A Genome-wide Association Study Provides Evidence of Sex-specific Involvement of Chr1p35.1 (ZSCAN20-TLR12P and Chr8p23.1 (HMGB1P46 With Diabetic Neuropathic Pain

Directory of Open Access Journals (Sweden)

Weihua Meng

2015-10-01

Full Text Available Neuropathic pain is defined as pain arising as a direct consequence of a lesion or a disease affecting the somatosensory system and it affects around 1 in 4 diabetic patients in the UK. The purpose of this genome-wide association study (GWAS was to identify genetic contributors to this disorder. Cases of neuropathic pain were defined as diabetic patients with a multiple prescription history of at least one of five drugs specifically indicated for the treatment of neuropathic pain. Controls were diabetic individuals who were not prescribed any of these drugs, nor amitriptyline, carbamazepine, or nortriptyline. Overall, 961 diabetic neuropathic pain cases and 3260 diabetic controls in the Genetics of Diabetes Audit and Research Tayside (GoDARTS cohort were identified. We found a cluster in the Chr1p35.1 (ZSCAN20-TLR12P with a lowest P value of 2.74 × 10−7 at rs71647933 in females and a cluster in the Chr8p23.1, next to HMGB1P46 with a lowest P value of 8.02 × 10−7 at rs6986153 in males. Sex-specific narrow sense heritability was higher in males (30.0% than in females (14.7%. This GWAS on diabetic neuropathic pain provides evidence for the sex-specific involvement of Chr1p35.1 (ZSCAN20-TLR12P and Chr8p23.1 (HMGB1P46 with the disorder, indicating the need for further research.

Hybrid Sterility Locus on Chromosome X Controls Meiotic Recombination Rate in Mouse.

Directory of Open Access Journals (Sweden)

Maria Balcova

2016-04-01

Full Text Available Meiotic recombination safeguards proper segregation of homologous chromosomes into gametes, affects genetic variation within species, and contributes to meiotic chromosome recognition, pairing and synapsis. The Prdm9 gene has a dual role, it controls meiotic recombination by determining the genomic position of crossover hotspots and, in infertile hybrids of house mouse subspecies Mus m. musculus (Mmm and Mus m. domesticus (Mmd, it further functions as the major hybrid sterility gene. In the latter role Prdm9 interacts with the hybrid sterility X 2 (Hstx2 genomic locus on Chromosome X (Chr X by a still unknown mechanism. Here we investigated the meiotic recombination rate at the genome-wide level and its possible relation to hybrid sterility. Using immunofluorescence microscopy we quantified the foci of MLH1 DNA mismatch repair protein, the cytological counterparts of reciprocal crossovers, in a panel of inter-subspecific chromosome substitution strains. Two autosomes, Chr 7 and Chr 11, significantly modified the meiotic recombination rate, yet the strongest modifier, designated meiotic recombination 1, Meir1, emerged in the 4.7 Mb Hstx2 genomic locus on Chr X. The male-limited transgressive effect of Meir1 on recombination rate parallels the male-limited transgressive role of Hstx2 in hybrid male sterility. Thus, both genetic factors, the Prdm9 gene and the Hstx2/Meir1 genomic locus, indicate a link between meiotic recombination and hybrid sterility. A strong female-specific modifier of meiotic recombination rate with the effect opposite to Meir1 was localized on Chr X, distally to Meir1. Mapping Meir1 to a narrow candidate interval on Chr X is an important first step towards positional cloning of the respective gene(s responsible for variation in the global recombination rate between closely related mouse subspecies.

Hybrid Sterility Locus on Chromosome X Controls Meiotic Recombination Rate in Mouse.

Science.gov (United States)

Balcova, Maria; Faltusova, Barbora; Gergelits, Vaclav; Bhattacharyya, Tanmoy; Mihola, Ondrej; Trachtulec, Zdenek; Knopf, Corinna; Fotopulosova, Vladana; Chvatalova, Irena; Gregorova, Sona; Forejt, Jiri

2016-04-01

Meiotic recombination safeguards proper segregation of homologous chromosomes into gametes, affects genetic variation within species, and contributes to meiotic chromosome recognition, pairing and synapsis. The Prdm9 gene has a dual role, it controls meiotic recombination by determining the genomic position of crossover hotspots and, in infertile hybrids of house mouse subspecies Mus m. musculus (Mmm) and Mus m. domesticus (Mmd), it further functions as the major hybrid sterility gene. In the latter role Prdm9 interacts with the hybrid sterility X 2 (Hstx2) genomic locus on Chromosome X (Chr X) by a still unknown mechanism. Here we investigated the meiotic recombination rate at the genome-wide level and its possible relation to hybrid sterility. Using immunofluorescence microscopy we quantified the foci of MLH1 DNA mismatch repair protein, the cytological counterparts of reciprocal crossovers, in a panel of inter-subspecific chromosome substitution strains. Two autosomes, Chr 7 and Chr 11, significantly modified the meiotic recombination rate, yet the strongest modifier, designated meiotic recombination 1, Meir1, emerged in the 4.7 Mb Hstx2 genomic locus on Chr X. The male-limited transgressive effect of Meir1 on recombination rate parallels the male-limited transgressive role of Hstx2 in hybrid male sterility. Thus, both genetic factors, the Prdm9 gene and the Hstx2/Meir1 genomic locus, indicate a link between meiotic recombination and hybrid sterility. A strong female-specific modifier of meiotic recombination rate with the effect opposite to Meir1 was localized on Chr X, distally to Meir1. Mapping Meir1 to a narrow candidate interval on Chr X is an important first step towards positional cloning of the respective gene(s) responsible for variation in the global recombination rate between closely related mouse subspecies.

Reduction of Hexavalent Chromium and Detection of Chromate Reductase (ChrR in Stenotrophomonas maltophilia

Directory of Open Access Journals (Sweden)

Rosa Baldiris

2018-02-01

Full Text Available An Gram negative strain of S. maltophilia, indigenous to environments contaminated by Cr(VI and identified by biochemical methods and 16S rRNA gene analysis, reduced chromate by 100%, 98–99% and 92% at concentrations in the 10–70, 80–300, and 500 mg/L range, respectively at pH 7 and temperature 37 °C. Increasing concentrations of Cr(VI in the medium lowered the growth rate but could not be directly correlated with the amount of Cr(VI reduced. The strain also exhibited multiple resistance to antibiotics and tolerance and resistance to various heavy metals (Ni, Zn and Cu, with the exception of Hg. Hexavalent chromium reduction was mainly associated with the soluble fraction of the cell evaluated with crude cell-free extracts. A protein of molecular weight around 25 kDa was detected on SDS-PAGE gel depending on the concentration of hexavalent chromium in the medium (0, 100 and 500 mg/L. In silico analysis in this contribution, revealed the presence of the chromate reductase gene ChrR in S. maltophilia, evidenced through a fragment of around 468 bp obtained experimentally. High Cr(VI concentration resistance and high Cr(VI reducing ability of the strain make it a suitable candidate for bioremediation.

Chronic Depressive Symptomatology in Mild Cognitive Impairment Is Associated with Frontal Atrophy Rate which Hastens Conversion to Alzheimer Dementia.

Science.gov (United States)

Sacuiu, Simona; Insel, Philip S; Mueller, Susanne; Tosun, Duygu; Mattsson, Niklas; Jack, Clifford R; DeCarli, Charles; Petersen, Ronald; Aisen, Paul S; Weiner, Michael W; Mackin, R Scott

2016-02-01

Investigate the association of chronic depressive symptomatology (chrDS) with cortical atrophy rates and conversion to Alzheimer dementia (AD) over 3 years in mild cognitive impairment (MCI). In a multicenter, clinic-based study, MCI elderly participants were selected from the Alzheimer's Disease Neuroimaging Initiative repository, based on availability of both serial structural magnetic resonance imaging and chrDS endorsed on three depression-related items from the Neuropsychiatric Inventory Questionnaire (chrDS N = 32 or no depressive symptoms N = 62) throughout follow-up. Clinical and laboratory investigations were performed every 6 months during the first 2 years and yearly thereafter (median follow-up: 3 years; interquartile range: 1.5-4.0 years). Cortical atrophy rates in 16 predefined frontotemporoparietal regions affected in major depression and AD and the rate of incident AD at follow-up. ChrDS in a single domain amnestic MCI sample were associated with accelerated cortical atrophy in the frontal lobe and anterior cingulate but not with atrophy rates in temporomedial or other AD-affected regions. During follow-up, 38 participants (42.7%) developed AD. Participants with chrDS had 60% shorter conversion time to AD than those without depressive symptoms. This association remained significant in survival models adjusted for temporomedial atrophy rates and showed the same trend in models adjusted for frontal cortical atrophy rate, which all increased the risk of AD. Our results suggest that chrDS associated with progressive atrophy of frontal regions may represent an additional risk factor for conversion to dementia in MCI as opposite to representing typical prodromal AD symptomatology. Published by Elsevier Inc.

Los orígenes del grial en la literatura medieval: de Chrétien de Troyes a Robert de Boron

Directory of Open Access Journals (Sweden)

Mario Martín Botero

2010-12-01

Full Text Available Este artículo muestra el origen literario del tema del Grial en la literatura medieval francesa, abordando dos textos esenciales para el surgimiento y consolidación de la “literatura del Grial”: Le Conte du Graal de Chrétien de Troyes y Le Roman de l’Estoire dou Graal de Robert de Boron. Los autores de estas obras establecen las bases para el desarrollo de toda una temática que gira alrededor del Grial a partir del siglo XII hasta nuestros días. El artículo muestra cómo de un objeto apenas sagrado en el texto de Chrétien de Troyes se pasa a una reliquia de la sangre de Cristo en la versión de Robert de Boron.This paper studies the literary origin of the Grail legend in medieval French literature, taking into account two important romances: Le Conte du Graal by Chrétien de Troyes and Le Roman de l’Estoire dou Graal by Robert de Boron. In these two texts the authors established the basis for the development of a new subject matter around the mysterious object called “Grail” from the Middle Ages to the present times. It will also be shown how an object, not totally sacred in Chrétien de Troyes, becomes a relic related with Jesus’s blood in Robert de Boron.

A Phase Ib dose-escalation study to evaluate safety and tolerability of the addition of the aminopeptidase inhibitor tosedostat (CHR-2797) to paclitaxel in patients with advanced solid tumours.

NARCIS (Netherlands)

Herpen, C.M.L. van; Eskens, F.A.; Jonge, M. de; Desar, I.M.E.; Hooftman, L.; Bone, E.A.; Timmer-Bonte, J.N.H.; Verweij, J.

2010-01-01

BACKGROUND: This Phase Ib dose-escalating study investigated safety, maximum tolerated dose (MTD), dose-limiting toxicity (DLT), pharmacokinetics (PK) and clinical antitumour activity of tosedostat (CHR-2797), an orally bioavailable aminopeptidase inhibitor, in combination with paclitaxel. METHODS:

Jeux et enjeux d’écriture chez Chrétien de Troyes: l’exemple de «Cligès»

Directory of Open Access Journals (Sweden)

Ida Lucia Machado

2011-10-01

Full Text Available Neste artigo, nos propomos descrever a estética da trama irônica presente na escritura de Chrétien de Troyes, tomando por base seu romance Cligès. A destacar algumas estratégias passíveis de criar o fenômeno irônico, estaremos também mostrando o poder de sedução que emana desta escritura.Nous nous proposons, dans cet artible, de décrire l’esthétique du jeu ironique chez Chrétien de Troyes, em puisant dans son roman Cligès. Enn dégageant qulques unes dês stratégies susceptibles de créer le phénomène ironique, nous montrerons, à la fois, le pouvoir de séduction qui emane de cette écriture.

Functional characterization of a multi-cancer risk locus on chr5p15.33 reveals regulation of TERT by ZNF148

NARCIS (Netherlands)

Fang, Jun; Jia, Jinping; Makowski, Matthew; Xu, Mai; Wang, Zhaoming; Zhang, Tongwu; Hoskins, Jason W; Choi, Jiyeon; Han, Younghun; Zhang, Mingfeng; Thomas, Janelle; Kovacs, Michael; Collins, Irene; Dzyadyk, Marta; Thompson, Abbey; O'Neill, Maura; Das, Sudipto; Lan, Qi; Koster, Roelof; Stolzenberg-Solomon, Rachael S; Kraft, Peter; Wolpin, Brian M; Jansen, Pascal W T C; Olson, Sara H; McGlynn, Katherine A; Kanetsky, Peter A; Chatterjee, Nilanjan; Barrett, Jennifer H.; Dunning, Alison M.; Taylor, John C.; Newton-Bishop, Julia A; Bishop, D. Timothy; Andresson, Thorkell; Petersen, Gloria M; Amos, Christopher I; Iles, Mark M.; Nathanson, Katherine L.; Landi, Maria Teresa; Vermeulen, Michiel; Brown, Kevin M; Amundadottir, Laufey T; Peeters, P

2017-01-01

Genome wide association studies (GWAS) have mapped multiple independent cancer susceptibility loci to chr5p15.33. Here, we show that fine-mapping of pancreatic and testicular cancer GWAS within one of these loci (Region 2 in CLPTM1L) focuses the signal to nine highly correlated SNPs. Of these,

Functional characterization of a multi-cancer risk locus on chr5p15.33 reveals regulation of TERT by ZNF148

NARCIS (Netherlands)

Fang, J. (Jun); Jia, J. (Jinping); Makowski, M. (Matthew); Xu, M. (Mai); Z. Wang (Zhaoming); Zhang, T. (Tongwu); Hoskins, J.W. (Jason W.); Choi, J. (Jiyeon); Han, Y. (Younghun); M. Zhang (Mingfeng); Thomas, J. (Janelle); Kovacs, M. (Michael); Collins, I. (Irene); Dzyadyk, M. (Marta); Thompson, A. (Abbey); O'Neill, M. (Maura); Das, S. (Sudipto); Lan, Q. (Qi); Koster, R. (Roelof); Stolzenberg-Solomon, R.S. (Rachael S.); P. Kraft (Peter); Wolpin, B.M. (Brian M.); P. Jansen; Olson, S. (Sara); K.A. McGlynn; P.P. Kanetsky (Peter P.); N. Chatterjee (Nilanjan); J.H. Barrett (Jennifer H.); A.M. Dunning (Alison); Taylor, J.C. (John C.); J.A. Newton Bishop (Julia); Timothy Bishop, D. (D.); Andresson, T. (Thorkell); Petersen, G.M. (Gloria M.); W. Amos; M.M. Iles (Mark M.); K.L. Nathanson (Katherine); Landi, M.T. (Maria Teresa); M. Vermeulen (Michiel); Brown, K.M. (Kevin M.); Amundadottir, L.T. (Laufey T.)

2017-01-01

textabstractGenome wide association studies (GWAS) have mapped multiple independent cancer susceptibility loci to chr5p15.33. Here, we show that fine-mapping of pancreatic and testicular cancer GWAS within one of these loci (Region 2 in CLPTM1L) focuses the signal to nine highly correlated SNPs. Of

Functional characterization of a multi-cancer risk locus on chr5p15.33 reveals regulation of TERT by ZNF148.

NARCIS (Netherlands)

Fang, Jun; Jia, Jinping; Makowski, Matthew; Xu, Mai; Wang, Zhaoming; Zhang, Tongwu; Hoskins, Jason W; Choi, Jiyeon; Han, Younghun; Zhang, Mingfeng; Thomas, Janelle; Kovacs, Michael; Collins, Irene; Dzyadyk, Marta; Thompson, Abbey; O'Neill, Maura; Das, Sudipto; Lan, Qi; Koster, Roelof; Stolzenberg-Solomon, Rachael S; Kraft, Peter; Wolpin, Brian M; Jansen, Pascal W T C; Olson, Sara; McGlynn, Katherine A; Kanetsky, Peter A; Chatterjee, Nilanjan; Barrett, Jennifer H; Dunning, Alison M; Taylor, John C; Newton-Bishop, Julia A; Bishop, D Timothy; Andresson, Thorkell; Petersen, Gloria M; Amos, Christopher I; Iles, Mark M; Nathanson, Katherine L; Landi, Maria Teresa; Vermeulen, Michiel; Brown, Kevin M; Amundadottir, Laufey T

2017-01-01

Genome wide association studies (GWAS) have mapped multiple independent cancer susceptibility loci to chr5p15.33. Here, we show that fine-mapping of pancreatic and testicular cancer GWAS within one of these loci (Region 2 in CLPTM1L) focuses the signal to nine highly correlated SNPs. Of these,

Implementation and Analysis of the Chromakey Augmented Virtual Environment (ChrAVE) Version 3.0 and Virtual Environment Helicopter (VEHELO) Version 2.0 in Simulated Helicopter Training

National Research Council Canada - National Science Library

Hahn, M. E

2005-01-01

The Chromakey Augmented Virtual Environment (ChrAVE) 3.0 System is a training system created to augment initial, refresher, and proficiency training in helicopter aviation using accurate simulation...

La cinéphilie chrétienne : Amédée Ayfre (1922-1964), sulpicien et critique de cinéma1

OpenAIRE

Rocher, Philippe

2012-01-01

Prêtre français de saint Sulpice et chrétien cinéphile, Amédée Ayfre a défendu l’esthétique et le réalisme cinématographiques contre le cinéma religieux du « Cinéma catholique ». Le « réalisme cinématographique » est un instrument de révélation chrétienne du Prochain. Brusquement décédé, Amédée Ayfre n’a pas eu la possibilité de dépasser ses premiers « Jalons pour une théologie de l’image ». In the middle Twentieth century, Amédée Ayfre, French priest of the Society of saint Sulpice and Ch...

Da Chrétien de Troyes a Shakespeare («The tragedy of King Richard the Third», a. I, sc. 2

Directory of Open Access Journals (Sweden)

Alfonso D'Agostino

2015-07-01

Full Text Available L’articolo si propone di considerare le somiglianze fra alcune vicende antico-francesi (l’Yvain di Chrétien de Troyes e il fabliau anonimo De celle que se fist foutre sur la fosse son mari con una scena del Riccardo III di Shakespeare. Anche se non si può dire che il dramma inglese dipenda dai testi narrativi oitanici, esso sviluppa lo stesso motivo della vedova consolata e una serie di motivi secondarî, di immagini (il sangue, il diavolo, la seduzione e di espressioni letterarie in modo sintomaticamente affine. The paper aims to evaluate similarities between some Old-French narratives (Chrétien de Troyes’ Yvain and the anonymous fabliau De celle que se fist foutre sur la fosse son mari and a scene from Shakespeare’s Richard III. Although we cannot affirm that Shakespeare’s play derives from the French narratives, it develops the same theme of “comforted widow” along with a series of secondary themes, of images (the blood, the devil, the seduction and literary expressions in a symptomatically, very similar way.

Application of response surface methodology for rapid chrysene biodegradation by newly isolated marine-derived fungus Cochliobolus lunatus strain CHR4D.

Science.gov (United States)

Bhatt, Jwalant K; Ghevariya, Chirag M; Dudhagara, Dushyant R; Rajpara, Rahul K; Dave, Bharti P

2014-11-01

For the first time, Cochliobolus lunatus strain CHR4D, a marine-derived ascomycete fungus isolated from historically contaminated crude oil polluted shoreline of Alang-Sosiya ship-breaking yard, at Bhavnagar coast, Gujarat has been reported showing the rapid and enhanced biodegradation of chrysene, a four ringed high molecular weight (HMW) polycyclic aromatic hydrocarbon (PAH). Mineral Salt Broth (MSB) components such as ammonium tartrate and glucose along with chrysene, pH and trace metal solution have been successfully optimized by Response Surface Methodology (RSM) using central composite design (CCD). A validated, two-step optimization protocol has yielded a substantial 93.10% chrysene degradation on the 4(th) day, against unoptimized 56.37% degradation on the 14(th) day. The results depict 1.65 fold increase in chrysene degradation and 1.40 fold increase in biomass with a considerable decrement in time. Based on the successful laboratory experiments, C. lunatus strain CHR4D can thus be predicted as a potential candidate for mycoremediation of HMW PAHs impacted environments.

PINP: a new method of tagging neuronal populations for identification during in vivo electrophysiological recording.

Directory of Open Access Journals (Sweden)

Susana Q Lima

Full Text Available Neural circuits are exquisitely organized, consisting of many different neuronal subpopulations. However, it is difficult to assess the functional roles of these subpopulations using conventional extracellular recording techniques because these techniques do not easily distinguish spikes from different neuronal populations. To overcome this limitation, we have developed PINP (Photostimulation-assisted Identification of Neuronal Populations, a method of tagging neuronal populations for identification during in vivo electrophysiological recording. The method is based on expressing the light-activated channel channelrhodopsin-2 (ChR2 to restricted neuronal subpopulations. ChR2-tagged neurons can be detected electrophysiologically in vivo since illumination of these neurons with a brief flash of blue light triggers a short latency reliable action potential. We demonstrate the feasibility of this technique by expressing ChR2 in distinct populations of cortical neurons using two different strategies. First, we labeled a subpopulation of cortical neurons-mainly fast-spiking interneurons-by using adeno-associated virus (AAV to deliver ChR2 in a transgenic mouse line in which the expression of Cre recombinase was driven by the parvalbumin promoter. Second, we labeled subpopulations of excitatory neurons in the rat auditory cortex with ChR2 based on projection target by using herpes simplex virus 1 (HSV1, which is efficiently taken up by axons and transported retrogradely; we find that this latter population responds to acoustic stimulation differently from unlabeled neurons. Tagging neurons is a novel application of ChR2, used in this case to monitor activity instead of manipulating it. PINP can be readily extended to other populations of genetically identifiable neurons, and will provide a useful method for probing the functional role of different neuronal populations in vivo.

[Comparison of methods for the identification of the most common yeasts in the clinical microbiology laboratory].

Science.gov (United States)

Guelfand, L; Grisolía, P; Bozzano, C; Kaufman, S

2003-01-01

We evaluated different methods for the routine identification of medically important yeasts. A total of 150 clinical isolates: 25 C. albicans, 25 C. tropicalis, 25 C. glabrata, 25 C. parapsilosis, 8 C. guilliermondii, 11 C. krusei and 31 Cryptococcus neoformans were tested by Yeast Biochemical Card bioMerieux Vitek (YBC), CHROMagar Candida (CHR). The addition of yeast morphology in Corn Meal agar-Tween 80 (AM) to YBC and CHR was also evaluated. The reference methods used were: API 20C, germ tube formation, AM, Christensen urea and Birdseed agar. YBC identified 135 yeasts with an overall accuracy of 90%. Sensitivity (S) and specificity (E) were: 92-98% for C. albicans and C. tropicalis; 84-99% for C. papapsilosis; 100-99% for C. glabrata; 91-100% for C. krusei; 63-98% for C. guilliermondii and 90-99% for Cryptococcus neoformans, respectively. CHR identified correctly 100% for C. albicans, 92% for C. tropicalis and 91% for C. krusei. Both methods combined with AM provided 100% S and E. We found that YBC system was appropriate for identification of yeasts isolated from human sources. CHR was effective and easy to use for identification of C. albicans, C. tropicalis and C. krusei. The routine use of AM with both methods is recommended.

Du neuf dans les relations de l'Église orthodoxe avec les autres chrétiens

OpenAIRE

Famerée, Joseph

2015-01-01

Cette note évoque quatre réunions scientifiques (Athènes, Chambésy, Thessalonique, Iasi) qui, coup sur coup, de mai 2013 à mai 2014, ont permis à des Orthodoxes d’échanger avec d’autres chrétiens, catholiques notamment, sur des sujets théologiques et œcuméniques importants pour l’évolution des différentes Églises. Une nouvelle génération de théologiens orthodoxes se lève, osant parler librement à propos de leur Église et montrer l’écart entre l’Orthodoxie idéale et l’Orthodoxie réelle, spécia...

Ora et labora. Paradigmes du modèle monacal médiéval chez Chrétien de Troyes / Ora et labora. Paradigms of the Medieval Monastic Model in Chrétien de Troyes’s Work

Directory of Open Access Journals (Sweden)

Diana Gradu

2015-05-01

Full Text Available The medieval monachal model is marked out by the faith, by the power, by the morality. It is also shared between confidence and fear with regard to the power on the earth, but, certainly, all the clerks and the monks of the Middle Age know and assume the rule Redde Caesari quae sunt Cesaris and quae sunt Dei Deo. The medieval literature, the unfaithful mirror, is reflected in an incomplete and sometimes idealized way, the example of the hermit, but it constitutes in the essential source of its paradigm. I shall stop to Chrétien of Troyes and to its novels, they are the most glorious proof of the Renaissance of the 12th century.

Le Mouvement républicain populaire (MRP : l’expérience singulière d’un parti d’inspiration démocrate chrétienne en République française (1944-1965

Directory of Open Access Journals (Sweden)

Isabelle Clavel

2016-05-01

Full Text Available En 1944, le Mouvement républicain populaire (MRP est créé par un groupe d’hommes et de femmes, apparenté à la famille démocrate-chrétienne. Dans le contexte de libération du territoire français, il s’agit pour ceux qui ont pris part aux mouvements de Résistance contre l’occupation nazie et le régime collaborateur de Vichy, de contribuer à la reconstruction du pays après le second conflit mondial. L’émergence de ce parti « d’inspiration chrétienne » constitue une nouveauté dans le paysage politique français. Jusqu’alors, aucun parti confessionnel n’était parvenu à peser électoralement au point de devenir l’un des principaux acteurs des gouvernements. Malgré une existence relativement brève de 1944 à 1965, cette trajectoire singulière permet d’étudier comment les catholiques, qui se reconnaissent dans la famille démocrate-chrétienne, ont achevé un processus d’acculturation au régime républicain, dont l’un des principes fondamentaux est la laïcité.

A Phase Ib dose-escalation study to evaluate safety and tolerability of the addition of the aminopeptidase inhibitor tosedostat (CHR-2797) to paclitaxel in patients with advanced solid tumours

NARCIS (Netherlands)

C.M.L. Herpen (Carla); F.A.L.M. Eskens (Ferry); M.J.A. de Jonge (Maja); I.M.E. Desar (Ingrid); L. Hooftman (Leon); E. Bone (Elisabeth); J.N.H. Timmerbonte (Johanna); J. Verweij (Jaap)

2010-01-01

textabstractBackground: This Phase Ib dose-escalating study investigated safety, maximum tolerated dose (MTD), dose-limiting toxicity (DLT), pharmacokinetics (PK) and clinical antitumour activity of tosedostat (CHR-2797), an orally bioavailable aminopeptidase inhibitor, in combination with

Comprehensive fine mapping of chr12q12-14 and follow-up replication identify activin receptor 1B (ACVR1B) as a muscle strength gene

NARCIS (Netherlands)

Windelinckx, An; De Mars, Gunther; Huygens, Wim; Peeters, Maarten W.; Vincent, Barbara; Wijmenga, Cisca; Lambrechts, Diether; Delecluse, Christophe; Roth, Stephen M.; Metter, E. Jeffrey; Ferrucci, Luigi; Aerssens, Jeroen; Vlietinck, Robert; Beunen, Gaston P.; Thomis, Martine A.

Muscle strength is important in functional activities of daily living and the prevention of common pathologies. We describe the two-staged fine mapping of a previously identified linkage peak for knee strength on chr12q12-14. First, 209 tagSNPs in/around 74 prioritized genes were genotyped in 500

Symptom assessment in early psychosis: the use of well-established rating scales in clinical high-risk and recent-onset populations.

Science.gov (United States)

Fulford, Daniel; Pearson, Rahel; Stuart, Barbara K; Fisher, Melissa; Mathalon, Daniel H; Vinogradov, Sophia; Loewy, Rachel L

2014-12-30

Symptom assessment in early psychosis research typically relies on scales validated in chronic schizophrenia samples. Our goal was to inform investigators who are selecting symptom scales for early psychosis research. We described measure characteristics, baseline scores, and scale inter-relationships in clinical-high-risk (CHR) and recent-onset psychotic disorder (RO) samples using the Positive and Negative Syndrome Scale, Brief Psychiatric Rating Scale, Scale for the Assessment of Positive Symptoms, and Scale for the Assessment of Negative Symptoms; for the CHR group only, we included the Scale of Prodromal Symptoms. For investigators selecting symptom measures in intervention or longitudinal studies, we also examined the relationship of symptom scales with psychosocial functioning. In both samples, symptom subscales in the same domain, across measures, were moderately to highly intercorrelated. Within all measures, positive symptoms were not correlated with negative symptoms, but disorganized symptoms overlapped with both positive and negative symptoms. Functioning was significantly related to negative and disorganized, but not positive, symptoms in both samples on most measures. Findings suggest strong overlap in symptom severity ratings among the most common scales. In recent-onset samples, each has strengths and weaknesses. In CHR samples, they appear to add little information above and beyond the SOPS. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Polarizable Embedded RI-CC2 Method for Two-Photon Absorption Calculations

DEFF Research Database (Denmark)

Hršak, Dalibor; Khah, Alireza Marefat; Christiansen, Ove

2015-01-01

We present a novel polarizable embedded resolution-of-identity coupled cluster singles and approximate doubles (PERI-CC2) method for calculation of two-photon absorption (TPA) spectra of large molecular systems. The method was benchmarked for three types of systems: a water-solvated molecule...... of formamide, a uracil molecule in aqueous solution, and a set of mutants of the channelrhodopsin (ChR) protein. The first test case shows that the PERI-CC2 method is in excellent agreement with the PE-CC2 method and in good agreement with the PE-CCSD method. The uracil test case indicates that the effects...... of hydrogen bonding on the TPA of a chromophore with the nearest environment is well-described with the PERI-CC2 method. Finally, the ChR calculation shows that the PERI-CC2 method is well-suited and efficient for calculations on proteins with medium-sized chromophores....

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75069 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr06 101.1-107.3 3.68 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75066 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr04 65.1-81.9 2.15 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75072 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr08 72.6-87.8 2.32 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75075 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr12 49.5-63.0 2.54 ... 10.1111/j.1365-3040.2011.02463.x 22074055

Une catastrophe glorieuse : le martyre des premiers chrétiens du Japon, Nagasaki, 1597

Directory of Open Access Journals (Sweden)

Clotilde Jacquelard

2011-11-01

Full Text Available Le naufrage du galion San Felipe dans le port de Urado (Shikoku, Japon en octobre 1596 fut le déclencheur d’un désastre missionnaire : le martyre de vingt-six chrétiens, franciscains espagnols et chrétiens japonais, à Nagasaki, le 5 février 1597. Cet article s’attache à examiner la relation dialectique entre les deux événements par l’étude de deux discours missionnaires franciscains hagiographiques. Il s’agit tout d’abord de rappeler la lecture providentialiste du temps à travers la perception de présages matériels et spirituels de la part des acteurs, puis de montrer que ces évènements paroxystiques révèlent en même temps qu’ils résolvent – temporairement – des tensions et des crises latentes, résultat de la confrontation entre plusieurs communautés culturelles comme la japonaise, l’espagnole et la portugaise, autour de prétentions géopolitiques, commerciales et religieuses dans cette zone de frontière de l’antiméridien du Pacifique nord.El naufragio del galeón San Felipe en el puerto de Urado (Shikoku, Japón en octubre de 1596 desembocó en un desastre misionero : el martirio de veintiséis cristianos, franciscanos españoles y cristianos japoneses, en Nagasaki, el 5 de febrero de 1597. Este artículo quiere examinar la relación dialéctica entre ambos acontecimientos, mediante el estudio de dos discursos misioneros franciscanos hagiográficos. Se trata de recordar primero la lectura providencialista de la época a través de la percepción de presagios tanto materiales como espirituales por parte de los actores, y mostrar luego que estos acontecimientos paroxísticos revelan, al mismo tiempo que resuelven –temporalmente– tensiones y crisis latentes, resultados de la confrontación de varias comunidades culturales como la japonesa, la española y la portuguesa, en torno a pretensiones geopolíticas, comerciales y religiosas en la zona fronteriza del antimeridiano del Pacífico norte.

Reduction of patient dose delivered by CHR diagnostic x-ray examinations

International Nuclear Information System (INIS)

Evans, R.D.; Schlenker, R.A.

1978-01-01

Three changes in technique have been made which reduce the x-ray dose delivered by diagnostic examinations of patients of the Center for Human Radiobiology (CHR): Kodak Lanex Regular screens and Kodak Ortho G film have been substituted for DuPont Cronex Parspeed screens and DuPont Cronex 4 film for five projections in the MIT examinations; 3 mm Al added filtration is now used in place of 1 mm Al added filtration in the ANL examination; improvements in collimation for the ANL examination have been made. Use of the new screen-film combination at MIT has reduced the mean dose to the active marrow of the female RANDO phantom from 606 +- 69 mrad to 235 +- 16 mrad; it has reduced the ovary dose from 606 +- 40 mrad to 291 +- 19 mrad and has left the breast dose unchanged at 333 +- 103 mrad. The change from 1 mm Al to 3 mm Al added filtration at ANL, without changes in collimation, would reduce the mean marrow dose in the phantom from 232 +- 14 mrad to 175 +- 26 mrad, reduce the ovary dose from 243 +- 25 mrad to 162 +- 38 mrad and reduce the breast dose from 388 +- 35 mrad to 226 +- 9 mrad. The changes in collimation at ANL should reduce these doses even further but the quantitative effect has not been ascertained

Living Joyfully after Losing Social Hope: Kierkegaard and Chrétien on Selfhood and Eschatological Expectation

Directory of Open Access Journals (Sweden)

J. Aaron Simmons

2017-02-01

Full Text Available In this essay, I offer an existential-phenomenological consideration of what it might look like to live joyfully after losing social hope. Using the example of the widespread hopelessness that many are feeling in light of the election of Donald Trump, I suggest that the danger of losing hope is that we can also lose our selfhood in the process. In order to develop a conception of “eschatological hope” that would be resistant to the loss of such social and political expectations, I draw specifically on Søren Kierkegaard’s notion that “the expectancy of faith is victory,” and Jean-Louis Chrétien’s idea of “the unhoped for,” in order to develop a model of hope that remains when it seems like all other hope has been lost. Rather than being overcome by anxiety about the future, eschatological hope fosters joy in the present.

The Development of the circadian heart rate rhytm (CDR) in Asian infants

OpenAIRE

Stanislaus Sandarupa, Drs., M.A., Ph.D.

2011-01-01

Although the human fetus can follow the maternal circadian thythm, the enterained expression of the circadian clock, based in the suprachiasmatic nucleus (SCN) of the hypothalamus awaits postnatal maturation of the retinal hypothalamic tract, and melatonin neurotransmission. Objective: To test the hypothesis that term-born Asian Infants, at reduced risk to die of Sudden Infant Death Syndrome (SIDS) exhibit a circadian heat rate thythm (CHR) at a later age than non-Asian term infants.

Stability and reproducibility of ADVIA 120-measured red blood cell and platelet parameters in dogs, cats, and horses, and the use of reticulocyte haemoglobin content (CH(R)) in the diagnosis of iron deficiency

NARCIS (Netherlands)

Prins, M.; van Leeuwen, M.W.; Teske, E.

2009-01-01

Tijdschr Diergeneeskd. 2009 Apr 1;134(7):272-8. Stability and reproducibility of ADVIA 120-measured red blood cell and platelet parameters in dogs, cats, and horses, and the use of reticulocyte haemoglobin content (CH(R)) in the diagnosis of iron deficiency. Prins M, van Leeuwen MW, Teske E.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75157 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr09 106.5-112.7 2.41 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75239 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr12 39.4-64.0 2.02 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75274 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic II_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 15.4-31.3 2.94 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75205 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt II_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 15.4-26.6 3.43 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75233 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 7.6-23.7 3.5 ... 10.1111/j.1365-3040.2011.02463.x 22074055

Orelhas de elefante, olhos de coruja, dentes de javali: maravilhoso e descritivo em Yvain ou le chevalier au lion, de Chrétien de Troyes

OpenAIRE

Luis Claudio Kinker Caliendo

2009-01-01

No final do século XII, Chrétien de Troyes considerado por muitos críticos o maior poeta francês da chamada Idade Média compõe um poema narrativo Yvain ou le Chevalier au Lion no qual se percebem elementos tidos como característicos do gênero maravilhoso, tais quais objetos mágicos e seres extraordinários, como monstros e gigantes. Esses elementos entre outros fatores levaram boa parte da crítica a enxergar na poesia medieval, durante muito tempo, uma certa ingenuidade, típica de uma in...

Los enigmas del Grial. En torno a la polémica sobre la unidad de El Cuento del Grial de Chrétien de Troyes

Directory of Open Access Journals (Sweden)

Victoria Cirlot

2014-12-01

Full Text Available Relectura de la polémica acerca de la unidad del último roman de Chrétien de Troyes, Li Contes del Graal que tuvo lugar a finales de los años cincuenta entre Martín de Riquer, Jean Frappier y Erich Köhler. Más de cincuenta años después se trata de valorar las aportaciones que dicha polémica supuso para la filología románica y, en concreto, para la valoración de la última obra del escritor de la Champaña.

