WorldWideScience

Sample records for raw bovine milk

  1. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  2. Raw bovine milk improves gut responses to feeding relative to infant formula in preterm piglets

    DEFF Research Database (Denmark)

    Li, Yanqi; Jensen, Mikkel Lykke; Chatterton, Dereck Edward Winston

    2014-01-01

    For preterm neonates, the quality of the first milk is crucial for intestinal maturation and resistance to necrotizing enterocolitis (NEC). Among other factors, milk quality is determined by the stage of lactation and processing. We hypothesized that unprocessed mature bovine milk (BM, raw bovine...

  3. The analysis of milk components and pathogenic bacteria isolated from bovine raw milk in Korea.

    Science.gov (United States)

    Park, Y K; Koo, H C; Kim, S H; Hwang, S Y; Jung, W K; Kim, J M; Shin, S; Kim, R T; Park, Y H

    2007-12-01

    Bovine mastitis can be diagnosed by abnormalities in milk components and somatic cell count (SCC), as well as by clinical signs. We examined raw milk in Korea by analyzing SCC, milk urea nitrogen (MUN), and the percentages of milk components (milk fat, protein, and lactose). The associations between SCC or MUN and other milk components were investigated, as well as the relationships between the bacterial species isolated from milk. Somatic cell counts, MUN, and the percentages of milk fat, protein, and lactose were analyzed in 30,019 raw milk samples collected from 2003 to 2006. The regression coefficients of natural logarithmic-transformed SCC (SCCt) on milk fat (-0.0149), lactose (-0.8910), and MUN (-0.0096), and those of MUN on milk fat (-0.3125), protein (-0.8012), and SCCt (-0.0671) were negative, whereas the regression coefficient of SCCt on protein was positive (0.3023). When the data were categorized by the presence or absence of bacterial infection in raw milk, SCCt was negatively associated with milk fat (-0.0172), protein (-0.2693), and lactose (-0.4108). The SCCt values were significantly affected by bacterial species. In particular, 104 milk samples infected with Staphylococcus aureus had the highest SCCt (1.67) compared with milk containing other mastitis-causing bacteria: coagulase-negative staphylococci (n = 755, 1.50), coagulase-positive staphylococci (except Staphylococcus aureus; n = 77, 1.59), Streptococcus spp. (Streptococcus dysgalactiae, n = 37; Streptococcus uberis, n = 12, 0.83), Enterococcus spp. (n = 46, 1.04), Escherichia coli (n = 705, 1.56), Pseudomonas spp. (n = 456, 1.59), and yeast (n = 189, 1.52). These results show that high SCC and MUN negatively affect milk components and that a statistical approach associating SCC, MUN, and milk components by bacterial infection can explain the patterns among them. Bacterial species present in raw milk are an important influence on SCC in Korea.

  4. Seasonal variation in the Dutch bovine raw milk composition

    NARCIS (Netherlands)

    Heck, J.M.L.; Valenberg, van H.J.F.; Dijkstra, J.; Hooijdonk, van A.C.M.

    2009-01-01

    In this study, we determined the detailed composition of and seasonal variation in Dutch dairy milk. Raw milk samples representative of the complete Dutch milk supply were collected weekly from February 2005 until February 2006. Large seasonal variation exists in the concentrations of the main

  5. Seasonal variation in the Dutch bovine raw milk composition.

    Science.gov (United States)

    Heck, J M L; van Valenberg, H J F; Dijkstra, J; van Hooijdonk, A C M

    2009-10-01

    In this study, we determined the detailed composition of and seasonal variation in Dutch dairy milk. Raw milk samples representative of the complete Dutch milk supply were collected weekly from February 2005 until February 2006. Large seasonal variation exists in the concentrations of the main components and milk fatty acid composition. Milk lactose concentration was rather constant throughout the season. Milk true protein content was somewhat more responsive to season, with the lowest content in June (3.21 g/100 g) and the highest content in December (3.38 g/100 g). Milk fat concentration increased from a minimum of 4.10 g/100 g in June to a maximum of 4.57 g/100 g in January. The largest (up to 2-fold) seasonal changes in the fatty acid composition were found for trans fatty acids, including conjugated linoleic acid. Milk protein composition was rather constant throughout the season. Milk unsaturation indices, which were used as an indication of desaturase activity, were lowest in spring and highest in autumn. Compared with a previous investigation of Dutch dairy milk in 1992, the fatty acid composition of Dutch raw milk has changed considerably, in particular with a higher content of saturated fatty acids in 2005 milk.

  6. A case of bovine raw milk contamination with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hunt Karen

    2012-07-01

    Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

  7. Protein carbonylation sites in bovine raw milk and processed milk products.

    Science.gov (United States)

    Milkovska-Stamenova, Sanja; Mnatsakanyan, Ruzanna; Hoffmann, Ralf

    2017-08-15

    During thermal treatment of milk, proteins are oxidized, which may reduce the nutritional value of milk, abolish protein functions supporting human health, especially important for newborns, and yield potentially harmful products. The side chains of several amino acids can be oxidized to reactive carbonyls, which are often used to monitor oxidative stress in organisms. Here we mapped protein carbonylation sites in raw milk and different brands of pasteurized, ultra high temperature (UHT) treated milk, and infant formulas (IFs) after digesting the precipitated proteins with trypsin. Reactive carbonyls were derivatized with O-(biotinylcarbazoylmethyl)hydroxylamine to enrich the modified peptides by avidin-biotin affinity chromatography and analyze them by nanoRP-UPLC-ESI-MS. Overall, 53 unique carbonylated peptides (37 carbonylation sites, 15 proteins) were identified. Most carbonyls were derived from dicarbonyls (mainly glyoxal). The number of carbonylation sites increased with the harsher processing from raw milk (4) to pasteurized (16) and UHT milk (16) and to IF (24). Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. THE DIRECT SALE OF RAW MILK: PREVALENCE OF PATHOGENS IN RAW MILK AND BOVINE FAECES COLLECTED IN FARMS WITHIN THE PROVINCE OF PESARO-URBINO

    Directory of Open Access Journals (Sweden)

    F. Tonucci

    2009-09-01

    Full Text Available In the last years, direct sale of raw milk by vending machines has largely increased in several European Countries and Italy. As a consequence, adequate hygienic measures and correct consumer’s information is required in order to reduce any potential risk linked to this product. In the present study, the occurrence of pathogens (Salmonella spp., verocytotoxigenic E.coli, Campylobacter spp., Listeria monocytogenes, S.aureus in raw milk and bovine faeces collected in 4 farms in the province of Pesaro-Urbino (Italy, between January 2007 and March 2009 has been investigated; 99.5% of milk samples resulted negative for the pathogens considered and complying with the regulation S. aureus limits. Campylobacter has been found in 0.44% of the samples, collected during summer, while only one sample resulted positive to a non-verocytotoxigenic E.coli O157. In respect to faeces, 62.6% of the samples resulted negative, 33.6% were contaminated by Campylobacter spp. (68% Campylobacter coli and 32% Campylobacter jejuni and 3.8% by E.coli O157. No samples resulted positive for Salmonella spp. or Listeria monocytogenes. The results highlight the necessity of a strict plan of hygienic and sanitary controls, with particular attention to milking process hygiene and raw milk storage, to reduce the risk of contamination of the product.

  9. A new comprehensive index for discriminating adulteration in bovine raw milk.

    Science.gov (United States)

    Liu, Jing; Ren, Jing; Liu, Zhen-Min; Guo, Ben-Heng

    2015-04-01

    This paper proposes a new comprehensive index, called Q, which can effectively discriminate artificial adulterated milk from unadulterated milk. Both normal and adulterated samples of bovine raw milk were analysed by Fourier transform infrared spectroscopic instrument to measure the traditional indices of quality, including fat (FAT), protein (PRO), lactose (LAC), total solids (TS), non-fat solid (NFS), freezing point (FP) and somatic cell counts (SCC). From these traditional indices, this paper elaborates a method to build the index Q. First, correlated analysis and principle component analysis were used to select parameter pairs TS-FAT and FP-LAC as predominant variables. Second, linear-regression analysis and residual analysis are applied to determine the index Q and its discriminating ranges. The verification and two-blind trial results suggested that index Q could accurately detect milk adulteration with maltodextrin and water (as low as 1.0% of adulteration proportions), and with other nine kinds of synthetic adulterants (as low as 0.5% of adulteration proportions). Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Effects of home-made boiling of bovine raw milk on its microbiological quality

    Directory of Open Access Journals (Sweden)

    Giampaolo Colavita

    2012-10-01

    Full Text Available The consumption of raw milk in Italy is allowed only “after boiling”. The aim of this research was to bet-ter understand how the heat treatment of raw milk performed at home by consumers assures their mi-crobiological safety. 50 samples of raw milk (each sample 500 ml provided to consumers who regularly buy raw milk from self-service automatic vending machines were followed from delivery till to after do-mestic heat treatment. Heating was performed by consumers according to their habits. The 50 samples were exposed to different heat treatments of which the mildest was at 68.5 °C and the most intense was at 97.8 °C before switching off. The average of temperatures used was 89.5 °C and the mode was 93.2 °C. According to the different parameters of heat treatment observed, 35 samples of raw milk and 35 samples of heated milk were selected for microbiological and process indicator analyses. Total Microbial Count (TMC, total and fecal coliforms, Escherichia coli, Staphylococcus aureus and Bacillus cereus loads were determined. E. coli was isolated only from one sample of raw milk. No B. cereus nor S. aure-us were found in all samples. After heat treatment, 4 samples showed a residual TMC ranging between 1,7 CFU/ml and 3,2 CFU/ml, whilst the count of total and fecal coliforms were irrelevant. The test for alkaline phosphatase has showed negative in all samples of heated milk, while the test of lactoperoxi-dase was positive in 3 samples. Results indicated that the microbiological risk attributable to the consumption of home heated raw milk is low, if the consumer applies regularly a good heating process.

  11. Molecular screening of bovine raw milk for the presence of Shiga toxin-producing Escherichia coli (STEC on dairy farms

    Directory of Open Access Journals (Sweden)

    Tatiane Vendramin

    2014-09-01

    Full Text Available Milkborne transmission of Shiga toxin- producing Escherichia coli (STEC has raised considerable concern due to recent outbreaks worldwide and poses a threat to public health. The aim of this study was to develop a sensitive and specific multiplex PCR assay to detect the presence of STEC in bovine raw milk. To identify E. coli (ATCC 25922 contamination, the gene uspA was used, and PCR sensitivity and specificity were accessed by testing diluted samples ranging from 2 to 2.0 × 10(6 CFU/mL. To detect STEC, the stx1 and stx2 genes were selected as targets. After reaction standardization, the multiplex assay was tested in raw milk collected from 101 cows on dairy farms. PCR assay for E. coli detection had a specificity of 100% and sensitivity of 79% (P<0.0001, with a lower detection limit of 2 CFU/mL. Multiplex PCR assay had 100% sensitivity for E. coli positive raw milk samples, and 31.1% were contaminated with STEC, 28.3% of stx2, and 1.9% of stx1. The multiplex PCR assay described in the present study can be employed to identify and screen E. coli harboring stx1 and stx2 genes in raw milk on dairy farms and in industries.

  12. Pseudomonas lactis sp. nov. and Pseudomonas paralactis sp. nov., isolated from bovine raw milk.

    Science.gov (United States)

    von Neubeck, Mario; Huptas, Christopher; Glück, Claudia; Krewinkel, Manuel; Stoeckel, Marina; Stressler, Timo; Fischer, Lutz; Hinrichs, Jörg; Scherer, Siegfried; Wenning, Mareike

    2017-06-01

    Five strains, designated WS 4672T, WS 4998, WS 4992T, WS 4997 and WS 5000, isolated from bovine raw milk formed two individual groups in a phylogenetic analysis. The most similar species on the basis of 16S rRNA gene sequences were Pseudomonas azotoformans IAM 1603T, Pseudomonas gessardii CIP 105469T and Pseudomonas libanensis CIP 105460T showing 99.7-99.6 % similarity. Using rpoD gene sequences Pseudomonas veronii LMG 17761T (93.3 %) was most closely related to strain WS 4672T and Pseudomonas libanensis CIP 105460T to strain WS 4992T (93.3 %). The five strains could be differentiated from their closest relatives and from each other by phenotypic and chemotaxonomic characterization and ANIb values calculated from draft genome assemblies. ANIb values of strains WS 4992T and WS4671T to the closest relatives are lower than 90 %. The major cellular polar lipids of both strains are phosphatidylethanolamine, phosphatidylglycerol, a phospholipid and diphosphatidylglycerol, and their major quinone is Q-9. The DNA G+C content of strains WS 4992T and WS 4672T were 60.0  and 59.7  mol%, respectively. Based on these genotypic and phenotypic traits two novel species of the genus Pseudomonas are proposed: Pseudomonas lactis sp. nov. [with type strain WS 4992T (=DSM 29167T=LMG 28435T) and the additional strains WS 4997 and WS 5000], and Pseudomonasparalactis sp. nov. [with type strain WS 4672T (=DSM 29164T=LMG 28439T) and additional strain WS 4998].

  13. Food Safety and Raw Milk

    Science.gov (United States)

    ... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...

  14. Prevalence, Virulence Potential, and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan, India.

    Science.gov (United States)

    Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit

    2017-03-01

    Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

  15. Lactic acid bacteria from raw milk as potentially beneficial strains to prevent bovine mastitis.

    Science.gov (United States)

    Espeche, M Carolina; Pellegrino, Matías; Frola, Ignacio; Larriestra, Alejandro; Bogni, Cristina; Nader-Macías, M E Fátima

    2012-02-01

    Bovine mastitis produces a wide variety of problems in the dairy farm. The treatment of this disease is based on the use of antibiotics which are not always effective. These drugs are also responsible for the presence of residues in the milk and the increase of antibiotic-resistant strains. Probiotic products were proposed as a valid alternative to antibiotic therapies and are also useful for the prevention of infectious syndromes. With the aim of designing a probiotic product to prevent bovine mastitis, lactic acid bacteria (LAB) were isolated from foremilk samples from different dairy farms in Córdoba-Argentina. One hundred and seventeen LAB were isolated and their beneficial characteristics such as the production of inhibitory substances, surface properties and production of exopolysaccharides (EPS) were assessed. Most of them displayed low degree of hydrophobicity, autoaggregation, EPS negative phenotype and were identified as Enterococcus hirae and Pediococcus pentosaceus. Nine LAB strains inhibited three indicator bacteria. Some isolates were pre-selected and genetically identified according to the results obtained. Antibiotic resistance and virulence factors were studied for the assessment of the safety of the strains. The results obtained were compared to those reported previously from samples obtained in the North-western area of the country and some differences were found. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Isolation and characterization of large spectrum and multiple bacteriocin-producing Enterococcus faecium strain from raw bovine milk.

    Science.gov (United States)

    Gaaloul, N; ben Braiek, O; Hani, K; Volski, A; Chikindas, M L; Ghrairi, T

    2015-02-01

    To assess the antimicrobial properties of lactic acid bacteria from Tunisian raw bovine milk. A bacteriocin-producing Enterococcus faecium strain was isolated from raw cow milk with activity against Gram-positive and Gram-negative bacteria. Antimicrobial substances produced by this strain were sensitive to proteolytic enzymes and were thermostable and resistant to a broad range of pH (2-10). Mode of action of antimicrobial substances was determined as bactericidal. Maximum activity was reached at the end of the exponential growth phase when checked against Listeria ivanovii BUG 496 (2366.62 AU ml(-1)). However, maximum antimicrobial activity against Pseudomonas aeruginosa 28753 was recorded at the beginning of the exponential growth phase. Enterococcus faecium GGN7 was characterized as free from virulence factors and was susceptible to tested antibiotics. PCR analysis of the micro-organism's genome revealed the presence of genes coding for enterocins A and B. Mass spectrometry analysis of RP-HPLC active fractions showed molecular masses corresponding to enterocins A (4835.77 Da) and B (5471.56 Da), and a peptide with a molecular mass of 3215.5 Da active only against Gram-negative indicator strains. The latter was unique in the databases. Enterococcus faecium GGN7 produces three bacteriocins with different inhibitory spectra. Based on its antimicrobial properties and safety, Ent. faecium GGN7 is potentially useful for food biopreservation. The results suggest the bacteriocins from GGN7 strain could be useful for food biopreservation. © 2014 The Society for Applied Microbiology.

  17. Correlation between mastitis occurrence and the count of microorganisms in bulk raw milk of bovine dairy herds in four selective culture media.

    Science.gov (United States)

    Souto, Luís I M; Minagawa, Clarice Y; Telles, Evelise O; Garbuglio, Márcio A; Amaku, Marcos; Melville, Priscilla A; Dias, Ricardo A; Sakata, Sonia T; Benites, Nilson R

    2010-02-01

    Milk is the normal secretion of the mammary gland, practically free of colostrum and obtained by the complete milking of one or more healthy animals. Mastitis is an inflammatory process of the mammary gland and it may cause alterations in the milk. The present work aimed to verify whether it is possible, by means of the counts of microorganism in the bulk raw milk in four selective culture media, to establish a correlation with the occurrence of mastitis and therefore, to monitor this disease in bovine dairy herds. The following selective culture media were used: KF Streptococcus Agar, Edwards Agar, Baird-Parker Agar, Blood Agar plus potassium tellurite. Spearman's correlation coefficient was calculated in order to compare the occurrence of mastitis (percentage) in each herd with respective selective culture media counts of microorganisms in bulk raw milk. Thirty-six possibilities were analysed (Tamis and CMT-positive rates were compared with the log-transformed count in four selective culture media) and there was a negative correlation between Tamis 3 and the Baird-Parker Agar plate count. The total results of microbiological tests showed that there were three correlations of the counts in selective culture media. Fifty-two possibilities were analysed and there was a negative correlation between no-bacterial-growth mastitis rates and log10 of KF Streptoccocus Agar plate count and there were two positive correlations between coagulase-positive staphylococci and log10 of Baird-Parker Agar plate count and Blood Agar plus potassium tellurite plate count.

  18. Speciation of native cations and added radionuclides in raw bovine milk. I. membraneless dialysis in aqueous biphasic systems

    International Nuclear Information System (INIS)

    Macasek, F.; Gerhart, P.; Malovikova, A.; Celkova, A.

    1996-01-01

    Partition of native sodium, potassium, magnesium, calcium and radioisotopes of cesium, strontium and europium was investigated in the aqueous liquid-liquid systems formed after agitation of fresh pasteurized skim bovine milk with 4% w/w water solution of pectin of various degree of esterification (60-93%). The partition of the ions in the 'membraneless dialysis' was described by Donnan equilibria and ion-exchange in the macro-and microheterogenous systems and, within uncertainty of results, does not depend on the degree of esterification. Strong negative non-ideality of Sr and Eu in milk phase is attributed to binding with proteins, casein particles in particular, and complexation with low molecular ligands. Separation factor α = D(Sr)/D(Ca) is 0.70 ±0.06, in favor of strontium concentration in pectin phase. While>96% of cesium is diffusible to pectin phase, only 43-56% (depending on physico-chemical model of dialysis) of strontium behaves in that way, and in original milk phase the percent of strontium cationic from may be as low as 13%. (author). 24 refs., 8 figs., 4 tabs

  19. Raw milk consumption and health

    Directory of Open Access Journals (Sweden)

    Popović-Vranješ Anka

    2015-01-01

    Full Text Available Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39% outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%, bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79% outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market. [Projekat Ministarstva nauke Republike Srbije, br. TR31095

  20. Modeling to control spores in raw milk

    NARCIS (Netherlands)

    Vissers, M.

    2007-01-01

    A modeling approach was used to identify measures at the farm that reduce transmission of microorganisms to raw milk. Butyric acid bacteria (BAB) and Bacillus cereus were used as case-studies. Minimizing the concentration of BAB spores in raw milk is important to prevent late-blowing of Gouda-type

  1. Influence of raw milk quality on fluid milk shelf life.

    Science.gov (United States)

    Barbano, D M; Ma, Y; Santos, M V

    2006-03-01

    Pasteurized fluid milk shelf life is influenced by raw milk quality. The microbial count and somatic cell count (SCC) determine the load of heat-resistant enzymes in milk. Generally, high levels of psychrotrophic bacteria in raw milk are required to contribute sufficient quantities of heat-stable proteases and lipases to cause breakdown of protein and fat after pasteurization. Sanitation, refrigeration, and the addition of CO2 to milk are used to control both total and psychrotrophic bacteria count. It is not uncommon for total bacterial counts of raw milk to be milk processors have not focused much attention on milk SCC. Increased SCC is correlated with increased amounts of heat-stable protease (plasmin) and lipase (lipoprotein lipase) in milk. When starting with raw milk that has a low bacterial count, and in the absence of microbial growth in pasteurized milk, enzymes associated with high SCC will cause protein and fat degradation during refrigerated storage, and produce off-flavors. As the ability to kill, remove, or control microbial growth in pasteurized refrigerated milk continues to improve, the original milk SCC will be the factor limiting the time of refrigerated storage before development of an off-flavor in milk. Most healthy cows in a dairy herd have a milk SCC 200,000 cell/mL are usually due to the contribution of high SCC milk from a small number of cows in the herd. Technology to identify these cows and keep their milk out of the bulk tank could substantially increase the value of the remaining milk for use in fluid milk processing. To achieve a 60- to 90-d shelf life of refrigerated fluid milk, fluid processors and dairy farmers need to work together to structure economic incentives that allow farmers to produce milk with the SCC needed for extended refrigerated shelf life.

  2. Characterization of carbohydrate structures of bovine MUC15 and distribution of the mucin in bovine milk

    DEFF Research Database (Denmark)

    Pallesen, Lone Tjener; Pedersen, Lise Refstrup Linnebjerg; Petersen, Torben Ellebæk

    2007-01-01

    by densitometric scanning of Western blots. In raw milk, MUC15 was shown to constitute 0.08% (wt) of the protein and approximately 1.5% (wt) of the MFGM-associated proteins. Surprisingly, this study showed that in addition to the fat-containing fractions, such as MFGM and buttermilk, MUC15 was present in nonfat......The present work reports the characterization of carbohydrate structures and the distribution of the newly identified mucin MUC15, a highly glycosylated protein associated with the bovine milk fat globule membrane (MFGM). Distribution of MUC15 was investigated in various fractions of bovine milk......-containing fractions as well, such as skim milk and whey. Compositional and structural studies of the carbohydrates of bovine milk MUC15 showed that the glycans are composed of fucose, galactose, mannose, N-acetylgalactosamine, N-acetylglycosamine, and sialic acid. The carbohydrate was shown to constitute 65...

  3. Expanding the bovine milk proteome through extensive fractionation

    DEFF Research Database (Denmark)

    Nissen, Asger; Bendixen, Emøke; Ingvartsen, Klaus Lønne

    2013-01-01

    Bovine milk is an agricultural product of tremendous value worldwide. It contains proteins, fat, lactose, vitamins, and minerals. It provides nutrition and immunological protection (e.g., in the gastrointestinal tract) to the newborn and young calf. It also forms an important part of human...... of low abundant proteins. Further, the general health and udder health of the dairy cows delivering the milk may influence the composition of the milk proteome. To gain a more exhaustive and true picture of the milk proteome, we performed an extensive preanalysis fractionation of raw composite milk...... nutrition. The repertoire of proteins in milk (i.e., its proteome) is vast and complex. The milk proteome can be described in detail by mass spectrometry-based proteomics. However, the high concentration of dominating proteins in milk reduces mass spectrometry detection sensitivity and limits detection...

  4. A simple micro-batch ion-exchange resin extraction method coupled with reverse-phase HPLC (MBRE-HPLC) to quantify lactoferrin in raw and heat-treated bovine milk.

    Science.gov (United States)

    Pochet, Sylvie; Arnould, Céline; Debournoux, Perrine; Flament, Jocelyne; Rolet-Répécaud, Odile; Beuvier, Eric

    2018-09-01

    Lactoferrin is an iron-binding cationic glycoprotein (pI = 8.7) beneficial for mammal health, especially udder and milk preservation. A new simple two-step method of quantification was developed. Lactoferrin in 1 mL of bovine skim milk was first adsorbed onto 100 mg of macroporous sulfonated-resin at pH 6.8 by rotary stirring for 90 min at 20-25 °C. After washing the resin, lactoferrin was desorbed using 1 mL of 2 M NaCl containing phenylalanine as a dilution marker, then fully resolved and quantified by RP-HPLC at 220 nm using a wide-bore C4 silica column. This robust, inexpensive and flexible method improves selectivity (no protein interference) and sensitivity compared to previous HPLC methods. In-laboratory validation demonstrated its linearity (25 to 514 µg Lf mL -1 ), accuracy (110 to 98% recovery), and precision (<4%), which were comparable to immuno-based methods. The results for individual raw cow's milk were strongly correlated with results using an ELISA test. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Determination of essential nutrients in raw milk

    Directory of Open Access Journals (Sweden)

    Penphimon Phongphanphanee

    2006-03-01

    Full Text Available Milk production in Thailand has gradually increased since 1961. Occasional oversupply of raw milk has become one of dairy farmers' major problems. Increasing the consumption of milk by making use of its separated nutrients may offer a solution. This study was to assess the composition of raw milk produced in Thailand, which included fat, protein, lactose, solid-not-fat (SNF and total solid (TS. A large dairy cooperatives in Saraburi Province was selected for the study. About 9% of its total members, constituting 108 farms, were randomly chosen. They consisted of small size (less than 20 cows/farm, medium size (21-100 cows/farm and large size (>100 cows/farm. The majority was medium-size. Raw milk from each farm was sampled at the delivery site of the cooperatives in the morning. Milk data of the 108 farms were compiled at 3 different periods between February and July 2003. The raw milk was analyzed by the Fourier Transform Infrared Analysis (FTIR using MilkoScan FT6000. The results showed the average fat content of 3.50±0.47%, protein of 3.13±0.16%, lactose of 4.59±0.12%, SNF of 8.42±0.20%, and TS of 11.92±0.54%. The samples were superior in all of the nutrients as compared to the standard levels set by the Department of Livestock Development, except for TS. This indicates the possibility of a local production of milk nutrients such as lactose and protein as ingredients for the pharmaceutical and health food industries.

  6. Food safety hazards associated with consumption of raw milk.

    Science.gov (United States)

    Oliver, Stephen P; Boor, Kathryn J; Murphy, Steven C; Murinda, Shelton E

    2009-09-01

    An increasing number of people are consuming raw unpasteurized milk. Enhanced nutritional qualities, taste, and health benefits have all been advocated as reasons for increased interest in raw milk consumption. However, science-based data to substantiate these claims are limited. People continue to consume raw milk even though numerous epidemiological studies have shown clearly that raw milk can be contaminated by a variety of pathogens, some of which are associated with human illness and disease. Several documented milkborne disease outbreaks occurred from 2000-2008 and were traced back to consumption of raw unpasteurized milk. Numerous people were found to have infections, some were hospitalized, and a few died. In the majority of these outbreaks, the organism associated with the milkborne outbreak was isolated from the implicated product(s) or from subsequent products made at the suspected dairy or source. In contrast, fewer milkborne disease outbreaks were associated with consumption of pasteurized milk during this same time period. Twenty nine states allow the sale of raw milk by some means. Direct purchase, cow-share or leasing programs, and the sale of raw milk as pet food have been used as means for consumers to obtain raw milk. Where raw milk is offered for sale, strategies to reduce risks associated with raw milk and products made from raw milk are needed. Developing uniform regulations including microbial standards for raw milk to be sold for human consumption, labeling of raw milk, improving sanitation during milking, and enhancing and targeting educational efforts are potential approaches to this issue. Development of pre- and postharvest control measures to effectively reduce contamination is critical to the control of pathogens in raw milk. One sure way to prevent raw milk-associated foodborne illness is for consumers to refrain from drinking raw milk and from consuming dairy products manufactured using raw milk.

  7. Haptoglobin and serum amyloid A in bulk tank milk in relation to raw milk quality.

    Science.gov (United States)

    Akerstedt, Maria; Waller, Karin Persson; Sternesjö, Ase

    2009-11-01

    The aim of the present study was to evaluate relationships between the presence of the two major bovine acute phase proteins haptoglobin (Hp) and serum amyloid A (SAA) and raw milk quality parameters in bulk tank milk samples. Hp and SAA have been suggested as specific markers of mastitis but recently also as markers for raw milk quality. Since mastitis has detrimental effects on milk quality, it is important to investigate whether the presence of Hp or SAA indicates such changes in the composition and properties of the milk. Bulk tank milk samples (n=91) were analysed for Hp, SAA, total protein, casein, whey protein, proteolysis, fat, lactose, somatic cell count and coagulating properties. Samples with detectable levels of Hp had lower casein content, casein number and lactose content, but higher proteolysis than samples without Hp. Samples with detectable levels of SAA had lower casein number and lactose content, but higher whey protein content than samples without SAA. The presence of acute phase proteins in bulk tank milk is suggested as an indicator for unfavourable changes in the milk composition, e.g. protein quality, due to udder health disturbances, with economical implications for the dairy industry.

  8. Monitoring of psychrotrophic microorganisms in raw milk

    Directory of Open Access Journals (Sweden)

    Radka Burdychová

    2008-01-01

    Full Text Available The group of psychrotrophic microorganisms belongs to the microorganisms representing a risk for human health as well as a risk of milk and milk products spoilage. Some genus are considered to be significant producers of proteolytic and lipolytic enzymes. In this work, we analysed raw milk samples (n = 109 originated from 26 different suppliers from the area of North and Middle Moravia. The screening was performed from March 2007 to February 2008. The total bacterial counts (TBC ranged between 3.2 × 103 to 8.3 × 106 CFU/ml. The psychrotrophic bacterial counts (PBC ranged between 1.0 × 103 to 8.2 × 106 CFU/ml. Total of 48.62 % and 48.62 % of samples exceeded the hygienic limit in raw milk for TBC and PBC, respectively. The correlation between TBC and PBC was highly significant (r = 0.87.Significantly higher (P < 0.05 numbers of psychrotrophic microorganisms were detected in summer months. The identification of isolates was carried out and all strains were sreened for ability to produce proteolytic and lipolytic enzymes. The most commonly identified genus in raw milk was of the genus Pseudomonas. The ability to produce proteases or lipases was found at 76 % identified bacterial strains.

  9. Brucella contamination in raw milk by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2016-10-01

    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

  10. Effect of Technological Treatments on Human-Like Leptin Level in Bovine Milk for Human Consumption.

    Science.gov (United States)

    Magistrelli, Damiano; Rosi, Fabia

    2014-07-23

    In this experiment, raw milk and commercially available full-cream UHT milk, semi-skimmed UHT milk, skimmed UHT milk, full-cream pasteurized milk, semi-skimmed pasteurized milk and infant formulas for babies between 6 and 12 months of age were analyzed by RIA, with a method using an antibody directed against human leptin and human leptin as reference standard. Raw milk and full-cream UHT milk did not differ for human-like leptin. Leptin content of full-cream pasteurized milk was not different to that of full-cream UHT milk, but it was 14% lower ( p raw milk. Human-like leptin level of semi-skimmed UHT milk was not different to that of semi-skimmed pasteurized milk, but it was 30% lower ( p pasteurized milks. In skimmed UHT milk, leptin was 40% lower ( p milk. Leptin was correlated ( p milks. Results suggest that the heat treatment (pasteurization or UHT) is not a modifier of human-like leptin content of edible commercial bovine milks, whereas the skimming process significantly reduces milk leptin level.

  11. Effect of Technological Treatments on Human-Like Leptin Level in Bovine Milk for Human Consumption

    Directory of Open Access Journals (Sweden)

    Damiano Magistrelli

    2014-07-01

    Full Text Available In this experiment, raw milk and commercially available full-cream UHT milk, semi-skimmed UHT milk, skimmed UHT milk, full-cream pasteurized milk, semi-skimmed pasteurized milk and infant formulas for babies between 6 and 12 months of age were analyzed by RIA, with a method using an antibody directed against human leptin and human leptin as reference standard. Raw milk and full-cream UHT milk did not differ for human-like leptin. Leptin content of full-cream pasteurized milk was not different to that of full-cream UHT milk, but it was 14% lower (p < 0.05 than that observed in raw milk. Human-like leptin level of semi-skimmed UHT milk was not different to that of semi-skimmed pasteurized milk, but it was 30% lower (p < 0.0001 than those of full-cream UHT and full-cream pasteurized milks. In skimmed UHT milk, leptin was 40% lower (p < 0.0001 than in full-cream UHT milk. Leptin was correlated (p < 0.001 with lipid content. Leptin level of infant formulas was not different to that of skimmed milks. Results suggest that the heat treatment (pasteurization or UHT is not a modifier of human-like leptin content of edible commercial bovine milks, whereas the skimming process significantly reduces milk leptin level.

  12. Hygienic and other aspects of raw milk vending machines

    OpenAIRE

    DANIEL, Radovan

    2011-01-01

    The aim of this work was to evaluate opportunities of raw milk sales. The questionnaire was submitted to respondents, which assessed the direct sale of milk, consumption, awareness about milk quality connecting with the sales of raw milk using a vending machines.

  13. The hygienic quality of raw reindeer milk

    Directory of Open Access Journals (Sweden)

    Joanna Kurki

    2004-04-01

    Full Text Available The somatic cell count (SCC and total bacterial count (TBC as well as the presence of major food-borne pathogens and udder pathogens in reindeer raw milk were studied. Two groups of 4 female reindeer were milked on alternate days for six weeks. A milk sample from each quarter was taken before milking and of the bulk milk at the end of milking. Micrococcus sp. was observed in one, Staphylococcus aureus in one and coagulase-negative staphylococci in five of the quarter samples (n=318. In the bulk milk (n=19 TBC varied between 700 and 1 700 000 cfu (colony forming units/ml and SCC between 52 000 and 183 000 cells/ml. No Bacillus cereus, S. aureus or Listeria monocytogenes were detected in the bulk milk, but Escherichia coli and Enterobacteriaceae were found in 5 bulk milk samples. According to the bacteriological examination the udder health of the reindeer was good. Indicative information on the SCC of healthy reindeer was obtained. None of the common potential food-poisoning bacteria were found in raw milk. There was great variation in the bulk milk TBC and the average TBC was rather high (ca. 300 000 cfu/ml. The hygienic quality of raw reindeer milk makes it well suited for food manufacture. However, the results indicate that the milking conditions may be crucial for the quality of raw milk.Abstract in Finnish / Yhteenveto:Tutkimuksen kohteena oli poron raakamaidon solupitoisuus ja kokonaispesäkeluku sekä tärkeimpien elintarvike- ja utarepatogeenien esiintyminen raakamaidossa. Kaksi 4 vaatimen ryhmää lypsettiin vuoropäivinä 6 viikon ajan. Ennen lypsyä vaatimista otettiin vedinkohtaiset näytteet ja lypsyn päätyttyä näyte yhteismaidosta. Micrococcus sp. todettiin yhdessä, Staphylococcus aureus yhdessä ja koagulaasinegatiivisia stafylokokkeja viidessä vedinkohtaisessa näytteessä (n=318. Yhteismaitonäytteiden (n=19 kokonaispesäkeluvut vaihtelivat välillä 700-1 700 000 pmy (pesäkkeitä muodostava yksikkö/ml ja somaattisten

  14. Survey to determine why people drink raw milk.

    Science.gov (United States)

    Mullin, Gerard E; Belkoff, Stephen M

    2014-11-01

    Fragility fractures associated with osteoporosis extract a large financial and personal toll on society. Pharmaceutical or dietary calcium intake is needed to increase bone mineral density to prevent fragility fractures. Although dairy products are a good source of calcium, patients who are unable to digest lactose tend to avoid them and are put at a greater risk for fracture than the general population. Anecdotal reports suggest that lactose maldigesters, when consuming raw milk, have a dramatic reduction in symptoms relative to pasteurized milk. The mechanism of the reported reduction in symptoms, if true, is unknown. The purpose of the current study was to survey raw milk drinkers to ascertain their health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. An online survey regarding raw milk was completed by 153 of 1527 members of a raw milk-buying community. The primary reason the respondents cited for drinking raw milk was that they believed it was more healthful; 30% reported some gastrointestinal discomfort when drinking pasteurized milk, yet almost all (99%) reported consuming raw milk without discomfort. Despite the reports of gastrointestinal discomfort, only 5% of respondents had been diagnosed as lactose intolerant by a medical professional, and only 1% had been diagnosed as lactose intolerant via the gold-standard hydrogen breath test. The primary motivation for drinking raw milk is its perceived health value, not its digestibility. Although raw milk appears to be more easily digested than pasteurized milk in our survey sample, the mechanism of digestibility remains unknown.

  15. Hygienic quality of raw milk with regard to legislation

    Directory of Open Access Journals (Sweden)

    Slavko Kirin

    2001-01-01

    Full Text Available Hygienic quality of raw milk is basic indicator of hygienic conditionduring processing and handling of milk as well as economical valorisation of animal product as a raw material in dairy products manufacture. Thus, total bacterial count in 1 mL of raw milk is used in modern legislation in milk pricing system. Apart from the economical and technological reasons hygienic quality of raw milk is also important from the health safety issue. In this paper microbiological quality legislation, set down by the EU and Croatian directives, are presented. Apart form the total microorganisms number the normative on the somatic cell number in row milk, as one of the quality indicators, are also presented. Pricing system of raw milk with regard to hygienic quality, current legislation especially from the point of view of a new legislation on row milk quality as well as suggestions to faster association into progressive dairy, legislation are listed.

  16. Microbiological quality and safety of raw and pasteurized milk ...

    African Journals Online (AJOL)

    This requires urgent attention by the appropriate authorities, because the poor microbiological quality of raw milk and pasteurized milk may expose consumers to health risks associated with the consumption of contaminated milk. Key words: Marketed milk, quality, acidity, total viable count, coliforms, enterobacteriaceae, ...

  17. Expanding the bovine milk proteome through extensive fractionation.

    Science.gov (United States)

    Nissen, Asger; Bendixen, Emøke; Ingvartsen, Klaus Lønne; Røntved, Christine Maria

    2013-01-01

    Bovine milk is an agricultural product of tremendous value worldwide. It contains proteins, fat, lactose, vitamins, and minerals. It provides nutrition and immunological protection (e.g., in the gastrointestinal tract) to the newborn and young calf. It also forms an important part of human nutrition. The repertoire of proteins in milk (i.e., its proteome) is vast and complex. The milk proteome can be described in detail by mass spectrometry-based proteomics. However, the high concentration of dominating proteins in milk reduces mass spectrometry detection sensitivity and limits detection of low abundant proteins. Further, the general health and udder health of the dairy cows delivering the milk may influence the composition of the milk proteome. To gain a more exhaustive and true picture of the milk proteome, we performed an extensive preanalysis fractionation of raw composite milk collected from documented healthy cows in early lactation. Four simple and industrially applicable techniques exploring the physical and chemical properties of milk, including acidification, filtration, and centrifugation, were used for separation of the proteins. This resulted in 5 different fractions, whose content of proteins were compared with the proteins of nonfractionated milk using 2-dimensional liquid chromatography tandem mass spectrometry analysis. To validate the proteome analysis, spectral counts and ELISA were performed on 7 proteins using the ELISA for estimation of the detection sensitivity limit of the 2-dimensional liquid chromatography tandem mass spectrometry analysis. Each fractionation technique resulted in identification of a unique subset of proteins. However, high-speed centrifugation of milk to whey was by far the best method to achieve high and repeatable proteome coverage. The total number of milk proteins initially detected in nonfractionated milk and the fractions were 635 in 2 replicates. Removal of dominant proteins and filtering for redundancy across the

  18. Radioimmunoassay for progesterone in bovine milk

    International Nuclear Information System (INIS)

    Ruiz, Miriam; Figueredo, Nancy; Castillo, Sonia; Pizarro

    2002-01-01

    A system for the measurement of progesterone in bovine milk by radioimmunoassay has been developed and validated. This assay includes an iodine tracer purified by HPLC, the standard prepared in fat-free milk and an antibody anti-progesterone combined with second antibody. The detection limit of the assay is at 0.2 nmol/L calculated from the maximum binding menus two standard deviations and the precision is satisfactory. In the recovery assay was used 4 milk different samples and the result was 98% of recuperation. The progesterone was determinate in milk samples from post-partum animals taking samples three times per week for 40 days. The assay is simple, rapid and possibility the progesterone measurement without sample dilution, distinguish the cyclic changes of this hormone that reflect the ovarian activity in the animals. (author)

  19. Detection and characterisation of Complement protein activity in bovine milk by bactericidal sequestration assay.

    Science.gov (United States)

    Maye, Susan; Stanton, Catherine; Fitzgerald, Gerald F; Kelly, Philip M

    2015-08-01

    While the Complement protein system in human milk is well characterised, there is little information on its presence and activity in bovine milk. Complement forms part of the innate immune system, hence the importance of its contribution during milk ingestion to the overall defences of the neonate. A bactericidal sequestration assay, featuring a Complement sensitive strain, Escherichia coli 0111, originally used to characterise Complement activity in human milk was successfully applied to freshly drawn bovine milk samples, thus, providing an opportunity to compare Complement activities in both human and bovine milks. Although not identical in response, the levels of Complement activity in bovine milk were found to be closely comparable with that of human milk. Differential counts of Esch. coli 0111 after 2 h incubation were 6.20 and 6.06 log CFU/ml, for raw bovine and human milks, respectively - the lower value representing a stronger Complement response. Exposing bovine milk to a range of thermal treatments e.g. 42, 45, 65, 72, 85 or 95 °C for 10 min, progressively inhibited Complement activity by increasing temperature, thus confirming the heat labile nature of this immune protein system. Low level Complement activity was found, however, in 65 and 72 °C heat treated samples and in retailed pasteurised milk which highlights the outer limit to which high temperature, short time (HTST) industrial thermal processes should be applied if retention of activity is a priority. Concentration of Complement in the fat phase was evident following cream separation, and this was also reflected in the further loss of activity recorded in low fat variants of retailed pasteurised milk. Laboratory-based churning of the cream during simulated buttermaking generated an aqueous (buttermilk) phase with higher levels of Complement activity than the fat phase, thus pointing to a likely association with the milk fat globule membrane (MFGM) layer.

  20. Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland

    DEFF Research Database (Denmark)

    Scullion, R.; Harrington, C.S.; Madden, R.H.

    2006-01-01

    A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....

  1. Genomic regions associated with bovine milk fatty acids in both summer and winter milk samples

    NARCIS (Netherlands)

    Bouwman, A.C.; Visker, M.H.P.W.; Arendonk, van J.A.M.; Bovenhuis, H.

    2012-01-01

    Background - In this study we perform a genome-wide association study (GWAS) for bovine milk fatty acids from summer milk samples. This study replicates a previous study where we performed a GWAS for bovine milk fatty acids based on winter milk samples from the same population. Fatty acids from

  2. Incidence of Listeria species in bovine, ovine, caprine, camel and water buffalo milk using cultural method and the PCR assay

    Directory of Open Access Journals (Sweden)

    Ebrahim Rahimi

    2014-02-01

    Full Text Available Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. Results: Using cultural method, 19 samples (7.3% were positive for Listeria spp. The highest prevalence of Listeria was found in raw water buffalo milk (11.8%, followed by raw bovine milk (10.6%, raw ovine milk (7.1%, and raw caprine milk (4.2% samples. All 37 camel milk samples from 20 camel breeding farms were negative for Listeria spp. The overall prevalence of Listeria was 7.3%, in which Listeria innocua was the most recovered species (4.2%; the remaining isolates were Listeria monocytogenes (1.9%, Listeria ivanovii (0.08% and Listeria seeligari (0.04%. The PCR assay could identify 8 Listeria-contaminated milk samples that were negative using the cultural method. Conclusions: The results presented in this study indicate the potential risk of infection with Listeria in people consuming raw and unpasteurized milk.

  3. Composition of raw cow milk and artisanal yoghurt collected in ...

    African Journals Online (AJOL)

    The composition of milk is of most importance to the dairy industry and human health. This study was conducted to provide data on the composition of raw cow milk and artisanal yoghurt collected in Maroua (Cameroon). Milk and yoghurt samples were collected from 11 breeding sites and 12 producers in the city of Maroua, ...

  4. Microbes from raw milk for fermented dairy products

    NARCIS (Netherlands)

    Wouters, J.T.M.; Ayad, E.H.E.; Hugenholtz, J.; Smit, G.

    2002-01-01

    Milk has a high nutritive value, not only For the new-born mammal and for the human consumer, but also for microbes. Raw milk kept at roam temperature will be liable to microbial spoilage. After some days, the milk will spontaneously become sour. This is generally due to the activity of lactic acid

  5. Bioelectrical impedance analysis of bovine milk fat

    Science.gov (United States)

    Veiga, E. A.; Bertemes-Filho, P.

    2012-12-01

    Three samples of 250ml at home temperature of 20°C were obtained from whole, low fat and fat free bovine UHT milk. They were analysed by measuring both impedance spectra and dc conductivity in order to establish the relationship between samples related to fat content. An impedance measuring system was developed, which is based on digital oscilloscope, a current source and a FPGA. Data was measured by the oscilloscope in the frequency 1 kHz to 100 kHz. It was showed that there is approximately 7.9% difference in the conductivity between whole and low fat milk whereas 15.9% between low fat and free fat one. The change of fatness in the milk can be significantly sensed by both impedance spectra measurements and dc conductivity. This result might be useful for detecting fat content of milk in a very simple way and also may help the development of sensors for measuring milk quality, as for example the detection of mastitis.

  6. Bioelectrical impedance analysis of bovine milk fat

    Energy Technology Data Exchange (ETDEWEB)

    Veiga, E A; Bertemes-Filho, P [Department of Electrical Eng., State University of Santa Catarina, Joinville (Brazil)

    2012-12-20

    Three samples of 250ml at home temperature of 20 Degree-Sign C were obtained from whole, low fat and fat free bovine UHT milk. They were analysed by measuring both impedance spectra and dc conductivity in order to establish the relationship between samples related to fat content. An impedance measuring system was developed, which is based on digital oscilloscope, a current source and a FPGA. Data was measured by the oscilloscope in the frequency 1 kHz to 100 kHz. It was showed that there is approximately 7.9% difference in the conductivity between whole and low fat milk whereas 15.9% between low fat and free fat one. The change of fatness in the milk can be significantly sensed by both impedance spectra measurements and dc conductivity. This result might be useful for detecting fat content of milk in a very simple way and also may help the development of sensors for measuring milk quality, as for example the detection of mastitis.

  7. Bioelectrical impedance analysis of bovine milk fat

    International Nuclear Information System (INIS)

    Veiga, E A; Bertemes-Filho, P

    2012-01-01

    Three samples of 250ml at home temperature of 20°C were obtained from whole, low fat and fat free bovine UHT milk. They were analysed by measuring both impedance spectra and dc conductivity in order to establish the relationship between samples related to fat content. An impedance measuring system was developed, which is based on digital oscilloscope, a current source and a FPGA. Data was measured by the oscilloscope in the frequency 1 kHz to 100 kHz. It was showed that there is approximately 7.9% difference in the conductivity between whole and low fat milk whereas 15.9% between low fat and free fat one. The change of fatness in the milk can be significantly sensed by both impedance spectra measurements and dc conductivity. This result might be useful for detecting fat content of milk in a very simple way and also may help the development of sensors for measuring milk quality, as for example the detection of mastitis.

  8. Encephalitozoon cuniculi in Raw Cow's Milk Remains Infectious After Pasteurization.

    Science.gov (United States)

    Kváč, Martin; Tomanová, Vendula; Samková, Eva; Koubová, Jana; Kotková, Michaela; Hlásková, Lenka; McEvoy, John; Sak, Bohumil

    2016-02-01

    This study describes the prevalence of Encephalitozoon cuniculi in raw cow's milk and evaluates the effect of different milk pasteurization treatments on E. cuniculi infectivity for severe combined immunodeficient (SCID) mice. Using a nested polymerase chain reaction approach, 1 of 50 milking cows was found to repeatedly shed E. cuniculi in its feces and milk. Under experimental conditions, E. cuniculi spores in milk remained infective for SCID mice following pasteurization treatments at 72 °C for 15 s or 85 °C for 5 s. Based on these findings, pasteurized cow's milk should be considered a potential source of E. cuniculi infection in humans.

  9. Consumption of raw or unpasteurized milk and milk products by pregnant women and children.

    Science.gov (United States)

    2014-01-01

    Sales of raw or unpasteurized milk and milk products are still legal in at least 30 states in the United States. Raw milk and milk products from cows, goats, and sheep continue to be a source of bacterial infections attributable to a number of virulent pathogens, including Listeria monocytogenes, Campylobacter jejuni, Salmonella species, Brucella species, and Escherichia coli O157. These infections can occur in both healthy and immunocompromised individuals, including older adults, infants, young children, and pregnant women and their unborn fetuses, in whom life-threatening infections and fetal miscarriage can occur. Efforts to limit the sale of raw milk products have met with opposition from those who are proponents of the purported health benefits of consuming raw milk products, which contain natural or unprocessed factors not inactivated by pasteurization. However, the benefits of these natural factors have not been clearly demonstrated in evidence-based studies and, therefore, do not outweigh the risks of raw milk consumption. Substantial data suggest that pasteurized milk confers equivalent health benefits compared with raw milk, without the additional risk of bacterial infections. The purpose of this policy statement was to review the risks of raw milk consumption in the United States and to provide evidence of the risks of infectious complications associated with consumption of unpasteurized milk and milk products, especially among pregnant women, infants, and children.

  10. Gravity separation of fat, somatic cells, and bacteria in raw and pasteurized milks.

    Science.gov (United States)

    Caplan, Z; Melilli, C; Barbano, D M

    2013-04-01

    The objective of experiment 1 was to determine if the extent of gravity separation of milk fat, bacteria, and somatic cells is influenced by the time and temperature of gravity separation or the level of contaminating bacteria present in the raw milk. The objective of experiment 2 was to determine if different temperatures of milk heat treatment affected the gravity separation of milk fat, bacteria, and somatic cells. In raw milk, fat, bacteria, and somatic cells rose to the top of columns during gravity separation. About 50 to 80% of the fat and bacteria were present in the top 8% of the milk after gravity separation of raw milk. Gravity separation for 7h at 12°C or for 22h at 4°C produced equivalent separation of fat, bacteria, and somatic cells. The completeness of gravity separation of fat was influenced by the level of bacteria in the milk before separation. Milk with a high bacterial count had less (about 50 to 55%) gravity separation of fat than milk with low bacteria count (about 80%) in 22h at 4°C. Gravity separation caused fat, bacteria, and somatic cells to rise to the top of columns for raw whole milk and high temperature, short-time pasteurized (72.6°C, 25s) whole milk. Pasteurization at ≥76.9°C for 25s prevented all 3 components from rising, possibly due to denaturation of native bovine immunoglobulins that normally associate with fat, bacteria, and somatic cells during gravity separation. Gravity separation can be used to produce reduced-fat milk with decreased bacterial and somatic cell counts, and may be a critical factor in the history of safe and unique traditional Italian hard cheeses produced from gravity-separated raw milk. A better understanding of the mechanism of this natural process could lead to the development of new nonthermal thermal technology (that does not involve heating the milk to high temperatures) to remove bacteria and spores from milk or other liquids. Copyright © 2013 American Dairy Science Association. Published by

  11. Pellet-free isolation of human and bovine milk extracellular vesicles by size-exclusion chromatography.

    Science.gov (United States)

    Blans, Kristine; Hansen, Maria S; Sørensen, Laila V; Hvam, Michael L; Howard, Kenneth A; Möller, Arne; Wiking, Lars; Larsen, Lotte B; Rasmussen, Jan T

    2017-01-01

    Studies have suggested that nanoscale extracellular vesicles (EV) in human and bovine milk carry immune modulatory properties which could provide beneficial health effects to infants. In order to assess the possible health effects of milk EV, it is essential to use isolates of high purity from other more abundant milk structures with well-documented bioactive properties. Furthermore, gentle isolation procedures are important for reducing the risk of generating vesicle artefacts, particularly when EV subpopulations are investigated. In this study, we present two isolation approaches accomplished in three steps based on size-exclusion chromatography (SEC) resulting in effective and reproducible EV isolation from raw milk. The approaches do not require any EV pelleting and can be applied to both human and bovine milk. We show that SEC effectively separates phospholipid membrane vesicles from the primary casein and whey protein components in two differently obtained casein reduced milk fractions, with one of the fractions obtained without the use of ultracentrifugation. Milk EV isolates were enriched in lactadherin, CD9, CD63 and CD81 compared to minimal levels of the EV-marker proteins in other relevant milk fractions such as milk fat globules. Nanoparticle tracking analysis and electron microscopy reveals the presence of heterogeneous sized vesicle structures in milk EV isolates. Lipid analysis by thin layer chromatography shows that EV isolates are devoid of triacylglycerides and presents a phospholipid profile differing from milk fat globules surrounded by epithelial cell plasma membrane. Moreover, the milk EV fractions are enriched in RNA with distinct and diverging profiles from milk fat globules. Collectively, our data supports that successful milk EV isolation can be accomplished in few steps without the use of ultracentrifugation, as the presented isolation approaches based on SEC effectively isolates EV in both human and bovine milk.

  12. Pellet-free isolation of human and bovine milk extracellular vesicles by size-exclusion chromatography

    DEFF Research Database (Denmark)

    Blans, Kristine Ingrid Marie; Hansen, Maria Stenum; Sørensen, Laila V.

    2017-01-01

    -marker proteins in other relevant milk fractions such as milk fat globules. Nanoparticle tracking analysis and electron microscopy reveals the presence of heterogeneous sized vesicle structures in milk EV isolates. Lipid analysis by thin layer chromatography shows that EV isolates are devoid of triacylglycerides...... accomplished in three steps based on size-exclusion chromatography (SEC) resulting in effective and reproducible EV isolation from raw milk. The approaches do not require any EV pelleting and can be applied to both human and bovine milk. We show that SEC effectively separates phospholipid membrane vesicles...... from the primary casein and whey protein components in two differently obtained casein reduced milk fractions, with one of the fractions obtained without the use of ultracentrifugation. Milk EV isolates were enriched in lactadherin, CD9, CD63 and CD81 compared to minimal levels of the EV...

  13. Effects of storage on the major constituents of raw milk

    Directory of Open Access Journals (Sweden)

    Peter Zajác

    2015-10-01

    Full Text Available Milk testing and quality control should be carried out at all stages of the dairy chain. Milk can be tested for quantity, organoleptic characteristic, compositional characteristic, physical and chemical characteristics, hygienic characteristics, adulteration or drug residues. The content of the major constituents of raw milk is important for milk payment system. Enzymes naturally present in the milk can change the chemical composition of raw milk. Also, enzymes secreted by bacteria or enzymes from somatic cells can degrade the raw milk composition. Products of these degradation reactions can have undesirable effects on milk structure, smell and taste. It is very important that farm-fresh raw milk be cooled immediately to not more than 8 °C in the case of daily collection, or not more than 6 °C if collection is not daily. During transport the cold chain must be maintained. An authorized person, properly trained in the appropriate technique, shall perform sampling of bulk milk in farm. Laboratory samples should be dispatched immediately after sampling to the dairy company and consequently to the testing laboratory. The time for dispatch of the samples to the testing laboratory should be as short as possible, preferably within 24 h. Laboratory samples shall be transported and stored at temperature 1 to 5 °C. Higher temperatures may adversely affect the composition of the laboratory sample and may cause disputes between the farmer, the dairy company and the laboratory. The effect of refrigerated storage at temperature 4 °C during 24 h on the composition of raw milk were investigated in this work, because we wanted to know how the milk composition will be changed and how the laboratory results will be affected. In many cases, the samples are not preserved with chemical preservants like azidiol, bronopol, potassium dichromate or Microtabs. We found, that the composition of raw cows' milk after 24 was changed significantly (p >0.005. We found an

  14. Quality control of raw cows' milk by headspace analysis

    NARCIS (Netherlands)

    Hettinga, K.A.; Valenberg, van H.J.F.; Hooijdonk, van A.C.M.

    2008-01-01

    This study investigated whether headspace analysis of volatile components can be used for monitoring the quality of raw cows¿ milk. The detection of different quality defects caused by cows¿ feed, microbiological and chemical contamination, as well as enzymatic deterioration was studied. Fresh raw

  15. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Monitoring of foodborne pathogens in raw cow milk in Tuscany

    Directory of Open Access Journals (Sweden)

    Laura Gasperetti

    2014-03-01

    Full Text Available Raw milk consumption in Italy has increased over the last few years and although raw milk is characterised by cold chain, short shelf-life and the duty of boiling before domestic consumption, it is still considered a hazard. From 2010 to 2013 a monitoring survey of raw milk sold through vending machines was carried out to investigate the occurrence of several foodborne pathogens stipulated in the national legal requirements, i.e. Listeria monocytogenes, Campylobacter spp., Salmonella spp., Escherichia coli O:157 and coagulase-positive Staphylococci. A total of 127 raw milk samples were collected from 19 dairy herds in Tuscany Region, Italy. In addition, the milk samples were tested for the presence and count of Yersinia genus. Results shown that only one sample was positive for non verocytotoxin- producing E. coli O:157, whereas a total of 38 samples (29.9% were postive for Yersinia genus; of the total 39 isolated bacteria, 23.6% were Y. enterocolitica, 2.4% Y. kristenseni and 4.7% Y. frederiksenii. None isolate was enteropathogenic; serotypes O:5 and O:8 were found in 16.6 and 13.3% of the isolates respectively, whereas none of the serotypes tested was detected in 70% of the isolates. The most probable number method revealed a count value between 0.03 and 24 MPN/mL. Based on these data a general assurance on health safety of raw milk produced and sold in Tuscany could be assessed.

  17. [Investigation of gestagenic effect of raw drone milk in rats].

    Science.gov (United States)

    Seres, Adrienn; Ducza, Eszter; Gáspár, Róbert

    2014-01-01

    Numerous honeybee products are used in traditional medicine. The best-known honeybee products are the honey, the propolis and the royal jelly. Drone milk is a relatively little-known honeybee product. Although, drone milk is traditionally used to treat infertility and to promote vitality in both men and women in certain countries, the literature furnishes no information concerning effects of the drone milk. The oestrogenic and androgenic effects of drone milk have recently been reported in rats and the effective compounds have also been identified. The aim of this study was to determine the putative gestagenic effect of raw drone milk in rats. Maintenance of pregnancy assays revealed that drone milk was able to increase the number of surviving fetuses. This results suggested some gestagenic effects. This effect was confirmed by RT-PCR and Western blot methods in which the mRNA and protein expressions of gestagen-dependent CRLR (Calcitonin Receptor-Like Receptor) peptide were determined. To determine the efficacy of gestagenic effect of drone milk, spironolactone (weak gestagen compound) was used. The combination of drone milk and spironolactone showed more potent gestagenic effect. These results lead us to suppose that raw drone milk shows weak gestagenic effect and this effect can be increased by another weak gestagen. Further studies are required to clarify the gestagenic mechanisms of action of drone milk.

  18. Raw Milk Hygiene at Local Markets and Automatic Milk Dispenser Machines

    Directory of Open Access Journals (Sweden)

    Gheorghe Şteţca

    2014-11-01

    Full Text Available In Romania, direct sales of raw milk to the final consumer is developed based on the local regulations. These are in accordance to European Regulation that must meet some quality requirements for the total number of germs, somatic cells, without antibiotics, coming from healthy animals who did not suffer from diseases that can be transmitted to humans through milk. Raw milk is sold in Romania in local markets and by automatic milk dispenser machines. Based on these regulations, a study regarding the quality and security to human health of raw milk was conducted on the commercialized milk in local markets and automatic milk dispensers. During May-June 2014 samples of raw milk were collected from Cluj-Napoca local markets and automatic milk dispensers. All samples were kept to refrigeration conditions until the moment of analyze which took place at the sampling day. The following parameters were taken into account: fat content, protein, casein, lactose, nonfat dry matter, pH, milk freezing point, added water, antibiotics residues, milk urea, number of germ cells and somatic cells. All obtained results were verified by the validated methods applied. Our research can be forward conducted in order to verify the hygiene and composition of milk from the whole dairy chain. 

  19. 119-132 Microbiological Quality of Raw Cow Milk across the Milk ...

    African Journals Online (AJOL)

    t

    equipment of producers in rural areas of Babile district; from the equipment of .... pastoral areas is supplied to urban centers through informal milk marketing channels ... raw milk across the milk supply chain to ensure safety and suitability ... Materials and Methods. 2.1. ... Ethiopia at 9°36′ N latitude and 41°52′ E longitude.

  20. Strontium-90 and cesium-137 in raw milk

    International Nuclear Information System (INIS)

    1979-01-01

    Under the commission of Science and Technology Agency, prefectural public health laboratories and institutes and Japan Chemical Analysis Center have measured the levels of 90 Sr and 137 Cs in milk samples. Sampling was done as follows: 4 times of raw milk samples a year in 10 prefectures for the report to WHO, 2 times of raw milk samples a year in 4 prefectures; and 2 times of city milk samples a year in 29 prefectures. Three litters of fresh milk were collected and carbonated in the prefectural public health laboratories and institutes of each prefecture, and the carbonated samples were collected at Japan Chemical Analysis Center. At Japan Chemical Analysis Center, these collected samples were radiochemically analysed for 90 Sr and 137 Cs using the method applied for the analysis of the radionuclides contents in total diet materials. (author)

  1. Prevalence of the pathogen microorganisms in raw cow milk

    Directory of Open Access Journals (Sweden)

    Angelovski Ljupco

    2009-11-01

    Full Text Available The aim of this study was to study the prevalence of Salmonella spp., Listeria spp., Staphylococcus spp. and E. coli in the raw cow milk. In this study 133 milk-tank samples from several milk collecting points were analysed. After the tests the following prevalence was detected: for Listeria spp. 13 positive samples (9.77%, with 9 Listeria monocytogenes samples confirmed (6.76%. Salmonella spp. was not detected in any of the the samples. The biggest presence was detected for Staphylococcus spp. with 113 positive samples (85.0%. Further testes has shown prevalence of coagulase-positive staphylococci of 73% (97 positive samples. Escherichia coli was confirmed in 57 samples (46.0%. The results from this study clearly indicate that pathogen microorganisms which are important for the human health can be found in the raw cow milk and their presence can be potential hazard for contamination of the milk-processing establishments.

  2. Quantitative milk genomics: estimation of variance components and prediction of fatty acids in bovine milk

    DEFF Research Database (Denmark)

    Krag, Kristian

    The composition of bovine milk fat, used for human consumption, is far from the recommendations for human fat nutrition. The aim of this PhD was to describe the variance components and prediction probabilities of individual fatty acids (FA) in bovine milk, and to evaluate the possibilities...

  3. On-line milk spectrometry: analysis of bovine milk composition

    Science.gov (United States)

    Spitzer, Kyle; Kuennemeyer, Rainer; Woolford, Murray; Claycomb, Rod

    2005-04-01

    We present partial least squares (PLS) regressions to predict the composition of raw, unhomogenised milk using visible to near infrared spectroscopy. A total of 370 milk samples from individual quarters were collected and analysed on-line by two low cost spectrometers in the wavelength ranges 380-1100 nm and 900-1700 nm. Samples were collected from 22 Friesian, 17 Jersey, 2 Ayrshire and 3 Friesian-Jersey crossbred cows over a period of 7 consecutive days. Transmission spectra were recorded in an inline flowcell through a 0.5 mm thick milk sample. PLS models, where wavelength selection was performed using iterative PLS, were developed for fat, protein, lactose, and somatic cell content. The root mean square error of prediction (and correlation coefficient) for the nir and visible spectrometers respectively were 0.70%(0.93) and 0.91%(0.91) for fat, 0.65%(0.5) and 0.47%(0.79) for protein, 0.36%(0.49) and 0.45%(0.43) for lactose, and 0.50(0.54) and 0.48(0.51) for log10 somatic cells.

  4. Results from raw milk microbiological tests do not predict the shelf-life performance of commercially pasteurized fluid milk.

    Science.gov (United States)

    Martin, N H; Ranieri, M L; Murphy, S C; Ralyea, R D; Wiedmann, M; Boor, K J

    2011-03-01

    Analytical tools that accurately predict the performance of raw milk following its manufacture into commercial food products are of economic interest to the dairy industry. To evaluate the ability of currently applied raw milk microbiological tests to predict the quality of commercially pasteurized fluid milk products, samples of raw milk and 2% fat pasteurized milk were obtained from 4 New York State fluid milk processors for a 1-yr period. Raw milk samples were examined using a variety of tests commonly applied to raw milk, including somatic cell count, standard plate count, psychrotrophic bacteria count, ropy milk test, coliform count, preliminary incubation count, laboratory pasteurization count, and spore pasteurization count. Differential and selective media were used to identify groups of bacteria present in raw milk. Pasteurized milk samples were held at 6°C for 21 d and evaluated for standard plate count, coliform count, and sensory quality throughout shelf-life. Bacterial isolates from select raw and pasteurized milk tests were identified using 16S ribosomal DNA sequencing. Linear regression analysis of raw milk test results versus results reflecting pasteurized milk quality consistently showed low R(2) values (tests and results from tests used to evaluate pasteurized milk quality. Our findings suggest the need for new raw milk tests that measure the specific biological barriers that limit shelf-life and quality of fluid milk products. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. Rapid determination of ampicillin in bovine milk by liquid chromatography with fluorescence detection

    Energy Technology Data Exchange (ETDEWEB)

    Ang, C.Y.W.; Luo, Wenhong [National Center for Toxicological Research, Jefferson, AR (United States)

    1997-01-01

    A rapid and sensitive liquid chromatographic (LC) method was developed for the determination of ampicillin residues in raw bovine milk, processed skim milk, and pasteurized, homogenized whole milk with vitamin D. Milk samples were deproteinized with trichloroacetic acid (TCA) and acetonictrile. After centrifugation, the clear supernatant was reacted with formaldehyde and TCA under heat. The major fluorescent derivative of ampicillin was then determined by reversed-phase LC with fluorescence detection. Average recoveries of ampicillin fortified at 5, 10, and 20 ppb (ng/mL) were all >85% with coefficients of variation <10%. Limits of detection ranged from 0.31 to 0.51 ppb and limits of quantitation, from 0.66 to 1.2 ppb. After appropriate validation, this method should be suitable for rapid analysis of milk for ampicillin residues at the tolerance level of 10 ppb. 16 refs., 4 figs., 3 tabs.

  6. Improved growth of preterm infants receiving mother's own raw milk compared with pasteurized donor milk.

    Science.gov (United States)

    Montjaux-Régis, N; Cristini, C; Arnaud, C; Glorieux, I; Vanpee, M; Casper, C

    2011-12-01

    To determine whether growth, feeding tolerance and infectious events of preterm infants is related to the proportion of intake of mother's own raw milk (maternal milk) versus pooled pasteurized banked breast milk (donor milk). This is a prospective observational study of 55 premature infants born less than 32 weeks of gestational age admitted to the neonatal intensive care unit at the Children's Hospital of Toulouse during two 6-month periods from 2003 to 2005. Enrolled infants were exclusively on enteral feeds with maternal milk ± donor milk. Mean gestational age was 28.6 weeks (SD 1.5) and mean birth weight 1105 grams (SD 282). During the time of exclusively breast milk feeds, weight gain (g/kg/day) was correlated to the proportion of maternal milk consumed (p = 0.0048, r = 0.4). Necrotizing enterocolitis was inversely correlated to the amount of maternal milk. The amount of maternal milk did not impact on infectious events. Mother's own raw milk improves weight gain compared with donor milk in preterm infants. Lactation strategies should be sought that helps mothers to increase their milk production. © 2011 The Author(s)/Acta Paediatrica © 2011 Foundation Acta Paediatrica.

  7. Genes involved in bovine milk-fat composition

    NARCIS (Netherlands)

    Schennink, A.

    2009-01-01

    The aim of the research described in this thesis was to identify genes that underlie the genetic variation in bovine milk-fat composition. The fat composition of milk samples from approximately 2,000 Dutch Holstein Friesian cows in their first lactation was measured by gas chromatography.

  8. Quality aspects of raw goat milk in Lower Southern Thailand

    OpenAIRE

    Siriwat Wasiksiri; Usa Chethanond; Sahutaya Pongprayoon; Somjit Srimai; Bunjob Nasae

    2010-01-01

    This study was conducted to determine the quality and safety of raw goat milk in Lower Southern Thailand duringAugust to September 2008. Milk samples were collected from five farms in Songkhla, Yala, and Pattani Province of which thepH, acidity, specific gravity, milk fat, solid not fat, total solid, total plate count, Coliform count, and antibiotic residue weretested. The results did not show any significant difference (p>0.05) on pH and total plate count among samples from eachfarm. However...

  9. Spoilage potential of Paenibacillussp. in Brazilian raw milk

    Directory of Open Access Journals (Sweden)

    José Carlos Ribeiro Júnior

    2016-04-01

    Full Text Available ABSTRACT: Bacterial spores are widespread in the environment and can contaminate milk. Spores are resistant to thermal conditions and your germination reduces milk shelf-life because the aerobic bacteria that are sporulated produce proteases and lipases. The aim of this study was identify Paenibacillus sp., the spoilage microbiota, arising from the germination of spores in raw milk and your spoilage potential. Twenty different milk samples were treated at 80°C/12min and plated to isolate spore-forming bacteria. These strains were picked in milk agar and tributyrin agar for verification of their potential proteolytic and lipolytic activities, respectively. Amplification and sequencing of the 16S rRNA gene of the strains for identification by similarity to the DNA sequences deposited in GenBank was performed. One hundred and thirty-seven isolates were obtained, of which 40 (29.2% showed spoilage activity for milk. Of these, three (7.5% were identified as strains of Paenibacillus sp., and all were lipolytic. Paenibacillus sp. have been identified as primarily responsible for the spoilage of pasteurized milk with a long shelf-life in other countries. To increase the shelf-life of Brazilian pasteurized milk, it is important to identify the sporulated microbes to determine their origin and to control the contamination of milk by vegetative forms such as spores.

  10. Detection and identification of Staphylococcus aureus in raw milk by ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-04-12

    Apr 12, 2010 ... detection and identification of S. aureus in raw milk demonstrated high sensitivity and specificity. Key words: Microarray .... sterile after screening for S. aureus contamination according to the procedure described by Wang ... methods, the microarray method is high throughput, specific, and sensitive and also ...

