken together, these results suggest that EaEAC suppresses inflammatory responses through inhibition of NO production, COX‑2 expression

  5. Coal Data: A reference

    International Nuclear Information System (INIS)

    1991-01-01

    The purpose of Coal Data: A Reference is to provide basic information on the mining and use of coal, an important source of energy in the United States. The report is written for a general audience. The goal is to cover basic material and strike a reasonable compromise between overly generalized statements and detailed analyses. The section ''Coal Terminology and Related Information'' provides additional information about terms mentioned in the text and introduces new terms. Topics covered are US coal deposits, resources and reserves, mining, production, employment and productivity, health and safety, preparation, transportation, supply and stocks, use, coal, the environment, and more. (VC)

  6. Emissions of organic hazardous air pollutants during Chinese coal combustion

    Energy Technology Data Exchange (ETDEWEB)

    Yan, R.; Zhu, H.J.; Zheng, C.G.; Xu, M.H. [Environmental Technology Institute, Singapore (Singapore). Innovative Center

    2002-05-01

    The emissions of organic hazardous air pollutants (HAPs) during the combustion of several typical Chinese coals were investigated. First, the distribution of four types of HAP, i.e., aliphatics, cyclic hydrocarbons, monoaromatic compounds and PAHs, in the CH{sub 2}C{sub l2} extracts of six Chinese coals were studied and the influences of the extractive times and coal varieties were also evaluated. Second, the partitioning of these HAPs in the flue gas during coal combustion in a small-scale reactor were investigated, depending on oven temperatures (500, 600, 700, 800, 900{sup o}C) and coal varieties. The behaviors of HAP in the combustion flue gas were compared with those in the CH{sub 2}, Cl{sub 2}, extracts. Finally, combustion was conducted at given conditions in two laboratory-scale reactors: a fluidized bed and a fixed bed. Two coals (Shengmu bituminous coal and Xunhuan anthracite coal) and one coke were considered. The HAP partitioning both in flue gases and in ashes were evaluated and compared between the two combustors.

  7. Characterization of solid residues from coal liquefaction processes. Phase I

    Energy Technology Data Exchange (ETDEWEB)

    Potter, J.; McDougall, W.M.; Kybett, B.D.; Neufeld, C.

    1981-01-01

    Various coal liquefaction and beneficiation processes are being investigated by independent research groups sponsored by the Canadian Federal Government. These processes include the co-processing of heavy oils and bitumen with coal, oxygen removal and hydrogenation of coal and supercritical gas extraction of coal. The end products, gaseous and liquid fuels and insoluble organic residues, vary with the experimental conditions. The physical properties and origin of the insoluble residue may influence such factors as degree of conversion, efficiency of the process, and ultimately, gaseous and liquid yields. One of the most suitable methods of assessing the nature of the insoluble residues is the use of petrography. This report deals with petrographic assessment of the coals and residues from various coal conversion processes; attempts were made to characterize the solid phases in the residues; to assess them in a quantitative manner and where possible; to correlate the results with experimental data; and to assess their effects on conversion. (30 refs.)

  8. Raw milk consumption and health

    Directory of Open Access Journals (Sweden)

    Popović-Vranješ Anka

    2015-01-01

    Full Text Available Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39% outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%, bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79% outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market. [Projekat Ministarstva nauke Republike Srbije, br. TR31095

  9. Raw material uranium; Rohstoff Uran

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2017-03-15

    Uranium is an important raw material in human life. Mostly using nuclear fission uranium is used in nuclear medicine, industry and research. The most important application is the generation of electricity in nuclear power plants. Due to the global availability the worldwide uranium supply is guaranties for a long time. The contribution covers the issues medicine, neutron research, energy generation, occurrence, mining, processing, recycling and disposal.

  10. Synthesis of beta-sialon from coal gangue

    Energy Technology Data Exchange (ETDEWEB)

    Luo, X.Y.; Sun, J.L.; Deng, C.J.; Hong, Y.R. [Beijing University Science & Technology, Beijing (China)

    2003-01-01

    It is worth studying the synthesis of beta-Sialon from coal gangue, because coal gangue is a waste of coal production and is a high quality kaolin contained carbon which is a perfect raw material of contained reducer itself for synthesis of beta-sialon. The study showed that a high conversion rate of 95% from coal gangue to beta-Sialon could be obtained by using process of carbothermal reduction nitridation when strictly controlling the thermodynamic conditions of synthesis. For controlling the synthesis conditions, the details of the effects of p(CO), P-O{sub 2} and T on the conversion rate of beta-sialon are discussed and the phase diagrams of oxygen pressure vs composition for Si{sub 3}N{sub 4}-A{sub l}N-Al{sub 2}O{sub 3}-SiO{sub 2} system at 1350, 1500, and 1600{sup o}C are constructed.

  11. Coal and public perceptions

    International Nuclear Information System (INIS)

    Porter, R.C.