High School Graduation Rates:Alternative Methods and Implications

Directory of Open Access Journals (Sweden)

Jing Miao

2004-10-01

Full Text Available The No Child Left Behind Act has brought great attention to the high school graduation rate as one of the mandatory accountability measures for public school systems. However, there is no consensus on how to calculate the high school graduation rate given the lack of longitudinal databases that track individual students. This study reviews literature on and practices in reporting high school graduation rates, compares graduation rate estimates yielded from alternative methods, and estimates discrepancies between alternative results at national, state, and state ethnic group levels. Despite the graduation rate method used, results indicate that high school graduation rates in the U.S. have been declining in recent years and that graduation rates for black and Hispanic students lag substantially behind those of white students. As to graduation rate method preferred, this study found no evidence that the conceptually more complex methods yield more accurate or valid graduation rate estimates than the simpler methods.

Symptom assessment in early psychosis: The use of well-established rating scales in clinical high-risk and recent-onset populations

OpenAIRE

Fulford, Daniel; Pearson, Rahel; Stuart, Barbara K.; Fisher, Melissa; Mathalon, Daniel H.; Vinogradov, Sophia; Loewy, Rachel L.

2014-01-01

Symptom assessment in early psychosis research typically relies on scales validated in chronic schizophrenia samples. Our goal was to inform investigators who are selecting symptom scales for early psychosis research. We described measure characteristics, baseline scores, and scale inter-relationships in clinical high-risk (CHR) and recent-onset psychotic disorder (RO) samples using the Positive and Negative Syndrome Scale, Brief Psychiatric Rating Scale, Scale for the Assessment of Positive ...

A 'college of astrology and medicine'? Charles V, Gervais Chrétien, and the scientific manuscripts of Maître Gervais's College.

Science.gov (United States)

Boudet, Jean-Patrice

2010-06-01

Considered an institution mainly devoted to astrology and medicine by Simon de Phares and by some historians who believe that he was reliable, the college founded in 1371 by Charles V's first physician, Gervais Chrétien, was in fact primarily dedicated to theological students. It was not before 1377 that there were created there two bursaries for scholares regis, specialising in 'licit mathematical sciences', and two medical fellowships. Yet the influence of the activity of these fellows seems to have been rather moderate and-as far as we can learn from the material still extant, notably from manuscripts that belonged to Maître Gervais' College and to some of its members-this institution was devoted much more to theological studies than to medicine and the quadrivium.

De la chair imbibée de foi : la viande comme marqueur de la frontière entre chrétiens et musulmans en Éthiopie

Directory of Open Access Journals (Sweden)

Éloi Ficquet

2006-05-01

Full Text Available Jamais en Éthiopie un chrétien et un musulman ne mangent de viande ensemble. Consommer de la viande qui n’a pas été consacrée à sa propre foi est appréhendé comme un acte hautement sacrilège équivalent à une apostasie. Cet interdit doit être compris dans une perspective comparative large sur les pratiques et les débats qui restreignent la commensalité de la viande entre les chrétiens et les musulmans. Les usages éthiopiens ont accentué cette question pour en faire un interdit puissant, marqueur d’une frontière interreligieuse. Comme toute frontière, cette « frontière carnée » a été le lieu de confrontations, d’aménagements et de transgressions dont les effets ont contribué à la construction de l’espace national éthiopien contemporain.Christians and Muslims in Ethiopia never eat meat together. Consuming meat that was not consecrated to one’s faith is seen as a highly sacrilegious act equal to apostasy. This interdict must be understood in comparative perspective that looks at the restrictions regarding the sharing of meat between Christians and Muslims. Ethiopian customs have emphasized this issue to turn it into a powerful interdict, tracing an inter-religious boundary. Like any boundary, this “dietary boundary” has been the site of confrontations, readjustments and transgressions whose effects have contributed to the building of a contemporary Ethiopian national space.

Loss of Chromosome 18 in Neuroendocrine Tumors of the Small Intestine: The Enigma Remains.

Science.gov (United States)

Nieser, Maike; Henopp, Tobias; Brix, Joachim; Stoß, Laura; Sitek, Barbara; Naboulsi, Wael; Anlauf, Martin; Schlitter, Anna M; Klöppel, Günter; Gress, Thomas; Moll, Roland; Bartsch, Detlef K; Heverhagen, Anna E; Knoefel, Wolfram T; Kaemmerer, Daniel; Haybaeck, Johannes; Fend, Falko; Sperveslage, Jan; Sipos, Bence

2017-01-01

Neuroendocrine tumors of the small intestine (SI-NETs) exhibit an increasing incidence and high mortality rate. Until now, no fundamental molecular event has been linked to the tumorigenesis and progression of these tumors. Only the loss of chromosome 18 (Chr18) has been shown in up to two thirds of SI-NETs, whereby the significance of this alteration is still not understood. We therefore performed the first comprehensive study to identify Chr18-related events at the genetic, epigenetic and gene/protein expression levels. We did expression analysis of all seven putative Chr18-related tumor suppressors by quantitative real-time PCR (qRT-PCR), Western blot and immunohistochemistry. Next-generation exome sequencing and SNP array analysis were performed with five SI-NETs with (partial) loss of Chr18. Finally, we analyzed all microRNAs (miRNAs) located on Chr18 by qRT-PCR, comparing Chr18+/- and Chr18+/+ SI-NETs. Only DCC (deleted in colorectal cancer) revealed loss of/greatly reduced expression in 6/21 cases (29%). No relevant loss of SMAD2, SMAD4, elongin A3 and CABLES was detected. PMAIP1 and maspin were absent at the protein level. Next-generation sequencing did not reveal relevant recurrent somatic mutations on Chr18 either in an exploratory cohort of five SI-NETs, or in a validation cohort (n = 30). SNP array analysis showed no additional losses. The quantitative analysis of all 27 Chr18-related miRNAs revealed no difference in expression between Chr18+/- and Chr18+/+ SI-NETs. DCC seems to be the only Chr18-related tumor suppressor affected by the monoallelic loss of Chr18 resulting in a loss of DCC protein expression in one third of SI-NETs. No additional genetic or epigenetic alterations were present on Chr18. © 2016 S. Karger AG, Basel.

A New Method to Calculate Internal Rate of Return

Directory of Open Access Journals (Sweden)

azadeh zandi

2015-09-01

Full Text Available A number of methods have been developed to choose the best capital investment projects such as net present value, internal rate of return and etc. Internal rate of return method is probably the most popular method among managers and investors. But despite the popularity there are serious drawbacks and limitations in this method. After decades of efforts made by economists and experts to improve the method and its shortcomings, Magni in 2010 has revealed a new approach that can solves the most of internal rate of return method problems. This paper present a new method which is originated from Magni’s approach but has much more simple calculations and can resolve all the drawbacks of internal rate of return method.

Novel Method For Low-Rate Ddos Attack Detection

Science.gov (United States)

Chistokhodova, A. A.; Sidorov, I. D.

2018-05-01

The relevance of the work is associated with an increasing number of advanced types of DDoS attacks, in particular, low-rate HTTP-flood. Last year, the power and complexity of such attacks increased significantly. The article is devoted to the analysis of DDoS attacks detecting methods and their modifications with the purpose of increasing the accuracy of DDoS attack detection. The article details low-rate attacks features in comparison with conventional DDoS attacks. During the analysis, significant shortcomings of the available method for detecting low-rate DDoS attacks were found. Thus, the result of the study is an informal description of a new method for detecting low-rate denial-of-service attacks. The architecture of the stand for approbation of the method is developed. At the current stage of the study, it is possible to improve the efficiency of an already existing method by using a classifier with memory, as well as additional information.

EPA guidance on the early intervention in clinical high risk states of psychoses

DEFF Research Database (Denmark)

Schmidt, S J; Schultze-Lutter, F; Schimmelmann, B G

2015-01-01

-analysis of current empirical evidence on the efficacy of psychological and pharmacological interventions in CHR samples. Eligible studies had to investigate conversion rate and/or functioning as a treatment outcome in CHR patients defined by the ultra-high risk and/or basic symptom criteria. Besides analyses...... on treatment effects on conversion rate and functional outcome, age and type of intervention were examined as potential moderators. Based on data from 15 studies (n=1394), early intervention generally produced significantly reduced conversion rates at 6- to 48-month follow-up compared to control conditions...... on conversion rates, but not on functional outcome relative to the control conditions. Early intervention in youth samples was generally less effective than in predominantly adult samples. Seven evidence-based recommendations for early intervention in CHR samples could have been formulated, although more...

“Et qui or me vaurra entendre, cuer et oreilles me doit rendre”: espacios de lectura y público de los roman courtois de Chrétien de Troyes (siglos XII-XIII

Directory of Open Access Journals (Sweden)

Diego Carlo Améndolla Spinola

2016-06-01

Full Text Available Basado en los planteamientos de la lógica social del texto, este artículo presenta un estudio del público que escuchaba los romances corteses entre los siglo XII y XIII, específicamente los realizados por Chrétien de Troyes –clérigo lector de la Corte de Leonor de Aquitania y de Enrique II Plantagenet–, además de establecer y analizar las diversas salas de los castillos donde estas obras literarias eran narradas.

Sterilization: new method options, failure rate info.

Science.gov (United States)

1998-01-01

This article discusses new sterilization methods for tubal ligation, failure rates, and risks for ectopic pregnancy in the US. The Filshie clip, which was developed by Femcare, Ltd. in Nottingham, England, and is distributed by Avalon Medical Corp of Vermont, was approved by the US Food and Drug Administration in September 1996. The company has provided training sessions at major universities nationwide and exhibited at national professional association meetings. A training video and two more films will be available in 1998. The new clip is considered a more modern approach to a tubal occlusion method, which relies on newer materials and solves prior problems. Physicians usually used Falope rings, which had better failure rates than the Hulka clip and bipolar coagulation methods. There is a need for more long-term and large scale information exchange about the new Filshie clip. Some physicians still use the Falope ring because it is cost effective and well-studied. Physicians are warned to continue to advise women about the potential failure rates up to 10 years after sterilization and the 1 in 3 risk of ectopic pregnancy. Counseling about failure rates and the risk of ectopic pregnancy should target women under 30 years old, who have the highest failure rates, and women 30-34 years old. All sterilized women should be advised to seek a provider immediately if they have pregnancy symptoms following sterilization. Counseling should include the issue of "regrets," since it is a permanent method. All women should know about nonpermanent methods and experience a basic informed consent process. Young women and newly divorced women are particularly vulnerable to the "regrets" syndrome.

La Fábula Ovidiana de Filomela revisada por la Edad Media: de Chrétien de Troyes a Alfonso x

Directory of Open Access Journals (Sweden)

Mario Martín Botero García

2014-12-01

Full Text Available En este trabajo se expone el contraste entre las dos traducciones al francés y al castellano de Filomela, una de las fábulas de las Metamorfosis de Ovidio, realizadas en los siglos xii y xiii por Chrétien de Troyes y Alfonso X. Por medio del análisis y cotejo de tres momentos narrativos, veremos la forma en que la materia antigua es tratada según el contexto determinado en el que se producen las traducciones. La versión francesa hace énfasis en una dimensión cortés en donde el personaje femenino es altamente valorado; por su parte, la versión castellana reivindica una racionalización de la fábula ovidiana, supeditada a una visión política e histórica. Se puede constatar así que las traducciones medievales no son serviles con respecto a la fuente latina sino que demuestran una gran libertad en la selección y combinación de elementos.

Cross-talk between cognate and noncognate RpoE sigma factors and Zn(2+)-binding anti-sigma factors regulates photooxidative stress response in Azospirillum brasilense.

Science.gov (United States)

Gupta, Namrata; Gupta, Ankush; Kumar, Santosh; Mishra, Rajeev; Singh, Chhaya; Tripathi, Anil Kumar

2014-01-01

Azospirillum brasilense harbors two redox-sensitive Zinc-binding anti-sigma (ZAS) factors (ChrR1 and ChrR2), which negatively regulate the activity of their cognate extra-cytoplasmic function (ECF) σ factors (RpoE1 and RpoE2) by occluding their binding to the core enzyme. Both pairs of RpoE-ChrR control responses to photooxidative stress. The aim of this study was to investigate whether the two RpoE-ChrR pairs cross-talk while responding to the stress. In silico analysis showed a high sequence similarity between ChrR1 and ChrR2 proteins, but differences in redox sensitivity. Using in silico and in vitro methods of protein-protein interaction, we have shown that both ChrR1 and ChrR2 proteins physically bind to their noncognate RpoE proteins. Restoration of the phenotypes of chrR1::Tn5 and chrR2::Km mutants related to carotenoid biosynthesis and photooxidative stress tolerance by expressing chrR1 or chrR2 provided in vivo evidence for the cross-talk. In addition, up- or down-regulation of several identical proteins by expressing chrR1 or chrR2 in the chrR1::Tn5 mutant provided another in vivo evidence for the cross-talk. Although multiple redox-sensitive ZAS anti-σ factors occur in some Gram-positive bacteria, no cross-talk is reported among them. We report here, for the first time, that the two ZAS anti-σ factors of A. brasilense also interact with their noncognate σ factors and affect gene expression. The two redox-sensitive ZAS anti-σ factors in A. brasilense may interact with their cognate as well as noncognate ECF σ factors to play an important role in redox homeostasis by facilitating recovery from the oxidative stress.

76 FR 21673 - Alternative Efficiency Determination Methods and Alternate Rating Methods

Science.gov (United States)

2011-04-18

... EERE-2011-BP-TP-00024] RIN 1904-AC46 Alternative Efficiency Determination Methods and Alternate Rating Methods AGENCY: Office of Energy Efficiency and Renewable Energy, Department of Energy. ACTION: Notice of... and data related to the use of computer simulations, mathematical methods, and other alternative...

EPA guidance on the early detection of clinical high risk states of psychoses

DEFF Research Database (Denmark)

Schultze-Lutter, F; Michel, C; Schmidt, S J

2015-01-01

The aim of this guidance paper of the European Psychiatric Association is to provide evidence-based recommendations on the early detection of a clinical high risk (CHR) for psychosis in patients with mental problems. To this aim, we conducted a meta-analysis of studies reporting on conversion rates...... to psychosis in non-overlapping samples meeting any at least any one of the main CHR criteria: ultra-high risk (UHR) and/or basic symptoms criteria. Further, effects of potential moderators (different UHR criteria definitions, single UHR criteria and age) on conversion rates were examined. Conversion rates...... in the identified 42 samples with altogether more than 4000 CHR patients who had mainly been identified by UHR criteria and/or the basic symptom criterion 'cognitive disturbances' (COGDIS) showed considerable heterogeneity. While UHR criteria and COGDIS were related to similar conversion rates until 2-year follow...

Constraint-based Word Segmentation for Chinese

DEFF Research Database (Denmark)

Christiansen, Henning; Bo, Li

2014-01-01

-hoc and statistically based methods. In this paper, we show experiments of implementing different approaches to CWSP in the framework of CHR Grammars [Christiansen, 2005] that provides a constraint solving approach to language analysis. CHR Grammars are based upon Constraint Handling Rules, CHR [Frühwirth, 1998, 2009......], which is a declarative, high-level programming language for specification and implementation of constraint solvers....

New methods for estimating follow-up rates in cohort studies

Directory of Open Access Journals (Sweden)

Xiaonan Xue

2017-12-01

Full Text Available Abstract Background The follow-up rate, a standard index of the completeness of follow-up, is important for assessing the validity of a cohort study. A common method for estimating the follow-up rate, the “Percentage Method”, defined as the fraction of all enrollees who developed the event of interest or had complete follow-up, can severely underestimate the degree of follow-up. Alternatively, the median follow-up time does not indicate the completeness of follow-up, and the reverse Kaplan-Meier based method and Clark’s Completeness Index (CCI also have limitations. Methods We propose a new definition for the follow-up rate, the Person-Time Follow-up Rate (PTFR, which is the observed person-time divided by total person-time assuming no dropouts. The PTFR cannot be calculated directly since the event times for dropouts are not observed. Therefore, two estimation methods are proposed: a formal person-time method (FPT in which the expected total follow-up time is calculated using the event rate estimated from the observed data, and a simplified person-time method (SPT that avoids estimation of the event rate by assigning full follow-up time to all events. Simulations were conducted to measure the accuracy of each method, and each method was applied to a prostate cancer recurrence study dataset. Results Simulation results showed that the FPT has the highest accuracy overall. In most situations, the computationally simpler SPT and CCI methods are only slightly biased. When applied to a retrospective cohort study of cancer recurrence, the FPT, CCI and SPT showed substantially greater 5-year follow-up than the Percentage Method (92%, 92% and 93% vs 68%. Conclusions The Person-time methods correct a systematic error in the standard Percentage Method for calculating follow-up rates. The easy to use SPT and CCI methods can be used in tandem to obtain an accurate and tight interval for PTFR. However, the FPT is recommended when event rates and

CREME96 and Related Error Rate Prediction Methods

Science.gov (United States)

Adams, James H., Jr.

2012-01-01

Predicting the rate of occurrence of single event effects (SEEs) in space requires knowledge of the radiation environment and the response of electronic devices to that environment. Several analytical models have been developed over the past 36 years to predict SEE rates. The first error rate calculations were performed by Binder, Smith and Holman. Bradford and Pickel and Blandford, in their CRIER (Cosmic-Ray-Induced-Error-Rate) analysis code introduced the basic Rectangular ParallelePiped (RPP) method for error rate calculations. For the radiation environment at the part, both made use of the Cosmic Ray LET (Linear Energy Transfer) spectra calculated by Heinrich for various absorber Depths. A more detailed model for the space radiation environment within spacecraft was developed by Adams and co-workers. This model, together with a reformulation of the RPP method published by Pickel and Blandford, was used to create the CR ME (Cosmic Ray Effects on Micro-Electronics) code. About the same time Shapiro wrote the CRUP (Cosmic Ray Upset Program) based on the RPP method published by Bradford. It was the first code to specifically take into account charge collection from outside the depletion region due to deformation of the electric field caused by the incident cosmic ray. Other early rate prediction methods and codes include the Single Event Figure of Merit, NOVICE, the Space Radiation code and the effective flux method of Binder which is the basis of the SEFA (Scott Effective Flux Approximation) model. By the early 1990s it was becoming clear that CREME and the other early models needed Revision. This revision, CREME96, was completed and released as a WWW-based tool, one of the first of its kind. The revisions in CREME96 included improved environmental models and improved models for calculating single event effects. The need for a revision of CREME also stimulated the development of the CHIME (CRRES/SPACERAD Heavy Ion Model of the Environment) and MACREE (Modeling and

Sodium flow rate measurement method of annular linear induction pumps

International Nuclear Information System (INIS)

Araseki, Hideo; Kirillov, Igor R.; Preslitsky, Gennady V.

2012-01-01

Highlights: ► We found a new method of flow rate monitoring of electromagnetic pump. ► The method is very simple and does not require a large space. ► The method was verified with an experiment and a numerical analysis. ► The experimental data and the numerical results are in good agreement. - Abstract: The present paper proposes a method for measuring sodium flow rate of annular linear induction pumps. The feature of the method lies in measuring the leaked magnetic field with measuring coils near the stator end on the outlet side and in correlating it with the sodium flow rate. This method is verified through an experiment and a numerical analysis. The data obtained in the experiment reveals that the correlation between the leaked magnetic field and the sodium flow rate is almost linear. The result of the numerical analysis agrees with the experimental data. The present method will be particularly effective to sodium flow rate monitoring of each one of plural annular linear induction pumps arranged in parallel in a vessel which forms a large-scale pump unit.

Reseña de: Caselli, Elisa, Antijudaïsme, pouvoir politique et administration de la justice. Juifs, chrétiens et converts dans l’ espace jurisdictionnel de la Chancillería de Valladolid (XVe-XVIe siècles.Villeneuve d’Ascq...

Directory of Open Access Journals (Sweden)

Enrique Cantera Montenegro

2017-05-01

Full Text Available Caselli, Elisa, Antijudaïsme, pouvoir politique et administration de la justice. Juifs, chrétiens et converts dans l’ espace jurisdictionnel de la Chancillería de Valladolid (XV^e-XVI^e siècles. Villeneuve d’Ascq Cedex. Atelier National de Reproduction des Thèses, 2016. 396 págs. isbn: 978-2-7295-8891-5.

Odd Bed-fellows: British Christians and Communists in the Struggle for Peace D’étranges compagnons : chrétiens et communistes britanniques dans la lutte pour la paix

Directory of Open Access Journals (Sweden)

Jeremy Tranmer

2011-04-01

Full Text Available Au début des années 1950, le doyen de l’archevêché de Cantorbéry œuvra au sein du mouvement pour la paix et participa à des activités organisées par le parti communiste britannique. En 1983, le prêtre catholique Bruce Kent, leader de la Campagne pour le Désarmement Nucléaire, loua l’engagement des communistes britanniques en faveur de la paix. Cet article cherche à examiner pourquoi et comment chrétiens et communistes surmontèrent leurs différences et coopérèrent dans la lutte contre l’arme nucléaire.

A review on measuring methods of gas-liquid flow rates

International Nuclear Information System (INIS)

Minemura, Kiyoshi; Yamashita, Masato

2000-01-01

This paper presents a review on the state of current measuring techniques for gas-liquid multiphase flow rates. After briefly discussing the basic idea on measuring methods for single-phase and two-phase flows, existing methods for the two-phase flow rates are classified into several types, that is, with or without a homogenizing device, single or combined method of several techniques, with intrusive or non-intrusive sensors, and physical or software method. Each methods are comparatively reviewed in view of measuring accuracy and manageability. Its scope also contains the techniques developed for petroleum-gas-water flow rates. (author)

Clinical Significance of Reticulocyte Hemoglobin Content in the Diagnosis of Iron Deficiency Anemia

Directory of Open Access Journals (Sweden)

Mustafa Karagülle

2013-06-01

Full Text Available OBJECTIVE: The aim of this study was to evaluate the clinical significance of reticulocyte hemoglobin content (CHr in the diagnosis of iron deficiency anemia (IDA and to compare it with other conventional iron parameters. METHODS: A total of 32 female patients with IDA (serum hemoglobin 120 g/L and serum ferritin <20 ng/mL were enrolled. RESULTS: CHr was 24.95±3.92 pg in female patients with IDA and 29.93±2.96 pg in female patients with iron deficiency. CHr showed a significant positive correlation with hemoglobin, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, serum iron, and transferrin saturation and a significant negative correlation with transferrin and total iron-binding capacity. The cut-off value of CHr for detecting IDA was 29 pg. CONCLUSION: Our data demonstrate that CHr is a useful parameter that can be confidently used in the diagnosis of IDA, and a CHr cut-off value of 29 pg predicts IDA.

High School Graduation Rates:Alternative Methods and Implications

OpenAIRE

Jing Miao; Walt Haney

2004-01-01

The No Child Left Behind Act has brought great attention to the high school graduation rate as one of the mandatory accountability measures for public school systems. However, there is no consensus on how to calculate the high school graduation rate given the lack of longitudinal databases that track individual students. This study reviews literature on and practices in reporting high school graduation rates, compares graduation rate estimates yielded from alternative methods, and estimates d...

Neuroanatomical and Symptomatic Sex Differences in Individuals at Clinical High Risk for Psychosis

Directory of Open Access Journals (Sweden)

Elisa Guma

2017-12-01

Full Text Available Sex differences have been widely observed in clinical presentation, functional outcome and neuroanatomy in individuals with a first-episode of psychosis, and chronic patients suffering from schizophrenia. However, little is known about sex differences in the high-risk stages for psychosis. The present study investigated sex differences in cortical and subcortical neuroanatomy in individuals at clinical high risk (CHR for psychosis and healthy controls (CTL, and the relationship between anatomy and clinical symptoms in males at CHR. Magnetic resonance images were collected in 26 individuals at CHR (13 men and 29 CTLs (15 men to determine total and regional brain volumes and morphology, cortical thickness, and surface area (SA. Clinical symptoms were assessed with the brief psychiatric rating scale. Significant sex-by-diagnosis interactions were observed with opposite directions of effect in male and female CHR subjects relative to their same-sex controls in multiple cortical and subcortical areas. The right postcentral, left superior parietal, inferior parietal supramarginal, and angular gyri [<5% false discovery rate (FDR] were thicker in male and thinner in female CHR subjects compared with their same-sex CTLs. The same pattern was observed in the right superior parietal gyrus SA at the regional and vertex level. Using a recently developed surface-based morphology pipeline, we observed sex-specific shape differences in the left hippocampus (<5% FDR and amygdala (<10% FDR. Negative symptom burden was significantly higher in male compared with female CHR subjects (p = 0.04 and was positively associated with areal expansion of the left amygdala in males (<5% FDR. Some limitations of the study include the sample size, and data acquisition at 1.5 T. This study demonstrates neuroanatomical sex differences in CHR subjects, which may be associated with variations in symptomatology in men and women with psychotic symptoms.

Adolescents at clinical-high risk for psychosis: Circadian rhythm disturbances predict worsened prognosis at 1-year follow-up.

Science.gov (United States)

Lunsford-Avery, Jessica R; Gonçalves, Bruno da Silva Brandão; Brietzke, Elisa; Bressan, Rodrigo A; Gadelha, Ary; Auerbach, Randy P; Mittal, Vijay A

2017-11-01

Individuals with psychotic disorders experience disruptions to both the sleep and circadian components of the sleep/wake cycle. Recent evidence has supported a role of sleep disturbances in emerging psychosis. However, less is known about how circadian rhythm disruptions may relate to psychosis symptoms and prognosis for adolescents with clinical high-risk (CHR) syndromes. The present study examines circadian rest/activity rhythms in CHR and healthy control (HC) youth to clarify the relationships among circadian rhythm disturbance, psychosis symptoms, psychosocial functioning, and the longitudinal course of illness. Thirty-four CHR and 32 HC participants were administered a baseline evaluation, which included clinical interviews, 5days of actigraphy, and a sleep/activity diary. CHR (n=29) participants were re-administered clinical interviews at a 1-year follow-up assessment. Relative to HC, CHR youth exhibited more fragmented circadian rhythms and later onset of nocturnal rest. Circadian disturbances (fragmented rhythms, low daily activity) were associated with increased psychotic symptom severity among CHR participants at baseline. Circadian disruptions (lower daily activity, rhythms that were more fragmented and/or desynchronized with the light/dark cycle) also predicted severity of psychosis symptoms and psychosocial impairment at 1-year follow-up among CHR youth. Circadian rhythm disturbances may represent a potential vulnerability marker for emergence of psychosis, and thus, rest/activity rhythm stabilization has promise to inform early-identification and prevention/intervention strategies for CHR youth. Future studies with longer study designs are necessary to further examine circadian rhythms in the prodromal period and rates of conversion to psychosis among CHR teens. Copyright © 2017. Published by Elsevier B.V.

A parametric method for assessing diversification-rate variation in phylogenetic trees.

Science.gov (United States)

Shah, Premal; Fitzpatrick, Benjamin M; Fordyce, James A

2013-02-01

Phylogenetic hypotheses are frequently used to examine variation in rates of diversification across the history of a group. Patterns of diversification-rate variation can be used to infer underlying ecological and evolutionary processes responsible for patterns of cladogenesis. Most existing methods examine rate variation through time. Methods for examining differences in diversification among groups are more limited. Here, we present a new method, parametric rate comparison (PRC), that explicitly compares diversification rates among lineages in a tree using a variety of standard statistical distributions. PRC can identify subclades of the tree where diversification rates are at variance with the remainder of the tree. A randomization test can be used to evaluate how often such variance would appear by chance alone. The method also allows for comparison of diversification rate among a priori defined groups. Further, the application of the PRC method is not restricted to monophyletic groups. We examined the performance of PRC using simulated data, which showed that PRC has acceptable false-positive rates and statistical power to detect rate variation. We apply the PRC method to the well-studied radiation of North American Plethodon salamanders, and support the inference that the large-bodied Plethodon glutinosus clade has a higher historical rate of diversification compared to other Plethodon salamanders. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

Simple method for the estimation of glomerular filtration rate

Energy Technology Data Exchange (ETDEWEB)

Groth, T [Group for Biomedical Informatics, Uppsala Univ. Data Center, Uppsala (Sweden); Tengstroem, B [District General Hospital, Skoevde (Sweden)

1977-02-01

A simple method is presented for indirect estimation of the glomerular filtration rate from two venous blood samples, drawn after a single injection of a small dose of (/sup 125/I)sodium iothalamate (10 ..mu..Ci). The method does not require exact dosage, as the first sample, taken after a few minutes (t=5 min) after injection, is used to normilize the value of the second sample, which should be taken in between 2 to 4 h after injection. The glomerular filtration rate, as measured by standard insulin clearance, may then be predicted from the logarithm of the normalized value and linear regression formulas with a standard error of estimate of the order of 1 to 2 ml/min/1.73 m/sup 2/. The slope-intercept method for direct estimation of glomerular filtration rate is also evaluated and found to significantly underestimate standard insulin clearance. The normalized 'single-point' method is concluded to be superior to the slope-intercept method and more sophisticated methods using curve fitting technique, with regard to predictive force and clinical applicability.

Methods for estimating disease transmission rates: Evaluating the precision of Poisson regression and two novel methods

DEFF Research Database (Denmark)

Kirkeby, Carsten Thure; Hisham Beshara Halasa, Tariq; Gussmann, Maya Katrin

2017-01-01

the transmission rate. We use data from the two simulation models and vary the sampling intervals and the size of the population sampled. We devise two new methods to determine transmission rate, and compare these to the frequently used Poisson regression method in both epidemic and endemic situations. For most...... tested scenarios these new methods perform similar or better than Poisson regression, especially in the case of long sampling intervals. We conclude that transmission rate estimates are easily biased, which is important to take into account when using these rates in simulation models....

Novel Fingertip Image-Based Heart Rate Detection Methods for a Smartphone

Directory of Open Access Journals (Sweden)

Rifat Zaman

2017-02-01

Full Text Available We hypothesize that our fingertip image-based heart rate detection methods using smartphone reliably detect the heart rhythm and rate of subjects. We propose fingertip curve line movement-based and fingertip image intensity-based detection methods, which both use the movement of successive fingertip images obtained from smartphone cameras. To investigate the performance of the proposed methods, heart rhythm and rate of the proposed methods are compared to those of the conventional method, which is based on average image pixel intensity. Using a smartphone, we collected 120 s pulsatile time series data from each recruited subject. The results show that the proposed fingertip curve line movement-based method detects heart rate with a maximum deviation of 0.0832 Hz and 0.124 Hz using time- and frequency-domain based estimation, respectively, compared to the conventional method. Moreover, another proposed fingertip image intensity-based method detects heart rate with a maximum deviation of 0.125 Hz and 0.03 Hz using time- and frequency-based estimation, respectively.

Parallel efficient rate control methods for JPEG 2000

Science.gov (United States)

Martínez-del-Amor, Miguel Á.; Bruns, Volker; Sparenberg, Heiko

2017-09-01

Since the introduction of JPEG 2000, several rate control methods have been proposed. Among them, post-compression rate-distortion optimization (PCRD-Opt) is the most widely used, and the one recommended by the standard. The approach followed by this method is to first compress the entire image split in code blocks, and subsequently, optimally truncate the set of generated bit streams according to the maximum target bit rate constraint. The literature proposes various strategies on how to estimate ahead of time where a block will get truncated in order to stop the execution prematurely and save time. However, none of them have been defined bearing in mind a parallel implementation. Today, multi-core and many-core architectures are becoming popular for JPEG 2000 codecs implementations. Therefore, in this paper, we analyze how some techniques for efficient rate control can be deployed in GPUs. In order to do that, the design of our GPU-based codec is extended, allowing stopping the process at a given point. This extension also harnesses a higher level of parallelism on the GPU, leading to up to 40% of speedup with 4K test material on a Titan X. In a second step, three selected rate control methods are adapted and implemented in our parallel encoder. A comparison is then carried out, and used to select the best candidate to be deployed in a GPU encoder, which gave an extra 40% of speedup in those situations where it was really employed.

Method for Determination of Neptunium in Large-Sized Urine Samples Using Manganese Dioxide Coprecipitation and ²⁴²Pu as Yield Tracer

DEFF Research Database (Denmark)

Qiao, Jixin; Hou, Xiaolin; Roos, Per

2013-01-01

A novel method for bioassay of large volumes of human urine samples using manganese dioxide coprecipitation for preconcentration was developed for rapid determination of 237Np. 242Pu was utilized as a nonisotopic tracer to monitor the chemical yield of 237Np. A sequential injection extraction chr...... and rapid analysis of neptunium contamination level for emergency preparedness....

Re-assessing copepod growth using the Moult Rate method

DEFF Research Database (Denmark)

Hirst, Andrew G.; Keister, J. E.; Richardson, A. J.

2014-01-01

Estimating growth and production rates of mesozooplankton, and copepods in particular, is important in describing flows of material and energy though pelagic systems. Over the past 30 years, the Moult Rate (MR) method has been used to estimate juvenile copepod growth rates in ∼40 papers. Yet the MR......-moulting stage, e.g. copepodite stage 5 to adult. We performed experiments with Calanus pacificus to estimate growth of stage C5 using an alternative method. We found that the error size and sign varied between mass type (i.e. DW, C and N). Recommendations for practical future assessments of growth in copepods...

La cinéphilie chrétienne : Amédée Ayfre (1922-1964, sulpicien et critique de cinéma The Christian cinema enthusiasm: Amédée Ayfre (1922-1964, priest of the Society of saint Sulpice and film critic

Directory of Open Access Journals (Sweden)

Philippe Rocher

2012-06-01

Full Text Available Prêtre français de saint Sulpice et chrétien cinéphile, Amédée Ayfre a défendu l’esthétique et le réalisme cinématographiques contre le cinéma religieux du « Cinéma catholique ». Le « réalisme cinématographique » est un instrument de révélation chrétienne du Prochain. Brusquement décédé, Amédée Ayfre n’a pas eu la possibilité de dépasser ses premiers « Jalons pour une théologie de l’image ».In the middle Twentieth century, Amédée Ayfre, French priest of the Society of saint Sulpice and Christian cinema enthusiast, defended esthetic and realism cinema against the religious cinema of « Catholic cinema ». For him, realist Cinema is the Christian revelation instrument of fellow man. Brusquely to die, he can’t proposed any more his first “Jalons pour une théologie de l’image”.

Sodium flow rate measurement method of annular linear induction pump

International Nuclear Information System (INIS)

Araseki, Hideo

2011-01-01

This report describes a method for measuring sodium flow rate of annular linear induction pumps arranged in parallel and its verification result obtained through an experiment and a numerical analysis. In the method, the leaked magnetic field is measured with measuring coils at the stator end on the outlet side and is correlated with the sodium flow rate. The experimental data and the numerical result indicate that the leaked magnetic field at the stator edge keeps almost constant when the sodium flow rate changes and that the leaked magnetic field change arising from the flow rate change is small compared with the overall leaked magnetic field. It is shown that the correlation between the leaked magnetic field and the sodium flow rate is almost linear due to this feature of the leaked magnetic field, which indicates the applicability of the method to small-scale annular linear induction pumps. (author)

Empathy in individuals clinically at risk for psychosis

DEFF Research Database (Denmark)

Derntl, B.; Michel, T. M.; Prempeh, P.

2015-01-01

no significant deficit in the CHR group. Functional data analysis revealed hyperactivation in a frontotemporoparietal network including the amygdala in the CHR group compared with the other two groups. Conclusions Despite normal behavioural performance, the CHR group activated the neural empathy network...... differently and specifically showed hyperactivation in regions critical for emotion processing. This could suggest a compensatory mechanism reflecting emotional hypersensitivity or dysfunctional emotion regulation. Further investigations should clarify the role of these neural alterations for development...... high risk for psychosis. Method Using functional magnetic resonance imaging, we measured 15 individuals at clinical high risk of psychosis (CHR group) and compared their empathy performance with 15 healthy volunteers and 15 patients with schizophrenia. Results Behavioural data analysis indicated...

Rating Methods for Proactive Recommendation on Smartwatches

OpenAIRE

Janosch Maier, Wolfgang Wörndl

2015-01-01

This paper analyzes possible interaction methods for using a recommender system on a smartwatch. As prerequisite, we describe interaction patterns currently used by Android Wear applications. Based on a prototype implementation the interaction methods action buttons, two button card and swipes are compared against each other. In a user study, 31 participating students were asked to rate restaurant recommendations offered in the setting of a context-aware, proactive recommender system. For eac...

Proposed test method for determining discharge rates from water closets

DEFF Research Database (Denmark)

Nielsen, V.; Fjord Jensen, T.

At present the rates at which discharge takes place from sanitary appliances are mostly known only in the form of estimated average values. SBI has developed a measuring method enabling determination of the exact rate of discharge from a sanitary appliance as function of time. The methods depends...

Laserspritzer: a simple method for optogenetic investigation with subcellular resolutions.