  11. Effect of leaving milk trucks empty and idle for 6 h between raw milk loads.

    Science.gov (United States)

    Kuhn, Eva; Meunier-Goddik, Lisbeth; Waite-Cusic, Joy G

    2018-02-01

    The US Pasteurized Milk Ordinance (PMO) allows milk tanker trucks to be used repeatedly for 24 h before mandatory clean-in-place cleaning, but no specifications are given for the length of time a tanker can be empty between loads. We defined a worst-case hauling scenario as a hauling vessel left empty and dirty (idle) for extended periods between loads, especially in warm weather. Initial studies were conducted using 5-gallon milk cans (pilot-scale) as a proof-of-concept and to demonstrate that extended idle time intervals could contribute to compromised raw milk quality. Based on pilot-scale results, a commercial hauling study was conducted through partnership with a Pacific Northwest dairy co-op to verify that extended idle times of 6 h between loads have minimal influence on the microbiological populations and enzyme activity in subsequent loads of milk. Milk cans were used to haul raw milk (load 1), emptied, incubated at 30°C for 3, 6, 10, and 20 h, and refilled with commercially pasteurized whole milk (load 2) to measure cross-contamination. For the commercial-scale study, a single tanker was filled with milk from a farm known to have poorer quality milk (farm A, load 1), emptied, and refilled immediately (0 h) or after a delay (6 h) with milk from a farm known to have superior quality milk (farm B, load 2). In both experiments, milk samples were obtained from each farm's bulk tank and from the milk can or tanker before unloading. Each sample was microbiologically assessed for standard plate count (SPC), lactic acid bacteria (LAB), and coliform counts. Selected isolates were assessed for lipolytic and proteolytic activity using spirit blue agar and skim milk agar, respectively. The pilot-scale experiment effectively demonstrated that extended periods of idle (>3 h) of soiled hauling vessels can significantly affect the microbiological quality of raw milk in subsequent loads; however, extended idle times of 6 h or less would not measurably compromise milk

  12. XENOBIOTICS AND BIOGENIC ELEMENTS IN RAW COW'S MILK

    Directory of Open Access Journals (Sweden)

    Agnieszka Greń

    2012-12-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE This paper presents the concentration some toxic and biogenic elements in milk from Nitra region. The aim of this investigation was to evaluate 30 samples of raw milk with fat contents 3.8% obtained from milk machine in the Nitra region. Samples were analyzed for metal contents using atomic absorption spectrophotometry (AAS. In comparison with maximum acceptable concentration for milk in the food codex of the Slovak republic, the level of contamination with cadmium was exceeded and reached the value 0.221 µg.ml-1. The copper content ranged from 1.201 µg.ml-1 to 5.810 µg.ml-1 and the average concentration reached 3.793 µg.ml-1.  Iron had an average of 1.824 µg.ml-1. Overall in all milk samples high correlations were found. Between positive correlation (0.7019 and negative correlation between of nickel and potassium concentration in raw milk (-0.72 was found. doi:10.5219/246

  13. Quality aspects of raw goat milk in Lower Southern Thailand

    Directory of Open Access Journals (Sweden)

    Siriwat Wasiksiri

    2010-05-01

    Full Text Available This study was conducted to determine the quality and safety of raw goat milk in Lower Southern Thailand duringAugust to September 2008. Milk samples were collected from five farms in Songkhla, Yala, and Pattani Province of which thepH, acidity, specific gravity, milk fat, solid not fat, total solid, total plate count, Coliform count, and antibiotic residue weretested. The results did not show any significant difference (p>0.05 on pH and total plate count among samples from eachfarm. However, acidity, specific gravity, milk fat, solid not fat, and total solid varied between farms depending on feed supplyand management. Means of total bacteria count and Coliform count of most samples were in TACF standard quality (log3.720 cfu/ml and log 1.892 cfu/ml, respectively, except four samples had higher Coliform contamination. Additionally,a higher proportion (22.7 % of samples with antibiotic residue was found.

  14. Factors affecting consumers' preferences for and purchasing decisions regarding pasteurized and raw milk specialty cheeses.

    Science.gov (United States)

    Colonna, A; Durham, C; Meunier-Goddik, L

    2011-10-01

    Eight hundred ninety consumers at a local food festival were surveyed about their specialty cheese purchasing behavior and asked to taste and rate, through nonforced choice preference, 1 of 4 cheese pairs (Cheddar and Gouda) made from pasteurized and raw milks. The purpose of the survey was to examine consumers' responses to information on the safety of raw milk cheeses. The associated consumer test provided information about specialty cheese consumers' preferences and purchasing behavior. Half of the consumers tested were provided with cheese pairs that were identified as being made from unpasteurized and pasteurized milk. The other half evaluated samples that were identified only with random 3-digit codes. Overall, more consumers preferred the raw milk cheeses than the pasteurized milk cheeses. A larger portion of consumers indicated preferences for the raw milk cheese when the cheeses were labeled and thus they knew which samples were made from raw milk. Most of the consumers tested considered the raw milk cheeses to be less safe or did not know if raw milk cheeses were less safe. After being informed that the raw milk cheeses were produced by a process approved by the FDA (i.e., 60-d ripening), most consumers with concerns stated that they believed raw milk cheeses to be safe. When marketing cheese made from raw milk, producers should inform consumers that raw milk cheese is produced by an FDA-approved process. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Is Leptospira able to survive in raw milk? Study on the inactivation at different storage times and temperatures.

    Science.gov (United States)

    Fratini, Filippo; Turchi, Barbara; Ferrone, Martina; Galiero, Alessia; Nuvoloni, Roberta; Torracca, Beatrice; Cerri, Domenico

    2016-09-01

    The consumption of raw milk is currently increasing due to several beneficial aspects, such as nutritional qualities, taste, and health benefits. However, some authors highlight the potential risk associated with raw milk consumption. In Italy, while the absence of some pathogen microorganisms is set by the regional regulation DGR 381/2007, for other microorganisms, such as Leptospira, no recommendations are provided. Leptospira is not ascribed among classical milk pathogens; however, it can potentially be present in raw milk. The aim of this study was to evaluate the survival in raw milk of six serovars of Leptospira after storage at different temperatures (4 °C ± 2 °C, 20 °C ± 2 °C, and 30 °C ± 2 °C) for different incubation times (20 min, 45 min, 1 h, and 1 h and 30 min), in order to determine the potential risk for consumers. Moreover, the immediate effect of bovine, goat, and donkey raw milk on tested Leptospira serovars was visually evaluated. After incubation, all samples were subcultured in EMJH and incubated aerobically at 30 °C for 3 months. All inoculated media were weekly examined by dark-field microscope in order to assess Leptospira survival. Extemporary observation of strains' behavior in milk allowed to detect an almost immediate motility loss, and no leptospires were detected by microscopic observations carried out weekly during the trial period. According to our results, it could be possible to exclude raw milk as a source of Leptospira infection for consumers.

  16. Impact of Freezing Time on Dornic Acidity in Three Types of Milk: Raw Donor Milk, Mother's Own Milk, and Pasteurized Donor Milk.

    Science.gov (United States)

    Vázquez-Román, Sara; Escuder-Vieco, Diana; García-Lara, Nadia Raquel; Alonso-Díaz, Clara; Lora, David; Martín-Pelegrina, María Dolores; Pallás-Alonso, Carmen Rosa

    2016-03-01

    Although under certain circumstances it is necessary to express milk, there are not many recommendations about the ideal storage conditions for human milk. The objectives of this study were to analyze the effects on Dornic acidity of frozen storage at -20 °C in three types of milk: raw donor milk, mother's own raw milk, and pasteurized donor milk. Forty-three samples of raw donor milk, 40 samples of pasteurized donor milk, and 16 samples of mother's own milk were analyzed. Dornic acidity was measured at time 0, before freezing. The remaining aliquots were frozen and analyzed after 1, 2, 3, and 4 weeks and after 2 and 3 months. In raw donor milk, the median acidity at the start was 3 °D (interquartile range [IQR] 2-3 °D); after 3 months, it was 5 °D (IQR 3-7 °D), with a significant increase in acidity after the second week. In mother's own milk, the mean acidity at the start was 3 °D (IQR 2-4 °D) and 7 °D (IQR 4-8 °D) at 3 months. The increase was significant after the third week. In pasteurized donor milk, the mean acidity was 3 °D (IQR 2-3 °D) at the start and 2 °D (IQR 2-3 °D) at the end. When comparing the three types of milk, there were significant differences from the first week between the two types of raw milk and the pasteurized milk (p raw milks (p = 0.77). Dornic acidity in unpasteurized milk significantly increases with the duration of freezing, probably due to the action of lipases, which is lost with pasteurization. It would be advisable to reduce the length of freezing time for unpasteurized milk.

  17. COMPARISON BETWEEN SOME PHYSICAL - CHEMICAL CHARACTERISTICS OF CACAO MILK AND RAW MILK

    OpenAIRE

    Florin Roman

    2009-01-01

    The paper presents a comparison between some physical - chemical characteristics of the cacao milk and of the raw milk. For this comparison we made the following determinations for both types of milk: the determination of the dry substance using the drying oven with a 102 °C temperature, the determination of the proteic substance by titration with sodium hydroxide ( NaOH ) N/10, the milk pasteurization control by the starch and potassium iodide test and the pH determination using the indicato...

  18. Traceability of Plant Diet Contents in Raw Cow Milk Samples

    Science.gov (United States)

    Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego

    2009-01-01

    The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982

  19. Chemical Contaminants in Raw and Pasteurized Human Milk.

    Science.gov (United States)

    Hartle, Jennifer C; Cohen, Ronald S; Sakamoto, Pauline; Barr, Dana Boyd; Carmichael, Suzan L

    2018-05-01

    Environmental contaminants ranging from legacy chemicals like p,p'-dichlorodiphenyltrichloroethane (DDT) to emerging chemicals like phthalates are ubiquitous. Research aims/questions: This research aims to examine the presence and co-occurrence of contaminants in human milk and effects of pasteurization on human milk chemical contaminants. We analyzed human milk donated by 21 women to a milk bank for 23 chemicals, including the persistent organic pollutants (POPs) polychlorinated biphenyls (PCBs), polybrominated diphenyl ethers (PBDEs), dichlorodiphenyltrichloroethane (DDT), and dichlorodiphenyldichloroethylene (DDE) isomers that are known to sequester in adipose tissue, along with the current-use and nonpersistent pesticides chlorpyrifos and permethrin, phthalates, and bisphenol A (BPA). Human milk was analyzed raw and pasteurized for these chemicals using gas chromatography-tandem mass spectrometry for the POPs and high-performance liquid chromatography-tandem mass spectrometry for non-POPs. Within the different chemical classes, PBDE47, PCB153, ppDDE, and MEHHP (phthalate metabolite) had the highest median concentrations and were observed in all samples. We also observed chlorpyrifos and BPA in all samples and permethrin in 90% of the samples tested. Only two chemicals, chlorpyrifos and permethrin, were susceptible to substantial degradation from pasteurization, a standard method for processing donated human milk. We detected 19 of 23 chemicals in all of our prepasteurized milk and 18 of 23 chemicals in all of our pasteurized milk. Pasteurization did not affect the presence of most of the chemicals. Future research should continue to explore human milk for potential chemical contamination and as a means to surveil exposures among women and children.

  20. Bioelectrical impedance analysis for bovine milk: Preliminary results

    Science.gov (United States)

    Bertemes-Filho, P.; Valicheski, R.; Pereira, R. M.; Paterno, A. S.

    2010-04-01

    This work reports the investigation and analysis of bovine milk quality by using biological impedance measurements using electrical impedance spectroscopy (EIS). The samples were distinguished by a first chemical analysis using Fourier transform midinfrared spectroscopy (FTIR) and flow citometry. A set of milk samples (100ml each) obtained from 17 different cows in lactation with and without mastitis were analyzed with the proposed technique using EIS. The samples were adulterated by adding distilled water and hydrogen peroxide in a controlled manner. FTIR spectroscopy and flow cytometry were performed, and impedance measurements were made in a frequency range from 500Hz up to 1MHz with an implemented EIS system. The system's phase shift was compensated by measuring saline solutions. It was possible to show that the results obtained with the Bioelectrical Impedance Analysis (BIA) technique may detect changes in the milk caused by mastitis and the presence of water and hydrogen peroxide in the bovine milk.

  1. Radiometric determination of the bacteriological quality of raw milk

    International Nuclear Information System (INIS)

    Cogan, T.M.; O'Connor, F.

    1977-01-01

    The usefulness of 14 CO 2 production from (U- 14 C) glucose, (U- 14 C) glutamate and ( 14 C) formate as an index of raw milk quality was investigated. Development work showed that the volume of milk sample influenced the detection of radioactivity. The regression coefficient between Log 10 of the inital bacterial count and the detection time (the time to reach 2000 cpm) in the presence of 0.13 μCi (U- 14 C) glucose/ml was -0.55 (n=119 samples) and the relationship was y=-0.11x+-0.46. The addition of 0.5 μCi (U- 14 C) glutamate and 0.5 μCi of ( 14 C) formate decreased the detection times but did not result in greater predictability. Further study is required before the method could be used to determine the bacteriological quality of milk

  2. Identification and quantification of major bovine milk proteins by liquid chromatography.

    Science.gov (United States)

    Bordin, G; Cordeiro Raposo, F; de la Calle, B; Rodriguez, A R

    2001-08-31

    In the field of food quality, bovine milk products are of particular interest due to the social and economic importance of the dairy products market. However, the risk of fraudulent manipulation is high in this area, for instance, replacing milk powder by whey is very interesting from an economic point of view. Therefore, there is a need to have suitable analytical methods available for the determination of all milk components, which is currently not the case, especially for the main proteins. The detection of potential manipulations requires then a clear analytical characterisation of each type of bovine milk, what constitutes the goal of this work. The separation of the major milk proteinic components has been carried out by ion-pair reversed-phase HPLC with photodiode array detection, using a C4 column. The overall optimisation has been achieved using a statistical experimental design procedure. The identification of each protein was ascertained using retention times, peak area ratios and second derivative UV spectra. Quantification was based on calibration curves drawn using purified proteins. Major sources of uncertainty were identified and the full uncertainty budget was established. The procedure was initially developed using the skimmed milk powder certified reference material CRM 063R and then applied to various types of commercial milks as well as to raw milk. The method is able to separate and quantify the seven major proteins (K-casein, alphas2-casein, alphas1-casein, beta-casein, alpha-lactalbumin, beta-lactoglobulin B and beta-lactoglobulin A) in one run and also to provide precise determinations of the total protein concentration. These are important results towards the further development of a reference method for major proteins in milk. In addition, the use of a certified material reference is suggested in order to make comparisons of method performances possible.

  3. Chosen biotic factors influencing raw cow milk freezing point

    Directory of Open Access Journals (Sweden)

    Oto Hanuš

    2011-01-01

    Full Text Available The milk freezing point depression (FPD is important physical property. FPD is influenced by milk composition especially by components with osmotic pressure activity and by other physiological factors. There is possible to indicate a foreign (extraneous water addition into milk by FPD. This is necessary to have a good estimated legislative FPD discrimination limit (FPD–L for purpose of milk quality control. This paper was aimed at obtaining information to improve such estimation. Impacts factors as season variations, estimated state of dairy cow nutrition and some milk components and properties on milk FPD and their relations to FPD were quantified (n 11 540 – 72 607 bulk raw cow milk samples. The highest FPD was in Spring (−0.52097 ± 0.004877 °C, the lowest in Autumn (−0.52516 ± 0.005725 °C; P < 0.001. Correlation between FPD and lactose was 0.35 (P < 0.001. 12% and 5.4% of FPD variability is explainable by lactose and casein variability. Relationship between FPD and urea (U was 0.26 (P < 0.001 in March. The worst FPD was in group with presupposed (according to milk urea and protein combination nitrogen matter (NM and energy (E insufficiency (−0.51855 ± 0.007288 °C. The best FPD was in group with presupposed NM and E surplus in feeding ration (−0.52536 ± 0.004785 °C; P < 0.001. The FPD was worse in suspicion on E deficiency (on the basis of fat/crude protein ratio as compared to presumption for balanced E nourishment of dairy herds (−0.52105 ± 0.006436 °C > −0.52244 ± 0.005367 °C; P < 0.001. Results can improve the estimation of objective FPD–L.

  4. New York Milk Supply with Bovine Growth Hormone

    OpenAIRE

    Magrath, William B.; Tauer, Loren W.

    1986-01-01

    New York milk supply functions with ans without Bovine Growth Hormone were estimated by a sector linear programming model. High Government price supports make bGH profitable and induces significant increases in output. Reduction or elimination of Price supports greatly diminishes bGH as a variable technology except at low bGH prices

  5. Genetic variation in bovine milk fat composition

    NARCIS (Netherlands)

    Stoop, W.M.

    2009-01-01

    In her thesis, Stoop shows that there is considerable genetic variation in milk fat composition, which opens opportunities to improve milk fat composition by selective breeding. Short and medium chain fatty acids had high heritabilities, whereas variation due to herd (mainly feed effects) was

  6. Microbiological quality of raw donkey milk from Campania Region

    Directory of Open Access Journals (Sweden)

    Nicola Costanzo

    2012-07-01

    Full Text Available Microbiological quality of raw milk from eight healthy donkeys reared in Campania Region was investigated. A total of 152 samples were analyzed in order to evaluate the milk safety status trough monitoring mesophilic total bacterial count (TBC at 32°C and 20°C, psychrophilic TBC at 5°C, Enterobacteriaceae, Salmonella spp., Listeria monocytogenes, Staphylococcus aureus and somatic cell count (SCC. The ranges for mesophilic bacteria at 32°C, 20°C and psychrophilic bacteria at 5°C were, respectively, 2.80-4.00 Log CFU/mL, 2.84-3.92 Log CFU/mL and 1.27-2.12 Log CFU/mL. Enterobacteriaceae showed a load ranging between 0.68-1.93 Log CFU/mL. No pathogenic bacteria were isolated. Estimated SCC values were always under 50,000 cells/mL. Additionally quantitative changes of bacterial population in raw bulk milk during eight storing days at 8°C and 3°C, were evaluated. Firstly, fresh bulk milk was contaminated by bacteria with a mean TBC at 32°C and 20°C of 2.71 Log CFU/mL and 2.64 Log CFU/mL, respectively, whereas TBC at 5°C and Enterobacteriaceae were not detected. After eight days of storage at 8°C, TBC at 32°C, 20°C and Enterobacteriaceae increased by three Log and TBC at 5°C by five Log. On the other side, after eight days of storage at 3°C no gradual Log increase was detected. Our results showed that donkey milk could be a good healthy ingredient for feeding where good hygienic procedures are applied and storage is kept at temperature lower than 3°C.

  7. PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk.

    Science.gov (United States)

    Rall, V L M; Vieira, F P; Rall, R; Vieitis, R L; Fernandes, A; Candeias, J M G; Cardoso, K F G; Araújo, J P

    2008-12-10

    Milk is considered a nutritious food because it contains several important nutrients including proteins and vitamins. Conversely, it can be a vehicle for several pathogenic bacteria such as Staphylococcus aureus. This study aimed to analyze the frequency of genes encoding the staphylococcal enterotoxins (SEs) SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI and SEJ in S. aureus strains isolated from raw or pasteurized bovine milk. S. aureus was found in 38 (70.4%) out of 54 raw milk samples at concentrations of up to 8.9 x 10(5) CFU/ml. This microorganism was present in eight samples of pasteurized milk before the expiration date and in 11 samples analyzed on the expiration date. Of the 57 strains studied, 68.4% were positive for one or more genes encoding the enterotoxins, and 12 different genotypes were identified. The gene coding for enterotoxin A, sea, was the most frequent (16 strains, 41%), followed by sec (8 strains, 20.5%), sed (5 strains, 12.8%), seb (3 strains, 7.7%) and see (2 strains, 5.1%). Among the genes encoding the other enterotoxins, seg was the most frequently observed (11 strains, 28.2%), followed by sei (10 strains) and seh and sej (3 strains each). With the recent identification of new SEs, the perceived frequency of enterotoxigenic strains has increased, suggesting that the pathogenic potential of staphylococci may be higher than previously thought; however, further studies are required to assess the expression of these new SEs by S. aureus, and their impact in foodborne disease. The quality of Brazilian milk is still low, and efforts from the government and the entire productive chain are required to attain consumer safety.

  8. Viscosity and Analytical Differences between Raw Milk and UHT Milk of Czech Cows

    Directory of Open Access Journals (Sweden)

    Kumbár V.

    2015-06-01

    Full Text Available Viscosity and analytical differences in four milk samples from Czech cows were described. Three samples of UHT milk (0.5%, 1.5%, and 3.5% fat and one sample of raw milk from a Czech bio-farm were analyzed. The following analytical properties were observed: titratable acidity, fat content, dry matter content, and protein content. Titratable acidity and dry matter content decreased in dependence upon the increasing milk fat content. The protein content ranged 3.51-3.57 g per 100 g milk. The milk flow behaviour represented by density, dynamic and kinematic viscosity, as well as the dependence of the milk flow behaviour on temperature were investigated. These properties were measured using a digital densitometer and a rotary viscometer. Milk density was studied at temperatures ranging 0-60 °C and dynamic viscosity at 0-100 °C. With increasing temperature, the density and dynamic viscosity of the studied milk samples decreased. The temperature dependence of dynamic viscosity was manifested in all samples. Kinematic viscosity was calculated from experimental data. Furthermore, mathematical models using Power law and Gaussian fitting were constructed. Determination coefficients achieved high values (0.843-0.997.

  9. Semi-Quantitative Method for Streptococci Magnetic Detection in Raw Milk

    Directory of Open Access Journals (Sweden)

    Carla Duarte

    2016-04-01

    Full Text Available Bovine mastitis is the most costly disease for dairy farmers and the most frequent reason for the use of antibiotics in dairy cattle; thus, control measures to detect and prevent mastitis are crucial for dairy farm sustainability. The aim of this study was to develop and validate a sensitive method to magnetically detect Streptococcus agalactiae (a Group B streptococci and Streptococcus uberis in raw milk samples. Mastitic milk samples were collected aseptically from 44 cows with subclinical mastitis, from 11 Portuguese dairy farms. Forty-six quarter milk samples were selected based on bacterial identification by conventional microbiology. All samples were submitted to PCR analysis. In parallel, these milk samples were mixed with a solution combining specific antibodies and magnetic nanoparticles, to be analyzed using a lab-on-a-chip magnetoresistive cytometer, with microfluidic sample handling. This paper describes a point of care methodology used for detection of bacteria, including analysis of false positive/negative results. This immunological recognition was able to detect bacterial presence in samples spiked above 100 cfu/mL, independently of antibody and targeted bacteria used in this work. Using PCR as a reference, this method correctly identified 73% of positive samples for streptococci species with an anti-S. agalactiae antibody, and 41% of positive samples for an anti-GB streptococci antibody.

  10. Milk production, raw milk quality and fertility of dromedary camels (Camelus Dromedarius) under intensive management.

    Science.gov (United States)

    Nagy, Péter; Thomas, Sonia; Markó, Orsolya; Juhász, Jutka

    2013-03-01

    In many arid countries, dromedaries play an important role as a milk source in rural areas. However, the milk and meat production potential of this species is not well understood and documented. A large-scale camel dairy farm was established in 2006 in the United Arab Emirates. This study summarises the most important data on milk production, raw milk quality and reproductive efficiency collected on this farm during the first three years of operation. The average daily milk production, the mean length of lactation and the mean total milk production per lactation of 174 dromedaries were 6.0 ± 0.12 kg (± SEM), 586 ± 11.0 days (± SEM) and 3314 ± 98.5 kg (± SEM), respectively. The lactation curve reached its peak during the 4th month after parturition (mean ± SEM, 8.9 ± 0.04 kg), then it declined gradually, falling to 50% of the maximum by the 16th month postpartum (mean ± SEM, 4.3 ± 0.06 kg). Milking three times a day did not increase daily milk production compared to two times milking. Mean total viable bacterial count (TVC) and mean somatic cell count (SCC, ± SEM) of bulk raw camel milk were 4,403 ± 94 CFU/cm3 and 392,602 ± 5,999 cells/cm3 for a one-year period, respectively. There was a significant difference among months (P fat, protein, lactose, total solids (TS) and solid-non-fat (SNF) concentrations of individual milk samples were 2.51 ± 0.03%, 2.60 ± 0.01%, 4.03 ± 0.03%, 9.98 ± 0.03% and 7.56 ± 0.03%, respectively. Lactation period, average daily milk production and morning vs. evening milking significantly influenced milk chemical composition. For the 470 camels in the breeding programme, end-of-season pregnancy rate and birth rate were 87.0% and 82.6%, respectively, after natural mating. We have demonstrated that sustainable milk production is possible from a traditional species, the dromedary camel, under an intensive management system.

  11. Quality of raw milk from a farm with automatic milking system in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Bohumíra Janštová

    2011-01-01

    Full Text Available The aim of this study was to assess the quality of raw cow’s milk from an automatic milking system. Samples of milk (48 were analyzed chemically and microbiologically and the somatic cell count, freezing point and inhibitor residues were determined. For comparison purposes, milk analysis data from two farms using conventional machine milking and 2008 milk analysis report data for the Czech Republic were used. All physical and chemical characteristics of the study samples were within the established limits. The average content (% of chemical indicators was following: fat 3.79 ± 0.18, protein 3.46 ± 0.06, casein 2.67 ± 0.09, lactose 4.82 ± 0.04 and NFS 8.96 ± 0.11. The values for freezing point and somatic cells count were 221 ± 46.103·ml-1 and -0.521 ± 0.003 °C respectively. No inhibitor residue was detected in any of the samples. Microbiological values were lower than the limits: the total microbial count (2.3·104 CFU·ml-1, psychrotrophic count (6.3·103 CFU·ml-1, coliform count (2.4·101 CFU·ml-1, Escherichia coli count (3.2·101 CFU·ml-1, enterococci count (8.5·101 CFU·ml-1 and Staphylococcus aureus count (1.1·101 CFU·ml-1. The study provides a comprehensive view on the quality of milk produced by robotic milking. The automatic milking system seems to be excellent in terms of milking and milk hygiene.

  12. Meat and milk compositions of bovine clones

    Science.gov (United States)

    Tian, X. Cindy; Kubota, Chikara; Sakashita, Kunihito; Izaike, Yoshiaki; Okano, Ryoichi; Tabara, Norio; Curchoe, Carol; Jacob, Lavina; Zhang, Yuqin; Smith, Sadie; Bormann, Charles; Xu, Jie; Sato, Masumi; Andrew, Sheila; Yang, Xiangzhong

    2005-01-01

    The technology is now available for commercial cloning of farm animals for food production, but is the food safe for consumers? Here, we provide data on >100 parameters that compare the composition of meat and milk from beef and dairy cattle derived from cloning to those of genetic- and breed-matched control animals from conventional reproduction. The cloned animals and the comparators were managed under the same conditions and received the same diet. The composition of the meat and milk from the clones were largely not statistically different from those of matched comparators, and all parameters examined were within the normal industry standards or previously reported values. The data generated from our match-controlled experiments provide science-based information desired by regulatory agencies to address public concerns about the safety of meat and milk from somatic animal clones. PMID:15829585

  13. Fluorometric determination of free and total isocitrate in bovine milk

    DEFF Research Database (Denmark)

    Larsen, Torben

    2014-01-01

    Isocitrate is an intermediate metabolite in the citric acid cycle found both inside the mitochondria as well as outside in the cytosolic shunt. Oxidation of isocitrate is believed to deliver large fractions of energy [i.e., reducing equivalents (NADPH) in the bovine udder] used for fatty acid...... and cholesterol synthesis. This study describes a new analytical method for determination of free and total isocitrate in bovine milk where time-consuming pretreatment of the sample is not necessary. Methods for estimation of both total isocitrate and free isocitrate are described, the difference being...

  14. Bovine immunodeficiency-like virus: inactivation in milk by pasteurisation.

    Science.gov (United States)

    Venables, C; Lysons, R; Horigan, M; Stagg, D; Dawson, M

    1997-03-15

    Bioassay was used to determine whether bovine immunodeficiency-like virus (BIV) in milk was inactivated by pasteurisation. Three groups of three calves were inoculated with virus (BIV isolate FL112), milk seeded with virus and milk seeded with virus that had been pasteurised before inoculation, respectively. Seroconversion to BIV was monitored for 12 months by an indirect immunofluorescence assay. The presence of BIV proviral DNA in peripheral blood was determined by a nested polymerase chain reaction (PCR). The animals were euthanized and virus isolation and PCR were attempted on peripheral blood mononunclear cells, prescapular lymph node and spleen. Transmission of BIV was confirmed in the groups that were inoculated with the virus and with the virus in milk, but no evidence of its transmission was demonstrated in the group that received the pasteurised inoculum.

  15. Evaluation of the Influence of Frequency of Milk Collection and Milking Dayshift on the Microbiological Quality of Raw Milk

    Directory of Open Access Journals (Sweden)

    Lucía Reguillo

    2018-01-01

    Full Text Available The aim of this study was to analyze the influence of milk collection frequency (24 h versus 48 h and milking dayshift (morning and evening on total mesophilic aerobic bacteria (MAB and psychrotrophic bacteria (PSY counts in raw milk samples. MAB counts were determined by flow cytometry (BactoScan and PSY counts by the plate counting agar method. An univariate statistical analysis was performed to find out significant differences among the studied factors. Results obtained showed that collecting milk every 24 h was effective in reducing MAB and PSY counts by 32 and 18%, respectively, compared to 48 h milk collection. This positive impact allowed reducing up to 4°C the temperature of the heat treatment in the dairy industry, thus involving energy savings of 22%. Milking during the mornings showed a significant reduction of MAB counts in comparison to milking performed during the evenings (P<0.05. These results are highly useful for the improvement of milk quality through the optimization of collection and milking systems set at primary production.

  16. Validation and application of FTIR spectroscopy in raw milk analysis

    Directory of Open Access Journals (Sweden)

    Kučević Denis S.

    2017-01-01

    Full Text Available The aim of this study was to investigate whether FTIR spectroscopy is an accurate and valid technique for the assessment of quality parameters in raw cow's milk: fat, protein, lactose, and total solids. The assessment was based on calibration series and comparison with reference material. Furthermore, it takes into account the results obtained in the inter-laboratory comparisons (proficiency testing. The calibration samples were purchased from the accredited regional reference laboratories. The validation parameters included linearity, accuracy, repeatability, reproducibility, and robustness. The linearity ratio was 0.95%. The biases calculated for the fat, protein, lactose and dry matter were -0.33, 0.31, -0.25, and 0.06 respectively. The F value from the F-test was used to determine the significant differences between two independent sets of the results. The obtained results were as follows: 1.469 for fat, 1.634 for protein, 1.192 for lactose, and 0.528 for dry matter. The intra-laboratory reproducibility calculated as the Horwitz Ratios for all parameters were within the criterion limits (0.5 to 0.8. The data obtained for carry-over were 0.27% for fat, 0.52% for protein, 0.47% for lactose, and 0.47% for dry matter. Based on the obtained results it can be concluded that the FTIR spectroscopy is a reliable instrumental technique for the determination of fat, protein, lactose and total solids in raw cow's milk.

  17. The effect of raw milk microbial flora on the sensory characteristics of salers-type cheeses

    OpenAIRE

    Callon, Cecile; Berdagué, Jean-Louis; Montel, Marie-Christine

    2005-01-01

    The sensory characteristics of Salers Protected Denomination of Origin raw-milk cheeses are linked to the biochemical composition of the raw material (milk) and to the resultant microbial community. To evaluate the influence of the microbial community on sensory characteristics, Salers-type cheeses were manufactured with the same pasteurized milk, reinoculated with 3 different microbial communities from 3 different filtrates from microfiltered milks. Each cheese was subjected to microbial cou...

  18. Immunochromatographic Lateral-flow test strip for the rapid detection of added bovine rennet whey in milk and milk powder

    NARCIS (Netherlands)

    Martin-Hernandez, C.; Munoz, M.; Daury, C.; Weymuth, H.; Kemmers-Voncken, A.; Corbation, V.; Toribo, T.; Bremer, M.G.E.G.

    2009-01-01

    An immunochromatographic lateral-flow test dipstick test was developed for the fast detection of bovine rennet whey in liquid milk and milk powder. The test is based on the binding of casein glycomacropeptide (cGMP) by two specific anti-bovine ¿-casein monoclonal antibodies and has a visual

  19. Raw cow’s milk relatively inhibits quorum sensing activity of Cromobacterium violaceum in comparison to raw she-camel’s milk

    Directory of Open Access Journals (Sweden)

    A.A. Moawad

    2011-10-01

    Full Text Available Milk from different animal species has variable levels of antimicrobial factors against some of spoilage bacteria. For example, they are significantly present in higher concentration in she-camel’s milk than in cattle or buffalo and they are more heat-resistant than their counterparts in cattle and buffalo. Spoilage bacteria are known to communicate with each other by release of signaling molecules, a phenomenon described as quorum sensing (QS. Some food matrices inhibit these signaling compounds. In this study we screened QS inhibitory activities in raw milk of cattle and camel. Ten samples each of fresh raw cow’s milk and she-camel’s milk from apparently healthy animals were screened using the bacterial model Cromobacterium violaceum. The tested cow’s raw milk samples were able to inhibit the production of QS signalling molecules acyl-homoserine lactones (AHLs produced by C. violaceum. However, she-camel’s milk samples were less effective in inhibiting such AHLs. Thus, one of the factors which influence the inhibitory activity could be derived from variation in milk chemical composition, especially in the percentage of fat which is significantly higher in tested cow’s milk samples (2.22±0.12 than in tested she-camel’s milk samples (1.44±0.35. Natural inhibition of QS signaling by cow’s milk may offer a unique means to control foodborne pathogens and reduce microbial spoilage.

  20. Influence of raw milk quality on processed dairy products: How do raw milk quality test results relate to product quality and yield?

    Science.gov (United States)

    Murphy, Steven C; Martin, Nicole H; Barbano, David M; Wiedmann, Martin

    2016-12-01

    This article provides an overview of the influence of raw milk quality on the quality of processed dairy products and offers a perspective on the merits of investing in quality. Dairy farmers are frequently offered monetary premium incentives to provide high-quality milk to processors. These incentives are most often based on raw milk somatic cell and bacteria count levels well below the regulatory public health-based limits. Justification for these incentive payments can be based on improved processed product quality and manufacturing efficiencies that provide the processor with a return on their investment for high-quality raw milk. In some cases, this return on investment is difficult to measure. Raw milks with high levels of somatic cells and bacteria are associated with increased enzyme activity that can result in product defects. Use of raw milk with somatic cell counts >100,000cells/mL has been shown to reduce cheese yields, and higher levels, generally >400,000 cells/mL, have been associated with textural and flavor defects in cheese and other products. Although most research indicates that fairly high total bacteria counts (>1,000,000 cfu/mL) in raw milk are needed to cause defects in most processed dairy products, receiving high-quality milk from the farm allows some flexibility for handling raw milk, which can increase efficiencies and reduce the risk of raw milk reaching bacterial levels of concern. Monitoring total bacterial numbers in regard to raw milk quality is imperative, but determining levels of specific types of bacteria present has gained increasing importance. For example, spores of certain spore-forming bacteria present in raw milk at very low levels (e.g., products to levels that result in defects. With the exception of meeting product specifications often required for milk powders, testing for specific spore-forming groups is currently not used in quality incentive programs in the United States but is used in other countries (e.g., the

  1. Hydrolytic potential of a psychrotrophic Pseudomonas isolated from refrigerated raw milk

    Directory of Open Access Journals (Sweden)

    Ana Paula F. Corrêa

    2011-12-01

    Full Text Available The production of extracellular hydrolases by a psychrotrophic bacterium isolated from refrigerated raw milk, and identified as a Pseudomonas sp. belonging to the Pseudomonas jenssenii group, was studied. This bacterium produced proteolytic and lipolytic enzymes in all media investigated (skim milk, cheese whey, casein broth, and tryptone soy broth. High levels of α-glucosidase were produced in skim milk broth. Hydrolytic enzymes detected in skim milk broth are of particular concern, indicating that these enzymes could be produced by Pseudomonas sp. during the cold storage of raw milk, contributing to the spoilage problem in milk and dairy products.

  2. RESEARCH ON ENVIRONMENTAL CONTAMINATION IN RAW MILK IN TURIN DEPARTEMENT : HEAVY METALS, P.C.B, ORGANOCHLORINE AND ORGANOPHOSPHORUS PESTICIDES – YEARS 2005 – 2008

    Directory of Open Access Journals (Sweden)

    S. Cavallera

    2013-02-01

    Full Text Available In the period between 2005 and 2008 was carried out a survey on 252 samples of raw bovine milk collected in Turin departement to certain levels of contamination by heavy metals (Cd, Cr, Fe, Hg, Pb, Zn, PCB and organophosphorus and organochlorine pesticides. These results argue that the levels of heavy metals, PCB and pesticides are well below what is expected by the European legislation and that the situation is under control and that raw milk meets the hygiene requirements for human health.

  3. Allergic reactions to raw, pasteurized, and homogenized/pasteurized cow milk

    DEFF Research Database (Denmark)

    Høst, A; Samuelsson, E G

    1988-01-01

    Five children aged 12-40 months with IgE-mediated adverse reactions to cow milk (immediate onset clinical pattern of cow milk allergy) were orally challenged double-blind in random order with three different milk preparations processed from the same batch of milk 1) raw untreated cow milk, 2......) pasteurized cow milk, 3) homogenized and pasteurized cow milk, and 4) Nutramigen (a commercial hypoallergenic infant formula based on hydrolysed casein) as placebo. Skin prick tests with the same preparations were also performed. On oral challenge the three different processed milk types provoked significant...... and similar allergic reactions in each child, and no adverse reactions followed the challenge with placebo (Nutramigen). Skin prick test with the same milk products were positive in all children and comparable to the results with an extract of purified raw cow milk protein (Soluprick), whereas Nutramigen did...

  4. Simultaneous Determination of TetracyclinesResidues in Bovine Milk Samples by Solid Phase Extraction and HPLC-FL Method

    Directory of Open Access Journals (Sweden)

    Mehra Mesgari Abbasi

    2011-06-01

    Full Text Available Introduction:Tetracyclines (TCs are widely used in animal husbandry and their residues in milk may resultinharmful effects on human. The aim of this study was to investigate the presence of TCs residues in various bovine milk samples from local markets of Ardabil, Iran. Methods:One hundred and fourteen pasteurized, sterilized and raw milk samples were collected from markets of Ardabil. Tetracycline, Oxytetracycline and Chlortetracycline (TCs residues extraction carried out by Solid Phase Extraction method. Determination of TCs residues were performed by high performance liquid chromatography (HPLC method using Fluorescence detector.Results: The mean of total TCs residues in all samples (114 samples was 97.6 ±16.9ng/g and that of pasteurized, sterilized and raw milk samples were 87.1 ± 17.7, 112.0 ± 57.3 and 154.0 ± 66.3ng/g respectively. Twenty five point four percent of the all samples, and24.4%, 30% and 28.6% of the pasteurized, sterilized and raw milk samples, respectively had higher TCs residues than the recommended maximum levels (100ng/g. Conclusion:This study indicates the presence of tetracycline residues more than allowed amount. Regulatory authorities should ensure proper withdrawal period before milking the animals and definite supervisions are necessary on application of these drugs.

  5. Detecting β-Casein Variation in Bovine Milk.

    Science.gov (United States)

    Caroli, Anna Maria; Savino, Salvatore; Bulgari, Omar; Monti, Eugenio

    2016-01-25

    In bovine species, β-casein (β-CN) is characterized by genetic polymorphism. The two most common protein variants are β-CN A² (the original one) and A¹, differing from A² for one amino acid substitution (Pro67 to His67). Several bioactive peptides affecting milk nutritional properties can originate from β-CN. Among them, β-casomorphin-7 (BCM7) ranging from amino acid 60 to 66 can be released more easily from β-CN variants carrying His67 (A¹ type) instead of Pro67 (A² type). Nowadays, "A2 milk" is produced in different countries claiming its potential benefits in human health. The aim of this study was to further develop and apply an isoelectric focusing electrophoresis (IEF) method to bulk and individual milk samples in order to improve its use for β-CN studies. We succeeded in identifying A2 milk samples correctly and quantifying the percentage of A², A¹, and B variants in bulk samples not derived from A2 milk as well as in individual milk samples. The method allows us to quantify the relative proportion of β-CN variants in whole milk without eliminating whey protein by acid or enzymatic precipitation of caseins. The aim of this study was also to study the different behavior of β-CN and β-lactoglobulin (β-LG) in the presence of trichloroacetic acid (TCA). The higher sensitivity of β-CN to TCA allows quantifying β-CN variants after TCA fixation because β-LG is not visible. Monitoring β-CN variation in cattle breeds is important in order to maintain a certain balance between Pro67 and His67 in dairy products. Overall, the debate between A1 and A2 milk needs further investigation.

  6. Proteolysis during ripening of Manchego cheese made from raw or pasteurized ewes' milk. Seasonal variation.

    Science.gov (United States)

    Gaya, Pilar; Sánchez, Carmen; Nuñez, Manuel; Fernández-García, Estrella

    2005-08-01

    Changes in nitrogen compounds during ripening of 40 batches of Manchego cheese made from raw milk (24 batches) or pasteurized milk (16 batches) at five different dairies throughout the year were investigated. After ripening for six months, degradation of p-kappa- and beta-caseins was more intense in raw milk cheese and degradation of alpha(s2)-casein in pasteurized milk cheese. Milk pasteurization had no significant effect on breakdown of alpha(s1)-casein. Hydrophobic peptide content did not differ between raw and pasteurized milk cheese, whereas hydrophilic peptide content was higher in raw milk cheese. There were no significant differences between seasons for residual caseins, but hydrophobic peptides were at a higher level in cheese made in autumn and winter and hydrophilic peptides in cheese made in winter and spring. Raw milk cheese had a higher content of total free amino acids and of most individual free amino acids than pasteurized milk cheese. The relative percentages of the individual free amino acids were significantly different for raw milk and pasteurized milk cheeses. The relative percentages of Lys and lie increased, while those of Val, Leu and Phe decreased during ripening. There were also seasonal variations within the relative percentages of free amino acids. In raw milk cheeses, Asp and Cys were relatively more abundant in those made in autumn, Glu and Arg in cheeses made in winter, and Lys and Ile in cheeses made in spring and summer. Biogenic amines were detected only in raw milk cheese, with the highest levels of histamine, tryptamine and tyramine in cheeses made in spring, winter and spring, respectively.

  7. Pasture Feeding Changes the Bovine Rumen and Milk Metabolome

    Directory of Open Access Journals (Sweden)

    Tom F. O’Callaghan

    2018-04-01

    Full Text Available The purpose of this study was to examine the effects of two pasture feeding systems—perennial ryegrass (GRS and perennial ryegrass and white clover (CLV—and an indoor total mixed ration (TMR system on the (a rumen microbiome; (b rumen fluid and milk metabolome; and (c to assess the potential to distinguish milk from different feeding systems by their respective metabolomes. Rumen fluid was collected from nine rumen cannulated cows under the different feeding systems in early, mid and late lactation, and raw milk samples were collected from ten non-cannulated cows in mid-lactation from each of the feeding systems. The microbiota present in rumen liquid and solid portions were analysed using 16S rRNA gene sequencing, while 1H-NMR untargeted metabolomic analysis was performed on rumen fluid and raw milk samples. The rumen microbiota composition was not found to be significantly altered by any feeding system in this study, likely as a result of a shortened adaptation period (two weeks’ exposure time. In contrast, feeding system had a significant effect on both the rumen and milk metabolome. Increased concentrations of volatile fatty acids including acetic acid, an important source of energy for the cow, were detected in the rumen of TMR and CLV-fed cows. Pasture feeding resulted in significantly higher concentrations of isoacids in the rumen. The ruminal fluids of both CLV and GRS-fed cows were found to have increased concentrations of p-cresol, a product of microbiome metabolism. CLV feeding resulted in increased rumen concentrations of formate, a substrate compound for methanogenesis. The TMR feeding resulted in significantly higher rumen choline content, which contributes to animal health and milk production, and succinate, a product of carbohydrate metabolism. Milk and rumen-fluids were shown to have varying levels of dimethyl sulfone in each feeding system, which was found to be an important compound for distinguishing between the diets

  8. Characterization of carbohydrate structures of bovine MUC15 and distribution of the mucin in bovine milk

    DEFF Research Database (Denmark)

    Pallesen, Lone Tjener; Pedersen, Lise Refstrup Linnebjerg; Petersen, Torben Ellebæk

    2007-01-01

    -containing fractions as well, such as skim milk and whey. Compositional and structural studies of the carbohydrates of bovine milk MUC15 showed that the glycans are composed of fucose, galactose, mannose, N-acetylgalactosamine, N-acetylglycosamine, and sialic acid. The carbohydrate was shown to constitute 65......% of the total molecular weight, and the molar ratios of the individual sugars to protein of the O-linked glycans were determined. The glycan structures of MUC15 were further studied by enzymatic deglycosylation experiments using different endo- and exoglycosidases as well as a panel of lectins. The N......-linked glycans. By comparing the results of peanut agglutinin lectin binding, enzymatic deglycosylation, and monosaccharide composition analysis, we concluded that bovine MUC15 also contains more complex O-glycans containing high amounts N-acetylglucosamine residues. Furthermore, a small subset of the O...

  9. Bovine milk fat globule membrane affects virulence expression in Escherichia coli O157:H7.

    Science.gov (United States)

    Tellez, A; Corredig, M; Guri, A; Zanabria, R; Griffiths, M W; Delcenserie, V

    2012-11-01

    The aim of this study was to examine the effect of the bovine milk fat globule membrane (MFGM) on the virulence of Escherichia coli O157:H7. The MFGM was extracted from raw or heat-treated milk, resulting in 2 preparations differing in protein composition. Both heated and raw MFGM exerted an inhibitory effect on Shiga toxin gene expression by E. coli O157:H7 (ratios of -7.69 and -5.96, respectively). Interestingly, the effect was stronger with heated MFGM, with a larger decrease in expression of the virulence gene fliC (ratio of -9.43). The difference in effect observed between heated and raw MFGM could be explained by the difference in protein composition between the 2 preparations. These results show, for the first time, a specific effect of MFGM on expressionof Shiga toxin genes as well as genes involved in the motility of E. coli O157:H7. This may offer a new approach to mitigate the adverse health effects caused by E. coli O157:H7 infections. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. Prevalence, seasonality, and growth of enterococci in raw and pasteurized milk in Victoria, Australia.

    Science.gov (United States)

    McAuley, Catherine M; Britz, Margaret L; Gobius, Kari S; Craven, Heather M

    2015-12-01

    This study investigated the prevalence, seasonality, and species variety of enterococci present in raw milk factory silos and pasteurized milk in 3 dairying regions in Victoria, Australia, over a 1-yr period. Additionally, the growth ability of thermoduric enterococci isolated in this study (Enterococcus faecalis, E. faecium, E. hirae, and E. durans) was determined in milk at temperatures likely to occur during storage, transport, and distribution, and before domestic consumption (4 and 7°C). Enterococci were detected in 96% of 211 raw milk samples, with an average count of 2.48 log10 cfu/mL. Counts were significantly lower in winter than summer (average 1.84 log10 cfu/mL) and were different between factories but not regions. Enterococcus faecalis was the most prevalent species isolated from raw milk in every factory, comprising between 61.5 and 83.5% of enterococcal species across each season. Enterococci were detected in lower numbers in pasteurized milk than in raw milk and were below the limit of detection on spread plates (pasteurization. Residual viable cells were only detected following enrichment using 100-mL samples of milk, with 20.8% of the samples testing positive; this equated to a decrease in the average raw milk enterococci count of >4 log10 cfu/mL following pasteurization. Although E. faecalis predominated in raw milk and E. durans was found in only 2.9% of raw milk samples, E. durans was the most prevalent species detected in pasteurized milk. The detection of enterococci in the pasteurized milk did not correlate with higher enterococci counts in the raw milk. This suggested that the main enterococci populations in raw milk were heat-sensitive and that thermoduric enterococci survived pasteurization in a small numbers of instances. All of the thermoduric enterococci that were assessed for growth at likely refrigeration temperatures were able to grow at both 4 and 7°C in sterile milk, with generation times of 35 to 41h and 16 to 22h, respectively

  11. Essential elements, cadmium, and lead in raw and pasteurized cow and goat milk

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, A.; Collins, W.F.; Williams, H.L.

    1985-08-01

    Fifteen essential elements plus cadmium and lead were determined in raw and pasteurized cow and goat milks by atomic absorption spectrophotometry. When results were compared on a wet weight basis, there were no significant differences between the raw and pasteurized milks except for cobalt, iron, and lead in goat milk. When copper in goat milk was expressed on a dry weight basis, there was a significant difference between raw and pasteurized milk. There were significantly higher amounts of cobalt, copper, iron, lead, magnesium, and phosphorus, wet weight basis, in pasteurized goat milk than in pasteurized cow milk. Significantly more nickel and sodium were in pasteurized cow milk. No difference in the content of chloride, calcium, potassium, and zinc was significant between the two milks. When dry weights of the two milks were compared, statistical differences were the same, except there was significantly more calcium and potassium in pasteurized cow milk than in pasteurized goat milk and there were no significant differences in the content of lead and phosphorus between the two milks. Percentages of the established and estimated recommended daily allowances show both cow and goat milk to be excellent sources of calcium, phosphorus, and potassium and fair sources of iron, magnesium, and sodium.

  12. The continuing debate over increasing consumption of raw (unpasteurised) milk: is it safe?

    DEFF Research Database (Denmark)

    Jordan, K. N.; Hunt, K.; Hoorfar, Jeffrey

    2012-01-01

    The debate on the consumption of raw (unpasteurised) milk continues. On one side there is the risk of illness associated with pathogenic bacteria that may be in the milk, a risk that can be mitigated by pasteurisation of the milk prior to consumption. On the other side, there are those who believ...

  13. Tick-borne Encephalitis Associated with Consumption of Raw Goat Milk, Slovenia, 2012

    Science.gov (United States)

    Hudopisk, Neda; Korva, Miša; Janet, Evgen; Simetinger, Marjana; Grgič-Vitek, Marta; Gubenšek, Jakob; Natek, Vladimir; Kraigher, Alenka; Strle, Franc

    2013-01-01

    Tick-borne encephalitis (TBE) developed in 3 persons in Slovenia who drank raw milk; a fourth person, who had been vaccinated against TBE, remained healthy. TBE virus RNA was detected in serum and milk of the source goat. Persons in TBE-endemic areas should be encouraged to drink only boiled/pasteurized milk and to be vaccinated. PMID:23697658

  14. CONCENTRATION OF SELECTED ELEMENTS IN RAW AND ULTRA HEAT TREATED COW MILK

    Directory of Open Access Journals (Sweden)

    Lukáčová Anetta

    2012-10-01

    Full Text Available The potential presence of toxic metals in food is being recognized as a priority by standards organizations and constitutes an analytical challenge. The toxic metal content of milk and dairy products is due to several factors: environmental conditions, the manufacturing process and the possible contamination during several steps of the manufacturing processes. The aim of this study was to evaluate samples of raw milk with fat contents 3.8% obtained at randomly from animal farms in around Nitra, western Slovakia region and ultra – heat treated cow milk (UHT with fat contents 1.5% commercially available from local market in Nitra. Samples of milk were analysed for metal contents using atomic absorption spectrophotometry (AAS. UHT milk showed higher levels of cadmium, nickel and iron. Higher levels of zinc, copper were detected in raw milk. Significant differences in the concentration of copper between raw and UHT cow milk were found.

  15. Detecting β-Casein Variation in Bovine Milk

    Directory of Open Access Journals (Sweden)

    Anna Maria Caroli

    2016-01-01

    Full Text Available In bovine species, β-casein (β-CN is characterized by genetic polymorphism. The two most common protein variants are β-CN A2 (the original one and A1, differing from A2 for one amino acid substitution (Pro67 to His67. Several bioactive peptides affecting milk nutritional properties can originate from β-CN. Among them, β-casomorphin-7 (BCM7 ranging from amino acid 60 to 66 can be released more easily from β-CN variants carrying His67 (A1 type instead of Pro67 (A2 type. Nowadays, “A2 milk” is produced in different countries claiming its potential benefits in human health. The aim of this study was to further develop and apply an isoelectric focusing electrophoresis (IEF method to bulk and individual milk samples in order to improve its use for β-CN studies. We succeeded in identifying A2 milk samples correctly and quantifying the percentage of A2, A1, and B variants in bulk samples not derived from A2 milk as well as in individual milk samples. The method allows us to quantify the relative proportion of β-CN variants in whole milk without eliminating whey protein by acid or enzymatic precipitation of caseins. The aim of this study was also to study the different behavior of β-CN and β-lactoglobulin (β-LG in the presence of trichloroacetic acid (TCA. The higher sensitivity of β-CN to TCA allows quantifying β-CN variants after TCA fixation because β-LG is not visible. Monitoring β-CN variation in cattle breeds is important in order to maintain a certain balance between Pro67 and His67 in dairy products. Overall, the debate between A1 and A2 milk needs further investigation.

  16. Molecular Typing and Antimicrobial Susceptibility of Methicillin-Resistant Staphylococcus aureus Isolated from Bovine Milk in Tanzania.

    Science.gov (United States)

    Mohammed, Jibril; Ziwa, Michael Henry; Hounmanou, Yaovi Mahuton Gildas; Kisanga, Adela; Tuntufye, Huruma Nelwike

    2018-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) in raw milk can be transmitted from animals to humans, and in Tanzania raw milk is sold in local markets and consumed as purchased. This study was performed to determine the molecular characteristics and antimicrobial susceptibility pattern of MRSA strains isolated from raw bovine milk sold at local markets in Tanzania. A total of 117 raw milk samples were cultured on Baird-Parker medium to isolate S. aureus and PCR was used for amplification of gltB gene for S. aureus identification and the presence of mecA gene for methicillin-resistant strains. Coagulase-negative (CN) S. aureus were reconfirmed using tube coagulase, DNase, and API Staph tests. MRSA isolates were spa typed whereas antimicrobial susceptibility testing was performed by the disc diffusion method. Forty-six coagulase positives (CP) and two CN S. aureus were identified. Most strains were resistant to penicillin (72%), and 3 isolates: 2 CN S. aureus and 1 coagulase-negative Staphylococci (CNS), were phenotypically resistant to vancomycin, oxacillin, and cefoxitin and were confirmed to carry mecA. Resistance to clindamycin, trimethoprim-sulfamethoxazole, and tetracycline was 23.9%, 30.4%, and 41.3%, respectively. Twelve isolates exhibited multidrug resistance; however, only one mecA positive strain among the three was typeable and belonged to spa type t2603. This study reports for the first time the presence of CN variant of MRSA, which was assigned the spa type t2603, and the presence of multidrug resistant S. aureus isolates from bovine milk in Morogoro, Tanzania.

  17. Aflatoxin M1 levels in raw milk, pasteurised milk and infant formula

    Directory of Open Access Journals (Sweden)

    Sharaf S. Omar

    2016-06-01

    Full Text Available The incidence of contamination of aflatoxin M1 (AFM1 in milk samples collected from the Jordanian market was investigated by using the competitive enzyme linked immunosorbent assay (ELISA technique. A total of 175 samples were collected during 2014-2015. All tested samples were contaminated with various levels of AFM1 ranging from 9.71 to 288.68 ng/kg. The concentration of AFM1 in 66% of fresh milk samples was higher than the maximum tolerance limit accepted by the European Union (50 ng/kg and 23% higher than the maximum tolerance limit accepted by the US (500 ng/kg. Percentages of contaminated raw cow, sheep, goat and camel milk exceeding the European tolerance limit were 60, 85, 75 and 0%, respectively. Of AFM1 contaminated pasteurised cow milk samples, 12% exceeded the European tolerance limit with a range of contamination between 14.60 and 216.78 ng/kg. For infant formula samples, the average concentration of AFM1 was 120.26 ng/kg (range from 16.55 to 288.68 ng/kg, the concentration of AFM1 in 85% of infant formula samples was higher than the maximum tolerance limit accepted by the European Union and the US (25 ng/kg.

  18. Detection of bovine herpesvirus 4 glycoprotein B and thymidine kinase DNA by PCR assays in bovine milk

    NARCIS (Netherlands)

    Wellenberg, G.J.; Verstraten, E.; Belak, S.; Verschuren, S.B.E.; Rijsewijk, F.A.M.; Peshev, R.; Oirschot, van J.T.

    2001-01-01

    A polymerase chain reaction (PCR) assay was developed to detect bovine herpesvirus 4 (BHV4) glycoprotein B (gB) DNA, and a nested-PCR assay was modified for the detection of BHV4 thymidine kinase (TK) DNA in bovine milk samples. To identify false-negative PCR results, internal control templates were

  19. Analysis of fenbendazole residues in bovine milk by ELISA.

    Science.gov (United States)

    Brandon, David L; Bates, Anne H; Binder, Ronald G; Montague, William C; Whitehand, Linda C; Barker, Steven A

    2002-10-09

    Fenbendazole residues in bovine milk were analyzed by ELISAs using two monoclonal antibodies. One monoclonal antibody (MAb 587) bound the major benzimidazole anthelmintic drugs, including fenbendazole, oxfendazole, and fenbendazole sulfone. The other (MAb 591) was more specific for fenbendazole, with 13% cross-reactivity with the sulfone and no significant binding to the sulfoxide metabolite. The limit of detection of the ELISA method in the milk matrix was 7 ppb for MAb 587 and 3 ppb for MAb 591. Fenbendazole was administered in feed, drench, and paste form to three groups of dairy cattle. Milk was collected immediately before dosing and then every 12 h for 5 days. The ELISA indicated that residue levels varied widely among individual cows in each group. Fenbendazole levels peaked at approximately 12-24 h and declined rapidly thereafter. Metabolites were detected at much higher levels than the parent compound, peaked at approximately 24-36 h, and declined gradually. Residue levels were undetectable by 72 h. The ELISA data correlated well with the total residues determined by chromatographic analysis, but the use of the two separate ELISAs did not afford an advantage over ELISA with the single, broadly reactive MAb 587. The ELISA method could be used to flag high-residue samples in on-site monitoring of fenbendazole in milk and is a potential tool for studying drug pharmacokinetics.

  20. Survey of Veterinary Drug Residues in Raw Milk in Hebei Province, China.

    Science.gov (United States)

    Han, Rong-Wei; Yu, Zhong-Na; Zhen, Tian-Yuan; Wang, Jun

    2017-10-17

    The objective of this study was to investigate the occurrence of veterinary drug residues in raw milk from Hebei, the second-largest dairy production province in the People's Republic of China. A total of 192 raw milk samples were collected from 64 milk stations in seven districts. Twenty-eight veterinary drug residues were analyzed by ultraperformance liquid chromatography with tandem mass spectrometry based on a China National Standard. Raw milk samples with multiple residues of veterinary drugs were not found in the present study. Residues of four veterinary drugs, penicillin G, sulfacetamide, trimethoprim, and lincomycin, were detected in 12 (6.25%) raw milk samples, with detection ratios of 1.04, 0.52, 3.13, and 1.56%, respectively. All veterinary drug residues detected were under the maximum residue levels as regulated by China, the European Union, the United States, and the Codex Alimentarius Commission. In general, raw milk from Hebei province was considered relatively safe for human consumption because of the low prevalence of veterinary drug residues. However, stringent control measurements for veterinary drug residues in raw milk are required because some veterinary drugs were detected in milk from some areas of Hebei province.

  1. Comparison of the in vitro digestion of raw pasture milk and commercial HTST and UHT pasteurized milk

    Science.gov (United States)

    Consumption of raw milk from pasture-fed cows, typically purchased at local farms, is steadily increasing in the US because many consumers believe that high-temperature short-time (HTST) or ultrahigh temperature (UHT) pasteurization affects the digestibility of milk proteins and thus the bioavailabi...

  2. Structural changes of bovine milk fat globules during in vitro digestion.

    Science.gov (United States)

    Gallier, S; Ye, A; Singh, H

    2012-07-01

    An in vitro digestion model that simulated gastric and intestinal fasting conditions was used to monitor the physical, chemical, and structural changes of fat globules from raw bovine milk. During in vitro gastric digestion, the fat globules were stable under low-acidic conditions. Some peptides and β-lactoglobulin were resistant to proteolysis by pepsin. Phospholipids, proteins, and peptides stabilized the globules in the stomach model. During in vitro intestinal digestion, most of the β-lactoglobulin and residual peptides were hydrolyzed by trypsin and chymotrypsin, and the lipolytic products, released from the hydrolysis of the triglyceride core of the globules, led to destabilization and coalescence of the globules. By accumulating at the surface of the fat globules, the lipolytic products formed a lamellar phase and their solubilization by bile salts resulted in the formation of disk-shaped micelles. This study brings new interesting insights on the digestion of bovine milk. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. Doxorubicin-Induced Gut Toxicity in Piglets fed Bovine Milk and Colostrum

    DEFF Research Database (Denmark)

    Shen, René Liang; Rathe, Mathias; Jiang, Pingping

    2016-01-01

    OBJECTIVE: Chemotherapy-induced intestinal toxicity is a common adverse effect of cancer treatment. We hypothesized that a milk diet containing bovine colostrum (BC) would reduce intestinal toxicity in doxorubicin-treated piglets. METHODS: Study 1 investigated intestinal parameters nine days after...... Colostrum supplementation had limited effects on doxorubicin-induced toxicity in milk-fed piglets suggesting that colostrum and a bovine milk diet enriched with whey protein provided similar...

  4. Effect of processing intensity on immunologically active bovine milk serum proteins

    NARCIS (Netherlands)

    Brick, Tabea; Ege, Markus; Boeren, Sjef; Böck, Andreas; Mutius, Von Erika; Vervoort, Jacques; Hettinga, Kasper

    2017-01-01

    Consumption of raw cow’s milk instead of industrially processed milk has been reported to protect children from developing asthma, allergies, and respiratory infections. Several heat-sensitive milk serum proteins have been implied in this effect though unbiased assessment of milk proteins in general

  5. Four-year monitoring of foodborne pathogens in raw milk sold by vending machines in Italy.

    Science.gov (United States)

    Giacometti, Federica; Bonilauri, Paolo; Serraino, Andrea; Peli, Angelo; Amatiste, Simonetta; Arrigoni, Norma; Bianchi, Manila; Bilei, Stefano; Cascone, Giuseppe; Comin, Damiano; Daminelli, Paolo; Decastelli, Lucia; Fustini, Mattia; Mion, Renzo; Petruzzelli, Annalisa; Rosmini, Roberto; Rugna, Gianluca; Tamba, Marco; Tonucci, Franco; Bolzoni, Giuseppe

    2013-11-01

    Prevalence data were collected from official microbiological records monitoring four selected foodborne pathogens (Salmonella, Listeria monocytogenes, Escherichia coli O157:H7, and Campylobacter jejuni) in raw milk sold by self-service vending machines in seven Italian regions (60,907 samples from 1,239 vending machines) from 2008 to 2011. Data from samples analyzed by both culture-based and real-time PCR methods were collected in one region. One hundred raw milk consumers in four regions were interviewed while purchasing raw milk from vending machines. One hundred seventy-eight of 60,907 samples were positive for one of the four foodborne pathogens investigated: 18 samples were positive for Salmonella, 83 for L. monocytogenes, 24 for E. coli O157:H7, and 53 for C. jejuni in the seven regions investigated. No significant differences in prevalence were found among regions, but a significant increase in C. jejuni prevalence was observed over the years of the study. A comparison of the two analysis methods revealed that real-time PCR was 2.71 to 9.40 times more sensitive than the culture-based method. Data on consumer habits revealed that some behaviors may enhance the risk of infection linked to raw milk consumption: 37% of consumers did not boil milk before consumption, 93% never used an insulated bag to transport raw milk home, and raw milk was consumed by children younger than 5 years of age. These results emphasize that end-product controls alone are not sufficient to guarantee an adequate level of consumer protection. The beta distribution of positive samples in this study and the data on raw milk consumer habits will be useful for the development of a national quantitative risk assessment of Salmonella, L. monocytogenes, E. coli O157, and C. jejuni infection associated with raw milk consumption.

  6. Determining the source of Bacillus cereus and Bacillus licheniformis isolated from raw milk, pasteurized milk and yoghurt.

    Science.gov (United States)

    Banykó, J; Vyletelová, M

    2009-03-01

    Strain-specific detection of Bacillus cereus and Bacillus licheniformis in raw and pasteurized milk, and yoghurt during processing. Randomly selected isolates of Bacillus spp. were subjected to PCR analysis, where single primer targeting to the repetitive sequence Box elements was used to fingerprint the species. The isolates were separated into six different fingerprint patterns. The results show that isolates clustered together at about the 57% similarity level with two main groups at the 82% and 83% similarity levels, respectively. Contamination with identical strains both of B. cereus and B. licheniformis in raw and pasteurized milk was found as well as contaminated with different strains (in the case of raw milk and yoghurt/pasteurized milk and yoghurt). Several BOX types traced in processed milk samples were not discovered in the original raw milk. BOX-PCR fingerprinting is useful for characterizing Bacillus populations in a dairy environment. It can be used to confirm environmental contamination, eventually clonal transfer of Bacillus strains during the technological processing of milk. Despite the limited number of strains analysed, the two Bacillus species yielded adequately detectable banding profiles, permitting differentiation of bacteria at the strain level and showing their diversity throughout dairy processing.

  7. Raw and Heat-Treated Milk: From Public Health Risks to Nutritional Quality

    Directory of Open Access Journals (Sweden)

    Francesca Melini

    2017-11-01

    Full Text Available Consumers have recently shown a preference for natural food products and ingredients and within that framework, their interest in consuming raw drinking milk has been highlighted, claiming nutritional, organoleptic and health benefits. However, a public debate has simultaneously emerged about the actual risks and benefits of direct human consumption of raw milk. This paper compares the microbiological, nutritional and sensory profile of raw and heat-treated milk, to evaluate the real risks and benefits of its consumption. In detail, it provides an updated overview of the main microbiological risks of raw milk consumption, especially related to the presence of pathogens and the main outputs of risk assessment models are reported. After introducing the key aspects of most commonly used milk heat-treatments, the paper also discusses the effects such technologies have on the microbiological, nutritional and sensory profile of milk. An insight into the scientific evidence behind the claimed protective effects of raw milk consumption in lactose-intolerant subjects and against the onset of asthma and allergy disorders in children is provided. The emergence of novel milk processing technologies, such as ohmic heating, microwave heating, high pressure processing, pulsed electric fields, ultrasound and microfiltration is also presented as an alternative to common thermal treatments.

  8. Raw milk from vending machines: Effects of boiling, microwave treatment, and refrigeration on microbiological quality.

    Science.gov (United States)

    Tremonte, Patrizio; Tipaldi, Luca; Succi, Mariantonietta; Pannella, Gianfranco; Falasca, Luisa; Capilongo, Valeria; Coppola, Raffaele; Sorrentino, Elena

    2014-01-01

    In Italy, the sale of raw milk from vending machines has been allowed since 2004. Boiling treatment before its use is mandatory for the consumer, because the raw milk could be an important source of foodborne pathogens. This study fits into this context with the aim to evaluate the microbiological quality of 30 raw milk samples periodically collected (March 2013 to July 2013) from 3 vending machines located in Molise, a region of southern Italy. Milk samples were stored for 72 h at 4 °C and then subjected to different treatments, such as boiling and microwaving, to simulate domestic handling. The results show that all the raw milk samples examined immediately after their collection were affected by high microbial loads, with values very close to or even greater than those acceptable by Italian law. The microbial populations increased during refrigeration, reaching after 72 h values of about 8.0 log cfu/mL for Pseudomonas spp., 6.5 log cfu/mL for yeasts, and up to 4.0 log cfu/mL for Enterobacteriaceae. Boiling treatment, applied after 72 h to refrigerated milk samples, caused complete decontamination, but negatively affected the nutritional quality of the milk, as demonstrated by a drastic reduction of whey proteins. The microwave treatment at 900 W for 75 s produced microbiological decontamination similar to that of boiling, preserving the content in whey proteins of milk. The microbiological characteristics of raw milk observed in this study fully justify the obligation to boil the raw milk from vending machines before consumption. However, this study also showed that domestic boiling causes a drastic reduction in the nutritional value of milk. Microwave treatment could represent a good alternative to boiling, on the condition that the process variables are standardized for safe domestic application. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  9. Bovine milk-derived exosomes for drug delivery

    Science.gov (United States)

    Gupta, Ramesh C.

    2015-01-01

    Exosomes are biological nanovesicles that are involved in cell-cell communication via the functionally-active cargo (such as miRNA, mRNA, DNA and proteins). Because of their nanosize, exosomes are explored as nanodevices for the development of new therapeutic applications. However, bulk, safe and cost-effective production of exosomes is not available. Here, we show that bovine milk can serve as a scalable source of exosomes that can act as a carrier for chemotherapeutic/chemopreventive agents. Drug-loaded exosomes showed significantly higher efficacy compared to free drug in cell culture studies and against lung tumor xenografts in vivo. Moreover, tumor targeting ligands such as folate increased cancer-cell targeting of the exosomes resulting in enhanced tumor reduction. Milk exosomes exhibited cross-species tolerance with no adverse immune and inflammatory response. Thus, we show the versatility of milk exosomes with respect to the cargo it can carry and ability to achieve tumor targetability. This is the first report to identify a biocompatible and cost-effective means of exosomes to enhance oral bioavailability, improve efficacy and safety of drugs. PMID:26604130

  10. The raw milk quality from organic and conventional agriculture

    Directory of Open Access Journals (Sweden)

    Juraj Čuboň

    2008-01-01

    Full Text Available In the experiment the parameters of milk quality from organic and conventional dairy farm were analyzed. The number of somatic cells was 219. 103 . ml−1 in the organic milk and 242. 103 . ml−1 in the conventional milk. It seems that conditions of organic farming could be able to have a positive effect of health of mammary gland. We found the highest number of somatic cells at the end of the year (336.103 . ml−1 in organic milk in December, respectively 336.103 . ml−1 in conventional milk in November. The total bacteria count was higher in organic milk (86.103 CFU . ml−1 than conventional (51.103 CFU . ml−1 likewise the number of coliform bacteria. Number of coliform bacteria was by conventional milk under 1000 CFU . ml−1 for all samples. The highest number of coliform bacteria in organic milk was achieved in February (1000 CFU . ml−1. We found higher content of fat (4.23 g . 100g−1 and protein (3.41 g . 100g−1 by organic milk in comparison with the conventional milk (4.11 g . 100g−1, resp. 3.39 g . 100g−1. The higher content of protein and fat in organic milk and the higher protein content in conventional milk were determined in December. The heat resistance was determined by 96 % ethanol required to coagulation of 2 ml of milk. The conventional milk has significantly lower heat resistance (1.38 ml than the organic one (1.86 ml. Better heat stability by organic milk and higher content of Ca (144.29 mg . 100g−1 correspond with higher technological quality of organic milk.