    1993-01-01

    The Department of Energy's (DOE) clean coal outreach efforts are described. The reason why clean coal technology outreach must be an integral part of coal's future is discussed. It is important that we understand the significance of these advances in coal utilization not just in terms of of hardware but in terms of public perception. Four basic premises in the use of coal are presented. These are: (1) that coal is fundamentally important to this nation's future; (2) that, despite premise number 1, coal's future is by no means assured and that for the last 10 years, coal has been losing ground; (3) that coal's future hinges on the public understanding of the benefits of the public's acceptance of advanced clean coal technology; and (4) hat public acceptance of clean coal technology is not going to be achieved through a nationwide advertising program run by the Federal government or even by the private sector. It is going to be gained at the grassroots level one community at a time, one plant at a time, and one referendum at a time. The Federal government has neither the resources, the staff, nor the mandate to lead the charge in those debates. What is important is that the private sector step up to the plate as individual companies and an individual citizens working one-one-one at the community level, one customer, one civic club, and one town meeting at a time

  12. Indonesian coal export potential

    International Nuclear Information System (INIS)

    Millsteed, Ch.; Jolly, L.; Stuart, R.

    1993-01-01

    Indonesia's coal mining sector is expanding rapidly. Much of the increase in coal production since the mid-1980s has been exported. Indonesian coal mining companies have large expansion programs and continuing strong export growth is projected for the remainder of the 1990s. The low mining costs of indonesian coal, together with proximity to Asian markets, mean that Indonesia is well placed to compete strongly with other thermal coal exporters and win market share in the large and expanding thermal coal market in Asia. However, there is significant uncertainty about the likely future level of Indonesia's exportable surplus of coal. The government's planned expansion in coal fired power generation could constrain export growth, while the ability of producers to meet projected output levels is uncertain. The purpose in this article is to review coal supply and demand developments in Indonesia and, taking account of the key determining factors, to estimate the level of coal exports from Indonesia to the year 2000. This time frame has been chosen because all currently committed mine developments are expected to be on stream by 2000 and because it is difficult to project domestic demand for coal beyond that year. 29 refs., 8 tabs., 7 figs

  13. Coal; Le charbon

    Energy Technology Data Exchange (ETDEWEB)

    Teissie, J.; Bourgogne, D. de; Bautin, F. [TotalFinaElf, La Defense, 92 - Courbevoie (France)

    2001-12-15

    Coal world production represents 3.5 billions of tons, plus 900 millions of tons of lignite. 50% of coal is used for power generation, 16% by steel making industry, 5% by cement plants, and 29% for space heating and by other industries like carbo-chemistry. Coal reserves are enormous, about 1000 billions of tons (i.e. 250 years of consumption with the present day rate) but their exploitation will be in competition with less costly and less polluting energy sources. This documents treats of all aspects of coal: origin, composition, calorific value, classification, resources, reserves, production, international trade, sectoral consumption, cost, retail price, safety aspects of coal mining, environmental impacts (solid and gaseous effluents), different technologies of coal-fired power plants and their relative efficiency, alternative solutions for the recovery of coal energy (fuel cells, liquefaction). (J.S.)

  14. Washability of Australian coals

    Energy Technology Data Exchange (ETDEWEB)

    Whitmore, R L

    1979-06-01

    Australian coals tend to be young in geological age and high in ash by world standards; preparation of the coal before marketing is almost universal. On the basis of float and sink data from 39 locations in the eastern Australian coalfields, the coals are place in four categories representing increasing difficulty in their washability characteristics. These seem to be related neither to the geological age nor the geographical position of the deposit and Hunter Valley coals, for example, span all categories. The influence of crushing on the washability of Australian coals is briefly considered and from limited data it is concluded to be appreciably smaller than for British or North American coals. A strategy for the float and sink analysis of Australian coals is proposed and the influence of washability characteristics on current trends in the selection of separating processes for coking and steaming products is discussed.

  15. Proceedings of the workshop on radioactivity associated with coal use

    International Nuclear Information System (INIS)

    1981-12-01

    A workshop on radioactivity in coal use was held on September 15 through 17, 1981, under the auspices of the US Department of Energy, Office of Environmental Programs, and the Los Alamos National Laboratory. The purpose of the workshop was to identify research issues associated with radioactivity resulting from the use of coal for electric power generation. The concensus of the 10 scientists participating in the workshop was that a moderate to strong need exists for research in solubility of fly ash in different fluids and for determination of radioactivity in construction materials. Several additional research issues were identified but were given a lower priority. Summaries of each presentation are included. Titles are: some effects of coal combustion on the radiation environment; radionuclides in western coal at Mound; low-level radiation in coals utilized and ashes produced at New York State electric utilities; radioactivity from coal use - where are the problems; chemistry of radionuclides in coal preparation; uranium daughters in natural atmospheric aerosols and coal-fired power plant emissions; possible contributions of coal extraction and utilization to radioactivity contributions in drinking water; and impact on water quality from radionuclides in coal. One paper has been abstracted separately for inclusion in the Energy Data Base