Directory of Open Access Journals (Sweden)

Qian-Quan Sun

Full Text Available To build a detailed circuit diagram in the brain, one needs to measure functional synaptic connections between specific types of neurons. A high-resolution circuit diagram should provide detailed information at subcellular levels such as soma, distal and basal dendrites. However, a limitation lies in the difficulty of studying long-range connections between brain areas separated by millimeters. Brain slice preparations have been widely used to help understand circuit wiring within specific brain regions. The challenge exists because long-range connections are likely to be cut in a brain slice. The optogenetic approach overcomes these limitations, as channelrhodopsin 2 (ChR2 is efficiently transported to axon terminals that can be stimulated in brain slices. Here, we developed a novel fiber optic based simple method of optogenetic stimulation: the laserspritzer approach. This method facilitates the study of both long-range and local circuits within brain slice preparations. This is a convenient and low cost approach that can be easily integrated with a slice electrophysiology setup, and repeatedly used upon initial validation. Our data with direct ChR2 mediated-current recordings demonstrates that the spatial resolution of the laserspritzer is correlated with the size of the laserspritzer, and the resolution lies within the 30 µm range for the 5 micrometer laserspritzer. Using olfactory cortical slices, we demonstrated that the laserspritzer approach can be applied to selectively activate monosynaptic perisomatic GABAergic basket synapses, or long-range intracortical glutamatergic inputs formed on different subcellular domains within the same cell (e.g. distal and proximal dendrites. We discuss significant advantages of the laserspritzer approach over the widely used collimated LED whole-field illumination method in brain slice electrophysiological research.

A method of estimating the knock rating of hydrocarbon fuel blend

Science.gov (United States)

Sanders, Newell D

1943-01-01

The usefulness of the knock ratings of pure hydrocarbon compounds would be increased if some reliable method of calculating the knock ratings of fuel blends was known. The purpose of this study was to investigate the possibility of developing a method of predicting the knock ratings of fuel blends.

Kinetic evaluation of photosensitivity in bi-stable variants of chimeric channelrhodopsins.

Directory of Open Access Journals (Sweden)

Shoko Hososhima

Full Text Available Channelrhodopsin-1 and 2 (ChR1 and ChR2 form cation channels that are gated by light through an unknown mechanism. We tested the DC-gate hypothesis that C167 and D195 are involved in the stabilization of the cation-permeable state of ChRWR/C1C2 which consists of TM1-5 of ChR1 and TM6-7 of ChR2 and ChRFR which consists of TM1-2 of ChR1 and TM3-7 of ChR2. The cation permeable state of each ChRWR and ChRFR was markedly prolonged in the order of several tens of seconds when either C167 or D195 position was mutated to alanine (A. Therefore, the DC-gate function was conserved among these chimeric ChRs. We next investigated the kinetic properties of the ON/OFF response of these bi-stable ChR mutants as they are important in designing the photostimulation protocols for the optogenetic manipulation of neuronal activities. The turning-on rate constant of each photocurrent followed a linear relationship to 0-0.12 mW mm(-2 of blue LED light or to 0-0.33 mW mm(-2 of cyan LED light. Each photocurrent of bi-stable ChR was shut off to the non-conducting state by yellow or orange LED light in a manner dependent on the irradiance. As the magnitude of the photocurrent was mostly determined by the turning-on rate constant and the irradiation time, the minimal irradiance that effectively evoked an action potential (threshold irradiance was decreased with time only if the neuron, which expresses bi-stable ChRs, has a certain large membrane time constant (eg. τm > 20 ms. On the other hand, in another group of neurons, the threshold irradiance was not dependent on the irradiation time. Based on these quantitative data, we would propose that these bi-stable ChRs would be most suitable for enhancing the intrinsic activity of excitatory pyramidal neurons at a minimal magnitude of irradiance.

Leak Rate Quantification Method for Gas Pressure Seals with Controlled Pressure Differential

Science.gov (United States)

Daniels, Christopher C.; Braun, Minel J.; Oravec, Heather A.; Mather, Janice L.; Taylor, Shawn C.

2015-01-01

An enhancement to the pressure decay leak rate method with mass point analysis solved deficiencies in the standard method. By adding a control system, a constant gas pressure differential across the test article was maintained. As a result, the desired pressure condition was met at the onset of the test, and the mass leak rate and measurement uncertainty were computed in real-time. The data acquisition and control system were programmed to automatically stop when specified criteria were met. Typically, the test was stopped when a specified level of measurement uncertainty was attained. Using silicone O-ring test articles, the new method was compared with the standard method that permitted the downstream pressure to be non-constant atmospheric pressure. The two methods recorded comparable leak rates, but the new method recorded leak rates with significantly lower measurement uncertainty, statistical variance, and test duration. Utilizing this new method in leak rate quantification, projects will reduce cost and schedule, improve test results, and ease interpretation between data sets.

An overexpression of chalcone reductase of Pueraria montana var. lobata alters biosynthesis of anthocyanin and 5'-deoxyflavonoids in transgenic tobacco.

Science.gov (United States)

Joung, Jae-youl; Kasthuri, G Mangai; Park, Ji-young; Kang, Won-jin; Kim, Hyun-soon; Yoon, Bong-sik; Joung, Hyouk; Jeon, Jae-heung

2003-03-28

We isolated the chalcone reductase (pl-chr) gene of Pueraria montana var. lobata by using a PCR strategy from cDNA pools of storage roots. A high level of expression of RNA was found in both stems and roots. The genomic Southern blot result suggests that pl-chr exists as a member of a small gene family. By introducing a pl-chr gene under the control of the 35S CaMV promoter into the pink-flowering Xanthi line of Nicotiana tabacum, the flower color was changed from pink to white-to-pink. The contents of anthocyanin in the flowers of the transgenic lines were dramatically decreased by 40%, but the total UV absorption compounds remained unchanged. The production of liquiritigenin in pl-chr overexpressed transgenic tobacco lines was confirmed by HPLC and MS analysis. The introduction of pl-chr gene provides a method to redirect the flavonoid pathway into 5'-deoxyflavonoid production in non-legume crops, in order to manipulate the phenylpropanoid pathway for isoflavonoid production.

Heart rate-based lactate minimum test: a reproducible method.

NARCIS (Netherlands)

Strupler, M.; Muller, G.; Perret, C.

2009-01-01

OBJECTIVE: To find the individual intensity for aerobic endurance training, the lactate minimum test (LMT) seems to be a promising method. LMTs described in the literature consist of speed or work rate-based protocols, but for training prescription in daily practice mostly heart rate is used. The

Spontaneous mutation rate in Chinese hamster cell clones differing in UV-sensitivity

International Nuclear Information System (INIS)

Manuilova, E.S.; Bagrova, A.M.; Moskovskij Gosudarstvennyj Univ.

1983-01-01

The spontaneous rate of appearance of mutations to 6-mercaptopurine (6 MP) resistence in the cells of CHR2 and CHs2 clones dofferent in sensitivity to lethal and matagenous effect of UV-rays, is investigated. Increased UV-sensitivity of CHs2 clone is caused by the violation of postreplicative DNA reparation. It is established that the purity of spontaneously occuring mutations in both clones turns out to be similar, i.e. (1.5-1.8)x10 -5 for the cell pergeneration. It is shown that the effect of postreplicative DNA reparation in the cells of chinese hamster is not connected with the increase of spontaneous mutation ability. The problem on the possible role of reparation in the mechanism of appearance of spontaneous and induced mutations in the cells of Chinese hamster with increased UV-sensitivity is discussed

The assessment of cognitive errors using an observer-rated method.

Science.gov (United States)

Drapeau, Martin

2014-01-01

Cognitive Errors (CEs) are a key construct in cognitive behavioral therapy (CBT). Integral to CBT is that individuals with depression process information in an overly negative or biased way, and that this bias is reflected in specific depressotypic CEs which are distinct from normal information processing. Despite the importance of this construct in CBT theory, practice, and research, few methods are available to researchers and clinicians to reliably identify CEs as they occur. In this paper, the author presents a rating system, the Cognitive Error Rating Scale, which can be used by trained observers to identify and assess the cognitive errors of patients or research participants in vivo, i.e., as they are used or reported by the patients or participants. The method is described, including some of the more important rating conventions to be considered when using the method. This paper also describes the 15 cognitive errors assessed, and the different summary scores, including valence of the CEs, that can be derived from the method.

Precise method for correcting count-rate losses in scintillation cameras

International Nuclear Information System (INIS)

Madsen, M.T.; Nickles, R.J.

1986-01-01

Quantitative studies performed with scintillation detectors often require corrections for lost data because of the finite resolving time of the detector. Methods that monitor losses by means of a reference source or pulser have unacceptably large statistical fluctuations associated with their correction factors. Analytic methods that model the detector as a paralyzable system require an accurate estimate of the system resolving time. Because the apparent resolving time depends on many variables, including the window setting, source distribution, and the amount of scattering material, significant errors can be introduced by relying on a resolving time obtained from phantom measurements. These problems can be overcome by curve-fitting the data from a reference source to a paralyzable model in which the true total count rate in the selected window is estimated from the observed total rate. The resolving time becomes a free parameter in this method which is optimized to provide the best fit to the observed reference data. The fitted curve has the inherent accuracy of the reference source method with the precision associated with the observed total image count rate. Correction factors can be simply calculated from the ratio of the true reference source rate and the fitted curve. As a result, the statistical uncertainty of the data corrected by this method is not significantly increased

Characterization of genomic instability in Saccharomyces cerevisiae and engaging teaching strategies described in two curricula

Science.gov (United States)

Keller, Alexandra P.

Cancer arises through an accumulation of mutations in the genome. In cancer cells, mutations are frequently caused by DNA rearrangements, which include chromosomal breakages, deletions, insertions, and translocations. Such events contribute to genomic instability, a known hallmark of cancer. To study cycles of chromosomal instability, we are using baker's yeast as a model organism. In yeast, a ChrVII system was previously developed (Admire et al., 2006), in which a disomic yeast strain was used to identify regions of instability on ChrVII. Using this system, a fragile site on the left arm of ChrVII (Admire et al., 2006) was identified and characterized. This study led to insight into mechanisms involved in chromosomal rearrangements and mutations that arise from them as well as to an understanding of mechanisms involved in genomic instability. To further our understanding of genomic instability, I devised a strategy to study instability on a different chromosome (ChrV) (Figure 3), so that we could determine whether lessons learned from the ChrVII system are applicable to other chromosomes, and/or whether other mechanisms of instability could be identified. A suitable strain was generated and analyzed, and our findings suggest that frequencies of instability on the right arm of ChrV are similar to those found in ChrVII. The results from the work in ChrV described in this paper support the idea that the instability found on ChrVII is not an isolated occurrence. My research was supported by an NSF GK-12 grant. The aim of this grant is to improve science education in middle schools, and as part of my participation in this program, I studied and practiced effective science communication methodologies. In attempts to explain my research to middle school students, I collaborated with others to develop methods for explaining genetics and the most important techniques I used in my research. While developing these methods, I learned more about what motivates people to learn

A Bayes linear Bayes method for estimation of correlated event rates.

Science.gov (United States)

Quigley, John; Wilson, Kevin J; Walls, Lesley; Bedford, Tim

2013-12-01

Typically, full Bayesian estimation of correlated event rates can be computationally challenging since estimators are intractable. When estimation of event rates represents one activity within a larger modeling process, there is an incentive to develop more efficient inference than provided by a full Bayesian model. We develop a new subjective inference method for correlated event rates based on a Bayes linear Bayes model under the assumption that events are generated from a homogeneous Poisson process. To reduce the elicitation burden we introduce homogenization factors to the model and, as an alternative to a subjective prior, an empirical method using the method of moments is developed. Inference under the new method is compared against estimates obtained under a full Bayesian model, which takes a multivariate gamma prior, where the predictive and posterior distributions are derived in terms of well-known functions. The mathematical properties of both models are presented. A simulation study shows that the Bayes linear Bayes inference method and the full Bayesian model provide equally reliable estimates. An illustrative example, motivated by a problem of estimating correlated event rates across different users in a simple supply chain, shows how ignoring the correlation leads to biased estimation of event rates. © 2013 Society for Risk Analysis.

An SEU rate prediction method for microprocessors of space applications

International Nuclear Information System (INIS)

Gao Jie; Li Qiang

2012-01-01

In this article,the relationship between static SEU (Single Event Upset) rate and dynamic SEU rate in microprocessors for satellites is studied by using process duty cycle concept and fault injection technique. The results are compared to in-orbit flight monitoring data. The results show that dynamic SEU rate by using process duty cycle can estimate in-orbit SEU rate of microprocessor reasonable; and the fault injection technique is a workable method to estimate SEU rate. (authors)

A comparative study of different methods for calculating electronic transition rates

Science.gov (United States)

Kananenka, Alexei A.; Sun, Xiang; Schubert, Alexander; Dunietz, Barry D.; Geva, Eitan

2018-03-01

We present a comprehensive comparison of the following mixed quantum-classical methods for calculating electronic transition rates: (1) nonequilibrium Fermi's golden rule, (2) mixed quantum-classical Liouville method, (3) mean-field (Ehrenfest) mixed quantum-classical method, and (4) fewest switches surface-hopping method (in diabatic and adiabatic representations). The comparison is performed on the Garg-Onuchic-Ambegaokar benchmark charge-transfer model, over a broad range of temperatures and electronic coupling strengths, with different nonequilibrium initial states, in the normal and inverted regimes. Under weak to moderate electronic coupling, the nonequilibrium Fermi's golden rule rates are found to be in good agreement with the rates obtained via the mixed quantum-classical Liouville method that coincides with the fully quantum-mechanically exact results for the model system under study. Our results suggest that the nonequilibrium Fermi's golden rule can serve as an inexpensive yet accurate alternative to Ehrenfest and the fewest switches surface-hopping methods.

Survey of methods for the rating of psychiatric impairment in Australia.

Science.gov (United States)

Mendelson, George

2004-05-01

One of the enduring clinical issues in the assessment of plaintiffs in personal injury and workers' compensation claims, as well as applicants for social security and disablement benefits, is that of the evaluation of impairment and work incapacity. Many writers on this topic confuse the concepts of impairment and disability, and similar confusion is reflected in a number of the rating methods that purport to evaluate impairment but in reality assess disability. In Australia there are 20 distinct statutory schemes for workers' compensation, motor accident compensation, and social security and other benefits, which utilise a variety of methods for the rating of psychiatric impairment. Recent legislative changes designed to restrict access to personal injury compensation at common law, which in two Australian State jurisdictions require the use of impairment rating scales, also specify the rating methods to be used in the assessment of psychiatric impairment. This article discusses the concepts of impairment and disability as defined by the World Health Organisation, and reviews the various methods for the rating of psychiatric impairment that are specified by statute in the federal and State jurisdictions in Australia.

Intensive Auditory Cognitive Training Improves Verbal Memory in Adolescents and Young Adults at Clinical High Risk for Psychosis.

Science.gov (United States)

Loewy, Rachel; Fisher, Melissa; Schlosser, Danielle A; Biagianti, Bruno; Stuart, Barbara; Mathalon, Daniel H; Vinogradov, Sophia

2016-07-01

Individuals at clinical high risk (CHR) for psychosis demonstrate cognitive impairments that predict later psychotic transition and real-world functioning. Cognitive training has shown benefits in schizophrenia, but has not yet been adequately tested in the CHR population. In this double-blind randomized controlled trial, CHR individuals (N = 83) were given laptop computers and trained at home on 40 hours of auditory processing-based exercises designed to target verbal learning and memory operations, or on computer games (CG). Participants were assessed with neurocognitive tests based on the Measurement and Treatment Research to Improve Cognition in Schizophrenia initiative (MATRICS) battery and rated on symptoms and functioning. Groups were compared before and after training using a mixed-effects model with restricted maximum likelihood estimation, given the high study attrition rate (42%). Participants in the targeted cognitive training group showed a significant improvement in Verbal Memory compared to CG participants (effect size = 0.61). Positive and Total symptoms improved in both groups over time. CHR individuals showed patterns of training-induced cognitive improvement in verbal memory consistent with prior observations in schizophrenia. This is a particularly vulnerable domain in individuals at-risk for psychosis that predicts later functioning and psychotic transition. Ongoing follow-up of this cohort will assess the durability of training effects in CHR individuals, as well as the potential impact on symptoms and functioning over time. Clinical Trials Number: NCT00655239. URL: https://clinicaltrials.gov/ct2/show/NCT00655239?term=vinogradov&rank=5. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center 2016.

Identification of genomic insertion and flanking sequence of G2-EPSPS and GAT transgenes in soybean using whole genome sequencing method

Directory of Open Access Journals (Sweden)

Bingfu Guo

2016-07-01

Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.

Change of CD20 Expression in Diffuse Large B-Cell Lymphoma Treated with Rituximab, an Anti-CD20 Monoclonal Antibody: A Study of the Osaka Lymphoma Study Group

Directory of Open Access Journals (Sweden)

Naoki Wada

2009-10-01

Full Text Available Change of CD20 expression was examined in cases of diffuse large B-cell lymphoma (DLBCL. CD20 expression after treatment with anti-CD20 antibody (rituximab, Rx for DLBCL was examined in 23 cases who received serial biopsy by immunohistochemistry (IHC and flow cytometry (FCM. CD20– by IHC and/or FCM was defined as CD20–. Four cases were CD20– at initial biopsy but became CD20+ after chemotherapy with Rx (CH-R (group A. Recurrent tumors in three group A cases became resistant to CH-R. Initial and recurrent tumors were CD20+ before and after CH-R in 17 cases (group B. Tumors before CH-R were CD20– in two cases (group C and continued to be CD20– in one and turned CD20+ in the other with survival time after the relapse of 8 and 23 months, respectively. Evaluation of CD20 expression with immunohistochemical and flow cytometric methods is used for the prediction of responsiveness of relapsed DLBCL for CH-R.

Benchmark calculations for evaluation methods of gas volumetric leakage rate

International Nuclear Information System (INIS)

Asano, R.; Aritomi, M.; Matsuzaki, M.

1998-01-01

A containment function of radioactive materials transport casks is essential for safe transportation to prevent the radioactive materials from being released into environment. Regulations such as IAEA standard determined the limit of radioactivity to be released. Since is not practical for the leakage tests to measure directly the radioactivity release from a package, as gas volumetric leakages rates are proposed in ANSI N14.5 and ISO standards. In our previous works, gas volumetric leakage rates for several kinds of gas from various leaks were measured and two evaluation methods, 'a simple evaluation method' and 'a strict evaluation method', were proposed based on the results. The simple evaluation method considers the friction loss of laminar flow with expansion effect. The strict evaluating method considers an exit loss in addition to the friction loss. In this study, four worked examples were completed for on assumed large spent fuel transport cask (Type B Package) with wet or dry capacity and at three transport conditions; normal transport with intact fuels or failed fuels, and an accident in transport. The standard leakage rates and criteria for two kinds of leak test were calculated for each example by each evaluation method. The following observations are made based upon the calculations and evaluations: the choked flow model of ANSI method greatly overestimates the criteria for tests ; the laminar flow models of both ANSI and ISO methods slightly overestimate the criteria for tests; the above two results are within the design margin for ordinary transport condition and all methods are useful for the evaluation; for severe condition such as failed fuel transportation, it should pay attention to apply a choked flow model of ANSI method. (authors)

Predicting the onset of psychosis in patients at clinical high risk: practical guide to probabilistic prognostic reasoning.

Science.gov (United States)

Fusar-Poli, P; Schultze-Lutter, F

2016-02-01

Prediction of psychosis in patients at clinical high risk (CHR) has become a mainstream focus of clinical and research interest worldwide. When using CHR instruments for clinical purposes, the predicted outcome is but only a probability; and, consequently, any therapeutic action following the assessment is based on probabilistic prognostic reasoning. Yet, probabilistic reasoning makes considerable demands on the clinicians. We provide here a scholarly practical guide summarising the key concepts to support clinicians with probabilistic prognostic reasoning in the CHR state. We review risk or cumulative incidence of psychosis in, person-time rate of psychosis, Kaplan-Meier estimates of psychosis risk, measures of prognostic accuracy, sensitivity and specificity in receiver operator characteristic curves, positive and negative predictive values, Bayes' theorem, likelihood ratios, potentials and limits of real-life applications of prognostic probabilistic reasoning in the CHR state. Understanding basic measures used for prognostic probabilistic reasoning is a prerequisite for successfully implementing the early detection and prevention of psychosis in clinical practice. Future refinement of these measures for CHR patients may actually influence risk management, especially as regards initiating or withholding treatment. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Dynamic crystallization of a eucrite basalt. [achondrite textural features produced by superheating and differing cooling rates

Science.gov (United States)

Walker, D.; Powell, M. A.; Hays, J. F.; Lofgren, G. E.

1978-01-01

The textural features produced in Stannern, a non-porpyritic representative of the eucrite basaltic achondrite class of meteorite, at differing cooling rates and various degrees of initial superheating were studied. Textures produced from mildly superheated melts were found to be fasciculate rather than porphyritic as the result of the cosaturated bulk chemistry of Stannern. The qualitative type of texture apparently depends mainly on the degree of initial superheating, whereas cooling rate exerts a strong influence on the coarseness of texture. Increasing the degree of superheating produces textures from intergranular/subophitic to fasciculate/porphyritic. With initial superheating to 1200 deg C the transition to quasi-porphyritic is controlled by cooling rate, but the development of phenocrysts is merely an overprint on the fasciculate background texture of the groundmass. The suppression of fasciculate texture is completed by a decrease of the degree of initial superheating below the plagioclast entry and suppression of quasi-porphyritic texture is completed by decrease of the degree of initial superheating below pyroxene entry; these qualitative changes do not seem to be produced by changes of cooling rate. A grain size/cooling rate dependence has been used to deduce the cooling rate of fasciculate-textured Stannern clasts (10.1 to 100 deg C/hr).

Estimating Maternal Mortality Rate Using Sisterhood Methods in ...

African Journals Online (AJOL)

... maternal and child morbidity and mortality, which could serve as a surveillance strategy to identify the magnitude of the problem and to mobilize resources to areas where the problems are most prominent for adequate control. KEY WORDS: Maternal Mortality Rate, Sisterhood Method. Highland Medical Research Journal ...

A method to assign failure rates for piping reliability assessments

International Nuclear Information System (INIS)

Gamble, R.M.; Tagart, S.W. Jr.

1991-01-01

This paper reports on a simplified method that has been developed to assign failure rates that can be used in reliability and risk studies of piping. The method can be applied on a line-by-line basis by identifying line and location specific attributes that can lead to piping unreliability from in-service degradation mechanisms and random events. A survey of service experience for nuclear piping reliability also was performed. The data from this survey provides a basis for identifying in-service failure attributes and assigning failure rates for risk and reliability studies

A method for projecting age-specific mortality rates for certain causes of death

International Nuclear Information System (INIS)

Leggett, R.W.; Crawford, D.J.

1981-01-01

A method is presented for projecting mortality rates for certain causes on the basis of observed rates during past years. This method arose from a study of trends in age-specific mortality rates for respiratory cancers, and for heuristic purposes it is shown how the method can be developed from certain theories of cancer induction. However, the method is applicable in the more common situation in which the underlying physical processes cannot be modeled with any confidence but the mortality rates are approximable over short time intervals by functions of the form a exp(bt), where b may vary in a continuous, predictable fashion as the time interval is varied. It appears from applications to historical data that this projection method is in some cases a substantial improvement over conventional curve-fitting methods and often uncovers trends which are not from observed data

Correction to the count-rate detection limit and sample/blank time-allocation methods

International Nuclear Information System (INIS)

Alvarez, Joseph L.

2013-01-01

A common form of count-rate detection limits contains a propagation of uncertainty error. This error originated in methods to minimize uncertainty in the subtraction of the blank counts from the gross sample counts by allocation of blank and sample counting times. Correct uncertainty propagation showed that the time allocation equations have no solution. This publication presents the correct form of count-rate detection limits. -- Highlights: •The paper demonstrated a proper method of propagating uncertainty of count rate differences. •The standard count-rate detection limits were in error. •Count-time allocation methods for minimum uncertainty were in error. •The paper presented the correct form of the count-rate detection limit. •The paper discussed the confusion between count-rate uncertainty and count uncertainty

Community-acquired lower respiratory tract infections in HIV-infected patients on antiretroviral therapy: predictors in a contemporary cohort study.

Science.gov (United States)

Lamas, Cristiane C; Coelho, Lara E; Grinsztejn, Beatriz J; Veloso, Valdilea G

2017-12-01

Community-acquired pneumonia represents the most frequent bacterial infection in patients with HIV/AIDS. We aimed to assess variables associated with lower respiratory tract infection (LRTI) among HIV-infected adults using ART. A cohort study of HIV-infected patients aged ≥18 years, enrolled from 2000 to 2015, on ART for at least 60 days, with primary outcome as the 1st episode of LRTI during follow-up. The independent variables included were sex at birth, age, race/skin color, educational level, tobacco smoking, alcohol use, cocaine use, diabetes mellitus, CD4 count, HIV viral load, influenza and pneumococcal vaccination. Extended Cox proportional hazards models accounting for time-updated variables were fitted to assess LRTI predictors. 2669 patients were included; median follow-up was 3.9 years per patient. LRTI was diagnosed in 384 patients; incidence rate was 30.7/1000 PY. In the unadjusted Cox extended models, non-white race [crude hazard ratio (cHR) 1.28, p = 0.020], cocaine use (cHR 2.01, p < 0.001), tobacco smoking (cHR 1.34, p value 0.007), and HIV viral load ≥400 copies/mL (cHR 3.40, p < 0.001) increased the risk of LRTI. Lower risk of LRTI was seen with higher educational level (cHR 0.61, p < 0.001), rise in CD4 counts (cHR 0.81, p < 0.001, per 100 cells/mm 3 increase), influenza (cHR 0.60, p = 0.002) and pneumococcal vaccination (cHR 0.57, p < 0.001). In the adjusted model, aHR for CD4 count was 0.86, for cocaine use 1.47 and for viral load ≥400 copies 2.20. LRTI has a high incidence in HIV-infected adults using ART. Higher CD4 counts and undetectable viral loads were protective, as were pneumococcal and influenza vaccines.

Measurement for the Leak Rate enhanced by a Improved Method

International Nuclear Information System (INIS)

Bae, Sang-Hoon; Choi, Young-San; Kim, Young-Ki; Lee, Yong-Sub; Jung, Hoan-Sung

2007-01-01

The leak rate measurement of the HANARO such as a research reactor that adopts a confinement concept for a reactor hall is very important one during a period inspection. This test verifies whether the reactor building could maintain the negative pressure or not when radiation is perceived by abnormal accidents. Of course, this may not cause a problem in a reactor operation only if it can satisfy the design requirement, but it is necessary to have some margin of a limitation value because a reactor hall should be managed more conservatively than the design reference. To meet the requirements of this strict design condition, previous method was changed to a new type of test with more stable and robust measuring method. The new leak rate measurement method is briefly introduced and the merits of this proposed method are shown through the data analyzed for last 3 years

Implementation of Online Promethee Method for Poor Family Change Rate Calculation

Directory of Open Access Journals (Sweden)

Lukito Aji Dhady

2018-01-01

Full Text Available This research has been done online calculation of the rate of poor family change rate by using Preference Ranking Method of Organization Of Enrichment Evaluation (PROMETHEE .This system is very useful to monitor poverty in a region as well as for administrative services related to poverty rate. The system consists of computer clients and servers connected via the internet network. Poor family residence data obtained from the government. In addition, survey data are inputted through the client computer in each administrative village and also 23 criteria of input in accordance with the established government. The PROMETHEE method is used to evaluate the value of poverty and its weight is used to determine poverty status. PROMETHEE output can also be used to rank the poverty of the registered population of the server based on the netflow value. The poverty rate is calculated based on the current poverty rate compared to the previous poverty rate. The rate results can be viewed online and real time on the server through numbers and graphs. From the test results can be seen that the system can classify poverty status, calculate the poverty rate change rate and can determine the value and poverty ranking of each population.

Implementation of Online Promethee Method for Poor Family Change Rate Calculation

Science.gov (United States)

Aji, Dhady Lukito; Suryono; Widodo, Catur Edi

2018-02-01

This research has been done online calculation of the rate of poor family change rate by using Preference Ranking Method of Organization Of Enrichment Evaluation (PROMETHEE) .This system is very useful to monitor poverty in a region as well as for administrative services related to poverty rate. The system consists of computer clients and servers connected via the internet network. Poor family residence data obtained from the government. In addition, survey data are inputted through the client computer in each administrative village and also 23 criteria of input in accordance with the established government. The PROMETHEE method is used to evaluate the value of poverty and its weight is used to determine poverty status. PROMETHEE output can also be used to rank the poverty of the registered population of the server based on the netflow value. The poverty rate is calculated based on the current poverty rate compared to the previous poverty rate. The rate results can be viewed online and real time on the server through numbers and graphs. From the test results can be seen that the system can classify poverty status, calculate the poverty rate change rate and can determine the value and poverty ranking of each population.

Apparatus and method for determining solids circulation rate

Science.gov (United States)

Ludlow, J Christopher [Morgantown, WV; Spenik, James L [Morgantown, WV

2012-02-14

The invention relates to a method of determining bed velocity and solids circulation rate in a standpipe experiencing a moving packed bed flow, such as the in the standpipe section of a circulating bed fluidized reactor The method utilizes in-situ measurement of differential pressure over known axial lengths of the standpipe in conjunction with in-situ gas velocity measurement for a novel application of Ergun equations allowing determination of standpipe void fraction and moving packed bed velocity. The method takes advantage of the moving packed bed property of constant void fraction in order to integrate measured parameters into simultaneous solution of Ergun-based equations and conservation of mass equations across multiple sections of the standpipe.

Clinical high risk for psychosis in children and adolescents: a systematic review.

Science.gov (United States)

Tor, Jordina; Dolz, Montserrat; Sintes, Anna; Muñoz, Daniel; Pardo, Marta; de la Serna, Elena; Puig, Olga; Sugranyes, Gisela; Baeza, Inmaculada

2017-09-15

The concept of being at risk for psychosis has been introduced both for adults and children and adolescents, but fewer studies have been conducted in the latter population. The aim of this study is to systematically review the articles associated with clinical description, interventions, outcome and other areas in children and adolescents at risk for psychosis. We searched in MEDLINE/PubMed and PsycINFO databases for articles published up to 30/06/16. Reviewed articles were prospective studies; written in English; original articles with Clinical High Risk (CHR) for psychosis samples; and mean age of samples younger than 18 years. From 103 studies initially selected, 48 met inclusion criteria and were systematically reviewed. Studies show that CHR children and adolescents present several clinical characteristics at baseline, with most attenuated positive-symptom inclusion criteria observed, reporting mostly perceptual abnormalities and suspiciousness, and presenting comorbid conditions such as depressive and anxiety disorders. CHR children and adolescents show lower general intelligence and no structural brain changes compared with controls. Original articles reviewed show rates of conversion to psychosis between 17 and 20% at 1 year follow-up and between 7 and 21% at 2 years. While 36% of patients recovered from their CHR status at 6-year follow-up, 40% still met CHR criteria. Studies in children and adolescents with CHR were conducted with different methodologies, assessments tools and small samples. It is important to conduct studies on psychopharmacological and psychological treatment, as well as replication of the few studies found.

Review of assessment methods discount rate in investment analysis

Directory of Open Access Journals (Sweden)

Yamaletdinova Guzel Hamidullovna

2011-08-01

Full Text Available The article examines the current methods of calculating discount rate in investment analysis and business valuation, as well as analyzes the key problems using various techniques in terms of the Russian economy.

Biasing transition rate method based on direct MC simulation for probabilistic safety assessment

Institute of Scientific and Technical Information of China (English)

Xiao-Lei Pan; Jia-Qun Wang; Run Yuan; Fang Wang; Han-Qing Lin; Li-Qin Hu; Jin Wang

2017-01-01

Direct Monte Carlo (MC) simulation is a powerful probabilistic safety assessment method for accounting dynamics of the system.But it is not efficient at simulating rare events.A biasing transition rate method based on direct MC simulation is proposed to solve the problem in this paper.This method biases transition rates of the components by adding virtual components to them in series to increase the occurrence probability of the rare event,hence the decrease in the variance of MC estimator.Several cases are used to benchmark this method.The results show that the method is effective at modeling system failure and is more efficient at collecting evidence of rare events than the direct MC simulation.The performance is greatly improved by the biasing transition rate method.

Paraquat prohibition and change in the suicide rate and methods in South Korea.

Directory of Open Access Journals (Sweden)

Woojae Myung

Full Text Available The annual suicide rate in South Korea is the highest among the developed countries. Paraquat is a highly lethal herbicide, commonly used in South Korea as a means for suicide. We have studied the effect of the 2011 paraquat prohibition on the national suicide rate and method of suicide in South Korea. We obtained the monthly suicide rate from 2005 to 2013 in South Korea. In our analyses, we adjusted for the effects of celebrity suicides, and economic, meteorological, and seasonal factors on suicide rate. We employed change point analysis to determine the effect of paraquat prohibition on suicide rate over time, and the results were verified by structural change analysis, an alternative statistical method. After the paraquat prohibition period in South Korea, there was a significant reduction in the total suicide rate and suicide rate by poisoning with herbicides or fungicides in all age groups and in both genders. The estimated suicide rates during this period decreased by 10.0% and 46.1% for total suicides and suicides by poisoning of herbicides or fungicides, respectively. In addition, method substitution effect of paraquat prohibition was found in suicide by poisoning by carbon monoxide, which did not exceed the reduction in the suicide rate of poisoning with herbicides or fungicides. In South Korea, paraquat prohibition led to a lower rate of suicide by paraquat poisoning, as well as a reduction in the overall suicide rate. Paraquat prohibition should be considered as a national suicide prevention strategy in developing and developed countries alongside careful observation for method substitution effects.

Paraquat prohibition and change in the suicide rate and methods in South Korea.

Science.gov (United States)

Myung, Woojae; Lee, Geung-Hee; Won, Hong-Hee; Fava, Maurizio; Mischoulon, David; Nyer, Maren; Kim, Doh Kwan; Heo, Jung-Yoon; Jeon, Hong Jin

2015-01-01

The annual suicide rate in South Korea is the highest among the developed countries. Paraquat is a highly lethal herbicide, commonly used in South Korea as a means for suicide. We have studied the effect of the 2011 paraquat prohibition on the national suicide rate and method of suicide in South Korea. We obtained the monthly suicide rate from 2005 to 2013 in South Korea. In our analyses, we adjusted for the effects of celebrity suicides, and economic, meteorological, and seasonal factors on suicide rate. We employed change point analysis to determine the effect of paraquat prohibition on suicide rate over time, and the results were verified by structural change analysis, an alternative statistical method. After the paraquat prohibition period in South Korea, there was a significant reduction in the total suicide rate and suicide rate by poisoning with herbicides or fungicides in all age groups and in both genders. The estimated suicide rates during this period decreased by 10.0% and 46.1% for total suicides and suicides by poisoning of herbicides or fungicides, respectively. In addition, method substitution effect of paraquat prohibition was found in suicide by poisoning by carbon monoxide, which did not exceed the reduction in the suicide rate of poisoning with herbicides or fungicides. In South Korea, paraquat prohibition led to a lower rate of suicide by paraquat poisoning, as well as a reduction in the overall suicide rate. Paraquat prohibition should be considered as a national suicide prevention strategy in developing and developed countries alongside careful observation for method substitution effects.

Semi-Automatic Rating Method for Neutrophil Alkaline Phosphatase Activity.

Science.gov (United States)

Sugano, Kanae; Hashi, Kotomi; Goto, Misaki; Nishi, Kiyotaka; Maeda, Rie; Kono, Keigo; Yamamoto, Mai; Okada, Kazunori; Kaga, Sanae; Miwa, Keiko; Mikami, Taisei; Masauzi, Nobuo

2017-01-01

The neutrophil alkaline phosphatase (NAP) score is a valuable test for the diagnosis of myeloproliferative neoplasms, but it has still manually rated. Therefore, we developed a semi-automatic rating method using Photoshop ® and Image-J, called NAP-PS-IJ. Neutrophil alkaline phosphatase staining was conducted with Tomonaga's method to films of peripheral blood taken from three healthy volunteers. At least 30 neutrophils with NAP scores from 0 to 5+ were observed and taken their images. From which the outer part of neutrophil was removed away with Image-J. These were binarized with two different procedures (P1 and P2) using Photoshop ® . NAP-positive area (NAP-PA) and granule (NAP-PGC) were measured and counted with Image-J. The NAP-PA in images binarized with P1 significantly (P < 0.05) differed between images with NAP scores from 0 to 3+ (group 1) and those from 4+ to 5+ (group 2). The original images in group 1 were binarized with P2. NAP-PGC of them significantly (P < 0.05) differed among all four NAP score groups. The mean NAP-PGC with NAP-PS-IJ indicated a good correlation (r = 0.92, P < 0.001) to results by human examiners. The sensitivity and specificity of NAP-PS-IJ were 60% and 92%, which might be considered as a prototypic method for the full-automatic rating NAP score. © 2016 Wiley Periodicals, Inc.