  11. Short communication: Microbial quality of raw milk following commercial long-distance hauling.

    Science.gov (United States)

    Darchuk, Emily M; Meunier-Goddik, Lisbeth; Waite-Cusic, Joy

    2015-12-01

    Hauling is a critical part of the commercial milk supply chain, yet very few studies have aimed to understand its effect on raw milk quality. This study focused on the effect of extended-duration tanker use during hauling on raw milk quality at a commercial facility. Standard tanker use [cleaned-in-place (CIP) once per 24h] served as a control and an incremental between-load water rinse with sanitizer treatment (RS) was evaluated to mitigate any effect from extended duration hauling. During this study, 1 commercial truck with 2 trailers was monitored for 10d. The truck collected milk at a large dairy farm, transported the milk to a manufacturing facility, and then returned to the same farm for a second load. Each round-trip journey took between 10 and 12h, allowing for 2 loads per 24-h use period. Following the second delivery, the truck was cleaned by CIP treatment starting a new treatment day. Producer samples were collected from the raw milk bulk tank on the farm before loading milk into the tanker. The same milk was sampled directly out of the tanker truck before unloading at the manufacturer. Effect on individual bacteria count, thermophilic spore count, and preliminary incubation count was quantified through common industry tests. Surface sponge swabs were also used to monitor tanker sanitation and the efficacy of cleaning treatments. Results did not identify a negative effect on raw milk quality due to extended duration hauling. Whereas the addition of RS did not provide any measurable quality benefits for the microbial milk quality, swab results demonstrated that the RS treatment was able to reduce surface bacteria in the tanker, although not to the same level as the full CIP treatment. Based on this study, current CIP practices for long distance milk hauling appear to be effective in mitigating any measurable effect on raw milk quality. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  12. Composition of raw cow milk and artisanal yoghurt collected in ...

    African Journals Online (AJOL)

    PONKA ROGER

    2013-12-04

    Dec 4, 2013 ... The composition of milk is of most importance to the dairy industry and human health. ... fraction was lower in yoghurt while Fe, Cu and Mn levels were lower in ... elements and water. ... blems result to the deterioration of fresh milk before ... milk was heated to boiling to destroy the pathogenic organisms at.

  13. Determination of Heavy Metals in Raw Milk Produced in Tangshan City, China

    Directory of Open Access Journals (Sweden)

    Li Aijun

    2016-01-01

    Full Text Available The objective of this study was to investigate the content of heavy metals (Arsenic, Lead, Chromium and Mercury in raw milk of Tangshan. Samples were obtained directly from dairy farms in Tangshan City. A total of 55 raw milk samples were collected in 2012, a total of 150 raw milk samples and 150 in 2013 and 2014 respectively. All the samples were analyzed by ICP-MS (Inductively Coupled Plasma Mass Spectrometry method-based on China National Standard. In general, heavy metals (Arsenic, Lead, Chromium and Mercury of raw milk in Tangshan were relatively safe for people’s health because none of those heavy metals (Arsenic, Lead, Chromium and Mercury contents exceeded the Maximum Limit set by China.

  14. "Don't Have A Cow, Man!": Recognizing Herd Share Agreements for Raw Milk.

    Science.gov (United States)

    Mayer, Timothy J

    2015-01-01

    Dissatisfaction with the industrial model of food production has caused many consumers to seek out food produced on local, family-scale farms that use U.S. Department of Agriculture certified organic or other sustainable practices to grow their food and raise their livestock. While almost all of the types of food that are available at the grocery store can also be found at the local farmers market, one food that is difficult to find in many states is raw milk—that is, milk that has not undergone pasteurization (heat treatment). This difficulty lies in the fact that most states prohibit the direct retail sale of raw milk to the final consumer because public health officials and state legislators fear that raw milk may contain bacteria harmful to human health such as E. coli, Campylobacter, and Listeria. However, some consumers reject these warnings and instead believe that raw milk possesses both nutritional and medicinal qualities. Indeed, an ever-increasing body of scientific research published in peer-reviewed journals supports the claim that raw milk consumption can mitigate or prevent some allergies and infections, especially in young children. In order for consumers to obtain raw milk in states where its sale is prohibited, some consumers have entered into arrangements with farmers known as “herd sharing,” through which the consumer effectively becomes an owner of the herd of cows or goats. For the price of the share and a monthly boarding fee, the shareholder can receive a weekly distribution of the herd’s primary dividend, namely the raw milk. Several states expressly permit this practice while most are silent and still a few prohibit it outright. The three courts in the United States that have ruled on herd share agreements have split, with two courts rejecting the agreements as a circumvention of the state’s prohibition on the sale of raw milk, and the other court assuming the agreement’s validity in light of the state’s failure to adequately

  15. Real-Time PCR Detection of Paenibacillus spp. in Raw Milk To Predict Shelf Life Performance of Pasteurized Fluid Milk Products

    OpenAIRE

    Ranieri, Matthew L.; Ivy, Reid A.; Mitchell, W. Robert; Call, Emma; Masiello, Stephanie N.; Wiedmann, Martin; Boor, Kathryn J.

    2012-01-01

    Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect...

  16. Measurement of Aflatoxin M1 in Raw and Pasteurized Cow Milk Samples by HPLC

    Directory of Open Access Journals (Sweden)

    afshin Nazari

    2007-10-01

    Full Text Available Nazari A1, Noroozi H2, Movahedi M3, Khaksarian M1 1. Instructor, Department of Physiology, Faculty of Medicine, Lorestan University of Medical Sciences 2. Assistant Professor, Department of Mycology, Faculty of Medicine, Iran University of Medical Sciences 3. Assistant Professor, Department of Genetic Epidemiology, Faculty of Medicine, Lorestan University of Medical Sciences Abstract Background: Aflatoxin M1 is a hydroxylated form of aflatoxin B1 which is produced by Aspergillus flavus. This toxin is produced when cows or other ruminants eat foods contaminated with these mycotoxins and then excrete them in the milk. The toxin is a potent liver and kidney carcinogenetic agent. Materials and methods: Forty two raw cows milk samples from local sources of milk collection and forty samples of commercial pasteurized market milk from Khorramabad, Lorestan, Iran were collected in summer and winter season of 2005. Twenty-one cow milk samples and 20 pasteurized milk samples in each season were analyzed for the presence of aflatoxin M1 (AFM1 by HPLC immunoaffinity columns. Results: Four of 21 raw milk samples in summer showed AFM1 levels between 0.017-0.046 ng/ml and all samples (100% in winter showed the presence of AFM1 levels between 0.003-0.041ng/ ml. AFM1 was detected in 55% of market pasteurized cow milk samples ranging from 0.017 to 0.533 ng/ml in summer and 100% ranging from 0.005-0.0054 ng/ml in winter.,Only one of all milk samples of pasteurized milk in summer had toxin level (0.533 ng/ml more than the maximum permissive limit (0.5 ng/ml. No significant difference was observed among mean contamination level of raw and pasteurized cow milk in two seasons. Key words: Aflatoxin M1, raw milk, pasteurized milk, Khoramabad, HPLC

  17. Effect of raw milk on lactose intolerance: a randomized controlled pilot study.

    Science.gov (United States)

    Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D

    2014-01-01

    This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). AUC H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10(-2), respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10(-2), respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC H2 and symptom severities were higher for both dairy milks compared with soy milk. Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance.

  18. Effect of Raw Milk on Lactose Intolerance: A Randomized Controlled Pilot Study

    Science.gov (United States)

    Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D.

    2014-01-01

    PURPOSE This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. METHODS We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC ∆H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). RESULTS AUC ∆H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10−2, respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10−2, respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC ∆H2 and symptom severities were higher for both dairy milks compared with soy milk. CONCLUSIONS Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance. PMID:24615309

  19. The microbial community of the gut differs between piglets fed sow milk, milk replacer or bovine colostrum

    DEFF Research Database (Denmark)

    Poulsen, Ann-Sofie Riis; de Jonge, Nadieh; Sugiharto, Sugiharto

    2017-01-01

    The aim of this study was to characterise the gut microbiota composition of piglets fed bovine colostrum (BC), milk replacer (MR) or sow milk (SM) in the post-weaning period. Piglets (n 36), 23-d old, were randomly allocated to the three diets. Faecal samples were collected at 23, 25, 27 and 30 d...

  20. Nutrient Profiles and Volatile Odorous Compounds of Raw Milk After Exposure to Electron Beam Pasteurizing Doses.

    Science.gov (United States)

    Ward, Lindsay R; Kerth, Chris R; Pillai, Suresh D

    2017-07-01

    Raw milk is known to contain relatively high numbers of microorganisms, some of which include microbial pathogens. Electron beam (eBeam) processing is a nonthermal pasteurization food processing technology. The underlying hypothesis was that eBeam processing will not negatively influence the composition, nutrient content, and aroma profile of raw milk. Raw milk samples were exposed to eBeam doses of 1 and 2 kGy, since our studies had shown that 2 kGy is suitable for raw milk pasteurization. The untreated and eBeam-treated raw milk samples were analyzed to detect changes in lactose, vitamin B 2 , vitamin B 12 , and calcium concentrations. The possible breakdown of casein and whey proteins and lipid oxidation were investigated along with the formation of volatile aroma compounds. Even though vitamin B 2 showed a 31.6% decrease in concentration, the B 2 content in eBeam-pasteurized raw milk met all USDA nutritional guidelines. Even though there were no indications of lipid oxidation after the 2.0-kGy eBeam treatment, there was lipid oxidation (58%) after 7 d of refrigerated storage. However, based on the GC-olfactory analysis, the lipid oxidation did not necessarily result in the development of a wide variety of off-odors. © 2017 Institute of Food Technologists®.

  1. Comparative analysis of the microbial communities in raw milk produced in different regions of Korea.

    Science.gov (United States)

    Kim, In Seon; Hur, Yoo Kyung; Kim, Eun Ji; Ahn, Young-Tae; Kim, Jong Geun; Choi, Yun-Jaie; Huh, Chul Sung

    2017-11-01

    The control of psychrotrophic bacteria causing milk spoilage and illness due to toxic compounds is an important issue in the dairy industry. In South Korea, Gangwon-do province is one of the coldest terrains in which eighty percent of the area is mountainous regions, and mainly plays an important role in the agriculture and dairy industries. The purposes of this study were to analyze the indigenous microbiota of raw milk in Gangwon-do and accurately investigate a putative microbial group causing deterioration in milk quality. We collected raw milk from the bulk tank of 18 dairy farms in the Hoengseong and Pyeongchang regions of Gangwon-do. Milk components were analyzed and the number of viable bacteria was confirmed. The V3 and V4 regions of 16S rRNA gene were amplified and sequenced on an Illumina Miseq platform. Sequences were then assigned to operational taxonomic units, followed by the selection of representative sequences using the QIIME software package. The milk samples from Pyeongchang were higher in fat, protein, lactose, total solid, and solid non-fat, and bacterial cell counts were observed only for the Hoengseong samples. The phylum Proteobacteria was detected most frequently in both the Hoengseong and Pyeongchang samples, followed by the phyla Firmicutes and Actinobacteria. Notably, Corynebacterium, Pediococcus, Macrococcus, and Acinetobacter were significantly different from two regions. Although the predominant phylum in raw milk is same, the abundances of major genera in milk samples were different between Hoengseong and Pyeongchang. We assumed that these differences are caused by regional dissimilar farming environments such as soil, forage, and dairy farming equipment so that the quality of milk raw milk from Pyeongchang is higher than that of Hoengseong. These results could provide the crucial information for identifying the microbiota in raw milk of South Korea.

  2. Fatty acid profile and health lipid indices in the raw milk of ...

    African Journals Online (AJOL)

    qw-k

    2015-02-26

    Feb 26, 2015 ... in the raw milk of Simmental and Holstein-Friesian cows from an organic farm. ... as an important source of energy, high-quality protein and essential ... Nevertheless, inter-breed differences in the milk fat composition were ...

  3. Draft Genome Sequence of Bacillus sp. FMQ74, a Dairy-contaminating Isolate from Raw Milk

    DEFF Research Database (Denmark)

    Okshevsky, Mira Ursula; Regina, Viduthalai R.; Marshall, Ian

    2017-01-01

    Representatives of the genus Bacillus are common milk contaminants that cause spoilage and flavor alterations of dairy products. Bacillus sp. FMQ74 was isolated from raw milk on a Danish dairy farm. To elucidate the genomic basis of this strain’s survival in the dairy industry, a high-quality draft...

  4. Bovine milk osteopontin - Targeting bacterial adhesion for biofilm control

    DEFF Research Database (Denmark)

    Kristensen, Mathilde Frost; Meyer, Rikke Louise; Schlafer, Sebastian

    2016-01-01

    Self-performed mechanical tooth cleaning does usually not result in complete biofilm removal, due to the complex oral anatomy and the strong adhesion of the biofilm to the tooth. Therefore, different supportive measures are employed, most of which aim at the chemical eradication of bacteria...... in dental biofilms. As their bactericidal action impacts the entire oral microflora, agents that inhibit biofilm formation without killing bacteria, such as the bovine milk protein osteopontin, have gained increasing attention. Here, we investigate the adhesion of 8 bacterial species associated with dental...... subsp. paracasei, Streptococcus mitis and Streptococcus oralis with 74.0%, 62.4%, 90.0%, 89.6% and 81.5%, respectively, compared to protein-free saliva. All reductions were statistically significant (p

  5. Bacteriocins of Non-aureus Staphylococci Isolated from Bovine Milk.

    Science.gov (United States)

    Carson, Domonique A; Barkema, Herman W; Naushad, Sohail; De Buck, Jeroen

    2017-09-01

    infections. We examined the ability of 441 NAS bacteria from Canadian bovine milk samples to inhibit growth of S. aureus in the laboratory. Overall, 9% inhibited growth of S. aureus and 58% of those also inhibited MRSA. In NAS whole-genome sequences, we identified >21% of NAS as having bacteriocin genes. Our study represents a foundation to further explore NAS bacteriocins for clinical use. Copyright © 2017 American Society for Microbiology.

  6. Bacteriocins of Non-aureus Staphylococci Isolated from Bovine Milk

    Science.gov (United States)

    Carson, Domonique A.; Barkema, Herman W.; Naushad, Sohail

    2017-01-01

    . We examined the ability of 441 NAS bacteria from Canadian bovine milk samples to inhibit growth of S. aureus in the laboratory. Overall, 9% inhibited growth of S. aureus and 58% of those also inhibited MRSA. In NAS whole-genome sequences, we identified >21% of NAS as having bacteriocin genes. Our study represents a foundation to further explore NAS bacteriocins for clinical use. PMID:28667105

  7. Towards a decision support system for control of multiple food safety hazards in raw milk production

    NARCIS (Netherlands)

    Spiegel, van der M.; Sterrenburg, P.; Haasnoot, W.; Fels-Klerx, van der H.J.

    2013-01-01

    Decision support systems (DSS) for controlling multiple food safety hazards in raw milk production have not yet been developed, but the underlying components are fragmentarily available. This article presents the state-of-the-art of essential DSS elements for judging food safety compliance of raw

  8. Effects of bovine milk lactoperoxidase system on some bacteria.

    Science.gov (United States)

    Cankaya, M; Sişecioğlu, M; Bariş, O; Güllüce, M; Ozdemir, H

    2010-01-01

    Bovine lactoperoxidase (LPO) was purified from skimmed milk using amberlite CG-50-H+ resin, CM sephadex C-50 ion-exchange chromatography, and sephadex G-100 gel filtration chromatography. Lactoperoxidase was purified 20.45-fold with a yield of 28.8%. Purity of enzyme checked by sodium dodecyl sulphate-polyacrylamide gel electrophoresis method and a single band was observed. Km was 0.25 mM at 20 degrees C, Vmax value was 7.95 micromol/ml min at 20 degrees C (pH 6.0). Antibacterial study was done by disk diffusion method of Kir-by-Bauer using Mueller-Hinton agar medium with slight modification. Bovine LPO showed high antibacterial activity in 100 mM thiocyanate-100 mM H2O2 medium for some bacteria (Brevibacillus centrosaurus, B. choshinensis, B. lyticum, Cedecea davisae, Chryseobacterium indoltheticum, Clavibacter michiganense pv. insidiosum, Kocuria erythromyxa, K. kristinae, K. rosea, K. varians, Paenibacillus validus, Pseudomonas syringae pv. populans, Ralstonia pickettii, Rhodococcus wratislaviensis, Serratia fonticola, Streptomyces violaceusniger, Vibrio cholerae-nonO1) respectively, and compared with well known antibacterial substances (levofloxacin, netilmicin). LPO system has inhibition effects on all type bacteria and concentration is really important such as LPO-100 mM thiocyanate-100 mM H2O2 system was proposed as an effective agent against many factors causing several diseases.

  9. ELECTROLYTE AND MINERAL COMPOSITION OF TERM DONOR HUMAN MILK BEFORE AND AFTER PASTEURIZATION AND OF RAW MILK OF PRETERM MOTHERS.

    Science.gov (United States)

    Codo, Carla Regina Bianchi; Caldas, Jamil Pedro de Siqueira; Peixoto, Rafaella Regina Alves; Sanches, Vitor Lacerda; Guiraldelo, Tamara Cristina; Cadore, Solange; Marba, Sérgio Tadeu Martins

    2018-02-22

    To determine and compare the concentrations of electrolytes and minerals in three different types of maternal milk samples: term donor milk before pasteurization, term donor milk after pasteurization and raw milk of mothers of preterm newborns at bedside. Descriptive cross-sectional study. Concentrations of calcium (Ca), phosphorous (P), magnesium (Mg), sodium (Na) and potassium (K) were measured in random samples of three human breast milk groups. Samples were analyzed using acid mineralization assisted by microwave radiation and further analysis by inductively coupled plasma optical emission spectrometry. Concentrations were expressed in mg/L, described as mean and standard deviation. The one-way ANOVA and Tukey's post-test were applied to determine the variability between the means of each group. Significance level was set at 5%. There was a significant reduction in the content of Ca (259.4±96.8 vs. 217.0±54.9; p=0.003), P (139.1±51.7 vs. 116.8±33.3; p=0.004) and K (580.8±177.1 vs. 470.9±109.4; ppasteurization. Samples of raw milk presented higher contents of Na than the donated milk (twice). The elements P and Ca would only reach the daily intake levels recommended by the European Society of Pediatric Gastroenterology, Hepatology and Nutrition if at least 60 mL of milk could be offered every 3 hours. Mg levels were not different between the three groups. There was a significant reduction in Ca, P and K levels in samples after pasteurization. The Na value in raw milk, collected at bedside, was higher than in the samples of donor's milk before pasteurization.

  10. STAT6-Dependent Collagen Synthesis in Human Fibroblasts Is Induced by Bovine Milk.

    Directory of Open Access Journals (Sweden)

    Stefan Kippenberger

    Full Text Available Since the domestication of the urus, 10.000 years ago, mankind utilizes bovine milk for different purposes. Besides usage as a nutrient also the external application of milk on skin has a long tradition going back to at least the ancient Aegypt with Cleopatra VII as a great exponent. In order to test whether milk has impact on skin physiology, cultures of human skin fibroblasts were exposed to commercial bovine milk. Our data show significant induction of proliferation by milk (max. 2,3-fold, EC50: 2,5% milk without toxic effects. Surprisingly, bovine milk was identified as strong inducer of collagen 1A1 synthesis at both, the protein (4-fold, EC50: 0,09% milk and promoter level. Regarding the underlying molecular pathways, we show functional activation of STAT6 in a p44/42 and p38-dependent manner. More upstream, we identified IGF-1 and insulin as key factors responsible for milk-induced collagen synthesis. These findings show that bovine milk contains bioactive molecules that act on human skin cells. Therefore, it is tempting to test the herein introduced concept in treatment of atrophic skin conditions induced e.g. by UV light or corticosteroids.

  11. RAW MILK IN AUTOMATIC SALE MACHINES: MONITORING PLAN IN PIEDEMONT REGION

    Directory of Open Access Journals (Sweden)

    S. Gallina

    2010-06-01

    Full Text Available Raw milk at vending machine is surging in popularity amongst consumers of Northern Italy; indeed in Piedmont Region there are more than 100 vending machines. In June 2008 Piedmont Region set out a specific monitoring plan to check the milk quality. From June to December 2008, 113 raw milk samples were collected at vending machines. Samples were analysed for Listeria monocytogenes, Salmonella spp., coagulase positive staphylococci, Staphylococcus aureus and Campylobacter. Moreover, 100 samples were analysed for the quantification of aflatoxin M1. 26 samples have been resulted Not Conform for the hygienic criteria and 1 exceeded the aflatoxin M1 limit.

  12. Comparing the sensitizing capacity of raw and processed cow's milk in a murine sensitization model for food allergy

    NARCIS (Netherlands)

    Abbring, S.; Diks, M.A.P.|info:eu-repo/dai/nl/372617298; Dingjan, G.M.; Baars, T.; Garssen, J.|info:eu-repo/dai/nl/086369962; Van Esch, B.C.A.M.|info:eu-repo/dai/nl/304839256

    2016-01-01

    Background: Epidemiological studies show that the consumption of raw milk early in life is protective against the development of allergies later in life. The effect was found to be limited to raw milk consumption and was not observed when this milk was boiled or when pasteurized and homogenized shop

  13. Microbiological Quality of Raw Goat Milk in Bogor, Indonesia

    Directory of Open Access Journals (Sweden)

    E. Taufik

    2011-08-01

    Full Text Available Milk samples were investigated for counts and prevalence of indicator bacteria, which were TPC, coliforms, coagulase positive Staphylococci (CPS, and coagulase negative Staphylococci (CNS. Ten potential risk factors were also evaluated in relation to the prevalence of indicator bacteria. The results showed that the median values of indicator bacterial counts from overall udder-half milk samples were 3.74, 0.70, 1.70, and 2.52 log cfu/ml and from bulk milk samples were 5.69, 2.98, 3.66 and 3.32 log cfu/ml for TPC, coliforms, CPS, and CNS, respectively. None of the median values of overall udder-half milk samples exceeded the maximum limit of the standards for all indicator bacteria. However, in the bulk milk samples only the median value of TPC below the maximum limit of the standards. Overall prevalence of coliforms, CPS and CNS from udder-half milk samples were 46.3%, 37.7%, and 66.0%, respectively, and from bulk milk samples were 86.7%, 76.7%, and 86.7%, respectively. Saanen crossbreed, fifth parity and udders with inflammation were found to be risk factors. This study results indicated that the hygienic practices in the dairy goat farms are still need to be increased. To increase the hygienic level of the milk, the identified significant risk factors must be controlled.

  14. Bacterial contaminations of informally marketed raw milk in Ghana ...

    African Journals Online (AJOL)

    Background: Milk has an outstanding nutritional quality but is also an excellent medium for bacterial growth and an important source of bacterial infection when consumed without pasteurization. Objective: To estimate the bacterial health risk of milk consumption in Accra and Kumasi, the twomajor cities in Ghana. Method: A ...

  15. A novel isolation strategy for obtaining crude membrane vesicles from bovine skim milk

    DEFF Research Database (Denmark)

    Blans, Kristine; Larsen, Lotte Bach; Wiking, Lars

    2014-01-01

    as exosomes and microvesicles. These vesicles contain various types of RNAs and proteins, suggested to transfer health-promoting messages from mother to offspring. However, the variety of the vesicles in milk is less understood and, additionally, complicated by the complexity of more pronounced milk...... components. Here we present a novel strategy for a short, gentle and non-denaturing isolation of skim milk-derived membrane vesicles. Methods: Untreated fresh bovine milk was defatted to remove milk fat globules. The resulting skim milk was subjected to ultracentrifugation. The resulting ochre...

  16. Contamination levels of aflatoxin M1 in bulk raw milk of Chaloos and Ramsar

    Directory of Open Access Journals (Sweden)

    A.R Barami

    2012-02-01

    Full Text Available Aflatoxin M1 (AFM1 appears in milk as a direct result of the ingestion of feed contaminated with aflatoxin B1 by cattle. This study was conducted to investigate the contamination rate of raw milk whit aflatoxin M1 in Chaloos and Ramsar raw milk collection centers. Two hundred bulk raw milk samples were collected during winter (January and February and summer (June and July seasons. The milk samples were analyzed by ELISA method for the presence of AFM1. During the winter, AFM1 was detected in 100% and 59/79% of the bulk raw milk samples in Ramsar and Chaloos, respectively; however, during summer 83/52% and 50/1 of the samples was found as positive in Ramsar and Chaloos, respectively. Furthermore, 45% of Ramsar and 30% of Chaloos bulk milk samples showed higher contamination level of AFM1 than maximum tolerance limit (50 ng/l accepted by National Standard as well as European Union. Although, the difference between the contamination rate in samples obtained during summer and winter seasons was not statistically significantly, (p

  17. Molds contamination of raw milk and dairy products: Occurrence, diversity and contamination source

    Directory of Open Access Journals (Sweden)

    T Moshtaghi Maleki

    2015-11-01

    Full Text Available This study aimed to assess the occurrence and diversity of mold species in raw milk and its products along with the identification of potential contamination sources. For this reason, a total of 260 samples consisting of 80 raw milk, 100 dairy products (i.e., pasteurized milk, yoghurt, cheese and buttermilk and 80 environmental (i.e. ingredients, packaging materials, surface of processing equipments and air specimens were collected. Using culture assay and microscopic observation, the occurrence as well as the diversity of mold species was investigated. According to the results, 82.3% of the samples were identified as positive for mold contamination. The percentage of mold contamination for raw milk was estimated as 97.5%. In the case of pasteurized milk, yoghurt, buttermilk, cheese and environmental samples, it was determined as 52%, 76%, 52%, 56% and 96.25%, respectively. Mold diversity among various samples consisted of Aspergillus, Geotrichum, Penicillium, Mucor, Alternaria, Rhizopus, Stemphylium, Cladosporium, and Fusarium. Results revealed a significant (p < 0.01 correlation between kind of mold species isolated from raw milk and dairy products. Similarly, a correlation was observed between dairy products and environmental sources. Regarding the high occurrence of mold contamination in raw milk and environmental sources, it seems that in some instances heat treatment was not effective enough to inactivate all molds; whereas in some other cases, cross contamination may have resulted in mold contamination. Therefore, it is crucial to maintain hygienic conditions during raw milk handling as well as processing steps. These practices could efficiently reduce the occurrence of mold contaminations in dairy products.

  18. The Effect of Bovine Milk on the Growth of Bombyx mori

    OpenAIRE

    Konala, Niharika; Abburi, Praveena; Bovilla, Venugopal Reddy; Mamillapalli, Anitha

    2013-01-01

    Bombyx mori L. (Lepidoptera: Bombycidae) is a well-studied Lepidopteran model system because of its morphology, life cycle, and economic importance. Many scientists have placed importance on enhancing the economic traits of B. mori because it's larvae, silkworms, are vital in the production of silk. In this study, the effect of bovine milk on B. mori growth was tested. Bovine milk contains several components that aid in healthy growth. The treatment was given to fifth instar B. mori larvae be...

  19. OXA-48 and CTX-M-15 extended-spectrum beta-lactamases in raw milk in Lebanon: epidemic spread of dominant Klebsiella pneumoniae clones.

    Science.gov (United States)

    Diab, Mohamad; Hamze, Monzer; Bonnet, Richard; Saras, Estelle; Madec, Jean-Yves; Haenni, Marisa

    2017-11-01

    Raw milk has recently been reported as a source of extended-spectrum beta-lactamase (ESBL) and carbapenemase genes. We thus investigated the prevalence of ESBL- and carbapenemase-producing Enterobacteriaceae in raw milk in Lebanon in order to assess the risk of transfer of these bacteria to humans. A high prevalence (30.2 %) of CTX-M-15-producing K. pneumoniae was detected in raw bovine milk. Three main K. pneumoniae clones were identified by PFGE and MLST typing. Southern blot experiments revealed that one of these clones carried the blaCTX-M-15 gene chromosomally. Moreover, one OXA-48-producing K. pneumoniae ST530 and seven CTX-M-15-producing Escherichia coli sharing the same ST were also detected. These findings highlight the spread of dominant CTX-M-15-producing K. pneumoniae clones and OXA-48-producing isolates in the food chain. Milk, which is mostly consumed raw in Lebanon, may be a source of human exposure to ESBLs and carbapenemases.

  20. Short communication: The effect of raw milk cooling on sensory perception and shelf life of high-temperature, short-time (HTST)-pasteurized skim milk.

    Science.gov (United States)

    Lee, A P; Barbano, D M; Drake, M A

    2016-12-01

    The cooling rate of raw milk may influence sensory properties and pasteurized shelf life. Under the Pasteurized Milk Ordinance for grade A milk, raw milk may be cooled instantaneously by on-farm heat exchangers but is also acceptable if "cooled to 10°C or less within four (4) hours of the commencement of the first milking." The objective of this study was to determine the effect of raw milk cooling on consumer perception and shelf life. Raw milk (18-21°C) was obtained and transported within 1h of milking to North Carolina State University (Raleigh). The batch of raw milk was split in 2 portions, and a plate heat exchanger was used to quickly cool one portion to <6°C within 1min. The second portion was stored in a jacketed bulk tank and slowly cooled over 4h to <10°C. Milk from 3 consecutive milkings was collected every 12h, with subsequent milkings added to the previous collections. The bulk milk was kept below 10°C while adding milk for the slow cool milk treatment. After 72h, each whole milk was separated; the skim milk was pasteurized at 73 or 78°C for 20 s, homogenized, and held at 4°C. Difference tests (n=75) and consumer acceptance tests (n=100) were conducted to determine if consumers could detect differences among milks. Descriptive analysis and microbial testing for aerobic, psychrotrophic, and psychrotolerant spore counts were conducted through shelf life. The entire experiment was repeated in triplicate. Raw milks averaged 3.3 logcfu/mL by aerobic plate count, <25cfu/mL coliforms, somatic cell count of 300,000 cells/mL, and 3.15±0.07% protein. Psychrotolerant spores were not found in the raw milk. Consumers could not detect differences between cooling treatments of the same pasteurization temperature or between different temperatures of the same cooling treatment. Milks reached sensory failure 49±4d on average after processing, and aerobic counts were between 5 to 7 logcfu/mL. Cooling treatment had no effect on shelf life. These results suggest

  1. Novel sensitive monoclonal antibody based competitive enzyme-linked immunosorbent assay for the detection of raw and processed bovine beta-casein.

    Science.gov (United States)

    Castillo, Daniela S; Cassola, Alejandro

    2017-01-01

    Cow milk protein allergy (CMPA) is the most common childhood food allergy, which can sometimes persist or can newly develop in adulthood with severe symptoms. CMPA's treatment is complete dietary avoidance of milk proteins. To achieve this task, patients have to be aware of milk proteins found as "hidden allergens" in food commodities. In regard to milk proteins, it has been reported that allergenicity of caseins remains unaffected upon heat treatment. For these reasons, we aimed to obtain monoclonal antibodies (mAbs) against native and denatured β-casein, one of the most abundant and antigenic caseins, in order to develop an indirect competitive ELISA (icELISA) to detect and quantify traces of this milk allergen in raw and processed foodstuffs. We developed two specific hybridoma clones, 1H3 and 6A12, which recognized β-casein in its denatured and native conformations by indirect ELISA (iELISA). Cross-reaction analysis by Western blot and iELISA indicated that these mAbs specifically recognized β-casein from bovine and goat milk extracts, while they did not cross-react with proteins present in other food matrixes. These highly specific mAbs enabled the development of sensitive, reliable and reproducible icELISAs to detect and quantify this milk protein allergen in food commodities. The extraction of β-casein from foodstuff was efficiently carried out at 60°C for 15 minutes, using an extraction buffer containing 1% SDS. The present study establishes a valid 1H3 based-icELISA, which allows the detection and quantification -0.29 ppm and 0.80 ppm, respectively- of small amounts of β-casein in raw and processed foods. Furthermore, we were able to detect milk contamination in incurred food samples with the same sensitivity as a commercial sandwich ELISA thus showing that this icELISA constitutes a reliable analytical method for control strategies in food industry and allergy prevention.

  2. The freezing point of raw and heat treated sheep milk and its variation during lactation

    Directory of Open Access Journals (Sweden)

    Bohumíra Janštová

    2013-01-01

    Full Text Available The freezing point of milk is an important indicator of the adulteration of the milk with water, but heat treatment may also affect its value. The aim of this study was determine freezing point of raw and heat treated sheep milk and its variation during lactation. The freezing point was determined in 42 bulk tank raw sheep milk samples and 42 pasteurized milk samples collected during lactation of sheep at one ecofarm in Moravian Walachia (Valašsko in the Czech Republic. The freezing point was determined in accordance with the standard ČSN 57 0538 using a thermistor cryoscope. The average freezing point of raw milk was -0.617 ± 0.052 °C, with a range from -0.560 to -0.875 °C. The freezing point was lower in the first months of lactation and increased at the end of lactation. The freezing point correlated (r = 0.8967 with the content of total non-fat solids. The average freezing point of sheep milk pasteurized at 65 °C for 30 min was -0.614 ± 0.053 °C, with a range from -0.564 to -0.702 °C. The median of freezing point differences between raw and pasteurized milk was 0.004 °C. Our study extends data about physico-chemical properties of sheep milk and registers for the first time specific changes in the freezing point value of sheep milk by heating.

  3. Protective effect of bovine milk against HCl and ethanol-induced gastric ulcer in mice.

    Science.gov (United States)

    Yoo, Jeong-Hyun; Lee, Jeong-Sang; Lee, You-Suk; Ku, SaeKwang; Lee, Hae-Jeung

    2018-05-01

    The purpose of this study was to investigate the gastroprotective effects of bovine milk on an acidified ethanol (HCl-ethanol) mixture that induced gastric ulcers in a mouse model. Mice received different doses of commercial fresh bovine milk (5, 10, and 20 mL/kg of body weight) by oral gavage once a day for 14 d. One hour after the last oral administration of bovine milk, the HCl-ethanol mixture was orally intubated to provoke severe gastric damage. Our results showed that pretreatment with bovine milk significantly suppressed the formation of gastric mucosa lesions. Pretreatment lowered gastric myeloperoxidase and increased gastric mucus contents and antioxidant enzymes catalase and superoxide dismutase. Administration of bovine milk increased nitrate/nitrite levels and decreased the malondialdehyde levels and the expression of proinflammatory genes, including transcription factor nuclear factor-κB, cyclooxygenase-2, and inducible nitric oxide synthase in the stomach of mice. These results suggest that bovine milk can prevent the development of gastric ulcer caused by acid and alcohol in mice. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. Short communication: Microbiological quality of raw cow milk and its association with herd management practices in Northern China.

    Science.gov (United States)

    Lan, X Y; Zhao, S G; Zheng, N; Li, S L; Zhang, Y D; Liu, H M; McKillip, J; Wang, J Q

    2017-06-01

    Contamination of raw milk with bacterial pathogens is potentially hazardous to human health. The aim of this study was to evaluate the total bacteria count (TBC) and presence of pathogens in raw milk in Northern China along with the associated herd management practices. A total of 160 raw milk samples were collected from 80 dairy herds in Northern China. All raw milk samples were analyzed for TBC and pathogens by culturing. The results showed that the number of raw milk samples with TBC milk samples were Staphylococcus aureus positive, 72 (45.00%) were Escherichia coli positive, 2 (1.25%) were Salmonella positive, 2 (1.25%) were Listeria monocytogenes positive, and 3 (1.88%) were Campylobacter positive. The prevalence of S. aureus was influenced by season, herd size, milking frequency, disinfection frequency, and use of a Dairy Herd Improvement program. The TBC was influenced by season and milk frequency. The correlation between TBC and prevalence of S. aureus or E. coli is significant. The effect size statistical analysis showed that season and herd (but not Dairy Herd Improvement, herd size, milking frequency, disinfection frequency, and area) were the most important factors affecting TBC in raw milk. In conclusion, the presence of bacteria in raw milk was associated with season and herd management practices, and further comprehensive study will be powerful for effectively characterizing various factors affecting milk microbial quality in bulk tanks in China. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. Composition of raw cow milk and artisanal yoghurt collected in ...

    African Journals Online (AJOL)

    PONKA ROGER

    2013-12-04

    Dec 4, 2013 ... cribed as being almost a complete food for man. It contains carbohydrates, protein ... For centuries, milk production in Cameroon has been characterized by a ...... and maintenance of the human body. (FAO/WHO/UNU, 2007).

  6. Comparação de metodologias para a determinação do pH e do ponto de congelamento do leite bovino cru sob diferentes características de conservação Comparison of methodologies for the determination of pH and freezing point in raw bovine milk under different conservation characteristics

    Directory of Open Access Journals (Sweden)

    Viviane Maia de Araújo

    2011-07-01

    of this work was to compare reference methodologies to Fourier transform infrared spectroscopy for analysis of pH and freezing point (FP under different storage conditions on samples of raw bovine milk. Milk samples were collected from bulk tank milk on 57 farms. Each sample was subdivided into 45 vials (40 mL which were distributed according to storage temperature (-20ºC, 7ºC and 25ºC, age of the sample (0, 3, 6 and 9 days and levels of water addition (0, 2, 4 and 6%. Bronopol was added into 44 flasks and one was maintained without addition of preservative for control. Frozen point and pH were determined by the standard methods (thermistor cryoscope and potentiometer, respectively and by the alternative methodology by using MilkoScanTM FT+. The results from each method, at different conditions of conservation of the samples, were evaluated by analysis of variance and comparison of means. The linear regression analysis was performed to evaluate the methodologies (reference and alternative for results of the frozen point in function of the age of the sample. Bronopol did not alter pH means, but it reduced frozen point. Correction factors were calculated to eliminate this effect on the results of the frozen point. Means of pH in three-day samples, kept at -20ºC and 25ºC were lower than the samples at 7ºC. The age of the samples affected the results of pH when they were submitted to 25ºC. The increase of storage temperature to 25ºC reduced means of frozen point in samples without addition of water and at nine days of storage. The increase in age of sample at -20ºC and 7ºC does not affect means of frozen point. There is a strong correlation among methodologies in function of age of the sample for frozen point.

  7. Assessment of the application of an automated electronic milk analyzer for the enumeration of total bacteria in raw goat milk.

    Science.gov (United States)

    Ramsahoi, L; Gao, A; Fabri, M; Odumeru, J A

    2011-07-01

    Automated electronic milk analyzers for rapid enumeration of total bacteria counts (TBC) are widely used for raw milk testing by many analytical laboratories worldwide. In Ontario, Canada, Bactoscan flow cytometry (BsnFC; Foss Electric, Hillerød, Denmark) is the official anchor method for TBC in raw cow milk. Penalties are levied at the BsnFC equivalent level of 50,000 cfu/mL, the standard plate count (SPC) regulatory limit. This study was conducted to assess the BsnFC for TBC in raw goat milk, to determine the mathematical relationship between the SPC and BsnFC methods, and to identify probable reasons for the difference in the SPC:BsnFC equivalents for goat and cow milks. Test procedures were conducted according to International Dairy Federation Bulletin guidelines. Approximately 115 farm bulk tank milk samples per month were tested for inhibitor residues, SPC, BsnFC, psychrotrophic bacteria count, composition (fat, protein, lactose, lactose and other solids, and freezing point), and somatic cell count from March 2009 to February 2010. Data analysis of the results for the samples tested indicated that the BsnFC method would be a good alternative to the SPC method, providing accurate and more precise results with a faster turnaround time. Although a linear regression model showed good correlation and prediction, tests for linearity indicated that the relationship was linear only beyond log 4.1 SPC. The logistic growth curve best modeled the relationship between the SPC and BsnFC for the entire sample population. The BsnFC equivalent to the SPC 50,000 cfu/mL regulatory limit was estimated to be 321,000 individual bacteria count (ibc)/mL. This estimate differs considerably from the BsnFC equivalent for cow milk (121,000 ibc/mL). Because of the low frequency of bulk tank milk pickups at goat farms, 78.5% of the samples had their oldest milking in the tank to be 6.5 to 9.0 d old when tested, compared with the cow milk samples, which had their oldest milking at 4 d

  8. CONTRIBUTION TO THE DEBATE ON THE MICROBIOLOGICAL QUALITY OF RAW MILK FROM VENDING MACHINES

    Directory of Open Access Journals (Sweden)

    Ján Šnelcer

    2011-07-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE MicrosoftInternetExplorer4 Microbiological quality or raw milk from vending maschine was analyzed in this work. Despite the pathogenic bacteria may be present in raw milk, the analyses and evaluations were focused to bacterial indicators only. Refer to total bacterial counts, the criterion ≤ 100,000 cfu/ml met 12 from 15 samples (80% and all samples complied with the supplementary criterion of 5×104 cfu/ml for psychrotrophs. Numbers of coagulase-positive staphylococci ranged closely around the average value 2.9×102 cfu/ml. Average numbers of coliforms and E. coli in raw milk were found 4.34 ± 0.42 and 3.25 ± 0.83 log CFU/ml, respectively. These values significantly exceeded even the limits applicable in the past. On the basis of unchanged numbers of these bacteria in milk after 24 h at 6 °C, we assume that the high numbers of coliforms and E. coli present in milk are the result of fecal contamination and not growth. As E. coli is an indicator of faecal contamination of raw milk comprising the possible presence of Salmonella sp. Campylobacter sp. and other pathogens, microbiological survey suggested appropriate preventive measures that should be applied in terms of risk management.doi:10.5219/98

  9. Proteolytic and lipolytic microbiota of refrigerated raw milk from northeast and southern regions of Brazil

    Directory of Open Access Journals (Sweden)

    Jose Carlos Ribeiro Junior

    2015-12-01

    Full Text Available The shelf life of milk and milk derivatives is directly related to the microbiological quality of refrigerated raw milk. Spoilage microorganisms with proteolytic and/or lipolytic properties are primarily responsible for the decrease in the quality of milk, which is reflected in the shelf life of pasteurized milk and all derivatives. The aim of this study was to determine the spoilage microbial load of refrigerated raw milk from the northeast and southern regions of Brazil, which have different climatic and technological conditions of production. We evaluated 46 samples of milk from the state of Paraná in the southern region, and 10 samples of milk from the state of Maranhão in the northeast region, totaling 56 samples collected from November 2013 to November 2014. The producers of Paraná were divided into large (20 or small (26 according to the average daily production. All producers of Maranhão were considered small (<500L/day. The proteolytic and lipolytic microorganism counts were conducted in milk agar and tributyrin agar, respectively. Milk from the large producers of Paraná had average counts of 1.4 × 104 CFU/mL for proteolytic microorganisms and 1.2 × 103 CFU/mL for lipolytics microorganisms, significantly (p <0.05 lower than the small producers in the same state, and the producers of Maranhão. Producers of Maranhao had counts of 1.1 × 105 CFU/mL for proteolytic microorganisms and 2 × 105 CFU/mL for lipolytic microorganisms, with the proteolytic count significantly lower than that of small Paraná producers. The amount of proteolytic and lipolytic spoilage microorganisms in milk is influenced by the adaptation of the microorganisms to cold, promoted by the cooling of milk, which is practiced less frequently in the country’s northeastern region. The amount of spoilage microorganisms is also affected by the implementation of milking hygiene practices, which reduce contamination. Such practices are more frequently and efficiently

  10. Assessment of Raw Cow Milk Quality in Smallholder Dairy Farms in Pemba Island Zanzibar, Tanzania

    Directory of Open Access Journals (Sweden)

    S. H. Gwandu

    2018-01-01

    Full Text Available Milk quality depends on the physicochemical characteristics, hygienic standards, and nutritional quality; however, animal husbandry practices, unhygienic harvesting and processing, may affect its quality. A cross-sectional study was conducted between August 2010 and July 2011 to assess the hygiene of cow milk production environment, raw cow milk physicochemical characteristics, and microbial quality and estimate the prevalence of antimicrobial residues using standard methods in Pemba Island. A total of 98 raw cow milk samples from selected smallholder dairy farms were analyzed, and the judgement on the quality used the East African Standards. Generally, the milk production chain was done under the unhygienic condition, and dirty plastic containers were used for collection and storage of milk under room temperature. Some milk samples had abnormal colour (2.1%, abnormal smell (7.1%, and pH below normal (35.7%, clotted on alcohol test (9.2%, and had the specific gravity below normal (13.3%. All the milk samples had mineral contents within the recommended range. Milk samples with butterfat below normal were 29.6%, while 14.3% had total solids below recommended values. The mean total viable count (TVC of milk container surfaces was 9.7±10.5 log CFU/100 cm2, while total coliform count (TCC was 7.8±8.5 log CFU/100 cm2. Up to 55.1% of milk had TVC beyond the recommended levels. The milk mean TVC was 11.02±11.6 log CFU/ml and TCC was 6.7±7.3 log CFU/ml. Up to 26.5% of milk samples had the TCC beyond levels. Results on physicochemical characteristics and nutritional analysis show that the raw cow milk in Pemba Island is of inferior quality. Microbiological results of this study imply heavy contaminations of milk. Antimicrobial residues were detected in 83% of the samples and most of them were from Wete District. Unhygienic milk production chain accelerates microbial contaminations, and antimicrobial residues in milk are a big

  11. Food safety in raw milk production: risk factors associated to bacterial DNA contamination.

    Science.gov (United States)

    Cerva, Cristine; Bremm, Carolina; Reis, Emily Marques dos; Bezerra, André Vinícius Andrade; Loiko, Márcia Regina; Cruz, Cláudio Estêvão Farias da; Cenci, Alexander; Mayer, Fabiana Quoos

    2014-06-01

    While human illness from milkborne pathogens may be linked to contamination of the product after pasteurization or improper pasteurization, such diseases are usually associated with consumption of raw milk or its by-products. Molecular biology tools were applied to investigate contamination by Listeria monocytogenes, Salmonella spp., some pathogenic strains of Escherichia coli, and Campylobacter jejuni in 548 raw milk samples from 125 dairy farms established in two regions from southern Brazil. Moreover, 15 variables were evaluated for their association with raw milk contamination levels, and the risk factors were determined by multiple regression analysis. Salmonella spp. were more frequently detected, followed by pathogenic E. coli. There was difference in contamination index between the regions, in which risk factors such as temporary cattle confinement, low milk production, low milking machine cleaning frequency, and milk storage area without tile walls were identified. The risk factors were specific to each region studied. Nevertheless, the data can be used to improve milk quality of dairy farms/herds with similar management practices.

  12. Triacylglycerol Profile of Summer and Winter Bovine Milk Fat and the Feasibility of Triacylglycerol Fragmentation

    NARCIS (Netherlands)

    Tzompa-Sosa, Daylan A.; Meurs, Pim P.; Valenberg, van Hein J.F.

    2018-01-01

    Bovine milk fat (MF) is considered to be one of the most complex fats, as it can consist of 400 FA which are non-randomly esterified into the TAG molecule. This study aims to determine specific differences on MF TAG profile between summer and winter cow's milk, and to study the feasibility of TAG

  13. Effect of soy and bovine milks on the dental plaque pH

    Directory of Open Access Journals (Sweden)

    Peyvand Moeiny

    2016-11-01

    (P<0.05. Conclusion: Bovine milk in none of frequent timing dropped its pH below basic pH but also significantly increased the plaque pH above the critical pH. The maximum pH drop for soy milk was in 2minutes after consumption but it never reached below the critical pH.

  14. Proteomic study on the stability of proteins in bovine, camel, and caprine milk sera after processing

    NARCIS (Netherlands)

    Zhang, Lina; Boeren, Sjef; Smits, Marcel; Hooijdonk, van Toon; Vervoort, Jacques; Hettinga, Kasper

    2016-01-01

    Milk proteins have been shown to be very sensitive to processing. This study aims to investigate the changes of the bovine, camel, and caprine milk proteins after freezing, pasteurization (62 °C, 30 min), and spray drying by proteomic techniques, filter-aided sample preparation (FASP) and

  15. Post-Exercise Muscle Protein Synthesis in Rats after Ingestion of Acidified Bovine Milk Compared with Skim Milk.

    Science.gov (United States)

    Nakayama, Kyosuke; Kanda, Atsushi; Tagawa, Ryoichi; Sanbongi, Chiaki; Ikegami, Shuji; Itoh, Hiroyuki

    2017-09-27

    Bovine milk proteins have a low absorption rate due to gastric acid-induced coagulation. Acidified milk remains liquid under acidic conditions; therefore, the absorption rate of its protein may differ from that of untreated milk. To investigate how this would affect muscle protein synthesis (MPS), we compared MPS after ingestion of acidified versus skim milk in rats. Male Sprague-Dawley rats swam for 2 h and were immediately administered acidified or skim milk, then euthanized at 30, 60, 90, and 120 min afterwards. Triceps muscle samples were excised for assessing fractional synthetic rate (FSR), plasma components, intramuscular free amino acids and mTOR signaling. The FSR in the acidified milk group was significantly higher than in the skim milk group throughout the post-ingestive period. Plasma essential amino acids, leucine, and insulin levels were significantly increased in the acidified milk group at 30 min after administration compared to the skim milk group. In addition, acidified milk ingestion was associated with greater phosphorylation of protein kinase B (Akt) and ribosomal protein S6 kinase (S6K1), and sustained phosphorylation of 4E-binding protein 1 (4E-BP1). These results indicate that compared with untreated milk, acidified milk ingestion is associated with greater stimulation of post-exercise MPS.

  16. Post-Exercise Muscle Protein Synthesis in Rats after Ingestion of Acidified Bovine Milk Compared with Skim Milk

    Directory of Open Access Journals (Sweden)

    Kyosuke Nakayama

    2017-09-01

    Full Text Available Bovine milk proteins have a low absorption rate due to gastric acid-induced coagulation. Acidified milk remains liquid under acidic conditions; therefore, the absorption rate of its protein may differ from that of untreated milk. To investigate how this would affect muscle protein synthesis (MPS, we compared MPS after ingestion of acidified versus skim milk in rats. Male Sprague-Dawley rats swam for 2 h and were immediately administered acidified or skim milk, then euthanized at 30, 60, 90, and 120 min afterwards. Triceps muscle samples were excised for assessing fractional synthetic rate (FSR, plasma components, intramuscular free amino acids and mTOR signaling. The FSR in the acidified milk group was significantly higher than in the skim milk group throughout the post-ingestive period. Plasma essential amino acids, leucine, and insulin levels were significantly increased in the acidified milk group at 30 min after administration compared to the skim milk group. In addition, acidified milk ingestion was associated with greater phosphorylation of protein kinase B (Akt and ribosomal protein S6 kinase (S6K1, and sustained phosphorylation of 4E-binding protein 1 (4E-BP1. These results indicate that compared with untreated milk, acidified milk ingestion is associated with greater stimulation of post-exercise MPS.

  17. Impact of applying hygienic practices at farm on bacteriological quality of raw milk

    Directory of Open Access Journals (Sweden)

    N. Pandey

    2014-09-01

    Full Text Available Aim: The present study was carried out to explore the potential source of contamination and the efficacy of different washing practices towards quality milk production. Materials and Methods: Probable sources of contamination viz. stored water, potable water, milker’s hands, milking pail, udder of individual buffalo and milk cans were subjected to different types of bacterial counts before the actual experiment to start. Twenty milch buffaloes thereafter were divided randomly into four treatment groups where washing was performed in each step viz. milker hands, udder of individual buffalo, milking pail and milk cans before milking either with water (T0: stored water, T1: potable water or sanitizers (T2: 200 ppm chlorine solution, T3: 50 ppm iodophore solution for 60 days. Bacterial counts again were performed for last 5 alternate days for all the sources involved along with the microbial load of raw milk. Data obtained were subjected to standard statistical analysis. Results: It was found that for all bacterial count stored water contributed significantly higher as compared to the potable water. Among the other potential sources of contamination (log/6 cm2, standard plate count (SPC and coliform count were significantly highest for milking pail (6.73±0.02 and udder of milch buffaloes (3.77±0.12, respectively, while for Staphylococci count both milking pail (3.24±0.02 and milking can (3.22±0.04 were contributed maximally (p0.05 for most of the parameters, even for the raw milk quality. Conclusion: Study revealed that milker hands, milking pails, udder of animals, milk cans and stored water used for washing of equipment are the potential source of contamination in raw milk. These were counted as critical point which needs attention for the production of high-quality milk. Potable water was found to be better than stored water. The use of either chlorine 200 ppm and iodophor 50 ppm is highly effective in reducing the bacterial population for

  18. In vivo digestion of bovine milk fat globules: effect of processing and interfacial structural changes. I. Gastric digestion.

    Science.gov (United States)

    Gallier, Sophie; Cui, Jack; Olson, Trent D; Rutherfurd, Shane M; Ye, Aiqian; Moughan, Paul J; Singh, Harjinder

    2013-12-01

    The aim was to study the in vivo gastric digestion of fat globules in bovine cream from raw, pasteurised or pasteurised and homogenised milk. Fasted rats were gavaged once and chyme samples were collected after 30, 120 and 180 min post-gavage. Proteins from raw (RC) and pasteurised (PC) creams appeared to be digested faster and to a greater extent. Free fatty acids (FAs) increased throughout the 3h postprandial period. Short and medium chain FAs were released more rapidly than long chain FAs which were hydrolysed to a greater degree from PC. The size of the fat globules of all creams increased in the stomach. Protein aggregates were observed in pasteurised and homogenised cream chyme. Protrusions, probably caused by the accumulation of insoluble lipolytic products, appeared at the surface of the globules in RC and PC chyme. Overall, PC proteins and lipids appeared to be digested to a greater extent. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Escherichia coli O26 IN RAW BUFFALO MILK: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    A. Rella

    2013-02-01

    Full Text Available Escherichia coli O26 is considered to be one of the most important food-borne pathogen. In this study, 120 buffalo milk samples collected in Lazio and in Apulia regions were tested for the presence of E. coli O26. One buffalo milk sample (0,8% tested positive for E. coli O26; the isolate was positive at the verocytotoxicity test and it showed resistance properties to different antimicrobial classes. These preliminary results highlight the need to monitor the foods of animal origin used for production and eaten by a wide range of persons, respect VTEC organism.

  20. Prevalence and distribution of Arcobacter spp. in raw milk and retail raw beef.

    Science.gov (United States)

    Shah, A H; Saleha, A A; Murugaiyah, M; Zunita, Z; Memon, A A

    2012-08-01

    A total of 106 beef samples which consisted of local (n = 59) and imported (n = 47) beef and 180 milk samples from cows (n = 86) and goats (n = 94) were collected from Selangor, Malaysia. Overall, 30.2% (32 of 106) of beef samples were found positive for Arcobacter species. Imported beef was significantly more contaminated (46.80%) than local beef (16.9%). Arcobacter butzleri was the species isolated most frequently from imported (81.8%) and local (60%) beef, followed by Arcobacter cryaerophilus in local (33.3%) and imported (18.2%) beef samples. Only one local beef sample (10%) yielded Arcobacter skirrowii. Arcobacter species were detected from cow's milk (5.8%), with A. butzleri as the dominant species (60%), followed by A. cryaerophilus (40%), whereas none of the goat's milk samples were found positive for Arcobacter. This is the first report of the detection of Arcobacter in milk and beef in Malaysia.

  1. PCR assay with host specific internal control forStaphylococcus aureus from bovine milk samples

    Directory of Open Access Journals (Sweden)

    Zafer Cantekin

    2015-03-01

    Full Text Available Staphylococcus aureus is considered as one of the most important and common pathogens of bovine mastitis. Polymerase Chain Reaction is frequently proposed in the diagnosis of S. aureus directly from milk samples instead of classical culture. However, false-negative results may occur in the polymerase chain reaction analysis performed directly from clinical material. For the purpose of disclosing the false negative results, the use of internal amplification controls can be beneficial. Therefore, in this study a new polymerase chain reaction technique with host specific internal amplification control was developed by optimizing S. aureus-specific primers in combination with bovine specific primers. The effectiveness of the developed technique in this study was attempted in milk samples from bovine subclinical mastitis. This technique has the potential to detect S. aureus from bovine milk samples or dairy products.

  2. Importance of Decision Support Systems About Food Safety in Raw Milk Production

    Directory of Open Access Journals (Sweden)

    Ecem Akan

    2015-12-01

    Full Text Available In raw milk production decision support systems for control of food safety hazards has not been developed but main points of this system are available. The decision support systems’ elements include data identification at critical points in the milk supply chain, an information management system and data exchange. Decision supports systems has been developed on the basis of these elements. In dairy sector decision support systems are significant for controlling of food safety hazards and preferred by producers. When these systems are implemented in the milk supply chain, it can be prevented unnecessary sampling and analysis. In this article it will be underlined effects of decision support system elements on food safety of raw milk.

  3. Microbiological quality of retail cheeses made from raw, thermized or pasteurized milk in the UK.

    Science.gov (United States)

    Little, C L; Rhoades, J R; Sagoo, S K; Harris, J; Greenwood, M; Mithani, V; Grant, K; McLauchlin, J

    2008-04-01

    Two studies of retail fresh, ripened and semi-hard cheeses made from raw, thermized or pasteurized milk were undertaken in the UK during 2004 and 2005 to determine the microbiological quality of these products. Using microbiological criteria in European Commission Recommendations 2004/24/EC and 2005/175/EC, 2% of both raw, thermized (37/1819 samples) and pasteurized (51/2618 samples) milk cheeses were of unsatisfactory quality. Raw or thermized milk cheeses were of unsatisfactory quality due to levels of Staphylococcus aureus at 10(4)cfu g(-1), Escherichia coli at 10(5)cfu g(-1), and/or Listeria monocytogenes at 10(2)cfu g(-1), whereas pasteurized milk cheeses were of unsatisfactory quality due to S. aureus at 10(3)cfu g(-1) and/or E. coli at 10(3)cfu g(-1). Salmonella was not detected in any samples. Cheeses were of unsatisfactory quality more frequently when sampled from premises rated as having little or no confidence in management and control systems, and stored/displayed at above 8 degrees C. Raw or thermized milk cheeses were also more likely to be of unsatisfactory quality when they were unripened types, and pasteurized milk cheeses when they were: semi-hard types; from specialist cheese shops or delicatessens; cut to order. These results emphasize the need for applying and maintaining good hygiene practices throughout the food chain to prevent contamination and/or bacterial growth. Labelling of cheeses with clear information on whether the cheese was prepared from raw milk also requires improvement.

  4. Effect of Processing Intensity on Immunologically Active Bovine Milk Serum Proteins.

    Science.gov (United States)

    Brick, Tabea; Ege, Markus; Boeren, Sjef; Böck, Andreas; von Mutius, Erika; Vervoort, Jacques; Hettinga, Kasper

    2017-08-31

    Consumption of raw cow's milk instead of industrially processed milk has been reported to protect children from developing asthma, allergies, and respiratory infections. Several heat-sensitive milk serum proteins have been implied in this effect though unbiased assessment of milk proteins in general is missing. The aim of this study was to compare the native milk serum proteome between raw cow's milk and various industrially applied processing methods, i.e., homogenization, fat separation, pasteurization, ultra-heat treatment (UHT), treatment for extended shelf-life (ESL), and conventional boiling. Each processing method was applied to the same three pools of raw milk. Levels of detectable proteins were quantified by liquid chromatography/tandem mass spectrometry following filter aided sample preparation. In total, 364 milk serum proteins were identified. The 140 proteins detectable in 66% of all samples were entered in a hierarchical cluster analysis. The resulting proteomics pattern separated mainly as high (boiling, UHT, ESL) versus no/low heat treatment (raw, skimmed, pasteurized). Comparing these two groups revealed 23 individual proteins significantly reduced by heating, e.g., lactoferrin (log2-fold change = -0.37, p = 0.004), lactoperoxidase (log2-fold change = -0.33, p = 0.001), and lactadherin (log2-fold change = -0.22, p = 0.020). The abundance of these heat sensitive proteins found in higher quantity in native cow's milk compared to heat treated milk, renders them potential candidates for protection from asthma, allergies, and respiratory infections.

  5. Inflammation-related microRNA expression level in the bovine milk is affected by mastitis.

    Science.gov (United States)

    Lai, Yu-Chang; Fujikawa, Takuro; Maemura, Tadashi; Ando, Takaaki; Kitahara, Go; Endo, Yasuyuki; Yamato, Osamu; Koiwa, Masateru; Kubota, Chikara; Miura, Naoki

    2017-01-01

    MicroRNA (miRNA) in tissue and liquid samples have been shown to be associated with many diseases including inflammation. We aimed to identify inflammation-related miRNA expression level in the bovine mastitis milk. Expression level of inflammation-related miRNA in milk from mastitis-affected and normal cows was analyzed using qPCR. We found that expression level of miR-21, miR-146a, miR-155, miR-222, and miR-383 was significantly upregulated in California mastitis test positive (CMT+) milk. We further analyzed these miRNA using a chip-based QuantStudio Digital PCR System. The digital PCR results correlated with those of qPCR, demonstrating upregulation of miR-21, miR-146a, miR-155, miR-222, and miR-383 in CMT+ milk. In conclusion, we identified miRNA that are upregulated in CMT+ milk. These miRNA exhibited sensitivity and specificity greater than 80% for differentiating between CMT+ milk and normal milk. Our findings suggest that inflammation-related miRNA expression level in the bovine milk was affected by mastitis, and miRNA in milk have potential for use as biomarkers of bovine mastitis.

  6. Detection and identification of Staphylococcus aureus in raw milk by ...

    African Journals Online (AJOL)

    Staphylococcus aureus causes foodborne diseases if consumed in contaminated milk products. Rapid detection and characterization of foodborne pathogen S. aureus is crucial for epidemiological investigations and food safety surveillance. It is still a challenge to detect and identify bacterial pathogens quickly and ...

  7. Proteolysis produced within biofilms of bacterial isolates from raw milk tankers.

    Science.gov (United States)

    Teh, Koon Hoong; Flint, Steve; Palmer, Jon; Andrewes, Paul; Bremer, Phil; Lindsay, Denise

    2012-06-15

    In this study, six bacterial isolates that produced thermo-resistant enzymes isolated from the internal surfaces of raw milk tankers were evaluated for their ability to produce proteolysis within either single culture biofilms or co-culture biofilms. Biofilms were formed in an in vitro model system that simulated the upper internal surface of a raw milk tanker during a typical summer's day of milk collection in New Zealand. The bacterial isolates were further evaluated for their ability to form biofilms at 25, 30 and 37°C. Mutual and competitive effects were observed in some of the co-culture biofilms, with all isolates being able to form biofilms in either single culture or co-culture at the three temperatures. The proteolysis was also evaluated in both biofilms and corresponding planktonic cultures. The proteolysis per cell decreased as the temperature of incubation (20-37°C) increased. Furthermore, mutualistic interactions in terms of proteolysis were observed when cultures were grown as co-culture biofilms. This is the first study to show that proteolytic enzymes can be produced in biofilms on the internal surfaces of raw milk tankers. This has important implications for the cleaning and the temperature control of raw milk transport tankers. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Selected abiotic factors that influence raw cow milk freezing point depression

    Directory of Open Access Journals (Sweden)

    Oto Hanuš

    2012-01-01

    Full Text Available Freezing point depression (FPD is an important property of milk that is influenced primarily by milk components connected to osmotic pressure. Under certain conditions it is possible to detect the addition of water to milk. It is necessary to have the right FPD limit in legislation for milk quality control. The aim of this study was to improve the estimation procedure of this limit. Apart from factors related to dairy cow nutrition, cattle breed and milk yield, it is important to take into account CO2 (6%, water steam evaporation and pasteurization under technological conditions. Bulk milk samples (1, 30, 6, 6, 10, 1 according to experiment from Holstein and Czech Fleckvieh breed (1:1 were used in the experiments and technologically treated. The effects of water addition (water saturated and unsaturated by CO2, carbon dioxide evaporation and pasteurization (80 °C for 22 min were quantified. Pasteurization aggravation of FPD was -0.00394 ± 0.00171 ºC (P P < 0.001 depending on practice. Increase in FPD is recorded after milking during technological procedures of milk storage, mixing, pumping, transport shaking and warming. During FPD shift, the acuteness of FPD data sets increases. This fact should be considered in the process of deriving standard raw cow milk FPD limits. Similar experimental analysis of milk FPD technological shifts has not been performed in this way until now.

  9. Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

    Directory of Open Access Journals (Sweden)

    Roberta Ortenzi

    2015-09-01

    Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

  10. Strategical control of cattle tick in the Milk Bovine: A Revision

    OpenAIRE

    Furlong, Jonh; EMBRAPA - Gado de Leite; Sales, Ronaldo de Oliveira; Universidade Federal do Ceará

    2013-01-01

    In this bibliographical revision the different types of controls used in the eradication of the bovine cattle tick are presented that to develop itself, it needs to pass a phase of its life in the animals. It is important to know that the carrapato of the bovines is different of the cattle tick of the equines. In this text the common cattle tick of the bovines will be argued only (Boophilus microplus), mainly of the milk bovines, whose way of combat is different of that it is made for cut bov...

  11. Effect of medicinal plants, Heavy metals and antibiotics against pathogenic bacteria isolated from raw, Boiled and pasteurized milk.

    Science.gov (United States)

    Ali, Nazish Mazhar; Sarwar, Khadija; Mazhar, Syed Abdullah; Liaqat, Iram; Andleeb, Saiqa; Mazhar, Bushra; Kalim, Bushra

    2017-11-01

    Present study has been undertaken to isolate and identify the bacterial flora in raw, boiled and pasteurized milk. Agar disc diffusion method was used to determine their sensitivity using medicinal plants, antibiotics and heavy metals. Methylene blue reduction test was used to test the quality of milk samples. Total 10 pathogenic strains were isolated, five strains were isolated from raw milk, three from boiled milk and 2 two from pasteurized milk. To determine optimum conditions for growth, these pathogenic microorganisms were incubated at various temperatures and pH. Gram's staining and biochemical tests revealed that these pathogenic bacteria include Lactobacillus sp., E. coli, Salmonella sp., Pseudomonas sp., Streptococcus sp. and Staphylococcus. Ribotyping revealed S2 as Pseudomonas fluorescens, S5 as Lactococcus lactis and S9 as Lactobacillus acidophilus. Prevalence of pathogenic organisms provided the evidence that contamination of milk arises during milking, transportation and storage of milk. Raw milk is more contaminated than other two types of milk because it contains highest percentage of pathogenic organisms and pasteurized milk was found to be of best quality among three types. So it is recommended to drink milk after proper boiling or pasteurization. Proper pasteurization and hygienic packing of milk is essential to minimize contamination in milk which can save human beings from many milk borne diseases. Our study suggests that antimicrobial use in animal husbandry should be minimized to reduce the hazard of antibiotic resistance. Plant extracts are better alternative against pathogenic bacteria in milk.

  12. Occurrence of Staphylococcus aureus in raw milk produced in dairy farms in São Paulo state, Brazil

    Directory of Open Access Journals (Sweden)

    Helena Fagundes

    2010-06-01

    Full Text Available The objective of the present study was to evaluate the occurrence of Staphylococcus aureus in milk produced in 37 farms located in the regions of Ribeirão Preto and São Carlos, state of São Paulo, Brazil. Two-hundred and eight samples of milk from individual cows showing subclinical mastitis, and 37 samples of bulk tank milk were analyzed. S. aureus strains were detected in 18 (7.3% milk samples: 14 (6.7% from samples of individual cows, and 4 (10.8% from bulk tank milk. Two individual milk samples (14.3% and two bulk milk samples contained enterotoxigenic S. aureus. PFGE analysis revealed the genetic heterogeneity of the strains isolated from raw milk, which presented to 13 S. aureus patterns. Results confirmed the potential transmission of staphylococcal food poisoning to consumers via milk of cows affected by subclinical mastitis, mainly when raw milk is ingested.

  13. Detection of Listeria in raw milk in Syria

    International Nuclear Information System (INIS)

    Al-Mariri, A.; Abou-Younes, A.

    2010-01-01

    The 66 milk collected from all province of Syria, were examined for the presence of Listeria sp. using a several technique, and L. monocytogenes serotypes associated with human listeriosis were also identified in the product. The PCR based method identified 117 strains of Listeria, L. monocytogenes, L. innocua, L. ivanovii, L. gravi, and L. welshimeri. The API Listeria system identified 94% of the isolates whereas FTIR identification was 98% for all Listeria species. (author)

  14. Bovine subclinical mastitis reduces milk yield and economic return

    NARCIS (Netherlands)

    Gonçalves, J.L.; Kamphuis, C.; Martins, C.M.M.R.; Barreiro, J.R.; Tomazi, T.; Gameiro, A.H.; Hogeveen, H.; Santos, dos M.V.

    2018-01-01

    The effect of different pathogens was studied by evaluating the contralateral (healthy and infected) mammary quarters of 146 lactating cows. The impact of SM on economic return (quarter milk yield × milk price) was determined by applying milk payment estimates on milk collected from healthy vs.

  15. Characterization of Staphylococcus aureus isolates from raw milk sources in Victoria, Australia.

    Science.gov (United States)

    McMillan, Kate; Moore, Sean C; McAuley, Catherine M; Fegan, Narelle; Fox, Edward M

    2016-07-29

    Highly pathogenic strains of Staphylococcus aureus can cause disease in both humans and animals. In animal species, including ruminants, S. aureus may cause severe or sub-clinical mastitis. Dairy animals with mastitis frequently shed S. aureus into the milk supply which can lead to food poisoning in humans. The aim of this study was to use genotypic and immunological methods to characterize S. aureus isolates from milk-related samples collected from 7 dairy farms across Victoria. A total of 30 S. aureus isolates were collected from milk and milk filter samples from 3 bovine, 3 caprine and 1 ovine dairy farms across Victoria, Australia. Pulsed Field Gel Electrophoresis (PFGE) identified 11 distinct pulsotypes among isolates; all caprine and ovine isolates shared greater than 80 % similarity regardless of source. Conversely, bovine isolates showed higher diversity. Multi-Locus Sequence Typing (MLST) identified 5 different sequence types (STs) among bovine isolates, associated with human or ruminant lineages. All caprine and ovine isolates were ST133, or a single allele variant of ST133. Two new novel STs were identified among isolates in this study (ST3183 and ST3184). With the exception of these 2 new STs, eBURST analysis predicted all other STs to be founding members of their associated clonal complexes (CCs). Analysis of genetic markers revealed a diverse range of classical staphylococcal enterotoxins (SE) among isolates, with 11 different SEs identified among bovine isolates, compared with just 2 among caprine and ovine isolates. None of the isolates contained mecA, or were resistant to oxacillin. The only antibiotic resistance identified was that of a single isolate resistant to penicillin; this isolate also contained the penicillin resistance gene blaZ. Production of SE was observed at 16 °C and/or 37 °C in milk, however no SE production was detected at 12 °C. Although this study characterized a limited number of isolates, bovine-associated isolates

  16. Characterization of Staphylococcus species isolated from raw milk and milk products (lben and jben) in North Morocco.