  16. Prevention of trace and major element leaching from coal combustion products by hydrothermally-treated coal ash

    Energy Technology Data Exchange (ETDEWEB)

    Adnadjevic, B.; Popovic, A.; Mikasinovic, B. [University of Belgrade, Belgrade (Serbia). Dept. of Chemistry

    2009-07-01

    The most important structural components of coal ash obtained by coal combustion in 'Nikola Tesla A' power plant located near Belgrade (Serbia) are amorphous alumosilicate, alpha-quartz, and mullite. The phase composition of coal ash can be altered to obtain zeolite type NaA that crystallizes in a narrow crystallization field (SiO{sub 2}/Al{sub 2}O{sub 3}; Na{sub 2}O/SiO{sub 2}; H{sub 2}O/Na{sub 2}O ratios). Basic properties (crystallization degree, chemical composition, the energy of activation) of obtained zeolites were established. Coal ash extracts treated with obtained ion-exchange material showed that zeolites obtained from coal ash were able to reduce the amounts of iron, chromium, nickel, zinc, copper, lead, and manganese in ash extracts, thus proving its potential in preventing pollution from dump effluent waters.

  17. Process for hydrogenating coal and coal solvents

    Energy Technology Data Exchange (ETDEWEB)

    Shridharani, K.G.; Tarrer, A.R.

    1983-02-15

    A novel process is described for the hydrogenation of coal by the hydrogenation of a solvent for the coal in which the hydrogenation of the coal solvent is conducted in the presence of a solvent hydrogenation catalyst of increased activity, wherein the hydrogenation catalyst is produced by reacting ferric oxide with hydrogen sulfide at a temperature range of 260/sup 0/ C to 315/sup 0/ C in an inert atmosphere to produce an iron sulfide hydrogenation catalyst for the solvent. Optimally, the reaction temperature is 275/sup 0/ C. Alternately, the reaction can be conducted in a hydrogen atmosphere at 350/sup 0/ C.

  18. Process for hydrogenating coal and coal solvents

    Science.gov (United States)

    Tarrer, Arthur R.; Shridharani, Ketan G.

    1983-01-01

    A novel process is described for the hydrogenation of coal by the hydrogenation of a solvent for the coal in which the hydrogenation of the coal solvent is conducted in the presence of a solvent hydrogenation catalyst of increased activity, wherein the hydrogenation catalyst is produced by reacting ferric oxide with hydrogen sulfide at a temperature range of 260.degree. C. to 315.degree. C. in an inert atmosphere to produce an iron sulfide hydrogenation catalyst for the solvent. Optimally, the reaction temperature is 275.degree. C. Alternately, the reaction can be conducted in a hydrogen atmosphere at 350.degree. C.

  19. Coal use and coal technology study (KIS)

    International Nuclear Information System (INIS)

    Kram, T.; Okken, P.A.; Gerbers, D.; Lako, P.; Rouw, M.; Tiemersma, D.N.

    1991-11-01

    The title study aims to assess the possible role for coal in the Netherlands energy system in the first decades of the next century and the part new coal conversion technologies will play under various conditions. The conditions considered relate to (sectoral) energy demand derived from national scenarios in an international context, to energy prices, to environmental constraints (acidification, solid waste management and disposal) and to the future role for nuclear power production. Targets for reduction of greenhouse gas emissions are not explicitly included, but resulting CO 2 emissions are calculated for each variant case. The part that coal can play in the Dutch energy supply is calculated and analyzed by means

  20. Studies of coal structure using carbene chemistry

    Energy Technology Data Exchange (ETDEWEB)

    1990-01-01

    The object of this grant was to react coal, derivatized forms of coal, and solvent swelled coal with carbenes (divalent carbon species) under mild conditions. These carbenes were to be prepared by treating the coal with several diazo compounds and then thermally decomposing them at relatively low temperatures (80--130{degree}C). The carbenes were to be chosen to show varying selectively toward aromatic rings containing heteroatom functionalities and toward polynuclear aromatic systems. In some instances, where selectivities toward aromatic and heteroaromatic ring systems were not known, model studies were to be carried out. Because of the generally mild conditions employed and the good selectivity anticipated, and actually observed with one particular system, it was expected that this methodology would provide structural information about the coal, along with data on the extent of occurrence and type of aromatic systems. After carbene reactions, treatment of the coal samples was to include extractions and thermolysis. Physical studies included thermogravimetric analysis, diffuse reflectance FT-IR spectroscopy, NMR ({sup 1}H and {sup 13}C) spectroscopy, gas chromatography, GC/MS and GC/FT-IR. 7 figs., 10 tabs.