Advanced evaluation method of SG TSP BEC hole blockage rate

International Nuclear Information System (INIS)

Izumida, Hiroyuki; Nagata, Yasuyuki; Harada, Yutaka; Murakami, Ryuji

2003-01-01

In spite of the control of the water chemistry of SG secondary feed-water in PWR-SG, SG TSP BEC holes, which are the flow path of secondary water, are often clogged. In the past, the trending of BEC hole blockage rate has conducted by evaluating ECT original signals and visual inspections. However, the ECT original signals of deposits are diversified, it becomes difficult to analyze them with the existing evaluation method using the ECT original signals. In this regard, we have developed the secondary side visual inspection system, which enables the high-accuracy evaluation of BEC hole blockage rate, and new ECT signal evaluation method. (author)

QTL analysis of dietary obesity in C57BL/6byj X 129P3/J F2 mice: diet- and sex-dependent effects.

Science.gov (United States)

Lin, Cailu; Theodorides, Maria L; McDaniel, Amanda H; Tordoff, Michael G; Zhang, Qinmin; Li, Xia; Bosak, Natalia; Bachmanov, Alexander A; Reed, Danielle R

2013-01-01

Obesity is a heritable trait caused by complex interactions between genes and environment, including diet. Gene-by-diet interactions are difficult to study in humans because the human diet is hard to control. Here, we used mice to study dietary obesity genes, by four methods. First, we bred 213 F2 mice from strains that are susceptible [C57BL/6ByJ (B6)] or resistant [129P3/J (129)] to dietary obesity. Percent body fat was assessed after mice ate low-energy diet and again after the same mice ate high-energy diet for 8 weeks. Linkage analyses identified QTLs associated with dietary obesity. Three methods were used to filter candidate genes within the QTL regions: (a) association mapping was conducted using >40 strains; (b) differential gene expression and (c) comparison of genomic DNA sequence, using two strains closely related to the progenitor strains from Experiment 1. The QTL effects depended on whether the mice were male or female or which diet they were recently fed. After feeding a low-energy diet, percent body fat was linked to chr 7 (LOD=3.42). After feeding a high-energy diet, percent body fat was linked to chr 9 (Obq5; LOD=3.88), chr 12 (Obq34; LOD=3.88), and chr 17 (LOD=4.56). The Chr 7 and 12 QTLs were sex dependent and all QTL were diet-dependent. The combination of filtering methods highlighted seven candidate genes within the QTL locus boundaries: Crx, Dmpk, Ahr, Mrpl28, Glo1, Tubb5, and Mut. However, these filtering methods have limitations so gene identification will require alternative strategies, such as the construction of congenics with very small donor regions.

Fastest Rates for Stochastic Mirror Descent Methods

KAUST Repository

Hanzely, Filip; Richtarik, Peter

2018-01-01

Relative smoothness - a notion introduced by Birnbaum et al. (2011) and rediscovered by Bauschke et al. (2016) and Lu et al. (2016) - generalizes the standard notion of smoothness typically used in the analysis of gradient type methods. In this work we are taking ideas from well studied field of stochastic convex optimization and using them in order to obtain faster algorithms for minimizing relatively smooth functions. We propose and analyze two new algorithms: Relative Randomized Coordinate Descent (relRCD) and Relative Stochastic Gradient Descent (relSGD), both generalizing famous algorithms in the standard smooth setting. The methods we propose can be in fact seen as a particular instances of stochastic mirror descent algorithms. One of them, relRCD corresponds to the first stochastic variant of mirror descent algorithm with linear convergence rate.

Fastest Rates for Stochastic Mirror Descent Methods

KAUST Repository

Hanzely, Filip

2018-03-20

Relative smoothness - a notion introduced by Birnbaum et al. (2011) and rediscovered by Bauschke et al. (2016) and Lu et al. (2016) - generalizes the standard notion of smoothness typically used in the analysis of gradient type methods. In this work we are taking ideas from well studied field of stochastic convex optimization and using them in order to obtain faster algorithms for minimizing relatively smooth functions. We propose and analyze two new algorithms: Relative Randomized Coordinate Descent (relRCD) and Relative Stochastic Gradient Descent (relSGD), both generalizing famous algorithms in the standard smooth setting. The methods we propose can be in fact seen as a particular instances of stochastic mirror descent algorithms. One of them, relRCD corresponds to the first stochastic variant of mirror descent algorithm with linear convergence rate.

'Continuation rate', 'use-effectiveness' and their assessment for the diaphragm and jelly method.

Science.gov (United States)

Chandrasekaran, C; Karkal, M

1972-11-01

Abstract The application of the life-table technique in the calculation of use-effectiveness of a contraceptive was proposed by Potter in 1963.(1) The technique was also found to be useful in assessing the duration for which the use of a contraceptive was continued. The keen interest that existed in the use of IUD in the mid-1960's was reflected in the terminology developed for assessment of the continuity of use. 'Retention rate' was a frequently used index.(2) Because of the development of the concept of segments whose end-period determined either termination of the use of a method or its continuance on a cut-off date, 'closure rate' and 'termination rate' have been used as measures of the discontinuance of the use of methods primarily of the IUD.(3) While discussing concepts relating to acceptance, use and effectiveness of family planning methods, more generally, an expert group suggested that 'continuation' should be used to denote that a client (or a couple) had begun to practise a method and that the method was still being practised.(4) Since this group defined 'an acceptor' as a person taking service and/or advice, i.e. having an IUD insertion or a sterilization operation or receiving supplies (or advice on methods such as 'rhythm' or coitus-interruptus with the intent of using the method), the base for the assessment of continuation rates, according to this group, would be only those acceptors who had begun using the method. The lifetable method has also been used for the study of the continuation rate for pill acceptors.(5) Balakrishnan, et al., made a study of continuation rates of oral contraceptives using the multiple decrement life-table technique.(6).

Estimating evolutionary rates using time-structured data: a general comparison of phylogenetic methods.

Science.gov (United States)

Duchêne, Sebastián; Geoghegan, Jemma L; Holmes, Edward C; Ho, Simon Y W

2016-11-15

In rapidly evolving pathogens, including viruses and some bacteria, genetic change can accumulate over short time-frames. Accordingly, their sampling times can be used to calibrate molecular clocks, allowing estimation of evolutionary rates. Methods for estimating rates from time-structured data vary in how they treat phylogenetic uncertainty and rate variation among lineages. We compiled 81 virus data sets and estimated nucleotide substitution rates using root-to-tip regression, least-squares dating and Bayesian inference. Although estimates from these three methods were often congruent, this largely relied on the choice of clock model. In particular, relaxed-clock models tended to produce higher rate estimates than methods that assume constant rates. Discrepancies in rate estimates were also associated with high among-lineage rate variation, and phylogenetic and temporal clustering. These results provide insights into the factors that affect the reliability of rate estimates from time-structured sequence data, emphasizing the importance of clock-model testing. sduchene@unimelb.edu.au or garzonsebastian@hotmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Fill rate estimation in periodic review policies with lost sales using simple methods

Energy Technology Data Exchange (ETDEWEB)

Cardós, M.; Guijarro Tarradellas, E.; Babiloni Griñón, E.

2016-07-01

Purpose: The exact estimation of the fill rate in the lost sales case is complex and time consuming. However, simple and suitable methods are needed for its estimation so that inventory managers could use them. Design/methodology/approach: Instead of trying to compute the fill rate in one step, this paper focuses first on estimating the probabilities of different on-hand stock levels so that the fill rate is computed later. Findings: As a result, the performance of a novel proposed method overcomes the other methods and is relatively simple to compute. Originality/value: Existing methods for estimating stock levels are examined, new procedures are proposed and their performance is assessed.

COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

Directory of Open Access Journals (Sweden)

G. Tantillo

2013-02-01

Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

Flow Rate Measurement Using 99mTc Radiotracer Method in a Pipe Installation

International Nuclear Information System (INIS)

Sipaun, S. M.; Bakar, A. Q. Abu; Othman, N.; Shaari, M. R.; Adnan, M. A. K.; Yusof, J. Mohd; Demanah, R.

2010-01-01

Flow rate is a significant parameter for managing processes in chemical processing plants and water processing facility. Accurate measurement of the flow rate allows engineers to monitor the delivery of process material, which in turn impacts a plant's capacity to produce their products. One of the available methods for determining the flow rate of a process material is by introducing a radiotracer to the system that mimics the material's flow pattern. In this study, a low activity Technetium-99m radioisotope was injected into a water piping setup and the 2'' x 2'' NaI (Tl) detectors were calibrated to detect spectrum peaks at specific points of the pipe installation. Using pulse velocity method, water flow rate was determined to be 11.3 litres per minute. For the sampling method, at different pump capacity, the flow rate was 15.0 litres per minute.

Method of Euthanasia Influences the Oocyte Fertilization Rate with Fresh Mouse Sperm

Science.gov (United States)

Hazzard, Karen C; Watkins-Chow, Dawn E; Garrett, Lisa J

2014-01-01

In vitro fertilization (IVF) is used to produce mouse embryos for a variety of reasons. We evaluated the effect of the method of euthanasia on the fertilization rate in 2 different IVF protocols. Oocytes collected from C57BL/6J female mice euthanized by CO2 inhalation or cervical dislocation were used in IVF with fresh sperm from either wild-type or genetically engineered C57BL/6J. Compared with CO2 inhalation, cervical dislocation improved the resulting rate of fertilization by 18% in an IVF method using Cook media and by 13% in an IVF method using methyl-B cyclodextrin and reduced glutathione. The lower fertilization rate due to euthanasia by CO2 inhalation was accompanied by changes in blood pH and body temperature despite efforts to minimize temperature drops. In our hands, euthanasia by cervical dislocation improved fertilization rates and consequently reduced the number of egg-donor mice required. PMID:25650969

Method of euthanasia influences the oocyte fertilization rate with fresh mouse sperm.

Science.gov (United States)

Hazzard, Karen C; Watkins-Chow, Dawn E; Garrett, Lisa J

2014-11-01

In vitro fertilization (IVF) is used to produce mouse embryos for a variety of reasons. We evaluated the effect of the method of euthanasia on the fertilization rate in 2 different IVF protocols. Oocytes collected from C57BL/6J female mice euthanized by CO2 inhalation or cervical dislocation were used in IVF with fresh sperm from either wild-type or genetically engineered C57BL/6J. Compared with CO2 inhalation, cervical dislocation improved the resulting rate of fertilization by 18% in an IVF method using Cook media and by 13% in an IVF method using methyl-B cyclodextrin and reduced glutathione. The lower fertilization rate due to euthanasia by CO2 inhalation was accompanied by changes in blood pH and body temperature despite efforts to minimize temperature drops. In our hands, euthanasia by cervical dislocation improved fertilization rates and consequently reduced the number of egg-donor mice required.

Systematic method for resource rating with two applications to potential wilderness areas

International Nuclear Information System (INIS)

Voelker, A.H.; Wedow, H.; Oakes, E.; Scheffler, P.K.

1979-09-01

A versatile method was developed to rate the energy- and mineral-resource potentials of areas in which land-management and resource-development decisions must be reached with a minimum expenditure of money and time. The method surveys published and personal information on resources in the region being assessed, selects the most appropriate information, synthesizes the information into map overlays and tract descriptions, rates the potential of tracts for particular resources, rates the overall importance of each tract for resource development, and documents the ratings and their significance. Basic criteria considered by the assessment team include the favorability and certainty ratings, the overall availability of each rated resource within this country, the size of a given tract, economic factors, and the number of resources in a tract. The method was applied to two separate but roughly similar geologic regions, the Idaho-Wyoming-Utah thrust belt and the central Appalachians. Undeveloped tracts of national forestland in these regions that are being considered for possible designation under the Roadless Area Review and Evaluation (RARE II) planning process were rated for their resource value. Results support earlier indications that the 63 tracts comprising the western thrust belt possess a high potential for future resource development. Nearly one-half of these tracts were rated either 3 or 4. However, the wide spread of the importance ratings between 1 and 4 suggests that some tracts or portions of tracts can be added to the National Wilderness System without compromising resource development. The 72 eastern thrust belt tracts were given lower ratings, which indicates the reduced significance of the few remaining roadless areas in this region in satisfying the nation's near-term resource needs

RCS Leak Rate Calculation with High Order Least Squares Method

International Nuclear Information System (INIS)

Lee, Jeong Hun; Kang, Young Kyu; Kim, Yang Ki

2010-01-01

As a part of action items for Application of Leak before Break(LBB), RCS Leak Rate Calculation Program is upgraded in Kori unit 3 and 4. For real time monitoring of operators, periodic calculation is needed and corresponding noise reduction scheme is used. This kind of study was issued in Korea, so there have upgraded and used real time RCS Leak Rate Calculation Program in UCN unit 3 and 4 and YGN unit 1 and 2. For reduction of the noise in signals, Linear Regression Method was used in those programs. Linear Regression Method is powerful method for noise reduction. But the system is not static with some alternative flow paths and this makes mixed trend patterns of input signal values. In this condition, the trend of signal and average of Linear Regression are not entirely same pattern. In this study, high order Least squares Method is used to follow the trend of signal and the order of calculation is rearranged. The result of calculation makes reasonable trend and the procedure is physically consistence

Study on the evaluation method of radiation dose rate around spent fuel shipping casks

International Nuclear Information System (INIS)

Yamakoshi, Hisao

1986-01-01

This study aims at developing a simple calculation method which can evaluate radiation dose rate around casks with high accuracy in a short time. The method is based on a concept of the radiation shielding characteristics of cask walls. The concept was introduced to replace for ordinary radiation shielding calculation which requires a long calculation time and a large memory capacity of a computer in the matrix calculation. For the purpose of verifying the accuracy and reliability of the new method, it was applied to the analysis of the dose rate distribution around actual casks, which had been measured. The results of the analysis revealed that the newly proposed method was excellent for the forecast of radiation dose rate distribution around casks in view of the accuracy and calculation time. The short calculation time and high accuracy by the proposed method were attained by dividing the whole procedure of ordinary fine radiation shielding calculation into the calculation of radiation dose rate on a cask surface by the matrix expression of the characteristic function and the calculation of dose rate distribution using the simple analytical expression of dose rate distribution around casks. The effect of the heterogeneous array of spent fuel in different burnup state on dose rate distribution around casks was evaluated by this method. (Kako, I.)

Standard Test Method for Determining Thermal Neutron Reaction Rates and Thermal Neutron Fluence Rates by Radioactivation Techniques

CERN Document Server

American Society for Testing and Materials. Philadelphia

2008-01-01

1.1 The purpose of this test method is to define a general procedure for determining an unknown thermal-neutron fluence rate by neutron activation techniques. It is not practicable to describe completely a technique applicable to the large number of experimental situations that require the measurement of a thermal-neutron fluence rate. Therefore, this method is presented so that the user may adapt to his particular situation the fundamental procedures of the following techniques. 1.1.1 Radiometric counting technique using pure cobalt, pure gold, pure indium, cobalt-aluminum, alloy, gold-aluminum alloy, or indium-aluminum alloy. 1.1.2 Standard comparison technique using pure gold, or gold-aluminum alloy, and 1.1.3 Secondary standard comparison techniques using pure indium, indium-aluminum alloy, pure dysprosium, or dysprosium-aluminum alloy. 1.2 The techniques presented are limited to measurements at room temperatures. However, special problems when making thermal-neutron fluence rate measurements in high-...

A Galvanic Coupling Method for Assessing Hydration Rates

Directory of Open Access Journals (Sweden)

Clement Ogugua Asogwa

2016-07-01

Full Text Available Recent advances in biomedical sensors, data acquisition techniques, microelectronics and wireless communication systems opened up the use of wearable technology for ehealth monitoring. We introduce a galvanic coupled intrabody communication for monitoring human body hydration. Studies in hydration provide the information necessary for understanding the desired fluid levels for optimal performance of the body’s physiological and metabolic processes during exercise and activities of daily living. Current measurement techniques are mostly suitable for laboratory purposes due to their complexity and technical requirements. Less technical methods such as urine color observation and skin turgor testing are subjective and cannot be integrated into a wearable device. Bioelectrical impedance methods are popular but mostly used for estimating total body water with limited accuracy and sensitive to 800 mL–1000 mL change in body fluid levels. We introduce a non-intrusive and simple method of tracking hydration rates that can detect up to 1.30 dB reduction in attenuation when as little as 100 mL of water is consumed. Our results show that galvanic coupled intrabody signal propagation can provide qualitative hydration and dehydration rates in line with changes in an individual’s urine specific gravity and body mass. The real-time changes in galvanic coupled intrabody signal attenuation can be integrated into wearable electronic devices to evaluate body fluid levels on a particular area of interest and can aid diagnosis and treatment of fluid disorders such as lymphoedema.

Estimation in adults of the glomerular filtration rate in [99mTc] DTPA renography - the rate constant method

International Nuclear Information System (INIS)

Carlsen, Ove

2004-01-01

The purpose of this study was to design an alternative and robust method for estimation of glomerular filtration rate (GFR) in [ 99 mTc]-diethylenetriaminepentaacetic acid ([ 99 mTc] -DTPA renography with a reliability not significantly lower than that of the conventional Gates' method. Methods: The method is based on renographies lasting 40 min in which regions of interest (ROIs) are manually created over selected parts of certain blood pools (e.g. heart, lungs, spleen, and liver). For each ROI the corresponding time-activity curve (TAC) was generated, decay corrected and exposed to a monoexponential fit in the time interval 10 to 40 min postinjection. The rate constant in min-1 of the monoexponential fit was denoted BETA. Following an iterative procedure comprising usually 5-10 manually created ROIs, the monoexponential fit with the maximum rate constant (BETA max ) was used for estimation of GFR. Results: In a patient material of 54 adult subjects in whom GFR was determined with multiple or one sample techniques with [ 51 Cr]-ethylenediaminetetraacetic acid ([ 51 Cr]-EDTA) the regression curve of standard GFR (GFR std ) (i.e. GFR adjusted to 1.73 m 2 body surface area) showed a close, non-linear relationship with BETA max with a correlation coefficient of 95%. The standard errors of estimate (SEE) were 6.6, 10.6 and 16.8 for GFR std equal to 30, 60, and 120 ml/(min .73 m 2 ), respectively. The corresponding SEE values for almost the same patient material using Gates' method were 8.4, 11.9, and 16.8 ml/(min 1.73 m 2 ). Conclusions: The alternative rate constant method yields estimates of GFR std with SEE values equal to or slightly smaller than in Gates' method. The two methods provide statistically uncorrelated estimates of GFR std . Therefore, pooled estimates of GFR std can be calculated with SEE values approximately 1.41 times smaller than those mentioned above. The reliabilities of the pooled estimate of GFR std separately and of the multiple samples method

Lidar method to estimate emission rates from extended sources

Science.gov (United States)

Currently, point measurements, often combined with models, are the primary means by which atmospheric emission rates are estimated from extended sources. However, these methods often fall short in their spatial and temporal resolution and accuracy. In recent years, lidar has emerged as a suitable to...

Linkage group-chromosome correlations in Sordaria macrospora: Chromosome identification by three dimensional reconstruction of their synaptonemal complex.

Science.gov (United States)

Zickler, D; Leblon, G; Haedens, V; Collard, A; Thuriaux, P

1984-01-01

Reconstruction of serially sectioned zygotene and pachytene nuclei has allowed, by measuring the lengths of synaptonemal complexes, an assignment of the 7 linkage (LG) groups to the 7 chromosomes in the fungus Sordaria macrospora. The 7 LG have been established using 19 mutants showing low second division segregation frequencies. Eight chromosomal rearrangements mapped on the 7 LG were used to identify the chromosomes involved. The following one to one assignment of the 7 LG to specific chromosomes was obtained: LG a: chromosome (chr) 1, LG b: chr5, LG c: chr6, LG d: chr7, LG e: chr4, LG f: chr3 and LG g: chr2 (the chromosome carrying the nucleolus organizer region).

Test Method for High β Particle Emission Rate of 63Ni Source Plate

OpenAIRE

ZHANG Li-feng

2015-01-01

For the problem of measurement difficulties of β particle emission rate of Ni-63 source plate used for Ni-63 betavoltaic battery, a relative test method of scintillation current method was erected according to the measurement principle of scintillation detector.β particle emission rate of homemade Ni-63 source plate was tested by the method, and the test results were analysed and evaluated, it was initially thought that scintillation current method was a feasible way of testing β particle emi...

Scale factor measure method without turntable for angular rate gyroscope

Science.gov (United States)

Qi, Fangyi; Han, Xuefei; Yao, Yanqing; Xiong, Yuting; Huang, Yuqiong; Wang, Hua

2018-03-01

In this paper, a scale factor test method without turntable is originally designed for the angular rate gyroscope. A test system which consists of test device, data acquisition circuit and data processing software based on Labview platform is designed. Taking advantage of gyroscope's sensitivity of angular rate, a gyroscope with known scale factor, serves as a standard gyroscope. The standard gyroscope is installed on the test device together with a measured gyroscope. By shaking the test device around its edge which is parallel to the input axis of gyroscope, the scale factor of the measured gyroscope can be obtained in real time by the data processing software. This test method is fast. It helps test system miniaturized, easy to carry or move. Measure quarts MEMS gyroscope's scale factor multi-times by this method, the difference is less than 0.2%. Compare with testing by turntable, the scale factor difference is less than 1%. The accuracy and repeatability of the test system seems good.

Potentially important periods of change in the development of social and role functioning in youth at clinical high risk for psychosis.

Science.gov (United States)

Velthorst, Eva; Zinberg, Jamie; Addington, Jean; Cadenhead, Kristin S; Cannon, Tyrone D; Carrión, Ricardo E; Auther, Andrea; Cornblatt, Barbara A; McGlashan, Thomas H; Mathalon, Daniel H; Perkins, Diana O; Seidman, Larry J; Tsuang, Ming T; Walker, Elaine F; Woods, Scott W; Reichenberg, Abraham; Bearden, Carrie E

2018-02-01

The developmental course of daily functioning prior to first psychosis-onset remains poorly understood. This study explored age-related periods of change in social and role functioning. The longitudinal study included youth (aged 12-23, mean follow-up years = 1.19) at clinical high risk (CHR) for psychosis (converters [CHR-C], n = 83; nonconverters [CHR-NC], n = 275) and a healthy control group (n = 164). Mixed-model analyses were performed to determine age-related differences in social and role functioning. We limited our analyses to functioning before psychosis conversion; thus, data of CHR-C participants gathered after psychosis onset were excluded. In controls, social and role functioning improved over time. From at least age 12, functioning in CHR was poorer than in controls, and this lag persisted over time. Between ages 15 and 18, social functioning in CHR-C stagnated and diverged from that of CHR-NC, who continued to improve (p = .001). Subsequently, CHR-C lagged behind in improvement between ages 21 and 23, further distinguishing them from CHR-NC (p role functioning, but to a lesser extent (p = .007). The results remained consistent when we accounted for the time to conversion. Our findings suggest that CHR-C start lagging behind CHR-NC in social and role functioning in adolescence, followed by a period of further stagnation in adulthood.

The Relationship Between Method of Viewing Lectures, Course Ratings, and Course Timing.

Science.gov (United States)

Burton, William B; Ma, Terence P; Grayson, Martha S

2017-01-01

In recent years, medical schools have provided students access to video recordings of course lectures, but few studies have investigated the impact of this on ratings of courses and teachers. This study investigated whether the method of viewing lectures was related to student ratings of the course and its components and whether the method used changed over time. Preclinical medical students indicated whether ratings of course lectures were based primarily on lecture attendance, video capture, or both. Students were categorized into Lecture, Video, or Both groups based on their responses to this question. The data consisted of 7584 student evaluations collected over 2 years. Students who attended live lectures rated the course and its components higher than students who only viewed the video or used both methods, although these differences were very small. Students increasingly watched lectures exclusively by video over time: in comparison with first-year students, second-year students were more likely to watch lectures exclusively by video; in comparison with students in the first half of the academic year, students in the second half of the academic year were more likely to watch lectures exclusively by video. With the increase in use of lecture video recordings across medical schools, attention must be paid to student attitudes regarding these methods.

Methods for measuring specific rates of mercury methylation and degradation and their use in determining factors controlling net rates of mercury methylation

International Nuclear Information System (INIS)

Ramlal, P.S.; Rudd, J.W.M.; Hecky, R.E.

1986-01-01

A method was developed to estimate specific rates of demethylation of methyl mercury in aquatic samples by measuring the volatile 14 C end products of 14 CH 3 HgI demethylation. This method was used in conjuction with a 203 Hg 2+ radiochemical method which determines specific rates of mercury methylation. Together, these methods enabled us to examine some factors controlling the net rate of mercury methylation. The methodologies were field tested, using lake sediment samples from a recently flooded reservoir in the Southern Indian Lake system which had developed a mercury contamination problem in fish. Ratios of the specific rates of methylation/demethylation were calculated. The highest ratios of methylation/demethylation were calculated. The highest ratios of methylation/demethylation occurred in the flooded shorelines of Southern Indian Lake. These results provide an explanation for the observed increases in the methyl mercury concentrations in fish after flooding

A comparison of surveillance methods for small incidence rates

Energy Technology Data Exchange (ETDEWEB)

Sego, Landon H.; Woodall, William H.; Reynolds, Marion R.

2008-05-15

A number of methods have been proposed to detect an increasing shift in the incidence rate of a rare health event, such as a congenital malformation. Among these are the Sets method, two modifcations of the Sets method, and the CUSUM method based on the Poisson distribution. We consider the situation where data are observed as a sequence of Bernoulli trials and propose the Bernoulli CUSUM chart as a desirable method for the surveillance of rare health events. We compare the performance of the Sets method and its modifcations to the Bernoulli CUSUM chart under a wide variety of circumstances. Chart design parameters were chosen to satisfy a minimax criteria.We used the steady- state average run length to measure chart performance instead of the average run length which was used in nearly all previous comparisons involving the Sets method or its modifcations. Except in a very few instances, we found that the Bernoulli CUSUM chart has better steady-state average run length performance than the Sets method and its modifcations for the extensive number of cases considered.

Dicty_cDB: Contig-U16181-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available s taurus Y Chr NOVECTOR CH240-507F20 (Children'... 48 0.79 1 ( AC232941 ) Bos taurus Y Chr NOVECTOR CH240-255J15 (Children...'... 48 0.79 1 ( AC232940 ) Bos taurus Y Chr NOVECTOR CH240-62I11 (Children's... 48 0.79 1 ( A...C232929 ) Bos taurus Y Chr NOVECTOR CH240-291F15 (Children'... 48 0.79 1 ( AC232768 ) Bos taurus Y Chr NOVECTOR CH240-460C15 (Childre...n'... 48 0.79 1 ( AC232755 ) Bos taurus Y Chr NOVECTOR CH240-409J7 (Children...'s... 48 0.79 1 ( AC232753 ) Bos taurus Y Chr NOVECTOR CH240-45P20 (Children's... 48 0.7

Trends in Suicide Methods and Rates among Older Adults in South Korea: A Comparison with Japan.

Science.gov (United States)

Park, Subin; Lee, Hochang Benjamin; Lee, Su Yeon; Lee, Go Eun; Ahn, Myung Hee; Yi, Ki Kyoung; Hong, Jin Pyo

2016-03-01

Lethality of the chosen method during a suicide attempt is a strong risk factor for completion of suicide. We examined whether annual changes in the pattern of suicide methods is related to annual changes in suicide rates among older adults in South Korea and Japan. We analyzed annual the World Health Organization data on rates and methods of suicide from 2000 to 2011 in South Korea and Japan. For Korean older adults, there was a significant positive correlation between suicide rate and the rate of hanging or the rate of jumping, and a significant negative correlation between suicide rate and the rate of poisoning. Among older adults in Japan, annual changes in the suicide rate and the pattern of suicide methods were less conspicuous, and no correlation was found between them. The results of the present study suggest that the increasing use of lethal suicide methods has contributed to the rise in suicide rates among older adults in South Korea. Targeted efforts to reduce the social acceptability and accessibility of lethal suicide methods might lead to lower suicide rate among older adults in South Korea.

Om Chr. Petersen

DEFF Research Database (Denmark)

Rasborg, Klaus

1992-01-01

Om en i dag næsten glemt skikkelse i dansk sociologi, der i sin samtid især blev kendt for sin doktordisputats om den franske sociolog Émile Durkheim......Om en i dag næsten glemt skikkelse i dansk sociologi, der i sin samtid især blev kendt for sin doktordisputats om den franske sociolog Émile Durkheim...

In situ feeding rates of plantonic copepods: A comparison of four methods

DEFF Research Database (Denmark)

Kiørboe, Thomas; Møhlenberg, Flemming; Riisgård, Hans Ulrik

1985-01-01

into estimates of in situ algal grazing rates by means of independently estimated gut turnover times, and were compared with chlorophyll and particle-volume grazing rates of animals sampled simultaneously and incubated in water from the collection depth. In addition, egg-production rates of adult females were...... problems of the different methods are discussed, and it is concluded that they all approach representative (although minimum) estimates of in situ feeding rates....

Can We Predict Psychosis Outside the Clinical High-Risk State? A Systematic Review of Non-Psychotic Risk Syndromes for Mental Disorders

Science.gov (United States)

Lee, Tae Young; Lee, Junhee; Kim, Minah; Choe, Eugenie

2018-01-01

Abstract Recent evidence has suggested that psychosis could develop not only in people at clinical high risk for psychosis (CHR-P) but also in those with clinical risk syndromes for emergent nonpsychotic mental disorders. The proportion of people with these clinical risk syndromes who will develop psychosis rather than to other nonpsychotic mental disorders is undetermined. Electronic databases were searched for studies reporting on clinical risk syndromes for the development of emergent nonpsychotic mental disorders. Incidence of emerging psychotic and nonpsychotic mental disorders defined on the ICD or DSM. Of a total of 9 studies relating to 3006 nonpsychotic at-risk individuals were included. Within prospective studies (n = 4, sample = 1051), the pooled incidence of new psychotic disorders across these clinical risk syndromes was of 12.9 per 1000 person-years (95% CI: 4.3 to 38.6) and that of nonpsychotic disorders (n = 3, sample = 538) was of 43.5 per 1000 person-years (95% CI: 30.9 to 61.3). Psychotic disorders may emerge outside the CHR-P paradigm, from clinical risk syndromes for incident nonpsychotic disorders, albeit at lower rates than in the CHR-P group. The clinical risk syndromes for emerging nonpsychotic disorders may exhibit a pluripotential risk of developing several types of mental disorders compared with CHR-P. If substantiated by future research, the current findings suggest that it may be useful to move beyond the current strategy of identifying individuals meeting CHR-P criteria only. PMID:29438561

Comparing methods for measuring the rate of spread of invading populations

Science.gov (United States)

Marius Gilbert; Andrew. Liebhold

2010-01-01

Measuring rates of spread during biological invasions is important for predicting where and when invading organisms will spread in the future as well as for quantifying the influence of environmental conditions on invasion speed. While several methods have been proposed in the literature to measure spread rates, a comprehensive comparison of their accuracy when applied...

Neurophysiological differences between patients clinically at high risk for schizophrenia and neurotypical controls--first steps in development of a biomarker.

Science.gov (United States)

Duffy, Frank H; D'Angelo, Eugene; Rotenberg, Alexander; Gonzalez-Heydrich, Joseph

2015-11-02

Schizophrenia is a severe, disabling and prevalent mental disorder without cure and with a variable, incomplete pharmacotherapeutic response. Prior to onset in adolescence or young adulthood a prodromal period of abnormal symptoms lasting weeks to years has been identified and operationalized as clinically high risk (CHR) for schizophrenia. However, only a minority of subjects prospectively identified with CHR convert to schizophrenia, thereby limiting enthusiasm for early intervention(s). This study utilized objective resting electroencephalogram (EEG) quantification to determine whether CHR constitutes a cohesive entity and an evoked potential to assess CHR cortical auditory processing. This study constitutes an EEG-based quantitative neurophysiological comparison between two unmedicated subject groups: 35 neurotypical controls (CON) and 22 CHR patients. After artifact management, principal component analysis (PCA) identified EEG spectral and spectral coherence factors described by associated loading patterns. Discriminant function analysis (DFA) determined factors' discrimination success between subjects in the CON and CHR groups. Loading patterns on DFA-selected factors described CHR-specific spectral and coherence differences when compared to controls. The frequency modulated auditory evoked response (FMAER) explored functional CON-CHR differences within the superior temporal gyri. Variable reduction by PCA identified 40 coherence-based factors explaining 77.8% of the total variance and 40 spectral factors explaining 95.9% of the variance. DFA demonstrated significant CON-CHR group difference (P <0.00001) and successful jackknifed subject classification (CON, 85.7%; CHR, 86.4% correct). The population distribution plotted along the canonical discriminant variable was clearly bimodal. Coherence factors delineated loading patterns of altered connectivity primarily involving the bilateral posterior temporal electrodes. However, FMAER analysis showed no CON-CHR

Asymmetric electrochemical supercapacitor, based on polypyrrole coated carbon nanotube electrodes

International Nuclear Information System (INIS)

Su, Y.; Zhitomirsky, I.

2015-01-01

Highlights: • Polypyrrole (PPy) coated multiwalled carbon nanotubes (MWCNT) were prepared. • New method is based on the use of new electrochemically active dopants for PPy. • The dopans provided dispersion of MWCNT and promoted PPy coating formation. • Symmetric PPy–MWCNT supercapacitors showed high capacitance and low resistance. • Asymmetric PPy–MWCNT/VN–MWCNT devices and modules allowed larger voltage window. - Abstract: Conductive polypyrrole (PPy) polymer – multiwalled carbon nanotubes (MWCNT) composites were synthesized using sulfanilic acid azochromotrop (SPADNS) and sulfonazo III sodium salt (CHR-BS) as anionic dopants for chemical polymerization of PPy. The composites were tested for application in electrodes of electrochemical supercapacitors (ES). Sedimentation tests, electrophoretic deposition experiments and Fourier transform infrared spectroscopy (FTIR) investigations showed that strong adsorption of anionic CHR-BS on MWCNT provided MWCNT dispersion. The analysis of scanning and transmission electron microscopy data demonstrated that the use of CHR-BS allowed the formation of PPy coatings on MWCNT. As a result, the composites, prepared using CHR-BS, showed higher capacitance, compared to the composites, prepared using SPADNS. The electrodes, containing MWCNT, coated with PPy showed a capacitance of 179 F g −1 for active mass loading of 10 mg cm −2 , good capacitance retention at scan rates in the range of 2–100 mV s −1 and excellent cyclic stability. Asymmetric ES devices, containing positive PPy–MWCNT electrodes and negative vanadium nitride (VN)–MWCNT electrodes showed significant improvement in energy storage performance, compared to the symmetric ES due to the larger voltage window. The low impedance and high capacitance of the individual cells paved the way to the development of modules with higher voltage, which showed good electrochemical performance

Prospects for DNA methods to measure human heritable mutation rates

International Nuclear Information System (INIS)

Mendelsohn, M.L.

1985-01-01

A workshop cosponsored by ICPEMC and the US Department of Energy was held in Alta, Utah, December 9-13, 1984 to examine the extent to which DNA-oriented methods might provide new approaches to the important but intractable problem of measuring mutation rates in control and exposed human populations. The workshop identified and analyzed six DNA methods for detection of human heritable mutation, including several created at the meeting, and concluded that none of the methods combine sufficient feasibility and efficiency to be recommended for general application. 8 refs

Measurements of μ capture rates in liquid hydrogen by the lifetime method

International Nuclear Information System (INIS)

Martino, Jacques.

1982-04-01

The μ capture reaction is a weak interaction. It can be observed as a result of the formation of muonic atoms for which the overlopping of the wave functions of the muon and nucleus is a maximum in the 1s state. The production of this (μp) bound state leads to a capture rate in relatively favorable competition with the disintegration rate. The capture rate for a pulsed muon beam (from the Saclay linear accelerator) was measured in liquid hydrogen by the lifetime method. The method and experimental equipment used for the lifetime measurements are described together with the different sources of systematic error and the results obtained. The interpretation of these results is discussed [fr

Ballistic deficit correction methods for large Ge detectors-high counting rate study

International Nuclear Information System (INIS)

Duchene, G.; Moszynski, M.