    Science.gov (United States)

    Bendahou, Abdrezzak; Lebbadi, Mariam; Ennanei, Latifa; Essadqui, Fatima Z; Abid, Mohammed

    2008-06-01

    To investigate the incidence and antibiotic resistance of staphylococcal strains isolated from milk and milk products and to trace the ecological origin of the Staphylococcus aureus isolated. Eighty-one samples of raw milk, lben (whey) and jben (cheese) were analyzed for the presence of staphylococcal strains. Isolates were identified by Gram stains, tests for coagulase, the API staph system and the WalkAway 40/96, which also determines the antimicrobial susceptibility profiles. The S. aureus strains were biotyped, and variable regions of the coagulase gene were amplified using the polymerase chain reaction. The identification results showed a predominance of coagulase-negative staphylococci (54 %). Coagulase-positive staphylococci that were identified were divided into 3 groups comprising S. aureus (40%), Staphylococcus intermedius (2 %) and Staphylococcus hyicus (4%). Among the S. aureus that was isolated, biotype C was the predominant biotype. Among 40 coagulase gene PCR-amplification products, 37 produced a single band, while 3 isolates produced two bands. The antimicrobial susceptibility-profile of the staphylococcal strains revealed a high incidence of S. aureus to penicillin G. In addition, Staphylococcus lentus presented considerable resistance to the oxacillin, erythromycin and lincomycin. The presence of staphylococci in raw milk, lben and jben in areas of northern Morocco poses a health hazard, so it is necessary for the public health inspectors to properly examine the conditions during production, storage and commercialization of all products made with unpasteurized milk.

  17. A novel isolation strategy for obtaining crude membrane vesicles from bovine skim milk

    DEFF Research Database (Denmark)

    Blans, Kristine; Larsen, Lotte Bach; Wiking, Lars

    Bovine milks content of phospholipid membranes have largely been explored in the cream fraction, and known as the milk fat globule membrane that surrounds fat droplets. In skim milk, the population of phospholipid membranes is reported to constitute membrane vesicles with a soluble content known...... is observed all over the gradient. The variety of the membrane vesicles is currently being investigated further by several means. Summary/conclusion: A new procedure for easy and gentle isolation of bovine milk membrane vesicles encompassing ultracentrifugation and size-exclusion chromatography has been...... established. The resulting vesicle isolate exhibits the general membrane vesicle characteristics and provides an appropriate start material from which the variety of milk vesicles can be investigated...

  18. Bovine milk in human nutrition--a review.

    Science.gov (United States)

    Haug, Anna; Høstmark, Arne T; Harstad, Odd M

    2007-09-25

    Milk and milk products are nutritious food items containing numerous essential nutrients, but in the western societies the consumption of milk has decreased partly due to claimed negative health effects. The content of oleic acid, conjugated linoleic acid, omega-3 fatty acids, short- and medium chain fatty acids, vitamins, minerals and bioactive compounds may promote positive health effects. Full-fat milk has been shown to increase the mean gastric emptying time compared to half-skimmed milk, thereby increasing the gastrointestinal transit time. Also the low pH in fermented milk may delay the gastric emptying. Hence, it may be suggested that ingesting full-fat milk or fermented milk might be favourable for glycaemic (and appetite?) regulation. For some persons milk proteins, fat and milk sugar may be of health concern. The interaction between carbohydrates (both natural milk sugar and added sugar) and protein in milk exposed to heat may give products, whose effects on health should be further studied, and the increasing use of sweetened milk products should be questioned. The concentration in milk of several nutrients can be manipulated through feeding regimes. There is no evidence that moderate intake of milk fat gives increased risk of diseases.

  19. Assessment of raw milk quality and stakeholders' awareness on milk-borne health risks in Arusha City and Meru District, Tanzania.

    Science.gov (United States)

    Ngasala, J Uma Bukuku; Nonga, Hezron Emmanuel; Mtambo, Mkumbukwa Madundo Angelo

    2015-06-01

    A cross-sectional study was conducted to assess the quality of raw milk and stakeholders' awareness on milk-borne health risks and factors for poor milk hygiene in Arusha City and Meru District, Tanzania between October and December 2012. A total of 105 smallholder dairy farmers, milk vendors and milk retailers were interviewed, and milk samples were collected for physical, microbial and antibiotic residue analysis using standard procedures. Questionnaire results indicated high level of awareness (94 %) that drinking raw milk can predispose consumers to milk-borne diseases; nevertheless, 65 % of respondents consumed raw milk. Physicochemical analyses showed some of the milk had sediments (20 %), bad smell (21 %) and had clotted on alcohol test (27 %). About 36 % of milk samples had pH below 6.6, and 25 % had specific gravity below 1.028 g/ml. The mean total viable count (TVC) of milk from vendors is significantly (P milk samples assessed had a higher TVC than the level recommended (2.0 × 10(5) cfu/ml) by the East African Community (EAC) standards. Up to 91 % of the milk samples had bacterial growth that included Eschericia coli (66 %), Staphylococcus aureus (33 %), Corynebacterium (11 %) and Pseudomonas (10 %). All smallholder dairy farmers were aware of drug residues, but majority (57 %) were unaware of human health effects caused by veterinary drug residues in milk. Up to 97 % of respondents reported to comply with drug withdrawal periods. This possibly led to all milk samples analysed to be negative from detectable levels of antibiotic residues. It is concluded that the level of awareness on milk quality is high, although practices associated with milking and post-harvest handling predispose milk to bacterial contamination which is a public health risk to milk consumers.

  20. Lipolytic Changes in the Milk Fat of Raw Milk and Their Effects on the Quality of Milk Products

    OpenAIRE

    Kirst, E.

    1986-01-01

    Lipolytic changes in milk rat affect sensory attributes and techno logicaI properties of milk and milk products. They are affectcd by physiologal, thermal . and biochemical factors as well as by the mechanics of fluids Lipolytic processes in milk are intensified by modern processing methods. In this review. special attention has been paid to runinant- related feeding of dairy cows. foaming of milk. mechanical and thermal influences and the growth of psycllrotrophic bacteria. Feeds defic...

  1. Rapid detection of Streptococcus uberis in raw milk by loop-mediated isothermal amplification

    NARCIS (Netherlands)

    Cornelissen, J.B.W.J.; Greeff, De A.; Heuvelink, A.E.; Swarts, M.; Smith, H.E.; Wal, Van der F.J.

    2016-01-01

    A loop-mediated isothermal amplification (LAMP) method to detect Streptococcus uberis in raw milk was developed and evaluated. Three genes (sodA, pauA, cpn60) were assessed for their suitability as targets in LAMP. The analytical sensitivity was 120, 120, and 12 fg per assay for the sodA, pauA,

  2. Optimized enrichment for the detection of Escherichia coli O26 in French raw milk cheeses.

    Science.gov (United States)

    Savoye, F; Rozand, C; Bouvier, M; Gleizal, A; Thevenot, D

    2011-06-01

    Our main objective was to optimize the enrichment of Escherichia coli O26 in raw milk cheeses for their subsequent detection with a new automated immunological method. Ten enrichment broths were tested for the detection of E. coli O26. Two categories of experimentally inoculated raw milk cheeses, semi-hard uncooked cheese and 'Camembert' type cheese, were initially used to investigate the relative efficacy of the different enrichments. The enrichments that were considered optimal for the growth of E. coli O26 in these cheeses were then challenged with other types of raw milk cheeses. Buffered peptone water supplemented with cefixim-tellurite and acriflavin was shown to optimize the growth of E. coli O26 artificially inoculated in the cheeses tested. Despite the low inoculum level (1-10 CFU per 25 g) in the cheeses, E. coli O26 counts reached at least 5.10(4) CFU ml(-1) after 24-h incubation at 41.5 °C in this medium. All the experimentally inoculated cheeses were found positive by the immunological method in the enrichment broth selected. Optimized E. coli O26 enrichment and rapid detection constitute the first steps of a complete procedure that could be used in routine to detect E. coli O26 in raw milk cheeses. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  3. Prevalence of Listeria monocytogenes in raw milk in North Lebanon

    International Nuclear Information System (INIS)

    Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

    2016-01-01

    Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

  4. Evaluation of biogenic amines and microbial counts throughout the ripening of goat cheeses from pasteurized and raw milk.

    Science.gov (United States)

    Novella-Rodríguez, Sonia; Veciana-Nogués, M Teresa; Roig-Sagués, Artur X; Trujillo-Mesa, Antonio J; Vidal-Carou, M Carmen

    2004-05-01

    The effect of the hygienic quality of milk on changes in microbial counts and biogenic amine content was evaluated during ripening of goat cheeses manufactured from pasteurized and raw milks at 1, 14, 30, 60 and 90 d. The original milk, rennet, curd and whey were also included in the study. The pH, salt content and extent of proteolysis in the cheese were also evaluated. Spermidine and spermine were the main amines in raw milk, while they were minor amines in cheeses. Other amines increased markedly during ripening, tyramine being the main amine in cheese made from raw milk and cadaverine and putrescine in those produced from pasteurized milk. Enterobacteriaceae counts decreased during ripening whereas those of lactic acid bacteria increased, especially lactobacilli and enterococci. Cheese made from raw milk showed higher microbial counts during ripening than those made from pasteurized milk, especially for Enterobacteriaceae and enterococci, counts being 2 or 3 log units higher. Raw milk cheese showed remarkably higher biogenic amines compared with pasteurized milk cheeses. Therefore, pasteurization of milk causes a decrease in final biogenic amine content of cheese as a result of the reduction of its microbial counts.

  5. Evaluation of raw milk quality in three subregions of the department of Sucre, Colombia

    Directory of Open Access Journals (Sweden)

    Alberto Romero P

    2018-03-01

    Full Text Available The objective was to evaluate the physicochemical, microbiological quality, somatic cell count and presence of inhibitors in raw milks in the department of Sucre. 150 samples of raw milk from six storage centers or processing plants from three subregions of the department of Sucre (Sabanas, San Jorge and Gulf of Morrosquillo were taken using a descriptive cross-sectional study. 25 samples in each collection center that correspond to 25 producers from the different subregions of the department were taken. Microbiological and physiochemical parameters and udder health were determined of a total of 50 samples for each subregion. The data obtained were analyzed according to accepted standards in Colombia. For the most part of the physicochemical parameters, were within the accepted values established in decree 616 of 2006 and decree 1880of 2011(protein ≥2.9%, fat ≥3.0%, density (15oC ≥1.030, TS ≥11.30, SNF ≥8.30. The count of colony forming units (CFU/mL in the different subregions was greater than 600,000 CFU/mL. The somatic cell count (SCC/mL was greater than 500,000 SCC/mL. In 8% of the sampled milks showed presence of inhibitors. Overall, the raw milk had good physicochemical quality but, the microbiological quality and health of the udder were poor, which requires immediate implementation of programs in order to obtain high quality hygienic milk.

  6. Contribution of natural milk culture to microbiota, safety and hygiene of raw milk cheese produced in alpine malga

    Directory of Open Access Journals (Sweden)

    Rosaria Lucchini

    2018-04-01

    Full Text Available Processing of alpine milk in malga farms is carried out under conditions that can favor contamination by coliforms, coagulase-positive staphylococci, or pathogens such as Listeria monocytogenes. With the aim to improve the hygienic characteristics and safety of cheese produced in four malga farms the use of lyophilized Natural Milk Culture prepared with selected strains was tested. Two cheesemaking tests were carried out in the same day always starting from the same milk: in the first case following the malga recipe that uses either Natural Whey Culture or without the addition of a starter, in the second one using a Natural Milk Culture. Cheesemaking were carried out in four malga farms located in the west area of Trentino region within the same week. For hygienic and safety evaluation, aerobic colony count, coagulase-positive staphylococci, Escherichia coli, staphylococcal toxins, Listeria monocytogenes , and Salmonella spp, pH and aw were determined in raw milk from evening and morning milking, curd in vat, curd after extraction and two months-ripened cheese. Pathogens or toxins, high values of coagulase- positive staphylococci and E. coli were not found in cheese samples. However, in the curd coagulase-positive staphylococci reached values almost of 5 Log CFU/g in the two malga without starter cultures. The use of Natural Milk Culture reduced E. coli counts. In addition, DNA was extracted from cheese samples and from Natural Milk Culture and the composition of the microbial community determined by Next Generation Sequencing method. The determination of cheese microbial communities demonstrated that the use of Natural Milk Culture exerted different effects in the different malga, in any case preserving bacterial biodiversity.

  7. RAW MILK AT VENDING MACHINES: EVALUATION OF E. SAKAZAKII, COXIELLA BURNETII AND M. PARATUBERCULOSIS IN PIEDMONT EXPERIENCE

    Directory of Open Access Journals (Sweden)

    S. Gallina

    2009-12-01

    Full Text Available Italian consumers changed their food habits in the last period; the increase of raw milk consuming is also related to the high number of self service vending machines that have been authorized, particularly in Northern Italy. According to national rules on raw milk hygienic conditions, the most important bacteria are checked by Veterinary Services; the aim of this study was to investigate some emerging or re-emerging hazards in raw milk at vending machines. For this reason 100 raw milk samples were collected and analyzed in order to detect E. sakazakii, Coxiella burnetii and M. avium subsp paratuberculosis. One milk sample resulted to be positive with PCR method for E. sakazakii (no cultural confirmation was possible; 49% of samples resulted posivite for the presence of Coxiella burnetii specific DNA, and 5% of milk samples came out positive to the presence of M. paratuberuclosis antibodies with ELISA methods.

  8. Microelements and heavy metals in raw cow milk from various regions in Serbia

    Directory of Open Access Journals (Sweden)

    Živkov-Baloš Milica

    2013-01-01

    Full Text Available In this study, the investigation results of raw milk and animal feed samples from farms located around industrial areas and from rural areas in Serbia are presented. Various microelements and heavy metals (Zn, Cu, Fe, Pb and Cd were determined by atomic absorption spectrophotometry (AAS. Mean concentration of Zn, Cu, Fe and Cd in raw milk were 5.94, 0.239, 2.034 and below 0.005 mg/kg, respectively. The mean lead concentration found in milk from a farm located near industrial area was 0.242±0.166 mg/kg (mean Pb concentrations for other four investigated farms were below 0.05 mg/kg. The obtained results indicate that particular attention should be paid to control of Pb residues in food, water and environment. [Projekat Ministarstva nauke Republike Srbije, br. TR 31084

  9. Analysis of the Kanamycin in Raw Milk Using the Suspension Array

    Directory of Open Access Journals (Sweden)

    Yanfei Wang

    2013-01-01

    Full Text Available With the monoclonal antibody against kanamycin being prepared successfully, a bead-based indirect competitive fluorescent immunoassay was developed to detect kanamycin in milk. The fact that there was no significant cross-reaction with other aminoglycoside antibiotics implied that the monoclonal antibody was highly specific for kanamycin. The limit of detection (LOD and the 50% inhibition concentration (IC50 in raw milk were 3.2 ng/mL and 52.5 ng/mL, respectively. Using the method developed in this study, the kanamycin concentrations were monitored in raw milk after the intramuscular administration of kanamycin in sick cows. Compared to the conventional enzyme-linked immunosorbent assay (ELISA, the method using the suspension array system was more sensitive. The results obtained in the present study showed a good correlation with that of the ELISA.

  10. Prevalence of Listeria species in raw milk and traditional dairy products in Isfahan, Iran

    Directory of Open Access Journals (Sweden)

    Ehsan Shamloo

    2015-01-01

    Full Text Available Aim: The study aimed to assess the prevalence of Listeria spp. in raw milk and traditional non-pasteurized dairy products in Isfahan, Iran. Materials and Methods: A total of 292 samples of raw milk and traditional dairy were examined for the presence of Listeria spp. using a two-step selective enrichment recommended by the United States Department of Agriculture. All isolates were subjected to standard biochemical tests. L. monocytogenes strains were further confirmed by polymerase chain reaction (PCR amplification. Results: Of 292 samples, 21 (7.14% and 4 (1.47% were positive for Listeria spp. and pathogenic L. monocytogenes, respectively. The prevalence of Listeria spp. in raw milk, ice cream, cream, and freni were 5.91 (5.49%, 12.63 (19.04%, 3.27 (11.11% and 1.25 (4%, respectively. Listeria was not detected from yogurt, butter, Kashk, and cheese. Listeria innocua at 16.21 (5.44% was the most prevalent species isolated, followed by L. monocytogenes at 4.21 (19% and L. seeligeri at 1.21 (4.7%. All strains of L. monocytogenes identified by biochemical tests were also confirmed by PCR. Conclusion: The study shows the prevalence of L. monocytogenes in raw milk and traditional dairy products sold in the market. Consumption of raw milk with mild heat treatment or its usage in traditional dishes could pose serious health problems due to lack of appropriate control measures. The lack of knowledge on the risks of listeriosis transmission indicates the need for implementation of a food safety education program. In addition, the Iranian food safety authorities should urgently set up an effective standard to screen all susceptible food products for the presence of Listeria.

  11. The effect of raw milk microbial flora on the sensory characteristics of Salers-type cheeses.

    Science.gov (United States)

    Callon, C; Berdagué, J L; Dufour, E; Montel, M C

    2005-11-01

    The sensory characteristics of Salers Protected Denomination of Origin raw-milk cheeses are linked to the biochemical composition of the raw material (milk) and to the resultant microbial community. To evaluate the influence of the microbial community on sensory characteristics, Salers-type cheeses were manufactured with the same pasteurized milk, reinoculated with 3 different microbial communities from 3 different filtrates from microfiltered milks. Each cheese was subjected to microbial counts (on selective media), biochemical tests, and volatile and sensory component analyses at different times of ripening. Adding different microbial communities to specimens of the same (biochemically identical) pasteurized milk lead to different sensory characteristics of the cheeses. Cheeses with fresh cream, hazelnut, and caramel attributes were opposed to those with fermented cream, chemical, and garlic flavors. The aromatic compounds identified (esters, acids, alcohols, and aldehydes) in these cheeses were quite similar. Nevertheless, one milk was distinguished by a higher content of acetoin, and lower 2-butanone and 3-methylpentanone concentrations. Over the production period of 1 mo, the different cheeses were characterized by the same balance of the microbial population assessed by microbial counts on different media. This was associated with the stability of some sensory attributes describing these cheeses. Nevertheless, there was no linear correlation between microbial flora data and sensory characteristics as measured in this study.

  12. Enzymatic-fluorometric quantification of cholesterol in bovine milk

    DEFF Research Database (Denmark)

    Larsen, Torben

    2012-01-01

    The present paper describes an enzymatic–fluorometric method for the determination of cholesterol in milk and other opaque matrices. The initial step of the method is to liberate chemically and physically bound cholesterol from the milk fat globule membrane by enzymatic action. The method is able...... to discriminate between esterified and free cholesterol in milk. The analysis is cost effective and is developed to work directly on whole, fresh milk thereby eliminating time consuming and tedious pre-treatment procedures of the sample. More than 1000 milk samples were analysed on the day of sampling. The total...... concentration of milk cholesterol ranged from 80 to 756 μM (n = 1068; mean 351 μM). Milk cholesterol was significantly correlated to milk fat concentration as analysed by mid-infra red spectrometry (r = 0.630; n = 853) and by an enzymatic–fluorometric method (triacylglycerol) (r = 0.611; n = 842)....

  13. Real Deal or No Deal? A Comparative Analysis of Raw Milk Cheese Regulation in Australia and France

    OpenAIRE

    William van Caenegem; Madeline Elizabeth Taylor

    2017-01-01

    Australia’s regulatory framework has resulted in the standardisation of cheese production based on pasteurisation. Up until early 2015, regulations effectively prohibited raw milk cheese-making in Australia and thus stifled artisanal on-farm production. Although the introduction of Food Standards Australia New Zealand Standard 4.2.4 has allowed the production of certain hard, low-moisture raw milk cheeses, the new standard is rigid and does not encourage new entrants into the emerging raw mil...

  14. The Evaluation of Aflatoxin M1 Level in Collected Raw Milk for Pasteurized Dairy

    Directory of Open Access Journals (Sweden)

    Ehsan Sadeghi

    2013-03-01

    Full Text Available Background: Aflatoxins are fungal toxins that have carcinogenic, cellular mutations and malformation effects. Aflatoxin M1 resists pasteurization, autoclave and the other methods that make foodstuff healthy. This study aims to determine the contents of aflatoxin M1 in raw milk of milk factories in Kermanshah province.Materials and Methods: This research is carried out through the descriptive-cross sectional method. Among the raw milk received by four pasteurized milk factories in Kermanshah, coded by (A, B, C, D labels, six samples, totally 320 samples (80 samples from each factory, were taken within four seasons. The concentration of aflatoxin M1 was examined by Enzyme-Linked Immunosorbent Assay (ELISA. The mean difference was analyzed statistically through t-test using SPSS software. Results: The content of aflatoxin was higher than Codex standard (0.5 µg/l in 295 samples. The total mean was 1.21, which exceeds two times the Codex standard. The highest and lowest contents of aflatoxin M1 were observed in “Factory D” in spring and in “Factory A” in autumn, respectively. There was a significant difference between contamination of aflatoxin M1 and different seasons (p< 0.05.Conclusion: High content of aflatoxin M1 in raw milk is worrying. Measuring the content of aflatoxin M1 is essential to reduce the toxin entering the daily food of animals and the other related factors. The considerable difference of aflatoxin M1 content between Factory D and Factory A can be attributed to the amount of the local milk and the industrial milk received by the factories.

  15. Compared with Raw Bovine Meat, Boiling but Not Grilling, Barbecuing, or Roasting Decreases Protein Digestibility without Any Major Consequences for Intestinal Mucosa in Rats, although the Daily Ingestion of Bovine Meat Induces Histologic Modifications in the Colon.

    Science.gov (United States)

    Oberli, Marion; Lan, Annaïg; Khodorova, Nadezda; Santé-Lhoutellier, Véronique; Walker, Francine; Piedcoq, Julien; Davila, Anne-Marie; Blachier, François; Tomé, Daniel; Fromentin, Gilles; Gaudichon, Claire

    2016-08-01

    Cooking may impair meat protein digestibility. When undigested proteins are fermented by the colon microbiota, they can generate compounds that potentially are harmful to the mucosa. This study addressed the effects of typical cooking processes and the amount of bovine meat intake on the quantity of undigested proteins entering the colon, as well as their effects on the intestinal mucosa. Male Wistar rats (n = 88) aged 8 wk were fed 11 different diets containing protein as 20% of energy. In 10 diets, bovine meat proteins represented 5% [low-meat diet (LMD)] or 15% [high-meat diet (HMD)] of energy, with the rest as total milk proteins. Meat was raw or cooked according to 4 processes (boiled, barbecued, grilled, or roasted). A meat-free diet contained only milk proteins. After 3 wk, rats ingested a (15)N-labeled meat meal and were killed 6 h later after receiving a (13)C-valine injection. Meat protein digestibility was determined from (15)N enrichments in intestinal contents. Cecal short- and branched-chain fatty acids and hydrogen sulfide were measured. Intestinal tissues were used for the assessment of protein synthesis rates, inflammation, and histopathology. Meat protein digestibility was lower in rats fed boiled meat (94.5% ± 0.281%) than in the other 4 groups (97.5% ± 0.0581%, P HMD) and on myeloperoxidase activity in the proximal colon (HMD > LMD), but not on other outcomes. The ingestion of bovine meat, whatever the cooking process and the intake amount, resulted in discrete histologic modifications of the colon (epithelium abrasion, excessive mucus secretion, and inflammation). Boiling bovine meat at a high temperature (100°C) for a long time (3 h) moderately lowered protein digestibility compared with raw meat and other cooking processes, but did not affect cecal bacterial metabolites related to protein fermentation. The daily ingestion of raw or cooked bovine meat had no marked effect on intestinal tissues, despite some slight histologic modifications

  16. Replacement of raw soybean with roasted soybean increased milk production in Holstein cows

    Directory of Open Access Journals (Sweden)

    Gilson Sebastião Dias Júnior

    Full Text Available ABSTRACT: The aim of this study was to evaluate the effect of total replacement of raw whole soybean (RAW for roastedwhole soybean (ROS on the production performance of Holstein cows. Two experiments were carried out usinga simple reversal design where RAW has been completely replaced by ROS. In experiment 1, 22 cows (175±60 days in milkwere used, and the dietary inclusion level of RAW or ROS was 3.7% of dry matter (DM. In experiment 2, 16 cows (130±50 days in milkwere used, and thedietary inclusion level of RAW or ROS was 11% of DM. In both experiments, ROS increased milk production by 1.1kgday-1 without changing fat and protein production. Dry matter intake or milk urea nitrogenwere not affected by dietary soy source. In experiment 2, plasma glucose concentration was decreased, and allantoin/creatinine ratio in urine tended to decreasein ROS. Experiment 2 also evaluated the nutrient digestibility and ruminal degradation kinetics of crude protein in two soybean sources. Roasting had no effect on the digestibility of DM, organic matter, and neutral detergent fiber. Roasted whole soybean hadgreater fraction B and lower protein degradation rate than did RAW; this showed that heat treatment was effective in increasing therumen undegradable amino acid flowto the animal, which suggesteda potential mechanism of action for improved performance observed in ROS.

  17. Reduction in heat-induced gastrointestinal hyperpermeability in rats by bovine colostrum and goat milk powders.

    Science.gov (United States)

    Prosser, C; Stelwagen, K; Cummins, R; Guerin, P; Gill, N; Milne, C

    2004-02-01

    Male Sprague-Dawley rats were assigned to one of three dietary groups [standard diet (Cont; n = 8), standard diet plus bovine colostrum powder (BColost 1.7 g/kg; n = 8), or goat milk powder (GMilk 1.7 g/kg; n = 8)] to determine the ability of these supplements to reduce gastrointestinal hyperpermeability induced by heat. Raising core body temperature of rats to 41.5 degrees C increased transfer of (51)Cr-EDTA from gut into blood 34-fold relative to the ambient temperature value (P transferred into the blood of rats in either the BColost (27% of Cont) or GMilk group (10% of Cont) after heating, showing that prior supplementation with either bovine colostrum or goat milk powder significantly reduced the impact of heat stress on gastrointestinal permeability. The changes in the BColost group were not significantly different than those of the GMilk group. The potential mechanism of the protective effect of bovine colostrum and goat milk powders may involve modulation of tight junction permeability, because both powders were able to maintain transepithelial resistance in Madin Darby canine kidney cells challenged with EGTA compared with cells maintained in media only. The results show that bovine colostrum powder can partially alleviate the effects of hyperthermia on gastrointestinal permeability in the intact animal. Moreover, goat milk powder was equally as effective as bovine colostrum powder, and both may be of benefit in other situations where gastrointestinal barrier function is compromised.

  18. Effect of Modified Pre-Milking Sanitizing Approaches on Raw Milk Quality Obtained from the Dairy Farmers of Tawau Area, Sabah

    Directory of Open Access Journals (Sweden)

    Sim Kheng Yuen

    2016-01-01

    Full Text Available The aim of the study was to investigate the raw milk hygiene and quality among the small holder dairy farmers in Tawau area. A total of 216 samples were collected from the respective dairy farmers and milk collecting centre located at Mile 15, Tawau. Preliminary results indicated that the quality of the raw milks obtained at farm level contained were inferior with high bacteria load (> than 107 CFU/ml. The total coliform (2.9-3.8 CFU/mL and Staphylococcus count (2.3-3.6 CFU/mL were relatively high in certain samples. However, none of the food borne pathogens was found. Trace back study revealed that the causes of contamination were attributed by poor hygienic handling among the dairy farmers and insufficient for immediate chilling of raw milk. A significant reduction in bacteria load was observed if the raw milk chilled immediately at farm. The implementation of modified pre-milking sanitizing practices improved the microbiology quality of the raw milks obtained from respective dairy farms. Future study will focus more on the effect of prolong storage towards the microbiological quality of raw milk.

  19. Occurrence of Listeria monocytogens in raw milk of ruminants in Basrah province

    Directory of Open Access Journals (Sweden)

    B. A. Abbas

    2012-01-01

    Full Text Available The present study was performed on three hundred raw milk samples, 100 each from cows, sheep and buffaloes were collected from different places of Basrah city. 7.3 % of the samples were found to be positive for Listeria spp. Cow's milk was found to be more infected than other animals milk with this bacteria. All bacterial isolates were confirmed as L. monocytogens by colony characteristics, beta haemolysis, cold enrichment procedure, selective media, Anton test, tumbling and inverted pine tree motility and sugar fermentation tests. Most isolates were found to be sensitive to cefotaxine, sulfamethoxazol, chloramphenical and tobramycin. rifampicin was found to have less effect on these isolates. Effects of pH and temperature on bacterial growth were also studied to test the ability of this microorganism to survive in milk under severe conditions. The pH range for growth was from 4 to 9.5. The temperature range was between 4 – 45 ºC.

  20. QUALITY AND SAFETY OF RAW COW’S MILK IN SLOVAKIA IN 2011

    Directory of Open Access Journals (Sweden)

    Jozef Čurlej

    2012-04-01

    Full Text Available The quality and safety of raw cow’s milk is very important for dairy companies and consumers of milk products. Due to the methods of production, it is impossible to completely eliminate contamination of milk with microorganisms, therefore the microbial content of milk is a major feature in determining its quality. Other important factors to consider include somatic cells count, veterinary drug residues, milk composition and freezing point. Somatic cells represent the udder health and can be used for monitoring of subclinical mastitis. A high level of somatic cells can increase proteolysis in milk which affects technological processes. Veterinary drugs administered to cows may lead to residues in the milk which are harmful to humans. The content of fat, protein and solids-non-fat are the main indicators used by dairies for technological purposes. In this article we discuss the quality and safety of raw cow’s milk in Slovakia during 2011. We found that 73.53% of samples tested for somatic cell count, and 84.54% of samples tested for total bacterial count, met the European Union legislation limits. We found the largest decrease in fat and protein content was during the summer period and the largest increase was in the winter period. We found that 92.14 %, 98.7% and 91.38% of samples met the limit presented in STN 570529:1999 for fat content, protein content and freezing point respectively. The percentage of drug positive samples was 0.087%.doi:10.5219/189

  1. Escherichia coli producing CMY-2 β-lactamase in bovine mastitis milk.

    Science.gov (United States)

    Endimiani, Andrea; Bertschy, Isabelle; Perreten, Vincent

    2012-01-01

    An Escherichia coli isolate producing the CMY-2 β-lactamase was found in the milk of a cow with recurrent subclinical mastitis. The isolate was resistant to the antibiotics commonly used for intramammary mastitis treatment, such as penicillins, cephalosporins, β-lactam/β-lactamase inhibitor combinations, aminoglycosides, tetracyclines, and sulfonamides. This is the first report of a plasmid-mediated AmpC-producing Enterobacteriaceae in bovine milk.

  2. β-Galactosidase activity of commercial lactase samples in raw and pasteurized milk at refrigerated temperatures.

    Science.gov (United States)

    Horner, T W; Dunn, M L; Eggett, D L; Ogden, L V

    2011-07-01

    Many consumers are unable to enjoy the benefits of milk due to lactose intolerance. Lactose-free milk is available but at about 2 times the cost of regular milk or greater, it may be difficult for consumers to afford. The high cost of lactose-free milk is due in part to the added cost of the lactose hydrolysis process. Hydrolysis at refrigerated temperatures, possibly in the bulk tank or package, could increase the flexibility of the process and potentially reduce the cost. A rapid β-galactosidase assay was used to determine the relative activity of commercially available lactase samples at different temperatures. Four enzymes exhibited low-temperature activity and were added to refrigerated raw and pasteurized milk at various concentrations and allowed to react for various lengths of time. The degree of lactose hydrolysis by each of the enzymes as a function of time and enzyme concentration was determined by HPLC. The 2 most active enzymes, as determined by the β-galactosidase assay, hydrolyzed over 98% of the lactose in 24h at 2°C using the supplier's recommended dosage. The other 2 enzymes hydrolyzed over 95% of the lactose in 24h at twice the supplier's recommended dosage at 2°C. Results were consistent in all milk types tested. The results show that it is feasible to hydrolyze lactose during refrigerated storage of milk using currently available enzymes. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. The microbial content of raw and pasteurized cow milk as determined by molecular approaches.

    Science.gov (United States)

    Quigley, Lisa; McCarthy, Robert; O'Sullivan, Orla; Beresford, Tom P; Fitzgerald, Gerald F; Ross, R Paul; Stanton, Catherine; Cotter, Paul D

    2013-08-01

    The microbial composition of raw and pasteurized milk is assessed on a daily basis. However, many such tests are culture-dependent, and, thus, bacteria that are present at subdominant levels, or that cannot be easily grown in the laboratory, may be overlooked. To address this potential bias, we have used several culture-independent techniques, including flow cytometry, real-time quantitative PCR, and high-throughput DNA sequencing, to assess the microbial population of milk from a selection of commercial milk producers, pre- and postpasteurization. The combination of techniques employed reveals the presence of a previously unrecognized and diverse bacterial population in unpasteurized cow milk. Most notably, the use of high-throughput DNA sequencing resulted in several bacterial genera being identified in milk samples for the first time. These included Bacteroides, Faecalibacterium, Prevotella, and Catenibacterium. Our culture-independent analyses also indicate that the bacterial population of pasteurized milk is more diverse than previously appreciated, and that nonthermoduric bacteria within these populations are likely to be in a damaged, nonculturable form. It is thus apparent that the application of state-of-the-art approaches can provide a detailed insight into the bacterial composition of milk and could potentially be employed in the future to investigate the factors that influence the composition of these populations. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. Incidence of Listeria species in bovine, ovine, caprine, camel and water buffalo milk using cultural method and the PCR assay

    OpenAIRE

    Rahimi, Ebrahim; Momtaz, Hassan; Behzadnia, Asma; Baghbadorani, Zeinab Torki

    2014-01-01

    Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. R...

  5. Examining trust factors in online food risk information: The case of unpasteurized or 'raw' milk.

    Science.gov (United States)

    Sillence, Elizabeth; Hardy, Claire; Medeiros, Lydia C; LeJeune, Jeffrey T

    2016-04-01

    The internet has become an increasingly important way of communicating with consumers about food risk information. However, relatively little is known about how consumers evaluate and come to trust the information they encounter online. Using the example of unpasteurized or raw milk this paper presents two studies exploring the trust factors associated with online information about the risks and benefits of raw milk consumption. In the first study, eye-tracking data was collected from 33 pasteurised milk consumers whilst they viewed six different milk related websites. A descriptive analysis of the eye-tracking data was conducted to explore viewing patterns. Reports revealed the importance of images as a way of capturing initial attention and foregrounding other features and highlighted the significance of introductory text within a homepage. In the second, qualitative study, 41 consumers, some of whom drank raw milk, viewed a selection of milk related websites before participating in either a group discussion or interview. Seventeen of the participants also took part in a follow up telephone interview 2 weeks later. The qualitative data supports the importance of good design whilst noting that balance, authorship agenda, the nature of evidence and personal relevance were also key factors affecting consumers trust judgements. The results of both studies provide support for a staged approach to online trust in which consumers engage in a more rapid, heuristic assessment of a site before moving on to a more in-depth evaluation of the information available. Findings are discussed in relation to the development of trustworthy online food safety resources. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Effect of raw sunflower seeds on goat milk production in different farming systems

    Directory of Open Access Journals (Sweden)

    L. Rapetti

    2010-04-01

    Full Text Available Aim of this study was to test the effect of raw sunflower seeds on goat milk production. Two farms with different farming systems (intensive and semi-intensive participated to the trial. In each farm about 60 mid-lactation Alpine goats were divided in two groups during spring-summer time. A diet containing 5-6% of sunflower seeds on DM basis was compared with a control diet in a change-over design. In the semi-intensive farm milk yield of goats fed sunflower was 3.46 kg/d compared to 3.58 kg/d of goats fed control diet, whereas in the intensive farm milk yield was 4.60 kg/d vs 4.66 kg/d. Fat content increased significantly from 2.99% to 3.23% only in the intensive farm. The research in the intensive farm investigated also milk and cheese fatty acids composition. Medium and short chain fatty acids (C8-C16 content dropped and long chain fatty acids content increased when sunflower was added. In conclusion raw sunflower seed inclusion in dairy goat diets can be useful, in order to limit the inversion of fat and protein percentages in milk.

  7. Iodine in raw and pasteurized milk of dairy cows fed different amounts of potassium iodide.

    Science.gov (United States)

    Norouzian, M A

    2011-02-01

    Relation between iodine (I) intake by lactating Holstein cows and iodine concentrations in raw and pasteurized milk were investigated. Four treatment groups with eight cows assigned to each treatment were fed a basal diet containing 0.534 mg I/kg alone or supplemented with potassium iodide at 2.5, 5 or 7.5 mg/kg in 7-week period. Iodine concentrations in raw milk increased with each increase in dietary I from 162.2 ng/ml for basal diet to 534.5, 559.8 and 607.5 ng/ml when 2.5, 5 and 7.5 mg/kg was fed as potassium iodide (P HTST) pasteurization process reduced I concentration. The mean iodine content found in the milk prior to heating processing was 466.0 ± 205.0 ng/ml, whereas for the processed milk this level was 349.5 ± 172.8 ng/ml. It was concluded that iodine supplementation above of NRC recommendation (0.5 mg/kg diet DM) resulted in significant increases in iodine concentrations in milk, although the effect of heating in HTST pasteurization process on iodine concentration was not negligible.

  8. Aflatoxin M1 contamination of raw and pasteurized milk produced in Sanandaj, Iran

    Directory of Open Access Journals (Sweden)

    Mafakheri, Sh.

    2010-07-01

    Full Text Available This study was conducted to evaluate and compare the levels of aflatoxin M1 in raw and pasteurized milk samples during different seasons by Enzyme- Linked Immuno Sorbent Assay in Sanandaj, Iran. In 257 (94.49% out of 272 milk samples the presence of aflatoxin M1 was detected in concentrations ranging between 0.007 and 115.930 ng/l. AFM1 level in 12 (4.4% of positive samples were higher than the maximum tolerance limit (50 ng/l accepted by Iran and European Union countries. Statistical evaluations showed that the differences between raw and pasteurized samples were not significant (p<0.05. There was no significant difference between spring and summer but the differences between other seasons were statistically significant. Winter samples with 22.35 ng/l and summer samples with 5.14 ng/l had the highest and lowest concentration, respectively (p<0.05. Since contamination of milk with aflatoxin is a potential risk for human health, milk and milk products should be controlled periodically for Aflatoxin contamination.

  9. Detection of Taste Change of Bovine and Goat Milk in Room Ambient Using Electronic Tongue

    Directory of Open Access Journals (Sweden)

    Imam Tazi

    2017-11-01

    Full Text Available An electronic tongue (e-tongue based on an array of lipid/polymer membranes has been successfully developed for measuring the taste evolution of natural milk. The e-tongue consisted of 16 different lipid/polymer membranes combined with or without a pH sensor. The natural milk of bovine and goat were purchased from the local farming store in Malang-Indonesia. The taste measurement was carried out, from fresh (0 h to stale (12 h, every two hours under room ambient without any treatment. The responses of the e-tongue were evaluated using a Principal Component Analysis (PCA and a Linear Discriminant Analysis (LDA. From PCA results, the taste of both milk samples tends to change by time although some groups show a partial overlapping. LDA results show the high precision of the e-tongue in clustering taste evolution. The correctly classified groups after the cross-validation procedure were achieved 95.7 and 87.1% for bovine and goat milk, respectively. The improvement of the classification using LDA was obtained by adding data from a pH sensor of each measurement as 100 and 98.6% for bovine and goat milk, respectively. This work indicates that the lab-made e-tongue may be useful to predict the quality of natural milk for the food industry.

  10. Microbiological quality and antibiotic residues in informally marketed raw cow milk within the coastal savannah zone of Ghana.

    Science.gov (United States)

    Addo, K K; Mensah, G I; Aning, K G; Nartey, N; Nipah, G K; Bonsu, C; Akyeh, M L; Smits, H L

    2011-02-01

    To investigate the microbiological quality and the presence of antibiotic residues in raw cow milk and in some indigenous milk products produced and marketed by the informal sector in the coastal savannah zone of Ghana. Milk samples were aseptically collected from 224 kraals and samples of 26 indigenous milk products were purchased from processors and retailers. Total plate counts, total coliform counts and the presence of Escherichia coli and E. coli O157:H7 were determined in all 250 samples. Milk samples were also tested for antibiotic residues. Total plate counts exceeded 10⁵ CFU/ml in 45.2% of the samples while coliforms exceeded 10³ CFU/ml in 66.0% and E. coli was detected in 11.2%. E. coli was present in raw cow milk but not in the indigenous products and all E. coli isolates were negative for E. coli O157:H7. Antibiotic residues were detected in 3.1% of the raw cow milk samples. Bulk milk contains unacceptable levels of hygiene indicators and antibiotic residues and is a potential source of milk-borne infections. The detection of E. coli and antibiotic residues raises public health concerns about the safety of fresh unpasteurized cow milk in the coastal savannah zone of Ghana and calls for improved farm hygiene, the need for milk pasteurization and the sensible use of antibiotics in the milk industry. © 2010 Blackwell Publishing Ltd.

  11. The effect of bovine milk on the growth of Bombyx mori.

    Science.gov (United States)

    Konala, Niharika; Abburi, Praveena; Bovilla, Venugopal Reddy; Mamillapalli, Anitha

    2013-01-01

    Bombyx mori L. (Lepidoptera: Bombycidae) is a well-studied Lepidopteran model system because of its morphology, life cycle, and economic importance. Many scientists have placed importance on enhancing the economic traits of B. mori because it's larvae, silkworms, are vital in the production of silk. In this study, the effect of bovine milk on B. mori growth was tested. Bovine milk contains several components that aid in healthy growth. The treatment was given to fifth instar B. mori larvae because the fifth instar period is when B. mori eats voraciously and shows maximum growth among all its larval stages. The larvae were treated with fresh mulberry, Morus L. (Rosales: Moraceae), leaves and mulberry leaves dipped in milk from the first day of the fifth instar. Treatments were given on alternate days, and the silkworms were weighed every day to determine whether milk had any role in enhancing the weight of the larvae. Cocoon weights were measured, as the weight indicates the approximate amount of silk that can be reeled. The results showed that larvae gained 82.5% more weight by the end of fifth instar larval when fed with mulberry leaves dipped in milk than when fed with fresh mulberry leaves without milk. The larvae fed with milk-treated leaves gained 310% weight from day 1 to day 7 of the fifth instar, while the larvae fed with fresh leaves gained 153% weight in the same timespan. In addition, cocoon weight increased by 8% when milk was added compared to when it was not. These results suggest that B. mori larvae can be fed mulberry leaves treated with bovine milk for better growth rate and increased silk production.

  12. Bacteriological quality of raw camel milk along the market value chain in Fafen zone, Ethiopian Somali regional state.

    Science.gov (United States)

    Abera, Tsegalem; Legesse, Yoseph; Mummed, Behar; Urga, Befekadu

    2016-05-26

    The camel is a multipurpose animal with a huge productive potential. Camel milk is a key food in arid and semi-arid areas of the African and Asian countries. The quality of milk is influenced by different bacteria present in milk. This study was conducted to evaluate total bacterial content in raw camel milk along the market chain in Fafen zone, Ethiopian Somali Regional State. One hundred twenty-six raw camel milk samples were collected from Gursum (47.1 %) and Babile (52.9 %) districts. The three sampling levels included were udder (14.7 %), milking bucket (29.4 %) and market (55.9 %). Milk samples were analyzed for total bacterial counts (TBC) and coliform counts (CC). Furthermore, major pathogens were isolated and identified. 108 (85.7 %) of raw camel milk samples demonstrated bacterial contamination. The overall mean TBC and CC of contaminated raw camel milk samples was 4.75 ± 0.17 and 4.03 ± 0.26 log CFU/ml, respectively. TBC increased from udder to market level and was higher in Gursum compared to Babile district (P < 0.05). Around 38.9 % of TBCs and 88.2 % CCs in contaminated raw camel milk samples were in the range considered unsafe for human utility. Staphylococcus spp. (89.8 %), Streptococcus spp. (53.7 %), E. coli (31.5 %), Salmonella spp. (17.6 %), Klebsiella spp. (5.6 %) and Enterobacter spp. (5.6 %) were the major bacterial microorganisms isolated. The majority of the bacterial isolates in this study showed high incidence in market as compared to production level. These results indicate a lack of compliance with good production practices and hygiene at milking, transportation and market of raw camel milk.

  13. High-throughput metataxonomic characterization of the raw milk microbiota identifies changes reflecting lactation stage and storage conditions.

    Science.gov (United States)

    Doyle, Conor J; Gleeson, David; O'Toole, Paul W; Cotter, Paul D

    2017-08-16

    Low temperature is used to control the growth of bacteria in milk, both pre- and post-pasteurization. As the duration of refrigerated storage extends, psychrotrophs dominate the milk microbiota, that can produce heat stable lipases which negatively impact the organoleptic qualities of milk. Here we examine the influence that refrigeration temperature (2°C, 4°C and 6°C) and storage duration (96h) have on the microbiota composition (16S profiling) of raw bulk tank milk (BTM). To reflect a proposed change to current farming practices, raw milk was blended after each milking (8 milkings) and stored for five consecutive days in each temperature-specific tank. Here 16S rRNA-based microbiota compositional analysis was performed after milk was collected on day 1 and again after the final addition of milk at day 5. In addition to assessing the impact of the duration and temperature of storage, the influence of lactation stage, i.e. mid- versus late-lactation, on the microbiota of the blended BTM was also examined. Overall, both temperature and length of storage had surprisingly little influence on the raw milk microbiota, other than an increase in proportions of Gammaproteobacteria in the blended milk samples collected after pooling on day 5, and in samples stored at 6°C. However, lactation stage had a considerable influence on microbiota composition, with milk from mid-lactation containing higher proportions of Bacteroides, Faecalibacterium, Campylobacter and Rhodanobacter, and late-lactation milk containing higher proportions of Actinobacteria. Overall, the study demonstrates that current temperature and storage duration practises impact the microbiota of raw milk, but these impacts are modest relative to the more considerable differences between mid and late-lactation milk. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Real Deal or No Deal? A Comparative Analysis of Raw Milk Cheese Regulation in Australia and France

    Directory of Open Access Journals (Sweden)

    William van Caenegem

    2017-04-01

    cheeses, the new standard is rigid and does not encourage new entrants into the emerging raw milk cheese consumer market. This article compares the Australian system with the French raw milk cheese regulation and production system, and argues that its approach in encouraging and supporting small farmhouse artisanal traditional raw milk cheese is beneficial to both producer and consumer, and has not resulted in any significant health risks. The Australian approach amounts to a missed opportunity to encourage the emergence of a value-added industry with local and export potential, and is at odds with important movements in food policy, such as recognition of the value of localism and terroir.

  15. Acute phase proteins in bovine milk in an experimental model of Staphylococcus aureus subclinical mastitis

    DEFF Research Database (Denmark)

    Eckersall, P D; Young, F J; Nolan, A M

    2006-01-01

    and serum amyloid A increase in serum during mastitis. The concentrations of these proteins were determined in an experimental model using a field strain of Staphylococcus aureus to induce subclinical mastitis in dairy cows. The expression of mRNA coding for these proteins was assessed and the presence of M......The objectives were to establish the origin of 2 acute phase proteins in milk during subclinical bovine mastitis and to characterize the relationship between those proteins in milk and blood. Haptoglobin (Hp) and mammary-associated serum amyloid A (M-SAA3) appear in milk during mastitis, whereas Hp...

  16. Molecular characterization of Aspergillus fumigatus isolated from raw cow milk in Argentina: Molecular typing of A. fumigatus from raw cow milk.

    Science.gov (United States)

    Pena, Gabriela A; Alonso, Verónica; Manini, Marina Velasco; Pellegrino, M; Cavaglieri, Lilia R

    2018-06-20

    Aspergillus fumigatus, the major etiological agent of human and animal aspergillosis, is a gliotoxinogenic species into section Fumigati commonly found in contaminated animal environments. In dairy herds, exposed areas of lactating cows, as mammalian glandule, can be easily contaminated by them. This study was aimed to identify A. fumigatus sensu lato strains (identified based on morphology) isolated from raw cow milk at species level, by morphological and molecular techniques, and to estimate their genetic variability. Forty-five A. fumigatus strains showed similar RAPD profiles (generated with PELF and URP1F primers) to each other and to A. fumigatus sensu stricto reference strains; also, they were almost identical to clinical human and feed-borne A. fumigatus strains included in the assay, since their similarity coefficient ranged from 0.7 to 1.00. Therefore, all strains were characterized as belonging to A. fumigatus sensu stricto species. This result was supported by sequencing the benA gene of selected strains and by maximum parsimony analysis. In addition, RAPD fingerprinting demonstrated intra-specific genetic variability into the A. fumigatus sensu stricto cluster. The results found in this study strengthen the fact that A. fumigatus sensu stricto is the predominant species in the Aspergillus section Fumigati found in animal environments such as dairy herd environments, while other species such as A. novofumigatus, A. fumigatiaffinis, A. udagawae and A. lentulus may be rarely isolated. Since no differences between animal and human strains were observed they can become pathogenic also for farm handlers'. Moreover, the presence of A. fumigatus sensu stricto in raw cow milk is probably a very important risk factor since milk and its by-products are generally indented for human consumption, then gliotoxin could be transferred to them. Copyright © 2018. Published by Elsevier B.V.

  17. Monitoring milk for antobodies against recombinant bovine somatotropin using a microsphere immunoassay-based biomarker approach

    NARCIS (Netherlands)

    Ludwig, S.K.J.; Smits, N.G.E.; Bremer, M.G.E.G.; Nielen, M.W.F.

    2012-01-01

    Recombinant bovine somatotropin (rbST) can be used to enhance milk production in dairy cattle. This is permitted in several countries but unauthorized in the European Union. Antibodies, which are produced endogenously in response to rbST administration, can be detected as a biomarker for indicating

  18. Research And Practice: Quantification Of Raw And Heat-Treated Cow Milk in Sheep Milk, Cheese And Bryndza By ELISA Method

    Directory of Open Access Journals (Sweden)

    Lucia Zeleňáková

    2016-01-01

    Full Text Available The aim of this study was to test the reliability of commercial ELISA tests (RC-bovino within raw and heat treated cow milk detection in sheep milk and cheese in order to obtain a high-quality, reliable and economically beneficial method suitable for routine application in practice. These tests were subsequently used for quantification of cow milk in commercial "Bryndza". Raw sheep milk, cow milk and heat-treated cow milk (pasteurisation at 72 °C for 15 sec or at 85 °C for 3 sec were mixed in precisely defined proportions (0 - 100% cow milk in sheep milk. The milk mixtures were sampled to detect adulteration and subsequently cheese was made. By ELISA tests was possible to determine these amounts of raw cow milk in sheep milk: 0.5% (0.2%, 5 % (4.81%, 50% (42.08% and 75% (56.52%. The pasteurized samples in different combinations gave lower optical density responses than those prepared from raw milk (by approximately 60%. In context with the above mentioned, the relationship between the real and detected amount of cow milk (% in different production stages (milk, cheese using a regression analysis was examined. However, a lower reliability of the detection was indicated by R2 values, which ranged from 0.4058 (cheese to 0.5175 (milk. In practice this means that although individual percentage (% of cow milk in the sample can be detected, but in the unknown sample it can not be clearly confirm whether the cow milk was raw or heat-treated. In this context, the results can be inaccurate and may not correspond to the real situation. Within monitoring phase of this research, 9 samples of bryndza were analysed with the results of detected cow milk ranged from 11.56% to 14.3%. The obtained results confirm that the appropriate selection of ELISA tests can become an important factor in the setting of analytical capabilities for the detection of milk and cheese adulteration.

  19. Fluorometric determination of uric acid in bovine milk

    DEFF Research Database (Denmark)

    Larsen, Torben; Moyes, Kasey

    2010-01-01

    The primary objective of this study is to validate a new fast method for determination of uric acid in milk. The method is based on an enzymatic-fluorometric technique that requires minimal pre-treatment of milk samples. The present determination of uric acid is based on the enzymatic oxidation o...

  20. Effect of continuous milking on immunoglobulin concentrations in bovine colostrum

    NARCIS (Netherlands)

    Verweij, J.J.; Koets, A.P.; Eisenberg, S.W.F.

    2014-01-01

    Continuous milking is defined as a dairy cattle management system without a planned dry period for cows in late gestation. Continuous milking has been described to reduce health problems common in periparturient cattle, but may affect colostrum immunoglobulin (Ig) concentration and subsequently calf

  1. Rapid method for quantification of nine sulfonamides in bovine milk using HPLC/MS/MS and without using SPE.

    Science.gov (United States)

    Nebot, Carolina; Regal, Patricia; Miranda, Jose Manuel; Fente, Cristina; Cepeda, Alberto

    2013-12-01

    Sulfonamides are antimicrobial agents widely employed in animal production and their residues in food could be an important risk to human health. In the dairy industry, large quantities of milk are monitored daily for the presence of sulfonamides. A simple and low-cost extraction protocol followed by a liquid chromatographic-tandem mass spectrometry method was developed for the simultaneous detection of nine sulfonamides in whole milk. The method was validated at the maximum residue limits established by European legislation. The limits of quantification obtained for most sulfonamides were between 12.5 and 25 μg kg(-1), detection capabilities ranged from 116 to 145 μg kg(-1), and recoveries, at 100 μg kg(-1), were greater than 89±12.5%. The method was employed to analyse 100 raw whole bovine milk samples collected from dairy farms in the northwest region of Spain. All of the samples were found to be compliant, but two were positive; one for sulfadiazine and the other for sulfamethoxipyridazine. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Investigation of some additive residues in bulk raw milk collected from Pakdasht area in 2009

    Directory of Open Access Journals (Sweden)

    T Moosavi

    2011-05-01

    Full Text Available Milk is one of the most important sources of human nutrition and because of high nutrient content; it is a very suitable medium for microbial growth and spoilage. Sometimes farmers cheat and add some additives to milk in order to cover the spoilage or other defects in milk. In this study 120 samples of bulk raw milk (10 samples each month were collected from dairy farms of Pakdasht under sterile condition and send to veterinary faculty of GarmsarUniversity. The following tests were done on each sample: Anti-microbial residues, residues milk acidity neutralizer, evaluation of sugar, formalin, Hydrogen peroxide, Salicylic acid and salt presence. Results were analyzed with Spss software and the results of the first six months of the year were compared statistically with the results of the second six months of the year. The mean of antimicrobial agents, milk acid neutralizer, formalin, hydrogen peroxide and salicylic acid showed no significant difference. But sugar in first semester were more than second semester (p

  3. HPLC identification of isoniazid residues in bovine milk

    Directory of Open Access Journals (Sweden)

    Leite R.M.H.

    2000-01-01

    Full Text Available The high pressure liquid chromatography (HPLC was used for the identification of isoniazid (isonicotinic acid hydrazide in the milk of cattle treated with a dose of 25 mg/kg/day in alternated days. The effect of milk pasteurization on the isoniazid residue concentration was also studied. The drug excretion presented a cyclic variation, with higher levels in the first day after administration (aa, a mean of 1104.48µg/l, and a decrease two days aa, with a mean of 104.12µg/l. Four days after the last administration of the drug it was not possible to identify residues of isoniazid in the milk of treated animals. Body weight and milk yield influenced the amount of the excreted drug, and pasteurization decreased (mean 47.07% the concentration of isoniazid residue in milk.

  4. Using milk leukocyte differentials for diagnosis of subclinical bovine mastitis.

    Science.gov (United States)

    Gonçalves, Juliano Leonel; Lyman, Roberta L; Hockett, Mitchell; Rodriguez, Rudy; Dos Santos, Marcos Veiga; Anderson, Kevin L

    2017-08-01

    This research study aimed to evaluate the use of the milk leukocyte differential (MLD) to: (a) identify quarter milks that are culture-positive; and (b) characterize the milk leukocyte responses to specific groups of pathogens causing subclinical mastitis. The MLD measures the absolute number and relative percentage of inflammatory cells in milk samples. Using the MLD in two dairy herds (170 and 172 lactating cows, respectively), we studied all lactating cows with a most recent monthly Dairy Herd Improvement Association somatic cell count (SCC) >200 × 103 cells/ml. Quarter milk samples from 78 cows meeting study criteria were analysed by MLD and aseptically collected milk samples were subjected to microbiological culture (MC). Based upon automated instrument evaluation of the number and percentage of inflammatory cells in milk, samples were designated as either MLD-positive or - negative for subclinicial mastitis. Positive MC were obtained from 102/156 (65·4%) of MLD-positive milk samples, and 28/135 (20·7%) of MLD-negative milk samples were MC-positive. When MC was considered the gold standard for mastitis diagnosis, the calculated diagnostic Se of the MLD was 65·4% (IC95% = 57·4 to 72·8%) and the Sp was 79·3% (IC95% = 71·4 to 85·7%). Quarter milks positive on MC had higher absolute numbers of neutrophils, lymphocytes and macrophages, with higher neutrophils% and lymphocytes% but lower macrophages%. The Log10 (N/L) ratios were the most useful ratio to differentiate specific subclinical mastitis quarters from healthy quarters. Use of the MLD on cows with monthly composite SCC > 200 × 103 cells/ml for screening at quarter level identified quarters more likely to be culture-positive. In conclusion, the MLD can provide an analysis of mammary quarter status more detailed than provided by SCC alone; however, the MLD response to subclinical mastitis was not found useful to specifically identify the causative pathogen.

  5. GENETIC DIVERSITY AMONG YERSINIA ENTEROCOLITICA ISOLATED FROM SEWAGE, RAW MILK AND PACKED FOODS

    Directory of Open Access Journals (Sweden)

    Shanmuga Priya Seshadhri

    2014-12-01

    Full Text Available A total of 90 isolates (40 from sewage, 30 from raw milk and 20 from packed foods collected to study the incidence of Yersinia enterocolitica. It was observed that 61 isolates (32 from sewage, 19 from raw milk and 10 from packed foods were found contaminated with the bacterium. All the isolated strains were confirmed to Yersinia enterocolitica, by using 16S rRNA PCR. Of 61 strains, only five strains (two from sewage and two from packed foods and one from raw milk were found to be the producers of haemolysin at 37 oC, while among the five strains only two strains from packed foods produced haemolysin at 28 oC. All the isolates showed resistance to amoxicillin and found sensitive to chloramphenicol. Seven strains were producer of High molecular weight proteins (HMWP. 53 strains have produced rough LPS, while the smooth LPS has been observed for 8 isolates. Eleven and six different profiles observed in outermembrane proteins and lipopolysaccaride respectively. Combined primer 1 and 2 RAPD-PCR dendogram shows eight different genotypic patterns.

  6. Peptidomic analysis reveals proteolytic activity of kefir microorganisms on bovine milk proteins

    Science.gov (United States)

    Dallas, David C.; Citerne, Florine; Tian, Tian; Silva, Vitor L. M.; Kalanetra, Karen M.; Frese, Steven A.; Robinson, Randall C.; Mills, David A.; Barile, Daniela

    2015-01-01

    Scope The microorganisms that make up kefir grains are well known for lactose fermentation, but the extent to which they hydrolyze and consume milk proteins remains poorly understood. Peptidomics technologies were used to examine the proteolytic activity of kefir grains on bovine milk proteins. Methods and results Gel electrophoresis revealed substantial digestion of milk proteins by kefir grains, with mass spectrometric analysis showing the release of 609 protein fragments and alteration of the abundance of >1,500 peptides that derived from 27 milk proteins. Kefir contained 25 peptides identified from the literature as having biological activity, including those with antihypertensive, antimicrobial, immunomodulatory, opioid and anti-oxidative functions. 16S rRNA and shotgun metagenomic sequencing identified the principle taxa in the culture as Lactobacillus species. Conclusion The model kefir sample contained thousands of protein fragments released in part by kefir microorganisms and in part by native milk proteases. PMID:26616950

  7. Peptidomic analysis reveals proteolytic activity of kefir microorganisms on bovine milk proteins.

    Science.gov (United States)

    Dallas, David C; Citerne, Florine; Tian, Tian; Silva, Vitor L M; Kalanetra, Karen M; Frese, Steven A; Robinson, Randall C; Mills, David A; Barile, Daniela

    2016-04-15

    The microorganisms that make up kefir grains are well known for lactose fermentation, but the extent to which they hydrolyze and consume milk proteins remains poorly understood. Peptidomics technologies were used to examine the proteolytic activity of kefir grains on bovine milk proteins. Gel electrophoresis revealed substantial digestion of milk proteins by kefir grains, with mass spectrometric analysis showing the release of 609 protein fragments and alteration of the abundance of >1500 peptides that derived from 27 milk proteins. Kefir contained 25 peptides identified from the literature as having biological activity, including those with antihypertensive, antimicrobial, immunomodulatory, opioid and anti-oxidative functions. 16S rRNA and shotgun metagenomic sequencing identified the principle taxa in the culture as Lactobacillus species. The model kefir sample contained thousands of protein fragments released in part by kefir microorganisms and in part by native milk proteases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Comparison of Coxiella burnetii shedding in milk of dairy bovine, caprine, and ovine herds.

    Science.gov (United States)

    Rodolakis, A; Berri, M; Héchard, C; Caudron, C; Souriau, A; Bodier, C C; Blanchard, B; Camuset, P; Devillechaise, P; Natorp, J C; Vadet, J P; Arricau-Bouvery, N

    2007-12-01

    The shedding of Coxiella burnetii in bovine, caprine, and ovine milk was measured using PCR, in 3 herds for each species, the bulk tank milk samples of which were positive at the time of their selection. Milk samples of 95 cows, 120 goats, and 90 ewes were sampled over 16 wk, as was the bulk tank milk. The shedding of C. burnetii in vaginal mucus and feces was checked at the beginning of the experiment and 2 mo later. The clinical signs in the selected herds as well as the duration and the shedding routes differed among the 3 species. The cows were asymptomatic and shed C. burnetii almost exclusively in milk. In one of the caprine herds, abortions due to C. burnetii were reported. The goats excreted the bacteria mainly in milk. In contrast, the ewes, which came from flocks with abortions due to Q fever (C. burnetii infection), shed the bacteria mostly in feces and in vaginal mucus. This could explain why human outbreaks of Q fever are more often related to ovine flocks than to bovine herds. These excretions did not seem more frequent when the samples were taken close to parturition. The samples were taken from 0 to 421 d after parturition in bovine herds and from 5 to 119 d and 11 to 238 d after parturition in the caprine and ovine herds, respectively. The shedding in milk was sometimes intermittent, and several animals shed the bacteria but were negative by ELISA: 80% of the ewes were seronegative, underscoring the lack of sensitivity of the ELISA tests available for veterinary diagnosis. The detection of antibodies in milk seems more sensitive than it is in serum.

  9. Total bacterial count and somatic cell count in refrigerated raw milk stored in communal tanks

    Directory of Open Access Journals (Sweden)

    Edmar da Costa Alves

    2014-09-01

    Full Text Available The current industry demand for dairy products with extended shelf life has resulted in new challenges for milk quality maintenance. The processing of milk with high bacterial counts compromises the quality and performance of industrial products. The study aimed to evaluate the total bacteria counts (TBC and somatic cell count (SCC in 768 samples of refrigerated raw milk, from 32 communal tanks. Samples were collected in the first quarter of 2010, 2011, 2012 and 2013 and analyzed by the Laboratory of Milk Quality - LQL. Results showed that 62.5%, 37.5%, 15.6% and 27.1% of the means for TBC in 2010, 2011, 2012 and 2013, respectively, were above the values established by legislation. However, we observed a significant reduction in the levels of total bacterial count (TBC in the studied periods. For somatic cell count, 100% of the means indicated values below 600.000 cells/mL, complying with the actual Brazilian legislation. The values found for the somatic cell count suggests the adoption of effective measures for the sanitary control of the herd. However, the results must be considered with caution as it highlights the need for quality improvements of the raw material until it achieves reliable results effectively.

  10. Isolation and identification of Salmonella typhimurium from raw cow, sheep and goat milk in Chahamaha Va Bakhteyari Province

    Directory of Open Access Journals (Sweden)

    F Tajbakhsh

    2014-05-01

    Full Text Available Salmonella typhimurium and S. enteritidisare known as the major causes of food-borne infection throughout the world. The present study was carried out to investigate the prevalence of S. typhimurium in raw milks of Chahamaha Va Bakhteyari province. For this reason, a total of 550 raw milks (consisting of 200 cow, 175 sheep and 175 goat milk samples were collected through October 2011 to March 2012 from dairy herds around Shahrekord. The samples were cultured and the isolated colonies were confirmed by PCR using species-specific ST11 and ST15 primers. According to the results, a total of 20 samples (3.63% were found positive for Salmonellaspp.Amongst, 14 (2.54% of cow milk, 2 (0.36% of sheep milk and 4 (0.72% of goat milk samples were contaminated. Using PCR, 9 (1.63% samples were contaminated with S. typhimurium. The results indicated a relatively high occurrence of S. typhimurium in raw milks. Therefore, it is essential to maintain hygienic measures during milking and handling. Besides, it is recommended not to use raw milk for the manufacturing of dairy products such as cheese and ice-cream.

  11. Stochastic simulation modeling to determine time to detect Bovine Viral Diarrhea antibodies in bulk tank milk

    DEFF Research Database (Denmark)

    Foddai, Alessandro; Enøe, Claes; Krogh, Kaspar

    2014-01-01

    A stochastic simulation model was developed to estimate the time from introduction ofBovine Viral Diarrhea Virus (BVDV) in a herd to detection of antibodies in bulk tank milk(BTM) samples using three ELISAs. We assumed that antibodies could be detected, after afixed threshold prevalence of seroco......A stochastic simulation model was developed to estimate the time from introduction ofBovine Viral Diarrhea Virus (BVDV) in a herd to detection of antibodies in bulk tank milk(BTM) samples using three ELISAs. We assumed that antibodies could be detected, after afixed threshold prevalence......, which was the most efficient ELISA, could detect antibodiesin the BTM of a large herd 280 days (95% prediction interval: 218; 568) after a transientlyinfected (TI) milking cow has been introduced into the herd. The estimated time to detectionafter introduction of one PI calf was 111 days (44; 605...

  12. Bovine tuberculosis and brucellosis prevalence in cattle from selected milk cooperatives in Arsi zone, Oromia region, Ethiopia.

    Science.gov (United States)

    Tschopp, Rea; Abera, Birhanu; Sourou, Sabi Yao; Guerne-Bleich, Emmanuelle; Aseffa, Abraham; Wubete, Alehegne; Zinsstag, Jakob; Young, Douglas

    2013-08-13

    Bovine tuberculosis (BTB) and bovine brucellosis are two important milk-borne zoonoses that have been shown to be prevalent to various degrees in Ethiopian cattle. The study was carried out in four Woredas (districts) around Asella town, Arsi Zone between October 2011 and March 2012 and included 318 small-holders in 13 dairy cooperatives that marketed the delivered milk. The aims of the study were i) to assess the prevalence of the two diseases in cattle in a cross-sectional study, ii) to assess potential risk factors of BTB and brucellosis to humans as well as the knowledge-attitude-practice (KAP) among these farmers towards these diseases. BTB testing using the comparative intradermal skin test (CIDT) was done on 584 milking cows, out of which 417 were serologically tested for brucellosis using the Rose Bengal Plate Test and reactors confirmed with an indirect ELISA test (PrioCHECK®). The individual animal prevalence was 0.3% (95% CI 0.1% to 1.3%) for BTB, 1.7% (95% CI 0.8% to 3.5%) for brucellosis and 8.9% (95% CI 6.8% to 11.5%) for MAC (Mycobacterium avium complex). Of the 13 milk cooperatives, two had at least one positive BTB reactor and five had animals positive for brucellosis. Cross-breeds accounted for 100% and 71.4% of the BTB and brucellosis reactors respectively. For both diseases, there were prevalence variations depending on Woreda. No animal was concomitant reactor for BTB and brucellosis. Raw milk was consumed by 55.4% of the respondents. 79.2% of the respondents reported touching the afterbirth with bare hands. The latter was fed to dogs in 83% of the households. One cow among the herds of the 130 interviewees had aborted in the last 12 months. Among the interviewees, 77% stated knowing tuberculosis in general but 42 out of the 130 respondents (32.3%) did not know that BTB was transmitted by livestock. Less than half (47.7%) of the respondents knew about brucellosis. Low prevalence of both diseases reflected the potential for the area to compete

  13. Prevalence and Characterization of Listeria Species from Raw Milk and Dairy Products from Çanakkale Province

    Directory of Open Access Journals (Sweden)

    Pınar Şanlıbaba

    2018-02-01

    Full Text Available The objective of this study was to determine the prevalence of Listeria species, specifically Listeria monocytogenes, in raw milk, pasteurized milk, white cheese, and homemade cheese. A total of 200 food samples were collected and analyzed to examine the presence of Listeria spp. The EN ISO 11290-1 method was used for isolation of Listeria. API Listeria test kit was used for biochemically characterization. Listeria spp. were isolated in 25 of the 200 samples (12.5%. The largest number of Listeria spp. was detected in homemade cheese (24%, followed by raw milk (18%, and white cheese (8%. Listeria spp. were not isolated from the pasteurized milk. The most common species isolated were Listeria innocua (5.5%; the remaining Listeria isolates were Listeria ivanovi (3.5%, Listeria welshimeri (3%, and Listeria monocytogenes (0.5%. Listeria monocytogenes was detected in only raw milk.

  14. [On-site evaluation of raw milk qualities by portable Vis/NIR transmittance technique].

    Science.gov (United States)

    Wang, Jia-Hua; Zhang, Xiao-Wei; Wang, Jun; Han, Dong-Hai

    2014-10-01

    To ensure the material safety of dairy products, visible (Vis)/near infrared (NIR) spectroscopy combined with che- mometrics methods was used to develop models for fat, protein, dry matter (DM) and lactose on-site evaluation. A total of 88 raw milk samples were collected from individual livestocks in different years. The spectral of raw milk were measured by a porta- ble Vis/NIR spectrometer with diffused transmittance accessory. To remove the scatter effect and baseline drift, the diffused transmittance spectra were preprocessed by 2nd order derivative with Savitsky-Golay (polynomial order 2, data point 25). Changeable size moving window partial least squares (CSMWPLS) and genetic algorithms partial least squares (GAPLS) meth- ods were suggested to select informative regions for PLS calibration. The PLS and multiple linear regression (MLR) methods were used to develop models for predicting quality index of raw milk. The prediction performance of CSMWPLS models were similar to GAPLS models for fat, protein, DM and lactose evaluation, the root mean standard errors of prediction (RMSEP) were 0.115 6/0.103 3, 0.096 2/0.113 7, 0.201 3/0.123 7 and 0.077 4/0.066 8, and the relative standard deviations of prediction (RPD) were 8.99/10.06, 3.53/2.99, 5.76/9.38 and 1.81/2.10, respectively. Meanwhile, the MLR models were also cal- ibrated with 8, 10, 9 and 7 variables for fat, protein, DM and lactose, respectively. The prediction performance of MLR models was better than or close to PLS models. The MLR models to predict fat, protein, DM and lactose yielded the RMSEP of 0.107 0, 0.093 0, 0.136 0 and 0.065 8, and the RPD of 9.72, 3.66, 8.53 and 2.13, respectively. The results demonstrated the usefulness of Vis/NIR spectra combined with multivariate calibration methods as an objective and rapid method for the quality evaluation of complicated raw milks. And the results obtained also highlight the potential of portable Vis/NIR instruments for on-site assessing quality indexes of

  15. Infectivity of cysts of the ME-49 Toxoplasma gondii strain in bovine milk and homemade cheese

    Directory of Open Access Journals (Sweden)

    Hiramoto RM

    2001-01-01

    Full Text Available OBJECTIVE: Analyze the infectivity and storage resistance of cysts of the ME-49 strain of Toxoplasma gondii in artificially infected bovine milk and homemade fresh cheese. METHODS: Pasteurized bovine milk was infected with 10 cysts/ml of the ME-49 strain of T.gondii and inoculated in different groups of mice, immediately or after storage at 4ºC for 5, 10 and 20 days. Homemade fresh cheese was prepared with artificially infected milk, and also tested in groups of mice, using the same storage process. Infection was identified by the presence of cysts in the brain or serological testing in challenged mice after 5 weeks, confirmed by Western Blot and histology. RESULTS: The infectivity of cysts of the ME-49 strain of T.gondii was maintained in the milk even after storage for 20 days at refrigerator temperatures. Cysts were also able to survive the production process of homemade fresh cheese and storage for a period of 10 days in the same conditions. CONCLUSIONS: These data demonstrated that milk and dairy products could be an important source of T.gondii in human contamination, reinforcing the importance of milk pasteurization before any processing or ingestion.

  16. [Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

    Science.gov (United States)

    Gelbícová, T; Karpísková, R

    2012-04-01

    Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

  17. Contamination Level of Staphylococcus spp. in Raw Goat Milk and Associated Risk Factors

    Directory of Open Access Journals (Sweden)

    E. Taufik

    2008-12-01

    Full Text Available This study was aimed to investigate the presence of pathogenic bacteria in raw goat milk by using Staphylococcus spp. as indicator bacteria, and also to evaluate the potential risk factors associated with them. Information regarding potential risk factors was collected by questionnaire. The conventional bacteriological method for bacterial isolation and the indirect test (California Mastitis Test (CMT for determining udder inflammation status were employed. A sample size of 300 udder halves milk samples from three commercial dairy goat farms in the Bogor District, West Java Province, Indonesia were investigated for counts and prevalence of indicator bacteria. Ten potential risk factors were also evaluated in relation to counts and prevalence of indicator bacteria. The results showed that the median value of indicator bacterial count from overall udder-half milk samples was 3.00 log cfu/ml. The indicator bacterial count from udder-half milk samples was significantly different (P<0.05 among farms. Overall prevalence of Staphylococcus spp. was 78.7%. As one of potential risk factors, udder inflammation status was found to be risk factor for Staphylococcus spp. contamination in milk. Udders with inflammation had significant association and a higher chance of having contaminated samples by Staphylococcus spp. as compared to udders without inflammation. Additionally, according to these study results, CMT can be used as an effective, reliable, cheap and “farm and farmer friendly test” for screening test of intramammary infection (IMI or sub clinical mastitis in dairy goats.

  18. Real-time PCR detection of Paenibacillus spp. in raw milk to predict shelf life performance of pasteurized fluid milk products.

    Science.gov (United States)

    Ranieri, Matthew L; Ivy, Reid A; Mitchell, W Robert; Call, Emma; Masiello, Stephanie N; Wiedmann, Martin; Boor, Kathryn J

    2012-08-01

    Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect Paenibacillus spp. in fluid milk and to discriminate between Paenibacillus and other closely related spore-forming bacteria. Specificity was confirmed using 16 Paenibacillus and 17 Bacillus isolates. All 16 Paenibacillus isolates were detected with a mean cycle threshold (C(T)) of 19.14 ± 0.54. While 14/17 Bacillus isolates showed no signal (C(T) > 40), 3 Bacillus isolates showed very weak positive signals (C(T) = 38.66 ± 0.65). The assay provided a detection limit of approximately 3.25 × 10(1) CFU/ml using total genomic DNA extracted from raw milk samples inoculated with Paenibacillus. Application of the TaqMan PCR to colony lysates obtained from heat-treated and enriched raw milk provided fast and accurate detection of Paenibacillus. Heat-treated milk samples where Paenibacillus (≥1 CFU/ml) was detected by this colony TaqMan PCR showed high bacterial counts (>4.30 log CFU/ml) after refrigerated storage (6°C) for 21 days. We thus developed a tool for rapid detection of Paenibacillus that has the potential to identify raw milk with microbial spoilage potential as a pasteurized product.

  19. Determination of heavy metals concentration in raw sheep milk from mercury polluted area

    Directory of Open Access Journals (Sweden)

    Radovan Stanovič

    2016-01-01

    Full Text Available The paper focuses on determining the content of monitored contaminants (Cd, Cu, Hg, Pb and Zn in 53 samples of raw sheep milk collected in 2013 and 2014 on the sites Poráč and Matejovce nad Hornádom (middle Spiš. The area is characterized by historical mining and metalworking activity (mining and processing of polymetallic ores rich in Hg, Cd and Pb. Currently, the area is one of the most mercury contaminated areas in Central Europe. All statistical analyses were carried out using the statistical software Statistica 10.0 (Statsoft, USA. Descriptive data analysis included minimum value, maximum value, arithmetic mean and standard deviation. The results of the studied contaminant content show that the limit value for cadmium (10 μg.kg-1 was exceeded in 25 samples. In the case of lead, the limit value of 20 μg.kg-1 was exceeded in 16 cases. The limit value for copper (0.4 mg.kg-1 was exceeded in one case. The limit value for zinc is not defined by a legislative standard. The risk level of the studied contaminants in the samples of raw sheep milk decreases as follows: Cd > Pb > Hg > Cu > Zn. It can be concluded that frequent and long-term consumption of the raw sheep milk originating from the studied sites poses a health risk. The content of the contaminants in the milk and their eventual transition into dairy products should be monitored over a longer term in more detail. Normal 0 21 false false false CS JA X-NONE

  20. Determination of lactose in raw milks by means of the combined He-Ne laser optothermal window

    NARCIS (Netherlands)

    Bakos, P.; Doka, O.; Ajtony, Z.; Bicanic, D.; Szucs, D.

    2002-01-01

    The concept of OW (with 632.8 nm He–Ne laser), combined with colorimetry based on a reaction of anthrone-sulphuric acid, was proposed as a new tool for determination of lactose in raw milk. Data obtained from various milk samples by OW colorimetry were compared to those acquired from the MilkoScan

  1. Isolation and molecular identification of Mycobacterium from commercially available pasteurized milk and raw milk samples collected from two infected cattle farms in Alborz Province, Iran.

    Science.gov (United States)

    Eftekhari, Mohsen; Mosavari, Nader

    2016-12-01

    Mycobacterium avium subsp. paratuberculosis (MAP) is an etiological agent of Johne's disease in ruminant including cattle, sheep and goats. This disease is considered an economically important disease in cattle. Animals with paratuberculosis shed viable MAP, particularly in their milk and feces. MAP may be involved in the development of Crohn's disease in humans through the consumption of contaminated milk and dairy products. Common methods of pasteurization are not enough to kill all MAP present in the milk and the bacterium has been isolated from raw milk, pasteurized milk and cheese samples. The purpose of this study was to evaluate two different methods for detecting MAP in milk and milk products. We analyzed the commonly used methods such as culture and molecular biology for identification of MAP. For this study, 50 milk samples from cows with suspected Johne's disease located in two dairy farms and 10 commercially available pasteurized milk and cheese samples from the market in Karaj city, Iran were selected. Following Ziehl-Neelsen staining of milk samples, direct microscopic detection of MAP was performed. All milk samples were centrifuged, and the concentrated samples were decontaminated using hexadecyl pyridinium chloride. The decontaminated milk suspensions were washed three times by centrifuging, and the collected filtrates were cultivated on Herrold's egg yolk medium enriched by Mycobactin J. Finally, identification and confirmation of isolates to MAP was performed using IS900-nested polymerase chain reaction (PCR). According to the obtained results by culture and PCR methods, none of the pasteurized milk and cheese samples showed the presence of MAP. However, 10% of the tested raw milk samples collected from suspected cattle showed the presence of MAP by both culture and PCR methods. Culture and PCR methods are reliable for identification of MAP from milk samples. Copyright © 2016.

  2. Bacteriological study of raw and unexpired pasteurized cow's milk collected at the dairy farms and super markets in Sari city in 2011

    OpenAIRE

    VAHEDI, M.; NASROLAHEI, M.; SHARIF, M.; MIRABI, A.M.

    2013-01-01

    Summary Introduction. The quality of milk is influenced by different bacteria present in milk. This study was undertaken to investigate the bacterial contamination of raw and pasteurized milk in Sari Township, Iran, 2011. Methods. In this investigation, 100 pasteurized milk samples were collected randomly from the super markets in the city and 100 raw milk samples from 4 dairy farms from suburb areas and evaluated for the presence of coliforms, Escherichia coli, Staphylococcus aureus and List...

  3. Determination of the concentrations of lead in raw milk in the Valley of Toluca

    International Nuclear Information System (INIS)

    Rosas Vilchis, E.

    1991-01-01

    The object of the present work, undertaken under the program of Regional and Cooperative Agreement for Nuclear Science and Technology in Latin America (ARCAL IV), was to determine the amounts of lead found in raw milk using the analytic techniques of Atomic Absorption Spectrophotometry (AAS), Inductively Coupled Plasma Atomic Emission Spectrometry (ICP-AES) and X-ray Fluorescence (FRX); so as to aid in solving problems of public health originating from elevated amounts of heavy metals in foods of animal origin. A total of thirty samples of raw milk were collected in the Valley of Toluca in Mexico, where heavy metal contaminants in the environment due to effects of rapid industrialization and urbanization, are known to have entered the food chain. The methodology, consisting in destroying organic matter in the samples by calcination, and included, in the case of AAS and ICP-AES, acid digestion. In the case of FRX, lead was extracted by ammonium 1-pyrrolidine carboditioate (APDC). The equipment to be used was calibrated and both blank and working solutions prepared in order to perform quantitative analysis. The concentrations of lead which were found in all the milk samples ranged from <0.03 to 0.31 μg/ml milk. These amounts within the maximum permissible limits, 0.5 μg/ml for all types of milk, established by the FDA. In the analysis ICP-AES gave best results as to sensitivity, precision and accuracy, followed by AAS which gave reliable results. FRX failed to detect lower limits and was, therefore, less reliable. (Author)

  4. Effects of bovine pregnancy on the fatty acid composition of milk: the significance for humans needs.

    Science.gov (United States)

    Barreiro, R; Regal, P; Díaz-Bao, M; Vázquez, B I; Cepeda, A

    2017-04-01

    Milk from 40 Holstein dairy cows was collected from two different farms in Galicia (Spain). The differences in the fatty acid composition of two groups of cows, 20 pregnant and 20 non-pregnant, was studied to determine whether pregnancy status is a determinant factor that can alter the fatty acid profile of milk. Gas-chromatography (GC) coupled to flame ionisation detection (FID) was used for the determination of the fatty acids. Differences in the milk fatty acids between pregnant and non-pregnant cows were pronounced showing statistically significant differences for some fatty acids and the total saturated and monounsaturated fatty acids. Milk from non-pregnant cows was lower in saturated fatty acids and higher in monounsaturated fatty acids (unlike milk from pregnant cows). The effects of the consumption of bovine milk, particularly milk fat, on human health have been studied in depth and sometimes are associated with negative effects, but milk has also several beneficial characteristics linked to some fatty acids.

  5. The influence of bovine milk high or low in isoflavones on hepatic gene expression in mice

    DEFF Research Database (Denmark)

    Skaanild, Mette Tingleff; Nielsen, Tina Skau

    2012-01-01

    Isoflavones have generated much attention due to their potential positive effects in various diseases. Phytoestrogens especially equol can be found in bovine milk, as feed ration for dairy cows is comprised of plants containing phytoestrogens. The aim of this study was to analyze the changes...... in hepatic gene expression after dietary intake of milk high and low in isoflavones. In addition to pelleted feed female NMRI mice were offered water, water added either 17β-estradiol, equol, Tween 80, and milk high and low in isoflavone content for a week. Gene expression was analyzed using an array q......PCR kit. It was revealed that Tween 80 and 17β-estradiol upregulated both phase I and phase II genes to the same extent whereas equol alone, high and low isoflavone milk did not alter the expression of phase I genes but decreased the expression of phase II genes. This study shows that dietary isoflavones...

  6. Milk losses due to bovine tropical theileriosis (Theileria annulata infection in Algeria

    Directory of Open Access Journals (Sweden)

    Ouarda Ayadi

    2016-09-01

    Full Text Available The authors studied the impact of tropical theileriosis onset on milk yield decrease in 10 local bred cows in Skikda (Northern Algeria during 2015 summer season. The milk yield decrease estimated weekly during two months was 2.76 L/day/cow corresponding to 31.92% of the total milk yield. This decrease corresponds to 110.5 Algerian Dinars (1.02 US$/day/diseased cow. The relative variation of milk yield showed a dramatic decrease from 82.72% to 0.76% at Day 21 then became constant. Further studies are needed to improve these estimations of financial losses due to bovine tropical theileriosis in Algeria.

  7. Detection of aflatoxin M1 in raw and commercial pasteurized milk in Urmia, Iran.

    Science.gov (United States)

    Tajik, Hossein; Rohani, Seyed Mehdi Razavi; Moradi, Mehran

    2007-11-15

    During the years 2005 and 2006, samples of raw and of pasteurized milk (72 samples each) were collected randomly from various parts of Urmia city in Iran for the detection of aflatoxin M1. Aflatoxin M1 levels were assessed by Enzyme Linked Immuno Sorbent Assay (ELISA). There was a high incidence of AFM1 (100%), in both raw and pasteurized milk samples. The AFM1 levels in 6.25% of samples were higher than the maximum tolerance limit accepted by European Union (50 ng L(-1)), while the observed mean ofAFM1 was lower than those proposed for European diets. Maximum level ofAFM1 in raw and pasteurized samples were 91.8 and 28.5 ng L(-1), while minimum levels were 4.3 and 5.1 ng L(-1), respectively. The levels ofAFM1 in total samples indicated that feeds for cows in this region were contaminated with AFB1 in such a level that appears to be a serious public health problem at the moment. Therefore, there is a need to limit exposure to aflatoxins by imposing regulatory limits.

  8. Contribution of hydrogen peroxide to the inhibition of Staphylococcus aureus by Lactococcus garvieae in interaction with raw milk microbial community

    OpenAIRE

    Delbes, Céline; Dorchies, Géraud; Chaabna, Zineddine; Callon, Cecile; Montel, Marie-Christine

    2010-01-01

    The response of Staphylococcus aureus growth inhibition by Lactococcus garvieae to catalase and milk lactoperoxidase, and its efficiency in raw milk cheese were evaluated. S. aureus and L. garvieae were co-cultivated in broth buffered at pH 6.8, and in raw, pasteurized and microfiltered milk, in presence and absence of catalase. Although H(2)O(2) production by L garvieae was detected only in agitated broth, the inhibition of S. aureus by L garvieae was reduced by catalase both in stati...

  9. Characterization of the indigenous microflora in raw and pasteurized buffalo milk during storage at refrigeration temperature by high-throughput sequencing

    Science.gov (United States)

    The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High quality samples of raw buffalo milk were obtained from five dairy farms in the Guangxi province of China. A sample of each milk was pasteurized, and both r...

  10. Effect of microfluidization on casein micelle size of bovine milk

    Science.gov (United States)

    Sinaga, H.; Deeth, H.; Bhandari, B.

    2018-02-01

    The properties of milk are likely to be dependent on the casein micelle size, and various processing technologies produce particular change in the average size of casein micelles. The main objective of this study was to manipulate casein micelle size by subjecting milk to microfluidizer. The experiment was performed as a complete block randomised design with three replications. The sample was passed through the microfluidizer at the set pressure of 83, 97, 112 and 126 MPa for one, two, three, four, five and six cycles, except for the 112 MPa. The results showed that microfluidized milk has smaller size by 3% with pressure up to 126 MPa. However, at each pressure, no further reduction was observed after increasing the passed up to 6 cycles. Although the average casein micelle size was similar, elevating pressure resulted in narrower size distribution. In contrast, increasing the number of cycles had little effect on casein micelle distribution. The finding from this study can be applied for future work to characterize the fundamental and functional properties of the treated milk.

  11. Comparison of Bovine coronavirus-specific and Bovine respiratory syncytial virus-specific antibodies in serum versus milk samples detected by enzyme-linked immunosorbent assay.

    Science.gov (United States)

    Ohlson, Anna; Blanco-Penedo, Isabel; Fall, Nils

    2014-01-01

    Bovine coronavirus (BCV; Betacoronavirus 1) and Bovine respiratory syncytial virus (BRSV) are significant causes of enteric and respiratory disease in beef and dairy cattle throughout the world. Indirect enzyme-linked immunosorbent assays are widely used to detect serum antibodies for herd monitoring and prevalence studies. In dairy herds, milk is more readily collected than serum. Hence, in order to investigate the test agreement between serum and milk, both serum and milk samples from 105 cows in 27 dairy herds were analyzed in parallel for presence of immunoglobulin G antibodies to BCV and BRSV. The Bland-Altman analyses of data demonstrated good agreement between serum and milk antibody titers for both viruses. The results indicate milk samples are sufficient for surveillance of antibodies to BCV and BRSV.

  12. Role of dietary supplementation in the protein content of bovine milk

    African Journals Online (AJOL)

    User

    2011-05-02

    May 2, 2011 ... Results of protein contents of fodder (FOD) in comparison with concentrates that is,. F-COC, F-MSC .... including proteins which provide a bulk amount of raw ... degradability of dietary protein and fat on ruminal, blood, and milk.

  13. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  14. Time resolved bovine host reponse to virulence factors mapped in milk by selected reaction monitoring

    DEFF Research Database (Denmark)

    Bislev, Stine Lønnerup; Kusebauch, Ulrike; Codrea, Marius Cosmin

    . In this study, we present a sensitive selected reaction monitoring (SRM) proteomics approach, targeting proteins suggested to play key roles in the bovine host response to mastitis. 17 biomarker candidates related to inflammatory response and mastitis were selected. The 17 candidate proteins were quantified......TIME RESOLVED BOVINE HOST RESPONSE TO VIRULENCE FACTORS, MAPPED IN MILK BY SELECTED REACTION MONITORING S.L. Bislev1, U. Kusebauch2, M.C. Codrea1, R. Moritz2, C.M. Røntved1, E. Bendixen1 1 Department of Animal Science, Faculty of Science and Technology, Aarhus University, Tjele, Denmark; 2...... Institute for Systems Biology, Seattle, Washington, USA Mastitis is beyond doubt the largest health problem in modern milk production. Many different pathogens can cause infections in the mammary gland, and give rise to severe toll on animal welfare, economic gain as well as on excessive use of antibiotics...

  15. Development of magnetic nanoparticle based calorimetric assay for the detection of bovine mastitis in cow milk.

    Science.gov (United States)

    Chinnappan, Raja; Al Attas, Sana; Kaman, Wendy E; Bikker, Floris J; Zourob, Mohammed

    2017-04-15

    Mastitis in dairy cattle is an inflammatory reaction of the udder tissue. Mastitis increases plasmin levels, leading to an increased proteolysis of milk proteins such as casein, resulting in a significant decrease in milk quality and related dairy products. Due to its key-role in mastitis, we used plasmin proteolytic activity as a biomarker for the detection of mastitis in bovine mastitic milk. Inspired by earlier studies on protease activity using mastitic milk samples, we developed a simple colorimetric assay to distinguish mastitic milk from milk derived from healthy animals. The plasmin substrate coupled to magnetic nanoparticles form a black self-assembled monolayer on a gold sensor surface. In the presence of increased levels of plasmin, the substrate is cleaved and the peptide fragment attached to the magnetic beads, will be attracted by the magnet which is present under the sensor strips revealing the golden surface. We found the area of the golden color surface proportional to plasmin activity. The sensitivity of this method was determined to be 1 ng/ml of plasmin in vitro. Next, we tested the biosensor using mastitis positive milk of which infection is confirmed by bacterial cultures. This newly developed colorimetric biosensor has high potential in applications for the diagnosis of mastitis with potential spin offs to health, food and environmental sectors. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. RESEARCHES REGARDING THE MICROBIOLOGIC PARAMETERS VALUE FROM RAW MILK USED IN TELEMEA CHEESE TECHNOLOGICAL PROCESS

    Directory of Open Access Journals (Sweden)

    ANDRA SULER

    2008-10-01

    Full Text Available An important faze for food quality control is verification of microbiological parameters of food products. In this way is assuring the prevention of alimentation toxicological infections to consumer, avoiding the technological and economical losses as well as increasing the products conservation period. In this paper are presents the microbiological exam results from raw milk used in Telemea cheese technological process, for 5 stations studied. The determinations were made on 2 series with 57 samples each of them, prelevated in reception fase, in summer and winter season.

  17. Evaluation of milk cathelicidin for detection of bovine mastitis.

    Science.gov (United States)

    Addis, M F; Tedde, V; Puggioni, G M G; Pisanu, S; Casula, A; Locatelli, C; Rota, N; Bronzo, V; Moroni, P; Uzzau, S

    2016-10-01

    Mastitis due to intramammary infection is one of the most economically relevant diseases in dairy cows, causing reductions in milk quality and quantity. Currently, mastitis monitoring is based on somatic cell count (SCC) and bacteriologic culture (BC) of milk. Nevertheless, inflammation-specific protein markers might provide more sensitive and reliable assays, enabling immunoassay-based screening strategies. Cathelicidin is an inflammatory protein released in milk that has recently demonstrated fair reliability and diagnostic potential for ewe mastitis. To assess its performance in cows, 531 quarter milk samples from 2 herds were tested using cathelicidin ELISA, SCC, and BC. We found that 29.0% of samples were positive for cathelicidin, 18.8% had SCC >200,000 cells/mL, and 13.7% were BC-positive. Cathelicidin showed a strong positive correlation with SCC as demonstrated by receiver operating characteristics curve analysis and by the clustering of cathelicidin-negative and cathelicidin-positive samples in association with low and high SCC values, respectively. For evaluating the diagnostic performance of a novel test, BC cannot be considered a reliable gold standard for true disease status because of its known limitations. Therefore, we assessed the sensitivity (Se) and specificity (Sp) of the milk cathelicidin ELISA using a latent class analysis approach together with BC and SCC by considering different diagnostic thresholds to identify the preferred Se/Sp combination. We modeled conditional dependence of cathelicidin and SCC to account for their close association. The cathelicidin ELISA showed higher Se than SCC and BC for almost all threshold combinations. In fact, at the best-performing threshold combination, the Se of cathelicidin was 80.6%, 6.2 percentage points higher than that of SCC >200,000 cells/mL (74.4%) and similar to that of SCC >100,000 cells/mL (80.2%). Most importantly, this Se was obtained with a loss in Sp of only 1.4 percentage points compared

  18. Effect of seasonal variation on the composition and properties of raw milk destined for processing in the UK.

    Science.gov (United States)

    Chen, Biye; Lewis, Michael J; Grandison, Alistair S

    2014-09-01

    The composition and physical properties of raw milk from a commercial herd were studied over a 1 year period in order to understand how best to utilise milk for processing throughout the year. Protein and fat levels demonstrated seasonal trends, while minerals and many physical properties displayed considerable variations, which were apparently unrelated to season. However, rennet clotting time, ethanol stability and foaming ability were subject to seasonal variation. Many significant interrelationships in physico-chemical properties were found. It is clear that the milk supply may be more suited to the manufacture of different products at different times of the year or even on a day to day basis. Subsequent studies will report on variation in production and quality of products manufactured from the same milk samples described in the current study and will thus highlight potential advantages of seasonal processing of raw milk. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Exposure assessment of dioxins and dioxin-like PCBs in pasteurised bovine milk using probabilistic modelling.

    Science.gov (United States)

    Adekunte, Adefunke O; Tiwari, Brijesh K; O'Donnell, Colm P

    2010-09-01

    Quantitative exposure assessment is a useful technique to investigate the risk from contaminants in the food chain. The objective of this study was to develop a probabilistic exposure assessment model for dioxins (PCDD/Fs) and dioxin-like PCBs (DL-PCBs) in pasteurised bovine milk. Mean dioxins and DL-PCBs (non-ortho and mono-ortho PCBs) concentrations (pg WHO-TEQ g(-1)) in bovine milk were estimated as 0.06 ± 0.07 pg WHO-TEQ g(-1) for dioxins and 0.08 ± 0.07 pg WHO-TEQ g(-1) for DL-PCBs using Monte Carlo simulation. The simulated model estimated mean exposure for dioxins was 0.19 ± 0.29 pg WHO-TEQ kg(-1)bw d(-1) and 0.14 ± 0.22 pg WHO-TEQ kg(-1) bw d(-1) and for DL-PCBs was 0.25 ± 0.30 pg WHO-TEQ kg(-1) bw d(-1) and 0.19 ± 0.22 pg WHO-TEQ kg(-1) bw d(-1) for men and women, respectively. This study showed that the mean dioxins and DL-PCBs exposure from consumption of pasteurised bovine milk is below the provisional maximum tolerable monthly intake of 70 pg TEQ kg(-1) bw month(-1) (equivalent of 2.3 pg TEQ kg(-1) bw d(-1)) recommended by the Joint FAO/WHO Expert Committee on Food Additives and Contaminants (JECFA). Results from this study also showed that the estimated dioxins and DL-PCBs concentration in pasteurised bovine milk is comparable to those reported in previous studies. Copyright © 2010 Elsevier Ltd. All rights reserved.

  20. A systematic review and meta-analysis of the effects of pasteurization on milk vitamins, and evidence for raw milk consumption and other health-related outcomes.

    Science.gov (United States)

    Macdonald, Lauren E; Brett, James; Kelton, David; Majowicz, Shannon E; Snedeker, Kate; Sargeant, Jan M

    2011-11-01

    Pasteurization of milk ensures safety for human consumption by reducing the number of viable pathogenic bacteria. Although the public health benefits of pasteurization are well established, pro-raw milk advocate organizations continue to promote raw milk as "nature's perfect food." Advocacy groups' claims include statements that pasteurization destroys important vitamins and that raw milk consumption can prevent and treat allergies, cancer, and lactose intolerance. A systematic review and meta-analysis was completed to summarize available evidence for these selected claims. Forty studies assessing the effects of pasteurization on vitamin levels were found. Qualitatively, vitamins B12 and E decreased following pasteurization, and vitamin A increased. Random effects meta-analysis revealed no significant effect of pasteurization on vitamin B6 concentrations (standardized mean difference [SMD], -2.66; 95% confidence interval [CI], -5.40, 0.8; P = 0.06) but a decrease in concentrations of vitamins B1 (SMD, -1.77; 95% CI, -2.57, -0.96; P pasteurization on milk's nutritive value was minimal because many of these vitamins are naturally found in relatively low levels. However, milk is an important dietary source of vitamin B2, and the impact of heat treatment should be further considered. Raw milk consumption may have a protective association with allergy development (six studies), although this relationship may be potentially confounded by other farming-related factors. Raw milk consumption was not associated with cancer (two studies) or lactose intolerance (one study). Overall, these findings should be interpreted with caution given the poor quality of reported methodology in many of the included studies.

  1. Influence of Homogenization and Thermal Processing on the Gastrointestinal Fate of Bovine Milk Fat: In Vitro Digestion Study.

    Science.gov (United States)

    Liang, Li; Qi, Ce; Wang, Xingguo; Jin, Qingzhe; McClements, David Julian

    2017-12-20

    Dairy lipids are an important source of energy and nutrients for infants and adults. The dimensions, aggregation state, and interfacial properties of fat globules in raw milk are changed by dairy processing operations, such as homogenization and thermal processing. These changes influence the behavior of fat globules within the human gastrointestinal tract (GIT). The gastrointestinal fate of raw milk, homogenized milk, high temperature short time (HTST) pasteurized milk, and ultrahigh temperature (UHT) pasteurized milk samples was therefore determined using a simulated GIT. The properties of particles in different regions of the GIT depended on the degree of milk processing. Homogenization increased the initial lipid digestion rate but did not influence the final digestion extent. Thermal processing of homogenized milk decreased the initial rate and final extent of lipid digestion, which was attributed to changes in interfacial structure. These results provide insights into the impact of dairy processing on the gastrointestinal fate of milk fat.

  2. Surveillance of bulk raw and commercially pasteurized cows' milk from approved Irish liquid-milk pasteurization plants to determine the incidence of Mycobacterium paratuberculosis.

    Science.gov (United States)

    O'Reilly, Ciara E; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R; Donaghy, John; Rowe, Michael; O'Mahony, Pat

    2004-09-01

    Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of 75 degrees C for 25 s. All analyses were undertaken at the Department of Food Science (Food Microbiology) laboratory at Queen's University Belfast. Each milk sample was subjected to two tests for M. paratuberculosis: immunomagnetic separation-PCR (IMS-PCR; to detect the presence of M. paratuberculosis cells, live or dead) and chemical decontamination and culture (to confirm the presence of viable M. paratuberculosis). Overall, M. paratuberculosis DNA was detected by IMS-PCR in 50 (12.9%; 95% confidence interval, 9.9 to 16.5%) raw-milk samples and 35 (9.8%; 95% confidence interval, 7.1 to 13.3%) pasteurized-milk samples. Confirmed M. paratuberculosis was cultured from one raw-milk sample and no pasteurized-milk samples. It is concluded that M. paratuberculosis DNA is occasionally present at low levels in both raw and commercially pasteurized cows' milk. However, since no viable M. paratuberculosis was isolated from commercially pasteurized cows' milk on retail sale in the Republic of Ireland, current pasteurization procedures are considered to be effective.

  3. Similar efficacy of human banked milk and bovine colostrum to decrease incidence of necrotizing enterocolitis in preterm piglets

    DEFF Research Database (Denmark)

    Jensen, Michael L.; Sangild, Per Torp; Lykke, Mikkel

    2013-01-01

    Preterm birth and formula feeding predispose to necrotizing enterocolitis (NEC) in infants. As mother's milk is often absent following preterm delivery, infant formula (IF) and human donor milk (HM) are frequently used as alternatives. We have previously shown that porcine and bovine colostrum (BC...

  4. Comparative evaluation of various solid phases for the development of coated tube assays for the estimation of progesterone in human serum, bovine serum and bovine milk

    International Nuclear Information System (INIS)

    Karir, Tarveen; Samuel, Grace; Sivaprasad, N.; Venkatesh, Meera

    2009-01-01

    Immobilization of progesterone antibody using three polystyrene surfaces and two progesterone radiotracers for use in the development of a coated tube assay for the evaluation of progesterone levels in human serum, bovine serum and bovine milk was studied. The selection of the solid phase and the tracers were based on the maximum binding, non-specific binding, sensitivity and percentage recovery. Amongst the polystyrene tubes studied, streptavidin coated tubes showed the acceptable assay features such as low non-specific binding (0.5-1.0%), adequate sensitivity (0.13-0.16 ng/ml) and recovery (85-115%) for all the three sample matrices, human serum, bovine serum and bovine milk.

  5. Fermentation characteristics and transit tolerance of probiotic Lactobacillus casei Zhang in soymilk and bovine milk during storage.

    Science.gov (United States)

    Wang, J; Guo, Z; Zhang, Q; Yan, L; Chen, W; Liu, X-M; Zhang, H-P

    2009-06-01

    Lactobacillus casei Zhang is a novel strain that was screened out of koumiss collected in Inner Mongolia, and our previous research showed that L. casei Zhang has health benefits such as cholesterol-reducing and immunomodulating effects. The fermentation characteristics of L. casei Zhang in soymilk and bovine milk and the transit tolerance of L. casei Zhang in fermented milk products during refrigerated storage for 28 d were assessed. A faster decrease in pH and faster growth of L. casei Zhang during fermentation were observed in soymilk compared with bovine milk at various inoculation rates, probably because of the low pH buffering capacity of soymilk. The fermented bovine milk samples had much higher final titratable acidity (TA) values (between 0.80 and 0.93%) than the soymilk samples (between 0.40 and 0.46%). Dramatic increases in TA values in the fermented soymilk samples during storage were observed, and the TA values of the fermented soymilk samples changed from survival rates of freshly prepared cultures of L. casei Zhang in simulated gastric juice at pH 2.0 and 2.5 were 31 and 69%, respectively, and the delivery of L. casei Zhang through fermented soymilk and bovine milk significantly improved the viability of L. casei Zhang in simulated gastric transit. Lactobacillus casei Zhang showed good tolerance to simulated gastric juice and intestinal juice in the fermented soymilk and bovine milk samples, and maintained high viability (>10(8) cfu/g) during storage at 4 degrees C for 28 d. Our results indicated that both soymilk and bovine milk could serve as vehicles for delivery of probiotic L. casei Zhang, and further research is needed to elucidate the mechanism of the change in pH and TA of L. casei Zhang in fermented milk samples during fermentation and storage and to understand the difference between soy- and milk-based systems.

  6. Behavior of Arcobacter butzleri and Arcobacter cryaerophilus in ultrahigh-temperature, pasteurized, and raw cow's milk under different temperature conditions.

    Science.gov (United States)

    Giacometti, Federica; Serraino, Andrea; Pasquali, Frederique; De Cesare, Alessandra; Bonerba, Elisabetta; Rosmini, Roberto

    2014-01-01

    The growth and survival of Arcobacter butzleri and Arcobacter cryaerophilus in milk were investigated at different storage temperatures. Three strains of each Arcobacter species were inoculated into ultrahigh-temperature (UHT), pasteurized, and raw cow's milk and stored at 4, 10, and 20°C for 6 days. The survival of Arcobacter spp. during storage was evaluated by a culture method. Results clearly showed that A. butzleri and A. cryaerophilus remained viable in milk when stored at 4°C and 10°C for a period of 6 days. When UHT and pasteurized milk were stored at 20°C, the A. butzleri count increased, with a longer lag-phase in pasteurized milk, whereas the A. cryaerophilus count increased in the first 48 h and then rapidly decreased to below the detection limit on the sixth storage day. When raw milk was stored at 20°C, the A. butzleri and A. cryaerophilus counts decreased from the first day of storage and no viable bacteria were recovered on the last day of storage. Generally, A. butzleri displayed a significantly better growth and survival capacity than A. cryaerophilus in milk. The present study is the first to assess the survival and/or growth of A. butzleri and A. cryaerophilus in milk. The evidence suggests that in case of primary contamination of milk or secondary contamination due to postprocessing contamination, milk can act as a potential source of Arcobacter infection in humans and could have public health implications, especially for raw milk consumption.

  7. Occurrence and characterization of Shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh.

    Science.gov (United States)

    Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A

    2010-11-01

    The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.

  8. [Instinct therapy--raw food with meat with exclusion of milk products. Report No. 16].

    Science.gov (United States)

    Jallut, O

    1989-06-13

    Instinct therapy is a diet consisting exclusively of food in its natural form, which has not been subjected to cooking, preserving or seasoning. Dairy products are forbidden. Indications are numerous and rather imprecise including especially cancer. Burger developed Instinct therapy in 1964 as a diet according to his own philosophy. 1980 he left Switzerland because the practice of "metasexuality" had caused him problems with the law. He founded a school of Instinct therapy in 1982 in France and published his book "La guerre du cru" (The Raw Food Fight) in 1985. In Switzerland, Besuchet took on the teaching of Burger in 1978 and was very active in giving lectures. He died in June 1985 of mediastinal cancer. According to Burger, man originally ate raw food and his instinct has not evolved since those pre-historic times, but has been "artificially modified" by cooked food and the consumption of non-human milk. If man could re-develop his natural instinct and eat only fresh food, which is not prepared in any way, he could solve his health problems and restore defenses against diseases such that these could become beneficial. Cooked food, milk and cereals are thought to be the cause of cancer but instinctive eating would help to avoid or to cure cancer. No preclinical or clinical trials have been carried out. The theories of Burger and Besuchet are based on unverifiable personal experiences.

  9. Quantitative assessment of Lactococcus lactis subsp. cremoris present in artisanal raw cow’s milk cheese

    Directory of Open Access Journals (Sweden)

    Milena Alicja Stachelska

    2018-01-01

    Full Text Available Lactococcus lactis subsp. cremoris belongs to lactic acid bacteria that play a crucial role in cheese production and it is known to be beneficial to human health. The aim of the study was to establish a rapid and accurate quantitative real-time polymerase chain reaction (qPCR method to detect and enumerate L. lactis subsp. cremoris in artisanal raw cow’s milk cheese. Artisanal raw cow’s milk cheese samples were used to check for presence and number of L. lactis subsp. cremoris strains. The method applies a set of target-specific PCR (polymerase chain reaction primers and a fluorogenic probe, and amplifies a part of the LACR_RS01280 gene that encodes the aminoacetone oxidase family flavin adenine dinucleotide (FAD binding enzyme. All 5 L. lactis subsp. cremoris strains examined were found to be qPCR positive. There was no signal recorded for 8 strains which belong to closely related species. The limit of detection amounted to ten copies per reaction and the assay indicated a linear dynamic range of seven logs. This method may be applied in detection and enumeration of L. lactis subsp. cremoris in cheese during its ripening. Moreover, it may be applied to examine the distribution of L. lactis subsp. cremoris during the cheese production and ripening.

  10. Electrophoretic and immunological properties of folate-binding protein isolated from bovine milk

    International Nuclear Information System (INIS)

    Iwai, Kazuo; Tani, Masako; Fushiki, Tohru

    1983-01-01

    Changes of the folate-binding protein (FBP) concentration in bovine milk after parturition were investigated. The FBP was highly purified from mature milk by affinity chromatography. The purified FBP showed a single protein band in polyacrylamide gel electrophoresis and was immunologically homogenous in double immunodiffusion. However, in two-dimensional gel electrophoresis, the FBP was separated into several spots in isoelectric focusing in the first dimension, and each spot also showed two molecular weights in SDS-gel electrophoresis in the second dimension. But these FBP molecules were immunologically identical with each other. The neuraminidase treatment obviously diminished the number of isoelectric points of the FBP. Thus, the variety of FBP molecules was at least partially due to the variability of the sialic acid content in the carbohydrate moieties. Moreover, the milk FBP showed species-specificity among mammals immunologically as well as physicochemically. (author)

  11. A Study on the Occurrence of Aflatoxin M1 in Raw and Pasteurized Milk Produced in Rafsanjan, Iran

    Directory of Open Access Journals (Sweden)

    FaAkrami Mohajeri Akrami Mohajeri

    2015-12-01

    Full Text Available Introduction: Aflatoxins, known as causative factors of hepatic and extra-hepatic carcinogenesis within humans, are extremely teratogenic, mutagenic, toxic, and carcinogenic compounds. Materials & Methods: This study was undertaken to determine the occurrence of aflatoxin M1 (AFM1 in 40 raw milk and 47 pasteurized milk samples collected during spring and winter. In order to analyze the samples, the Enzyme-linked Immunosorbent Assay (ELISA procedure was used. The statistical methods used in this study were based on normal confidence intervals and analysis of variance (ANOVA. Results: Aflatoxin M1 was detected in 97.5% of the raw milk ranging from 6.52 to 68.17 ng/l and 95.7% of the pasteurized milk, ranging from 0.8 to 58.13 ng/l. Toxin levels in 10% of the raw milk and 2.1% of the pasteurized milk samples exceeded the Iranian national standard limit i.e. 50 ng/l.  Due to seasonal variations, mean concentration of AFM1 in the samples collected in winter was significantly (P < 0.03 higher than those collected in the summer. Conclusion: Large amount of AFM1 in milk samples might be a potential hazard for the public health. Reducing the levels of AFB1 in animal feedstuffs can be regarded as the initial step to control the transfer of AFM1 to humans.

  12. Important vectors for Listeria monocytogenes transmission at farm dairies manufacturing fresh sheep and goat cheese from raw milk.

    Science.gov (United States)

    Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin

    2011-06-01

    The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.

  13. The inhibitory effect of sodium thiocyanate and sodium percarbonate ratios on microorganism growth in raw milk samples as an effective treatment to extend milk quality during storage

    Directory of Open Access Journals (Sweden)

    Supreena Srisaikham

    2017-02-01

    Full Text Available Preservation of raw milk quality by activation of lactoperoxidase system (LPs was studied for the inhibition of microorganism growth. The antimicrobial effects of LPs were examined by measuring thiocyanate (SCN- concentration, lactoperoxidase (LP activity, milk composition, total bacterial count (TBC and coliform count (CC. All parameters were analyzed at 0 h and at 25°C and 30°C as a control. Thus, the experiment was conducted to evaluate the effect of 2 different temperatures (25°C vs 30°C and 4 ratios of NaSCN:2Na2CO3 3H2O2 (0:0, 7:15, 14:30 and 21:45 mg/L on milk samples (both uninoculated raw milk samples and Escherichia coli (E. coli inoculated milk samples with 8 replicates per run using 0-12 h incubation time in vitro assay. The runs were conducted on the same 4 NaSCN:2Na2CO3 3H2O2 ratios and different temperature and time of incubation were used. The results showed that the milk SCN- concentration and LP activity increased with increasing NaSCN:2Na2CO3 3H2O2 ratios. Milk compositions retained the quality of normal milk fat, protein, lactose, solid-not-fat (SNF and total solid (TS contents, and they were not significantly affected by the LPs activation. An obvious effect of the LP activated milk was the inhibition of TBC in uninoculated raw milk samples for 6 to 12 h both at 25°C and 30°C, and for 6 to 9 h in E. coil inoculated milk samples, whereas CC (6 h at 25°C and at least 3 h at 30°C for both uninoculated and E. coil inoculated milk samples. It is concluded that improved preservation of milk can be achieved through the addition of 14:30 and 21:45 mg/L of NaSCN:2Na2CO3 3H2O2 in uninoculated and E. coil inoculated milk samples respectively, to extend milk quality during storage.

  14. Calcium availability in bovine milk with treatment with gamma rays

    International Nuclear Information System (INIS)

    Leonardi, Ana Lucia; Canniatti-Brazaca, Solange Guidolin

    2011-01-01

    Milk is an important food because it is rich in calcium and proteins. The objective of this research was to evaluate the effect of gamma radiation from 60 Co on the calcium availability and sensorial aspects. The milk samples were packed in bags similar to those used for commercial products. The samples were submitted to gamma radiation at doses of 0.1, 0.5, 1.0, 2.0 and 3.0 kGy and stored at 4 deg C with evaluations on the 1st, 4th, 7th, and 10th days of storage. The calcium amount and centesimal composition were evaluated at the beginning of the study. Calcium dialysis in vitro was performed at different times of storage. Sensorial analysis was conducted on two doses with a more stable pH under the lowest radiation dose and the second lowest radiation dose, 0.5 and 1.0 kGy, respectively. Data analysis was conducted using the Tukey test (5%). Physicochemical analysis showed an increase in calcium availability, and the most adequate dose found was 1 kGy due to its highest pH stability in the period of 10 days, but the sensorial analysis showed that the samples were not well accepted by the testers. (author)

  15. Rate of inactivation of cytomegalovirus in raw banked milk during storage at -20 degrees C and pasteurisation

    DEFF Research Database (Denmark)

    Friis, Henrik; Andersen, H K

    1982-01-01

    Samples of milk from 23 mothers attending the department of obstetrics and gynaecology and 36 who donated milk to the department's milk bank were cultured for cytomegalovirus. Virus was isolated from samples from 12 of the milk donors but none of the mothers attending the department; follow......-up studies during lactation in seven of these 12 women showed that five continued to excrete the virus. Samples were taken on three occasions from one woman who regularly excreted high titres of the virus. Storage at -20 degrees C for over three days reduced the titre by over 99%; after pasteurisation at 63...... degrees C for eight minutes the milk did not contain any viable virus. It is recommended that raw banked milk used for feeding preterm babies should be kept frozen for at least 72 hours before feeding....

  16. Surveillance of Bulk Raw and Commercially Pasteurized Cows' Milk from Approved Irish Liquid-Milk Pasteurization Plants To Determine the Incidence of Mycobacterium paratuberculosis

    OpenAIRE

    O'Reilly, Ciara E.; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R.; Donaghy, John; Rowe, Michael; O'Mahony, Pat

    2004-01-01

    Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of ...

  17. The use of the Fourier Transform Infrared spectroscopy to determine adulterants in raw milk

    Directory of Open Access Journals (Sweden)

    Laerte Dagher Cassoli

    2011-11-01

    Full Text Available The objective of this study was to develop calibrations to determine the concentration of some milk adulterants by using the automated methodology of Fourier Transform Infrared (FTIR. For construction of calibrations, samples were collected from 100 farms in the states of São Paulo and Minas Gerais. Samples were tainted with three different adulterants commonly used in the adulteration of raw milk: sodium bicarbonate (SB, sodium citrate (SC and cheese whey (W. Each adulterant was used at three different concentrations (SB: 0.05, 0.10 and 0.25%; SC: 0.025, 0.050 and 0.075% and W: 5, 10 and 20%. For validation, 60 samples were collected in other farms, which were not considered at the development stage of calibration. Adulterants were added at the following concentrations: 0.03, 0.06, 0.10 and 0.12% for SB; 0.02, 0.04, 0.06 and 0.08% for SC and 5, 10 and 20% for W. Performance of each calibration was evaluated in terms of accuracy (Se, detection limit (DL and determination coefficient (R². All calibrations presented R² higher than 0.91 with DL of 0.015%; 0.017% and 3.9% for SB, SC and W, respectively. Accuracy was 0.005%, 0.009% and 2.26% for SB, SC and W, respectively. Results show that the FTIR methodology can be used for determining the concentration of sodium bicarbonate, sodium citrate and whey in raw milk. Associated with automated equipment, it is a viable option for monitoring these adulterants, having low operational costs and high analytical performance as additional features.

  18. Antibiotic resistance in bacteria Staphylococcus spp. isolated from samples of raw sheep's milk

    Directory of Open Access Journals (Sweden)

    Milan Vasiľ

    2016-12-01

    Full Text Available From samples of raw sheep's milk were determined results of bacteriological examination from two herds in region of Eastern Slovakia in three years lasting study. The occurrence of Staphylococcus spp. 41.6% (124 was determined from 298 samples. The seven species of staphylococci were on a regular basis isolated: S. epidermidis (34, S. chromogenes (26, S. aureus (16. Alternately have been recorded S. warneri (16, S. schleiferi (15, S. haemolyticus (9 and S. xylosus (8. All isolated pathogens were tested by in vitro test on Mueller-Hinton agar by disc methods on resistance to 10 types of antibiotics.  Highest value of resistance was determined to Penicilin 21.0%, Neomycin 10.5% and Novobiocin 9.7%. Lower resistance was in to Oxacilin 7.2% and Amoxicilin 6.5%. Minimal resistance was founded to Cefoxitin 0.8%, Linkomycin 2.4%, Erytromycin, and Streptomycin 3.2%. Was founded total resistance (21.0% to all antibiotics in S. epidermidis (34 during the three years, S. chromogenes (26 showed resistance to 8 types of antibiotics (12.9%, S. aureus (16 to 6 antibiotics (10.5% and S. warneri (16 to 4 antibiotics (5.6%. It was confirmed that sheep's milk remains a major source of staphylococci. Bacteria in comparison with isolates from cows' raw milk, showed lower values of resistance, but were resistant to more than two antibiotics. Recorded occurrence of resistance in staphylococci may be connected with a minimum use of antibiotics in the treatment of mastitis and other diseases in sheep herds. Reported resistance to the tested antibiotics became the basis for the recommendation to use preparations to treat mastitis in sheep principally by the detection of resistance to antibiotics contained.

  19. Prevalence and Antimicrobial Resistance of Campylobacter Isolated from Dressed Beef Carcasses and Raw Milk in Tanzania.

    Science.gov (United States)

    Kashoma, Isaac P; Kassem, Issmat I; John, Julius; Kessy, Beda M; Gebreyes, Wondwossen; Kazwala, Rudovick R; Rajashekara, Gireesh

    2016-01-01

    Campylobacter species are commonly transmitted to humans through consumption of contaminated foods such as milk and meat. The aim of this study was to investigate the prevalence, antimicrobial resistance, and genetic determinants of resistance of Campylobacter isolated from raw milk and beef carcasses in Tanzania. The antimicrobial resistance genes tested included blaOXA-61 (ampicillin), aph-3-1 (aminoglycoside), tet(O) (tetracycline), and cmeB (multi-drug efflux pump). The prevalence of Campylobacter was 9.5% in beef carcasses and 13.4% in raw milk, respectively. Using multiplex-polymerase chain reaction (PCR), we identified 58.1% of the isolates as Campylobacter jejuni, 30.7% as Campylobacter coli, and 9.7% as other Campylobacter spp. One isolate (1.6%) was positive for both C. jejuni and C. coli specific PCR. Antimicrobial susceptibility testing using the disk diffusion assay and the broth microdilution method showed resistance to: ampicillin (63% and 94.1%), ciprofloxacin (9.3% and 11.8%), erythromycin (53.7% and 70.6%), gentamicin (0% and 15.7%), streptomycin (35.2% and 84.3%), and tetracycline (18.5% and 17.7%), respectively. Resistance to azithromycin (42.6%), nalidixic acid (64.8%), and chloramphenicol (13%) was determined using the disk diffusion assay only, while resistance to tylosin (90.2%) was quantified using the broth microdilution method. The blaOXA-61 (52.6% and 28.1%), cmeB (26.3% and 31.3%), tet(O) (26.3% and 31.3%), and aph-3-1 (5.3% and 3.0%) were detected in C. coli and C. jejuni. These findings highlight the extent of antimicrobial resistance in Campylobacter occurring in important foods in Tanzania. The potential risks to consumers emphasize the need for adequate control approaches, including the prudent use of antimicrobials to minimize the spread of antimicrobial-resistant Campylobacter.

  20. Evaluation of raw milk quality in different production systems and periods of the year

    Directory of Open Access Journals (Sweden)

    Marcos Inácio Marcondes

    2014-12-01

    Full Text Available The objective of this study was to evaluate the quality of raw milk in different production systems and its variation throughout the year. The data were collected from 943 dairy farms in the South, Central-West and Central regions of the state of Minas Gerais, and in Vale do Paraíba, in the state of São Paulo, Brazil. The data were collected in the period from January 2009 to September 2011, in a total of 18,206 samples. The properties were divided into confinement, semi-confinement and extensive production systems. The evaluated factors were somatic cell count (SCC, total bacterial count (TBC and protein and fat contents. There was no effect of production system on the contents of protein, fat and SCC. Total bacterial count, however, was affected by production. Seasonal variations were found for SCC, TBC, protein and fat; the highest protein values were found from March to June; the highest fat contents were obtained from May to August; and TBC and SCC, from December to March. The production system does not interfere with the percentage of fat and protein and SCC of the milk. However, confinement systems present a better TBC content. Both month and year are factors that interfere with TBC, SCC, protein and milk fat, and the best patterns are found in the coldest periods of the year.

  1. Quantitative Determination of Ivermectin in Raw Milk Using Positive ESI LC-MS/MS

    Directory of Open Access Journals (Sweden)

    Meenakshi Dahiya

    2010-01-01

    Full Text Available Ivermectin, a veterinary drug, is commonly used endectocide for animal husbandry. The drug is available in the form of subcutaneous or topical formulations. Its application may cause accumulation of its residues into the animal tissues, which ultimately find their way into the food products, such as milk and meat products. In order to determine the residues of ivermectin in milk, a comparatively simple, sensitive and rapid method was developed and validated using LC-MS/MS. The MRM transitions corresponding to m/z 892.71>569.6, 892.71>551.5 and 892.71>307.3 were used for the purpose of quantification and evaluation of other parameters of the method. The limit of detection of the method was found to be 0.1 μg/kg and the limit of quantitation was calculated as 0.2 μg/kg. The method was found to be linear in the range of 1.0 ng/mL to 100.0 ng/mL with correlation coefficient of 0.9992 for pure calibration curve and 0.9990 for the matrix- matched calibration curve. The recoveries of ivermectin from the spiked samples of raw milk were found between 85 to 105%.

  2. Incidence of Nocardia species in raw milk collected from different localities of Assiut City of Egypt

    Directory of Open Access Journals (Sweden)

    Nahed Mohamad Wahba

    2011-10-01

    Full Text Available This study aimed to isolate and enumerate Nocardiae from the examined raw milk samples. 240 random milk samples were collected from cows, buffaloes, sheep and goats from different localities in Assiut city- Egypt. The incidences of Nocardia spp. were 47.8, 43.3, 53.3 and 66.7% with average counts of 3.8 x104, 4.5x104, 1.4x104 and 7.6x103/CFUmL of the examined samples, respectively. Pathogenicity of the isolates was also studied. N. otitidiscavarium and N. brasiliensis caused sudden death of rats while, N. farcinica and N. carnea strains were non pathogenic. Other species caused several lesions. It was concluded from the study that, Nocardia species are existed in retailed and fresh milk of different farm animals. Most of the isolated strains were highly pathogenic to rats. Consequently, preventive measures should be taken to protect consumers from being infected. [Vet. World 2011; 4(5.000: 201-204

  3. Cryo-transmission electron tomography of native casein micelles from bovine milk

    Science.gov (United States)

    Trejo, R.; Dokland, T.; Jurat-Fuentes, J.; Harte, F.

    2013-01-01

    Caseins are the principal protein components in milk and an important ingredient in the food industry. In liquid milk, caseins are found as micelles of casein proteins and colloidal calcium nanoclusters. Casein micelles were isolated from raw skim milk by size exclusion chromatography and suspended in milk protein-free serum produced by ultrafiltration (molecular weight cut-off of 3 kDa) of raw skim milk. The micelles were imaged by cryo-electron microscopy and subjected to tomographic reconstruction methods to visualize the 3-dimensional and internal organization of native casein micelles. This provided new insights into the internal architecture of the casein micelle that had not been apparent from prior cryo-transmission electron microscopy studies. This analysis demonstrated the presence of water-filled cavities (~20 to 30 nm in diameter), channels (diameter greater than ~5 nm), and several hundred high-density nanoclusters (6 to 12 nm in diameter) within the interior of the micelles. No spherical protein submicellar structures were observed. PMID:22118067

  4. Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells.

    Science.gov (United States)

    Li, Ran; Dudemaine, Pier-Luc; Zhao, Xin; Lei, Chuzhao; Ibeagha-Awemu, Eveline Mengwi

    2016-01-01

    alternative non-invasive source of RNA in assessing miRNA activities in bovine mammary gland. Predicted target genes (1802) of 14 highly expressed miRNAs in milk fractions were enriched in fundamental cellular functions, infection, organ and tissue development. Furthermore, some miRNAs were highly enriched (FDR whey (3), cells (11) and mammary gland tissue (14) suggesting specific regulatory functions in the various fractions. In conclusion, we have obtained a comprehensive miRNA profile of the different milk fractions using high throughput sequencing. Our comparative analysis showed that miRNAs from milk fat accurately portrayed the miRNome of mammary gland tissue. Functional annotation of the top expressed miRNAs in milk confirmed their critical regulatory roles in mammary gland functions and potentially to milk recipients.

  5. Factors Influencing the Flavour of Bovine Milk and Cheese from Grass Based versus Non-Grass Based Milk Production Systems

    Science.gov (United States)

    Faulkner, Hope; Clarke, Holly J.; O’Sullivan, Maurice G.; Kerry, Joseph P.

    2018-01-01

    There has been a surge in interest in relation to differentiating dairy products derived from pasture versus confined systems. The impact of different forage types on the sensory properties of milk and cheese is complex due to the wide range of on farm and production factors that are potentially involved. The main effect of pasture diet on the sensory properties of bovine milk and cheese is increased yellow intensity correlated to β-carotene content, which is a possible biomarker for pasture derived dairy products. Pasture grazing also influences fat and fatty acid content which has been implicated with texture perception changes in milk and cheese and increased omega-3 fatty acids. Changes in polyunsaturated fatty acids in milk and cheese due to pasture diets has been suggested may increase susceptibility to lipid oxidation but does not seem to be an issue to due increased antioxidants and the reducing environment of cheese. It appears that pasture derived milk and cheese are easier to discern by trained panellists and consumers than milk derived from conserved or concentrate diets. However, milk pasteurization, inclusion of concentrate in pasture diets, cheese ripening time, have all been linked to reducing pasture dietary effects on sensory perception. Sensory evaluation studies of milk and cheese have, in general, found that untrained assessors who best represent consumers appear less able to discriminate sensory differences than trained assessors and that differences in visual and textural attributes are more likely to be realized than flavour attributes. This suggests that sensory differences due to diet are often subtle. Evidence supports the direct transfer of some volatiles via inhalation or ingestion but more so with indirect transfer post rumen metabolism dietary components. The impact of dietary volatiles on sensory perception of milk and dairy products obviously depends upon their concentration and odour activity, however very little quantitative

  6. Factors Influencing the Flavour of Bovine Milk and Cheese from Grass Based versus Non-Grass Based Milk Production Systems

    Directory of Open Access Journals (Sweden)

    Kieran N. Kilcawley

    2018-03-01

    Full Text Available There has been a surge in interest in relation to differentiating dairy products derived from pasture versus confined systems. The impact of different forage types on the sensory properties of milk and cheese is complex due to the wide range of on farm and production factors that are potentially involved. The main effect of pasture diet on the sensory properties of bovine milk and cheese is increased yellow intensity correlated to β-carotene content, which is a possible biomarker for pasture derived dairy products. Pasture grazing also influences fat and fatty acid content which has been implicated with texture perception changes in milk and cheese and increased omega-3 fatty acids. Changes in polyunsaturated fatty acids in milk and cheese due to pasture diets has been suggested may increase susceptibility to lipid oxidation but does not seem to be an issue to due increased antioxidants and the reducing environment of cheese. It appears that pasture derived milk and cheese are easier to discern by trained panellists and consumers than milk derived from conserved or concentrate diets. However, milk pasteurization, inclusion of concentrate in pasture diets, cheese ripening time, have all been linked to reducing pasture dietary effects on sensory perception. Sensory evaluation studies of milk and cheese have, in general, found that untrained assessors who best represent consumers appear less able to discriminate sensory differences than trained assessors and that differences in visual and textural attributes are more likely to be realized than flavour attributes. This suggests that sensory differences due to diet are often subtle. Evidence supports the direct transfer of some volatiles via inhalation or ingestion but more so with indirect transfer post rumen metabolism dietary components. The impact of dietary volatiles on sensory perception of milk and dairy products obviously depends upon their concentration and odour activity, however very

  7. Visible and near-infrared spectroscopic analysis of raw milk for cow health monitoring: reflectance or transmittance?

    Science.gov (United States)

    Aernouts, B; Polshin, E; Lammertyn, J; Saeys, W

    2011-11-01

    The composition of produced milk has great value for the dairy farmer. It determines the economic value of the milk and provides valuable information about the metabolism of the corresponding cow. Therefore, online measurement of milk components during milking 2 or more times per day would provide knowledge about the current health and nutritional status of each cow individually. This information provides a solid basis for optimizing cow management. The potential of visible and near-infrared (Vis/NIR) spectroscopy for predicting the fat, crude protein, lactose, and urea content of raw milk online during milking was, therefore, investigated in this study. Two measurement modes (reflectance and transmittance) and different wavelength ranges for Vis/NIR spectroscopy were evaluated and their ability to measure the milk composition online was compared. The Vis/NIR reflectance measurements allowed for very accurate monitoring of the fat and crude protein content in raw milk (R(2)>0.95), but resulted in poor lactose predictions (R(2)milk samples gave accurate fat and crude protein predictions (R(2)>0.90) and useful lactose predictions (R(2)=0.88). Neither Vis/NIR reflectance nor transmittance spectroscopy lead to an acceptable prediction of the milk urea content. Transmittance spectroscopy can thus be used to predict the 3 major milk components, but with lower accuracy for fat and crude protein than the reflectance mode. Moreover, the small sample thickness (1mm) required for NIR transmittance measurement considerably complicates its online use. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  8. Proteome analysis of functionally differentiated bovine (Bos indicus) mammary epithelial cells isolated from milk

    KAUST Repository

    Janjanam, Jagadeesh

    2013-10-01

    Mammary gland is made up of a branching network of ducts that end in alveoli. Terminally differentiated mammary epithelial cells (MECs) constitute the innermost layer of aveoli. They are milk-secreting cuboidal cells that secrete milk proteins during lactation. Little is known about the expression profile of proteins in the metabolically active MECs during lactation or their functional role in the lactation process. In the present investigation, we have reported the proteome map of MECs in lactating cows using 2DE MALDI-TOF/TOF MS and 1D-Gel-LC-MS/MS. MECs were isolated from milk using immunomagnetic beads and confirmed by RT-PCR and Western blotting. The 1D-Gel-LC-MS/MS and 2DE-MS/MS based approaches led to identification of 431 and 134 proteins, respectively, with a total of 497 unique proteins. Proteins identified in this study were clustered into functional groups using bioinformatics tools. Pathway analysis of the identified proteins revealed 28 pathways (p < 0.05) providing evidence for involvement of various proteins in lactation function. This study further provides experimental evidence for the presence of many proteins that have been predicted in annotated bovine genome. The data generated further provide a set of bovine MEC-specific proteins that will help the researchers to understand the molecular events taking place during lactation. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Prevalence, characterization, and antimicrobial resistance of Yersinia species and Yersinia enterocolitica isolated from raw milk in farm bulk tanks.

    Science.gov (United States)

    Jamali, Hossein; Paydar, Mohammadjavad; Radmehr, Behrad; Ismail, Salmah

    2015-02-01

    The aims of this study were to investigate the prevalence and to characterize and determine the antibiotic resistance of Yersinia spp. isolates from raw milk. From September 2008 to August 2010, 446 raw milk samples were obtained from farm bulk milk tanks in Varamin, Iran. Yersinia spp. were detected in 29 (6.5%) samples, out of which 23 (79.3%), 5 (17.2%), and 1 (3.4%) were isolated from cow, sheep, and goat raw milk, respectively. The most common species isolated was Yersinia enterocolitica (65.5%), followed by Yersinia frederiksenii (31%), and Yersinia kristensenii (3.4%). Of the 19 Y. enterocolitica isolates, 14 (73.7%) were grouped into bioserotype 1A/O:9, 4 (21.1%) belonged to bioserotype 1B:O8, 1 (5.3%) belonged to bioserotype 4/O:3, and 1 isolate (biotype 1A) was not typable. All the isolates of biotypes 1B and 4harbored both the ystA and ail genes. However, all the isolates of biotype 1A were only positive for the ystB gene. The tested Yersinia spp. showed the highest percentages of resistance to tetracycline (48.3%), followed by ciprofloxacin and cephalothin (each 17.2%), ampicillin (13.8%), streptomycin (6.9%), and amoxicillin and nalidixic acid (each 3.4%). All of the tested isolates demonstrated significant sensitivity to gentamicin and chloramphenicol. Recovery of potentially pathogenic Y. enterocolitica from raw milk indicates high risks of yersiniosis associated with consumption of raw milk. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. Sanitary Quality of Raw Milk within the Commodity Subsector in Mbarara District and Kampala City in Uganda

    Directory of Open Access Journals (Sweden)

    N. Grillet

    2005-04-01

    Full Text Available The sanitary quality of raw milk is an important issue in Uganda for social, economical and health reasons. The present study carried out on the informal raw milk subsector of Uganda highlighted two main issues: (i poor hygiene conditions from the production location all the way to the consumer; (ii lack of an efficient preservation system to limit bacteria development during transportation to Kampala. The bacteria population reached very high levels close to 2 x 106 colony forming units per milliliter on the farm milk of Mbarara District in the southwestern region of the country, and these levels increased 150-fold during transportation to Kampala. The sector also includes rudimentary pasteurization units, where the overheated milk comes out bacteria-free. However, conservation over several days of the overheated milk makes this process potentially more dangerous than beneficial. Thus, the need for all the players of the sector to implement a strategy to improve milk quality can be two ways: (i by changing common practices to ensure better hygiene conditions; (ii by improving milk preserving through new methods such as cooling, small-scale pasteurization, or the use of the lactoperoxidase system. This study can help develop a technical and scientific basis to generate quality improvement actions in Uganda. But, whatever the strategy adopted by decision makers, it can only be implemented if all the stakeholders of the sector are involved.

  11. Status of food and raw milk supply and problem just after the reactor accident

    International Nuclear Information System (INIS)

    Hirakawa, Sachiko; Murakami, Kana; Yoshizawa, Nobuaki; Takizawa, Mari; Kawai, Masaki; Sato, Osamu; Takagi, Syunji; Nakamura, Takashi

    2014-01-01

    Iodine 131 was detected in the environment and the food such as vegetables, raw milk and tap water just after the reactor accident following the East Japan Great Earthquake occurred in March 11, 2011. This article investigated status of refuge of Fukushima residents, their dietary life and food distribution from March 11 to 31 just after the accident so as to reevaluate internal exposure dose with Iodine 131. Investigation results showed most of food taken by refugees was confirmed food stock or relief supplies outside from the disaster area and suggested food contaminated with Iodine 131 was not widely consumed and distributed due to limit to send designated vegetables, restriction of tap water intake, damaged distribution facilities and closing down of retail stores. Restriction of tap water intake was only applied partly, so this might cause internal exposure dose due to tap water. (T. Tanaka)

  12. Concerns about the microbiological quality of traditional raw milk cheeses: a worldwide issue

    Directory of Open Access Journals (Sweden)

    Erica Tirloni

    2014-11-01

    Full Text Available Six types of unripened raw milk fresh (Robiola, Crescenza, Primo sale and Formaggella and  “pasta filata” cheeses (Mozzarella and Burrata were evaluated for microbiological parameters. No Listeria monocytogenes or Salmonella spp. were detected, but high microbial counts were revealed. Significantly higher Total Viable Counts (TVC and Enterobacteriaceae counts were observed in “fresh cheese” than in “pasta filata” samples. Values > 6 Log CFU/g were found in 81.3% of fresh vs 50% in pasta filata for TVC and 65.6% vs 12.5% for Enterobacteriaceae, respectively. An evident contamination by Escherichia coli, Coagulase-positive Staphylococci and Pseudomonas spp. was detected in all the cheeses: the causes could be the improper hygiene of the artisanal production practices and the permanence of the cheeses on the refrigerated shelves. A careful attention to the respect of the good manufacturing practices is suggested to avoid the presence of initial high bacterial loads.

  13. Determination of total bacterial count in raw milk by flow cytometry

    Directory of Open Access Journals (Sweden)

    Dubravka Samaržija

    2004-01-01

    Full Text Available The automatic flow cytometry as routine method for total bacterial count determination of raw ex-farm milk has recently been accepted in Croatia. This method significantly differs from the reference method (Standard Plate Count mostly in the presentation of the results obtained. Therefore, this paper summarized experiences in the application of flow cytometry in the dairy laboratories practice. The principle and the practice of the method, methodological details and factors influencing the results were described. In order to avoid problems regarding the interpretation of the results, which aregeneral problems of the quantitative microbiology, this article try to explain an appropriate conversion of the results with regards to SPC/ml, as an official method for the bacteriological quality proposal by the national legislation.

  14. Invited review: Microbial evolution in raw-milk, long-ripened cheeses produced using undefined natural whey starters.

    Science.gov (United States)

    Gatti, Monica; Bottari, Benedetta; Lazzi, Camilla; Neviani, Erasmo; Mucchetti, Germano

    2014-02-01

    The robustness of the starter culture during cheese fermentation is enhanced by the presence of a rich consortium of microbes. Natural starters are consortia of microbes undoubtedly richer than selected starters. Among natural starters, natural whey starters (NWS) are the most common cultures currently used to produce different varieties of cheeses. Undefined NWS are typically used for Italian cooked, long-ripened, extra-hard, raw milk cheeses, such as Parmigiano Reggiano and Grana Padano. Together with raw milk microbiota, NWS are responsible for most cheese characteristics. The microbial ecology of these 2 cheese varieties is based on a complex interaction among starter lactic acid bacteria (SLAB) and nonstarter lactic acid bacteria (NSLAB), which are characterized by their different abilities to grow in a changing substrate. This review aims to summarize the latest findings on Parmigiano Reggiano and Grana Padano to better understand the dynamics of SLAB, which mainly arise from NWS, and NSLAB, which mainly arise from raw milk, and their possible role in determining the characteristics of these cheeses. The review is presented in 4 main sections. The first summarizes the main microbiological and chemical properties of the ripened cheese as determined by cheese-making process variables, as these variables may affect microbial growth. The second describes the microbiota of raw milk as affected by specific milk treatments, from milking to the filling of the cheese milk vat. The third describes the microbiota of NWS, and the fourth reviews the knowledge available on microbial dynamics from curd to ripened cheese. As the dynamics and functionality of complex undefined NWS is one of the most important areas of focus in current food microbiology research, this review may serve as a good starting point for implementing future studies on microbial diversity and functionality of undefined cheese starter cultures. Copyright © 2014 American Dairy Science Association

  15. Effective heat inactivation of Mycobacterium avium subsp. paratuberculosis in raw milk contaminated with naturally infected feces.

    Science.gov (United States)

    Rademaker, Jan L W; Vissers, Marc M M; Te Giffel, Meike C

    2007-07-01

    The effectiveness of high-temperature, short holding time (HTST) pasteurization and homogenization with respect to inactivation of Mycobacterium avium subsp. paratuberculosis was evaluated quantitatively. This allowed a detailed determination of inactivation kinetics. High concentrations of feces from cows with clinical symptoms of Johne's disease were used to contaminate raw milk in order to realistically mimic possible incidents most closely. Final M. avium subsp. paratuberculosis concentrations varying from 10(2) to 3.5 x 10(5) cells per ml raw milk were used. Heat treatments including industrial HTST were simulated on a pilot scale with 22 different time-temperature combinations, including 60 to 90 degrees C at holding (mean residence) times of 6 to 15 s. Following 72 degrees C and a holding time of 6 s, 70 degrees C for 10 and 15 s, or under more stringent conditions, no viable M. avium subsp. paratuberculosis cells were recovered, resulting in >4.2- to >7.1-fold reductions, depending on the original inoculum concentrations. Inactivation kinetic modeling of 69 quantitative data points yielded an E(a) of 305,635 J/mol and an lnk(0) of 107.2, corresponding to a D value of 1.2 s at 72 degrees C and a Z value of 7.7 degrees C. Homogenization did not significantly affect the inactivation. The conclusion can be drawn that HTST pasteurization conditions equal to 15 s at > or =72 degrees C result in a more-than-sevenfold reduction of M. avium subsp. paratuberculosis.