1995-01-01

This study presents different ballistic correction methods versus input count rate (from 3 to 50 kcounts/s) using four large Ge detectors of about 70 % relative efficiency. It turns out that the Tennelec TC245 linear amplifier in the BDC mode (Hinshaw method) is the best compromise for energy resolution throughout. All correction methods lead to narrow sum-peaks indistinguishable from single Γ lines. The full energy peak throughput is found representative of the pile-up inspection dead time of the corrector circuits. This work also presents a new and simple representation, plotting simultaneously energy resolution and throughput versus input count rate. (TEC). 12 refs., 11 figs

Function of C-terminal hydrophobic region in fructose dehydrogenase

International Nuclear Information System (INIS)

Sugimoto, Yu; Kawai, Shota; Kitazumi, Yuki; Shirai, Osamu; Kano, Kenji

2015-01-01

Fructose dehydrogenase (FDH) catalyzes oxidation of D-fructose into 2-keto-D-fructose and is one of the enzymes allowing a direct electron transfer (DET)-type bioelectrocatalysis. FDH is a heterotrimeric membrane-bound enzyme (subunit I, II, and III) and subunit II has a C terminal hydrophobic region (CHR), which was expected to play a role in anchoring to membranes from the amino acid sequence. We have constructed a mutated FDH lacking of CHR (ΔchrFDH). Contrary to the expected function of CHR, ΔchrFDH is expressed in the membrane fraction, and subunit I/III subcomplex (ΔcFDH) is also expressed in a similar activity level but in the soluble fraction. In addition, the enzyme activity of the purified ΔchrFDH is about one twentieth of the native FDH. These results indicate that CHR is concerned with the binding between subunit I(/III) and subunit II and then with the enzyme activity. ΔchrFDH has clear DET activity that is larger than that expected from the solution activity, and the characteristics of the catalytic wave of ΔchrFDH are very similar to those of FDH. The deletion of CHR seems to increase the amounts of the enzyme with the proper orientation for the DET reaction at electrode surfaces. Gel filtration chromatography coupled with urea treatment shows that the binding in ΔchrFDH is stronger than that in FDH. It can be considered that the rigid binding between subunit I(/III) and II without CHR results in a conformation different from the native one, which leads to the decrease in the enzyme activity in solution

Comparison on different repetition rate locking methods in Er-doped fiber laser

Science.gov (United States)

Yang, Kangwen; Zhao, Peng; Luo, Jiang; Huang, Kun; Hao, Qiang; Zeng, Heping

2018-05-01

We demonstrate a systematic comparative research on the all-optical, mechanical and opto-mechanical repetition rate control methods in an Er-doped fiber laser. A piece of Yb-doped fiber, a piezoelectric transducer and an electronic polarization controller are simultaneously added in the laser cavity as different cavity length modulators. By measuring the cavity length tuning ranges, the output power fluctuations, the temporal and frequency repetition rate stability, we show that all-optical method introduces the minimal disturbances under current experimental condition.

From lumping to splitting and back again: Atypical social and language development in individuals with clinical-high-risk for psychosis, first episode schizophrenia, and autism spectrum disorders

Science.gov (United States)

Solomon, Marjorie; Olsen, Emily; Niendam, Tara; Ragland, J. Daniel; Yoon, Jong; Minzenberg, Michael; Carter, Cameron S.

2011-01-01

Objective Individuals with autism and schizophrenia exhibit atypical language and social symptoms. The extent to which these symptoms are evident during development and in current functioning is unclear. Method Three groups of patients aged 11–20 diagnosed as clinical-high-risk for psychosis (CHR; n = 15), first episode psychosis (FEP; n = 16), and autism spectrum disorders (ASD; n = 20), plus typically developing individuals (TYP; n = 20) were compared on common autism parent-report questionnaires assessing social and language development and current functioning including the Social Communication Questionnaire, the Children’s Communication Checklist, and the Social Reciprocity Scale. Results All clinical groups demonstrated atypical social and language development, with social impairment highest in ASD. Twenty percent of participants with CHR and FEP met diagnostic criteria for ASD as assessed by parent-report. ASD exhibited greater current syntactic, and pragmatic language symptoms including delayed echolalia, pedantic speech, and deficits in appreciating irony and sarcasm. All clinical groups exhibited current deficits in social functioning. CHR and FE had similar and intermediate levels of functioning relative to ASD and TYP, with CHR generally scoring closer to TYP, providing construct validity for the CHR diagnostic label. Conclusions The results of this study suggest that ASDs, CHR, and FEP share common features of atypical neurodevelopment of language and social function. Evidence of impaired social reciprocity across both disorders and distinct language symptoms in ASDs provides important information for differential diagnosis and psychosis prevention, as well as leads for future investigations of comparative genetics and pathophysiology. PMID:21458242

A Fast Soft Bit Error Rate Estimation Method

Directory of Open Access Journals (Sweden)

Ait-Idir Tarik

2010-01-01

Full Text Available We have suggested in a previous publication a method to estimate the Bit Error Rate (BER of a digital communications system instead of using the famous Monte Carlo (MC simulation. This method was based on the estimation of the probability density function (pdf of soft observed samples. The kernel method was used for the pdf estimation. In this paper, we suggest to use a Gaussian Mixture (GM model. The Expectation Maximisation algorithm is used to estimate the parameters of this mixture. The optimal number of Gaussians is computed by using Mutual Information Theory. The analytical expression of the BER is therefore simply given by using the different estimated parameters of the Gaussian Mixture. Simulation results are presented to compare the three mentioned methods: Monte Carlo, Kernel and Gaussian Mixture. We analyze the performance of the proposed BER estimator in the framework of a multiuser code division multiple access system and show that attractive performance is achieved compared with conventional MC or Kernel aided techniques. The results show that the GM method can drastically reduce the needed number of samples to estimate the BER in order to reduce the required simulation run-time, even at very low BER.

Neutron spectra determination methods using the measured reaction rates in SAPIS

International Nuclear Information System (INIS)

Bondars, Kh.Ya.; Lapenas, A.A.

1980-01-01

Mathematical basis of algorithms is given for methods of neutron spectra restoration in accordance with the measured reaction rates of the activation detectors included into the information-determination system SAIPS aimed at generalization of the most popular home and foreign neutron spectra determination methods as well as the establishment of their mutual relations. The following neutron spectra determination methods are described: SAND-II, CRYSTAL BALL, WINDOWS, SPECTRA, RESP, JUL; polynominal and directed divergence methods. The algorithms have been realized on the ES computer

Development of a Self-Rated Mixed Methods Skills Assessment: The NIH Mixed Methods Research Training Program for the Health Sciences

Science.gov (United States)

Guetterman, Timothy C.; Creswell, John W.; Wittink, Marsha; Barg, Fran K.; Castro, Felipe G.; Dahlberg, Britt; Watkins, Daphne C.; Deutsch, Charles; Gallo, Joseph J.

2017-01-01

Introduction Demand for training in mixed methods is high, with little research on faculty development or assessment in mixed methods. We describe the development of a Self-Rated Mixed Methods Skills Assessment and provide validity evidence. The instrument taps six research domains: “Research question,” “Design/approach,” “Sampling,” “Data collection,” “Analysis,” and “Dissemination.” Respondents are asked to rate their ability to define or explain concepts of mixed methods under each domain, their ability to apply the concepts to problems, and the extent to which they need to improve. Methods We administered the questionnaire to 145 faculty and students using an internet survey. We analyzed descriptive statistics and performance characteristics of the questionnaire using Cronbach’s alpha to assess reliability and an ANOVA that compared a mixed methods experience index with assessment scores to assess criterion-relatedness. Results Internal consistency reliability was high for the total set of items (.95) and adequate (>=.71) for all but one subscale. Consistent with establishing criterion validity, respondents who had more professional experiences with mixed methods (e.g., published a mixed methods paper) rated themselves as more skilled, which was statistically significant across the research domains. Discussion This Self-Rated Mixed Methods Assessment instrument may be a useful tool to assess skills in mixed methods for training programs. It can be applied widely at the graduate and faculty level. For the learner, assessment may lead to enhanced motivation to learn and training focused on self-identified needs. For faculty, the assessment may improve curriculum and course content planning. PMID:28562495

Measuring Protein Synthesis Rate In Living Object Using Flooding Dose And Constant Infusion Methods

OpenAIRE

Ulyarti, Ulyarti

2018-01-01

Constant infusion is a method used for measuring protein synthesis rate in living object which uses low concentration of amino acid tracers. Flooding dose method is another technique used to measure the rate of protein synthesis which uses labelled amino acid together with large amount of unlabelled amino acid.  The latter method was firstly developed to solve the problem in determination of precursor pool arise from constant infusion method.  The objective of this writing is to com...

Dose rate reduction method for NMCA applied BWR plants

International Nuclear Information System (INIS)

Nagase, Makoto; Aizawa, Motohiro; Ito, Tsuyoshi; Hosokawa, Hideyuki; Varela, Juan; Caine, Thomas

2012-09-01

BRAC (BWR Radiation Assessment and Control) dose rate is used as an indicator of the incorporation of activated corrosion by products into BWR recirculation piping, which is known to be a significant contributor to dose rate received by workers during refueling outages. In order to reduce radiation exposure of the workers during the outage, it is desirable to keep BRAC dose rates as low as possible. After HWC was adopted to reduce IGSCC, a BRAC dose rate increase was observed in many plants. As a countermeasure to these rapid dose rate increases under HWC conditions, Zn injection was widely adopted in United States and Europe resulting in a reduction of BRAC dose rates. However, BRAC dose rates in several plants remain high, prompting the industry to continue to investigate methods to achieve further reductions. In recent years a large portion of the BWR fleet has adopted NMCA (NobleChem TM ) to enhance the hydrogen injection effect to suppress SCC. After NMCA, especially OLNC (On-Line NobleChem TM ), BRAC dose rates were observed to decrease. In some OLNC applied BWR plants this reduction was observed year after year to reach a new reduced equilibrium level. This dose rate reduction trends suggest the potential dose reduction might be obtained by the combination of Pt and Zn injection. So, laboratory experiments and in-plant tests were carried out to evaluate the effect of Pt and Zn on Co-60 deposition behaviour. Firstly, laboratory experiments were conducted to study the effect of noble metal deposition on Co deposition on stainless steel surfaces. Polished type 316 stainless steel coupons were prepared and some of them were OLNC treated in the test loop before the Co deposition test. Water chemistry conditions to simulate HWC were as follows: Dissolved oxygen, hydrogen and hydrogen peroxide were below 5 ppb, 100 ppb and 0 ppb (no addition), respectively. Zn was injected to target a concentration of 5 ppb. The test was conducted up to 1500 hours at 553 K. Test

76 FR 38281 - Federal Employees Health Benefits Program: New Premium Rating Method for Most Community Rated...

Science.gov (United States)

2011-06-29

... CFR Parts 1602, 1615, et al. Federal Employees Health Benefits Program: New Premium Rating Method for... Part 890; 48 CFR Parts 1602, 1615, 1632, and 1652 RIN 3206-AM39 Federal Employees Health Benefits..., 2011 (76 FR 36857). The document amends the Federal Employees Health Benefits (FEHB) regulations at 5...

Bright-field in situ hybridization for HER2 gene amplification in breast cancer using tissue microarrays: correlation between chromogenic (CISH) and automated silver-enhanced (SISH) methods with patient outcome.

Science.gov (United States)

Francis, Glenn D; Jones, Mark A; Beadle, Geoffrey F; Stein, Sandra R

2009-06-01

HER2 gene amplification or overexpression occurs in 15% to 25% of breast cancers and has implications for treatment and prognosis. The most commonly used methods for HER2 testing are fluorescence in situ hybridization (FISH) and immunohistochemistry. FISH is considered to be the reference standard and more accurately predicts response to trastuzumab, but is technically demanding, expensive, and requires specialized equipment. In situ hybridization is required to be eligible for adjuvant treatment with trastuzumab in Australia. Bright-field in situ hybridization is an alternative to FISH and uses a combination of in situ methodology and a peroxidase-mediated chromogenic substrate such as diaminobenzidine [chromogenic in situ hybridization (CISH)] or multimer technology coupled with enzyme metallography [silver-enhanced in situ hybridization (SISH)] to create a marker visible under bright-field microscopy. CISH was introduced into diagnostic testing in Australia in October 2006. SISH methodology is a more recent introduction into the testing repertoire. An evaluation of CISH and SISH performance to assess patient outcome were performed using tissue microarrays. Tissue microarrays were constructed in duplicate using material from 593 patients with invasive breast carcinoma and assessed using CISH and SISH. Gene amplification was assessed using the American Society of Clinical Oncology/College of American Pathologists guideline and Australian HER2 Advisory Board criteria (single probe: diploid, 1 to 2.5 copies/nucleus; polysomy >2.5 to 4 copies/nucleus; equivocal, >4 to 6 copies/nucleus; low-level amplification, >6 to 10 copies/nucleus and high-level amplification >10 copies/nucleus; dual probe HER2/CHR17 ratio: nonamplified 2.2). Results were informative for 337 tissue cores comprising 230 patient samples. Concordance rates were 96% for HER2 single probe CISH and SISH and 95.5% for single probe CISH and dual probe HER2/CHR17 SISH. Both bright-field methods correlated

De l’utopie socialiste au réalisme chrétien

Directory of Open Access Journals (Sweden)

Isabelle Richet

2006-03-01

Full Text Available Le New Deal est le premier mouvement réformiste d’ampleur dans l’histoire des Etats‑Unis qui n’ait pas été inspiré, ni soutenu, par les forces du protestantisme. Si une majorité des protestants et de leur clergé se sont opposés au New Deal à partir de positions conservatrices, le théologien Reinhold Niebuhr en a développé au départ une virulente critique de gauche avant de finalement rallier le président démocrate à la fin des années trente. Nourrie par le rejet de l’idéalisme du Social Gospel, incapable à ses yeux de comprendre les rapports sociaux en terme de classe et de pouvoir, la critique de Niebuhr emprunte les outils d’analyse marxistes pour développer une approche réaliste, tant du point de vue des fins que des moyens de la lutte politique. Le New Deal lui apparaît avant tout comme un programme visant à sauver le capitalisme, alors que la société fondée sur la justice qu’il envisage passe par la socialisation des moyens de production qui ne pourra émerger qu’à travers des conflits sociaux au cours desquels les moyens de lutte même violents sont justifiés. Mais sous l’influence des évènements en Europe au lendemain de la victoire d’Hitler, Reinhold Niebuhr se tourne au milieu des années trente vers une réflexion théologique inspirée de l’orthodoxie de Karl Barth et de son frère Richard Niebuhr, qui l’amène à réintroduire le péché comme la limite absolue de toute l’expérience humaine, interdisant d’envisager la création d’une société de paix et de justice. Ce nouvel absolutisme théologique nourrit un relativisme politique, le réalisme chrétien consistant désormais à choisir la moins mauvaise des options en présence. De ce point de vue, le président démocrate qui appelle à la préparation militaire s’impose désormais comme le choix le plus réaliste face à la montée du fascisme en Europe.The New Deal was the first major reformist experiment in the

Neutron Scattering in Hydrogenous Moderators, Studied by Time Dependent Reaction Rate Method

Energy Technology Data Exchange (ETDEWEB)

Larsson, L G; Moeller, E; Purohit, S N

1966-03-15

The moderation and absorption of a neutron burst in water, poisoned with the non-1/v absorbers cadmium and gadolinium, has been followed on the time scale by multigroup calculations, using scattering kernels for the proton gas and the Nelkin model. The time dependent reaction rate curves for each absorber display clear differences for the two models, and the separation between the curves does not depend much on the absorber concentration. An experimental method for the measurement of infinite medium reaction rate curves in a limited geometry has been investigated. This method makes the measurement of the time dependent reaction rate generally useful for thermalization studies in a small geometry of a liquid hydrogenous moderator, provided that the experiment is coupled to programs for the calculation of scattering kernels and time dependent neutron spectra. Good agreement has been found between the reaction rate curve, measured with cadmium in water, and a calculated curve, where the Haywood kernel has been used.

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp.

Science.gov (United States)

Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong

2015-03-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp

Science.gov (United States)

DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG

2015-01-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630

Tensile strength of concrete under static and intermediate strain rates: Correlated results from different testing methods

International Nuclear Information System (INIS)

Wu Shengxing; Chen Xudong; Zhou Jikai

2012-01-01

Highlights: ► Tensile strength of concrete increases with increase in strain rate. ► Strain rate sensitivity of tensile strength of concrete depends on test method. ► High stressed volume method can correlate results from various test methods. - Abstract: This paper presents a comparative experiment and analysis of three different methods (direct tension, splitting tension and four-point loading flexural tests) for determination of the tensile strength of concrete under low and intermediate strain rates. In addition, the objective of this investigation is to analyze the suitability of the high stressed volume approach and Weibull effective volume method to the correlation of the results of different tensile tests of concrete. The test results show that the strain rate sensitivity of tensile strength depends on the type of test, splitting tensile strength of concrete is more sensitive to an increase in the strain rate than flexural and direct tensile strength. The high stressed volume method could be used to obtain a tensile strength value of concrete, free from the influence of the characteristics of tests and specimens. However, the Weibull effective volume method is an inadequate method for describing failure of concrete specimens determined by different testing methods.

Automated brightfield dual-color in situ hybridization for detection of mouse double minute 2 gene amplification in sarcomas.

Science.gov (United States)

Zhang, Wenjun; McElhinny, Abigail; Nielsen, Alma; Wang, Maria; Miller, Melanie; Singh, Shalini; Rueger, Ruediger; Rubin, Brian P; Wang, Zhen; Tubbs, Raymond R; Nagle, Raymond B; Roche, Pat; Wu, Ping; Pestic-Dragovich, Lidija

2011-01-01

of CHR12 without net MDM2 amplifications. These results show that the use of the ISH MDM2 and CHR12 assay allows simultaneous analyses of the 2 DNA targets within the context of tissue morphology. This method combines the advantages of a fully automated protocol with bright field microscopy and has the potential for routine application in surgical pathology.

Excessive leakage measurement using pressure decay method in containment building local leakage rate test at nuclear power plant

Energy Technology Data Exchange (ETDEWEB)

Lee, Won Kyu; Kim, Chang Soo; Kim, Wang Bae [KHNP, Central Research Institute, Daejeon (Korea, Republic of)

2016-06-15

There are two methods for conducting the containment local leakage rate test (LLRT) in nuclear power plants: the make-up flow rate method and the pressure decay method. The make-up flow rate method is applied first in most power plants. In this method, the leakage rate is measured by checking the flow rate of the make-up flow. However, when it is difficult to maintain the test pressure because of excessive leakage, the pressure decay method can be used as a complementary method, as the leakage rates at pressures lower than normal can be measured using this method. We studied the method of measuring over leakage using the pressure decay method for conducting the LLRT for the containment building at a nuclear power plant. We performed experiments under conditions similar to those during an LLRT conducted on-site. We measured the characteristics of the leakage rate under varies pressure decay conditions, and calculated the compensation ratio based on these data.

Chromosome Y variants from different inbred mouse strains are linked to differences in the morphologic and molecular responses of cardiac cells to postpubertal testosterone

Directory of Open Access Journals (Sweden)

Churchill Gary A

2009-04-01

Full Text Available Abstract Background We have reported previously that when chromosome Y (chrY from the mouse strain C57BL/6J (ChrYC57 was substituted for that of A/J mice (ChrYA, cardiomyocytes from the resulting "chromosome substitution" C57BL/6J-chrYA strain were smaller than that of their C57BL/6J counterparts. In reverse, when chrYA from A/J mice was substituted for that of chrYC57, cardiomyocytes from the resulting A/J-chrYC57 strain were larger than in their A/J counterparts. We further used these strains to test whether: 1 the origin of chrY could also be linked to differences in the profile of gene expression in the hearts of adult male mice, and 2 post-pubertal testosterone could play a role in the differential morphologic and/or molecular effects of chrYC57 and chrYA. Results The increased size of cardiomyocytes from adult male C57BL/6J mice compared to C57BL/6J-chrYA resulted from the absence of hypertrophic effects of post-pubertal testosterone on cells from the latter strain. However, gene profiling revealed that the latter effect could not be explained on the basis of an insensitivity of cells from C57BL/6J-chrYA to androgens, since even more cardiac genes were affected by post-pubertal testosterone in C57BL/6J-chrYA hearts than in C57BL/6J. By testing for interaction between the effects of surgery and strain, we identified 249 "interaction genes" whose expression was affected by post-pubertal testosterone differentially according to the genetic origin of chrY. These interaction genes were found to be enriched within a limited number of signaling pathways, including: 1 p53 signaling, which comprises the interacting genes Ccnd1, Pten and Cdkn1a that are also potential co-regulators of the androgen receptors, and 2 circadian rhythm, which comprises Arntl/Bmal1, which may in turn regulate cell growth via the control of Cdkn1a. Conclusion Although post-pubertal testosterone increased the size of cardiomyocytes from male C56BL/6J mice but not that from

Comparison between calculation methods of dose rates in gynecologic brachytherapy

International Nuclear Information System (INIS)

Vianello, E.A.; Biaggio, M.F.; D R, M.F.; Almeida, C.E. de

1998-01-01

In treatments with radiations for gynecologic tumors is necessary to evaluate the quality of the results obtained by different calculation methods for the dose rates on the points of clinical interest (A, rectal, vesicle). The present work compares the results obtained by two methods. The Manual Calibration Method (MCM) tri dimensional (Vianello E., et.al. 1998), using orthogonal radiographs for each patient in treatment, and the Theraplan/T P-11 planning system (Thratonics International Limited 1990) this last one verified experimentally (Vianello et.al. 1996). The results show that MCM can be used in the physical-clinical practice with a percentile difference comparable at the computerized programs. (Author)

77 FR 31756 - Energy Conservation Program: Alternative Efficiency Determination Methods and Alternative Rating...

Science.gov (United States)

2012-05-30

...-AC46 Energy Conservation Program: Alternative Efficiency Determination Methods and Alternative Rating... regulations authorizing the use of alternative methods of determining energy efficiency or energy consumption... alternative methods of determining energy efficiency or energy consumption of various consumer products and...

Seeding method and rate influence on weed suppression in aerobic ...

African Journals Online (AJOL)

High weed pressure is amongst the major constraints to the extensive adoption of aerobic rice system as a water-wise technique. Towards developing a sustainable weed management strategy, seeding method and rate may substantially contribute to weed suppression and reduce herbicide use and weeding cost. A trough ...

THE EFFECT OF EXCHANGE RATE ON THE CONSTRUCTION PROJECTS AND PROTECTION METHODS

Directory of Open Access Journals (Sweden)

Handan AKSUYEK,

2017-02-01

Full Text Available As with all sectors, recent extreme changes occurred in the exchange rates have substantially affected the construction operations. While the rise in foreign exchange rates leads to harmful effects in the negative direction at the operations having foreign exchange – based debt or it provides also advantageous effect in the positive direction at the construction companies having foreign exchange – indexed investments. In this context, this sudden change in foreign exchange rates which cannot be predicted beforehand and emerges as a result of speculative events. As with all operations carrying out foreign exchange – based tasks, these fluctuations in the foreign exchange rate head first among the factors which affect the achievement or failure of the cost or profit targets previously determined by the construction companies as well. Therefore, the companies whose costs and profits consist of different units of currency in their construction agreements should apply to the hedging methods in order to be protected against the exchange rate. As for the main tools of protection method are the derivative products such as forward, futures, swap and optional contracts. In this study, the effect of exchange rate fluctuations on the completion costs of construction projects is scrutinized. Moreover, the tools which may be employed by the construction companies in order to get rid of exchange rate which adversely influence the building companies in both directions have been comparatively evaluated.

Real-time Continuous Assessment Method for Mental and Physiological Condition using Heart Rate Variability

Science.gov (United States)

Yoshida, Yutaka; Yokoyama, Kiyoko; Ishii, Naohiro

It is necessary to monitor the daily health condition for preventing stress syndrome. In this study, it was proposed the method assessing the mental and physiological condition, such as the work stress or the relaxation, using heart rate variability at real time and continuously. The instantanuous heart rate (HR), and the ratio of the number of extreme points (NEP) and the number of heart beats were calculated for assessing mental and physiological condition. In this method, 20 beats heart rate were used to calculate these indexes. These were calculated in one beat interval. Three conditions, which are sitting rest, performing mental arithmetic and watching relaxation movie, were assessed using our proposed algorithm. The assessment accuracies were 71.9% and 55.8%, when performing mental arithmetic and watching relaxation movie respectively. In this method, the mental and physiological condition was assessed using only 20 regressive heart beats, so this method is considered as the real time assessment method.

Sequential multi-nuclide emission rate estimation method based on gamma dose rate measurement for nuclear emergency management

International Nuclear Information System (INIS)

Zhang, Xiaole; Raskob, Wolfgang; Landman, Claudia; Trybushnyi, Dmytro; Li, Yu

2017-01-01

Highlights: • Sequentially reconstruct multi-nuclide emission using gamma dose rate measurements. • Incorporate a priori ratio of nuclides into the background error covariance matrix. • Sequentially augment and update the estimation and the background error covariance. • Suppress the generation of negative estimations for the sequential method. • Evaluate the new method with twin experiments based on the JRODOS system. - Abstract: In case of a nuclear accident, the source term is typically not known but extremely important for the assessment of the consequences to the affected population. Therefore the assessment of the potential source term is of uppermost importance for emergency response. A fully sequential method, derived from a regularized weighted least square problem, is proposed to reconstruct the emission and composition of a multiple-nuclide release using gamma dose rate measurement. The a priori nuclide ratios are incorporated into the background error covariance (BEC) matrix, which is dynamically augmented and sequentially updated. The negative estimations in the mathematical algorithm are suppressed by utilizing artificial zero-observations (with large uncertainties) to simultaneously update the state vector and BEC. The method is evaluated by twin experiments based on the JRodos system. The results indicate that the new method successfully reconstructs the emission and its uncertainties. Accurate a priori ratio accelerates the analysis process, which obtains satisfactory results with only limited number of measurements, otherwise it needs more measurements to generate reasonable estimations. The suppression of negative estimation effectively improves the performance, especially for the situation with poor a priori information, where it is more prone to the generation of negative values.

Sequential multi-nuclide emission rate estimation method based on gamma dose rate measurement for nuclear emergency management

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xiaole, E-mail: zhangxiaole10@outlook.com [Institute for Nuclear and Energy Technologies, Karlsruhe Institute of Technology, Karlsruhe, D-76021 (Germany); Institute of Public Safety Research, Department of Engineering Physics, Tsinghua University, Beijing, 100084 (China); Raskob, Wolfgang; Landman, Claudia; Trybushnyi, Dmytro; Li, Yu [Institute for Nuclear and Energy Technologies, Karlsruhe Institute of Technology, Karlsruhe, D-76021 (Germany)

2017-03-05

Highlights: • Sequentially reconstruct multi-nuclide emission using gamma dose rate measurements. • Incorporate a priori ratio of nuclides into the background error covariance matrix. • Sequentially augment and update the estimation and the background error covariance. • Suppress the generation of negative estimations for the sequential method. • Evaluate the new method with twin experiments based on the JRODOS system. - Abstract: In case of a nuclear accident, the source term is typically not known but extremely important for the assessment of the consequences to the affected population. Therefore the assessment of the potential source term is of uppermost importance for emergency response. A fully sequential method, derived from a regularized weighted least square problem, is proposed to reconstruct the emission and composition of a multiple-nuclide release using gamma dose rate measurement. The a priori nuclide ratios are incorporated into the background error covariance (BEC) matrix, which is dynamically augmented and sequentially updated. The negative estimations in the mathematical algorithm are suppressed by utilizing artificial zero-observations (with large uncertainties) to simultaneously update the state vector and BEC. The method is evaluated by twin experiments based on the JRodos system. The results indicate that the new method successfully reconstructs the emission and its uncertainties. Accurate a priori ratio accelerates the analysis process, which obtains satisfactory results with only limited number of measurements, otherwise it needs more measurements to generate reasonable estimations. The suppression of negative estimation effectively improves the performance, especially for the situation with poor a priori information, where it is more prone to the generation of negative values.

Qualitative and quantitative methods for human factor analysis and assessment in NPP. Investigations and results

International Nuclear Information System (INIS)

Hristova, R.; Kalchev, B.; Atanasov, D.

2005-01-01

We consider here two basic groups of methods for analysis and assessment of the human factor in the NPP area and give some results from performed analyses as well. The human factor is the human interaction with the design equipment, with the working environment and takes into account the human capabilities and limits. In the frame of the qualitative methods for analysis of the human factor are considered concepts and structural methods for classifying of the information, connected with the human factor. Emphasize is given to the HPES method for human factor analysis in NPP. Methods for quantitative assessment of the human reliability are considered. These methods allow assigning of probabilities to the elements of the already structured information about human performance. This part includes overview of classical methods for human reliability assessment (HRA, THERP), and methods taking into account specific information about human capabilities and limits and about the man-machine interface (CHR, HEART, ATHEANA). Quantitative and qualitative results concerning human factor influence in the initiating events occurrences in the Kozloduy NPP are presented. (authors)

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available Samples were stored at 8C after harvest, until analyzed on November. After 24 hours of the cooking, discolouration was evaluated. 1,4,6 ... Chr06 ... 10.1007/s00122-013-2254-y 24408376

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available Samples were stored at 8C after harvest, until analyzed on November. After 24 hours of the cooking, discolouration was evaluated. 1,4,6 ... Chr01 ... 10.1007/s00122-013-2254-y 24408376

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available Samples were stored at 8C after harvest, until analyzed on November. After 24 hours of the cooking, discolouration was evaluated. 1,4,6 ... Chr04 ... 10.1007/s00122-013-2254-y 24408376

Reference Values of Reticulocyte Hemoglobin Content and Their Relation With Other Indicators of Iron Status in Healthy Children.

Science.gov (United States)

López-Ruzafa, Encarnación; Vázquez-López, Maria A; Lendinez-Molinos, Francisco; Poveda-González, Juan; Galera-Martínez, Rafael; Bonillo-Perales, Antonio; Martín-González, Manuel

2016-10-01

Reticulocyte hemoglobin content (CHr) is considered an indicator of functional iron deficiency, but is understudied in children. The goals of this study are to determine the reference intervals for CHr in healthy children, and their relation with iron parameters, erythropoiesis, and individual conditions. A total of 902 children without iron deficiency, aged 1 to 11 years were analyzed in a cross-sectional study. Besides a physical examination of the subjects and a questionnaire completed by their parents, the complete blood count, serum transferrin receptor, ferritin, transferrin saturation, erythrocyte protoporphyrin, serum erythropoietin, C-reactive protein, and CHr levels were measured. Changes in CHr, iron status, and erythropoiesis at different age intervals were analyzed and linear multiple regression was used to identify the factors that determine CHr variability. Mean value obtained for CHr was 30.9±1.8 pg (P2.5-P97.5: 26.9 to 34.3 pg), but the influence of age on CHr (the values increased with age) and on the iron parameters justified the establishment of different reference ranges. In addition to age, nutritional status, hematologic measurements, reticulocytes, transferrin saturation, and erythrocyte protoporphyrin accounted for 39% of CHr variability.

Effect of different rates and methods of benomyl and mancozeb ...

African Journals Online (AJOL)

AJB SERVER

2006-07-22

Jul 22, 2006 ... Field assessment of different rates and methods of three fungicide applications on delay in senescence. (DS) and grain ... Out of 170 species in the genus, V. unguiculata is ... The experiment was conducted at the teaching and research farm of Faculty of Agricultural Sciences, Ladoke Akintola University of.

Concurrent Driving Method with Fast Scan Rate for Large Mutual Capacitance Touch Screens

Directory of Open Access Journals (Sweden)

Mohamed Gamal Ahmed Mohamed

2015-01-01

Full Text Available A novel touch screen control technique is introduced, which scans each frame in two steps of concurrent multichannel driving and differential sensing. The proposed technique substantially increases the scan rate and reduces the ambient noise effectively. It is also extended to a multichip architecture to support excessively large touch screens with great scan rate improvement. The proposed method has been implemented using 0.18 μm CMOS TowerJazz process and tested with FPGA and AFE board connecting a 23-inch touch screen. Experimental results show a scan rate improvement of up to 23.8 times and an SNR improvement of 24.6 dB over the conventional method.

The relations of age and pubertal development with cortisol and daily stress in youth at clinical risk for psychosis.

Science.gov (United States)

Moskow, Danielle M; Addington, Jean; Bearden, Carrie E; Cadenhead, Kristin S; Cornblatt, Barbara A; Heinssen, Robert; Mathalon, Daniel H; McGlashan, Thomas H; Perkins, Diana O; Seidman, Larry J; Tsuang, Ming T; Cannon, Tyrone D; Woods, Scott W; Walker, Elaine F

2016-04-01

Prodromal syndromes often begin in adolescence - a period of neurodevelopmental changes and heightened stress sensitivity. Research has shown elevated stress and cortisol in individuals at clinical high risk (CHR) for psychosis. This cross-sectional study examined relations of age and pubertal status with cortisol and self-reported stress in healthy controls (HCs) and CHR adolescents. It was hypothesized that the relations of age and pubertal stage with cortisol and stress would be more pronounced in CHR youth. Participants were 93 HCs and 348 CHR adolescents from the North American Prodrome Longitudinal Study (NAPLS). At baseline, measures of stress (Daily Stress Inventory - DSI), Tanner stage (TS), and salivary cortisol were obtained. ANCOVA revealed increased DSI scores with age for both groups, and higher DSI scores in CHR adolescents than HCs, with a more pronounced difference for females. Contrary to prediction, with age controlled, HCs showed greater TS-related DSI increases. Analysis of cortisol showed no significant interactions, but a main effect of age and a trend toward higher cortisol in the CHR group. Correlations of cortisol with TS were higher in HC than CHR group. Stress measures increased with age in HC and CHR adolescents, and DSI scores also increased with TS in HCs. The results do not support a more pronounced age or TS increase in stress measures in CHR adolescents, but instead suggest that stress indices tend to be elevated earlier in adolescence in the CHR group. Potential determinants of findings and future directions are discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of An Optimization Method for Determining Automation Rate in Nuclear Power Plants

International Nuclear Information System (INIS)

Lee, Seung Min; Seong, Poong Hyun; Kim, Jong Hyun

2014-01-01

Since automation was introduced in various industrial fields, it has been known that automation provides positive effects like greater efficiency and fewer human errors, and negative effect defined as out-of-the-loop (OOTL). Thus, before introducing automation in nuclear field, the estimation of the positive and negative effects of automation on human operators should be conducted. In this paper, by focusing on CPS, the optimization method to find an appropriate proportion of automation is suggested by integrating the suggested cognitive automation rate and the concepts of the level of ostracism. The cognitive automation rate estimation method was suggested to express the reduced amount of human cognitive loads, and the level of ostracism was suggested to express the difficulty in obtaining information from the automation system and increased uncertainty of human operators' diagnosis. The maximized proportion of automation that maintains the high level of attention for monitoring the situation is derived by an experiment, and the automation rate is estimated by the suggested automation rate estimation method. It is expected to derive an appropriate inclusion proportion of the automation system avoiding the OOTL problem and having maximum efficacy at the same time

Point and interval forecasts of mortality rates and life expectancy: A comparison of ten principal component methods

Directory of Open Access Journals (Sweden)

Han Lin Shang

2011-07-01

Full Text Available Using the age- and sex-specific data of 14 developed countries, we compare the point and interval forecast accuracy and bias of ten principal component methods for forecasting mortality rates and life expectancy. The ten methods are variants and extensions of the Lee-Carter method. Based on one-step forecast errors, the weighted Hyndman-Ullah method provides the most accurate point forecasts of mortality rates and the Lee-Miller method is the least biased. For the accuracy and bias of life expectancy, the weighted Hyndman-Ullah method performs the best for female mortality and the Lee-Miller method for male mortality. While all methods underestimate variability in mortality rates, the more complex Hyndman-Ullah methods are more accurate than the simpler methods. The weighted Hyndman-Ullah method provides the most accurate interval forecasts for mortality rates, while the robust Hyndman-Ullah method provides the best interval forecast accuracy for life expectancy.

Wavelet denoising method; application to the flow rate estimation for water level control

International Nuclear Information System (INIS)

Park, Gee Young; Park, Jin Ho; Lee, Jung Han; Kim, Bong Soo; Seong, Poong Hyun

2003-01-01

The wavelet transform decomposes a signal into time- and frequency-domain signals and it is well known that a noise-corrupted signal could be reconstructed or estimated when a proper denoising method is involved in the wavelet transform. Among the wavelet denoising methods proposed up to now, the wavelets by Mallat and Zhong can reconstruct best the pure transient signal from a highly corrupted signal. But there has been no systematic way of discriminating the original signal from the noise in a dyadic wavelet transform. In this paper, a systematic method is proposed for noise discrimination, which could be implemented easily into a digital system. For demonstrating the potential role of the wavelet denoising method in the nuclear field, this method is applied to the steam or feedwater flow rate estimation of the secondary loop. And the configuration of the S/G water level control system is proposed for incorporating the wavelet denoising method in estimating the flow rate value at low operating powers

Application of Statistical Methods of Rain Rate Estimation to Data From The TRMM Precipitation Radar

Science.gov (United States)

Meneghini, R.; Jones, J. A.; Iguchi, T.; Okamoto, K.; Liao, L.; Busalacchi, Antonio J. (Technical Monitor)

2000-01-01

The TRMM Precipitation Radar is well suited to statistical methods in that the measurements over any given region are sparsely sampled in time. Moreover, the instantaneous rain rate estimates are often of limited accuracy at high rain rates because of attenuation effects and at light rain rates because of receiver sensitivity. For the estimation of the time-averaged rain characteristics over an area both errors are relevant. By enlarging the space-time region over which the data are collected, the sampling error can be reduced. However. the bias and distortion of the estimated rain distribution generally will remain if estimates at the high and low rain rates are not corrected. In this paper we use the TRMM PR data to investigate the behavior of 2 statistical methods the purpose of which is to estimate the rain rate over large space-time domains. Examination of large-scale rain characteristics provides a useful starting point. The high correlation between the mean and standard deviation of rain rate implies that the conditional distribution of this quantity can be approximated by a one-parameter distribution. This property is used to explore the behavior of the area-time-integral (ATI) methods where fractional area above a threshold is related to the mean rain rate. In the usual application of the ATI method a correlation is established between these quantities. However, if a particular form of the rain rate distribution is assumed and if the ratio of the mean to standard deviation is known, then not only the mean but the full distribution can be extracted from a measurement of fractional area above a threshold. The second method is an extension of this idea where the distribution is estimated from data over a range of rain rates chosen in an intermediate range where the effects of attenuation and poor sensitivity can be neglected. The advantage of estimating the distribution itself rather than the mean value is that it yields the fraction of rain contributed by

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96955 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr08 ... 10.1007/s00122-013-2254-y 24408376

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96953 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr03 ... 10.1007/s00122-013-2254-y 24408376

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96951 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr01 ... 10.1007/s00122-013-2254-y 24408376

Standard test method for measurement of fatigue crack growth rates

CERN Document Server

American Society for Testing and Materials. Philadelphia

2015-01-01

1.1 This test method covers the determination of fatigue crack growth rates from near-threshold to Kmax controlled instability. Results are expressed in terms of the crack-tip stress-intensity factor range (ΔK), defined by the theory of linear elasticity. 1.2 Several different test procedures are provided, the optimum test procedure being primarily dependent on the magnitude of the fatigue crack growth rate to be measured. 1.3 Materials that can be tested by this test method are not limited by thickness or by strength so long as specimens are of sufficient thickness to preclude buckling and of sufficient planar size to remain predominantly elastic during testing. 1.4 A range of specimen sizes with proportional planar dimensions is provided, but size is variable to be adjusted for yield strength and applied force. Specimen thickness may be varied independent of planar size. 1.5 The details of the various specimens and test configurations are shown in Annex A1-Annex A3. Specimen configurations other than t...

Open charcoal chamber method for mass measurements of radon exhalation rate from soil surface

International Nuclear Information System (INIS)

Tsapalov, Andrey; Kovler, Konstantin; Miklyaev, Peter

2016-01-01

Radon exhalation rate from the soil surface can serve as an important criterion in the evaluation of radon hazard of the land. Recently published international standard ISO 11665-7 (2012) is based on the accumulation of radon gas in a closed container. At the same time since 1998 in Russia, as a part of engineering and environmental studies for the construction, radon flux measurements are made using an open charcoal chamber for a sampling duration of 3–5 h. This method has a well-defined metrological justification and was tested in both favorable and unfavorable conditions. The article describes the characteristics of the method, as well as the means of sampling and measurement of the activity of radon absorbed. The results of the metrological study suggest that regardless of the sampling conditions (weather, the mechanism and rate of radon transport in the soil, soil properties and conditions), uncertainty of method does not exceed 20%, while the combined standard uncertainty of radon exhalation rate measured from the soil surface does not exceed 30%. The results of the daily measurements of radon exhalation rate from the soil surface at the experimental site during one year are reported. - Highlights: • Radon exhalation rate from the soil surface area of 32 cm"2 can be measured at level of 10 mBq/(m"2s) at the uncertainty ≤30%. • The method has a metrological justification. • No need to consider climate conditions, soil properties and conditions, mechanism and rate of radon transport in the soil.

Predicting hepatitis B monthly incidence rates using weighted Markov chains and time series methods.

Science.gov (United States)

Shahdoust, Maryam; Sadeghifar, Majid; Poorolajal, Jalal; Javanrooh, Niloofar; Amini, Payam

2015-01-01

Hepatitis B (HB) is a major global mortality. Accurately predicting the trend of the disease can provide an appropriate view to make health policy disease prevention. This paper aimed to apply three different to predict monthly incidence rates of HB. This historical cohort study was conducted on the HB incidence data of Hamadan Province, the west of Iran, from 2004 to 2012. Weighted Markov Chain (WMC) method based on Markov chain theory and two time series models including Holt Exponential Smoothing (HES) and SARIMA were applied on the data. The results of different applied methods were compared to correct percentages of predicted incidence rates. The monthly incidence rates were clustered into two clusters as state of Markov chain. The correct predicted percentage of the first and second clusters for WMC, HES and SARIMA methods was (100, 0), (84, 67) and (79, 47) respectively. The overall incidence rate of HBV is estimated to decrease over time. The comparison of results of the three models indicated that in respect to existing seasonality trend and non-stationarity, the HES had the most accurate prediction of the incidence rates.

Shutdown Dose Rate Analysis Using the Multi-Step CADIS Method

International Nuclear Information System (INIS)

Ibrahim, Ahmad M.; Peplow, Douglas E.; Peterson, Joshua L.; Grove, Robert E.

2015-01-01

The Multi-Step Consistent Adjoint Driven Importance Sampling (MS-CADIS) hybrid Monte Carlo (MC)/deterministic radiation transport method was proposed to speed up the shutdown dose rate (SDDR) neutron MC calculation using an importance function that represents the neutron importance to the final SDDR. This work applied the MS-CADIS method to the ITER SDDR benchmark problem. The MS-CADIS method was also used to calculate the SDDR uncertainty resulting from uncertainties in the MC neutron calculation and to determine the degree of undersampling in SDDR calculations because of the limited ability of the MC method to tally detailed spatial and energy distributions. The analysis that used the ITER benchmark problem compared the efficiency of the MS-CADIS method to the traditional approach of using global MC variance reduction techniques for speeding up SDDR neutron MC calculation. Compared to the standard Forward-Weighted-CADIS (FW-CADIS) method, the MS-CADIS method increased the efficiency of the SDDR neutron MC calculation by 69%. The MS-CADIS method also increased the fraction of nonzero scoring mesh tally elements in the space-energy regions of high importance to the final SDDR

Chronotherapeutic drug delivery systems: an approach to circadian rhythms diseases.

Science.gov (United States)

Sunil, S A; Srikanth, M V; Rao, N Sreenivasa; Uhumwangho, M U; Latha, K; Murthy, K V Ramana

2011-11-01

The purpose of writing this review on chronotherapeutic drug delivery systems (ChrDDs) is to review the literatures with special focus on ChrDDs and the various dosage forms, techniques that are used to target the circadian rhythms (CR) of various diseases. Many functions of the human body vary considerably in a day. ChrDDs refers to a treatment method in which in vivo drug availability is timed to match circadian rhythms of disease in order to optimize therapeutic outcomes and minimize side effects. Several techniques have been developed but not many dosage forms for all the diseases are available in the market. ChrDDs are gaining importance in the field of pharmaceutical technology as these systems reduce dosing frequency, toxicity and deliver the drug that matches the CR of that particular disease when the symptoms are maximum to worse. Finally, the ultimate benefit goes to the patient due the compliance and convenience of the dosage form. Some diseases that follow circadian rhythms include cardiovascular diseases, asthma, arthritis, ulcers, diabetes etc. ChrDDs in the market were also discussed and the current technologies used to formulate were also stated. These technologies include Contin® , Chronotopic®, Pulsincaps®, Ceform®, Timerx®, Oros®, Codas®, Diffucaps®, Egalet®, Tablet in capsule device, Core-in-cup tablet technology. A coated drug-core tablet matrix, A bi-layered tablet, Multiparticulate-based chronotherapeutic drug delivery systems, Chronoset and Controlled release microchips.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT90902 Malus x domestica Rosaceae ... Tensile testing of apple peels_Max force distance Max force... the x-axis corresponding to the maximum force value. 1 ... Chr15 30.7 4.41 ... 10.1093/jxb/erv366 26220084

Optimization of automation: III. Development of optimization method for determining automation rate in nuclear power plants

International Nuclear Information System (INIS)

Lee, Seung Min; Kim, Jong Hyun; Kim, Man Cheol; Seong, Poong Hyun

2016-01-01

Highlights: • We propose an appropriate automation rate that enables the best human performance. • We analyze the shortest working time considering Situation Awareness Recovery (SAR). • The optimized automation rate is estimated by integrating the automation and ostracism rate estimation methods. • The process to derive the optimized automation rate is demonstrated through case studies. - Abstract: Automation has been introduced in various industries, including the nuclear field, because it is commonly believed that automation promises greater efficiency, lower workloads, and fewer operator errors through reducing operator errors and enhancing operator and system performance. However, the excessive introduction of automation has deteriorated operator performance due to the side effects of automation, which are referred to as Out-of-the-Loop (OOTL), and this is critical issue that must be resolved. Thus, in order to determine the optimal level of automation introduction that assures the best human operator performance, a quantitative method of optimizing the automation is proposed in this paper. In order to propose the optimization method for determining appropriate automation levels that enable the best human performance, the automation rate and ostracism rate, which are estimation methods that quantitatively analyze the positive and negative effects of automation, respectively, are integrated. The integration was conducted in order to derive the shortest working time through considering the concept of situation awareness recovery (SAR), which states that the automation rate with the shortest working time assures the best human performance. The process to derive the optimized automation rate is demonstrated through an emergency operation scenario-based case study. In this case study, four types of procedures are assumed through redesigning the original emergency operating procedure according to the introduced automation and ostracism levels. Using the

Identification of novel genes associated with renal tertiary lymphoid organ formation in aging mice.

Science.gov (United States)

Huang, Yuan; Caputo, Christina R; Noordmans, Gerda A; Yazdani, Saleh; Monteiro, Luiz Henrique; van den Born, Jaap; van Goor, Harry; Heeringa, Peter; Korstanje, Ron; Hillebrands, Jan-Luuk

2014-01-01

A hallmark of aging-related organ deterioration is a dysregulated immune response characterized by pathologic leukocyte infiltration of affected tissues. Mechanisms and genes involved are as yet unknown. To identify genes associated with aging-related renal infiltration, we analyzed kidneys from aged mice (≥20 strains) for infiltrating leukocytes followed by Haplotype Association Mapping (HAM) analysis. Immunohistochemistry revealed CD45+ cell clusters (predominantly T and B cells) in perivascular areas coinciding with PNAd+ high endothelial venules and podoplanin+ lymph vessels indicative of tertiary lymphoid organs. Cumulative cluster size increased with age (analyzed at 6, 12 and 20 months). Based on the presence or absence of clusters in male and female mice at 20 months, HAM analysis revealed significant associations with loci on Chr1, Chr2, Chr8 and Chr14 in male mice, and with loci on Chr4, Chr7, Chr13 and Chr14 in female mice. Wisp2 (Chr2) showed the strongest association (P = 5.00×10(-137)) in male mice; Ctnnbip1 (P = 6.42×10(-267)) and Tnfrsf8 (P = 5.42×10(-245)) (both on Chr4) showed the strongest association in female mice. Both Wisp2 and Ctnnbip1 are part of the Wnt-signaling pathway and the encoded proteins were expressed within the tertiary lymphoid organs. In conclusion, this study revealed differential lymphocytic infiltration and tertiary lymphoid organ formation in aged mouse kidneys across different inbred mouse strains. HAM analysis identified candidate genes involved in the Wnt-signaling pathway that may be causally linked to tertiary lymphoid organ formation.

Family Perception and 6-Month Symptomatic and Functioning Outcomes in Young Adolescents at Clinical High Risk for Psychosis in a General Population in China.

Directory of Open Access Journals (Sweden)

Lu Wang

Full Text Available Given the difficulty of treating schizophrenia and other forms of psychosis, researchers have shifted focus to early detection and intervention of individuals at clinical high risk (CHR for psychosis. Previous studies have shown that elements in family functioning could predict symptom outcome in CHR individuals. However, associations between self reported family functioning and symptom or functioning outcome of CHR individuals was rarely reported. Our study aimed to investigate the characteristics and the role of family functioning in the development of CHR individuals among young adolescents.A sample of 32 CHR individuals was recruited from 2800 university students. The characteristics of family perception were evaluated by both Family Assessment Device (FAD and Family cohesion and adaptability evaluation Scale II (FACES II. 6 month follow up data was available with 25 of the recruited CHR individuals. Baseline socio-demographic characteristics and family functioning were compared between CHR and control group. We also measured the associations between different dimensions of perceived family functioning and both severity of prodromal symptoms and global functioning at baseline and 6-month follow up.CHR individuals showed more maladaptive family functioning compared to control in nearly all of the dimensions of FAD and FACES II except for Affective Involvement. Better Problem Solving and Affective Responsiveness predicted less severe positive and negative symptoms respectively. Family cohesion and adaptability were not only correlated with the baseline severity of general symptoms, but also positively associated with the general and disorganized symptom outcome.This study contributed preliminary evidence towards the associations between family perception and symptom outcome of CHR individuals. It also provided evidence for the importance of family interventions on CHR individuals.

Associations between changes in the pattern of suicide methods and rates in Korea, the US, and Finland

Science.gov (United States)

2014-01-01

Background The lethality of the suicide method employed is a strong risk factor for the completion of suicide. We examined whether annual changes in the pattern of suicide methods is related to annual changes in suicide rates in South Korea, the United States (US), and Finland. Methods We analyzed annual data from 2000–2011 for South Korea and Finland, and 2000–2010 for the US in order to examine trends in the rates and methods of suicide. Data on suicide methods were obtained from the World Health Organization (WHO) mortality database. Results Along with an annual rapid increase in suicide rates, the incidence of hanging increased steadily while suicide by self-poisoning steadily decreased in South Korea. In the US, along with an annual increase in suicide rates, the proportion of suicides committed by hanging increased while those committed with the use of firearms steadily decreased. In Finland, annual changes in the suicide rate and suicide method were not statistically significant during the study period. Conclusions Our present findings suggest that the increased use of specific lethal methods for suicide, namely hanging, is reflected in the increased suicide rates in the Korean and the US populations. The most effective approach for reducing overall suicide rates may be the implementation of population-based initiatives that reduce both the accessibility (e.g., access to firearms) and the social acceptability (e.g., effective and responsible regulations for reporting suicide) of lethal methods of suicide. PMID:24949083

A finite element modeling method for predicting long term corrosion rates

International Nuclear Information System (INIS)

Fu, J.W.; Chan, S.

1984-01-01

For the analyses of galvanic corrosion, pitting and crevice corrosion, which have been identified as possible corrosion processes for nuclear waste isolation, a finite element method has been developed for the prediction of corrosion rates. The method uses a finite element mesh to model the corrosive environment and the polarization curves of metals are assigned as the boundary conditions to calculate the corrosion cell current distribution. A subroutine is used to calculate the chemical change with time in the crevice or the pit environments. In this paper, the finite element method is described along with experimental confirmation

The method of treatment cessation and recurrence rate of amblyopia.

Science.gov (United States)

Walsh, Leah A; Hahn, Erik K; LaRoche, G Robert

2009-09-01

To date, much of the research regarding amblyopia has been focused on which therapeutic modality is the most efficacious in amblyopia management. Unfortunately, there is a lack of research into which method of treatment cessation is the most appropriate once therapy has been completed. The purpose of this study is to investigate if the cessation method affects the recurrence rate of amblyopia. This study was a prospective randomized clinical trial of 20 subjects who were wearing full-time occlusion and were at the end point of their therapy. The subjects were randomized into one of two groups: abrupt cessation or therapy tapering. All subjects were followed for 3 consecutive 4-week intervals, for a total of 12 weeks, to assess the short-term recurrence rate of amblyopia. Subjects who were in the tapered group had their occlusion reduced from full-time occlusion (all waking hours minus one) to 50% of waking hours at study enrollment (i.e., from 12 hours/day to 6 hours per day); occlusion was reduced by an additional 50% at the first 4-week study visit (i.e., from 6 hours/day to 3 hours), with occlusion being discontinued completely at the week 8 visit. All subjects who were in the abrupt cessation group had their full-time occlusion discontinued completely at the start of the study (i.e., from 12 hours/day to none). Additional assessments were also conducted at week 26 and week 52 post-therapy cessation to determine the longer term amblyopia regression rate. For the purposes of this study, recurrence was defined as a 0.2 (10 letters) or more logarithm of the minimum angle of resolution (logMAR) loss of visual acuity. A recurrence of amblyopia occurred in 4 of 17 (24%; CI 9%-47%) participants completing the study by the week 52 study end point. There were 2 subjects from each treatment group who demonstrated a study protocol-defined recurrence. There was a 24% risk of amblyopia recurrence if therapy was discontinued abruptly or tapered in 8 weeks. In this small

NDT method in determining the rate of corrosion applicable to risk based inspection

International Nuclear Information System (INIS)

Mohamed Hairul Hasmoni; Mohamad Pauzi Ismail; Ab Razak Hamzah

2004-01-01

Corrosion is a major problem in oil and gas industries, refineries and chemical process plants as the equipment is often exposed to corrosive environments or elevated temperature. Important equipment need to operate safely and reliably to avoid injuries to personnel and the public, and to prevent loss time and cost incurred due to loss of production and shutdown. The paper assess the approach in evaluating the technique of non-destructive testing (NDT) using Ultrasonic Testing (UT) in determining the rate of corrosion and remaining life of equipment applicable to Risk Based Inspection (RBI). Methods in determining the corrosion rate are presented using analytical method. Examples and data from MINT chiller water pipeline are presented to illustrate the application of these methods. (Author)

System and Method for Determining Rate of Rotation Using Brushless DC Motor

Science.gov (United States)

Howard, David E. (Inventor); Smith, Dennis A. (Inventor)

2000-01-01

A system and method are provided for measuring rate of rotation. A brushless DC motor is rotated and produces a back electromagnetic force (emf) on each winding thereof. Each winding's back-emf is squared. The squared outputs associated with each winding are combined, with the square root being taken of such combination, to produce a DC output proportional only to the rate of rotation of the motor's shaft.

Assessing Teachers' Judgements of Students' Academic Motivation and Emotions across Two Rating Methods

Science.gov (United States)

Zhu, Mingjing; Urhahne, Detlef

2014-01-01

The present study examines the accuracy of teachers' judgements about students' motivation and emotions in English learning with two different rating methods. A sample of 480 sixth-grade Chinese students reported their academic self-concept, learning effort, enjoyment, and test anxiety via a questionnaire and were rated on these dimensions by…

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75103 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr06 102.7-108.3 5.59 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75102 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr06 38.9-56.2 3.42 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75104 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr09 100.8-112.7 2.78 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT97962 Solanum tuberosum Solanaceae ... chip color of tuber at normal temperature after cold storage mean val...ue of 2 years 1,3 pPt-536041 ... Chr01 67.8 3.83 ... 10.1007/s11032-015-0415-1 26612975

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT97965 Solanum tuberosum Solanaceae ... chip color of tuber at normal temperature after cold storage mean val...ue of 2 years 1,3 pPt-536863 ... Chr06 75.9 3.84 ... 10.1007/s11032-015-0415-1 26612975

Marker list: QM109927 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available ulation VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109927 Solanum lycopersicum Solanaceae L16L Others ATAGTGTCTACTTCAGGG CCATCAAACAGTTCTCT S. peruvianum pop

Marker list: QM109928 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available GATGGCGTT S. peruvianum population VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109928 Solanum lycopersicum Solanaceae DH8R Others TAGAGAGACTATCCTTTA CACATTCAGT

The evaluation of the statistical monomineral thermobarometric methods for the reconstruction of the lithospheric mantle structure

Science.gov (United States)

Ashchepkov, I.; Vishnyakova, E.

2009-04-01

The modified versions of the thermobarometers for the mantle assemblages were revised sing statistical calibrations on the results of Opx thermobarometry. The modifications suggest the calculation of the Fe# of coexisting olivine Fe#Ol according to the statistical approximations by the regressions obtained from the xenoliths from kimberlite data base including >700 associations. They allow reproduces the Opx based TP estimates and to receive the complete set of the TP values for mantle xenoliths and xenocrysts. For GARNET Three variants of barometer give similar results. The first is published (Ashchepkov, 2006). The second is calculating the Al2O3 from Garnet for Orthopyroxene according to procedure: xCrOpx=Cr2O3/CaO)/FeO/MgO/500 xAlOpx=1/(3875*(exp(Cr2O3^0.2/CaO)-0.3)*CaO/989+16)-XcrOpx Al2O3=xAlOp*24.64/Cr2O3^0.2*CaO/2.+FeO*(ToK-501)/1002 And then it suppose using of the Al2O3 in Opx barometer (McGregor, 1974). The third variant is transformation of the G. Grutter (2006) method by introducing of the influence of temperature. P=40+(Cr2O3)-4.5)*10/3-20/7*CaO+(ToC)*0.0000751*MgO)*CaO+2.45*Cr2O3*(7-xv(5,8)) -Fe*0.5 with the correction for P>55: P=55+(P-55)*55/(1+0.9*P) Average from this three methods give appropriate values comparable with determined with (McGregor,1974) barometer. Temperature are estimating according to transformed Krogh thermometer Fe#Ol_Gar=Fe#Gar/2+(T(K)-1420)*0.000112+0.01 For the deep seated associations P>55 kbar T=T-(0.25/(0.4-0.004*(20-P))-0.38/Ca)*275+51*Ca*Cr2-378*CaO-0.51)-Cr/Ca2*5+Mg/(Fe+0.0001)*17.4 ILMENITE P= ((TiO2-23.)*2.15-(T0-973)/20*MgO*Cr2O3 and next P=(60-P)/6.1+P ToK is determined according to (Taylor et al , 1998) Fe#Ol_Chr =(Fe/(Fe+Mg)ilm -0.35)/2.252-0.0000351*(T(K)-973) CHROMITE The equations for PT estimates with chromite compositions P=Cr/(Cr+Al)*T(K)/14.+Ti*0.10 with the next iteration P=-0.0053*P^2+1.1292*P+5.8059 +0.00135*T(K)*Ti*410-8.2 For P> 57 P=P+(P-57)*2.75 Temperature estimates are according to the O

Neuropsychology of the Prodrome to Psychosis in the NAPLS Consortium: Relationship to Family History and Conversion to Psychosis

Science.gov (United States)

Seidman, Larry J.; Giuliano, Anthony J.; Meyer, Eric C.; Addington, Jean; Cadenhead, Kristin S.; Cannon, Tyrone D.; McGlashan, Thomas H.; Perkins, Diana O.; Tsuang, Ming T.; Walker, Elaine F.; Woods, Scott W.; Bearden, Carrie E.; Christensen, Bruce K.; Hawkins, Keith; Heaton, Robert; Keefe, Richard S. E.; Heinssen, Robert; Cornblatt, Barbara A.

2011-01-01

Context Early detection and prospective evaluation of clinical high-risk (CHR) individuals who may develop schizophrenia or other psychotic disorders is critical for predicting psychosis onset and for testing preventive interventions. Objective To elucidate the neuropsychology of the CHR syndrome, to determine the association of neuropsychological function with conversion to psychosis and family history (FH) of psychosis, and to examine whether baseline neuropsychological functioning predicts subsequent psychosis. Design, Setting, and Participants Longitudinal study with 2 1/2 years follow-up of 304 prospectively identified CHR individuals meeting Structured Interview for Prodromal Syndromes (SIPS) criteria, 52 non-CHR persons with a FH of psychosis in first- or second-degree relatives (“family HR”/FHR), and 193 normal controls with neither a FH of psychosis nor a CHR syndrome, all of whom had baseline neuropsychological evaluations, recruited across eight centers as part of the North American Prodrome Longitudinal Study (NAPLS). Main Measures A neurocognitive composite score, eight individual neuropsychological measures, an IQ estimate, and HR status. Results Global (“composite”) neuropsychological functioning was comparably impaired in CHR and FHR groups compared to controls, but profiles differed significantly between groups. Neuropsychological functioning in the CHR group was significantly lower in persons who progressed to psychosis than in those who did not, and worst in the subgroup with a FH of psychosis. Tests of processing speed and verbal learning and memory were most sensitive in discriminating CHR from controls, although reductions were less severe than in established schizophrenia. Neuropsychological functioning did not contribute uniquely to the prediction of psychosis beyond clinical criteria, but worse verbal memory predicted more rapid conversion. Conclusion These findings document that CHR individuals have significant neuropsychological

Marker list: QM357356 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QM357356 Solanum tuberosum Solanaceae toPt-437059 Others ... CIP703825 ... Chr10 ratio of tuber length to tuber... width trait and eye depth of tuber trait 1 10.1186/s12863-015-0213-0 26024857

Channelrhodopsin-2 localised to the axon initial segment.

Directory of Open Access Journals (Sweden)

Matthew S Grubb

2010-10-01

Full Text Available The light-gated cation channel Channelrhodopsin-2 (ChR2 is a powerful and versatile tool for controlling neuronal activity. Currently available versions of ChR2 either distribute uniformly throughout the plasma membrane or are localised specifically to somatodendritic or synaptic domains. Localising ChR2 instead to the axon initial segment (AIS could prove an extremely useful addition to the optogenetic repertoire, targeting the channel directly to the site of action potential initiation, and limiting depolarisation and associated calcium entry elsewhere in the neuron. Here, we describe a ChR2 construct that we localised specifically to the AIS by adding the ankyrinG-binding loop of voltage-gated sodium channels (Na(vII-III to its intracellular terminus. Expression of ChR2-YFP-Na(vII-III did not significantly affect the passive or active electrical properties of cultured rat hippocampal neurons. However, the tiny ChR2 currents and small membrane depolarisations resulting from AIS targeting meant that optogenetic control of action potential firing with ChR2-YFP-Na(vII-III was unsuccessful in baseline conditions. We did succeed in stimulating action potentials with light in some ChR2-YFP-Na(vII-III-expressing neurons, but only when blocking KCNQ voltage-gated potassium channels. We discuss possible alternative approaches to obtaining precise control of neuronal spiking with AIS-targeted optogenetic constructs and propose potential uses for our ChR2-YFP-Na(vII-III probe where subthreshold modulation of action potential initiation is desirable.

Simplified method of ''push-pull'' test data analysis for determining in situ reaction rate coefficients

International Nuclear Information System (INIS)

Haggerty, R.; Schroth, M.H.; Istok, J.D.

1998-01-01

The single-well, ''''push-pull'''' test method is useful for obtaining information on a wide variety of aquifer physical, chemical, and microbiological characteristics. A push-pull test consists of the pulse-type injection of a prepared test solution into a single monitoring well followed by the extraction of the test solution/ground water mixture from the same well. The test solution contains a conservative tracer and one or more reactants selected to investigate a particular process. During the extraction phase, the concentrations of tracer, reactants, and possible reaction products are measured to obtain breakthrough curves for all solutes. This paper presents a simplified method of data analysis that can be used to estimate a first-order reaction rate coefficient from these breakthrough curves. Rate coefficients are obtained by fitting a regression line to a plot of normalized concentrations versus elapsed time, requiring no knowledge of aquifer porosity, dispersivity, or hydraulic conductivity. A semi-analytical solution to the advective-dispersion equation is derived and used in a sensitivity analysis to evaluate the ability of the simplified method to estimate reaction rate coefficients in simulated push-pull tests in a homogeneous, confined aquifer with a fully-penetrating injection/extraction well and varying porosity, dispersivity, test duration, and reaction rate. A numerical flow and transport code (SUTRA) is used to evaluate the ability of the simplified method to estimate reaction rate coefficients in simulated push-pull tests in a heterogeneous, unconfined aquifer with a partially penetrating well. In all cases the simplified method provides accurate estimates of reaction rate coefficients; estimation errors ranged from 0.1 to 8.9% with most errors less than 5%

Application of accelerated evaluation method of alteration temperature and constant dose rate irradiation on bipolar linear regulator LM317

International Nuclear Information System (INIS)

Deng Wei; Wu Xue; Wang Xin; Zhang Jinxin; Zhang Xiaofu; Zheng Qiwen; Ma Wuying; Lu Wu; Guo Qi; He Chengfa

2014-01-01

With different irradiation methods including high dose rate irradiation, low dose rate irradiation, alteration temperature and constant dose rate irradiation, and US military standard constant high temperature and constant dose rate irradiation, the ionizing radiation responses of bipolar linear regulator LM317 from three different companies were investigated under the operating and zero biases. The results show that compared with constant high temperature and constant dose rate irradiation method, the alteration temperature and constant dose rate irradiation method can not only very rapidly and accurately evaluate the dose rate effect of three bipolar linear regulators, but also well simulate the damage of low dose rate irradiation. Experiment results make the alteration temperature and constant dose rate irradiation method successfully apply to bipolar linear regulator. (authors)

Method for enhancing microbial utilization rates of gases using perfluorocarbons

Science.gov (United States)

Turick, C.E.

1997-06-10

A method of enhancing the bacterial reduction of industrial gases using perfluorocarbons (PFCs) is disclosed. Because perfluorocarbons (PFCs) allow for a much greater solubility of gases than water does, PFCs have the potential to deliver gases in higher concentrations to microorganisms when used as an additive to microbial growth media thereby increasing the rate of the industrial gas conversion to economically viable chemicals and gases. 3 figs.

Measurement of disintegration rates of 60Co volume sources by the sum-peak method

International Nuclear Information System (INIS)

Kawano, Takao; Ebihara, Hiroshi

1991-01-01

The sum-peak method has been applied to the determination of the disintegration rates of 60 Co volume sources (1.05 x 10 4 Bq, 1.05 x 10 3 Bq and 1.05 x 10 2 Bq, in 100-ml polyethylene bottles) by using a NaI(Tl) detector of a diameter of 50 mm and a height of 50 mm. The experimental results showed that decreasing the disintegration rates resulted in enlarged underestimation in comparison with the true disintegration rates. It was presumed that the underestimations of the disintegration rates determined by the sum-peak method resulted from the overestimations of the areas under the sum peaks caused by the overlap of the area under the Compton scattering of the γ-ray (2614 keV) emitted from a naturally occurring radionuclide 208 Tl under the sum peaks. (author)

Qualitative and quantitative expression status of the human chromosome 20 genes in cancer tissues and the representative cell lines.

Science.gov (United States)

Wang, Quanhui; Wen, Bo; Yan, Guangrong; Wei, Junying; Xie, Liqi; Xu, Shaohang; Jiang, Dahai; Wang, Tingyou; Lin, Liang; Zi, Jin; Zhang, Ju; Zhou, Ruo; Zhao, Haiyi; Ren, Zhe; Qu, Nengrong; Lou, Xiaomin; Sun, Haidan; Du, Chaoqin; Chen, Chuangbin; Zhang, Shenyan; Tan, Fengji; Xian, Youqi; Gao, Zhibo; He, Minghui; Chen, Longyun; Zhao, Xiaohang; Xu, Ping; Zhu, Yunping; Yin, Xingfeng; Shen, Huali; Zhang, Yang; Jiang, Jing; Zhang, Chengpu; Li, Liwei; Chang, Cheng; Ma, Jie; Yan, Guoquan; Yao, Jun; Lu, Haojie; Ying, Wantao; Zhong, Fan; He, Qing-Yu; Liu, Siqi

2013-01-04

Under the guidance of the Chromosome-centric Human Proteome Project (C-HPP), (1, 2) we conducted a systematic survey of the expression status of genes located at human chromosome 20 (Chr.20) in three cancer tissues, gastric, colon, and liver carcinoma, and their representative cell lines. We have globally profiled proteomes in these samples with combined technology of LC-MS/MS and acquired the corresponding mRNA information upon RNA-seq and RNAchip. In total, 323 unique proteins were identified, covering 60% of the coding genes (323/547) in Chr.20. With regards to qualitative information of proteomics, we overall evaluated the correlation of the identified Chr.20 proteins with target genes of transcription factors or of microRNA, conserved genes and cancer-related genes. As for quantitative information, the expression abundances of Chr.20 genes were found to be almost consistent in both tissues and cell lines of mRNA in all individual chromosome regions, whereas those of Chr.20 proteins in cells are different from tissues, especially in the region of 20q13.33. Furthermore, the abundances of Chr.20 proteins were hierarchically evaluated according to tissue- or cancer-related distribution. The analysis revealed several cancer-related proteins in Chr.20 are tissue- or cell-type dependent. With integration of all the acquired data, for the first time we established a solid database of the Chr.20 proteome.

Evaluating the relationship between cannabis use and IQ in youth and young adults at clinical high risk of psychosis.

Science.gov (United States)

Buchy, Lisa; Seidman, Larry J; Cadenhead, Kristin S; Cannon, Tyrone D; Cornblatt, Barbara A; McGlashan, Thomas H; Perkins, Diana O; Stone, William; Tsuang, Ming T; Walker, Elaine F; Woods, Scott W; Bearden, Carrie E; Mathalon, Daniel H; Addington, Jean

2015-12-30

Among people with psychosis, those with a history of cannabis use show better cognitive performance than those who are cannabis naïve. It is unknown whether this pattern is present in youth at clinical high risk (CHR) of psychosis. We evaluated relationships between IQ and cannabis use while controlling for use of other substances known to impact cognition in 678 CHR and 263 healthy control (HC) participants. IQ was estimated using the Vocabulary and Block Design subtests of the Wechsler Abbreviated Scale of Intelligence. Drug and alcohol use severity and frequency were assessed with the Alcohol and Drug Use Scale, and we inquired participants' age at first use. CHR were further separated into early and late age at onset of cannabis use sub-groups, and low-, moderate- and high-frequency sub-groups. No significant differences in IQ emerged between CHR or HC cannabis users vs. non-users, or between use frequency groups. CHR late-onset users showed significantly higher IQ than CHR early-onset users. Age at onset of cannabis use was significantly and positively correlated with IQ in CHR only. Results suggest that age at onset of cannabis may be a more important factor for IQ than use current use or use frequency in CHR. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

A method to increase optical timing spectra measurement rates using a multi-hit TDC

International Nuclear Information System (INIS)

Moses, W.W.

1993-01-01

A method is presented for using a modern time to digital converter (TDC) to increase the data collection rate for optical timing measurements such as scintillator decay times. It extends the conventional delayed coincidence method, where a synchronization signal ''starts'' a TDC and a photomultiplier tube (PMT) sampling the optical signal ''stops'' the TDC. Data acquisition rates are low with the conventional method because ε, the light collection efficiency of the ''stop'' PMT, is artificially limited to ε∼0.01 photons per ''start'' signal to reduce the probability of detecting more than one photon during the sampling period. With conventional TDCs, these multiple photon events bias the time spectrum since only the first ''stop'' pulse is digitized. The new method uses a modern TDC to detect whether additional ''stop'' signals occur during the sampling period, and actively reject these multiple photon events. This allows ε to be increased to almost 1 photon per ''start'' signal, which maximizes the data acquisition rate at a value nearly 20 times higher. Multi-hit TDCs can digitize the arrival times of n ''stop'' signals per ''start'' signal, which allows ε to be increased to ∼3n/4. While overlap of the ''stop'' signals prevents the full gain in data collection rate to be realized, significant improvements are possible for most applications. (orig.)

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75106 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 50% of the ger...mination of viable seeds (h-1) 2 ... Chr04 65.1-80.4 2.29 ... 10.1111/j.1365-3040.2011.02463.x 22074055

Advanced methods comparisons of reaction rates in the Purdue Fast Breeder Blanket Facility

International Nuclear Information System (INIS)

Hill, R.N.; Ott, K.O.

1988-01-01

A review of worldwide results revealed that reaction rates in the blanket region are generally underpredicted with the discrepancy increasing with penetration; however, these results vary widely. Experiments in the large uniform Purdue Fast Breeder Blanket Facility (FBBF) blanket yield an accurate quantification of this discrepancy. Using standard production code methods (diffusion theory with 50 group cross sections), a consistent Calculated/Experimental (C/E) drop-off was observed for various reaction rates. A 50% increase in the calculated results at the outer edge of the blanket is necessary for agreement with experiments. The usefulness of refined group constant generation utilizing specialized weighting spectra and transport theory methods in correcting this discrepancy was analyzed. Refined group constants reduce the discrepancy to half that observed using the standard method. The surprising result was that transport methods had no effect on the blanket deviations; thus, transport theory considerations do not constitute or even contribute to an explanation of the blanket discrepancies. The residual blanket C/E drop-off (about half the standard drop-off) using advanced methods must be caused by some approximations which are applied in all current methods. 27 refs., 3 figs., 1 tab

QTL list: SpRg-7 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available entage concerning shoot regeneration 2 ME10-141 ... Chr07 19.51 6.84 ... 10.1186/1471-2229-11-140 22014149 ... QT73653 Solanum lycopersicum Solanaceae SpRg-7 In vitro plant regeneraion bud perc

Modeling dose-rate on/over the surface of cylindrical radio-models using Monte Carlo methods

International Nuclear Information System (INIS)

Xiao Xuefu; Ma Guoxue; Wen Fuping; Wang Zhongqi; Wang Chaohui; Zhang Jiyun; Huang Qingbo; Zhang Jiaqiu; Wang Xinxing; Wang Jun

2004-01-01

Objective: To determine the dose-rates on/over the surface of 10 cylindrical radio-models, which belong to the Metrology Station of Radio-Geological Survey of CNNC. Methods: The dose-rates on/over the surface of 10 cylindrical radio-models were modeled using the famous Monte Carlo code-MCNP. The dose-rates on/over the surface of 10 cylindrical radio-models were measured by a high gas pressurized ionization chamber dose-rate meter, respectively. The values of dose-rate modeled using MCNP code were compared with those obtained by authors in the present experimental measurement, and with those obtained by other workers previously. Some factors causing the discrepancy between the data obtained by authors using MCNP code and the data obtained using other methods are discussed in this paper. Results: The data of dose-rates on/over the surface of 10 cylindrical radio-models, obtained using MCNP code, were in good agreement with those obtained by other workers using the theoretical method. They were within the discrepancy of ±5% in general, and the maximum discrepancy was less than 10%. Conclusions: As if each factor needed for the Monte Carlo code is correct, the dose-rates on/over the surface of cylindrical radio-models modeled using the Monte Carlo code are correct with an uncertainty of 3%

Development of a Self-Rated Mixed Methods Skills Assessment: The National Institutes of Health Mixed Methods Research Training Program for the Health Sciences.