  16. Effective Heat Inactivation of Mycobacterium avium subsp. paratuberculosis in Raw Milk Contaminated with Naturally Infected Feces▿

    Science.gov (United States)

    Rademaker, Jan L. W.; Vissers, Marc M. M.; te Giffel, Meike C.

    2007-01-01

    The effectiveness of high-temperature, short holding time (HTST) pasteurization and homogenization with respect to inactivation of Mycobacterium avium subsp. paratuberculosis was evaluated quantitatively. This allowed a detailed determination of inactivation kinetics. High concentrations of feces from cows with clinical symptoms of Johne's disease were used to contaminate raw milk in order to realistically mimic possible incidents most closely. Final M. avium subsp. paratuberculosis concentrations varying from 102 to 3.5 × 105 cells per ml raw milk were used. Heat treatments including industrial HTST were simulated on a pilot scale with 22 different time-temperature combinations, including 60 to 90°C at holding (mean residence) times of 6 to 15 s. Following 72°C and a holding time of 6 s, 70°C for 10 and 15 s, or under more stringent conditions, no viable M. avium subsp. paratuberculosis cells were recovered, resulting in >4.2- to >7.1-fold reductions, depending on the original inoculum concentrations. Inactivation kinetic modeling of 69 quantitative data points yielded an Ea of 305,635 J/mol and an lnk0 of 107.2, corresponding to a D value of 1.2 s at 72°C and a Z value of 7.7°C. Homogenization did not significantly affect the inactivation. The conclusion can be drawn that HTST pasteurization conditions equal to 15 s at ≥72°C result in a more-than-sevenfold reduction of M. avium subsp. paratuberculosis. PMID:17496131

  17. Occurrence of Staphylococcus aureus on Farms with Small Scale Production of Raw Milk Cheeses in Poland

    Directory of Open Access Journals (Sweden)

    Jolanta G. Rola

    2016-03-01

    Full Text Available This paper describes the results of a 3-year study on the prevalence, enterotoxinogenicity and resistance to antimicrobials of S. aureus isolated on dairy farms with small scale production of raw cow milk cheeses. The samples of raw milk, semi-finished products and the final products as well as swabs were collected between 2011 and 2013 from nine dairy farms in Poland. A total of 244 samples were examined, of which 122 (50.0% were contaminated with S. aureus including 18 of 26 (69.2% mature cheese samples with log10 CFU g−1 between <1- and 7.41. In swabs collected from the staff and production environment the highest contamination rate with coagulase positive staphylococci (CPS was detected on hands of cheese makers (4.34 log10 CFU/swab. None of the cheese samples contaminated with CPS contained staphylococcal enterotoxins (SEs. However, 55 of 122 (45.1% S. aureus isolates possessed SEs genes, mainly (26 of 55; 47.3% a combination of the sed, sej and ser genes. Furthermore, the sep (15 of 55; 27.3% as well as seg and sei (9 of 55; 16.4% genes were also identified. The remaining S. aureus isolates possessed the sea gene (one isolate, the combination of sec, seg and sei (three isolates as well as the sed, sej, sep and ser markers together (one CPS. Resistance to penicillin (62 of 122 isolates; 50.8% was the most common among the tested isolates. Some CPS were also resistant to chloramphenicol (7; 5.7% and tetracycline (5; 4.1%. The obtained results indicated that the analyzed cheeses were safe for consumers. To improve the microbiological quality of traditional cheese products more attention should be paid to animal welfare and hygiene practices during the process of cheese manufacturing in some dairy farms.

  18. Competitive advantage of bacteriocinogenic strains within lactic acid bacteria consortium of raw milk cheese

    Directory of Open Access Journals (Sweden)

    Irena Rogelj

    2011-03-01

    Full Text Available The presence of gene determinants for different bacteriocins has been already demonstrated in traditional Slovenian types of raw milk cheeses ‘Tolminc’ and ‘Kraški’. These genes were present also in the cultivable microbiota. In this research the aim was to establish how the presence of gene determinants for bacteriocins in microbial consortia is reflected in its antimicrobial activity. In addition, one of the goals was to determine whether the strains that carry gene determinants for bacteriocins have any competitive growth advantage in microbial population. Microbial consortium of ‘Tolminc’ cheese was propagated in milk and examined at the end of propagation its antimicrobial activity and the presence of gene determinants for bacteriocins. Comparison of the results obtained before and after propagation leaded to the conclusion that most of the strains possessing gene determinants for bacteriocins were unable to persist during propagation. The strains which did persist during propagation carried gene determinants for enterocins P, L50B and cytolysin. Antimicrobial activity of consortium before and after propagation was not substantially different and cannot be attributed to any of detected bacteriocins.

  19. Exploring causal networks of bovine milk fatty acids in a multivariate mixed model context

    DEFF Research Database (Denmark)

    Bouwman, Aniek C; Valente, Bruno D; Janss, Luc L G

    2014-01-01

    Knowledge regarding causal relationships among traits is important to understand complex biological systems. Structural equation models (SEM) can be used to quantify the causal relations between traits, which allow prediction of outcomes to interventions applied to such a network. Such models...... are fitted conditionally on a causal structure among traits, represented by a directed acyclic graph and an Inductive Causation (IC) algorithm can be used to search for causal structures. The aim of this study was to explore the space of causal structures involving bovine milk fatty acids and to select...

  20. Use of DNA from milk tank for diagnosis and typing of bovine leukaemia virus

    International Nuclear Information System (INIS)

    Felmer, R.; Zuniga, J.; Recabal, M.; Floody, H.

    2005-01-01

    With the aim of achieving a better understanding of the epidemiology of Bovine leukaemia virus (BLV) infection, we investigated the suitability of milk tank samples for effecting molecular epidemiology studies of BLV in a southern area of Chile. As part of a serological survey for BLV antibodies carried out in 280 herds, we selected 33 strong positive samples, from which DNA was isolated to perform a BLV-specific nested PCR. Using RFLP analysis, all 33 PCR products could be assigned to the known Australian or the Belgium subgroups. A phylogenetic tree resulting from the comparison of these sequences demonstrates the relations and differences among and within the subgroups. (author)

  1. Effects of somatic cell count in subclinical mastitis on raw milk quality in dairy farms of Khuzestan province

    Directory of Open Access Journals (Sweden)

    mohammad Hossieni nejad

    2016-01-01

    Full Text Available Mastitis is an infectious disease that is spread in livestock and can cause cattle mortality. Generally a cow with mastitis has a 15 per cent decrease in milk production. In addition, losses from changes in some components of milk should also be considered. Any change in milk properties can be severe hazard for milk producers, dairy factories and consumers. In this study, the effect of somatic cell count on row milk quality of cows affected by subclinical mastitis was studied. For this purpose 240 milk samples were collected from dairy farms with subclinical mastitis (traditional and industrial of Khuzestan province in 2014 and their somatic cell count, protein and lipid contact and acidity determined. The mean±SD for somatic cells, acidity, protein and fat were 3.20×105±1.37×105 SCC/ml, 14.50±0.62 D°, 3.12±0.06% and 3.23±0.14% respectively. After statistical analysis, reverse correlation were found between somatic cell count with milk fat and protein. However, direct correlation was observed between range of milk fat and protein (p>0.01. Furthermore the results indicated that the range of acidity in spring and winter, protein and fat in winter and somatic cell in summer and autumn were more than the other seasons. According to statistical analysis, protein percent of milk samples in industrial farms were higher than traditional farms although the range of somatic cells was higher for traditional milk samples ‏p>0.05 According to the result, it seems that the somatic cell count of milk influences raw milk fat and protein content and acidity.

  2. A comparison of the determination of the rennet coagulation properties of bovine milk

    Directory of Open Access Journals (Sweden)

    Roman Pytel

    2016-07-01

    Full Text Available The aim of the work was compared of two different methods (the visual method and the nephelo turbidimetry method for determination of rennet coagulation time. It was observed the effect of heat treatment of milk; types of rennet and addition of different amount of CaCl2 into the pasteurized milk. It was used two different chymosin rennet. For the visual method was milk sample (100 mL equilibrated at 35 °C, 1 mL of rennet was added into milk and was measured the time required for the first visible flakes (visual method. For the determination rennet coagulation time by nephelo-turbidimetry was removed part of milk with rennet and placed into nephelo-turbidimetry. Milk had a titratable acidity in the range from 6.5 to 7.0 °SH, average pH of milk was 6.68. Dry matter content was in range from 12.351 to 13.142%. The average content of protein by Kjeldahl was 3.14%, fat by Gerber 4.34%, lactose by polarimetry 4.68% and calcium content 1.1%. The pasteurized milk had the worst rennet coagulation time about 32 s compared to the raw milk. The difference coagulation time between milk with addition of 20 µL CaCl2 and 40 µL CaCl2 was in range 21 s to 26 s by visual method. The difference coagulation time between milk with addition of 20 µL CaCl2 and 40 µL CaCl2 was 15 s by nephelo-turbidimetry method. There occurred statistically non-significant differences in most of the measurements, comparing the visual and the nephelo-turbidimetric method. The heat treatment, addition of CaCl2 and using of different rennet had an influence on the curd category. It was obtained, that using nephelo-turbidimetry shown objective results for measuring the rennet coagulation time contrary the subjective visual method. Further, the results obtained by nephelo-turbidimetry are accurate and determined with the lower variation.

  3. [Determination of fat, protein and DM in raw milk by portable short-wave near infrared spectrometer].

    Science.gov (United States)

    Li, Xiao-yun; Wang, Jia-hua; Huang, Ya-wei; Han, Dong-hai

    2011-03-01

    Near infrared diffuse reflectance spectroscopy calibrations of fat, protein and DM in raw milk were studied with partial least-squares (PLS) regression using portable short-wave near infrared spectrometer. The results indicated that good calibrations of fat and DM were found, the correlation coefficients were all 0.98, the RMSEC were 0.187 and 0.217, RMSEP were 0.187 and 0.296, the RPDs were 5.02 and 3.20 respectively; the calibration of protein needed to be improved but can be used for practice, the correlation coefficient was 0.95, RMSEC was 0.105, RMSEP was 0.120, and RPD was 2.60. Furthermore, the measuring accuracy was improved by analyzing the correction relation of fat and DM in raw milk This study will probably provide a new on-site method for nondestructive and rapid measurement of milk.

  4. Analysis of the Storage Methods for Raw Human Milk from Mothers with Infants Admitted to a Neonatal Intensive Care Unit, According to Brazilian Regulations.

    Science.gov (United States)

    Grazziotin, Maria Celestina Bonzanini; Grazziotin, Ana Laura; Vidal, Newton Medeiros; Freire, Marcia Helena de Souza; da Silva, Regina Paula Guimarães Vieira Cavalcante

    2016-08-01

    Milk safety is an important concern in neonatal units and human milk banks. Therefore, evidence-based recommendations regarding raw milk handling and storage are needed to safely promote supplying hospitalized infants with their mother's own milk. To evaluate raw human milk storage methods according to Brazilian milk management regulations by investigating the effects of refrigeration (5°C) for 12 hours and freezing (-20°C) for 15 days on the acidity and energy content in a large number of raw milk samples. Expressed milk samples from 100 distinct donors were collected in glass bottles. Each sample was separated into 3 equal portions that were analyzed at room temperature and after either 12 hours of refrigeration or 15 days of freezing. Milk acidity and energy content were determined by Dornic titration and creamatocrit technique, respectively. All samples showed Dornic acidity values within the established acceptable limit (≤ 8°D), as required by Brazilian regulations. In addition, energy content did not significantly differ among fresh, refrigerated and frozen milk samples (median of ~50 kcal/100 mL for each). Most samples tested (> 80%) were considered top quality milk (milk energy content was preserved after storage. We conclude that the storage methods required by Brazilian regulations are suitable to ensure milk safety and energy content of stored milk when supplied to neonates. © The Author(s) 2016.

  5. Characterization of the indigenous microflora in raw and pasteurized buffalo milk during storage at refrigeration temperature by high-throughput sequencing.

    Science.gov (United States)

    Li, Ling; Renye, John A; Feng, Ling; Zeng, Qingkun; Tang, Yan; Huang, Li; Ren, Daxi; Yang, Pan

    2016-09-01

    The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High-quality samples of raw buffalo milk were obtained from 3 dairy farms in the Guangxi province in southern China. Five liters of each milk sample were pasteurized (72°C; 15 s); and both raw and pasteurized milks were stored at refrigeration temperature (1-4°C) for various times with their microbial communities characterized using the Illumina Miseq platform (Novogene, Beijing, China). Results showed that both raw and pasteurized milks contained a diverse microbial population and that the populations changed over time during storage. In raw buffalo milk, Lactococcus and Streptococcus dominated the population within the first 24h; however, when stored for up to 72h the dominant bacteria were members of the Pseudomonas and Acinetobacter genera, totaling more than 60% of the community. In pasteurized buffalo milk, the microbial population shifted from a Lactococcus-dominated community (7d), to one containing more than 84% Paenibacillus by 21d of storage. To increase the shelf-life of buffalo milk and its products, raw milk needs to be refrigerated immediately after milking and throughout transport, and should be monitored for the presence of Paenibacillus. Results from this study suggest pasteurization should be performed within 24h of raw milk collection, when the number of psychrotrophic bacteria are low; however, as Paenibacillus spores are resistant to pasteurization, additional antimicrobial treatments may be required to extend shelf-life. The findings from this study are expected to aid in improving the quality and safety of raw and pasteurized buffalo milk. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  6. Pathogenic bacteria and heavy metals toxicity assessments in evaluating unpasteurized raw milk quality through biochemical tests collected from dairy cows

    Directory of Open Access Journals (Sweden)

    Hamid Iqbal

    2016-11-01

    Full Text Available Objective: To evaluate the hygienic quality by determining the presence of predominant pathogenic microbial contaminants (contagious or environmental and indiscriminate heavy metals contained in unpasteurized milk samples collected from cattle specie of cow. Methods: Raw milk samples were collected in October, 2014 from different regions of District Kohat, Khyber Pakhtunkhwa, Pakistan and cultured on the selective media plates according to the manufacturer instructions to observe pathogenic microbial flora and confirm it with relevant biochemical tests to specify bacterial specie. Results: Milk samples analyzed on MacConkey and nutrient agar media were found contaminated mostly with coliform, Staphylococcus aureus, Enterobacter aerogenes and Proteus vulgaris. Similarly, result of the heavy metals analysis performed using atomic absorption spectrophotometer flame photometry showed that raw milk contains heavy metals residues of lead and cadmium contents at higher levels while copper, zinc and chromium were observed lower than permissible limits whereas manganese within specified recommended values. Conclusions: Microbial contamination of milk and toxic metals is mainly accredited to the scrupulous unhygienic measures during processing of milk exhibiting a wide array of hazardous impacts on human health.

  7. Specificity and Effector Functions of Human RSV-Specific IgG from Bovine Milk.

    Directory of Open Access Journals (Sweden)

    Gerco den Hartog

    Full Text Available Respiratory syncytial virus (RSV infection is the second most important cause of death in the first year of life, and early RSV infections are associated with the development of asthma. Breastfeeding and serum IgG have been shown to protect against RSV infection. Yet, many infants depend on bovine milk-based nutrition, which at present lacks intact immunoglobulins.To investigate whether IgG purified from bovine milk (bIgG can modulate immune responses against human RSV.ELISAs were performed to analyse binding of bIgG to human respiratory pathogens. bIgG or hRSV was coated to plates to assess dose-dependent binding of bIgG to human Fcγ receptors (FcγR or bIgG-mediated binding of myeloid cells to hRSV respectively. S. Epidermidis and RSV were used to test bIgG-mediated binding and internalisation of pathogens by myeloid cells. Finally, the ability of bIgG to neutralise infection of HEp2 cells by hRSV was evaluated.bIgG recognised human RSV, influenza haemagglutinin and Haemophilus influenza. bIgG bound to FcγRII on neutrophils, monocytes and macrophages, but not to FcγRI and FcγRIII, and could bind simultaneously to hRSV and human FcγRII on neutrophils. In addition, human neutrophils and dendritic cells internalised pathogens that were opsonised with bIgG. Finally, bIgG could prevent infection of HEp2 cells by hRSV.The data presented here show that bIgG binds to hRSV and other human respiratory pathogens and induces effector functions through binding to human FcγRII on phagocytes. Thus bovine IgG may contribute to immune protection against RSV.

  8. Specificity and Effector Functions of Human RSV-Specific IgG from Bovine Milk.

    Science.gov (United States)

    den Hartog, Gerco; Jacobino, Shamir; Bont, Louis; Cox, Linda; Ulfman, Laurien H; Leusen, Jeanette H W; van Neerven, R J Joost

    2014-01-01

    Respiratory syncytial virus (RSV) infection is the second most important cause of death in the first year of life, and early RSV infections are associated with the development of asthma. Breastfeeding and serum IgG have been shown to protect against RSV infection. Yet, many infants depend on bovine milk-based nutrition, which at present lacks intact immunoglobulins. To investigate whether IgG purified from bovine milk (bIgG) can modulate immune responses against human RSV. ELISAs were performed to analyse binding of bIgG to human respiratory pathogens. bIgG or hRSV was coated to plates to assess dose-dependent binding of bIgG to human Fcγ receptors (FcγR) or bIgG-mediated binding of myeloid cells to hRSV respectively. S. Epidermidis and RSV were used to test bIgG-mediated binding and internalisation of pathogens by myeloid cells. Finally, the ability of bIgG to neutralise infection of HEp2 cells by hRSV was evaluated. bIgG recognised human RSV, influenza haemagglutinin and Haemophilus influenza. bIgG bound to FcγRII on neutrophils, monocytes and macrophages, but not to FcγRI and FcγRIII, and could bind simultaneously to hRSV and human FcγRII on neutrophils. In addition, human neutrophils and dendritic cells internalised pathogens that were opsonised with bIgG. Finally, bIgG could prevent infection of HEp2 cells by hRSV. The data presented here show that bIgG binds to hRSV and other human respiratory pathogens and induces effector functions through binding to human FcγRII on phagocytes. Thus bovine IgG may contribute to immune protection against RSV.

  9. Evaluation of a multiplex immunoassay for bovine respiratory syncytial virus and bovine coronavirus antibodies in bulk tank milk against two indirect ELISAs using latent class analysis

    DEFF Research Database (Denmark)

    Toftaker, Ingrid; Toft, Nils; Stokstad, Maria

    2018-01-01

    Bovine respiratory syncytial virus (BRSV) and bovine coronavirus (BCV) are responsible for respiratory disease and diarrhea in cattle worldwide. The Norwegian control program against these infections is based on herd-level diagnosis using a new multiplex immunoassay. The objective of this study...... was to estimate sensitivity and specificity across different cut-off values for the MVD-Enferplex BCV/BRSV multiplex, by comparing them to a commercially available ELISA, the SVANOVIR® BCV-Ab and SVANOVIR® BRSV-Ab, respectively. We analyzed bulk tank milk samples from 360 herds in a low- and 360 herds in a high...

  10. Determination of the conjugated linoleic acid-containing triacylglycerols in New Zealand bovine milk fat.

    Science.gov (United States)

    Robinson, N P; MacGibbon, A K

    2000-07-01

    Reversed-phase high-performance liquid chromatography (HPLC) with ultraviolet (UV) detection at 233 nm was used to separate, quantify, and identify the triacylglycerols (TAG) of milk fat that contain conjugated linoleic acid (CLA). The absorbance at 233 nm was substantially due to CLA-TAG (chromatography of some representative TAG devoid of CLA, such as tripalmitin and triolein, showed poor responses at 233 nm, 1/800th that of CLA-TAG). A CLA molar extinction coefficient at 233 nm of 23,360 L mol(-1) cm(-1) and an HPLC UV response factor were obtained from a commercially available cis-9,trans-11-CLA standard. This molar extinction coefficient was only 86% of reported literature values. Summation of all chromatographic peaks absorbing at 233 nm using the corrected response factor gave good agreement with independent determinations of total CLA by gas chromatography and UV spectrophotometry. This agreement allowed quantification of individual CLA-TAG peaks in the HPLC separation of a typical New Zealand bovine milk fat. Three CLA-containing TAG, CLA-dipalmitin, CLA-oleoyl-palmitin and CLA-diolein, were prepared by interesterification of tripalmitin with the respective fatty acid methyl esters and used to assign individual peaks in the reversed-phase chromatography of total milk fat, of which CLA-oleoyl-palmitin was coincident with the largest UV peak. Band fractions from argentation thin-layer chromatography of total milk fat were similarly employed to identify five predominant CLA-TAG groups in total milk fat: CLA-disaturates, CLA-oleoyl-saturates, CLA-vaccenyl-saturates, CLA-vaccenyl-olein, and CLA-diolein.

  11. Verocytotoxin-producing Escherichia coli O26 in raw water buffalo (Bubalus bubalis) milk products in Italy.

    Science.gov (United States)

    Lorusso, Vanessa; Dambrosio, Angela; Quaglia, Nicoletta Cristiana; Parisi, Antonio; La Salandra, Giovanna; Lucifora, Giuseppe; Mula, Giuseppina; Virgilio, Sebastiano; Carosielli, Leonardo; Rella, Addolorata; Dario, Marco; Normanno, Giovanni

    2009-08-01

    Escherichia coli 026 is known as a verocytotoxin-producing E. coli (VTEC) organism that causes severe foodborne diseases such as hemorrhagic colitis and hemolytic uremic syndrome. Although cattle are the most important reservoir of VTEC, only a few reports on the role of water buffalo (Bubalus bubalis) as a reservoir of VTEC and on the presence of these organisms in their milk are available. However, in Southern Italy, where water buffalo are intensively reared, an outbreak of hemolytic uremic syndrome due to E. coli 026 has recently been reported, in which the consumption of typical dairy products was considered to be a common risk factor. The aims of this work were to assess the prevalence of E. coli O26 in raw water buffalo milk, to characterize the virulence gene profiles of the isolates, and to evaluate their phenotypic antimicrobial resistance pattern. Of 160 analyzed samples, 1 (0.6%) tested positive for E. coli O26, and the isolate showed the stx1+/stx2+/eae-/hlyA+ genotypic profile. The strain showed resistance against glycopeptides, macrolides, and penicillins. The presence of VTEC organisms in raw water buffalo milk could be considered to be a potential threat to consumers; however, the strict adherence to the processes used in the preparation of the most common buffalo dairy products could strongly mitigate the foodborne risk. To our knowledge, this article reports the first isolation and characterization of E. coli O26 VTEC in raw water buffalo milk.

  12. Evaluation of Antibiotic Residues in Pasteurized and Raw Milk Distributed in the South of Khorasan-e Razavi Province, Iran.

    Science.gov (United States)

    Moghadam, Mortez Mohammadzadeh; Amiri, Mostafa; Riabi, Hamed Ramezani Awal; Riabi, Hamid Ramezani Awal

    2016-12-01

    The presence of antibiotic residues in milk and other products livestock is a health problem which can endanger public health. Antibiotics are used widely in animal husbandry to treat diseases related to bacterial infections. Antimicrobial drugs have been in use for decades in industry. They are commonly used in livestock facilities to treat mastitis. This study aimed to investigate antibiotic residues in pasteurized milk distributed in schools, in milk collection centers, and in milk production factories in Gonabad city. This cross-sectional study was conducted on 251 samples of commercial pasteurized milk packet distributed in schools (code A), raw milk collection centers in Gonabad city (code B), and pasteurized milk production factories (code C) in Gonabad city. The Copan test kit of Denmark Christian Hansen Company was used to monitor antibiotic residues in milk. The data were analysed employing Chi-square test and one-way analysis of variance (ANOVA) to determine significant differences using SPSS software version 20. The significant level was considered at pmilk samples were collected out of which 143 (57%) were code A, 84 (33.5%) code B and 24 (9.6%) code C. Total number of 189 samples (75.2%) were negative and 62 (24.8%) were positive. From the three types of milk samples, 41 samples (28.7%) of the code A, 18 samples (21.4%) of the code B and 3 samples (12.5%) of the code C were positive. In general, from the milk samples most contaminated with antibiotics, 17 samples were positive in January and regarding code A, 13 samples were positive in the same month. There was not a significant difference among the three types of milk (p>0.05). The highest number of milk samples (n=7) contaminated with antibiotics were related to code B (38.5%). Most positive cases were related to code A in winter. Also, there was no significant difference among the three types of contaminated milk regarding the year and month (p=0.164 and p=0.917, respectively). Pasteurized milk

  13. Pseudomonas helleri sp. nov. and Pseudomonas weihenstephanensis sp. nov., isolated from raw cow's milk.

    Science.gov (United States)

    von Neubeck, M; Huptas, C; Glück, C; Krewinkel, M; Stoeckel, M; Stressler, T; Fischer, L; Hinrichs, J; Scherer, S; Wenning, M

    2016-03-01

    Analysis of the microbiota of raw cow's milk and semi-finished milk products yielded seven isolates assigned to the genus Pseudomonas that formed two individual groups in a phylogenetic analysis based on partial rpoD and 16S rRNA gene sequences. The two groups could be differentiated from each other and also from their closest relatives as well as from the type species Pseudomonas aeruginosa by phenotypic and chemotaxonomic characterization and average nucleotide identity (ANIb) values calculated from draft genome assemblies. ANIb values within the groups were higher than 97.3 %, whereas similarity values to the closest relatives were 85 % or less. The major cellular lipids of strains WS4917T and WS4993T were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol; the major quinone was Q-9 in both strains, with small amounts of Q-8 in strain WS4917T. The DNA G+C contents of strains WS4917T and WS4993T were 58.08 and 57.30 mol%, respectively. Based on these data, strains WS4917T, WS4995 ( = DSM 29141 = LMG 28434), WS4999, WS5001 and WS5002 should be considered as representatives of a novel species of the genus Pseudomonas, for which the name Pseudomonas helleri sp. nov. is proposed. The type strain of Pseudomonas helleri is strain WS4917T ( = DSM 29165T = LMG 28433T). Strains WS4993T and WS4994 ( = DSM 29140 = LMG 28438) should be recognized as representing a second novel species of the genus Pseudomonas, for which the name Pseudomonas weihenstephanensis sp. nov. is proposed. The type strain of Pseudomonas weihenstephanensis is strain WS4993T ( = DSM 29166T = LMG 28437T).

  14. Association of metabolic acidosis with bovine milk-based human milk fortifiers.

    Science.gov (United States)

    Cibulskis, C C; Armbrecht, E S

    2015-02-01

    To compare the incidence of metabolic acidosis and feeding intolerance associated with powdered or acidified liquid human milk fortifier (HMF). This retrospective study evaluated infants ⩽ 32 weeks gestational age or ⩽ 1500 g birth weight who received human milk with either powdered or acidified liquid HMF (50 consecutively born infants per group). Primary outcomes tracked were metabolic acidosis (base excess less than -4 mmol l(-1) or bicarbonate less than 18 mmol l(-1)), feeding intolerance (gastric residual > 50% feed volume, > 3 loose stools or emesis per day, abdominal tenderness or distention), necrotizing enterocolitis, late-onset infection, death, length of hospital stay and ability to remain on HMF. Demographics, feeding practices, growth parameters and laboratory data were also collected. Significantly more infants who received acidified liquid HMF developed metabolic acidosis (P acidosis or feeding intolerance than those on powdered HMF (P acidosis and to be switched off HMF than those who received powdered HMF. Growth in the liquid HMF group was no different than the powdered group, despite higher protein intake.

  15. Effects of seasonal change and parity on raw milk composition and related indices in Chinese Holstein cows in northern China.

    Science.gov (United States)

    Yang, L; Yang, Q; Yi, M; Pang, Z H; Xiong, B H

    2013-01-01

    This study was to investigate the effects of seasonal change and parity on milk composition and related indices, and to analyze the relationships among milk indices in Chinese Holstein cows from an intensive dairy farm in northern China. The 6,520 sets of complete Dairy Herd Improvement data were obtained and grouped by natural month and parity. The data included daily milk yield (DMY), milk solids percentage (MSP), milk fat percentage (MFP), milk protein percentage (MPP), milk lactose percentage (MLP), somatic cell count (SCC), somatic cell score (SCS), milk production loss (MPL), and fat-to-protein ratio (FPR). Data analysis showed that the above 9 indices were affected by both seasonal change and parity. However, the interaction between parity and seasonal change showed effects on MLP, SCS, MPL, and DMY, but no effects on MFP, MPP, MSP, and FPR. Duncan's multiple comparison on seasonal change showed that DMY (23.58 kg/d), MSP (12.35%), MPP (3.02%), and MFP (3.81%) were the lowest in June, but SCC (288.7 × 10(3)/mL) and MPL (0.69 kg/d) were the lowest in January; FPR (1.32) was the highest in February. Meanwhile, Duncan's multiple comparison on parities showed that MSP, MPP, and MLP were reduced rapidly in the fourth lactation, but SCC and MPL increased with increasing parities. The canonical correlation analysis for indices showed that SCS had high positive correlation with MPL (0.8360). Therefore, a few models were developed to quantify the effects of seasonal change and parity on raw milk composition using the Wood model. The changing patterns of milk composition and related indices in different months and parities could provide scientific evidence for improving feeding management and nutritional supplementation of Chinese Holstein cows. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  16. Extension of raw milk quality through supplementation of hydrocyanic acid from fresh cassava peel in dairy cattle diet

    Directory of Open Access Journals (Sweden)

    Supreena Srisaikham

    2017-12-01

    Full Text Available The objective of this study was to evaluate the effects on the extension of raw milk quality through supplementation of hydrocyanic acid (HCN levels from fresh cassava peel (FCPe in dairy cattle diet by increasing the milk thiocyanate (SCN concentration and lactoperoxidase (LP activity. The sample was twenty-four Holstein Friesian crossbred lactating dairy cows, averaging 87±31 days in milk (DIM, 13.4±2.9 kg of milk and 397±52 kg body weight (BW. All cows were fed the control diet with 6.5 kg/d of 21% crude protein (CP concentrate and ad libitum grass silage (GS. The treatments groups were as follows: 1 the control diet for the 1st group, the 2nd group received the control diet supplemented with 400 g/d of FCPe (75 ppm HCN and the 3rd group received the control diet supplemented with 800 g/d of FCPe (150 ppm HCN. The results showed that 800 g/h/d FCPe enhanced the efficiency of LP activity in raw milk to reduce total bacterial count (TBC and coliform count (CC; therefore, 400 g/h/d FCPe can be used in the concentrate for lactating dairy cows.

  17. Characterization of an apically derived epithelial membrane glycoprotein from bovine milk, which is expressed in capillary endothelia in diverse tissues

    OpenAIRE

    1985-01-01

    A glycoprotein (PAS IV) of apparent Mr 76,000 was purified from bovine milk-fat-globule membrane and partially characterized. PAS IV contained mannose, galactose, and sialic acid as principal sugars (approximately 5.3% total carbohydrate [wt/wt]) and existed in milk in at least four isoelectric variants. The glycoprotein appeared to be an integral membrane protein by several criteria. PAS IV was recovered in the detergent phase of Triton X-114 extracts of milk-fat-globule membrane at room tem...

  18. Longitudinal metagenomic profiling of bovine milk to assess the impact of intramammary treatment using a third-generation cephalosporin

    NARCIS (Netherlands)

    Ganda, Erika K.; Bisinotto, Rafael S.; Lima, Svetlana F.; Kronauer, Kristina; Decter, Dean H.; Oikonomou, Georgios; Schukken, Ynte H.|info:eu-repo/dai/nl/075051907; Bicalho, Rodrigo C.

    2016-01-01

    Antimicrobial usage in food animals has a direct impact on human health, and approximately 80% of the antibiotics prescribed in the dairy industry are used to treat bovine mastitis. Here we provide a longitudinal description of the changes in the microbiome of milk that are associated with mastitis

  19. Compositional and biochemical changes in Genestoso cheese, a Spanish raw cow's milk variety, during ripening.

    Science.gov (United States)

    Arenas, Ricardo; González, Leticia; Sacristán, Noelia; Tornadijo, María E; Fresno, José M

    2015-03-15

    Physicochemical characteristics, proteolysis and lipolysis were studied throughout the ripening of eight batches of a traditional Spanish variety made from raw cow's milk, in order to establish a basis for its industrial production. The main compositional characteristics of this cheese after 60 days of ripening were its high proportion of total solids (TS; 752 g kg⁻¹ of cheese), an average content of protein (452.8 g kg⁻¹ TS) and fat (475.1 g kg⁻¹ TS) and the presence of residual lactose (12.5 g kg⁻¹ TS). Its pH value (4.04) was extremely low. Phosphorus (5.13 g kg⁻¹ TS) and sodium (8.29 g kg⁻¹ TS) were the most abundant mineral elements in cheese, whereas calcium levels (1.92 g kg⁻¹ TS) were very low. Proteolysis extension and depth were very low, which resulted in almost zero degradation of αs1- and β-casein. Fat acidity increased during ripening, reaching final values of 50.1 mg KOH kg⁻¹ of fat. The main free fatty acid was C16:0, followed by C18:1 and C14:0. These results suggest that this variety undergoes a limited proteolysis and moderate lipolysis during ripening. The low pH, low calcium content and limited proteolysis led to a crumbly texture in this cheese variety. © 2014 Society of Chemical Industry.

  20. Monitoring of aflatoxin M1 in raw cow milk in Croatia during winter 2015

    Directory of Open Access Journals (Sweden)

    Nina Bilandžić

    2016-01-01

    Full Text Available A total of 548 raw milk samples were collected in the western, central and eastern regions of Croatia during February and March 2015. Aflatoxin M1 (AFM1 concentrations were quantified by the enzyme immunoassay method. The method limits of detection (LOD and quantification (LOQ were 22.2 and 34.2 ng/kg, respectively. The mean AFM1 levels measured in the three regions were (ng/kg as follows: western 3.69, central 3.11 and eastern 4.14. In total, the 548 samples analysed concentrations were below the LOD value and accordingly below the European Union maximum residue level (EU MRL of 50 ng/kg. The results suggest an absence of use of contaminated with aflatoxin B1 supplementary feedstuff for lactating cows in winter 2015. Such results might be related to the improved storage conditions for feed as well as to the enhanced and more stringent feed control system for mycotoxins in Croatia.

  1. Bacteriocin-Producing Enterococcus faecium LCW 44: A High Potential Probiotic Candidate from Raw Camel Milk.

    Science.gov (United States)

    Vimont, Allison; Fernandez, Benoît; Hammami, Riadh; Ababsa, Ahlem; Daba, Hocine; Fliss, Ismaïl

    2017-01-01

    Bacterial isolates from raw camel milk were screened for antibacterial activity using the agar diffusion assay. Ten isolates selected for their inhibition of Gram-positive bacteria were identified by 16S sequencing as Enterococcus faecium or durans . An isolate named E. faecium LCW 44 exhibited the broadest antibacterial spectrum with an inhibitory activity against several Gram-positive strains belonging to the genera Clostridium , Listeria , Staphylococcus , and Lactobacillus. E. faecium LCW 44 was shown to produce N-formylated enterocins L50A and L50B, as revealed by mass spectrometry and PCR analyses. This isolate did not harbor any of the virulence factors tested and was shown to be sensitive to all tested antibiotics. It showed high resistance to gastric and intestinal conditions (78 ± 4% survival). Its adhesion index was evaluated at 176 ± 86 and 24 ± 86 on Caco-2 cells and HT-29 cells, respectively, and it significantly reduced adhesion of Listeria monocytogenes by 65 and 49%, respectively. In Macfarlane broth (simulating the nutrient content of the colon), counts of L. monocytogenes were reduced by 2 log 10 cycles after 24 h in co-culture with E. faecium LCW 44, compared to the increase of 4 log 10 cycles when cultured alone. Comparison with a bacteriocin-non-producing mutant of E. faecium LCW 44 strongly suggests that inhibition of L. monocytogenes was due to bacteriocin production. Altogether, E. faecium LCW 44 thus has potential for use as a probiotic for humans and veterinary medicine.

  2. Raw drone milk of honeybees elicits uterotrophic effect in rats: evidence for estrogenic activity.

    Science.gov (United States)

    Seres, Adrienn B; Ducza, Eszter; Báthori, Mária; Hunyadi, Attila; Béni, Zoltán; Dékány, Miklós; Gáspár, Róbert

    2013-05-01

    Numerous honeybee products are used in medicine, but the literature furnishes no information concerning the effects of the drone milk (DM), although drone brood, which is similar to DM, was reported to elicit a hormone-like strengthening effect. In certain countries, DM is traditionally used to treat infertility and to promote vitality in both men and women. The aim of this study was to determine the putative estrogen hormone-like effect of raw DM in rats and to identify the effective compounds. Uterotrophic assays revealed that DM increased the relative weight of the immature rat uterus. This effect was confirmed by reverse transcription polymerase chain-reaction and Western blot methods, in which the mRNA and protein expression of the estrogen-dependent peptide complement component C3 was determined. Column chromatography and uterotrophic assays were used to fractionate and check bioactivity, respectively. The active compound after the last fractionation was identified by the nuclear magnetic resonance and mass spectrometry techniques as E-dec-2-enedioic acid, which is very similar to the fatty acids with estrogenic activity that were previously isolated from royal jelly. These results lead us to suppose that E-dec-2-enedioic acid is responsible for the estrogen-like effect of DM. This appears to be the first report on the pharmacological effects of DM and E-dec-2-enedioic acid in mammals.

  3. Bacteriocin-Producing Enterococcus faecium LCW 44: A High Potential Probiotic Candidate from Raw Camel Milk

    Directory of Open Access Journals (Sweden)

    Allison Vimont

    2017-05-01

    Full Text Available Bacterial isolates from raw camel milk were screened for antibacterial activity using the agar diffusion assay. Ten isolates selected for their inhibition of Gram-positive bacteria were identified by 16S sequencing as Enterococcus faecium or durans. An isolate named E. faecium LCW 44 exhibited the broadest antibacterial spectrum with an inhibitory activity against several Gram-positive strains belonging to the genera Clostridium, Listeria, Staphylococcus, and Lactobacillus. E. faecium LCW 44 was shown to produce N-formylated enterocins L50A and L50B, as revealed by mass spectrometry and PCR analyses. This isolate did not harbor any of the virulence factors tested and was shown to be sensitive to all tested antibiotics. It showed high resistance to gastric and intestinal conditions (78 ± 4% survival. Its adhesion index was evaluated at 176 ± 86 and 24 ± 86 on Caco-2 cells and HT-29 cells, respectively, and it significantly reduced adhesion of Listeria monocytogenes by 65 and 49%, respectively. In Macfarlane broth (simulating the nutrient content of the colon, counts of L. monocytogenes were reduced by 2 log10 cycles after 24 h in co-culture with E. faecium LCW 44, compared to the increase of 4 log10 cycles when cultured alone. Comparison with a bacteriocin-non-producing mutant of E. faecium LCW 44 strongly suggests that inhibition of L. monocytogenes was due to bacteriocin production. Altogether, E. faecium LCW 44 thus has potential for use as a probiotic for humans and veterinary medicine.

  4. CHARACTERIZATION OF AUTOCHTHONUS LACTIC FLORA OF A CAMPANIAN CHILLI CHEESE PRODUCED FROM RAW SHEEP MILK

    Directory of Open Access Journals (Sweden)

    A. Mormile

    2012-08-01

    Full Text Available The natural lactic flora of the artisanal chilli “Tramonti” cheese, a typical product manufactured in the “Lattari mountains”, area of Salerno province (Italy, was investigated. Particular attention was paid to the growth dynamics assessment and to the molecular identification of the indigenous lactic acid bacteria involved in the ripening of this cheese made with raw sheep milk without starter cultures. One batch was monitored taking 4 sample on 0, 30, 50 and 105 ripening days. Lactobacillus and Lactococcus were enumerated and randomly isolated on MRS and LM17 agar (32ºC x 48h -mesophilic flora- and 42°C x 48h -thermophilic flora, respectively. N. 66 presumptive lactic acid bacteria isolates, gram positive and catalase negative, were genotipically identified by Ribotyping. Mesophilic Lactobacillus remained at levels of 107 cfu/g during whole maturation time and thermophilic Lactobacillus, from initial values of 105 cfu/g, reached concentratios of 106 cfu/g at the end of maturation. Mesophilic and thermophilic Lactococcus showed, on average, levels of 106 since the beginning of the ripening. Ribotyping allowed to detect 4 lactic acid bacteria species: Enterococcus faecium (65,15%, Lactococcus lactis spp. cremoris (24,24%, Enterococcus faecalis (6,06% and Enterococcus durans (4,54%, showing the diversity of indigenous lactic acid bacteria of chilli “Tramonti” cheese.

  5. Streptococcus moroccensis sp. nov. and Streptococcus rifensis sp. nov., isolated from raw camel milk.

    Science.gov (United States)

    Kadri, Zaina; Amar, Mohamed; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; El Farricha, Omar; Vandamme, Peter

    2014-07-01

    Two catalase- and oxidase-negative Streptococcus-like strains, LMG 27682(T) and LMG 27684(T), were isolated from raw camel milk in Morocco. Comparative 16S rRNA gene sequencing assigned these bacteria to the genus Streptococcus with Streptococcus rupicaprae 2777-2-07(T) as their closest phylogenetic neighbour (95.9% and 95.7% similarity, respectively). 16S rRNA gene sequence similarity between the two strains was 96.7%. Although strains LMG 27682(T) and LMG 27684(T) shared a DNA-DNA hybridization value that corresponded to the threshold level for species delineation (68%), the two strains could be distinguished by multiple biochemical tests, sequence analysis of the phenylalanyl-tRNA synthase (pheS), RNA polymerase (rpoA) and ATP synthase (atpA) genes and by their MALDI-TOF MS profiles. On the basis of these considerable phenotypic and genotypic differences, we propose to classify both strains as novel species of the genus Streptococcus, for which the names Streptococcus moroccensis sp. nov. (type strain, LMG 27682(T)  = CCMM B831(T)) and Streptococcus rifensis sp. nov. (type strain, LMG 27684(T)  = CCMM B833(T)) are proposed. © 2014 IUMS.

  6. Quality of raw cow milk in Republic of Macedonia determined through the testing of somatic cell count and total viable count

    Directory of Open Access Journals (Sweden)

    Angelovski Ljupco

    2008-11-01

    Full Text Available Somatic cells count and total viable count are criteria used to estimate the compliance of raw cow milk with the Book of rules for demands for safety and hygiene and procedures for official controls of milk and milk products, Official Gazette of RM 157/2007. According to the given demands, raw milk operators are obliged to conduct all procedures and to guarantee that milk is in compliance with the criteria laid down in Book of rules. At the same time, Republic of Macedonia have to fulfill EU criteria laid down in Directive 92/46 (Council directive 92/46/EEC laying down the health rules for the production and placing on the market of raw milk, heat-treated milk and milkbased products for quality of raw milk as part of implementation of community legislation and milk production. The independent laboratory for milk quality control at FVM-Skopje, in frame of its activities in the period February- August 2008 has conducted a study for obtaining preliminary results for the situation with raw milk quality produced in R. of Macedonia for somatic cells counts and total viable count. In the study we analyzed 2065 samples for TVC and 1625 samples for SCC of raw milk samples produced in different parts of the country. From the tested samples only 41,8% fulfill criteria for SCC and 41,45% criteria for TVC lay down in Book of rules for 2008. Assessment of the results in light of Council Directive it is obvious that only 42,7% of the samples for SCC and 10,7% for TVC fulfill the criteria of Council Directive having in mind different requirements vs. Book of rules.

  7. Raw Cow’s Milk Prevents the Development of Airway Inflammation in a Murine House Dust Mite-Induced Asthma Model

    Directory of Open Access Journals (Sweden)

    Suzanne Abbring

    2017-08-01

    Full Text Available Epidemiological studies show an inverse relation between raw cow’s milk consumption and the development of asthma. This protective effect seems to be abolished by milk processing. However, evidence for a causal relationship is lacking, and direct comparisons between raw and processed milk are hardly studied. Therefore, this study investigated the preventive capacity of raw and heated raw milk on the development of house dust mite (HDM-induced allergic asthma in mice. Six- to seven-week-old male BALB/c mice were intranasally (i.n. sensitized with 1 µg HDM or PBS on day 0, followed by an i.n. challenge with 10 µg HDM or PBS on days 7–11. In addition, mice were fed 0.5 mL raw cow’s milk, heated raw cow’s milk, or PBS three times a week throughout the study, starting 1 day before sensitization. On day 14, airway hyperresponsiveness (AHR in response to increasing doses of methacholine was measured to assess lung function. Bronchoalveolar lavage fluid (BALF and lungs were furthermore collected to study the extent of airway inflammation. Raw milk prevented both HDM-induced AHR and pulmonary eosinophilic inflammation, whereas heated raw milk did not. Both milk types suppressed the Th2-polarizing chemokine CCL17 in lung homogenates and reduced lung Th2 and Th17 cell frequency. IL-4 and IL-13 production after ex vivo restimulation of lung T cells with HDM was also reduced by both milk types. However, local IL-5 and IL-13 concentrations were only suppressed by raw milk. These findings support the asthma-protective capacity of raw cow’s milk and show the importance of reduced local type 2 cytokine levels. Heated raw milk did not show an asthma-protective effect, which indicates the involvement of heat-sensitive components. Besides causal evidence, this study provides the basis for further mechanistic studies.

  8. Quantitative analysis of veterinary drugs in bovine muscle and milk by liquid chromatography quadrupole time-of-flight mass spectrometry.

    Science.gov (United States)

    Saito-Shida, Shizuka; Sakai, Takatoshi; Nemoto, Satoru; Akiyama, Hiroshi

    2017-07-01

    A simple and reliable multiresidue method for quantitative determination of veterinary drugs in bovine muscle and milk using liquid chromatography quadrupole time-of-flight mass spectrometry (LC-QTOF-MS) was developed. Critical MS parameters such as capillary voltage, cone voltage, collision energy, desolvation gas temperature and extraction mass window were carefully optimised to obtain the best possible sensitivity. Analytical samples were prepared using extraction with acetonitrile and hexane in the presence of anhydrous sodium sulphate and acetic acid, followed by ODS cartridge clean-up. The developed method was validated for 82 veterinary drugs in bovine muscle and milk at spike levels of 0.01 and 0.1 mg kg - 1 . With the exception of cefoperazone and phenoxymethylpenicillin, all these compounds exhibited sufficient signal intensity at 0.01 μg ml -1 (equivalent to 0.01 mg kg - 1 ), indicating the high sensitivity of the developed method. For most targets, the determined accuracies were within 70-120%, with repeatability and reproducibility being below 20% at both levels. Except for sulfathiazole in bovine muscle, no interfering peaks at target compound retention times were detected in the blank extract, indicating that the developed method is highly selective. The absence of sulfathiazole in bovine muscle was confirmed by simultaneous acquisition at low and high collision energies to afford exact masses of molecular adduct and fragment ions. Satisfactory linearity was observed for all compounds, with matrix effects being negligible for most targets in bovine muscle and milk at both spike levels. Overall, the results suggest that the developed LC-QTOF-MS method is suitable for routine regulatory-purpose analysis of veterinary drugs in bovine muscle and milk.

  9. The association of low-molecular-weight hydrophobic compounds with native casein micelles in bovine milk.

    Science.gov (United States)

    Cheema, M; Mohan, M S; Campagna, S R; Jurat-Fuentes, J L; Harte, F M

    2015-08-01

    The agreed biological function of the casein micelles in milk is to carry minerals (calcium, magnesium, and phosphorus) from mother to young along with amino acids for growth and development. Recently, native and modified casein micelles were used as encapsulating and delivery agents for various hydrophobic low-molecular-weight probes. The ability of modified casein micelles to bind certain probes may derive from the binding affinity of native casein micelles. Hence, a study with milk from single cows was conducted to further elucidate the association of hydrophobic molecules into native casein micelles and further understand their biological function. Hydrophobic and hydrophilic extraction followed by ultraperformance liquid chromatography-high resolution mass spectrometry analysis were performed over protein fractions obtained from size exclusion fractionation of raw skim milk. Hydrophobic compounds, including phosphatidylcholine, lyso-phosphatidylcholine, phosphatidylethanolamine, and sphingomyelin, showed strong association exclusively to casein micelles as compared with whey proteins, whereas hydrophilic compounds did not display any preference for their association among milk proteins. Further analysis using liquid chromatography-tandem mass spectrometry detected 42 compounds associated solely with the casein-micelles fraction. Mass fragments in tandem mass spectrometry identified 4 of these compounds as phosphatidylcholine with fatty acid composition of 16:0/18:1, 14:0/16:0, 16:0/16:0, and 18:1/18:0. These results support that transporting low-molecular-weight hydrophobic molecules is also a biological function of the casein micelles in milk. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. EFFECTIVENESS OF RISK MANAGEMENT IN DIRECTLY RAW MILK SELLING AT “E. AVANZI” CENTER OF PISA UNIVERSITY

    Directory of Open Access Journals (Sweden)

    S. Rindi

    2010-03-01

    Full Text Available Authors show the results about the effectiveness verification of prevention measures adopted in raw milk directly selling at “E. Avanzi” Centre of Pisa University. The good hygienic practices applied during production, storage and selling phases demonstrated to guarantee, in raw milk, conditions complying to hygienic criteria provided for the current regulation in Tuscany. The effectiveness verification about risk communication, carried out interviewing a sample of buyers, shows as, beside a predominant attitude towards attention to potential hygienic risks, overstay areas of reduced awareness about food risk and the ways to manage prevention. Authors hope for, in this context, such as in other similar productions, the approach yet launched towards continuous improvement of good hygienic practices adopted by businesses, could be extended to risk communication, with the aim to promote conscious and responsable choices of consumer.

  11. SNP discovery in the bovine milk transcriptome using RNA-Seq technology.

    Science.gov (United States)

    Cánovas, Angela; Rincon, Gonzalo; Islas-Trejo, Alma; Wickramasinghe, Saumya; Medrano, Juan F

    2010-12-01

    High-throughput sequencing of RNA (RNA-Seq) was developed primarily to analyze global gene expression in different tissues. However, it also is an efficient way to discover coding SNPs. The objective of this study was to perform a SNP discovery analysis in the milk transcriptome using RNA-Seq. Seven milk samples from Holstein cows were analyzed by sequencing cDNAs using the Illumina Genome Analyzer system. We detected 19,175 genes expressed in milk samples corresponding to approximately 70% of the total number of genes analyzed. The SNP detection analysis revealed 100,734 SNPs in Holstein samples, and a large number of those corresponded to differences between the Holstein breed and the Hereford bovine genome assembly Btau4.0. The number of polymorphic SNPs within Holstein cows was 33,045. The accuracy of RNA-Seq SNP discovery was tested by comparing SNPs detected in a set of 42 candidate genes expressed in milk that had been resequenced earlier using Sanger sequencing technology. Seventy of 86 SNPs were detected using both RNA-Seq and Sanger sequencing technologies. The KASPar Genotyping System was used to validate unique SNPs found by RNA-Seq but not observed by Sanger technology. Our results confirm that analyzing the transcriptome using RNA-Seq technology is an efficient and cost-effective method to identify SNPs in transcribed regions. This study creates guidelines to maximize the accuracy of SNP discovery and prevention of false-positive SNP detection, and provides more than 33,000 SNPs located in coding regions of genes expressed during lactation that can be used to develop genotyping platforms to perform marker-trait association studies in Holstein cattle.

  12. Bovine respiratory syncytial virus and bovine coronavirus antibodies in bulk tank milk - risk factors and spatial analysis.

    Science.gov (United States)

    Toftaker, Ingrid; Sanchez, Javier; Stokstad, Maria; Nødtvedt, Ane

    2016-10-01

    Bovine respiratory syncytial virus (BRSV) and bovine coronavirus (BCoV) are considered widespread among cattle in Norway and worldwide. This cross-sectional study was conducted based on antibody-ELISA of bulk tank milk (BTM) from 1347 herds in two neighboring counties in western Norway. The study aims were to determine the seroprevalence at herd level, to evaluate risk factors for BRSV and BCoV seropositivity, and to assess how these factors were associated with the spatial distribution of positive herds. The overall prevalence of BRSV and BCoV positive herds in the region was 46.2% and 72.2%, respectively. Isopleth maps of the prevalence risk distribution showed large differences in prevalence risk across the study area, with the highest prevalence in the northern region. Common risk factors of importance for both viruses were herd size, geographic location, and proximity to neighbors. Seropositivity for one virus was associated with increased odds of seropositivity for the other virus. Purchase of livestock was an additional risk factor for BCoV seropositivity, included in the model as in-degree, which was defined as the number of incoming movements from individual herds, through animal purchase, over a period of five years. Local dependence and the contribution of risk factors to this effect were assessed using the residuals from two logistic regression models for each virus. One model contained only the x- and y- coordinates as predictors, the other had all significant predictors included. Spatial clusters of high values of residuals were detected using the normal model of the spatial scan statistic and visualized on maps. Adjusting for the risk factors in the final models had different impact on the spatial clusters for the two viruses: For BRSV the number of clusters was reduced from six to four, for BCoV the number of clusters remained the same, however the log-likelihood ratios changed notably. This indicates that geographical differences in proximity to

  13. Occurrence of aflatoxin M(1) in some samples of UHT, raw & pasteurized milk from Indian states of Karnataka and Tamilnadu.

    Science.gov (United States)

    Siddappa, Vinutha; Nanjegowda, Divyashree Kallenahalli; Viswanath, Prema

    2012-11-01

    Aflatoxin M(1) (AFM(1)) is a toxic metabolite found in the milk of lactating animals which have consumed feedstuffs contaminated with aflatoxin B(1). Ultra high temperature treated (UHT) milk is a product which is becoming popular in developing countries like India as there is a lack of proper cold storage or refrigeration facilities. In this study, 45 samples of UHT milk of popular brands prevalent in the market were analyzed for the presence of AFM(1) by reversed phase HPLC using fluorescent detector after cleanup of sample with immunoaffinity columns. All samples of plain UHT milk were positive for AFM(1) and 38% of these contained levels more than 0.5 μg/kg, the maximum permitted limit prescribed by the Codex Alimentarius Commission and by the mandatory regulations of the country, the FSSAI Regulations, 2011. In 62.5% of flavored UHT milk, AFM(1) was below detectable levels (0.02 μgL(-1)). However, 12.5% of these samples also contained levels exceeding the maximum permitted limits. AFM(1) was present in 61.6% of the 52 raw milk samples analyzed from the two states of Karnataka and Tamilnadu with a range of 0.1-3.8 μgL(-1). 17.3% of these samples also exceeded the regulatory limits of the country. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Bovine chromosomal regions affecting rheological traits in rennet-induced skim milk gels

    DEFF Research Database (Denmark)

    Gregersen, Vivi Raundahl; Gustavsson, F; Glantz, M

    2015-01-01

    genomic regions affecting traits related to rennet-induced gelation, the aim of this study was to identify potential candidate genes affecting these traits. Hence, rennet-induced gelation, including rennet coagulation time, gel strength, and yield stress, was measured in skim milk samples collected from...... 379 animals of the Swedish Red breed using low-amplitude oscillation measurements. All animals had genotypes for almost 621,000 segregating single nucleotide polymorphisms (SNP), identified using the Bovine HD SNPChip (Illumina Inc., San Diego, CA). The genome was scanned for associations, haplotypes...... based on SNP sets comprising highly associated SNP were inferred, and the effects of the 2 most common haplotypes within each region were analyzed using mixed models. Even though the number of animals was relatively small, a total of 21 regions were identified, with 4 regions showing association...

  15. The potential of the endolysin Lysdb from Lactobacillus delbrueckii phage for combating Staphylococcus aureus during cheese manufacture from raw milk.

    Science.gov (United States)

    Guo, Tingting; Xin, YongPing; Zhang, Chenchen; Ouyang, Xudong; Kong, Jian

    2016-04-01

    Phage endolysins have received increased attention in recent times as potential antibacterial agents and the biopreservatives in food production processes. Staphylococcus aureus is one of the most common pathogens in bacterial food poisoning outbreaks. In this study, the endolysin Lysdb, one of the two-component cell lysis cassette of Lactobacillus delbrueckii phage phiLdb, was shown to possess a muramidase domain and catalytic sites with homology to Chalaropsis-type lysozymes. Peptidoglycan hydrolytic bond specificity determination revealed that Lysdb was able to cleave the 6-O-acetylated peptidoglycans present in the cell walls of S. aureus. Turbidity reduction assays demonstrated that Lysdb could effectively lyse the S. aureus live cells under acidic and mesothermal conditions. To further evaluate the ability of Lysdb as a potential antibacterial agent against S. aureus in cheese manufacture, Lactobacillus casei BL23 was engineered to constitutively deliver active Lysdb to challenge S. aureus in lab-scale cheese making from raw milk. Compared with the raw milk, the viable counts of S. aureus were reduced by 10(5)-fold in the cheese inoculated with the engineered L. casei strain during the fermentation process, and the pathogenic bacterial numbers remained at a low level (10(4) CFU/g) after 6 weeks of ripening at 10 °C. Taken together, all results indicated that the Lysdb has the function as an effective tool for combating S. aureus during cheese manufacture from raw milk.

  16. Rapid Screening of Bovine Milk Oligosaccharides in a Whey Permeate Product and Domestic Animal Milks by Accurate Mass Database and Tandem Mass Spectral Library

    Science.gov (United States)

    Lee, Hyeyoung; Cuthbertson, Daniel J.; Otter, Don E.; Barile, Daniela

    2018-01-01

    A bovine milk oligosaccharide (BMO) library, prepared from cow colostrum, with 34 structures was generated and used to rapidly screen oligosaccharides in domestic animal milks and a whey permeate powder. The novel library was entered into a custom Personal Compound Database and Library (PCDL) and included accurate mass, retention time, and tandem mass spectra. Oligosaccharides in minute-sized samples were separated using nanoliquid chromatography (nanoLC) coupled to a high resolution and sensitive quadrupole-Time of Flight (Q-ToF) MS system. Using the PCDL, 18 oligosaccharides were found in a BMO-enriched product obtained from whey permeate processing. The usefulness of the analytical system and BMO library was further validated using milks from domestic sheep and buffaloes. Through BMO PCDL searching, 15 and 13 oligosaccharides in the BMO library were assigned in sheep and buffalo milks, respectively, thus demonstrating significant overlap between oligosaccharides in bovine (cow and buffalo) and ovine (sheep) milks. This method was shown to be an efficient, reliable, and rapid tool to identify oligosaccharide structures using automated spectral matching. PMID:27428379

  17. Exploratory analysis of dynamics of frequency distribution of raw cow milk quality indicators in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Oto Hanuš

    2011-01-01

    Full Text Available A consistent link of the raw milk quality (RMQ to the farmer price is essential. The aim was to analyse the properties of milk quality indicators (MQIs and propose a new synthetic relative MQI (SQSM from among various individual MQIs. SQSM could serve for consistent inclusion each quality change into the price. The paper was focused on exploratory analysis (normality (N testing of files of MQIs. On the basis of the results, the MQIs were divided into two groups without and with necessity of original data transformation (TRN. Log and Box–Cox TRNs were tested in terms of possibilities of the files approach to the normal data frequency distribution (FD. The compositional MQIs deviated less and health and hygienic MQIs more from normal FD in original data (P < 0.05. The TRNs approached the data files to N very markedly in health and hygienic MQIs. The synthesis of various values of MQIs into SQSM was proposed. SQSM values were derived from model file of real data about MQIs and validated for use at farmer milk price modifications by the normality FD test. 33.3% of month SQSM files were normal (P > 0.05, the other were very close to the N with negligible deviations. The useability of the SQSM system for the balancing of raw milk purchase price premiums and penalties was tentatively confirmed.

  18. Bacteriological study of raw and unexpired pasteurized cow's milk collected at the dairy farms and super markets in Sari city in 2011.

    Science.gov (United States)

    Vahedi, M; Nasrolahei, M; Sharif, M; Mirabi, A M

    2013-06-01

    The quality of milk is influenced by different bacteria present in milk. This study was undertaken to investigate the bacterial contamination of raw and pasteurized milk in Sari Township, Iran, 2011. In this investigation, 100 pasteurized milk samples were collected randomly from the super markets in the city and 100 raw milk samples from 4 dairy farms from suburb areas and evaluated for the presence of coliforms, Escherichia coli, Staphylococcus aureus and Listeria monocytogenes by culture methods and biochemical tests. Data analysis was performed by SPSS software using Chi2 test and described in percentage. In the raw milk, contamination with E. coli, coliforms and Staphylococcus aureus was observed in 42 (42%), 36 (36%) and 22 (22%) of samples respectively, and the same for the pasteurized milk samples was 9 (9%), 2 (2%) and 2 (2%), respectively. Listeria monocytogenes was not detected in any sample. Presence of E. coli in the milk could be due to contamination with waste water and fecal materials. Considering the contamination of raw and pasteurized milk with E. coli and coliforms, sanitary practice during collecting and transporting, particularly in the summer season is recommended.

  19. Exfoliation rate of mammary epithelial cells in milk on bovine mastitis caused by Staphylococcus aureus is associated with bacterial load.

    Science.gov (United States)

    Nagasawa, Yuya; Kiku, Yoshio; Sugawara, Kazue; Tanabe, Fuyuko; Hayashi, Tomohito

    2018-01-01

    The exfoliation rate of mammary epithelial cells (MECs) in milk is affected by physiological, breeding and environmental factors. Little is known about the relationship between the MEC exfoliation into milk and mammary-infected Staphylococcus aureus (S. aureus) load on bovine mastitis caused by S. aureus. The aim of this study was to investigate the relationship between S. aureus load and the proportion of MEC exfoliation in milk using five substantial bovine mastitis models. In 64 randomly extracted milk samples from udders at 3-21 days after S. aureus infusion, there were various samples with different numbers of S. aureus counts and somatic cell counts. No significant correlations were found between the S. aureus counts and somatic cell count (r = 0.338). In contrast, a significant correlation was noted between S. aureus counts and the proportion of cytokeratin-positive cells in the milk from the infused udders (r = 0.734, P mastitis udders caused by S. aureus may contribute to reduced milk yield. © 2017 Japanese Society of Animal Science.

  20. High-pressure homogenization of raw and pasteurized milk modifies the yield, composition, and texture of queso fresco cheese.

    Science.gov (United States)

    Escobar, D; Clark, S; Ganesan, V; Repiso, L; Waller, J; Harte, F

    2011-03-01

    High-pressure homogenization (HPH) of milk was studied as an alternative processing operation in the manufacturing of queso fresco cheese. Raw and pasteurized (65°C for 30 min) milks were subjected to HPH at 0, 100, 200, and 300 MPa and then used to manufacture queso fresco. The cheeses were evaluated for yield, moisture content, titratable acidity, nitrogen content, whey protein content, yield force, yield strain, and tactile texture by instrumental or trained panel analyses. The combination of HPH and thermal processing of milk resulted in cheeses with increased yield and moisture content. The net amount of protein transferred to the cheese per kilogram of milk remained constant for all treatments except raw milk processed at 300 MPa. The highest cheese yield, moisture content, and crumbliness were obtained for thermally processed milk subjected to HPH at 300 MPa. The principal component analysis of all measured variables showed that the variables yield, moisture content, and crumbliness were strongly correlated to each other and negatively correlated to the variables yield strain, protein content (wet basis), and sensory cohesiveness. It is suggested that the combination of thermal processing and HPH promotes thermally induced denaturation of whey protein, together with homogenization-induced dissociation of casein micelles. The combined effect results in queso fresco containing a thin casein-whey matrix that is able to better retain sweet whey. These results indicate that HPH has a strong potential for the manufacture of queso fresco with excellent yield and textural properties. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Glucose transporter expression differs between bovine monocyte and macrophage subsets and is influenced by milk production.

    Science.gov (United States)

    Eger, M; Hussen, J; Koy, M; Dänicke, S; Schuberth, H-J; Breves, G

    2016-03-01

    The peripartal period of dairy cows is characterized by negative energy balance and higher incidences of infectious diseases such as mastitis or metritis. With the onset of lactation, milk production is prioritized and large amounts of glucose are transported into the mammary gland. Decreased overall energy availability might impair the function of monocytes acting as key innate immune cells, which give rise to macrophages and dendritic cells and link innate and adaptive immunity. Information on glucose requirements of bovine immune cells is rare. Therefore, this study aims to evaluate glucose transporter expression of the 3 bovine monocyte subsets (classical, intermediate, and nonclassical monocytes) and monocyte-derived macrophages and to identify influences of the peripartal period. Blood samples were either collected from nonpregnant healthy cows or from 16 peripartal German Holstein cows at d -14, +7, and +21 relative to parturition. Quantitative real-time PCR was applied to determine mRNA expression of glucose transporters (GLUT) 1, GLUT3, and GLUT4 in monocyte subsets and monocyte-derived macrophages. The low GLUT1 and GLUT3 expression in nonclassical monocytes was unaltered during differentiation into macrophages, whereas in classical and intermediate monocytes GLUT expression was downregulated. Alternatively activated M2 macrophages consumed more glucose compared with classically activated M1 macrophages. The GLUT4 mRNA was only detectable in unstimulated macrophages. Neither monocytes nor macrophages were insulin responsive. In the peripartum period, monocyte GLUT1 and GLUT3 expression and the GLUT3/GLUT1 ratio were negatively correlated with lactose production. The high-affinity GLUT3 transporter appears to be the predominant glucose transporter on bovine monocytes and macrophages, especially in the peripartal period when blood glucose levels decline. Glucose transporter expression in monocytes is downregulated as a function of lactose production, which

  2. Human campylobacteriosis related to the consumption of raw milk sold by vending machines in Italy: Quantitative risk assessment based on official controls over four years.

    Science.gov (United States)

    Giacometti, Federica; Bonilauri, Paolo; Amatiste, Simonetta; Arrigoni, Norma; Bianchi, Manila; Losio, Marina Nadia; Bilei, Stefano; Cascone, Giuseppe; Comin, Damiano; Daminelli, Paolo; Decastelli, Lucia; Merialdi, Giuseppe; Mioni, Renzo; Peli, Angelo; Petruzzelli, Annalisa; Tonucci, Franco; Piva, Silvia; Serraino, Andrea

    2015-09-01

    A quantitative risk assessment (RA) model was developed to describe the risk of campylobacteriosis linked to consumption of raw milk sold in vending machines in Italy. Exposure assessment was based on the official microbiological records of raw milk samples from vending machines monitored by the regional Veterinary Authorities from 2008 to 2011, microbial growth during storage, destruction experiments, consumption frequency of raw milk, serving size, consumption preference and age of consumers. The differential risk considered milk handled under regulation conditions (4°C throughout all phases) and the worst time-temperature field handling conditions detected. Two separate RA models were developed, one for the consumption of boiled milk and the other for the consumption of raw milk, and two different dose-response (D-R) relationships were considered. The RA model predicted no human campylobacteriosis cases per year either in the best (4°C) storage conditions or in the case of thermal abuse in case of boiling raw milk, whereas in case of raw milk consumption the annual estimated campylobacteriosis cases depend on the dose-response relationships used in the model (D-R I or D-R II), the milk time-temperature storage conditions, consumer behaviour and age of consumers, namely young (with two cut-off values of ≤5 or ≤6 years old for the sensitive population) versus adult consumers. The annual estimated cases for young consumers using D-R II for the sensitive population (≤5 years old) ranged between 1013.7/100,000 population and 8110.3/100,000 population and for adult consumers using D-R I between 79.4/100,000 population and 333.1/100,000 population. Quantification of the risks associated with raw milk consumption is necessary from a public health perspective and the proposed RA model represents a useful and flexible tool to perform future RAs based on local consumer habits to support decision-making on safety policies. Further educational programmes for raw milk

  3. Virulence factors and genetic variability of Staphylococcus aureus strains isolated from raw sheep's milk cheese.

    Science.gov (United States)

    Spanu, Vincenzo; Spanu, Carlo; Virdis, Salvatore; Cossu, Francesca; Scarano, Christian; De Santis, Enrico Pietro Luigi

    2012-02-01

    Contamination of dairy products with Staphylococcus aureus can be of animal or human origin. The host pathogen relationship is an important factor determining genetic polymorphism of the strains and their potential virulence. The aim of the present study was to carry out an extensive characterization of virulence factors and to study the genetic variability of S. aureus strains isolated from raw ewe's milk cheese. A total of 100 S. aureus strains isolated from cheese samples produced in 10 artisan cheese factories were analyzed for the presence of enterotoxins (sea-see) and enterotoxins-like genes (seh, sek, sel, sem, seo, sep), leukocidins, exfoliatins, haemolysins, toxic shock syndrome toxin 1 (TSST-1) and the accessory gene regulator alleles (agr). Strains were also typed using pulsed-field gel electrophoresis (PFGE). AMOVA analysis carried out on PFGE and PCR data showed that the major component explaining genetic distance between strains was the dairy of origin. Of the total isolates 81% had a pathogenicity profile ascribable to "animal" biovar while 16% could be related to "human" biovar. The biovar allowed to estimate the most likely origin of the contamination. Minimum inhibitory concentrations (MICs) of nine antimicrobial agents and the presence of the corresponding genes coding for antibiotic resistance was also investigated. 18 strains carrying blaZ gene showed resistance to ampicillin and penicillin and 6 strains carrying tetM gene were resistant to tetracycline. The presence of mecA gene and methicillin resistance, typical of strains of human origin, was never detected. The results obtained in the present study confirm that S. aureus contamination in artisan cheese production is mainly of animal origin. Copyright © 2011. Published by Elsevier B.V.

  4. Milk-run kanban system for raw printed circuit board withdrawal to surface-mounted equipment

    Directory of Open Access Journals (Sweden)

    Swee Li Chee

    2012-12-01

    Full Text Available Purpose:  The paper aims to present a case study and later simulation analysis on a kanban system that incorporating milk-run operation to draw in raw material to the process. Design/methodology/approach:  Data collection at the case study company for ten weeks followed by a process study called value stream mapping. The proposed kanban model is simulated to test its various performances including total output, average flow time, average work-in-process, SME utilization, and average waiting time. Response surface methodology is adopted to generate suitable representative regression models.  Findings: For all performance measures, simulation results showed that the proposed system consistently outperforms the push system currently practiced. Second, the system indicates the advantages of leveling, particularly in the event of machine failure and blockage. Third, operator in the proposed kanban system has a lower utilization, even with the additional material handling task.   Research limitations/implications: This study only begins to reveal the implication of leveling for production control on multi-machine scenario. The simulation of the system is solely based only the case study. The control parameters critical to the case study, were naturally used. The furtherance of the research should include generalizing the system and devising the respective methodology to facilitate wider applications. Practical implications: Originality/value:  The kanban system is proposed in the light of conflicting interests in handling the surface mounting and the related upstream processes. Such aspect is common to electronics assembly industry.