Science.gov (United States)

Guetterman, Timothy C; Creswell, John W; Wittink, Marsha; Barg, Fran K; Castro, Felipe G; Dahlberg, Britt; Watkins, Daphne C; Deutsch, Charles; Gallo, Joseph J

2017-01-01

Demand for training in mixed methods is high, with little research on faculty development or assessment in mixed methods. We describe the development of a self-rated mixed methods skills assessment and provide validity evidence. The instrument taps six research domains: "Research question," "Design/approach," "Sampling," "Data collection," "Analysis," and "Dissemination." Respondents are asked to rate their ability to define or explain concepts of mixed methods under each domain, their ability to apply the concepts to problems, and the extent to which they need to improve. We administered the questionnaire to 145 faculty and students using an internet survey. We analyzed descriptive statistics and performance characteristics of the questionnaire using the Cronbach alpha to assess reliability and an analysis of variance that compared a mixed methods experience index with assessment scores to assess criterion relatedness. Internal consistency reliability was high for the total set of items (0.95) and adequate (≥0.71) for all but one subscale. Consistent with establishing criterion validity, respondents who had more professional experiences with mixed methods (eg, published a mixed methods article) rated themselves as more skilled, which was statistically significant across the research domains. This self-rated mixed methods assessment instrument may be a useful tool to assess skills in mixed methods for training programs. It can be applied widely at the graduate and faculty level. For the learner, assessment may lead to enhanced motivation to learn and training focused on self-identified needs. For faculty, the assessment may improve curriculum and course content planning.

Improving the singles rate method for modeling accidental coincidences in high-resolution PET

International Nuclear Information System (INIS)

Oliver, Josep F; Rafecas, Magdalena

2010-01-01

Random coincidences ('randoms') are one of the main sources of image degradation in PET imaging. In order to correct for this effect, an accurate method to estimate the contribution of random events is necessary. This aspect becomes especially relevant for high-resolution PET scanners where the highest image quality is sought and accurate quantitative analysis is undertaken. One common approach to estimate randoms is the so-called singles rate method (SR) widely used because of its good statistical properties. SR is based on the measurement of the singles rate in each detector element. However, recent studies suggest that SR systematically overestimates the correct random rate. This overestimation can be particularly marked for low energy thresholds, below 250 keV used in some applications and could entail a significant image degradation. In this work, we investigate the performance of SR as a function of the activity, geometry of the source and energy acceptance window used. We also investigate the performance of an alternative method, which we call 'singles trues' (ST) that improves SR by properly modeling the presence of true coincidences in the sample. Nevertheless, in any real data acquisition the knowledge of which singles are members of a true coincidence is lost. Therefore, we propose an iterative method, STi, that provides an estimation based on ST but which only requires the knowledge of measurable quantities: prompts and singles. Due to inter-crystal scatter, for wide energy windows ST only partially corrects SR overestimations. While SR deviations are in the range 86-300% (depending on the source geometry), the ST deviations are systematically smaller and contained in the range 4-60%. STi fails to reproduce the ST results, although for not too high activities the deviation with respect to ST is only a few percent. For conventional energy windows, i.e. those without inter-crystal scatter, the ST method corrects the SR overestimations, and deviations from

New method of analyzing well tests in fractured wells using sandface pressure and rate data

Energy Technology Data Exchange (ETDEWEB)

Osman, M.; Almehaideb, R.; Abou-Kassem, J. [U.A.E. University, Al-Ain (United Arab Emirates)

1998-05-01

Analysis of variable flow rate tests has been of special interest recently because in many cases it is impractical to keep a flow rate constant long enough to perform a drawdown test. Further, in many other drawdown and buildup tests, the early data were influenced by wellbore storage effects, and the duration of these effects could be quite long for low-permeability reservoirs. This paper presents a mathematical model which describes drawdown and buildup tests in hydraulically fractured wells. This new method uses a specialized plot approach to analyze the linear flow data and combines it with the superposition of constant-rate solution method for the analysis of psuedoradial flow data. It does not require prior knowledge of the fracture type (uniform-flux or infinite-conductivity); in fact it predicts the fracture type. This method is useful for the analysis of simultaneously measured downhole pressure and sandface rate data. 12 refs., 11 figs., 3 tabs.

Method and apparatus for obtaining enhanced production rate of thermal chemical reactions

Science.gov (United States)

Tonkovich, Anna Lee Y [Pasco, WA; Wang, Yong [Richland, WA; Wegeng, Robert S [Richland, WA; Gao, Yufei [Kennewick, WA

2003-04-01

The present invention is a method and apparatus (vessel) for providing a heat transfer rate from a reaction chamber through a wall to a heat transfer chamber substantially matching a local heat transfer rate of a catalytic thermal chemical reaction. The key to the invention is a thermal distance defined on a cross sectional plane through the vessel inclusive of a heat transfer chamber, reaction chamber and a wall between the chambers. The cross sectional plane is perpendicular to a bulk flow direction of the reactant stream, and the thermal distance is a distance between a coolest position and a hottest position on the cross sectional plane. The thermal distance is of a length wherein the heat transfer rate from the reaction chamber to the heat transfer chamber substantially matches the local heat transfer rate.

Dose rate estimates and spatial interpolation maps of outdoor gamma dose rate with geostatistical methods; A case study from Artvin, Turkey

International Nuclear Information System (INIS)

Yeşilkanat, Cafer Mert; Kobya, Yaşar; Taşkin, Halim; Çevik, Uğur

2015-01-01

In this study, compliance of geostatistical estimation methods is compared to ensure investigation and imaging natural Fon radiation using the minimum number of data. Artvin province, which has a quite hilly terrain and wide variety of soil and located in the north–east of Turkey, is selected as the study area. Outdoor gamma dose rate (OGDR), which is an important determinant of environmental radioactivity level, is measured in 204 stations. Spatial structure of OGDR is determined by anisotropic, isotropic and residual variograms. Ordinary kriging (OK) and universal kriging (UK) interpolation estimations were calculated with the help of model parameters obtained from these variograms. In OK, although calculations are made based on positions of points where samples are taken, in the UK technique, general soil groups and altitude values directly affecting OGDR are included in the calculations. When two methods are evaluated based on their performances, it has been determined that UK model (r = 0.88, p < 0.001) gives quite better results than OK model (r = 0.64, p < 0.001). In addition, as a result of the maps created at the end of the study, it was illustrated that local changes are better reflected by UK method compared to OK method and its error variance is found to be lower. - Highlights: • The spatial dispersion of gamma dose rates in Artvin, which possesses one of the roughest lands in Turkey were studied. • The performance of different Geostatistic methods (OK and UK methods) for dispersion of gamma dose rates were compared. • Estimation values were calculated for non-sampling points by using the geostatistical model, the results were mapped. • The general radiological structure was determined in much less time with lower costs compared to experimental methods. • When theoretical methods are evaluated, it was obtained that UK gives more descriptive results compared to OK.

Genetic control of a central pattern generator: rhythmic oromotor movement in mice is controlled by a major locus near Atp1a2.

Directory of Open Access Journals (Sweden)

John D Boughter

Full Text Available Fluid licking in mice is a rhythmic behavior that is controlled by a central pattern generator (CPG located in a complex of brainstem nuclei. C57BL/6J (B6 and DBA/2J (D2 strains differ significantly in water-restricted licking, with a highly heritable difference in rates (h(2≥0.62 and a corresponding 20% difference in interlick interval (mean ± SEM = 116.3±1 vs 95.4±1.1 ms. We systematically quantified motor output in these strains, their F(1 hybrids, and a set of 64 BXD progeny strains. The mean primary interlick interval (MPI varied continuously among progeny strains. We detected a significant quantitative trait locus (QTL for a CPG controlling lick rate on Chr 1 (Lick1, and a suggestive locus on Chr 10 (Lick10. Linkage was verified by testing of B6.D2-1D congenic stock in which a segment of Chr 1 of the D2 strain was introgressed onto the B6 parent. The Lick1 interval on distal Chr 1 contains several strong candidate genes. One of these is a sodium/potassium pump subunit (Atp1a2 with widespread expression in astrocytes, as well as in a restricted population of neurons. Both this subunit and the entire Na(+/K(+-ATPase molecule have been implicated in rhythmogenesis for respiration and locomotion. Sequence variants in or near Apt1a2 strongly modulate expression of the cognate mRNA in multiple brain regions. This gene region has recently been sequenced exhaustively and we have cataloged over 300 non-coding and synonymous mutations segregating among BXD strains, one or more of which is likely to contribute to differences in central pattern generator tempo.

Large deviations and queueing networks: Methods for rate function identification

OpenAIRE

Atar, Rami; Dupuis, Paul

1999-01-01

This paper considers the problem of rate function identification for multidimensional queueing models with feedback. A set of techniques are introduced which allow this identification when the model possesses certain structural properties. The main tools used are representation formulas for exponential integrals, weak convergence methods, and the regularity properties of associated Skorokhod Problems. Two examples are treated as special cases of the general theory: the classical Jackson netwo...

Suicide epidemics: the impact of newly emerging methods on overall suicide rates - a time trends study

Directory of Open Access Journals (Sweden)

Chang Shu-Sen

2011-05-01

Full Text Available Abstract Background The impact of newly emerging, popular suicide methods on overall rates of suicide has not previously been investigated systematically. Understanding these effects may have important implications for public health surveillance. We examine the emergence of three novel methods of suicide by gassing in the 20th and 21st centuries and determine the impact of emerging methods on overall suicide rates. Methods We studied the epidemic rises in domestic coal gas (1919-1935, England and Wales, motor vehicle exhaust gas (1975-1992, England and Wales and barbecue charcoal gas (1999-2006, Taiwan suicide using Poisson and joinpoint regression models. Joinpoint regression uses contiguous linear segments and join points (points at which trends change to describe trends in incidence. Results Epidemic increases in the use of new methods of suicide were generally associated with rises in overall suicide rates of between 23% and 71%. The recent epidemic of barbecue charcoal suicides in Taiwan was associated with the largest rise in overall rates (40-50% annual rise, whereas the smallest rise was seen for car exhaust gassing in England and Wales (7% annual rise. Joinpoint analyses were only feasible for car exhaust and charcoal burning suicides; these suggested an impact of the emergence of car exhaust suicides on overall suicide rates in both sexes in England and Wales. However there was no statistical evidence of a change in the already increasing overall suicide trends when charcoal burning suicides emerged in Taiwan, possibly due to the concurrent economic recession. Conclusions Rapid rises in the use of new sources of gas for suicide were generally associated with increases in overall suicide rates. Suicide prevention strategies should include strengthening local and national surveillance for early detection of novel suicide methods and implementation of effective media guidelines and other appropriate interventions to limit the spread of

Trends in Suicide Methods and Rates among Older Adults in South Korea: A Comparison with Japan

OpenAIRE

Park, Subin; Lee, Hochang Benjamin; Lee, Su Yeon; Lee, Go Eun; Ahn, Myung Hee; Yi, Ki Kyoung; Hong, Jin Pyo

2016-01-01

Objective Lethality of the chosen method during a suicide attempt is a strong risk factor for completion of suicide. We examined whether annual changes in the pattern of suicide methods is related to annual changes in suicide rates among older adults in South Korea and Japan. Methods We analyzed annual the World Health Organization data on rates and methods of suicide from 2000 to 2011 in South Korea and Japan. Results For Korean older adults, there was a significant positive correlation betw...

Reexamining the Dissolution of Spent Fuel: A Comparison of Different Methods for Calculating Rates

International Nuclear Information System (INIS)

Hanson, Brady D.; Stout, Ray B.

2004-01-01

Dissolution rates for spent fuel have typically been reported in terms of a rate normalized to the surface area of the specimen. Recent evidence has shown that neither the geometric surface area nor that measured with BET accurately predicts the effective surface area of spent fuel. Dissolution rates calculated from results obtained by flowthrough tests were reexamined comparing the cumulative releases and surface area normalized rates. While initial surface area is important for comparison of different rates, it appears that normalizing to the surface area introduces unnecessary uncertainty compared to using cumulative or fractional release rates. Discrepancies in past data analyses are mitigated using this alternative method

12041_2017_864_MOESM1_ESM.docx

Indian Academy of Sciences (India)

sony

6, rs4970834, T/C, chr1:109814880, CELSR2, intronic, TC↓. 7, rs599839, G/A ... 10, rs10127775, T/A, chr1:230295789, GALNT2, intronic, HDL↓. 11, rs780092, G/ ... 18, rs3812316, G/C, chr7:73020337, MLXIPL, coding, TG↑. 19, rs327, G/T ...

Multi-rate cubature Kalman filter based data fusion method with residual compensation to adapt to sampling rate discrepancy in attitude measurement system.

Science.gov (United States)

Guo, Xiaoting; Sun, Changku; Wang, Peng

2017-08-01

This paper investigates the multi-rate inertial and vision data fusion problem in nonlinear attitude measurement systems, where the sampling rate of the inertial sensor is much faster than that of the vision sensor. To fully exploit the high frequency inertial data and obtain favorable fusion results, a multi-rate CKF (Cubature Kalman Filter) algorithm with estimated residual compensation is proposed in order to adapt to the problem of sampling rate discrepancy. During inter-sampling of slow observation data, observation noise can be regarded as infinite. The Kalman gain is unknown and approaches zero. The residual is also unknown. Therefore, the filter estimated state cannot be compensated. To obtain compensation at these moments, state error and residual formulas are modified when compared with the observation data available moments. Self-propagation equation of the state error is established to propagate the quantity from the moments with observation to the moments without observation. Besides, a multiplicative adjustment factor is introduced as Kalman gain, which acts on the residual. Then the filter estimated state can be compensated even when there are no visual observation data. The proposed method is tested and verified in a practical setup. Compared with multi-rate CKF without residual compensation and single-rate CKF, a significant improvement is obtained on attitude measurement by using the proposed multi-rate CKF with inter-sampling residual compensation. The experiment results with superior precision and reliability show the effectiveness of the proposed method.

Positional cloning of "Lisch-Like", a candidate modifier of susceptibility to type 2 diabetes in mice.

Directory of Open Access Journals (Sweden)

Marija Dokmanovic-Chouinard

2008-07-01

Full Text Available In 404 Lep(ob/ob F2 progeny of a C57BL/6J (B6 x DBA/2J (DBA intercross, we mapped a DBA-related quantitative trait locus (QTL to distal Chr1 at 169.6 Mb, centered about D1Mit110, for diabetes-related phenotypes that included blood glucose, HbA1c, and pancreatic islet histology. The interval was refined to 1.8 Mb in a series of B6.DBA congenic/subcongenic lines also segregating for Lep(ob. The phenotypes of B6.DBA congenic mice include reduced beta-cell replication rates accompanied by reduced beta-cell mass, reduced insulin/glucose ratio in blood, reduced glucose tolerance, and persistent mild hypoinsulinemic hyperglycemia. Nucleotide sequence and expression analysis of 14 genes in this interval identified a predicted gene that we have designated "Lisch-like" (Ll as the most likely candidate. The gene spans 62.7 kb on Chr1qH2.3, encoding a 10-exon, 646-amino acid polypeptide, homologous to Lsr on Chr7qB1 and to Ildr1 on Chr16qB3. The largest isoform of Ll is predicted to be a transmembrane molecule with an immunoglobulin-like extracellular domain and a serine/threonine-rich intracellular domain that contains a 14-3-3 binding domain. Morpholino knockdown of the zebrafish paralog of Ll resulted in a generalized delay in endodermal development in the gut region and dispersion of insulin-positive cells. Mice segregating for an ENU-induced null allele of Ll have phenotypes comparable to the B.D congenic lines. The human ortholog, C1orf32, is in the middle of a 30-Mb region of Chr1q23-25 that has been repeatedly associated with type 2 diabetes.

Assessment of Estimation Methods ForStage-Discharge Rating Curve in Rippled Bed Rivers

Directory of Open Access Journals (Sweden)

P. Maleki

2016-02-01

in a flume located at the hydraulic laboratory ofShahrekordUniversity, Iran. Bass (1993 [reported in Joep (1999], determined an empirical relation between median grain size, D50, and equilibrium ripple length, l: L=75.4 (logD50+197 Eq.(1 Where l and D50 are both given in millimeters. Raudkivi (1997 [reported in Joep (1999], proposed another empirical relation to estimate the ripple length that D50 is given in millimeters: L=245(D500.35 Eq. (2 Flemming (1988 [reported in Joep (1999], derived an empirical relation between mean ripple length and ripple height based on a large dataset: hm= 0.0677l 0.8098 Eq.(3 Where hm is the mean ripple height (m and l is the mean ripple length (m. Ikeda S. and Asaeda (1983 investigated the characteristics of flow over ripples. They found that there are separation areas and vortices at lee of ripples and maximum turbulent diffusion occurs in these areas. Materials and Methods: In this research, the effects of two different type of ripples onthe hydraulic characteristics of flow were experimentally studied in a flume located at the hydraulic laboratory of ShahrekordUniversity, Iran. The flume has the dimensions of 0.4 m wide and depth and 12 m long. Generally 48 tests variety slopes of 0.0005 to 0.003 and discharges of 10 to 40 lit/s, were conducted. Velocity and the shear stress were measured by using an Acoustic Doppler Velocimeter (ADV. Two different types of ripples (parallel and flake ripples were used. The stage- discharge rating curve was then estimated in different ways, such as Einstein - Barbarvsa, shen and White et al. Results and Discussion: In order to investigateresult of the tests, were usedst atistical methods.White method as amaximum valueofα, RMSE, and average absolute error than other methods. Einstein method offitting the discharge under estimated. Evaluation of stage- discharge rating curve methods based on the obtained results from this research showed that Shen method had the highest accuracy for developing the

ANSI/ASHRAE/IES Standard 90.1-2010 Performance Rating Method Reference Manual

Energy Technology Data Exchange (ETDEWEB)

Goel, Supriya [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Rosenberg, Michael I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

2016-05-01

This document is intended to be a reference manual for the Appendix G Performance Rating Method (PRM) of ANSI/ASHRAE/IES Standard 90.1- 2010 (Standard 90.1-2010).The PRM is used for rating the energy efficiency of commercial and high-rise residential buildings with designs that exceed the requirements of Standard 90.1. The procedures and processes described in this manual are designed to provide consistency and accuracy by filling in gaps and providing additional details needed by users of the PRM. It should be noted that this document is created independently from ASHRAE and SSPC 90.1 and is not sanctioned nor approved by either of those entities . Potential users of this manual include energy modelers, software developers and implementers of “beyond code” energy programs. Energy modelers using ASHRAE Standard 90.1-2010 for beyond code programs can use this document as a reference manual for interpreting requirements of the Performance Rating method. Software developers, developing tools for automated creation of the baseline model can use this reference manual as a guideline for developing the rules for the baseline model.

Identification of strain-rate and thermal sensitive material model with an inverse method

CERN Document Server

Peroni, L; Peroni, M

2010-01-01

This paper describes a numerical inverse method to extract material strength parameters from the experimental data obtained via mechanical tests at different strain-rates and temperatures. It will be shown that this procedure is particularly useful to analyse experimental results when the stress-strain fields in the specimen cannot be correctly described via analytical models. This commonly happens in specimens with no regular shape, in specimens with a regular shape when some instability phenomena occur (for example the necking phenomena in tensile tests that create a strongly heterogeneous stress-strain fields) or in dynamic tests (where the strain-rate field is not constant due to wave propagation phenomena). Furthermore the developed procedure is useful to take into account thermal phenomena generally affecting high strain-rate tests due to the adiabatic overheating related to the conversion of plastic work. The method presented requires strong effort both from experimental and numerical point of view, an...

Research on criticality analysis method of CNC machine tools components under fault rate correlation

Science.gov (United States)

Gui-xiang, Shen; Xian-zhuo, Zhao; Zhang, Ying-zhi; Chen-yu, Han

2018-02-01

In order to determine the key components of CNC machine tools under fault rate correlation, a system component criticality analysis method is proposed. Based on the fault mechanism analysis, the component fault relation is determined, and the adjacency matrix is introduced to describe it. Then, the fault structure relation is hierarchical by using the interpretive structure model (ISM). Assuming that the impact of the fault obeys the Markov process, the fault association matrix is described and transformed, and the Pagerank algorithm is used to determine the relative influence values, combined component fault rate under time correlation can obtain comprehensive fault rate. Based on the fault mode frequency and fault influence, the criticality of the components under the fault rate correlation is determined, and the key components are determined to provide the correct basis for equationting the reliability assurance measures. Finally, taking machining centers as an example, the effectiveness of the method is verified.

Charged-particle thermonuclear reaction rates: I. Monte Carlo method and statistical distributions

International Nuclear Information System (INIS)

Longland, R.; Iliadis, C.; Champagne, A.E.; Newton, J.R.; Ugalde, C.; Coc, A.; Fitzgerald, R.

2010-01-01

A method based on Monte Carlo techniques is presented for evaluating thermonuclear reaction rates. We begin by reviewing commonly applied procedures and point out that reaction rates that have been reported up to now in the literature have no rigorous statistical meaning. Subsequently, we associate each nuclear physics quantity entering in the calculation of reaction rates with a specific probability density function, including Gaussian, lognormal and chi-squared distributions. Based on these probability density functions the total reaction rate is randomly sampled many times until the required statistical precision is achieved. This procedure results in a median (Monte Carlo) rate which agrees under certain conditions with the commonly reported recommended 'classical' rate. In addition, we present at each temperature a low rate and a high rate, corresponding to the 0.16 and 0.84 quantiles of the cumulative reaction rate distribution. These quantities are in general different from the statistically meaningless 'minimum' (or 'lower limit') and 'maximum' (or 'upper limit') reaction rates which are commonly reported. Furthermore, we approximate the output reaction rate probability density function by a lognormal distribution and present, at each temperature, the lognormal parameters μ and σ. The values of these quantities will be crucial for future Monte Carlo nucleosynthesis studies. Our new reaction rates, appropriate for bare nuclei in the laboratory, are tabulated in the second paper of this issue (Paper II). The nuclear physics input used to derive our reaction rates is presented in the third paper of this issue (Paper III). In the fourth paper of this issue (Paper IV) we compare our new reaction rates to previous results.

A chimeric receptor of the insulin-like growth factor receptor type 1 (IGFR1) and a single chain antibody specific to myelin oligodendrocyte glycoprotein activates the IGF1R signalling cascade in CG4 oligodendrocyte progenitors.

Science.gov (United States)

Annenkov, Alexander; Rigby, Anne; Amor, Sandra; Zhou, Dun; Yousaf, Nasim; Hemmer, Bernhard; Chernajovsky, Yuti

2011-08-01

In order to generate neural stem cells with increased ability to survive after transplantation in brain parenchyma we developed a chimeric receptor (ChR) that binds to myelin oligodendrocyte glycoprotein (MOG) via its ectodomain and activates the insulin-like growth factor receptor type 1 ‎‎(IGF1R) signalling cascade. Activation of this pro-survival pathway in response to ligand broadly available in the brain might increase neuroregenerative potential of transplanted precursors. The ChR was produced by fusing a MOG-specific single ‎chain antibody with the extracellular boundary of the IGF1R transmembrane segment. The ChR is expressed on the cellular surface, predominantly as a monomer, and is not N-glycosylated. To show MOG-dependent functionality of the ChR, neuroblastoma cells B104 expressing this ChR were stimulated with monolayers of cells expressing recombinant MOG. The ChR undergoes MOG-dependent tyrosine phosphorylation and homodimerisation. It promotes insulin and IGF-independent growth of the oligodendrocyte progenitor cell line CG4. The proposed mode of the ChR activation is by MOG-induced dimerisation which promotes kinase domain transphosphorylation, by-passing the requirement of conformation changes known to be important for IGF1R activation. Another ChR, which contains a segment of the β-chain ectodomain, was produced in an attempt to recapitulate some of these conformational changes, but proved non-functional. 2011 Elsevier B.V. All rights reserved.

Evaluation and comparison of estimation methods for failure rates and probabilities

Energy Technology Data Exchange (ETDEWEB)

Vaurio, Jussi K. [Fortum Power and Heat Oy, P.O. Box 23, 07901 Loviisa (Finland)]. E-mail: jussi.vaurio@fortum.com; Jaenkaelae, Kalle E. [Fortum Nuclear Services, P.O. Box 10, 00048 Fortum (Finland)

2006-02-01

An updated parametric robust empirical Bayes (PREB) estimation methodology is presented as an alternative to several two-stage Bayesian methods used to assimilate failure data from multiple units or plants. PREB is based on prior-moment matching and avoids multi-dimensional numerical integrations. The PREB method is presented for failure-truncated and time-truncated data. Erlangian and Poisson likelihoods with gamma prior are used for failure rate estimation, and Binomial data with beta prior are used for failure probability per demand estimation. Combined models and assessment uncertainties are accounted for. One objective is to compare several methods with numerical examples and show that PREB works as well if not better than the alternative more complex methods, especially in demanding problems of small samples, identical data and zero failures. False claims and misconceptions are straightened out, and practical applications in risk studies are presented.

Calculation method for gamma-dose rates from spherical puffs

International Nuclear Information System (INIS)

Thykier-Nielsen, S.; Deme, S.; Lang, E.

1993-05-01

The Lagrangian puff-models are widely used for calculation of the dispersion of atmospheric releases. Basic output from such models are concentrations of material in the air and on the ground. The most simple method for calculation of the gamma dose from the concentration of airborne activity is based on semi-infinite cloud model. This method is however only applicable for points far away from the release point. The exact calculation of the cloud dose using the volume integral requires significant computer time. The volume integral for the gamma dose could be approximated by using the semi-infinite cloud model combined with correction factors. This type of calculation procedure is very fast, but usually the accuracy is poor due to the fact that the same correction factors are used for all isotopes. The authors describe a more elaborate correction method. This method uses precalculated values of the gamma-dose rate as a function of the puff dispersion parameter (δ p ) and the distance from the puff centre for four energy groups. The release of energy for each radionuclide in each energy group has been calculated and tabulated. Based on these tables and a suitable interpolation procedure the calculation of gamma doses takes very short time and is almost independent of the number of radionuclides. (au) (7 tabs., 7 ills., 12 refs.)

Validity and extension of the SCS-CN method for computing infiltration and rainfall-excess rates

Science.gov (United States)

Mishra, Surendra Kumar; Singh, Vijay P.

2004-12-01

A criterion is developed for determining the validity of the Soil Conservation Service curve number (SCS-CN) method. According to this criterion, the existing SCS-CN method is found to be applicable when the potential maximum retention, S, is less than or equal to twice the total rainfall amount. The criterion is tested using published data of two watersheds. Separating the steady infiltration from capillary infiltration, the method is extended for predicting infiltration and rainfall-excess rates. The extended SCS-CN method is tested using 55 sets of laboratory infiltration data on soils varying from Plainfield sand to Yolo light clay, and the computed and observed infiltration and rainfall-excess rates are found to be in good agreement.

Application of the dose rate spectroscopy to the dose-to-curie conversion method using a NaI(Tl) detector

International Nuclear Information System (INIS)

JI, Young-Yong; Chung, Kun Ho; Kim, Chang-Jong; Kang, Mun Ja; Park, Sang Tae

2015-01-01

Dose rate spectroscopy is a very useful method to directly calculate the individual dose rate from the converted energy spectrum for the dose rate using the G-factor which is related to the used detector response function. A DTC conversion method for the estimation of the radioactivity based on the measured dose rate from the radioactive materials can then be modified into a simple equation using the dose rate spectroscopy. In order to make the method validation of the modified DTC conversion method, experimental verifications using a 3″φx3″ NaI(Tl) detector were conducted at the simple geometry of the point source located onto a detector and more complex geometries which mean the assay of the simulated radioactive material. In addition, the linearity about the results from the modified DTC conversion method was also estimated by increasing the distance between source positions and a detector to confirm the method validation in the energy, dose rate, and distance range of the gamma nuclides. - Highlights: • A modified DTC conversion method using the dose rate spectroscopy was established. • In-situ calibration factors were calculated from the MCNP simulation. • Radioactivities of the disk sources were accurately calculated using a modified DTC conversion method. • A modified DTC conversion method was applied to the assay of the radioactive material

Waste tank ventilation rates measured with a tracer gas method

International Nuclear Information System (INIS)

Huckaby, J.L.; Evans, J.C.; Sklarew, D.S.; Mitroshkov, A.V.

1998-08-01

Passive ventilation with the atmosphere is used to prevent accumulation of waste gases and vapors in the headspaces of 132 of the 177 high-level radioactive waste Tanks at the Hanford Site in Southeastern Washington State. Measurements of the passive ventilation rates are needed for the resolution of two key safety issues associated with the rates of flammable gas production and accumulation and the rates at which organic salt-nitrate salt mixtures dry out. Direct measurement of passive ventilation rates using mass flow meters is not feasible because ventilation occurs va multiple pathways to the atmosphere (i.e., via the filtered breather riser and unsealed tank risers and pits), as well as via underground connections to other tanks, junction boxes, and inactive ventilation systems. The tracer gas method discussed in this report provides a direct measurement of the rate at which gases are removed by ventilation and an indirect measurement of the ventilation rate. The tracer gas behaves as a surrogate of the waste-generated gases, but it is only diminished via ventilation, whereas the waste gases are continuously released by the waste and may be subject to depletion mechanisms other than ventilation. The fiscal year 1998 tracer studies provide new evidence that significant exchange of air occurs between tanks via the underground cascade pipes. Most of the single-shell waste tanks are connected via 7.6-cm diameter cascade pipes to one or two adjacent tanks. Tracer gas studies of the Tank U-102/U-103 system indicated that the ventilation occurring via the cascade line could be a significant fraction of the total ventilation. In this two-tank cascade, air evidently flowed from Tank U-103 to Tank U-102 for a time and then was observed to flow from Tank U-102 to Tank U-103

Assessment of interchangeability rate between 2 methods of measurements: An example with a cardiac output comparison study.

Science.gov (United States)

Lorne, Emmanuel; Diouf, Momar; de Wilde, Robert B P; Fischer, Marc-Olivier

2018-02-01

The Bland-Altman (BA) and percentage error (PE) methods have been previously described to assess the agreement between 2 methods of medical or laboratory measurements. This type of approach raises several problems: the BA methodology constitutes a subjective approach to interchangeability, whereas the PE approach does not take into account the distribution of values over a range. We describe a new methodology that defines an interchangeability rate between 2 methods of measurement and cutoff values that determine the range of interchangeable values. We used a simulated data and a previously published data set to demonstrate the concept of the method. The interchangeability rate of 5 different cardiac output (CO) pulse contour techniques (Wesseling method, LiDCO, PiCCO, Hemac method, and Modelflow) was calculated, in comparison with the reference pulmonary artery thermodilution CO using our new method. In our example, Modelflow with a good interchangeability rate of 93% and a cutoff value of 4.8 L min, was found to be interchangeable with the thermodilution method for >95% of measurements. Modelflow had a higher interchangeability rate compared to Hemac (93% vs 86%; P = .022) or other monitors (Wesseling cZ = 76%, LiDCO = 73%, and PiCCO = 62%; P < .0001). Simulated data and reanalysis of a data set comparing 5 CO monitors against thermodilution CO showed that, depending on the repeatability of the reference method, the interchangeability rate combined with a cutoff value could be used to define the range of values over which interchangeability remains acceptable.

Use of a ring chromosome and pulsed-field gels to study interhomolog recombination, double-strand DNA breaks and sister-chromatid exchange in yeast

International Nuclear Information System (INIS)

Game, J.C.; Sitney, K.C.; Cook, V.E.; Mortimer, R.K.

1989-01-01

The authors describe a system that uses pulsed-field gels for the physical detection of recombinant DNA molecules, double-strand DNA breaks (DSB) and sister-chromatid exchange in the yeast Saccharomyces cerevisiae. The system makes use of a circular variant of chromosome II (Chr. III). Meiotic recombination between this ring chromosome and a linear homolog produces new molecules of sizes distinguishable on gels from either parental molecule. They demonstrate that these recombinant molecules are not present either in strains with two linear Chr. III molecules or in rad50 mutants, which are defective in meiotic recombination. In conjunction with the molecular endpoints. They present data on the timing of commitment to meiotic recombination scored genetically. They have used x-rays to linearize circular Chr. III, both to develop a sensitive method for measuring frequency of DSB and as a means of detecting double-size circles originating in part from sister-chromatid exchange, which they find to be frequent during meiosis

The competition of charge remote and charge directed fragmentation mechanisms in quaternary ammonium salt derivatized peptides--an isotopic exchange study.

Science.gov (United States)

Cydzik, Marzena; Rudowska, Magdalena; Stefanowicz, Piotr; Szewczuk, Zbigniew

2011-12-01

Derivatization of peptides as quaternary ammonium salts (QAS) is a promising method for sensitive detection by electrospray ionization tandem mass spectrometry (Cydzik et al. J. Pept. Sci. 2011, 17, 445-453). The peptides derivatized by QAS at their N-termini undergo fragmentation according to the two competing mechanisms - charge remote (ChR) and charge directed (ChD). The absence of mobile proton in the quaternary salt ion results in ChR dissociation of a peptide bond. However, Hofmann elimination of quaternary salt creates an ion with one mobile proton leading to the ChD fragmentation. The experiments on the quaternary ammonium salts with deuterated N-alkyl groups or amide NH bonds revealed that QAS derivatized peptides dissociate according to the mixed ChR-ChD mechanism. The isotopic labeling allows differentiation of fragments formed according to ChR and ChD mechanisms. © The Author(s) 2011. This article is published with open access at Springerlink.com

Pleural liquid clearance rate measured in awake sheep by the volume of dilution method

International Nuclear Information System (INIS)

Broaddus, V.C.; Wiener-Kronish, J.P.; Berthiaume, Y.; Staub, N.C.

1986-01-01

The authors reported 24h clearance of mock pleural effusions measured terminally in sheep. To measure effusion volume at different times in the same sheep, they injected 111 In-transferrin and measured its dilution. In 5 sheep with effusions of known sizes, the method was accurate to +/-10%. In 5 awake sheep, the authors injected 10 ml/kg of a 1% protein solution via a non-penetrating rib capsule. At 6h, the authors measured the volume by the dilution method and at 24h by direct recovery. The clearance rate in each animal was constant at 2.9-6.0%/h (average 4.8 +/- 1.3%/h). This new method gives a reliable two point clearance rate and requires fewer animals

Experiments to Evaluate and Implement Passive Tracer Gas Methods to Measure Ventilation Rates in Homes

Energy Technology Data Exchange (ETDEWEB)

Lunden, Melissa [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Faulkner, David [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Heredia, Elizabeth [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Cohn, Sebastian [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Dickerhoff, Darryl [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Noris, Federico [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Logue, Jennifer [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Hotchi, Toshifumi [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Singer, Brett [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Sherman, Max H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

2012-10-01

This report documents experiments performed in three homes to assess the methodology used to determine air exchange rates using passive tracer techniques. The experiments used four different tracer gases emitted simultaneously but implemented with different spatial coverage in the home. Two different tracer gas sampling methods were used. The results characterize the factors of the execution and analysis of the passive tracer technique that affect the uncertainty in the calculated air exchange rates. These factors include uncertainties in tracer gas emission rates, differences in measured concentrations for different tracer gases, temporal and spatial variability of the concentrations, the comparison between different gas sampling methods, and the effect of different ventilation conditions.

Covariance methodology applied to 35S disintegration rate measurements by the CIEMAT/NIST method

International Nuclear Information System (INIS)

Koskinas, M.F.; Nascimento, T.S.; Yamazaki, I.M.; Dias, M.S.