  5. Caseins from bovine colostrum and milk strongly bind piscidin-1, an antimicrobial peptide from fish.

    Science.gov (United States)

    Kütt, Mary-Liis; Stagsted, Jan

    2014-09-01

    A model system of bovine colostrum and piscidin, a fish-derived antimicrobial peptide, was developed to study potential interactions of antimicrobial peptides in colostrum. We did not detect any antimicrobial activity of colostrum using the radial plate diffusion assay; in fact colostrum completely abrogated activity of added piscidin. This could not be explained by degradation of piscidin by colostrum, which was less than ten percent. We found that colostrum even protected piscidin against degradation by added proteases. We further observed that colostrum and milk rapidly quenched the fluorescence of fluorescein-piscidin but not that of fluorescein. This effect was not seen with BSA and the specific quenching of fluorescein-piscidin by colostrum was saturably inhibited with unlabeled piscidin. Size exclusion chromatography indicated that fluorescein-piscidin bound to casein micelles with no apparent binding to IgG or whey proteins. Further, addition of pure caseins was able to quench fluorescence of fluorescein-piscidin and to inhibit the antimicrobial activity of piscidin. The interaction between caseins and piscidin could be dissociated by guanidine hydrochloride and recovered piscidin had antimicrobial activity against bacteria. Based on our results we propose that caseins could be carriers for antimicrobial peptides in colostrum and milk. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Longitudinal metagenomic profiling of bovine milk to assess the impact of intramammary treatment using a third-generation cephalosporin

    Science.gov (United States)

    Ganda, Erika K.; Bisinotto, Rafael S.; Lima, Svetlana F.; Kronauer, Kristina; Decter, Dean H.; Oikonomou, Georgios; Schukken, Ynte H.; Bicalho, Rodrigo C.

    2016-01-01

    Antimicrobial usage in food animals has a direct impact on human health, and approximately 80% of the antibiotics prescribed in the dairy industry are used to treat bovine mastitis. Here we provide a longitudinal description of the changes in the microbiome of milk that are associated with mastitis and antimicrobial therapy. Next-generation sequencing, 16 S rRNA gene quantitative real-time PCR, and aerobic culturing were applied to assess the effect of disease and antibiotic therapy on the milk microbiome. Cows diagnosed with clinical mastitis associated with Gram-negative pathogens or negative aerobic culture were randomly allocated into 5 days of Ceftiofur intramammary treatment or remained as untreated controls. Serial milk samples were collected from the affected quarter and the ipsilateral healthy quarter of the same animal. Milk from the mastitic quarter had a higher bacterial load and reduced microbial diversity compared to healthy milk. Resolution of the disease was accompanied by increases in diversity indexes and a decrease in pathogen relative abundance. Escherichia coli-associated mastitic milk samples had a remarkably distinct bacterial profile, dominated by Enterobacteriaceae, when compared to healthy milk. However, no differences were observed in culture-negative mastitis samples when compared to healthy milk. Antimicrobial treatment had no significant effect on clinical cure, bacteriological cure, pathogen clearance rate or bacterial load. PMID:27874095

  7. Synergistic Effect of the Lactoperoxidase System and Cinnamon Essential Oil on Total Flora and Salmonella Growth Inhibition in Raw Milk

    Directory of Open Access Journals (Sweden)

    Chiraz Abbes

    2018-01-01

    Full Text Available Despite its antibacterial and antipathogenic effects, the heat treatment of milk induces undesirable changes that can be noted in the overall properties of ultrahigh temperature (UHT milk, such as changes in nutritional and organoleptic properties. Our goal is to find new nonthermal antibacterial technologies for the preservation of raw milk (RM. This study investigates the possible synergistic effect of using a combination of the lactoperoxidase system (LS and 3 μg mL−1 of cinnamon essential oil (cinnamon EO to inactivate the total flora of milk and Salmonella Hadar (S. Hadar. The LS was activated with 30 mg L−1 sodium percarbonate and 14 mg L−1 of sodium thiocyanate. Using this approach, we obtained a synergistic effect with a complete inhibition of the activity of the total flora of the milk and S. Hadar after 12 hours at 25°C. In addition, the attainment of synergy was defined when the inhibitory effect of the two compounds together was greater than the effect observed by each compound added alone. Moreover, the monitoring of the synergistic effect at 4°C for 5 days showed complete inhibition of total flora for 3 days and for S. Hadar it was up to 5 days. To summarize, the current study clearly identified a new inhibitory combination that may be used in food-based applications.

  8. Determination of protein concentration in raw milk by mid-infrared fourier transform infrared/attenuated total reflectance spectroscopy.

    Science.gov (United States)

    Etzion, Y; Linker, R; Cogan, U; Shmulevich, I

    2004-09-01

    This study investigates the potential use of attenuated total reflectance spectroscopy in the mid-infrared range for determining protein concentration in raw cow milk. The determination of protein concentration is based on the characteristic absorbance of milk proteins, which includes 2 absorbance bands in the 1500 to 1700 cm(-1) range, known as the amide I and amide II bands, and absorbance in the 1060 to 1100 cm(-1) range, which is associated with phosphate groups covalently bound to casein proteins. To minimize the influence of the strong water band (centered around 1640 cm(-1)) that overlaps with the amide I and amide II bands, an optimized automatic procedure for accurate water subtraction was applied. Following water subtraction, the spectra were analyzed by 3 methods, namely simple band integration, partial least squares (PLS) and neural networks. For the neural network models, the spectra were first decomposed by principal component analysis (PCA), and the neural network inputs were the spectra principal components scores. In addition, the concentrations of 2 constituents expected to interact with the protein (i.e., fat and lactose) were also used as inputs. These approaches were tested with 235 spectra of standardized raw milk samples, corresponding to 26 protein concentrations in the 2.47 to 3.90% (weight per volume) range. The simple integration method led to very poor results, whereas PLS resulted in prediction errors of about 0.22% protein. The neural network approach led to prediction errors of 0.20% protein when based on PCA scores only, and 0.08% protein when lactose and fat concentrations were also included in the model. These results indicate the potential usefulness of Fourier transform infrared/attenuated total reflectance spectroscopy for rapid, possibly online, determination of protein concentration in raw milk.

  9. Molecular characterization of Streptococcus agalactiae and Streptococcus uberis isolates from bovine milk.

    Science.gov (United States)

    Shome, Bibek Ranjan; Bhuvana, Mani; Mitra, Susweta Das; Krithiga, Natesan; Shome, Rajeswari; Velu, Dhanikachalam; Banerjee, Apala; Barbuddhe, Sukhadeo B; Prabhudas, Krishnamshetty; Rahman, Habibar

    2012-12-01

    Streptococci are one among the major mastitis pathogens which have a considerable impact on cow health, milk quality, and productivity. The aim of the present study was to investigate the occurrence and virulence characteristics of streptococci from bovine milk and to assess the molecular epidemiology and population structure of the Indian isolates using multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). Out of a total of 209 bovine composite milk samples screened from four herds (A-D), 30 Streptococcus spp. were isolated from 29 milk samples. Among the 30 isolates, species-specific PCR and partial 16S rRNA gene sequence analysis identified 17 Streptococcus agalactiae arising from herd A and 13 Streptococcus uberis comprising of 5, 7, and 1 isolates from herds B, C, and D respectively. PCR based screening for virulence genes revealed the presence of the cfb and the pavA genes in 17 and 1 S. agalactiae isolates, respectively. Similarly, in S. uberis isolates, cfu gene was present in six isolates from herd C, the pau A/skc gene in all the isolates from herds B, C, and D, whereas the sua gene was present in four isolates from herd B and the only isolate from herd D. On MLST analysis, all the S. agalactiae isolates were found to be of a novel sequence type (ST), ST-483, reported for the first time and is a single locus variant of the predicted subgroup founder ST-310, while the S. uberis isolates were found to be of three novel sequence types, namely ST-439, ST-474, and ST-475, all reported for the first time. ST-474 was a double locus variant of three different STs of global clonal complex ST-143 considered to be associated with clinical and subclinical mastitis, but ST-439 and ST-475 were singletons. Unique sequence types identified for both S. agalactiae and S. uberis were found to be herd specific. On PFGE analysis, identical or closely related restriction patterns for S. agalactiae ST-483 and S. uberis ST-439 in herds A and B

  10. Proteolysis, lipolysis, volatile compounds and sensory characteristics of Hispánico cheeses made using frozen curd from raw and pasteurized ewe milk.

    Science.gov (United States)

    Alonso, Rocío; Picon, Antonia; Gaya, Pilar; Nuñez, Manuel

    2013-02-01

    Hispánico cheese, manufactured from a mixture of cow and ewe milk, is representative of cheese varieties made using milk from more than one animal species in Mediterranean countries. The shortage of ewe milk production in autumn hinders the uniformity of Hispánico cheese composition throughout the year. To surmount this inconvenience of ewe milk seasonality, curds made in spring from raw and pasteurized ewe milk were stored frozen and used four months later for the manufacture of Hispánico cheese. Experimental cheeses were made by mixing fresh curd from pasteurized cow milk with thawed curd from raw or pasteurized ewe milk, and control cheese from a mixture of pasteurized cow and ewe milk in the same proportion. Characteristics of experimental and control cheeses throughout a 60-d ripening period were investigated. On the one hand, the experimental cheese containing frozen curd from raw ewe milk showed the highest counts of staphylococci, Gram-negative bacteria and coliforms, the highest levels of aminopeptidase and esterase activity, and the highest concentrations of free amino acids, free fatty acids, alcohols and esters. On the other, the experimental cheese containing frozen curd from pasteurized ewe milk had concentrations of free amino acids, free fatty acids and volatile compounds similar to those of control cheese, with the only exception being a higher level of ketones. Flavour intensity reached the highest scores in the experimental cheese containing frozen curd from raw ewe milk, followed by the experimental cheese containing frozen curd from pasteurized ewe milk. Flavour quality scores of both experimental cheeses were similar, and lower than those of control cheese.

  11. Recovering traditional raw-milk Tetilla cheese flavour and sensory attributes by using Kocuria varians and Yarrowia lipolytica adjunct cultures.

    Science.gov (United States)

    Centeno, J A; Garabal, J I; Docampo, F; Lorenzo, J M; Carballo, J

    2017-06-19

    The rationale of the present study was to evaluate the potential of microbial adjunct cultures including Kocuria varians and/or Yarrowia lipolytica strains in the recovery of the typical sensory profile of traditional (raw-milk) Tetilla cheese. Four batches of Tetilla cheese, a short ripened cows' milk cheese produced in Galicia (NW Spain), were made in duplicate from pasteurized milk inoculated with different microbial cultures. A control batch was manufactured by adding a mesophilic commercial D-starter only. The other three batches were made with the same starter after a cheese-milk pre-ripening step carried out with (i) an adjunct culture of K. varians, (ii) an adjunct culture of Y. lipolytica, or (iii) a combination of both adjunct cultures. The highest pH and water activity values, associated with softer textures were determined in the cheeses manufactured with the Y. lipolytica adjunct after 21days of ripening. The contents of the volatile compounds 3-methylbutanol, dimethyl disulfide and dimethyl trisulfide were higher in the cheeses made with only the K. varians adjunct than in the cheeses made with the only yeast adjunct and in the control cheeses. The contents of hexanoic and octanoic acids were highest in the cheeses made with the Y. lipolytica adjunct, and levels of ethyl hexanoate, ethyl octanoate and ethyl decanoate were higher in the cheeses made with only the yeast adjunct than in the other batches of cheese. The cheeses manufactured with both adjunct cultures were awarded the highest scores for flavour and overall sensory parameters (considering the standards of the traditional product) and were considered very similar to 'good quality' artisanal raw-milk cheeses. We conclude that use of selected Micrococcaceae and Y. lipolytica strains as adjunct cultures would differentiate the sensory properties and contribute to the quality and typicality of the short-ripened rennet-curd Galician Tetilla and Arzúa-Ulloa cheeses. Copyright © 2017 Elsevier B

  12. Prevalence and molecular characteristics of Staphylococcus aureus, including methicillin resistant strains, isolated from bulk can milk and raw milk products in pastoral communities of South-West Uganda.

    Science.gov (United States)

    Asiimwe, Benon B; Baldan, Rossella; Trovato, Alberto; Cirillo, Daniela M

    2017-06-13

    Staphylococcus aureus strains are now regarded as zoonotic agents. In pastoral settings where human-animal interaction is intimate, multi-drug resistant microorganisms have become an emerging zoonotic issue of public health concern. The study of S. aureus prevalence, antimicrobial resistance and clonal lineages in humans, animals and food in African settings has great relevance, taking into consideration the high diversity of ethnicities, cultures and food habits that determine the lifestyle of the people. Little is known about milk carriage of methicillin resistant S. aureus strains (MRSA) and their virulence factors in Uganda. Here, we present the prevalence of MRSA in bulk can milk and raw milk products in pastoral communities of south-west Uganda. We also present PFGE profiles, spa-types, as well as frequency of enterotoxins genes. S. aureus was identified by the coagulase test, susceptibility testing by the Kirby-Bauer disc diffusion and E-test methods and MRSA by detection of the mecA gene and SCCmec types. The presence of Panton - Valentine Leucocidin (PVL) genes and staphylococcal enterotoxins was determined by PCR, while genotyping was by PFGE and spa typing. S. aureus were isolated from 30/148 (20.3%) milk and 11/91(12%) sour milk samples. mecA gene carriage, hence MRSA, was detected in 23/41 (56.1%) of the isolates, with 21 of the 23 (91.3%) being SCCmec type V; while up to 30/41 (73.2%) of the isolates were resistant to tetracycline. Only five isolates carried the PVL virulence gene, while PFGE typing revealed ten clusters (ranging from two seven isolates each) that comprised 83% of the sample, and only eight isolates with unique pulsotypes. The largest PFGE profile (E) consisted of seven isolates while t7753, t1398, and t2112 were the most common spa-types. Thirty seven of the 41 strains (90.2%) showed at least one of the eight enterotoxin genes tested, with sem 29 (70.7%), sei 25 (61%) and seg 21 (51.2%) being the most frequently observed genes. This

  13. INTERNAL MILIEAU OF DAIRY COWS AT THE BEGINNING OF LACTATION AND ITS INFLUENCE ON COMPOSITION OF RAW MILK

    Directory of Open Access Journals (Sweden)

    Tušimová Eva

    2015-02-01

    between serum ALT and milk sodium (0.738; P<0.05, what points to close relationship between hepatic enzymes and mineral composition of raw milk.

  14. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL producing Enterobacteriaceae in food producing animals, minced meat and raw milk

    Directory of Open Access Journals (Sweden)

    Geser Nadine

    2012-03-01

    Full Text Available Abstract Background The impact of food animals as a possible reservoir for extended-spectrum beta-lactamase (ESBL producing Enterobacteriaceae, and the dissemination of such strains into the food production chain need to be assessed. In this study 334 fecal samples from pigs, cattle, chicken and sheep were investigated at slaughter. Additionally, 100 raw milk samples, representing bulk tank milk of 100 different dairy farms, 104 minced meat (pork and beef samples and 67 E. coli isolates from cattle E. coli mastitis were analyzed. Results As many as 15.3% of the porcine, 13.7% of the bovine, 8.6% of the sheep and 63.4% of the chicken fecal samples yielded ESBL producers after an enrichment step. In contrast, none of the minced meat, none of the bulk tank milk samples and only one of the mastitis milk samples contained ESBL producing strains. Of the total of 91 isolates, 89 were E. coli, one was Citrobacter youngae and one was Enterobacter cloacae. PCR analysis revealed that 78 isolates (85.7% produced CTX-M group 1 ESBLs while six isolates (6.6% produced CTX-M group 9 enzymes. Five detected ESBLs (5.5% belonged to the SHV group and 2 isolates (2.2% contained a TEM-type enzyme. A total of 27 CTX-M producers were additionally PCR-positive for TEM-beta-lactamase. The ESBL-encoding genes of 53 isolates were sequenced of which 34 produced CTX-M-1, 6 produced CTX-M-14, 5 produced CTX-M-15 and also 5 produced SHV-12. Two isolates produced TEM-52 and one isolate expressed a novel CTX-M group 1 ESBL, CTX-M-117. One isolate--aside from a CTX-M ESBL-- contained an additional novel TEM-type broad-spectrum beta-lactamase, TEM-186. Conclusions The relatively high rates of ESBL producers in food animals and the high genetic diversity among these isolates are worrisome and indicate an established reservoir in farm animals.

  15. Seasonal Variability of Thermophilic Campylobacter Spp. in Raw Milk Sold by Automatic Vending Machines in Lombardy Region.

    Science.gov (United States)

    Bertasi, Barbara; Losio, Marina Nadia; Daminelli, Paolo; Finazzi, Guido; Serraino, Andrea; Piva, Silvia; Giacometti, Federica; Massella, Elisa; Ostanello, Fabio

    2016-06-03

    In temperate climates, a seasonal trend was observed in the incidence of human campylobacteriosis cases, with peaks reported in spring and autumn in some countries, or in summer in others; a similar trend was observed in Campylobacter spp. dairy cattle faecal shedding, suggesting that cattle may play a role in the seasonal peak of human infection. The objectives of this study were to assess if a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk exists and to evaluate a possible relation between this and the increase of human campylobacteriosis incidence in summer months. The results showed a mean prevalence of 1.6% of milk samples positive for thermophilic Campylobacter spp. with a wide range (0.0-3.1%) in different months during the three years considered. The statistical analysis showed a significant difference (P<0.01) of the prevalence of positive samples for thermophilic Campylobacter spp. between warmer and cooler months (2.3 vs 0.6%). The evidence of a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk sold for direct consumption, with an increase of the prevalence in warmer months, may represent one of the possible links between seasonal trend in cattle faecal shedding and seasonal trend in human campylobacteriosis.

  16. Seasonal variability of thermophilic Campylobacter spp. in raw milk sold by automatic vending machines in Lombardy Region

    Directory of Open Access Journals (Sweden)

    Barbara Bertasi

    2016-06-01

    Full Text Available In temperate climates, a seasonal trend was observed in the incidence of human campylobacteriosis cases, with peaks reported in spring and autumn in some countries, or in summer in others; a similar trend was observed in Campylobacter spp. dairy cattle faecal shedding, suggesting that cattle may play a role in the seasonal peak of human infection. The objectives of this study were to assess if a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk exists and to evaluate a possible relation between this and the increase of human campylobacteriosis incidence in summer months. The results showed a mean prevalence of 1.6% of milk samples positive for thermophilic Campylobacter spp. with a wide range (0.0-3.1% in different months during the three years considered. The statistical analysis showed a significant difference (PCampylobacter spp. between warmer and cooler months (2.3 vs 0.6%. The evidence of a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk sold for direct consumption, with an increase of the prevalence in warmer months, may represent one of the possible links between seasonal trend in cattle faecal shedding and seasonal trend in human campylobacteriosis.

  17. Identification of Staphylococus aureus genes expressed during growth in milk : a useful model for selection of genes important in bovine mastitis?

    NARCIS (Netherlands)

    Lammers, A.; Kruijt, E.; Kuijt, van de C.; Nuijten, P.J.M.; Smith, H.E.

    2000-01-01

    Staphylococcus aureus is a major cause of bovine mastitis. Since gene expression of many bacteria is known to be regulated by the environment, milk may play an important role in the regulation of the early steps in the pathogenesis of bovine mastitis by S. aureus. To get insight into the response of

  18. Total tract nutrient digestion and milk fatty acid profile of dairy cows fed diets containing different levels of whole raw soya beans.

    Science.gov (United States)

    Venturelli, B C; de Freitas Júnior, J E; Takiya, C S; de Araújo, A P C; Santos, M C B; Calomeni, G D; Gardinal, R; Vendramini, T H A; Rennó, F P

    2015-12-01

    Whole oilseeds such as soya beans have been utilized in dairy rations to supply additional fat and protein. However, antinutritional components contained in soya beans, such as trypsin inhibitors and haemagglutinins (lectins) may alter digestibility of nutrients and consequently affect animal performance. The objective of the present experiment was to quantify the effect of different levels of whole raw soya beans in diets of dairy cows on nutrient intake, total tract digestion, nutrient balances and milk yield and composition. Sixteen mid to late-lactation cows (228 ± 20 days in milk; mean ± SD) were used in four replicated 4 × 4 Latin square design experiment with 21-d periods. Cows were assigned to each square according to milk yield and DIM. The animals were randomly allocated to treatments: control (without soya beans addition; CO), WS9, WS18 and WS27, with addition of 9%, 18% and 27% of whole raw soya bean in diet on a dry matter (DM) basis respectively. All diets contained identical forage and concentrate components and consisted of maize silage and concentrate based on ground corn and soya beans at a ratio of 60:40. There were no differences in OM, CP, NDF and NEL intakes (kg/day and MJ/day) among the treatments (p > 0.05). However, DM and NFC intakes were negatively affected (p = 0.04 and p raw soya beans for EE (p raw soya beans. However, the nutritive characteristics of excreted grains were not altered. Milk (kg), milk lactose (kg) and protein (kg) yield decreased linearly (p milk fat content (%) increased linearly (p raw soya beans inclusion. Increasing addition of whole raw soya beans affected milk fatty acid profile with a linear decrease of cis-9-trans 11CLA and total saturated FA; and linear increase of total unsaturated and C18:3 FA. Energy balance was positively affected (p = 0.03) by whole raw soya beans as well as efficiency of NEL milk/DE intake (p = 0.02). Nitrogen balance and microbial protein synthesis were not affected by whole raw soya

  19. Direct screening of tetracyclines in water and bovine milk using room temperature phosphorescence detection

    International Nuclear Information System (INIS)

    Traviesa-Alvarez, J.M.; Costa-Fernandez, J.M.; Pereiro, R.; Sanz-Medel, A.

    2007-01-01

    A fast and simple flow-through optosensor was designed and characterized for the direct screening of four tetracycline (TCC) antibiotics (tetracycline, oxytetracycline, chlortetracycline and doxycycline) in water and bovine milk samples. The proposed optosensor provides rapid binary yes/no overall responses, being appropriate for the screening of this family of antibiotics above or below a pre-set concentration threshold. The experimental set-up is based on a flow-injection manifold coupled on-line to a phosphorescence detector. Aliquots of the samples are pretreated with Eu(III) to form room temperature phosphorescent metal chelates and injected in the flow manifold. Those chelates are then on-line retained on a conventional flow-cell (packed with polymeric Amberlite XAD-4 particles) which is placed inside the cell holder of the phosphorimeter. After the emission is registered, the antibiotic-metal complexes are eluted from the packed resin with 1 M HCl (for milk samples a second regeneration step, using methanol, should be performed). A sample throughput of about 20 samples per hour was obtained. Optimum experimental conditions include a pH 9, a Eu(III) concentration of 2 x 10 -4 M and 8 mM sodium sulphite as chemical deoxygenant. The phosphorescence emitted by the europium-TCC complexes was measured at 394 and 617 nm for excitation and emission wavelengths, respectively. The unreliability region, given by the probability of false positives and false negatives, respectively (set at 5% in both cases) was in the range between 0.2 and 11.6 nM for detection of tetracyclines in water samples (at a cut-off level of 4 nM) and in the range between 165 and 238 nM for detection of tetracyclines in milk (cut-off level fixed at the normative EU level of 200 nM). Finally, the applicability of the proposed screening optosensor was tested for the reliable control of tetracyclines in contaminated and uncontaminated water and milk samples

  20. Direct screening of tetracyclines in water and bovine milk using room temperature phosphorescence detection

    Energy Technology Data Exchange (ETDEWEB)

    Traviesa-Alvarez, J M [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Costa-Fernandez, J M [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Pereiro, R [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Sanz-Medel, A [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain)

    2007-04-18

    A fast and simple flow-through optosensor was designed and characterized for the direct screening of four tetracycline (TCC) antibiotics (tetracycline, oxytetracycline, chlortetracycline and doxycycline) in water and bovine milk samples. The proposed optosensor provides rapid binary yes/no overall responses, being appropriate for the screening of this family of antibiotics above or below a pre-set concentration threshold. The experimental set-up is based on a flow-injection manifold coupled on-line to a phosphorescence detector. Aliquots of the samples are pretreated with Eu(III) to form room temperature phosphorescent metal chelates and injected in the flow manifold. Those chelates are then on-line retained on a conventional flow-cell (packed with polymeric Amberlite XAD-4 particles) which is placed inside the cell holder of the phosphorimeter. After the emission is registered, the antibiotic-metal complexes are eluted from the packed resin with 1 M HCl (for milk samples a second regeneration step, using methanol, should be performed). A sample throughput of about 20 samples per hour was obtained. Optimum experimental conditions include a pH 9, a Eu(III) concentration of 2 x 10{sup -4} M and 8 mM sodium sulphite as chemical deoxygenant. The phosphorescence emitted by the europium-TCC complexes was measured at 394 and 617 nm for excitation and emission wavelengths, respectively. The unreliability region, given by the probability of false positives and false negatives, respectively (set at 5% in both cases) was in the range between 0.2 and 11.6 nM for detection of tetracyclines in water samples (at a cut-off level of 4 nM) and in the range between 165 and 238 nM for detection of tetracyclines in milk (cut-off level fixed at the normative EU level of 200 nM). Finally, the applicability of the proposed screening optosensor was tested for the reliable control of tetracyclines in contaminated and uncontaminated water and milk samples.

  1. Assess the prevalence rate of Campylobacter genus and Campylobacter jejuni species in raw milk collected from the Amol City by Multiplex- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ali Dabiri

    2016-03-01

    Full Text Available Background & Objective: Campylobacter can be transmitted through the raw milk. The purpose of this study was to determine the prevalence of Campylobacter genus and Campylobacter jejuni (C. jejuni species in raw milk samples. Materials & Methods: In this study, 72 samples of raw milk were collected of the platforms milk in the Amol city in summer. Phenotypic identification of Campylobacter genus and C. jejuni species using microbiology laboratory methods and molecular identification of this bacterium using Multiplex- Polymerase Chain Reaction (M-PCR were performed. The data was calculated using the SPSS 16.0 software and the Fisher's exact test (p < 0.05. Results: Among the 72 samples, 13.88% of samples were contaminated with C. jejuni and 2.77% were contaminated with Campylobacter genus. The highest prevalence rate for this bacterium was in July (20.83% and the lowest prevalence rate was in September (12.5%. The significant difference between the prevalence of the Campylobacter genus and C. jejuni species in raw milk samples in various months of summer was not observed (p = 0.07. Conclusion: This study showed the raw milk contamination with Campylobacter, and thereby the sanitation in the dairy food production places and the use of fast and accurate method to identify this bacterium is important.

  2. Distinct composition of bovine milk from Jersey and Holstein-Friesian cows with good, poor or non-coagulation properties as reflected in protein genetic variants and isoforms

    DEFF Research Database (Denmark)

    Jensen, Hanne Bak; Poulsen, Nina Aagaard; Andersen, Kell Kleiner

    2012-01-01

    The objective of this study was to examine variation in overall milk, protein, and mineral composition of bovine milk in relation to rennet-induced coagulation, with the aim of elucidating the underlying causes of milk with impaired coagulation abilities. On the basis of an initial screening of 892...... of minerals (Ca, P, Mg) were identified in poorly coagulating and noncoagulating milk in comparison with milk with good coagulation properties. Liquid chromatography/electrospray ionization-mass spectrometry revealed the presence of a great variety of genetic variants of the major milk proteins, namely, αS1...... milk samples from 42 herds with Danish Jersey and Holstein-Friesian cows, a subset of 102 samples was selected to represent milk with good, poor, or noncoagulating properties (i.e., samples that within each breed represented the most extremes in regard to coagulation properties). Milk with good...

  3. Fatty acid profile and health lipid indices in the raw milk of ewes ...

    African Journals Online (AJOL)

    indoor or part-time grazing) of ewes and dietary supplementation with hemp seed (non-drug varieties of Cannabis sativa L.) on milk production and the composition of milk fatty acids (FAs). The experimental diets were constituted as a 2 x 2 factorial ...

  4. Occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM) in raw and pasteurized milk in the northwestern region of Paraná, Brazil.

    Science.gov (United States)

    Sgarioni, Sônia Aparecida; Hirata, Rosario Dominguez Crespo; Hirata, Mario Hiroyuki; Leite, Clarice Queico Fujimura; de Prince, Karina Andrade; de Andrade Leite, Sergio Roberto; Filho, Dirceu Vedovello; Siqueira, Vera Lucia Dias; Caleffi-Ferracioli, Katiany Rizzieri; Cardoso, Rosilene Fressatti

    2014-01-01

    Milk is widely consumed in Brazil and can be the vehicle of agent transmission. In this study, was evaluated the occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM) in raw and pasteurized milk consumed in the northwestern region of Paraná, Brazil. Fifty-two milk samples (20 pasteurized and 32 raw) from dairy farms near the municipality of Maringa, Parana State, Brazil were collected. Milk samples were decontaminated using 5% oxalic acid method and cultured on Lowenstein-Jensen and Stonebrink media at 35 °C and 30 °C, with and without 5-10% CO2. Mycobacteria isolates were identified by morphological features, PCR-Restriction Fragment Length Polymorphism Analysis (PCR-PRA) and Mycolic acids analysis. Thirteen (25%) raw and 2 (4%) pasteurized milk samples were positive for acid fast bacilli growth. Nine different species of NTM were isolated (M. nonchromogenicum, M. peregrinum, M. smegmatis, M. neoaurum, M. fortuitum, M. chelonae, M. flavescens, M. kansasii and M. scrofulaceum). M. bovis was not detected. Raw and pasteurized milk may be considered one source for NTM human infection. The paper reinforces the need for intensification of measures in order to avoid the milk contamination and consequently prevent diseases in the south of Brazil.

  5. Occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM in raw and pasteurized milk in the northwestern region of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Sônia Aparecida Sgarioni

    2014-06-01

    Full Text Available Milk is widely consumed in Brazil and can be the vehicle of agent transmission. In this study, was evaluated the occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM in raw and pasteurized milk consumed in the northwestern region of Paraná, Brazil. Fifty-two milk samples (20 pasteurized and 32 raw from dairy farms near the municipality of Maringa, Parana State, Brazil were collected. Milk samples were decontaminated using 5% oxalic acid method and cultured on Lowenstein-Jensen and Stonebrink media at 35 °C and 30 °C, with and without 5-10% CO2. Mycobacteria isolates were identified by morphological features, PCR-Restriction Fragment Length Polymorphism Analysis (PCR-PRA and Mycolic acids analysis. Thirteen (25% raw and 2 (4% pasteurized milk samples were positive for acid fast bacilli growth. Nine different species of NTM were isolated (M. nonchromogenicum, M. peregrinum, M. smegmatis, M. neoaurum, M. fortuitum, M. chelonae, M. flavescens, M. kansasii and M. scrofulaceum. M. bovis was not detected. Raw and pasteurized milk may be considered one source for NTM human infection. The paper reinforces the need for intensification of measures in order to avoid the milk contamination and consequently prevent diseases in the south of Brazil.

  6. LC-MS/MS analysis of permethylated free oligosaccharides and N-glycans derived from human, bovine, and goat milk samples.

    Science.gov (United States)

    Dong, Xue; Zhou, Shiyue; Mechref, Yehia

    2016-06-01

    Oligosaccharides in milk not only provide nutrition to the infants but also have significant immune biofunctions such as inhibition of pathogen binding to the host cell. The main component in milk oligosaccharides is free oligosaccharides. Since the proteins in milk are highly glycosylated, N-glycans in milk also play an import role. In this study, we investigated the permethylated free oligosaccharides and N-glycans extracted from bovine, goat, and human milks using LC-MS/MS. Quantitation profiles of free oligosaccharides and N-glycans were reported. The number of free oligosaccharides observed in bovine, goat, and human milk samples (without isomeric consideration) were 11, 8, and 11, respectively. Human milk had more complex free oligosaccharides structures than the other two milk samples. Totally 58, 21, and 43 N-glycan structures (without isomeric consideration) were associated with whey proteins extracted from bovine, goat, and human milk samples, respectively. Bovine milk free oligosaccharides and N-glycans from whey proteins were highly sialylated and to a lesser extend fucosylated. Goat and human milk free oligosaccharides and N-glycans from whey proteins were both highly fucosylated. Also, the isomeric glycans in milk samples were determined by porous graphitic carbon LC at elevated temperatures. For example, separation of human milk free oligosaccharide Gal-GlcNAc-(Fuc)-Gal-Glc and Gal-GlcNAc-Gal-Glc-Fuc isomers was achieved using porous graphitic carbon column. Permethylation of the glycan structures facilitated the interpretation of MS/MS. For example, internal cleavage and glycosidic bond cleavage are readily distinguished in the tandem mass spectra of permethylated glycans. This feature resulted in the identification of several isomers. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. The effect of parity on the proportion of important healthy fatty acids in raw milk of Holstein cows

    Directory of Open Access Journals (Sweden)

    Luděk Stádník

    2013-11-01

    Full Text Available The objective of this study was to determine and evaluate the effect of parity on the fatty acids groups’ proportion in Holstein cows’ milk during the first phase of lactations, with an emphasis on its potential importance for consumer health. A total of 25 Holstein cows, 9 primiparous, 9 in the 2nd, and 7 in the 3rd and subsequent parity, were observed and sampled at 7-day intervals through the first 17 weeks of lactation. The percentage proportion of saturated (hypercholesterolemic and volatile as its components and unsaturated (monounsaturated and polyunsaturated as its components fatty acids in the samples of milk fat (n=425 was determined. The effects of parity and negative energy balance, as well as regression, on the lactation week and the fat to protein ratio were evaluated using SAS 9.3. A significantly (P<0.01 lower proportion of unhealthy hypercholesterolemic fatty acids was detected in primiparous cows (-2.67 % and those in the 3rd and subsequent lactation (-2.94 % compared to the 2nd lactation, as well as a simultaneously higher proportion of healthy unsaturated fatty acids (+2.07, respectively +3.08 %. The determined relationships corresponded to organism stress evoked by the initiation of milk production and its maintenance in higher parities. Therefore, the generally required prolongation of dairy cows’ longevity can influence on the quality of raw milk, especially considering composition of fatty acids.

  8. Correlation between somatic cell count and chemical composition of cooled raw milk in properties of Rio Grande do Norte, Brazil

    Directory of Open Access Journals (Sweden)

    Adriano Henrique do Nascimento Rangel

    2014-06-01

    Full Text Available Due to the damage caused by subclinical mastitis in loss of production and quality of milk, the present study aimed to verify the correlation between somatic cell count (SCC and the chemical composition of cooled raw milk collected in the Agreste region of Rio Grande do Norte, Brazil, in drought and rain seasons. Samples were collected in seven dairy farms during morning time, between January 2010 and March 2012, and sent to the Brazilian et of Milk Quality Laboratory (ESALQ/USP. The contents of protein, fat, lactose, casein, total solids, nonfat dry extract and urea nitrogen, besides of SCC and total bacterial count were performed. Data were submitted to analysis of variance, correlation analysis and comparison of means by Tuckey test , 5%. The average SCC was 604,000 cells/mL and had significant variation in the dry period (558 000 cells/mL and rainy (650 000 cells/mL. The SCC was positively correlated with fat and total solids but negatively with the lactose cow’s milk of bulk tank, regardless of the season in the Agreste of Rio Grande do Norte.

  9. Characteristics of Aerococcus viridans isolated from bovine subclinical mastitis and its effect on milk SCC, yield, and composition.

    Science.gov (United States)

    Sun, Meng; Gao, Jian; Ali, Tariq; Yu, Dan; Zhang, Shiyao; Khan, Saeed U; Fanning, Séamus; Han, Bo

    2017-04-01

    Aerococcus viridians (A. viridans), an environmental Gram-positive bacterium, has been documented to be associated with bovine mastitis. However, its exact role in bovine mastitis and the changes it brings about in milk characteristics are not yet known. The objectives of the current study were to describe the antibiotic resistance of A. viridans from bovine mastitis as well as the correlation between existence of this pathogen in udders and the somatic cell counts (SCC), daily milk yield, and composition of individual cow. One-year sampling for subclinical mastitis composite milk was conducted based on monthly DHI data from September 2013 to August 2014, in a commercial herd located in Beijing, China. All samples were cultured and pathogens were identified using microbiology method. A. viridians isolates were further identified by API identification system and 16S ribosomal RNA (rRNA) sequencing method. Kirby-Bauer disk diffusion method was used to test the antibiotic resistance of A. viridians against kinds of antimicrobial substance. SCC, milk yield, and milk composition data were from monthly Dairy Herd Improvement (DHI) results. Results showed that a total of 279 (16.67%) A. viridans isolates were identified from among 1674 bacterial isolates cultured from milk samples with high SCC. The incidence of mastitis caused by A. viridans was the highest (48-53%) during the summer season. Majority of the isolates were susceptible to most of antimicrobial compounds tested, especially to β-lactams, but were found to be resistant (50-90%) to aminoglycosides, sulfonamides, and tetracycline. The average SCC of the A. viridans infected cows was significantly higher (1000.0 × 10 3  cells/mL) (P  0.05) by 1.86 kg/day. Reductions were also observed in fat content (P > 0.05), lactose (P  0.05), whereas protein content increased significantly (P bovine subclinical mastitis wherein it exerts an effect on SCC, milk yield, and composition.

  10. Molecular characterization and antibiotic resistance of enterotoxigenic and entero-aggregative Escherichia coli isolated from raw milk and unpasteurized cheeses

    Directory of Open Access Journals (Sweden)

    Mojtaba Bonyadian

    2014-04-01

    Full Text Available The aim of this study was to determine the occurrence of enterotoxigenic and enteroaggregative Escherichia coli strains and antibiotic resistance of the isolates in raw milk and unpasteurized cheese. Out of 200 samples of raw milk and 50 samples of unpasteurized cheeses, 96 and 24 strains of E. coli were isolated, respectively. Polymerase chain reaction (PCR was used to detect the genes encoding heat-stable enterotoxin a (STa, heat-stable enterotoxin b (STb, heat labile toxin (LT and enteroaggregative heat-stable toxin1 (EAST1. Twelve out of 120 (10.00% isolates harbored the gene for EAST1, 2(1.66% isolates were detected as producing STb and LT toxins and 12 (10.00% strains contained STb and EAST1 genes. None of the strains contain the STa gene. All of the strains were tested for antibiotic resistance by disk diffusion method. Disks included: ciprofloxacin (CFN, trimetoprim-sulfamethoxazole (TSX, oxytetracycline (OTC, gentamicin (GMN, cephalexin (CPN, nalidixic acid (NDA and nitrofurantoin (NFN, ampicillin (AMP, neomycin (NEO and streptomycin (STM. Among 120 isolated strains of E. coli, the resistance to each antibiotics were as follows: OTC100%, CPN 86.00%, NDA 56.00%, NFN 42.00%, GMN 30.00%, TSX 28.00%, CFN 20%, AM 23.40% and STM 4.25%. None of the isolates were resistant to NEO. The present data indicate that different resistant E. coli pathogens may be found in raw milk and unpasteurized cheese. It poses an infection risk for human and transferring the resistant factors to microflora of the consumers gut.

  11. Bovine colostrum improves neonatal growth, digestive function, and gut immunity relative to donor human milk and infant formula in preterm pigs

    DEFF Research Database (Denmark)

    Rasmussen, Stine Ostenfeldt; Martin, Lena; Østergaard, Mette Viberg

    2016-01-01

    Mother's own milk is the optimal first diet for preterm infants, but donor human milk (DM) or infant formula (IF) is used when supply is limited. We hypothesized that a gradual introduction of bovine colostrum (BC) or DM improves gut maturation, relative to IF during the first 11 days after preterm...

  12. Prevalence and Antimicrobial Susceptibility Profiles of Pathogen Isolated from Bovine Mastitis Milk in Transylvania, Romania

    Directory of Open Access Journals (Sweden)

    Cosmina Bouari

    2016-11-01

    Full Text Available Mastitis in cows, one of the most common and economically important infectious diseases of dairy cattle, all over the world, with significant impact due to economic losses, occurs when the udder becomes inflamed because the leukocytes are released into the mammary gland usually in response to bacteria invasion of the teat canal. The main objective of this study was to evaluate the in vitro antimicrobial susceptibility of bacteria isolated from milk in order to design specific control programs for bovine mastitis in this area. A total of 204 milk samples aseptically collected both from farms and private owners were processed during May 2014 and March 2016 within the Microbiology Laboratory of the Faculty of Veterinary Cluj-Napoca, Romania. The microbiological examination was carried out by inoculation on blood agar and MacConkey medium. After the overnight incubation in aerobic conditions, the identification of the isolates was performed using microscopic, cultural and biochemical methods. Biochemical identification was based on API 20 Biomerieux system. Susceptibility to antibiotics was evaluated using Kirby Bauer disk diffusion method on Mueller-Hinton agar; the antibiotics were represented by Amoxicillin and Clavulanic Acid, Ceftiofur, Florfenicol, Mastidiscs, Enrofloxacin, Penicillin and Tetracycline. Staphylococcus spp. was the most common isolated pathogen, in 54.9% of the specimens, followed by Streptococcus spp. in 20.1%, Escherichia coli in 10.78%, Klebsiella spp. in 8.34%, Bacillus spp. in 5.88%. The most frequent associations were represented by staphylococci-streptococci in 62.7% of the samples, followed by streptococci-bacillus in 19.8% of the samples. The most important etiological agents identified were Staphylococcus aureus, S uberis, Streptococcus agalactiae, and Escherichia coli. Antimicrobial susceptibility test for the total isolates revealed good sensitivity to Enrofloxacin, Mastidiscs and Amoxicillin and Clavulanic Acid

  13. Detection of Salmonella spp., Candida albicans, Aspergillus spp., and Antimicrobial Residues in Raw and Processed Cow Milk from Selected Smallholder Farms of Zimbabwe

    Directory of Open Access Journals (Sweden)

    Tryness Anastazia Mhone

    2012-01-01

    Full Text Available A cross-sectional study was conducted to detect the presence of Salmonella spp., Candida albicans, Aspergillus spp., and antimicrobial residues in raw milk (n=120 and processed cow milk (n=20 from smallholder dairy farms from three sites in Zimbabwe. Culture and isolation of Salmonella spp., C. albicans, and Aspergillus spp. were performed using selective media, while antimicrobial residues were detected by a dye reduction test. No Salmonella, but C. albicans (17.5%; 21/120, Aspergillus spp. (0.8%; 1/120, and antimicrobial residues (2.5%; 3/120 were detected from raw milk. C. albicans was isolated from all three sites, while Aspergillus spp. and antimicrobial residues were detected from sites 1 and 3, respectively. From processed milk, only C. albicans (5% was isolated while Aspergillus spp. and antimicrobial residues were not detected. These results suggested low prevalence of Salmonella spp. and Aspergillus spp. and a relatively high prevalence of C. albicans in raw milk from the smallholder farms. The potential public health risks of C. albicans and the detected antimicrobial residues need to be considered. Thus, educating farmers on improving milking hygiene and storage of milk and establishing programmes for monitoring antimicrobial residues may help to improve the safety of milk from smallholder farms.

  14. Evaluation of Brucella contamination in raw milk in Kerman dairy farms by PCR

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2016-10-01

    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. In endemic developing countries, dairy products produced from untreated milk are a potential threat to public health. The aim of this study was to detect brucellae in milk from dairy cattle farms in Kerman (Iran. Methods: Forthy and eight Bulk Tank Milk (BTM  were collected from 48 dairy cattle farm including 4200 cow. All milk samples were examined by PCR to detect Brucella-specific DNA. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp from 48 BTM samples in this area.. Conclusions: The detection of Brucella DNA in milk for human consumption, especially the highly pathogenic species B. melitensis, is of obvious concern. The shedding of Brucella spp. in milk poses an increasing threat to consumers in Iran. Consumption of dairy products produced from non-pasteurized milk by individual farmers operating under poor hygienic conditions represents an unacceptable risk to public health.

  15. A Comparative Study on Physicochemical Characteristics of Raw Goat Milk Collected from Different Farms in Malaysia.

    Science.gov (United States)

    Jaafar, Syarifah Hazirah Syd; Hashim, Roshada; Hassan, Zaiton; Arifin, Norlelawati

    2018-03-01

    This study was conducted to determine the physical and chemical composition of goat milk produced by eight local farms located in the central region of Malaysia. Farms 1 to 4 (F1-SC, F2-SP, F3-SP, F4-SBC) reared Saanen-type goats while farms 5 to 8 (F5-JK, F6-JPEC, F7-JTC, F8-JC), Jamnapari-type goats. The common feedstuffs used in all farms comprised of fresh or silage from Napier grass, feed pellets, and brans while two farms, F5-JK and F6-JPEC supplemented the feeds with soybean-based product. The total solid content, dry matter, and proximate composition of goat milk and feedstuffs from the different farms were determined and the results analysed using principal component analysis. Total solid content of goat milk from the Jamnapari crossbreed had the highest solid content ranging from 11.81% to 17.54% compared to milk from farms with Saanen and Saanen crossbreed (10.95% to 14.63%). Jamnapari-type goats from F5-JK, F6-JPEC, and F8-JC had significantly higher ( p milk fat and protein contents (7.36%, 7.14%, and 6.59% fat; 5.08%, 6.19%, and 4.23% protein, respectively) than milk from other farms but, milk produced by Saanen-type goats from F4-SBC contained similar protein content (4.34%) to that from F8-JC. Total ash and carbohydrate contents in milk ranged between 0.67% to 0.86% and 3.26% to 4.71%, respectively, regardless of goat breed. Feeding soybean-based products appear to have a positive influence on milk fat and protein content in Jamnaparitype goats.

  16. A Comparative Study on Physicochemical Characteristics of Raw Goat Milk Collected from Different Farms in Malaysia

    Science.gov (United States)

    Jaafar, Syarifah Hazirah Syd; Hashim, Roshada; Hassan, Zaiton; Arifin, Norlelawati

    2018-01-01

    This study was conducted to determine the physical and chemical composition of goat milk produced by eight local farms located in the central region of Malaysia. Farms 1 to 4 (F1-SC, F2-SP, F3-SP, F4-SBC) reared Saanen-type goats while farms 5 to 8 (F5-JK, F6-JPEC, F7-JTC, F8-JC), Jamnapari-type goats. The common feedstuffs used in all farms comprised of fresh or silage from Napier grass, feed pellets, and brans while two farms, F5-JK and F6-JPEC supplemented the feeds with soybean-based product. The total solid content, dry matter, and proximate composition of goat milk and feedstuffs from the different farms were determined and the results analysed using principal component analysis. Total solid content of goat milk from the Jamnapari crossbreed had the highest solid content ranging from 11.81% to 17.54% compared to milk from farms with Saanen and Saanen crossbreed (10.95% to 14.63%). Jamnapari-type goats from F5-JK, F6-JPEC, and F8-JC had significantly higher (p < 0.05) milk fat and protein contents (7.36%, 7.14%, and 6.59% fat; 5.08%, 6.19%, and 4.23% protein, respectively) than milk from other farms but, milk produced by Saanen-type goats from F4-SBC contained similar protein content (4.34%) to that from F8-JC. Total ash and carbohydrate contents in milk ranged between 0.67% to 0.86% and 3.26% to 4.71%, respectively, regardless of goat breed. Feeding soybean-based products appear to have a positive influence on milk fat and protein content in Jamnaparitype goats. PMID:29644024

  17. Neutral cleanup procedure for 2,3,7,8-tetrachlorodibenzo-p-dioxin residues in bovine fat and milk.

    Science.gov (United States)

    O'Keefe, P W; Meselson, M S; Baughman, R W

    1978-05-01

    A neutral cleanup method for 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in milk and animal tissue was developed involving solvent extraction and liquid adsorption chromatography on magnesia-Celite 545, alumina, and Florisil. Cleaned up extracts were subjected to dual-ion analysis in a direct probe high resolution mass spectrometer, interfaced to a multi-channel analyzer for signal averaging. Calibration experiments were carried out with bovine milk and beef fat samples containing added TCDD. The 37CI isotopic isomer of TCDD was added as an internal standard. The response was linear for concentrations in the ppt range, with recoveries about 80%. Milk from a cow fed TCDD was cleaned up by the neutral procedure or, alternatively, a base-acid extraction procedure. The TCDD recoveries for both procedures were essentially the same. Recoveries of TCDD from liver samples of a rat given 14C-TCDD intraperitoneally, subjected to neutral cleanup and radioactive counting, were about 70%.

  18. Development of a loop-mediated isothermal amplification assay for the detection of Streptococcus agalactiae in bovine milk.

    Science.gov (United States)

    Bosward, Katrina L; House, John K; Deveridge, Amber; Mathews, Karen; Sheehy, Paul A

    2016-03-01

    Streptococcus agalactiae is a well-characterized bovine mastitis pathogen that is known to be highly contagious and capable of spreading rapidly in affected dairy herds. Loop-mediated isothermal amplification (LAMP) is a novel molecular diagnostic method that has the capability to provide rapid, cost-effective screening for pathogens to support on-farm disease control and eradication programs. In the current study, a LAMP test was developed to detect S. agalactiae in milk. The assay was validated on a bank of existing clinical mastitis milk samples that had previously been identified as S. agalactiae positive via traditional microbiological culture techniques and PCR. The LAMP assay was conducted on bacterial colonies and DNA extracted from milk in tube- and plate-based formats using multiple detection platforms. The 1-h assay conducted at 64 °C exhibited repeatability (coefficient of variation) of 2.07% (tube) and 8.3% (plate), sensitivity to ~20 pg of extracted DNA/reaction, and specificity against a panel of known bacterial mastitis pathogens. Of the 109 known S. agalactiae isolates assessed by LAMP directly from bacterial cells in culture, 108 were identified as positive, in accordance with PCR analysis. The LAMP analysis from the corresponding milk samples indicated that 104 of these milks exhibited a positive amplification curve. Although exhibiting some limitations, this assay provides an opportunity for rapid screening of milk samples to facilitate on-farm management of this pathogen. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  19. Detection of toxic shock toxin (tst gene in Staphylococcus aureus isolated from bovine milk samples

    Directory of Open Access Journals (Sweden)

    S. Baniardalan

    2017-09-01

    Full Text Available Staphylococcus aureus is a major causative pathogen of clinical and subclinical mastitis in dairy cattle all over the world. This agent produces a variety of extracellular toxins and virulence factors in-cluding toxic shock syndrome toxin-1 (TSST-1 which is the major cause of toxic shock syndrome (TSS. In the present study, 76 S. aureus isolates have been obtained from milk samples collected from 7 dairy herds in Hamedan province of Iran. The isolates were identified based on the biochemical and molecular methods using PCR amplification of the femA gene. The staphylococcal isolates were also examined for the presence of TSST-1 (tst encoding gene. This gene was detected in only one S. aureus isolate (1.3%. The results revealed that S. aureus strains causing bovine mastitis may potentially produce staphylococcal toxic shock syndrome toxin-1, indicating that it is very important to follow the presence of TSST-1 producing S. aureus isolates in foodstuffs to protect consumers against the risk of toxic shock syndrome

  20. Effects of different pasteurizers on the nutritional quality of raw milk ...

    African Journals Online (AJOL)

    ) of local and exotic cow breeds (White Fulani, New Jersey and Mixture of the two breeds) were investigated before and after pasteurization of milk samples from the breeds in aluminium, stainless and galvanized steel pasteurizers that was ...

  1. Thermal properties of milk fat, xanthine oxidase, caseins and whey proteins in pulsed electric field-treated bovine whole milk.

    Science.gov (United States)

    Sharma, Pankaj; Oey, Indrawati; Everett, David W

    2016-09-15

    Thermodynamics of milk components (milk fat, xanthine oxidase, caseins and whey proteins) in pulsed electric field (PEF)-treated milk were compared with thermally treated milk (63 °C for 30 min and 73 °C for 15s). PEF treatments were applied at 20 or 26 kV cm(-1) for 34 μs with or without pre-heating of milk (55 °C for 24s), using bipolar square wave pulses in a continuous mode of operation. PEF treatments did not affect the final temperatures of fat melting (Tmelting) or xanthine oxidase denaturation (Tdenaturation), whereas thermal treatments increased both the Tmelting of milk fat and the Tdenaturation for xanthine oxidase by 2-3 °C. Xanthine oxidase denaturation was ∼13% less after PEF treatments compared with the thermal treatments. The enthalpy change (ΔH of denaturation) of whey proteins decreased in the treated-milk, and denaturation increased with the treatment intensity. New endothermic peaks in the calorimetric thermograms of treated milk revealed the formation of complexes due to interactions between MFGM (milk fat globule membrane) proteins and skim milk proteins. Evidence for the adsorption of complexes onto the MFGM surface was obtained from the increase in surface hydrophobicity of proteins, revealing the presence of unfolded hydrophobic regions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Do different standard plate counting (IDF/ISSO or AOAC) methods interfere in the conversion of individual bacteria counts to colony forming units in raw milk?

    Science.gov (United States)

    Cassoli, L D; Lima, W J F; Esguerra, J C; Da Silva, J; Machado, P F; Mourão, G B

    2016-10-01

    This study aimed to establish the correlation between individual bacterial count (IBC) obtained by flow cytometry and the number of colony forming units (CFU) determined by standard plate count (SPC) in raw milk using two different reference methodologies: the methodology of the International Dairy Federation (IDF) - International Organization for Standardization (ISO) 4833, incubation for 72 h at 30°C and the methodology of the Association of Official Analytical Chemists (AOAC), incubation for 48 h at 35°C. For this, 100 bovine milk samples (80 ml) from different farms were collected in a sterile bottle and maintained refrigerated at 4°C and were delivered to the laboratory. In the laboratory, the samples were divided into two vials of 40 ml each. Then, half of the vials were forwarded for the SPC analysis, and the other half were analysed using the equipment BactoScan FC. The analyses by flow cytometry and SPC were performed at the same time (maximum deviation of +/- 1 h). To transform the data from IBC ml(-1) to CFU ml(-1) (IDF or AOAC methodology), a standard linear regression equation was used, as recommended by IDF/ISO-196. The difference between the reference methodologies affects the equation that transforms IBC into CFU and therefore the accuracy of the results. The results estimated by the equation using the ISO 4833 methodology were on average 0·18 log units higher than the results estimated using the equation using the AOAC methodology. After the comparison of the methodologies, it was concluded that there is an impact of the reference methodologies on the conversion of the results from IBC to CFU. Depending on the methodology adopted by each laboratory or country, there may not be equivalence in the results. Hence, the laboratories specialized in milk quality analysis that have changed their methodology for analysis, passing from the MAPA (AOAC) methodology to the IDF standard, need to develop new conversion equations to make their

  3. Raw milk consumption and other early-life farm exposures and adult pulmonary function in the Agricultural Lung Health Study.

    Science.gov (United States)

    Wyss, Annah B; House, John S; Hoppin, Jane A; Richards, Marie; Hankinson, John L; Long, Stuart; Henneberger, Paul K; Beane Freeman, Laura E; Sandler, Dale P; O'Connell, Elizabeth Long; Cummings, Christie Barker; Umbach, David M; London, Stephanie J

    2018-03-01

    Literature suggests that early exposure to the farming environment protects against atopy and asthma; few studies have examined pulmonary function. We evaluated associations between early-life farming exposures and pulmonary function in 3061 adults (mean age=63) from a US farming population using linear regression. Childhood raw milk consumption was associated with higher FEV 1 (β=49.5 mL, 95% CI 2.8 to 96.1 mL, p=0.04) and FVC (β=66.2 mL, 95% CI 13.2 to 119.1 mL, p=0.01). We did not find appreciable associations with other early-life farming exposures. We report a novel association between raw milk consumption and higher pulmonary function that lasts into older adulthood. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  4. Effects of fat content, pasteurization method, homogenization pressure, and storage time on the mechanical and sensory properties of bovine milk.

    Science.gov (United States)

    Li, Y; Joyner, H S; Carter, B G; Drake, M A

    2018-04-01

    Fluid milk may be pasteurized by high-temperature short-time pasteurization (HTST) or ultrapasteurization (UP). Literature suggests that UP increases milk astringency, but definitive studies have not demonstrated this effect. Thus, the objective of this study was to determine the effects of pasteurization method, fat content, homogenization pressure, and storage time on milk sensory and mechanical behaviors. Raw skim (fat), 2%, and 5% fat milk was pasteurized in duplicate by indirect UP (140°C, 2.3 s) or by HTST pasteurization (78°C, 15 s), homogenized at 20.7 MPa, and stored at 4°C for 8 wk. Additionally, 2% fat milk was processed by indirect UP and homogenized at 13.8, 20.7, and 27.6 MPa and stored at 4°C for 8 wk. Sensory profiling, instrumental viscosity, and friction profiles of all milk were evaluated at 25°C after storage times of 1, 4, and 8 wk. Sodium dodecyl sulfate PAGE and confocal laser scanning microscopy were used to determine protein structural changes in milk at these time points. Fresh HTST milk was processed at wk 7 for wk 8 evaluations. Ultrapasteurization increased milk sensory and instrumental viscosity compared with HTST pasteurization. Increased fat content increased sensory and instrumental viscosity, and decreased astringency and friction profiles. Astringency, mixed regimen friction profiles, and sensory viscosity also increased for UP versus HTST. Increased storage time showed no effect on sensory viscosity or mechanical viscosity. However, increased storage time generally resulted in increased friction profiles and astringency. Sodium dodecyl sulfate PAGE and confocal laser scanning microscopy showed increased denatured whey protein in UP milk compared with HTST milk. The aggregates or network formed by these proteins and casein micelles likely caused the increase in viscosity and friction profiles during storage. Homogenization pressure did not significantly affect friction behaviors, mechanical viscosity, or astringency; however

  5. Effect of organic farming on selected raw cow milk components and properties

    Directory of Open Access Journals (Sweden)

    Ivana Cermanová

    2011-01-01

    Full Text Available Organic dairying is an alternative for friendly exploitation of environment. This paper was focused on impacts of organic dairying on milk composition and properties. The conventional (C cow milk was compared to organic (O milk. Holstein bulk milk samples (BMSs from winter and summer season in 4 C and 4 O (n = 32 and 32 BMSs; 2 years herds were investigated. 6 herds were grazed and 2 C herds were not grazed. Mean O cow milk yield (MY, 305 lactation days was 7037.3 ± 421.5 and C MY 7015.8 ± 1068.1 kg. Higher values (P < 0.05 in O milk had: log acetone (0.7321 > 0.6048; titration acidity (8.34 > 7.82 ml 0.25 mol.l−1 NaOH; alcohol stability (0.6 > 0.44 ml; time for enzymatic coagulation (150.75 > 115.03 second; whey protein (0.54 > 0.49%; fat/crude protein (1.2 > 1.15; milk fermentation ability (FAM by titration (31.45 > 22.18 ml 0.25 mol.l−1 NaOH. Lower values (P < 0.05 in O milk had: solids–not–fat (8.64 < 8.73%; urea content (19.91 < 29.03 mg.100ml−1; electrical conductivity (3.66 < 4.08 mS.cm−1; whey volume (32.03 < 34.53 ml; crude protein (3.16 < 3.25%; casein (2.47 < 2.58%; non–protein nitrogen compounds (0.15 < 0.18%; urea nitrogen in non-protein nitrogen ratio (40.81 < 49.0%; casein numbers for crude protein and true protein (78.12 < 79.58 and 81.99 < 84.11%; coli bacteria count in normal and logarithm form (330.56 < 1502.92 CFU.ml−1 and 1.484 < 2.5823; actual yoghurt acidity (4.71 < 4.8. O cows suffered probably from lower energy and nitrogen compounds intake due to feeding under mentioned conditions. O milk could be a little better environment for yoghurt cultivation.

  6. Effect of humates in diet of dairy cows on the raw milk main components

    Directory of Open Access Journals (Sweden)

    Miroslava Potůčková

    2017-01-01

    Full Text Available The effect of supplemental humic substances (HS on the main milk components was investigated. A total of 10 dairy cows (Czech pied cattle, crossbred Czech pied cattle ´ Ayrshire and crossbred Czech pied cattle ´ Red Holstein were tested. Animals were randomly divided into 2 groups, control (C and experimental (E. Animals fed the same feed mixture and group E was additionally supplemented with HS (200 mg.kg-1 of product Humafit prepared from the Sakhalin Leonardite. The experimental period took 3 months. Cows were milked twice a day. The milk composition (lactose, fat, crude protein, pure protein and casein of every cow was monitored on days 0, 14, 28, 42, 56, 70 and 84 of the experiment. Pure protein content was determined by Kjeldahl method, other components were analysed using an infrared analyserMilkoScan FT 120. It was found that the crude protein, pure protein and casein content in milk of group E significantly (p <0.05 increased from the 56th day of the experimental period. Differences of the protein fraction contents in group C and of the dry matter, non-fat dry matter, lactose and fat content in both groups were non-significant (p <0.05.Higher protein and especially casein content in milk could be very important for the cheesemaking as it could increase the cheese yield. Normal 0 21 false false false CS X-NONE X-NONE

  7. Bovine milk sampling efficiency for pregnancy-associated glycoproteins (PAG) detection test

    Energy Technology Data Exchange (ETDEWEB)

    Silva, H. K. da; Cassoli, L.D.; Pantoja, J.F.C.; Cerqueira, P.H.R.; Coitinho, T.B.; Machado, P.F.

    2016-07-01

    Two experiments were conducted to verify whether the time of day at which a milk sample is collected and the possible carryover in the milking system may affect pregnancy-associated glycoproteins (PAG) levels and, consequently, the pregnancy test results in dairy cows. In experiment one, we evaluated the effect of time of day at which the milk sample is collected from 51 cows. In experiment two, which evaluated the possible occurrence of carryover in the milk meter milking system, milk samples from 94 cows belonging to two different farms were used. The samples were subjected to pregnancy test using ELISA methodology to measure PAG concentrations and to classify the samples as positive (pregnant), negative (nonpregnant), or suspicious (recheck). We found that the time of milking did not affect the PAG levels. As to the occurrence of carryover in the milk meter, the PAG levels of the samples collected from Farm-2 were heavily influenced by a carryover effect compared with the samples from Farm-1. Thus, milk samples submitted to a pregnancy test can be collected during the morning or the evening milking. When the sample is collected from the milk meters, periodic equipment maintenance should be noted, including whether the milk meter is totally drained between different animals’ milking and equipment cleaning between milking is performed correctly to minimize the occurrence of carryover, thereby avoiding the effect on PAG levels and, consequently, the pregnancy test results. Therefore, a single milk sample can be used for both milk quality tests and pregnancy test.

  8. Bovine milk sampling efficiency for pregnancy-associated glycoproteins (PAG) detection test

    International Nuclear Information System (INIS)

    Silva, H. K. da; Cassoli, L.D.; Pantoja, J.F.C.; Cerqueira, P.H.R.; Coitinho, T.B.; Machado, P.F.

    2016-01-01

    Two experiments were conducted to verify whether the time of day at which a milk sample is collected and the possible carryover in the milking system may affect pregnancy-associated glycoproteins (PAG) levels and, consequently, the pregnancy test results in dairy cows. In experiment one, we evaluated the effect of time of day at which the milk sample is collected from 51 cows. In experiment two, which evaluated the possible occurrence of carryover in the milk meter milking system, milk samples from 94 cows belonging to two different farms were used. The samples were subjected to pregnancy test using ELISA methodology to measure PAG concentrations and to classify the samples as positive (pregnant), negative (nonpregnant), or suspicious (recheck). We found that the time of milking did not affect the PAG levels. As to the occurrence of carryover in the milk meter, the PAG levels of the samples collected from Farm-2 were heavily influenced by a carryover effect compared with the samples from Farm-1. Thus, milk samples submitted to a pregnancy test can be collected during the morning or the evening milking. When the sample is collected from the milk meters, periodic equipment maintenance should be noted, including whether the milk meter is totally drained between different animals’ milking and equipment cleaning between milking is performed correctly to minimize the occurrence of carryover, thereby avoiding the effect on PAG levels and, consequently, the pregnancy test results. Therefore, a single milk sample can be used for both milk quality tests and pregnancy test.

  9. Mastitomics, the integrated omics of bovine milk in an experimental model of Streptococcus uberis mastitis: 3. Untargeted metabolomics.

    Science.gov (United States)

    Thomas, Funmilola Clara; Mudaliar, Manikhandan; Tassi, Riccardo; McNeilly, Tom N; Burchmore, Richard; Burgess, Karl; Herzyk, Pawel; Zadoks, Ruth N; Eckersall, P David

    2016-08-16

    Intramammary infection leading to bovine mastitis is the leading disease problem affecting dairy cows and has marked effects on the milk produced by infected udder quarters. An experimental model of Streptococcus uberis mastitis has previously been investigated for clinical, immunological and pathophysiological alteration in milk, and has been the subject of peptidomic and quantitative proteomic investigation. The same sample set has now been investigated with a metabolomics approach using liquid chromatography and mass spectrometry. The analysis revealed over 3000 chromatographic peaks, of which 690 were putatively annotated with a metabolite. Hierarchical clustering analysis and principal component analysis demonstrated that metabolite changes due to S. uberis infection were maximal at 81 hours post challenge with metabolites in the milk from the resolution phase at 312 hours post challenge being closest to the pre-challenge samples. Metabolic pathway analysis revealed that the majority of the metabolites mapped to carbohydrate and nucleotide metabolism show a decreasing trend in concentration up to 81 hours post-challenge whereas an increasing trend was found in lipid metabolites and di-, tri- and tetra-peptides up to the same time point. The increase in these peptides coincides with an increase in larger peptides found in the previous peptidomic analysis and is likely to be due to protease degradation of milk proteins. Components of bile acid metabolism, linked to the FXR pathway regulating inflammation, were also increased. Metabolomic analysis of the response in milk during mastitis provides an essential component to the full understanding of the mammary gland's response to infection.

  10. Characterization of an apically derived epithelial membrane glycoprotein from bovine milk, which is expressed in capillary endothelia in diverse tissues.

    Science.gov (United States)

    Greenwalt, D E; Mather, I H

    1985-02-01

    A glycoprotein (PAS IV) of apparent Mr 76,000 was purified from bovine milk-fat-globule membrane and partially characterized. PAS IV contained mannose, galactose, and sialic acid as principal sugars (approximately 5.3% total carbohydrate [wt/wt]) and existed in milk in at least four isoelectric variants. The glycoprotein appeared to be an integral membrane protein by several criteria. PAS IV was recovered in the detergent phase of Triton X-114 extracts of milk-fat-globule membrane at room temperature. When bound to membrane, PAS IV was resistant to digestion by a number of proteinases, although after solubilization with non-ionic detergents, the protein was readily degraded. Amino acid analysis of the purified protein revealed a high percentage of amino acids with nonpolar residues. The location of PAS IV was determined in bovine tissues by using immunofluorescence techniques. In mammary tissue, PAS IV was located on both the apical surfaces of secretory epithelial cells and endothelial cells of capillaries. This glycoprotein was also detected in endothelial cells of heart, liver, spleen, pancreas, salivary gland, and small intestine. In addition to mammary epithelial cells, PAS IV was also located in certain other epithelial cells, most notably the bronchiolar epithelial cells of lung. The potential usefulness of this protein as a specific marker of capillary endothelial cells in certain tissues is discussed.

  11. Comparing the mannitol-egg yolk-polymyxin agar plating method with the three-tube most-probable-number method for enumeration of Bacillus cereus spores in raw and high-temperature, short-time pasteurized milk.

    Science.gov (United States)

    Harper, Nigel M; Getty, Kelly J K; Schmidt, Karen A; Nutsch, Abbey L; Linton, Richard H

    2011-03-01

    The U.S. Food and Drug Administration's Bacteriological Analytical Manual recommends two enumeration methods for Bacillus cereus: (i) standard plate count method with mannitol-egg yolk-polymyxin (MYP) agar and (ii) a most-probable-number (MPN) method with tryptic soy broth (TSB) supplemented with 0.1% polymyxin sulfate. This study compared the effectiveness of MYP and MPN methods for detecting and enumerating B. cereus in raw and high-temperature, short-time pasteurized skim (0.5%), 2%, and whole (3.5%) bovine milk stored at 4°C for 96 h. Each milk sample was inoculated with B. cereus EZ-Spores and sampled at 0, 48, and 96 h after inoculation. There were no differences (P > 0.05) in B. cereus populations among sampling times for all milk types, so data were pooled to obtain overall mean values for each treatment. The overall B. cereus population mean of pooled sampling times for the MPN method (2.59 log CFU/ml) was greater (P milk samples ranged from 2.36 to 3.46 and 2.66 to 3.58 log CFU/ml for inoculated milk treatments for the MYP plate count and MPN methods, respectively, which is below the level necessary for toxin production. The MPN method recovered more B. cereus, which makes it useful for validation research. However, the MYP plate count method for enumeration of B. cereus also had advantages, including its ease of use and faster time to results (2 versus 5 days for MPN).

  12. Evaluation of milk yield losses associated with Salmonella antibodies in bulk tank milk in bovine dairy herds

    DEFF Research Database (Denmark)

    Nielsen, T D; Green, L E; Kudahl, Anne Margrethe Braad

    2012-01-01

    The effect of Salmonella on milk production is not well established in cattle. The objective of this study was to investigate whether introduction of Salmonella into dairy cattle herds was associated with reduced milk yield and determine the duration of any such effect. Longitudinal data from 2005...... through 2009 were used, with data from 12 mo before until 18 mo after the estimated date of infection. Twenty-eight case herds were selected based on an increase in the level of Salmonella-specific antibodies in bulk-tank milk from ... was randomly allocated to the control herds. Hierarchical mixed effect models with the outcome test-day yield of energy-corrected milk (ECM)/cow were used to investigate daily milk yield before and after the estimated herd infection date for cows in parities 1, 2, and 3+. Control herds were used to evaluate...

  13. Continuous raw skim milk processing by pulsed electric field at non-lethal temperature: effect on microbial inactivation and functional properties

    OpenAIRE

    Floury , Juliane; Grosset , Noël; Leconte , Nadine; Pasco , Maryvonne; Madec , Marie-Noëlle; Jeantet , Romain

    2006-01-01

    International audience; Pulsed electric field (PEF) is an emerging non-thermal processing technology used to inactivate microorganisms in liquid foods such as milk. The objective of this research was to study the effectiveness of continuous PEF equipment (square wave pulses) on total microorganisms of raw skim milk and on Salmonella enteritidis inactivation under moderate temperatures (T < 50 °C). Processing parameters (electric field and pulse width) were chosen as follows: 45 kV*cm-1/500 ns...

  14. Antibiotic resistance profile of bacteria isolated from raw milk samples of cattle and buffaloes

    Directory of Open Access Journals (Sweden)

    Tahlina Tanzin

    2016-03-01

    Conclusion: Two different species of bacteria i.e., S. aureus and E. coli are contaminating with milk samples. The pathogenic bacteria can be controlled effectively by using Ciprofloxacin and Levofloxacin in the case of mastitis in cattle and buffaloes in Bangladesh. [J Adv Vet Anim Res 2016; 3(1.000: 62-67

  15. Raw Camel Milk Properties on Alloxan-Induced Diabetic Wistar Rats

    Directory of Open Access Journals (Sweden)

    Kebir Nasr-Eddine

    2017-03-01

    Full Text Available Background and aims: Diabetes is one of the most frequent and serious chronic diseases in humans all over the world. The aim of our study was to evaluate the antidiabetic activity of camel milk on serum glucose and lipid profile of alloxan-induced diabetic rats.

  16. Fatty acid profile and health lipid indices in the raw milk of ewes ...

    African Journals Online (AJOL)

    Daniel

    2016-08-02

    Aug 2, 2016 ... Feeding the I diets increased the proportion of short-chain FAs (C4:0 - ..... in milk short- and medium-chain FAs with an increased fresh pasture supply in ... to SFA above 0.45 and a ratio of n-6/n-3 below 4.0 are required in the ...

  17. STUDY REGARDING THE CORELATION BETWEEN SOMATIC CELLS COUNT AND MAJOR CHEMICAL COMPOUNDS IN RAW MILK

    Directory of Open Access Journals (Sweden)

    S. ACATINCĂI

    2008-10-01

    Full Text Available This study approaches the dynamic of somatic cells number and chemical composition of milk during 13 months of control. The study also investigates the correlations between the number of somatic cells and some chemical parameters in milk. Studies were carried out on Romanian Black and White cows between March 2005 and March 2006 at the Didactical farm of the Banat University of Agricultural Sciences Timisoara. As quality indicator, the number of somatic cells has different values among the controls. Average values for the 13 months of control, with the exception of three controls, were below maximum limit admitted from 1th of January 2007 (600000 SCC/ml milk. There weren’t any significant differences for SCC between the two seasons. Chemical parameters in milk varied in close limits and the differences were not significant, with one exception for fat percent. Fat percent is higher (p<0.05 in the cold season 3.87% compared with 3.55% during the warm season. Somatic cells number is weak correlated with lactose and strong correlated with proteins.

  18. [Detection of a Disease Cluster by the Health Authorities of Stendal District due to Campylobacter jejuni in a Nursery After the Consumption of Raw Milk].

    Science.gov (United States)

    Hermann, N; Schubert, I

    2015-07-01

    A notification from a laboratory concerning the detection of Campylobacter jejuni in a 6-year-old boy initiated the investigation carried out by the health authorities from Stendal district, in order to explain the morbidity rate caused by the germ. The day after the boy's pediatrician informed about a visit to a farm, which was confirmed by the head of the nursery. She told the health authorities about the consumption of raw milk during their visit at the farm.The following days more children fell sick. Within 10 days the total number of diseased children was 21. The health authorities asked for stool samples of the diseased children, nursery nurses and the head of the farm since raw milk presents a potential cause of infection. The health authorities together with the Saxony-Anhalt State Office for Consumer Protection conducted a retrospective cohort study. The aim was to explain the association between the exposure from raw milk consumption and the occurrence of the disease from C. jejuni. Based on a questionnaire data about the food and milk intake at the nursery and at home and about the trip to the farm were collected. 91% of the children's cohort and 86% of the adults' cohort were captured.The exposed group at risk showed a higher risk of falling ill than the group, which was not exposed. The risk factor raw milk explained the difference. Furthermore, the analysis of milk samples taken by the district veterinary office from 2 cows and from the farm's tank was able to detect the germs. The correlation of the illness, the consumption of raw milk, the detection of C. jejuni in the samples taken from the children and the samples taken from the cows was evident. Based on the case the health authorities recommended that heads of nurseries as well as heads of dairy farming in the district of Stendal needed to be advised on raw milk. Nurseries are still allowed to take trips to farms. However, raw animal derivates including milk must not be consumed. © Georg Thieme

  19. In vivo digestion of bovine milk fat globules: effect of processing and interfacial structural changes. II. Upper digestive tract digestion.

    Science.gov (United States)

    Gallier, Sophie; Zhu, Xiang Q; Rutherfurd, Shane M; Ye, Aiqian; Moughan, Paul J; Singh, Harjinder

    2013-12-01

    The aim of this research was to study the effect of milk processing on the in vivo upper digestive tract digestion of milk fat globules. Fasted rats were serially gavaged over a 5h period with cream from raw, pasteurised, or pasteurised and homogenised milk. Only a few intact dietary proteins and peptides were present in the small intestinal digesta. Significantly (Praw (448 mg g(-1) digesta dry matter (DDM)) and homogenised creams (528 mg g(-1) DDM), as compared to pasteurised and homogenised cream (249 mg g(-1) DDM). Microscopy techniques were used to investigate the structural changes during digestion. Liquid-crystalline lamellar phases surrounding the fat globules, fatty acid soap crystals and lipid-mucin interactions were evident in all small intestinal digesta. Overall, the pasteurised and homogenised cream appeared to be digested to a greater extent. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Effect of thermal protectants on the stability of bovine milk immunoglobulin G

    Energy Technology Data Exchange (ETDEWEB)

    Chen, C. C. [National Taiwan University, Taipei, Taiwan (China); Chang, H. M.

    1998-09-15

    pH stability, thermal stability, and the effect of homogenization and ultrasonic treatment on the stability of bovine milk immunoglobulin G (IgG) in model systems was studied. Separated IgG (0.02 mg/mL) was found to be unstable and susceptible to denaturation when incubated at pH 4 or 10 or thermally treated at temperature 75 degrees C. IgG in the colostrum, on the other hand, was found to be much more stable than in whey or in PBS when thermally treated at temperatures in the range of 75-100 degrees C. The residual IgC content reduced more sharply with increasing heating times, and almost no IgG content was detected when IgG in PBS (0.15 M NaCl/0.01 M phosphate buffer, pH 7.0) was heated at 95 degrees C for 15 s, whereas the corresponding residual IgG contents in whey and colostrum were found to be 42 and 59%, respectively. For IgG in PBS heated at 95 degrees C for 15 s, addition of 5% fructose or maltose displayed most remarkable protection effects by raising the residual IgG content to 31%, followed by sucrose, lactose, glucose, and galactose. However, extravagant addition ( 30%) to IgG in PBS led to a decline in residual IgG content. Addition of 0.4% glutamic acid and 2% glycine to IgG in PBS heated at 95 degrees C for 15 s also remarkably improved the residual IgG content by 13.5 and 26.7%, respectively. Glycerol and sugar alcohol, such as sorbitol, stabilized IgG during the thermal treatment.

  1. Effect of thermal protectants on the stability of bovine milk immunoglobulin G

    International Nuclear Information System (INIS)

    Chen, C.C.; Chang, H.M.

    1998-01-01

    pH stability, thermal stability, and the effect of homogenization and ultrasonic treatment on the stability of bovine milk immunoglobulin G (IgG) in model systems was studied. Separated IgG (0.02 mg/mL) was found to be unstable and susceptible to denaturation when incubated at pH 4 or 10 or thermally treated at temperature 75 degrees C. IgG in the colostrum, on the other hand, was found to be much more stable than in whey or in PBS when thermally treated at temperatures in the range of 75-100 degrees C. The residual IgC content reduced more sharply with increasing heating times, and almost no IgG content was detected when IgG in PBS (0.15 M NaCl/0.01 M phosphate buffer, pH 7.0) was heated at 95 degrees C for 15 s, whereas the corresponding residual IgG contents in whey and colostrum were found to be 42 and 59%, respectively. For IgG in PBS heated at 95 degrees C for 15 s, addition of 5% fructose or maltose displayed most remarkable protection effects by raising the residual IgG content to 31%, followed by sucrose, lactose, glucose, and galactose. However, extravagant addition ( 30%) to IgG in PBS led to a decline in residual IgG content. Addition of 0.4% glutamic acid and 2% glycine to IgG in PBS heated at 95 degrees C for 15 s also remarkably improved the residual IgG content by 13.5 and 26.7%, respectively. Glycerol and sugar alcohol, such as sorbitol, stabilized IgG during the thermal treatment

  2. Identification of gram-negative bacteria from critical control points of raw and pasteurized cow milk consumed at Gondar town and its suburbs, Ethiopia.

    Science.gov (United States)

    Garedew, Legesse; Berhanu, Ayalew; Mengesha, Desalegne; Tsegay, Getachew

    2012-11-06

    Milk is highly prone to contamination and can serve as an efficient vehicle for human transmission of foodborne pathogens, especially gram-negative bacteria, as these are widely distributed in the environment. This cross-sectional study of gram-negative staining bacterial contamination of milk meant for human consumption was carried out from October 2010 to May 2011 in Gondar town, Ethiopia. Milk samples were collected from critical control points, from production to consumption, that were hypothesized to be a source of potential contamination. Milk sampling points included smallholder's milk producers, dairy co-operatives, a milk processing plant, and supermarkets. The hygienic procedures applied during milking, milk collection, transportation, pasteurization, and postpasteurization storage conditions at these specified critical control points were evaluated. Standard bacteriological cultivation and biochemical assays were used to isolate and identify bacterial pathogens in the milk samples. The results of the current study showed that conditions for contamination of raw milk at different critical points were due to less hygienic practices in pre-milking udder preparation, sub-optimal hygiene of milk handlers, and poor sanitation practices associated with milking and storage equipments. Among all critical control points considered, transportation containers at milk collection centers and at processing plants were found to be the most heavily contaminated with gram-negative staining bacterial species. Overall, 54 different bacterial species were indentified, and Escherichia coli (29.6%), Pseudomonas aeruginosa (18.5%), and Klebsiella pneumoniae (16.7%), were the most commonly identified gram-negative staining bacterial pathogens. Of particular interest was that no gram-negative staining bacteria were isolated from pasteurized milk samples with varying shelf life. This study showed the presence of diverse pathogenic gram-negative staining bacterial species in raw

  3. Identification of gram-negative bacteria from critical control points of raw and pasteurized cow milk consumed at Gondar town and its suburbs, Ethiopia

    Directory of Open Access Journals (Sweden)

    Garedew Legesse

    2012-11-01

    Full Text Available Abstract Background Milk is highly prone to contamination and can serve as an efficient vehicle for human transmission of foodborne pathogens, especially gram-negative bacteria, as these are widely distributed in the environment. Methods This cross-sectional study of gram-negative staining bacterial contamination of milk meant for human consumption was carried out from October 2010 to May 2011 in Gondar town, Ethiopia. Milk samples were collected from critical control points, from production to consumption, that were hypothesized to be a source of potential contamination. Milk sampling points included smallholder’s milk producers, dairy co-operatives, a milk processing plant, and supermarkets. The hygienic procedures applied during milking, milk collection, transportation, pasteurization, and postpasteurization storage conditions at these specified critical control points were evaluated. Standard bacteriological cultivation and biochemical assays were used to isolate and identify bacterial pathogens in the milk samples. Results The results of the current study showed that conditions for contamination of raw milk at different critical points were due to less hygienic practices in pre-milking udder preparation, sub-optimal hygiene of milk handlers, and poor sanitation practices associated with milking and storage equipments. Among all critical control points considered, transportation containers at milk collection centers and at processing plants were found to be the most heavily contaminated with gram-negative staining bacterial species. Overall, 54 different bacterial species were indentified, and Escherichia coli (29.6%, Pseudomonas aeruginosa (18.5%, and Klebsiella pneumoniae (16.7%, were the most commonly identified gram-negative staining bacterial pathogens. Of particular interest was that no gram-negative staining bacteria were isolated from pasteurized milk samples with varying shelf life. Conclusion This study showed the presence of

  4. Prevalence and Characterization of Staphylococcus aureus Cultured From Raw Milk Taken From Dairy Cows With Mastitis in Beijing, China

    Directory of Open Access Journals (Sweden)

    Wei Wang

    2018-06-01

    Full Text Available The colonization of dairy herds and subsequent contamination of raw milk by Staphylococcus aureus (S. aureus, especially those expressing a multi-drug resistance (MDR, biofilm and toxins producing ability, remains an important issue for both the dairy producer and public health. In this study, we investigated the prevalence, antimicrobial resistance, virulence, and genetic diversity of S. aureus in raw milk taken from 2 dairy farms in Beijing, China. Ninety (46.2%, 90/195 samples were positive for S. aureus. Resistant to penicillin (PEN (31.3%, ciprofloxacin (18.8% and enrofloxacin (15.6% were the most often observed. Isolates cultured from farm B showed significantly higher resistance to penicillin (73.9%, ciprofloxacin (34.8%, enrofloxacin (34.8%, tilmicosin (17.4%, and erythromycin (17.4% than those from farm A (p < 0.05. Totally, 94.8% S. aureus harbored at least one virulence gene and the pvl (93.8%, sec (65.6%, and sea (60.4% genes were the most frequently detected. The pvl and sec genes were more often detected in isolates from farm A (97.3% and 84.9% respectively than those from farm B (p < 0.05. Of all 77 staphylococcus enterotoxin (SE-positive isolates, more than 90% could produce enterotoxins and 70.1% could produce two types. Biofilm related genes (icaA/D, clf/B, can, and fnbA were detected in all96 isolates. All 96 isolates could produce biofilm with 8.3, 70.8, and 18.8% of the isolates demonstrating weak, moderate and strong biofilm formation, respectively. A total of 5 STs, 7 spa types (1 novel spa type t17182, 3agr types (no agrII, and 14 SmaI-pulso-types were found in this study. PFGE cluster II-CC1-ST1-t127-agr III was the most prevalent clone (56.3%. Isolates of agr III (PFGE Cluster I/II-CC1-ST1-t127/2279 had higher detection of virulence genes than those of agr I and agr IV. TheMSSA-ST398-t1456-agr I clone expressed the greatest MDRbut with no virulence genes and weakly biofilm formation. Our finding indicated a relatively

  5. Qualidade do leite cru ovino armazenado sob refrigeração | Quality of ovine raw milk stored under refrigeration

    Directory of Open Access Journals (Sweden)

    Félix Roman Munieweg

    2017-02-01

    Full Text Available A industrialização de lácteos ovinos é recente no Brasil e a produção é concentrada em regiões de serra, como a Gaúcha. O leite ovino possui alto conteúdo de sólidos comparado ao bovino, com maior rendimento na produção de queijo. A produção deste leite sofre variações sazonais e poderia ser estocado até obter uma quantidade suficiente para processamento. O objetivo deste trabalho foi avaliar parâmetros microbiológicos e físico-químicos no leite proveniente de seis produtores sob armazenamento refrigerado. O leite foi analisado durante sete dias, incluindo contagem padrão em placas (CPP, psicrotróficos, coliformes totais e termotolerantes, Staphylococcus sp. e Staphylococcus aureus, acidez titulável, pH, atividade de água e proteína. Os resultados demonstraram altas contagens microbianas e CPP acima dos limites estabelecidos pela legislação para a maioria das amostras. Contagens de psicrotróficos, coliformes totais e fecais foram elevadas durante este período. A acidez titulável aumentou ao longo dos dias e o conteúdo de proteína diminuiu. As amostras do produtor B apresentaram menores contagens microbianas dentre todas testadas. A estocagem a frio torna-se uma alternativa, a curto prazo, quando há diminuição na produção de leite ovino para beneficiamento a derivados. No entanto, o período de armazenamento refrigerado não deve ultrapassar dois dias, devido à deterioração. ==================================================== The dairy sheep industry is recent in Brazil and the production is concentrated in mountainous regions, such as Serra Gaúcha. Ovine milk has a higher solids content compared to bovine milk, thus with higher yield in cheese production. Sheep milk production undergoes seasonal variations and it could be stored until a sufficient quantity is available for processing. The objective of this study was to evaluate microbiological and physicochemical parameters in ovine milk from six

  6. Magnetic bead and gold nanoparticle probes based immunoassay for β-casein detection in bovine milk samples.

    Science.gov (United States)

    Li, Y S; Meng, X Y; Zhou, Y; Zhang, Y Y; Meng, X M; Yang, L; Hu, P; Lu, S Y; Ren, H L; Liu, Z S; Wang, X R

    2015-04-15

    In this work, a double-probe based immunoassay was developed for rapid and sensitive determination of β-casein in bovine milk samples. In the method, magnetic beads (MBs), employed as supports for the immobilization of anti-β-casein polyclonal antibody (PAb), were used as the capture probe. Colloidal gold nanoparticles (AuNPs), employed as a bridge for loading anti-β-casein monoclonal antibody (McAb) and horseradish peroxidase (HRP), were used as the amplification probe. The presence of β-casein causes the sandwich structures of MBs-PAb-β-casein-McAb-AuNPs through the interaction between β-casein and the anti-β-casein antibodies. The HRP, used as an enzymatic-amplified tracer, can catalytically oxidize the substrate 3,3',5,5'-tetramethylbenzidine (TMB), generating optical signals that are proportional to the quantity of β-casein. The linear range of the immunoassay was from 6.5 to 1520ngmL(-1). The limit of detection (LOD) was 4.8ngmL(-1) which was 700 times lower than that of MBs-antibody-HRP based immunoassay and 6-7 times lower than that from the microplate-antibody-HRP based assay. The recoveries of β-casein from bovine milk samples were from 95.0% to 104.3% that had a good correlation coefficient (R(2)=0.9956) with those obtained by an official standard Kjeldahl method. For higher sensitivity, simple sample pretreatment and shorter time requirement of the antigen-antibody reaction, the developed immunoassay demonstrated the viability for detection of β-casein in bovine milk samples. Copyright © 2014. Published by Elsevier B.V.

  7. High-resolution melt analysis for species identification of coagulase-negative staphylococci derived from bovine milk.

    Science.gov (United States)

    Ajitkumar, Praseeda; Barkema, Herman W; Zadoks, Ruth N; Morck, Douglas W; van der Meer, Frank J U M; De Buck, Jeroen

    2013-03-01

    Coagulase-negative staphylococci (CNS) are the most frequently isolated pathogens isolated from bovine milk. In this study, we report a rapid assay for species identification of CNS using high-resolution melt analysis (HRMA) of 16S rDNA sequences. Real-time polymerase chain reaction amplification of 16S rRNA gene fragment, spanning the variable region V1 and V2, was performed with a resulting amplicon of 215 bp. A library of distinct melt curves of reference strains of 13 common CNS species was created using HRMA. Sequencing of 16S rRNA and rpoB genes, and, when needed, tuf gene, of 100 CNS isolates obtained from Canadian Bovine Mastitis Research Network was done to determine their species identity, allowing for subsequent evaluation of the performance of HRMA for field isolates of bovine CNS. A combination of HRMA and sequencing revealed that Staphylococcus chromogenes, S. xylosus, S. simulans, and S. sciuri had multiple genotypes, complicating their resolution by HRMA. As the 3 genotypes of S. chromogenes had distinct melt curves, the 3 distinct genotypes were employed as reference strains in a blinded trial of 156 CNS isolates to identify S. chromogenes. HRMA correctly identified all S. chromogenes isolates which were later confirmed by sequencing. Staphylococcus chromogenes (68%) was most frequently found among the CNS isolates, followed by S. haemolyticus (10%) and S. xylosus (6%). The present study revealed that HRMA of 16S rRNA gene (V1-V2) could be used as a rapid, efficient, low-cost, and minimally cumbersome technique for S. chromogenes identification, the most common CNS derived from bovine milk. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Point prevalence of bovine fascioliasis and the influence of chemotherapy on the milk yield in a lactating bovine population from the district of Toba Tek Singh, Pakistan.

    Science.gov (United States)

    Khan, M K; Sajid, M S; Khan, M N; Iqbal, Z; Arshad, M; Hussain, A

    2011-09-01

    This paper provides an estimation of the point prevalence of fascioliasis and its economic impact in terms of increased milk yield after chemotherapy of a bovine population from the district of Toba Tek Singh, Punjab, Pakistan. A total of 2400 cattle and buffaloes were examined quantitatively using the McMaster egg-counting technique. Infected cattle and buffaloes (50 of each) were randomly selected and each divided into two groups of 25 animals. Groups A (buffaloes) and C (cattle) were treated with oxyclozanide (orally, 16.6 mg kg- 1 body weight). Groups B and D served as negative controls for buffaloes and cattle, respectively. Pre- and post-treatment milk yield was recorded to determine if there were any changes in milk yield after treatment. Of 2400 faecal samples analysed, 654 (27.25%) were positive for Fasciola spp. with a mean number of eggs per gram (EPG) of 503.2. The point prevalence and worm burden of fascioliasis was significantly higher (OR = 2.13; P < 0.05) in buffaloes (34.58%; 415/1200; mean EPG maximum likelihood = 521.4) as compared to that of cattle (19.92%; 239/1200; mean EPG maximum likelihood = 415.8). Among the parasite species, F. gigantica (19.88%; 477/2400) was predominant (OR = 3.12; P < 0.05) as compared to F. hepatica (7.38%; 177/2400). An average daily increase of 0.67 and 0.87 litres of milk, with 0.41% and 0.37% more fat per animal, was observed in oxyclozanide-treated buffaloes and cattle, respectively. The economic value of reduced production of infected animals was estimated as US$0.33 and 0.32 per animal per day for cattle and buffaloes, respectively.

  9. Genetic Variation in Vitamin B-12 Content of Bovine Milk and Its Association with SNP along the Bovine Genome

    NARCIS (Netherlands)

    Rutten, M.J.M.; Bouwman, A.C.; Sprong, R.C.; Arendonk, van J.A.M.; Visker, M.H.P.W.

    2013-01-01

    Vitamin B-12 (also called cobalamin) is essential for human health and current intake levels of vitamin B-12 are considered to be too low. Natural enrichment of the vitamin B-12 content in milk, an important dietary source of vitamin B-12, may help to increase vitamin B-12 intake. Natural enrichment

  10. Study of fodder, urine and bovine milk in marginal region of the Rio das Vellhas, Curvelo - Minas Gerais, Brazil

    International Nuclear Information System (INIS)

    Veado, Maria Adelaide R.V.; Oliveira, Arno H. de; Veado, Julio Cesar C.; Melo, Marilia M.; Menezes, Maria Angela de B.C

    2000-01-01

    The parametric technique k 0 of neutronic activation was used for determination of elements in samples of bovine urine and milk and fodder plant, of the region of farming production of Curvelo - Minas Gerais, Brazil. The samples had been collected in farms next to the margins to the Rio das Velhas that periodically suffer flooding in the rainy station. Clinical veterinarians studies disclose that many animals created in this region present illnesses with nervous symptomatology, suggestive of a picture of poisoning, however without definite diagnosis. These pathologies frequently are observed after the flooding. In this work had been determined the elements, Cr, Co, Zn among others. The results gotten in the different samples of urine and milk of the studied animals, as well as in the fodder plants, suggest that it has influence of loaded metals for waters of the high course of the basin river of Velhas

  11. DNA carryover in milk samples from routine milk recording used for PCR-based diagnosis of bovine Staphylococcus aureus mastitis

    DEFF Research Database (Denmark)

    Mahmmod, Yasser Saadeldien Ibrahim; Klaas, Ilka Christine; Enevoldsen, Carsten

    2017-01-01

    milking order must be considered in mastitis control efforts. We suggest a practical interpretation of PCR results: cows with a Ct-value 37 and 32-37 can be labeled "very likely to be negative for Staph. aureus...

  12. Cyclic lipodepsipeptides produced by Pseudomonas spp. naturally present in raw milk induce inhibitory effects on microbiological inhibitor assays for antibiotic residue screening.

    Directory of Open Access Journals (Sweden)

    Wim Reybroeck

    Full Text Available Two Pseudomonas strains, identified as closely related to Pseudomonas tolaasii, were isolated from milk of a farm with frequent false-positive Delvotest results for screening putative antibiotic residues in raw milk executed as part of the regulatory quality programme. Growth at 5 to 7°C of these isolates in milk resulted in high lipolysis and the production of bacterial inhibitors. The two main bacterial inhibitors have a molecular weight of 1168.7 and 1140.7 Da respectively, are heat-tolerant and inhibit Geobacillus stearothermophilus var. calidolactis, the test strain of most of the commercially available microbiological inhibitor tests for screening of antibiotic residues in milk. Furthermore, these bacterial inhibitors show antimicrobial activity against Staphylococcus aureus, Bacillus cereus and B. subtilis and also interfere negatively with yoghurt production. Following their isolation and purification with RP-HPLC, the inhibitors were identified by NMR analysis as cyclic lipodepsipeptides of the viscosin group. Our findings bring to light a new challenge for quality control in the dairy industry. By prolonging the refrigerated storage of raw milk, the keeping quality of milk is influenced by growth and metabolic activities of psychrotrophic bacteria such as pseudomonads. Besides an increased risk of possible spoilage of long shelf-life milk, the production at low temperature of natural bacterial inhibitors may also result in false-positive results for antibiotic residue screening tests based on microbial inhibitor assays thus leading to undue production loss.

  13. Nutritional and hygienic quality of raw milk in the mid-northern region of Algeria: correlations and risk factors.

    Science.gov (United States)

    Adjlane-Kaouche, Soumeya; Benhacine, Rafik; Ghozlane, Faiçal; Mati, Abderrahmane

    2014-01-01

    This paper aims to study the overall quality of raw milk in the mid-northern region of Algeria. The analysis results showed a decrease in the average temperature for the delivery of 1,54°C with P0.05) was observed in almost all the physical and nutritional parameters studied (pH, fat content, and protein content) between M1 and M2. The average contamination by total mesophilic aerobic bacteria (TMAB), coliforms, yeasts, molds, and different pathogens in samples taken at M1 showed significant changes at M2. This was confirmed by the decrease of reduction time of methylene blue (RTMB), about 54%. The variation was described as follows: (P>0.05) for yeasts and (Pmilks delivered. In conclusion, several risk factors have been identified in this study, namely, the effect of the season and the distance between the farm and the dairy unit.

  14. High-pressure processing of a raw milk cheese improved its food safety maintaining the sensory quality.

    Science.gov (United States)

    Delgado, Francisco José; Delgado, Jonathan; González-Crespo, José; Cava, Ramón; Ramírez, Rosario

    2013-12-01

    The effect of high-pressure treatment (400 or 600 MPa for 7 min) on microbiology, proteolysis, texture and sensory parameters was investigated in a mature raw goat milk cheese. At day 60 of analysis, Mesophilic aerobic, Enterobacteriaceae, lactic acid bacteria and Listeria spp. were inactivated after high-pressure treatment at 400 or 600 MPa. At day 90, mesophilic aerobic, lactic acid bacteria and Micrococacceae counts were significantly lower in high-pressure-treated cheeses than in control ones. In general, nitrogen fractions were significantly modified after high-pressure treatment on day 60 at 600 MPa compared with control cheeses, but this effect was not found in cheeses after 30 days of storage (day 90). On the other hand, high-pressure treatment caused a significant increase of some texture parameters. However, sensory analysis showed that neither trained panellists nor consumers found significant differences between control and high-pressure-treated cheeses.

  15. An ecological study of lactococci isolated from raw milk in the camembert cheese registered designation of origin area.

    Science.gov (United States)

    Corroler, D; Mangin, I; Desmasures, N; Gueguen, M

    1998-12-01

    The genetic diversity of lactococci isolated from raw milk in the Camembert cheese Registered Designation of Origin area was studied. Two seasonal samples (winter and summer) of raw milk were obtained from six farms in two areas (Bessin and Bocage Falaisien) of Normandy. All of the strains analyzed had a Lactococcus lactis subsp. lactis phenotype, whereas the randomly amplified polymorphic DNA (RAPD) technique genotypically identified the strains as members of L. lactis subsp. lactis or L. lactis subsp. cremoris. The genotypes were confirmed by performing standard PCR with primers corresponding to a region of the histidine biosynthesis operon. The geographic distribution of each subspecies of L. lactis was determined; 80% of the Bocage Falaisien strains were members of L. lactis subsp. lactis, and 30.5% of the Bessin strains were members of L. lactis subsp. lactis. A dendrogram was produced from a computer analysis of the RAPD profiles in order to evaluate the diversity of the lactococci below the subspecies level. The coefficient of similarity for 117 of the 139 strains identified as members of L. lactis subsp. cremoris was as high as 66%. The L. lactis subsp. lactis strains were more heterogeneous and formed 10 separate clusters (the level of similarity among the clusters was 18%). Reference strains of L. lactis subsp. lactis fell into 2 of these 10 clusters, demonstrating that lactococcal isolates are clearly different. As determined by the RAPD profiles, some L. lactis subsp. lactis strains were specific to the farms from which they originated and were recovered throughout the year (in both summer and winter). Therefore, the typicality of L. lactis subsp. lactis strains was linked to the farm of origin rather than the area. These findings emphasize the significance of designation of origin and the specificity of "Camembert de Normandie" cheese.

  16. Comparison of the acidification activities of commercial starter cultures in camel and bovine milk

    DEFF Research Database (Denmark)

    Berhe, Tesfemariam; Ipsen, Richard; Seifu, Eyassu

    2018-01-01

    Camel milk has been reported to be difficult to ferment due to anti-microbial properties. The present study tested eight commercial starter cultures for their ability to grow in camel milk. All investigated cultures were able to acidify camel milk and reached a final pH at a level similar to what...

  17. Field handling conditions of raw milk sold in vending machines: experimental evaluation of the behaviour of Listeria monocytogenes, Escherichia coli O157:H7, Salmonella Typhimurium and Campylobacter jejuni

    Directory of Open Access Journals (Sweden)

    Renato G. Zanoni

    2012-01-01

    Full Text Available The direct sale by farmers of raw milk for human consumption has been allowed in Italy since 2004. The aim of this study was to evaluate the behaviour of selected foodborne pathogens in raw milk sold in vending machines, in field handling conditions, and during shelf-life from production to consumption. Temperature of storage of raw milk in 33 farms authorized to produce and sell raw milk were investigated from farm to vending machine delivery, together with consumer habits in one province of the Emilia-Romagna region of northern Italy. Failure to maintain appropriate low temperatures during shelf-life was recorded and 43% of consumers did not boil milk before consumption. Listeria monocytogenes, Escherichia coli O157:H7, Salmonella Typhimurium and Campylobacter jejuni strains were inoculated into raw milk samples, and the best (4°C as established by law and worst temperature storage conditions detected (variable temperature were simulated. Boiling tests were performed for each pathogen considered at high and low levels of contamination. Results showed an increase in L. monocytogenes in milk stored at 4°C and at variable temperatures recorded in shelf-life monitoring, an increase in E. coli O157:H7 and S. Typhimurium at variable temperatures but not at 4°C, and a decrease in C. jejuni in all storage conditions. Boiling milk is effective in making it safe for consumers. This study provides evidence that appropriate handling of raw milk, maintaining low temperatures, together with consumer education concerning boiling raw milk before consumption are key factors in preventing foodborne infections linked to raw milk consumption, and helps assess the risk of foodborne infection linked to raw milk consumption.

  18. Conjugated linolenic acid (CLnA), conjugated linoleic acid (CLA) and other biohydrogenation intermediates in plasma and milk fat of cows fed raw or extruded linseed.

    Science.gov (United States)

    Akraim, F; Nicot, M C; Juaneda, P; Enjalbert, F

    2007-07-01

    Thirty lactating dairy cows were used in a 3 × 3 Latin-square design to investigate the effects of a raw or extruded blend of linseed and wheat bran (70:30) on plasma and milk fatty-acids (FA). Linseed diets, containing 16.6% linseed blend on a dry-matter basis, decreased milk yield and protein percentage. They decreased the proportions of FA with less than 18 carbons in plasma and milk and resulted in cis-9, cis-12, cis-15 18:3 proportions that were more than three and four times higher in plasma and milk, respectively, whereas cis-9, cis-12 18:2 proportions were decreased by 10-15%. The cis-9, trans-11, cis-15 18:3 isomer of conjugated linolenic acid was not detected in the milk of control cows, but was over 0.15% of total FA in the milk fat of linseed-supplemented cows. Similarly, linseed increased plasma and milk proportions of all biohydrogenation (BH) intermediates in plasma and milk, including the main isomer of conjugated linoleic acid cis-9, trans-11 18:2, except trans-4 18:1 and cis-11, trans-15 18:2 in plasma lipids. In milk fat, compared with raw linseed, extruded linseed further reduced 6:0-16:0 even-chain FA, did not significantly affect the proportions of 18:0, cis-9 18:1 and cis-9, cis-12 18:2, tended to increase cis-9, cis-12, cis-15 18:3, and resulted in an additional increase in the proportions of most BH intermediates. It was concluded that linseed addition can improve the proportion of conjugated linoleic and linolenic acids, and that extrusion further increases the proportions of intermediates of ruminal BH in milk fat.

  19. Validation of a rapid lateral flow test for the simultaneous determination of β-lactam drugs and flunixin in raw milk.

    Science.gov (United States)

    Douglas, David; Banaszewski, Katie; Juskelis, Rima; Al-Taher, Fadwa; Chen, Yang; Cappozzo, Jack; McRobbie, Lindsay; Salter, Robert S

    2012-07-01

    β-Lactam antibiotics are the most commonly used drugs on dairy farms. β-Lactam residues in milk are kept out of the human milk supply with good agricultural practices and mandatory truck screening performed by the dairy industry under Appendix N of the Pasteurized Milk Ordinance. Flunixin, a nonsteroidal and anti-inflammatory drug, appears in dairy cattle tissue residues with a frequency similar to the occurrence of penicillin G. This creates concern that flunixin residues could be in milk and would go undetected under current milk screening programs. A single test that combines mandatory β-lactam screening with voluntary flunixin screening is an economical approach for monitoring and controlling for potential flunixin or 5-hydroxyflunixin, the primary flunixin metabolite marker in milk. The objective of this study was to validate a β-lactam and flunixin rapid lateral flow test (LFT) and compare the results obtained with a liquid chromatography-triple quadrupole tandem mass spectrometry (LC-MS/MS) method for the simultaneous determination of flunixin and 5-hydroxyflunixin in raw milk with a limit of detection of , 1 ppb, equivalent to 1 ng/ml. Using the LFT, three combined manufactured lots of test strips detected penicillin G at 2.0 ppb, ampicillin at 6.8 ppb, amoxicillin at 5.9 ppb, cephapirin at 13.4 ppb, ceftiofur (total metabolites) at 63 ppb, and 5-hydroxyflunixin at 1.9 ppb at least 90% of the time with 95% confidence. The LFT also detected incurred flunixin milk samples that were analyzed with the LC-MS/MS and diluted to tolerance in raw milk. The detection levels for the LFT are lower than the U.S. safe levels or tolerances and qualify the test to be used in compliance with U.S. milk screening programs.

  20. Influence of storage and heating on protein glycation levels of processed lactose-free and regular bovine milk products.

    Science.gov (United States)

    Milkovska-Stamenova, Sanja; Hoffmann, Ralf

    2017-04-15

    Thermal treatment preserves the microbiological safety of milk, but also induces Maillard reactions modifying for example proteins. The purpose of this study was evaluating the influence of consumer behaviors (storage and heating) on protein glycation degrees in bovine milk products. Lactosylation and hexosylation sites were identified in ultra-high temperature (UHT), lactose-free pasteurized, and lactose-free UHT milk (ULF) and infant formula (IF) using tandem mass spectrometry (electron transfer dissociation). Overall, 303 lactosylated and 199 hexosylated peptides were identified corresponding to 170 lactosylation (31 proteins) and 117 hexosylation sites (25 proteins). In quantitative terms, storage increased lactosylation up to fourfold in UHT and IF and hexosylation up to elevenfold in ULF and threefold in IF. These levels increased additionally twofold when the stored samples were heated (40°C). In conclusion, storage and heating appear to influence protein glycation levels in milk at similar or even higher degrees than industrial processing. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Nutritional and Hygienic Quality of Raw Milk in the Mid-Northern Region of Algeria: Correlations and Risk Factors

    Directory of Open Access Journals (Sweden)

    Soumeya Adjlane-Kaouche

    2014-01-01

    Full Text Available This paper aims to study the overall quality of raw milk in the mid-northern region of Algeria. The analysis results showed a decrease in the average temperature for the delivery of 1,54°C with P0.05 was observed in almost all the physical and nutritional parameters studied (pH, fat content, and protein content between M1 and M2. The average contamination by total mesophilic aerobic bacteria (TMAB, coliforms, yeasts, molds, and different pathogens in samples taken at M1 showed significant changes at M2. This was confirmed by the decrease of reduction time of methylene blue (RTMB, about 54%. The variation was described as follows: (P>0.05 for yeasts and (P<0.05 for molds in M1 and M2, (P<0.05 for TMAB in M1, and (P<0.001 for TC, FC, and TMAB in M2. The analysis for the detection of Salmonella spp. showed no contamination in all samples tested, while antibiotic residues were detected in 35% of milks delivered. In conclusion, several risk factors have been identified in this study, namely, the effect of the season and the distance between the farm and the dairy unit.

  2. Schiff base: A high affinity chemical agent to decrease the concentration of aflatoxin M1 in raw milk contaminated artificially

    Directory of Open Access Journals (Sweden)

    Frane Delaš

    2012-03-01

    Full Text Available In the present study were conducted the effect of pH (5.5, 6.0 and 6.5 and concentration of new synthesized 3-/2-aminophenylimino-(p-toluoyl/-4-hydroxy-6-(p-tolyl-2H-pyrane-2-one (Schiff base on decrease the concentration of aflatoxin M1 (AFM1 in raw milk contaminated with known concentration of this toxin. Experiments were carried out at temperature of 4 °C during 35 days. At pH 5.5 Schiff base concentration of 0.1 µmol/L was lessening the concentration of AFM1 after 35 days by 55 %. However, at pH 6.5 the most effective concentration for lessening of AFM1 was 0.5 µmol/L. Schiff base was not effective at pH value of 7 or higher. The ability of Schiff base to act as antimycotoxigenic agent provides new perspective for possibly using this compound to control AFM1 contamination in milk and to extent shelf lives of this food. Detection of toxicity of investigated Schiff base was performed by using the brine shrimp (Artemia salina larvae as an biological indicator to determine their sensitivity to this chemical agent.

  3. Consumption of unprocessed cow's milk protects infants from common respiratory infections

    NARCIS (Netherlands)

    Loss, G.; Depner, M.; Ulfman, L.H.; Neerven, van R.J.J.; Hose, A.J.; Genuneit, J.

    2015-01-01

    Background: Breast-feeding is protective against respiratory infections in early life. Given the co-evolutionary adaptations of humans and cattle, bovine milk might exert similar anti-infective effects in human infants. Objective: To study effects of consumption of raw and processed cow's milk on

  4. Human-Based Human Milk Fortifier as Rescue Therapy in Very Low Birth Weight Infants Demonstrating Intolerance to Bovine-Based Human Milk Fortifier.

    Science.gov (United States)

    Sandhu, Amanjot; Fast, Sharla; Bonnar, Kari; Baier, Ronald John; Narvey, Michael

    2017-11-01

    To describe the results of utilizing a human milk-based human milk fortifier (HMHMF) as rescue therapy to meet nutritional requirements in very low birth weight and preterm infants demonstrating feeding intolerance to bovine-based human milk fortifier (BHMF) in the Canadian Neonatal Intensive Care Unit (NICU) setting. At two Level III NICUs in Winnipeg, MB, Canada, a rescue protocol was implemented to provide HMHMF for infants demonstrating intolerance to BHMF. To qualify for rescue, infants were required to experience two episodes of significant gastrointestinal (GI) symptoms associated with fortification with BHMF. A case series report was conducted retrospectively examining the success of rescue therapy, growth rates, protein, and calorie intakes before and after initiation of HMHMF in seven infants. Seven infants (birth weight 723 ± 247 g, gestation 25.3 ± 3.4 weeks) were treated with rescue fortification with HMHMF. All infants were transitioned off parenteral nutrition (PN) without relapse of GI symptoms. Growth rate, protein, and calorie intakes improved with the use of HMHMF. Very low birth weight and preterm infants with GI intolerance to BHMF were successfully rescued with use of HMHMF. Improvements in growth were achieved without need for supplementation with PN through achievement of sufficient enteral calorie and protein intakes.

  5. Short communication: Postpasteurization hold temperatures of 4 or 6°C, but not raw milk holding of 24 or 72 hours, affect bacterial outgrowth in pasteurized fluid milk.

    Science.gov (United States)

    Andrus, Alexis D; Campbell, Brynne; Boor, Kathryn J; Wiedmann, Martin; Martin, Nicole H

    2015-11-01

    As fluid milk processors continue to reduce microbial spoilage in fluid milk through improved control of postpasteurization contamination and psychrotolerant sporeformer outgrowth, it is necessary to identify strategies to further improve the quality and extend the shelf life of fluid milk products that are high-temperature, short-time pasteurized. Solutions that optimize product quality, and are economically feasible, are of particular interest to the dairy industry. To this end, this study examined the effects of raw milk holding time and temperature of pasteurized milk storage over shelf life on bacterial growth. In 3 independent replicates, raw milk was stored for 24 and 72 h before pasteurization at 76°C for 25s and then incubated at 3 different storage conditions: (1) 4°C for 21d; (2) 4°C for the first 48 h, then 6°C for the duration of the 21-d shelf life; or (3) 6°C for 21d. Total bacteria counts were assessed initially and on d 7, 14, and 21. No substantial difference in bacterial growth over shelf life was observed between samples processed from raw milk held for 24 versus 72 h. A significantly lower bacterial load was seen at d 21 after pasteurization in samples held at 4°C, versus 4°C for the first 48 h followed by 6°C for the duration of the 21-d shelf life and samples held at 6°C for 21d. This work demonstrates the importance of maintaining control of the fluid milk cold chain throughout postpasteurization, transportation, and retail storage on fluid milk microbial quality. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  6. Effects of raw milk and starter feed on intake and body composition of Holstein x Gyr male calves up to 64 days of age

    NARCIS (Netherlands)

    Silva, A.L.; Marcondes, M.I.; Detmann, E.; Machado, F.S.; Valadares Filho, S.C.; Trece, A.S.; Dijkstra, J.

    2015-01-01

    The objective was to evaluate the effect of supplying different levels of raw milk, alone or in combination, with access to a starter feed, on the intake, digestibility, daily gain, N balance, and body composition of Holstein × Gyr crossbred suckling calves until 64 d of age. Thirty-nine male calves

  7. Suitability of the charm HVS and a microbiological multiplate system for detection of residues in raw milk at EU maximum residue levels

    NARCIS (Netherlands)

    Nouws, J.F.M.; Egmond, van H.; Loeffen, G.; Schouten, J.; Keukens, H.; Smulders, I.; Stegeman, H.

    1999-01-01

    In this paper we assessed the suitability of the Charm HVS and a newly developed microbiological multiplate system as post-screening tests to confirm the presence of residues in raw milk at or near the maximum permissible residue level (MRL). The multiplate system is composed of Bacillus

  8. INTRODUCTION OF PASTEURIZED/RAW COW'S MILK DURING THE SECOND SEMESTER OF LIFE AS A RISK FACTOR OF TYPE 1 DIABETES MELLITUS IN SCHOOL CHILDREN AND ADOLESCENTS.

    Science.gov (United States)

    Villagrán-García, Edna F; Hurtado-López, Erika F; Vasquez-Garibay, Edgar M; Troyo-Sanromán, Rogelio; Aguirre-Salas, Liuba M; Larrosa-Haro, Alfredo; León-Robles, Ruth V

    2015-08-01

    to demonstrate that type 1 diabetes mellitus (T1DM) in school children and adolescents is associated with the early introduction of pasteurized/raw cow's milk in the second semester of life. this non-probabilistic study included 150 subjects (75 patients and 75 controls), divided according to sex and age (range, 6 to 16 years). T1DM was considered to be a dependent variable, and pasteurized/ raw cow's milk (P/RCM) was considered to be an independent variable in the study. The statistical analyses included chi-squared test, odds ratio and 95% confidence intervals. the subjects were 51% male, age 11 ± 3.2 years, and 80% were breastfed, 18% were exclusively breastfed, and 13% received pasteurized/raw cow's milk. The children receiving P/RCM had a higher risk of T1DM [OR, 3.9 (1.2-12.8)]. The presence of T1DM was three times higher in those consuming P/RCM vs. those receiving follow-up formula [RM, 3.2 (1.03-10.07)]. introducing pasteurized/raw cow's milk in the second semester of life increased by four times the likelihood of developing T1DM in children and adolescents. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  9. A validated PCR-based method to detect Listeria monocytogenes using raw milk as a food model - Towards an international standard

    DEFF Research Database (Denmark)

    D'Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.

    2004-01-01

    the accordance (repeatability) and the concordance (reproducibility) were 99.4%. The assay was incorporated within a method for the detection of L. monocytogenes in raw milk, which involves 24 It of enrichment in half-Fraser broth followed by 16 h of enrichment in a medium that can be added directly into the PCR...

  10. High occurrence of Helicobacter pylori in raw goat, sheep and cow milk inferred by glmM gene: a risk of food-borne infection?

    Science.gov (United States)

    Quaglia, N C; Dambrosio, A; Normanno, G; Parisi, A; Patrono, R; Ranieri, G; Rella, A; Celano, G V

    2008-05-10

    Helicobacter pylori is an organism widespread in humans and sometimes responsible for serious illnesses, such as gastric and duodenal ulcers, MALToma and even gastric cancer. It has been hypothesized that the infection route by H. pylori involves multiple pathways including food-borne transmission, as the microorganism has been detected from foods such as sheep and cow milk. This work reports the results of a survey conducted in order to investigate the presence of H. pylori in raw goat, sheep and cow milk produced in Southern Italy, employing a Nested Polymerase Chain Reaction (Nested-PCR) assay for the detection of the phosphoglucosamine mutase gene (glmM), as screening method followed by conventional bacteriological isolation. Out of the 400 raw milk samples examined, 139 (34.7%) resulted positive for the presence of glmM gene, but no strains were isolated. In this work H. pylori DNA has been firstly detected from 41 (25.6%) raw goat milk samples. The results deserve further investigations on the contamination source/s of the milk samples and on the major impact that it may have on consumers.

  11. Evaluation of milk yield losses associated with Salmonella antibodies in bulk tank milk in bovine dairy herds.

    Science.gov (United States)

    Nielsen, T D; Green, L E; Kudahl, A B; Østergaard, S; Nielsen, L R

    2012-09-01

    The effect of Salmonella on milk production is not well established in cattle. The objective of this study was to investigate whether introduction of Salmonella into dairy cattle herds was associated with reduced milk yield and determine the duration of any such effect. Longitudinal data from 2005 through 2009 were used, with data from 12 mo before until 18 mo after the estimated date of infection. Twenty-eight case herds were selected based on an increase in the level of Salmonella-specific antibodies in bulk-tank milk from levels consistently energy-corrected milk (ECM)/cow were used to investigate daily milk yield before and after the estimated herd infection date for cows in parities 1, 2, and 3+. Control herds were used to evaluate whether the effects in the case herds could be reproduced in herds without Salmonella infection. Herd size, days in milk, somatic cell count, season, and year were included in the models. Yield in first-parity cows was reduced by a mean of 1.4 kg (95% confidence interval: 0.5 to 2.3) of ECM/cow per day from 7 to 15 mo after the estimated herd infection date, compared with that of first-parity cows in the same herds in the 12 mo before the estimated herd infection date. Yield for parity 3+ cows was reduced by a mean of 3.0 kg (95% confidence interval: 1.3 to 4.8) of ECM/cow per day from 7 to 15 mo after herd infection compared with that of parity 3+ cows in the 12 mo before the estimated herd infection. We observed minor differences in yield in second-parity cows before and after herd infection and observed no difference between cows in control herds before and after the simulated infection date. Milk yield decreased significantly in affected herds and the reduction was detectable several months after the increase in bulk tank milk Salmonella antibodies. It took more than 1 yr for milk yield to return to preinfection levels. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  12. Fatty acid composition, fat soluble vitamin concentrations and oxidative stability in bovine milk produced on two pastures with different botanical composition

    DEFF Research Database (Denmark)

    Adler, S A; Dahl, A V; Jensen, Søren Krogh

    2013-01-01

    to oxidation. Two groups of 8 multiparous Norwegian Red dairy cows [mean (standard deviation); 599 (45.1) kg body weight, 73 (15.0) d in milk, 29.9 (2.90) kg milk/d at experiment start] grazed either a short-term pasture (SP) or a long-term pasture (LP). Both pastures were organically managed, meaning......Previous research has shown that grazing pastures compared to feeding preserved forages has large impact on milk fatty acid (FA) composition, but differences between grazing red clover (Trifolium pratense L.) or white clover (Trifolium repens L.) are small, whereas the herbage proportions...... of dicotyledon botanical families is positively correlated with the milk-fat proportions of total polyunsaturated FA when grazing pastures in the Alps. The objective of the present study was to investigate the influence of botanically different pastures on bovine milk composition and milk susceptibility...

  13. Effect of safflower oil, flaxseed oil, monensin, and vitamin E on concentration of conjugated linoleic acid in bovine milk fat.

    Science.gov (United States)

    Bell, J A; Griinari, J M; Kennelly, J J

    2006-02-01

    Conjugated linoleic acid (CLA) refers to a mixture of conjugated octadecadienoic acids of predominantly ruminant origin. The main isomer in bovine milk fat is the cis-9, trans-11 CLA. Interest in CLA increased after the discovery of its health-promoting properties, including potent anticarcinogenic activity. Two experiments were conducted to evaluate dietary strategies aimed at increasing the concentration of CLA in bovine milk fat. Both experiments were organized as a randomized complete block design with a repeated measures treatment structure. In Experiment 1, 28 Holstein cows received either a control diet or one of 3 treatments for a period of 2 wk. The control diet consisted of 60% forage (barley silage, alfalfa silage, and alfalfa hay) and 40% concentrate on a dry matter (DM) basis, fed as a total mixed ration (TMR). The concentrate was partially replaced in the treatment groups with 24 ppm of monensin (MON), 6% of DM safflower oil (SAFF), or 6% of DM safflower oil plus 24 ppm of monensin (SAFF/M). Average cis-9, trans-11 CLA levels in milk fat after 2 wk of feeding were 0.45, 0.52, 3.36, and 5.15% of total fatty acids for control, MON, SAFF, and SAFF/M, respectively. In Experiment 2, 62 Holstein cows received either a control diet or one of 5 treatment diets for a period of 9 wk. The control diet consisted of 60% forage (barley silage, alfalfa silage, and alfalfa hay) and 40% concentrate on a DM basis, fed as a TMR. The concentrate was partially replaced in the treatment groups with 6% of DM safflower oil (SAFF), 6% of DM safflower oil plus 150 IU of vitamin E/kg of DM (SAFF/E), 6% of DM safflower oil plus 24 ppm of monensin (SAFF/M), 6% of DM safflower oil plus 24 ppm of monensin plus 150 IU of vitamin E/kg of DM (SAFF/ME), or 6% of DM flaxseed oil plus 150 IU of vitamin E/kg of DM (FLAX/E). Average cis-9, trans-11 CLA levels during the treatment period were 0.68, 4.12, 3.48, 4.55, 4.75, and 2.80% of total fatty acids for control, SAFF, SAFF/E, SAFF

  14. Genetic characterization of antimicrobial resistance in coagulase-negative staphylococci from bovine mastitis milk.

    Science.gov (United States)

    Frey, Yvonne; Rodriguez, Joan Peña; Thomann, Andreas; Schwendener, Sybille; Perreten, Vincent

    2013-04-01

    Coagulase-negative staphylococci (CNS; n=417) were isolated from bovine milk and identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Nineteen different species were identified, and Staphylococcus xylosus, Staphylococcus chromogenes, Staphylococcus haemolyticus, and Staphylococcus sciuri were the most prevalent species. Resistance to oxacillin (47.0% of the isolates), fusidic acid (33.8%), tiamulin (31.9%), penicillin (23.3%), tetracycline (15.8%), streptomycin (9.6%), erythromycin (7.0%), sulfonamides (5%), trimethoprim (4.3%), clindamycin (3.4%), kanamycin (2.4%), and gentamicin (2.4%) was detected. Resistance to oxacillin was attributed to the mecA gene in 9.7% of the oxacillin-resistant isolates. The remaining oxacillin-resistant CNS did not contain the mecC gene or mecA1 promoter mutations. The mecA gene was detected in Staphylococcus fleurettii, Staphylococcus epidermidis, Staph. haemolyticus, and Staph. xylosus. Resistance to tetracycline was attributed to the presence of tet(K) and tet(L), penicillin resistance to blaZ, streptomycin resistance to str and ant(6)-Ia, and erythromycin resistance to erm(C), erm(B), and msr. Resistance to tiamulin and fusidic acid could not be attributed to an acquired resistance gene. In total, 15.1% of the CNS isolates were multidrug resistant (i.e., resistant to 2 or more antimicrobials). The remaining CNS isolates were susceptible to antimicrobials commonly used in mastitis treatment. Methicillin-resistant CNS isolates were diverse, as determined by mecA gene sequence analysis, staphylococcal cassette chromosome mec typing, and pulsed-field gel electrophoresis. Arginine catabolic mobile element types 1 and 3 were detected in both methicillin-resistant and methicillin-susceptible Staph. epidermidis and were associated with sequence types ST59 and ST111. Because this study revealed the presence of multidrug-resistant CNS in a heterogeneous CNS population, we recommend antibiogram analysis

  15. Antimicrobial susceptibility of coagulase-negative Staphylococcus species isolated from bovine milk.

    Science.gov (United States)

    Sawant, A A; Gillespie, B E; Oliver, S P

    2009-02-16

    Coagulase-negative Staphylococcus (CNS) isolates (n=168) obtained from milk from heifers and dairy cows were screened for minimum inhibitory concentration (MIC) to antimicrobials used commonly for mastitis therapy. Of the 10 CNS species included in the study, the predominant species were Staphylococcus chromogenes (n=61), Staphylococcus epidermidis (n=37), Staphylococcus hyicus (n=37), and Staphylococcus simulans (n=16). The majority of CNS was susceptible to ampicillin, oxacillin, cephalothin, and ceftiofur. Erythromycin and pirlimycin were also very effective in vitro inhibitors of CNS. The only exception was observed with S. epidermidis. Of 37 S. epidermidis evaluated, 13 (35%) exhibited efflux-based resistance to erythromycin (> or =16 microg/ml) encoded by msrA and one isolate carried ermC encoding ribosomal methylase-based resistance to both erythromycin (> or =64 microg/ml) and pirlimycin (> or =64 microg/ml). A total of 17 S. epidermidis, 11 S. chromogenes, and one S. hyicus exhibited phenotypic resistance to ampicillin (> or =0.5 microg/ml). Constitutive beta-lactamase production was observed in all ampicillin resistant isolates except 4 S. epidermidis that exhibited inducible beta-lactamase production. Induced beta-lactamase production was also observed in 13 S. epidermidis that were phenotypically susceptible to the entire MIC panel. All isolates that produced beta-lactamase either constitutively or by induction carried blaZ. S. epidermidis (n=12, 32%) that were resistant to methicillin (oxacillin > or =0.5 microg/ml) carried low affinity penicillin-binding protein encoded by mecA. Most multi-drug resistant (MDR) S. epidermidis (> or =2 resistance genes) were resistant to ampicillin, erythromycin and methicillin. All except one MDR S. epidermidis had icaAB, which encodes for polysaccharide intercellular adhesion. Based on pulsed field gel electrophoresis, MDR S. epidermidis were closely related genotypically, and were isolated from different cows on the

  16. Construction of an Electrochemical Sensor Based on Carbon Nanotubes/Gold Nanoparticles for Trace Determination of Amoxicillin in Bovine Milk

    Directory of Open Access Journals (Sweden)

    Aliyu Muhammad

    2016-01-01

    Full Text Available In this work, a novel electrochemical sensor was fabricated for determination of amoxicillin in bovine milk samples by decoration of carboxylated multi-walled carbon nanotubes (MWCNTs with gold nanoparticles (AuNPs using ethylenediamine (en as a cross linker (AuNPs/en-MWCNTs. The constructed nanocomposite was homogenized in dimethylformamide and drop casted on screen printed electrode. Field emission scanning electron microscopy (FESEM, energy dispersive X-Ray (EDX, X-Ray diffraction (XRD and cyclic voltammetry were used to characterize the synthesized nanocomposites. The results show that the synthesized nanocomposites induced a remarkable synergetic effect for the oxidation of amoxicillin. Effect of some parameters, including pH, buffer, scan rate, accumulation potential, accumulation time and amount of casted nanocomposites, on the sensitivity of fabricated sensor were optimized. Under the optimum conditions, there was two linear calibration ranges from 0.2–10 µM and 10–30 µM with equations of Ipa (µA = 2.88C (µM + 1.2017; r = 0.9939 and Ipa (µA = 0.88C (µM + 22.97; r = 0.9973, respectively. The limit of detection (LOD and limit of quantitation (LOQ were calculated as 0.015 µM and 0.149 µM, respectively. The fabricated electrochemical sensor was successfully applied for determination of Amoxicillin in bovine milk samples and all results compared with high performance liquid chromatography (HPLC standard method.

  17. Net analyte signal standard addition method for simultaneous determination of sulphadiazine and trimethoprim in bovine milk and veterinary medicines.

    Science.gov (United States)

    Hajian, Reza; Mousavi, Esmat; Shams, Nafiseh

    2013-06-01

    Net analyte signal standard addition method has been used for the simultaneous determination of sulphadiazine and trimethoprim by spectrophotometry in some bovine milk and veterinary medicines. The method combines the advantages of standard addition method with the net analyte signal concept which enables the extraction of information concerning a certain analyte from spectra of multi-component mixtures. This method has some advantages such as the use of a full spectrum realisation, therefore it does not require calibration and prediction step and only a few measurements require for the determination. Cloud point extraction based on the phenomenon of solubilisation used for extraction of sulphadiazine and trimethoprim in bovine milk. It is based on the induction of micellar organised media by using Triton X-100 as an extraction solvent. At the optimum conditions, the norm of NAS vectors increased linearly with concentrations in the range of 1.0-150.0 μmolL(-1) for both sulphadiazine and trimethoprim. The limits of detection (LOD) for sulphadiazine and trimethoprim were 0.86 and 0.92 μmolL(-1), respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Outbreak of Human Brucellosis from Consumption of Raw Goats' Milk in Penang, Malaysia.

    Science.gov (United States)

    Leong, Kar Nim; Chow, Ting Soo; Wong, Peng Shyan; Hamzah, Siti Hawa; Ahmad, Norazah; Ch'ng, Chin Chin

    2015-09-01

    We report the largest outbreak of brucellosis in Penang, Malaysia. Brucellosis is not endemic in this region. The index case was a 45-year-old goat farm owner presented with 3 weeks of fever, headache, severe lethargy, poor appetite, and excessive sweating. He claimed to have consumed unpasteurized goat's milk that he had also sold to the public. Tests were negative for tropical diseases (i.e., dengue fever, malaria, leptospirosis and scrub typhus) and blood culture showed no growth. Based on epidemiological clues, Brucella serology was ordered and returned positive. Over a period of 1 year, 79 patients who had consumed milk bought from the same farm were diagnosed with brucellosis. Two of these patients were workers on the farm. Four laboratory staff had also contracted the disease presumably through handling of the blood samples. The mean duration from onset of symptoms to diagnosis was 53 days with a maximum duration of 210 days. A combination treatment of rifampin and doxycycline for 6 weeks was the first line of treatment in 90.5% of patients. One-third of the patients had sequelae after recovering and 21% had a relapse. We highlight the importance of Brucellosis as a differential diagnosis when a patient has unexplained chronic fever. © The American Society of Tropical Medicine and Hygiene.

  19. BOX & JENKINS METHODOLOGY: AN APLICATION IN RAW MILK DATA FROM THE STATE OF MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    Eduardo Campana Barbosa

    2014-04-01

    Full Text Available The Box & Jenkins methodology was used to obtain a statistical model for estimate the production in liters of milk of the 6 first months of 2013 in Minas Gerais state, adjusting SARIMA (p, d, q x (P, D, Qs models, where d and D are the number of differences to remove the trend and seasonality of time series, p and q are the order of the autoregressive and moving average operators, P and Q are the order of the autoregressive and moving average seasonal operators and s is the seasonal periodicity. The Akaike Criterion Information (AIC procedure was used to select the 6 most parsimonious models and to find the best one the error indicators Mean Squared Error (EQM and Mean Absolute Percent Error (MAPE were analyzed, in addition to the assumptions of residues white noise. The Seasonal Autoregressive Integrated Moving Average SARIMA (3,1,2 x (0,1,212 was upper, view of the principle of parsimony and with more precise estimates. The forecast was more adjusted to the real values of milk production in Minas Gerais state and the model had smaller error indicators. The residues estimated were by this model white noise.

  20. Bacteriological quality of raw human milk: effect of storage in a refrigerator.

    Science.gov (United States)

    Olowe, S A; Ahmed, I; Lawal, S F; Ransome-Kuti, S

    1987-12-01

    Eighty-seven breast milk samples were obtained from 63 mothers of infants on the neonatal intensive care unit of the Lagos University Teaching Hospital. The samples were cultured for bacteria immediately after collection (0 h) and then stored in a domestic refrigerator from where cultures were repeated at 6-hourly intervals for 24 h. At 0 h, three (3.4%) of the samples were sterile; 56 (64%) grew coagulase negative staphylococci, and one (1.1%) Streptococcus viridans. Thus, 60 (69%) of the samples were either sterile or contained only skin commensals. Twenty-nine (31%) grew potential pathogens--coagulase positive staphylococci in two (2.3%) and mixed growth of staphylococci, coliforms and klebsiella in 25 (28.3%). During the 24 h storage in the refrigerator, bacteria multiplied in 50 and their growth was inhibited in 32 of the samples. But the mean bacterial count at any time during the 24 h was not significantly different from that at the beginning of the storage in the refrigerator. It is proposed that expressed breast milk stored in a domestic refrigerator can be given safely to infants within 24 h of collection if heavy contamination is prevented at the time of collection.

  1. A Raman-spectroscopy-based approach for detection and discrimination of Streptococcus thermophilus and Lactobacillus bulgaricus phages at low titer in raw milk.

    Science.gov (United States)

    Tayyarcan, Emine Kübra; Acar Soykut, Esra; Boyaci, Ismail Hakki

    2018-04-11

    In this study, a method combining Raman spectroscopy with chemometric analysis was developed for detection of phage presence in raw milk and discrimination of Streptococcus thermophilus and Lactobacillus bulgaricus phages which are among the main phages causing problems in dairy industry. For this purpose, S. thermophilus and L. bulgaricus phages were added into raw milk separately, and then some pretreatments such as fat separation, removal of casein, and filtration were applied to the raw milk samples. Raman spectra of the samples were collected and then analyzed using principal component analysis in order to discriminate these phages in raw milk. In the next step, dilutions of S. thermophilus phages in pretreated raw milk were prepared, and Raman spectra were collected. These spectra were analyzed by using partial least squares method to quantify phages in low titer. Consequently, it has been demonstrated that S. thermophilus and L. bulgaricus phages, which have titers sufficient to fail the fermentation (~ 10 7  pfu/mL) and have lower titers (10 2 -10 3  pfu/mL), could be discriminated from antibiotic and each other. Additionally, low concentrations of S. thermophilus phages (10 2  pfu/mL) could be detected through Raman spectroscopy with a short analysis time (60 min) and high coefficient of determination (R 2 ) values for both calibration (0.985) and validation (0.906) with a root mean square error of calibration of 70.54 and root mean square error of prediction of 165.47. However, a lower success was achieved with L. bulgaricus phages and the obtained coefficient of determination values were not sufficiently high (0.649).

  2. Phenotypic and genotypic characterization of lactic acid bacteria isolated from raw goat milk and effect of farming practices on the dominant species of lactic acid bacteria.

    Science.gov (United States)

    Tormo, Hélène; Ali Haimoud Lekhal, Djamila; Roques, C

    2015-10-01

    Lactic acid bacteria, in particular Lactococcus lactis, play a decisive role in the cheese making process and more particularly in lactic cheeses which are primarily produced on goat dairy farms. The objective of this study was therefore to identify the main lactic acid bacteria found in raw goats' milk from three different regions in France and evaluate if certain farming practices have an effect on the distribution of species of lactic acid bacteria in the various milk samples. Identification at genus or species level was carried out using phenotypic tests and genotypic methods including repetitive element REP-PCR, species-specific PCR and 16S rRNA gene sequencing. The distribution of the main bacterial species in the milk samples varied depending on farms and their characteristics. Out of the 146 strains identified, L. lactis was the dominant species (60% of strains), followed by Enterococcus (38%) of which Enterococcus faecalis and Enterococcus faecium. Within the species L. lactis, L. lactis subsp lactis was detected more frequently than L. lactis subsp cremoris (74% vs. 26%). The predominance of L. lactis subsp cremoris was linked to geographical area studied. It appears that the animals' environment plays a role in the balance between the dominance of L. lactis and enterococci in raw goats' milk. The separation between the milking parlor and the goat shed (vs no separation) and only straw in the bedding (vs straw and hay) seems to promote L. lactis in the milk (vs enterococci). Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Implementation of the Bacillus cereus microbiological plate used for the screening of tetracyclines in raw milk samples with STAR protocol - the problem with false-negative results solved.

    Science.gov (United States)

    Raspor Lainšček, P; Biasizzo, M; Henigman, U; Dolenc, J; Kirbiš, A

    2014-01-01

    In antibiotic residue analyses the first step of screening is just as important as the following steps. Screening methods need to be quick and inexpensive, but above all sensitive enough to detect the antibiotic residue at or below the maximum residue limit (MRL). In the case of a positive result, the next step is conducted and further methods are used for confirmation. MRLs stated in European Union Regulation 37/2010 for tetracyclines in raw milk are: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 100 µg kg(-1) for chlortetracycline and no limit for doxycycline because it is prohibited for use in animals from which milk is produced for human consumption. The current five-plate microbiological screening method for the detection of antibiotic residues in raw milk was found to be simple and inexpensive, but not specific, sensitive and reliable enough to detect tetracycline at MRL in routine raw milk screening procedures. Spiking samples with tetracycline at the MRL level and applying them on Bacillus cereus ATCC 11778 microbiological plates often gave false-negative results, indicating that tetracyclines may have to be inactivated or masked. Tetracyclines seem to bind to a certain component in milk. Consequently, when applying samples to the B. cereus microbiological plate the antibiotic cannot inhibit the growth of B. cereus which disables the formation of inhibition zones on the test plate. After adding the appropriate amount of citric acid into the milk samples, we solved the problem of false-negative results. During the validation 79 samples of milk were spiked with tetracyclines at different concentrations: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 80 µg kg(-1) for chlortetracycline and 30 µg kg(-1) for doxycycline. Concentrations used in the validation matched the requirements for MRLs (they were either at or below the MRLs) stated in European Union Regulation 37/2010. The sensitivity of the validation was 100%.

  4. Occurrence of B1 Aflatoxin in diet and M1 Aflatoxin in bovine milk

    OpenAIRE

    Adriana Frizzarin; Thiago Pereira Motta; Thamires Martins; Livia Castelani; Heloisa Solda de Azevedo; Cláudia Rodrigues Pozzi

    2012-01-01

    Ensuring food quality is one of the principles of food safety. Food for dairy cattle may be contaminated by fungi of the genus Aspergillus, which produce aflatoxins. The B1 aflatoxin, when ingested by animals, is biotransformed in liver in several other toxic metabolites, including M1 aflatoxin which is excreted in milk. M1 aflatoxin has a carcinogenic effect, which the presence in milk poses a serious risk to public health because milk and dairy products are consumed mainly by children, preg...

  5. Tooth replantation after use of Euro-Collins solution or bovine milk as storage medium: a histomorphometric analysis in dogs.

    Science.gov (United States)

    Sottovia, André Dotto; Sottovia Filho, Dagoberto; Poi, Wilson Roberto; Panzarini, Sônia Regina; Luize, Danielle Shima; Sonoda, Celso Koogi

    2010-01-01

    Euro-Collins solution was developed for the preservation of organs for transplantation, whose characteristics have raised interest for its use as a storage medium for avulsed teeth before replantation. This study evaluated histologically and morphometrically the healing process of dog teeth replanted after storage in Euro-Collins solution or bovine milk. Eighty roots of 4 young adult mongrel dogs were randomly assigned to 4 groups (n = 20) and the root canals were instrumented and obturated with gutta-percha and a calcium hydroxide-based sealer. After 2 weeks, the teeth were extracted and subjected to the following protocols: GI (negative control), replantation immediately after extraction; GII (positive control), bench-drying for 2 hours before replantation; GIII and GIV, immersion in 10 mL of whole bovine milk and Euro-Collins solution at 4 degrees C, respectively, for 8 hours before replantation. The animals were sacrificed 90 days postoperatively. The pieces containing the replanted teeth were subjected to routine processing for histologic and histometric analyses under light microscopy and polarized light microscopy. Root resorption was observed in all groups. GII exhibited the greatest loss of dental structure (P < .01), and inflammatory resorption was predominant in this group. Storage in milk showed poorer results than immediate replantation and storage in Euro-Collins solution (P < .01). The teeth stored in Euro-Collins solution presented similar extension of root resorption and periodontal ligament reorganization to those of immediately replanted teeth. The findings of this study suggest that the Euro-Collins solution is an adequate storage medium for keeping avulsed teeth for up to 8 hours before replantation.

  6. Activity and milk compositional changes following experimentally induced Streptococcus uberis bovine mastitis.

    Science.gov (United States)

    Kester, H J; Sorter, D E; Hogan, J S

    2015-02-01

    Milk constituents and physical activity of cows experimentally infected with Streptococcus uberis mastitis were compared with those of uninfected cows. Twelve late-lactation Holsteins cows were paired based on milk production and parity. One cow in each pair was experimentally infected in the right front mammary gland with Strep. uberis. The remaining cow in each pair served as an uninfected control. Real-time analyses of milk constituents provided fat, protein, and lactose percentages at each milking. Pedometers were placed on the left front leg of all cows and activity was measured. Intramammary infections with Strep. uberis reduced milk yield in experimental cows by approximately 1.6kg/d in the first week after challenge compared with control cows. Lactose percentage in milk was reduced on d 3, 4, 5, and 6 after challenge in treatment cows compared with controls. Percentages of fat and protein in milk did not differ between infected and uninfected cows the week after infections were induced. Total steps per day were reduced and minutes resting per day were increased the week after experimental challenge in infected cows compared with control cows. The number of resting bouts did not differ between infected and uninfected cows. Changes in percentage of lactose in milk and animal activity caused by experimentally induced Strep. uberis mastitis were detected by the automated milk analyzer and pedometer systems. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.