2014-01-01

The Nuclear Metrology Laboratory (LMN) at IPEN is carrying out measurements in a LSC (Liquid Scintillation Counting system), applying the CIEMAT/NIST method. In this context 35 S is an important radionuclide for medical applications and it is difficult to be standardized by other primary methods due to low beta ray energy. The CIEMAT/NIST is a standard technique used by most metrology laboratories in order to improve accuracy and speed up beta emitter standardization. The focus of the present work was to apply the covariance methodology for determining the overall uncertainty in the 35 S disintegration rate. All partial uncertainties involved in the measurements were considered, taking into account all possible correlations between each pair of them. - Highlights: ► 35 S disintegration rate measured in Liquid Scintillator system using CIEMAT/NIST method. ► Covariance methodology applied to the overall uncertainty in the 35 S disintegration rate. ► Monte Carlo simulation was applied to determine 35 S activity in the 4πβ(PC)-γ coincidence system

Environmental dose rate assessment of ITER using the Monte Carlo method

Directory of Open Access Journals (Sweden)

Karimian Alireza

2014-01-01

Full Text Available Exposure to radiation is one of the main sources of risk to staff employed in reactor facilities. The staff of a tokamak is exposed to a wide range of neutrons and photons around the tokamak hall. The International Thermonuclear Experimental Reactor (ITER is a nuclear fusion engineering project and the most advanced experimental tokamak in the world. From the radiobiological point of view, ITER dose rates assessment is particularly important. The aim of this study is the assessment of the amount of radiation in ITER during its normal operation in a radial direction from the plasma chamber to the tokamak hall. To achieve this goal, the ITER system and its components were simulated by the Monte Carlo method using the MCNPX 2.6.0 code. Furthermore, the equivalent dose rates of some radiosensitive organs of the human body were calculated by using the medical internal radiation dose phantom. Our study is based on the deuterium-tritium plasma burning by 14.1 MeV neutron production and also photon radiation due to neutron activation. As our results show, the total equivalent dose rate on the outside of the bioshield wall of the tokamak hall is about 1 mSv per year, which is less than the annual occupational dose rate limit during the normal operation of ITER. Also, equivalent dose rates of radiosensitive organs have shown that the maximum dose rate belongs to the kidney. The data may help calculate how long the staff can stay in such an environment, before the equivalent dose rates reach the whole-body dose limits.

Mapping of murine radiation-induced acute myeloid leukaemia susceptibility loci

International Nuclear Information System (INIS)

Darakhshan, F.

2001-01-01

Studies on radiation-induced AML have shown characteristic phenotypic variation in susceptibility amongst inbred mouse strains, suggesting the involvement of genetic factors in determining the development of AML post-irradiation exposure. The main objective of the present study therefore was to identify and map markers in linkage disequilibrium with gene variants associated with influencing susceptibility to radiation induced AML in mice. Given Chr 2 abnormalities are characteristic of AML in mice, this feature was exploited in an effort to overcome the long latency for AML development. Analysis of Chr 2 aberrations at 24 and 48 h following irradiation established a positive correlation between Chr 2 radiosensitivity and radiation-AML susceptibility thus validating the choice of substitute assay. The analysis also resulted in the identification of a further trait, additional to Chr 2 radiosensitivity, termed overall chromosome radiosensitivity. Genetic mapping of Chr 2 radiosensitivity using public domain microsatellite database information resulted in the definition of cluster regions on 7 different chromosomes. Further genotyping reduced the candidate regions to 3 specific regions of interest. A test of allelic association could not ascertain a conclusive link between markers at these regions and the Chr 2 radiosensitivity/radiation-AML susceptibility phenotype. However, a region on Chr 4 around D4Mit221 appears to be most strongly associated. Similar studies identified three chromosomal regions of interest (on Chrs 4, 8 and 16) associated with overall chromosome radiosensitivity trait. An independent mapping strategy using F3 RCS confirmed the likely involvement of two of the candidate Chr 2 radiosensitivity regions identified by the inbred analysis including that on Chr 4 and also highlighted phenotypic heterogeneity amongst resistant RC strains, suggesting the influence of multiple alleles in specific phenotypes. RFLP analysis of candidate genes, localised on

QTL list: Swf-1 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT98650 Cucumis sativus Cucurbitaceae Swf-1 resistance to Melon yellow spot virus ...resistance to Melon yellow spot virus MYSV-FuCu05P 3 SSR13109 Chr01 ... 29.0-55.6 10.5 ... 10.1007/s10681-015-1444-x ...

QTL list: Swf-2 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT98651 Cucumis sativus Cucurbitaceae Swf-2 resistance to Melon yellow spot virus ...resistance to Melon yellow spot virus MYSV-FuCu05P 3 CSN251 Chr03 ... 34.0-56.0 11 ... 10.1007/s10681-015-1444-x ...

QTL list: Swf-3 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT98652 Cucumis sativus Cucurbitaceae Swf-3 resistance to Melon yellow spot virus ...resistance to Melon yellow spot virus MYSV-FuCu05P 3 SSR6225 Chr04 ... 61.9-80.4 4.4 ... 10.1007/s10681-015-1444-x ...

Marker list: QM299721 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available TGTGGTCAGGGAGTA RGT x GD ('Renetta Grigia di Torriana' x 'Golden Delicious', code 99411)|RGT x GRH ('Renetta... Grigia di Torriana' x 'GoldRush', code 99412) ... Chr12 apple skin russeting in RGT crosses 3 10.1186/s12870-015-0507-4 26084469

Marker list: QM300172 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available AAAAGGAAACATCCA RGT x GD ('Renetta Grigia di Torriana' x 'Golden Delicious', code 99411)|RGT x GRH ('Renetta... Grigia di Torriana' x 'GoldRush', code 99412) ... Chr12 apple skin russeting in RGT crosses 3 10.1186/s12870-015-0507-4 26084469

Marker list: QM300173 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available TAGCATTCAGTCAGC RGT x GD ('Renetta Grigia di Torriana' x 'Golden Delicious', code 99411)|RGT x GRH ('Renetta... Grigia di Torriana' x 'GoldRush', code 99412) ... Chr12 apple skin russeting in RGT crosses 3 10.1186/s12870-015-0507-4 26084469

Marker list: QM300106 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available ACCCATGGAATTGT RGT x GD ('Renetta Grigia di Torriana' x 'Golden Delicious', code 99411)|RGT x GRH ('Renetta ...Grigia di Torriana' x 'GoldRush', code 99412) ... Chr12 apple skin russeting in RGT crosses 3 10.1186/s12870-015-0507-4 26084469

Marker list: QM183663 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available CG GCTCCAACTTCAATGCCTGT Gold Ball Livingston x Yellow Pear|San Marzano x Gold Ball Livingston|T1693 x Yellow Pear ... chr11 fruit shape 1 10.1038/hdy.2013.45 23673388 ... QM183663 Solanum lycopersicum Solanaceae 11EP186 CAPS/dCAPS TGGAAGCTTTAAACTTGTCGTT

Variation of strain rate sensitivity index of a superplastic aluminum alloy in different testing methods

Science.gov (United States)

Majidi, Omid; Jahazi, Mohammad; Bombardier, Nicolas; Samuel, Ehab

2017-10-01

The strain rate sensitivity index, m-value, is being applied as a common tool to evaluate the impact of the strain rate on the viscoplastic behaviour of materials. The m-value, as a constant number, has been frequently taken into consideration for modeling material behaviour in the numerical simulation of superplastic forming processes. However, the impact of the testing variables on the measured m-values has not been investigated comprehensively. In this study, the m-value for a superplastic grade of an aluminum alloy (i.e., AA5083) has been investigated. The conditions and the parameters that influence the strain rate sensitivity for the material are compared with three different testing methods, i.e., monotonic uniaxial tension test, strain rate jump test and stress relaxation test. All tests were conducted at elevated temperature (470°C) and at strain rates up to 0.1 s-1. The results show that the m-value is not constant and is highly dependent on the applied strain rate, strain level and testing method.

Study (Prediction of Main Pipes Break Rates in Water Distribution Systems Using Intelligent and Regression Methods

Directory of Open Access Journals (Sweden)

Massoud Tabesh

2011-07-01

Full Text Available Optimum operation of water distribution networks is one of the priorities of sustainable development of water resources, considering the issues of increasing efficiency and decreasing the water losses. One of the key subjects in optimum operational management of water distribution systems is preparing rehabilitation and replacement schemes, prediction of pipes break rate and evaluation of their reliability. Several approaches have been presented in recent years regarding prediction of pipe failure rates which each one requires especial data sets. Deterministic models based on age and deterministic multi variables and stochastic group modeling are examples of the solutions which relate pipe break rates to parameters like age, material and diameters. In this paper besides the mentioned parameters, more factors such as pipe depth and hydraulic pressures are considered as well. Then using multi variable regression method, intelligent approaches (Artificial neural network and neuro fuzzy models and Evolutionary polynomial Regression method (EPR pipe burst rate are predicted. To evaluate the results of different approaches, a case study is carried out in a part ofMashhadwater distribution network. The results show the capability and advantages of ANN and EPR methods to predict pipe break rates, in comparison with neuro fuzzy and multi-variable regression methods.

Increasing recruitment rates in an inpatient clinical research study using quality improvement methods.

Science.gov (United States)

Sauers, Hadley S; Beck, Andrew F; Kahn, Robert S; Simmons, Jeffrey M

2014-11-01

One important benefit of successful patient recruitment is increased generalizability of findings. We sought to optimize enrollment of children admitted with asthma as part of a population-based, prospective, observational cohort study with the goal of enrolling at least 60% of all eligible and staffed patients. Quality improvement methods were used to improve cohort recruitment. Weekly meetings with study staff and study leadership were held to plan and discuss how to maximize recruitment rates. Significant initial variability in recruitment success prompted the team to use small-scale tests of change to increase recruitment numbers. A number of tests were trialed, focusing primarily on reducing patient refusals and improving recruitment process efficiency. Recruitment rates were calculated by dividing eligible by enrolled patients and displayed using annotated Shewhart control charts. Control charts were used to illustrate week-to-week variability while also enabling differentiation of common-cause and special-cause variation. The study enrolled 774 patients, representing 54% of all eligible and 59% of those eligible for whom staff were available to enroll. Our mean weekly recruitment rate increased from 55% during the first 3 months of the study to a statistically significant sustained rate of 61%. This was sustained given numerous obstacles, such as departing and hiring of staff and adding a second recruitment location. Implementing quality improvement methods within a larger research study led to an increase in the rate of recruitment as well as the stability in recruitment rates from week-to-week. Copyright © 2014 by the American Academy of Pediatrics.

Estimation of turbulence dissipation rate by Large eddy PIV method in an agitated vessel

Directory of Open Access Journals (Sweden)

Kysela Bohuš

2015-01-01

Full Text Available The distribution of turbulent kinetic energy dissipation rate is important for design of mixing apparatuses in chemical industry. Generally used experimental methods of velocity measurements for measurement in complex geometries of an agitated vessel disallow measurement in resolution of small scales close to turbulence dissipation ones. Therefore, Particle image velocity (PIV measurement method improved by large eddy Ply approach was used. Large eddy PIV method is based on modeling of smallest eddies by a sub grid scale (SGS model. This method is similar to numerical calculations using Large Eddy Simulation (LES and the same SGS models are used. In this work the basic Smagorinsky model was employed and compared with power law approximation. Time resolved PIV data were processed by Large Eddy PIV approach and the obtained results of turbulent kinetic dissipation rate were compared in selected points for several operating conditions (impeller speed, operating liquid viscosity.

A new method to determine reflex latency induced by high rate stimulation of the nervous system

Directory of Open Access Journals (Sweden)

Ilhan eKaracan

2014-07-01

Full Text Available High rate stimulations of the neuromuscular system, such as continuous whole body vibration, tonic vibration reflex and high frequency electrical stimulation, are used in the physiological research with an increasing interest. In these studies, the neuronal circuitries underlying the reflex responses remain unclear due to the problem of determining the exact reflex latencies. We present a novel cumulated average method to determine the reflex latency during high rate stimulation of the nervous system which was proven to be significantly more accurate than the classical method. The classical method, cumulant density analysis, reveals the relationship between the two synchronously recorded signals as a function of the lag between the signals. The comparison of new method with the classical technique and their relative accuracy was tested using a computer simulation. In the simulated signals the EMG response latency was constructed to be exactly 40 ms. The new method accurately indicated the value of the simulated reflex latency (40 ms. However, the classical method showed that the lag time between the simulated triggers and the simulated signals was 49 ms. Simulation results illustrated that the cumulated average method is a reliable and more accurate method compared with the classical method. We therefore suggest that the new cumulated average method is able to determine the high rate stimulation induced reflex latencies more accurately than the classical method.

QTL list: RXopJ4 resistance locus [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT62244 Solanum lycopersicum Solanaceae RXopJ4 resistance locus resistance to bacterial spot... disease resistance to bacterial spot disease (Xanthomonas perforans (Xp)) 3 J350 ... Chr06 ... 10.1007/s00122-012-2004-6 23117718

Genetic analysis of autoimmune sialadenitis in nonobese diabetic mice: a major susceptibility region on chromosome 1.

Science.gov (United States)

Boulard, Olivier; Fluteau, Guy; Eloy, Laure; Damotte, Diane; Bedossa, Pierre; Garchon, Henri-Jean

2002-04-15

The nonobese diabetic (NOD) mouse strain provides a good study model for Sjögren's syndrome (SS). The genetic control of SS was investigated in this model using different matings, including a (NOD x C57BL/6 (B6))F(2) cross, a (NOD x NZW)F(2) cross, and ((NOD x B6) x NOD) backcross. Multiple and different loci were detected depending on parent strain combination and sex. Despite significant complexity, two main features were prominent. First, the middle region of chromosome 1 (chr.1) was detected in all crosses. Its effect was most visible in the (NOD x B6)F(2) cross and dominated over that of other loci, including those mapping on chr.8, 9, 10, and 16; the effect of these minor loci was observed only in the absence of the NOD haplotype on chr.1. Most critically, the chr.1 region was sufficient to trigger an SS-like inflammatory infiltrate of salivary glands as shown by the study of a new C57BL/6 congenic strain carrying a restricted segment derived from NOD chr.1. Second, several chromosomal regions were previously associated with NOD autoimmune phenotypes, including Iddm (chr.1, 2, 3, 9, and 17, corresponding to Idd5, Idd13, Idd3, Idd2, and Idd1, respectively), accounting for the strong linkage previously reported between insulitis and sialitis, and autoantibody production (chr.10 and 16, corresponding to Bana2 and Bah2, respectively). Interestingly, only two loci were detected in the (NOD x NZW)F(2) cross, on chr.1 in females and on chr.7 in males, probably because of the latent autoimmune predisposition of the NZW strain. Altogether these findings reflect the complexity and heterogeneity of human SS.

Quasi-static method and finite element method for obtaining the modifications of the spontaneous emission rate and energy level shift near a plasmonic nanostructure.

Science.gov (United States)

Zhao, Yun-Jin; Tian, Meng; Wang, Xiao-Yun; Yang, Hong; Zhao, Heping; Huang, Yong-Gang

2018-01-22

We provide numerical demonstrations of the applicability and accuracy of the quasi-static method and the finite-element method in the investigation of the modifications of the spontaneous emission rate and the energy level shift of an emitter placed near a silver-air interface or a silver nano-sphere. The analytical results are presented as a reference. Our calculations show that the finite element method is an accurate and general method. For frequency away from the radiative mode, the quasi-static method can be applied more effectively for calculating the energy level shift than the spontaneous emission rate. But for frequency around, there is a blue shift for both and this shift increases with the increasing of emitter-silver distance. Applying the theory to the nanosphere dimmer, we see similar phenomenon and find extremely large modifications of the spontaneous emission rate and energy level shift. These findings are instructive in the fields of quantum light-matter interactions.

Evaluation of trauma care using TRISS method: the role of adjusted misclassification rate and adjusted w-statistic

Directory of Open Access Journals (Sweden)

Bytyçi Cen I

2009-01-01

Full Text Available Abstract Background Major trauma is a leading cause of death worldwide. Evaluation of trauma care using Trauma Injury and Injury Severity Score (TRISS method is focused in trauma outcome (deaths and survivors. For testing TRISS method TRISS misclassification rate is used. Calculating w-statistic, as a difference between observed and TRISS expected survivors, we compare our trauma care results with the TRISS standard. Aim The aim of this study is to analyze interaction between misclassification rate and w-statistic and to adjust these parameters to be closer to the truth. Materials and methods Analysis of components of TRISS misclassification rate and w-statistic and actual trauma outcome. Results The component of false negative (FN (by TRISS method unexpected deaths has two parts: preventable (Pd and non-preventable (nonPd trauma deaths. Pd represents inappropriate trauma care of an institution; otherwise nonpreventable trauma deaths represents errors in TRISS method. Removing patients with preventable trauma deaths we get an Adjusted misclassification rate: (FP + FN - Pd/N or (b+c-Pd/N. Substracting nonPd from FN value in w-statistic formula we get an Adjusted w-statistic: [FP-(FN - nonPd]/N, respectively (FP-Pd/N, or (b-Pd/N. Conclusion Because adjusted formulas clean method from inappropriate trauma care, and clean trauma care from the methods error, TRISS adjusted misclassification rate and adjusted w-statistic gives more realistic results and may be used in researches of trauma outcome.

Method and system of simulating nuclear power plant count rate for training purposes

International Nuclear Information System (INIS)

Alliston, W.H.; Koenig, R.H.

1975-01-01

A method and system are described for the real-time simulation of the dynamic operation of a nuclear power plant in which nuclear flux rate counters are provided for monitoring the rate of nuclear fission of the reactor. The system utilizes apparatus that includes digital computer means for calculating data relating to the rate of nuclear fission of a simulated reactor model, which rate is controlled in accordance with the operation of control panel devices. A digital number from the computer corresponding to the flux rate controls an oscillator driven counter means to produce a pulse after a predetermined count. This pulse controls an oscillator driven polynomial counter to count a random number that controls a third counter in accordance with pulse from the first counter to produce a random fission count for operating the meters. (U.S.)

Evaluation of trauma care using TRISS method: the role of adjusted misclassification rate and adjusted w-statistic.

Science.gov (United States)

Llullaku, Sadik S; Hyseni, Nexhmi Sh; Bytyçi, Cen I; Rexhepi, Sylejman K

2009-01-15

Major trauma is a leading cause of death worldwide. Evaluation of trauma care using Trauma Injury and Injury Severity Score (TRISS) method is focused in trauma outcome (deaths and survivors). For testing TRISS method TRISS misclassification rate is used. Calculating w-statistic, as a difference between observed and TRISS expected survivors, we compare our trauma care results with the TRISS standard. The aim of this study is to analyze interaction between misclassification rate and w-statistic and to adjust these parameters to be closer to the truth. Analysis of components of TRISS misclassification rate and w-statistic and actual trauma outcome. The component of false negative (FN) (by TRISS method unexpected deaths) has two parts: preventable (Pd) and non-preventable (nonPd) trauma deaths. Pd represents inappropriate trauma care of an institution; otherwise nonpreventable trauma deaths represents errors in TRISS method. Removing patients with preventable trauma deaths we get an Adjusted misclassification rate: (FP + FN - Pd)/N or (b+c-Pd)/N. Substracting nonPd from FN value in w-statistic formula we get an Adjusted w-statistic: [FP-(FN - nonPd)]/N, respectively (FP-Pd)/N, or (b-Pd)/N). Because adjusted formulas clean method from inappropriate trauma care, and clean trauma care from the methods error, TRISS adjusted misclassification rate and adjusted w-statistic gives more realistic results and may be used in researches of trauma outcome.

Development of Joint Climate and Discharge Projections for the International Rhine River Basin - the CHR RheinBlick2050 Project

Science.gov (United States)

Görgen, K.; Pfister, L.

2008-12-01

The anticipated climate change will lead to modified hydro-meteorological regimes that influence discharge behaviour and hydraulics of rivers. This has variable impacts on managed (anthropogenic) and unmanaged (natural) systems, depending on their sensitivity and vulnerability (ecology, economy, infrastructure, transport, energy production, water management, etc.). Decision makers in these contexts need adequate adaptation strategies to minimize adverse effects of climate change, i.e. an improved knowledge on the potential impacts including uncertainties means an extension of the informed options open to users. The goal of the highly applied study presented here is the development of joint, consistent climate and discharge projections for the international Rhine River catchments (Switzerland, France, Germany, Netherlands) in order to assess future changes of hydro-meteorological regimes in the meso- and macroscale Rhine River catchments and to derive and improve the understanding of such impacts on hydrologic and hydraulic processes. The RheinBlick2050 project is an international effort initiated by the International Commission for the Hydrology of the Rhine Basin (CHR) in close cooperation with the International Commission for the Protection of the Rhine. The core experiment design foresees a data-synthesis, multi-model approach where (transient) (bias- corrected) regional climate change projections are used as forcing data for existing calibrated hydrological (and hydraulic) models at a daily temporal resolution over mesoscale catchments of the Rhine River. Mainly for validation purposes, hydro-meteorological observations from national weather services are compiled into a new consistent 5 km x 5 km reference dataset from 1961 to 2005. RCM data are mainly used from the ENSEMBLES project and other existing dynamical downscaling model runs to derive probabilistic ensembles and thereby also access uncertainties on a regional scale. A benchmarking is helping to

Meta-analytic methods for pooling rates when follow-up duration varies: a case study

Directory of Open Access Journals (Sweden)

Wolf Fredric M

2004-07-01

Full Text Available Abstract Background Meta-analysis can be used to pool rate measures across studies, but challenges arise when follow-up duration varies. Our objective was to compare different statistical approaches for pooling count data of varying follow-up times in terms of estimates of effect, precision, and clinical interpretability. Methods We examined data from a published Cochrane Review of asthma self-management education in children. We selected two rate measures with the largest number of contributing studies: school absences and emergency room (ER visits. We estimated fixed- and random-effects standardized weighted mean differences (SMD, stratified incidence rate differences (IRD, and stratified incidence rate ratios (IRR. We also fit Poisson regression models, which allowed for further adjustment for clustering by study. Results For both outcomes, all methods gave qualitatively similar estimates of effect in favor of the intervention. For school absences, SMD showed modest results in favor of the intervention (SMD -0.14, 95% CI -0.23 to -0.04. IRD implied that the intervention reduced school absences by 1.8 days per year (IRD -0.15 days/child-month, 95% CI -0.19 to -0.11, while IRR suggested a 14% reduction in absences (IRR 0.86, 95% CI 0.83 to 0.90. For ER visits, SMD showed a modest benefit in favor of the intervention (SMD -0.27, 95% CI: -0.45 to -0.09. IRD implied that the intervention reduced ER visits by 1 visit every 2 years (IRD -0.04 visits/child-month, 95% CI: -0.05 to -0.03, while IRR suggested a 34% reduction in ER visits (IRR 0.66, 95% CI 0.59 to 0.74. In Poisson models, adjustment for clustering lowered the precision of the estimates relative to stratified IRR results. For ER visits but not school absences, failure to incorporate study indicators resulted in a different estimate of effect (unadjusted IRR 0.77, 95% CI 0.59 to 0.99. Conclusions Choice of method among the ones presented had little effect on inference but affected the

Improvement of life prediction accuracy by introduction of strain-rate effect into modified ductility exhaustion method

International Nuclear Information System (INIS)

Takahashi, Yukio

1994-01-01

It is important to use a reliable creep-fatigue damage evaluation method to prevent failures due to creep-fatigue damage accumulated during operation life in the structural design for fast breeder reactor plants. In this study, slow strain-rate fatigue tests were conducted for SUS316 steel for fast breeder application (316FR) and the improvement of creep-fatigue life estimation method was proposed based on test results. Main results can be summarized as follows: (1) In the slow strain-rate fatigue tests, life reduction caused by creep damage was observed as in the case of strain-hold creep-fatigue tests. (2) Strain-rate dependency of creep damage was introduced into the modified ductility exhaustion method previously proposed by the author. Good agreement of predicted lives with observed lives was achieved for SUS304 and 316FR steels with the method proposed here. (author)

Differential relations of locus of control to perceived social stress among help-seeking adolescents at low vs. high clinical risk of psychosis.

Science.gov (United States)

Millman, Zachary B; Weintraub, Marc J; Bentley, Eryn; DeVylder, Jordan E; Mittal, Vijay A; Pitts, Steven C; Thompson, Elizabeth; Demro, Caroline; Reeves, Gloria M; Schiffman, Jason

2017-06-01

Research suggests that perceived social stress influences illness presentation and course among youth in the clinical high-risk (CHR) phase of psychosis. Little is known, however, about the social cognitive factors associated with social stress perception in this population, particularly relative to youth with non-CHR psychopathology. Individuals with psychosis tend to endorse an external locus of control (LOC), which is associated with the stress response in healthy individuals. LOC may therefore be related to perceived social stress in youth at CHR. We examined the differential relations of self-reported LOC and perceived social stress, as measured by the Behavior Assessment System for Children, Second Edition, across 45 CHR and 65 help-seeking control (HSC) participants. Youth at CHR reported more social stress (F[1, 107]=6.28, p=0.01) and a more external LOC (F[1, 107]=4.98, p=0.03) than HSCs. Further, external LOC was more strongly associated with feelings of social stress in the CHR group relative to the HSC group (interaction: b=0.35, t[105]=2.32, psocial stress, however, were nonsignificant at internal levels of LOC (b=-2.0, t[105]=-0.72, p=0.48; f 2 =0.00). Results suggest that perceptions of uncontrollability over one's social environment may more often induce or exacerbate feelings of stress and tension in CHR youth relative to HSCs. A better understanding of the social cognition-stress relation may improve understanding of CHR phenomenology, etiology, and treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

Learning to trust: social feedback normalizes trust behavior in first-episode psychosis and clinical high risk.

Science.gov (United States)

Lemmers-Jansen, Imke L J; Fett, Anne-Kathrin J; Hanssen, Esther; Veltman, Dick J; Krabbendam, Lydia

2018-06-13

Psychosis is characterized by problems in social functioning that exist well before illness onset, and in individuals at clinical high risk (CHR) for psychosis. Trust is an essential element for social interactions that is impaired in psychosis. In the trust game, chronic patients showed reduced baseline trust, impaired response to positive social feedback, and attenuated brain activation in reward and mentalizing areas. We investigated whether first-episode psychosis patients (FEP) and CHR show similar abnormalities in the neural and behavioral mechanisms underlying trust. Twenty-two FEP, 17 CHR, and 43 healthy controls performed two trust games, with a cooperative and an unfair partner in the fMRI scanner. Region of interest analyses were performed on mentalizing and reward processing areas, during the investment and outcome phases of the games. Compared with healthy controls, FEP and CHR showed reduced baseline trust, but like controls, learned to trust in response to cooperative and unfair feedback. Symptom severity was not associated with baseline trust, however in FEP associated with reduced response to feedback. The only group differences in brain activation were that CHR recruited the temporo-parietal junction (TPJ) more than FEP and controls during investment in the unfair condition. This hyper-activation in CHR was associated with greater symptom severity. Reduced baseline trust may be associated with risk for psychotic illness, or generally with poor mental health. Feedback learning is still intact in CHR and FEP, as opposed to chronic patients. CHR however show distinct neural activation patterns of hyper-activation of the TPJ.

The Role of Trauma and Stressful Life Events among Individuals at Clinical High Risk for Psychosis: A Review

Directory of Open Access Journals (Sweden)

Danessa Mayo

2017-04-01

Full Text Available The experience of childhood trauma (CT and stressful life events (SLEs is associated with subsequent development of a variety of mental health conditions, including psychotic illness. Recent research identifying adolescents and young adults at clinical high risk (CHR for psychosis allows for prospective evaluation of the impact of trauma and adverse life events on psychosis onset and other outcomes, addressing etiological questions that cannot be answered in studies of fully psychotic or non-clinical populations. This article provides a comprehensive review of the current emerging literature on trauma and adverse life events in the CHR population. Up to 80% of CHR youth endorse a lifetime history of childhood traumatic events and victimization (e.g., bullying. Several studies have shown that the experience of CT predicts psychosis onset among CHR individuals, while the literature on the influence of recent SLEs (e.g., death of a loved one remains inconclusive. Multiple models have been proposed to explain the link between trauma and psychosis, including the stress-vulnerability and stress-sensitivity hypotheses, with emphases on both cognitive processes and neurobiological mechanisms (e.g., the hypothalamic–pituitary–adrenal axis. Despite the preponderance of CHR individuals who endorse either CT or SLEs, no clinical trials have been conducted evaluating interventions for trauma in CHR youth to date. Furthermore, the current process of formal identification and assessment of trauma, SLEs, and their impact on CHR youth is inconsistent in research and clinical practice. Recommendations for improving trauma assessment, treatment, and future research directions in the CHR field are provided.

Associations between changes in the pattern of suicide methods and rates in Korea, the US, and Finland

OpenAIRE

Park, Subin; Ahn, Myung Hee; Lee, Ahrong; Hong, Jin Pyo

2014-01-01

Background The lethality of the suicide method employed is a strong risk factor for the completion of suicide. We examined whether annual changes in the pattern of suicide methods is related to annual changes in suicide rates in South Korea, the United States (US), and Finland. Methods We analyzed annual data from 2000–2011 for South Korea and Finland, and 2000–2010 for the US in order to examine trends in the rates and methods of suicide. Data on suicide methods were obtained from the World ...

Engineering Mathematical Analysis Method for Productivity Rate in Linear Arrangement Serial Structure Automated Flow Assembly Line

Directory of Open Access Journals (Sweden)

Tan Chan Sin

2015-01-01

Full Text Available Productivity rate (Q or production rate is one of the important indicator criteria for industrial engineer to improve the system and finish good output in production or assembly line. Mathematical and statistical analysis method is required to be applied for productivity rate in industry visual overviews of the failure factors and further improvement within the production line especially for automated flow line since it is complicated. Mathematical model of productivity rate in linear arrangement serial structure automated flow line with different failure rate and bottleneck machining time parameters becomes the basic model for this productivity analysis. This paper presents the engineering mathematical analysis method which is applied in an automotive company which possesses automated flow assembly line in final assembly line to produce motorcycle in Malaysia. DCAS engineering and mathematical analysis method that consists of four stages known as data collection, calculation and comparison, analysis, and sustainable improvement is used to analyze productivity in automated flow assembly line based on particular mathematical model. Variety of failure rate that causes loss of productivity and bottleneck machining time is shown specifically in mathematic figure and presents the sustainable solution for productivity improvement for this final assembly automated flow line.

Evaluation method of gas leakage rate from transportation casks of radioactive materials (gas leakage rates from scratches on O-ring surface)

International Nuclear Information System (INIS)

Aritomi, Masanori; Li Ninghua; Asano, Ryoji; Kawa, Tsunemichi

2004-01-01

A sealing function is essential for transportation and/or storage casks of radioactive materials under both normal and accidental operating conditions in order to prevent radioactive materials from being released into the environment. In the safety analysis report, the release rate of radioactive materials into the environment is evaluated using the correlations specified in the ANSI N14.5, 1987. The purposes of the work are to reveal the underlying problems on the correlations specified in the ANSI N14.5 related to gas leakage rates from a scratch on O-ring surface and from multi-leak paths, to offer a data base to study the evaluation method of the leakage rate and to propose the evaluation method. In this paper, the following insights were obtained and clarified: 1. If a characteristic value of a leak path is defined as D 4 /a ('D' is the diameter and 'a' is the length), a scratch on the O-ring surface can be evaluated as a circular tube. 2. It is proper to use the width of O-ring groove on the flange as the leak path length for elastomer O-rings. 3. Gas leakage rates from multi leak paths of the transportation cask can be evaluated in the same manner as a single leak path if an effective D4/a is introduced. (author)

A photocurrent compensation method of bipolar transistors under high dose rate radiation and its experimental research

International Nuclear Information System (INIS)

Yin Xuesong; Liu Zhongli; Li Chunji; Yu Fang

2005-01-01

Experiment using discrete bipolar transistors has been performed to verify the effect of the photocurrent compensation method. The theory of the dose rate effects of bipolar transistors and the photocurrent compensation method are introduced. The comparison between the response of hardened and unhardened circuits under high dose rate radiation is discussed. The experimental results show instructiveness to the hardness of bipolar integrated circuits under transient radiation. (authors)

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available uration of french fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking. ...Samples were stored at 8C after harvest, until analyzed on November. After 24 hours of the cooking, discolouration was evaluated. 1,4,6 ... Chr01 ... 10.1007/s00122-013-2254-y 24408376

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96907 Solanum tuberosum Solanaceae ... after cooking darkening Non-enzymatic discol...ouration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after cooking. After 1 hour of the coo...king, discolouration was evaluated. 1,4 ... Chr11 ... 10.1007/s00122-013-2254-y 24408376

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT96905 Solanum tuberosum Solanaceae ... after cooking darkening Non-enzymatic discol...ouration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after cooking. After 1 hour of the coo...king, discolouration was evaluated. 1,4 ... Chr03 ... 10.1007/s00122-013-2254-y 24408376

The log mean heat transfer rate method of heat exchanger considering the influence of heat radiation

International Nuclear Information System (INIS)

Wong, K.-L.; Ke, M.-T.; Ku, S.-S.

2009-01-01

The log mean temperature difference (LMTD) method is conventionally used to calculate the total heat transfer rate of heat exchangers. Because the heat radiation equation contains the 4th order exponential of temperature which is very complicate in calculations, thus LMTD method neglects the influence of heat radiation. From the recent investigation of a circular duct in some practical situations, it is found that even in the situation of the temperature difference between outer duct surface and surrounding is low to 1 deg. C, the heat radiation effect can not be ignored in the situations of lower ambient convective heat coefficient and greater surface emissivities. In this investigation, the log mean heat transfer rate (LMHTR) method which considering the influence of heat radiation, is developed to calculate the total heat transfer rate of heat exchangers.

High-resolution labeling and functional manipulation of specific neuron types in mouse brain by Cre-activated viral gene expression.

Directory of Open Access Journals (Sweden)

Sandra J Kuhlman

2008-04-01

Full Text Available We describe a method that combines Cre-recombinase knockin mice and viral-mediated gene transfer to genetically label and functionally manipulate specific neuron types in the mouse brain. We engineered adeno-associated viruses (AAVs that express GFP, dsRedExpress, or channelrhodopsin (ChR2 upon Cre/loxP recombination-mediated removal of a transcription-translation STOP cassette. Fluorescent labeling was sufficient to visualize neuronal structures with synaptic resolution in vivo, and ChR2 expression allowed light activation of neuronal spiking. The structural dynamics of a specific class of neocortical neuron, the parvalbumin-containing (Pv fast-spiking GABAergic interneuron, was monitored over the course of a week. We found that although the majority of Pv axonal boutons were stable in young adults, bouton additions and subtractions on axonal shafts were readily observed at a rate of 10.10% and 9.47%, respectively, over 7 days. Our results indicate that Pv inhibitory circuits maintain the potential for structural re-wiring in post-adolescent cortex. With the generation of an increasing number of Cre knockin mice and because viral transfection can be delivered to defined brain regions at defined developmental stages, this strategy represents a general method to systematically visualize the structure and manipulate the function of different cell types in the mouse brain.

Genome-Wide Identification of Chalcone Reductase Gene Family in Soybean: Insight into Root-Specific GmCHRs and Phytophthora sojae Resistance

Directory of Open Access Journals (Sweden)

Caroline J. Sepiol

2017-12-01

Full Text Available Soybean (Glycine max [L.] Merr is one of the main grain legumes worldwide. Soybean farmers lose billions of dollars’ worth of yield annually due to root and stem rot disease caused by the oomycete Phytophthora sojae. Many strategies have been developed to combat the disease, however, these methods have proven ineffective in the long term. A more cost effective and durable approach is to select a trait naturally found in soybean that can increase resistance. One such trait is the increased production of phytoalexin glyceollins in soybean. Glyceollins are isoflavonoids, synthesized via the legume-specific branch of general phenylpropanoid pathway. The first key enzyme exclusively involved in glyceollin synthesis is chalcone reductase (CHR which coacts with chalcone synthase for the production of isoliquiritigenin, the precursor for glyceollin biosynthesis. Here we report the identification of 14 putative CHR genes in soybean where 11 of them are predicted to be functional. Our results show that GmCHRs display tissue-specific gene expression, and that only root-specific GmCHRs are induced upon P. sojae infection. Among 4 root-specific GmCHRs, GmCHR2A is located near a QTL that is linked to P. sojae resistance suggesting GmCHR2A as a novel locus for partial resistance that can be utilized for resistance breeding.

Desempenho diagnóstico e associações clínicas dos anticorpos contra componentes da cromatina no lúpus eritematoso sistêmico juvenil Diagnostic performance and clinical associations of antibodies to the chromatin antigenic system in juvenile systemic lupus erythematosus

Directory of Open Access Journals (Sweden)

Silene Peres Keusseyan

2012-10-01

Full Text Available OBJETIVOS: Determinar a frequência de anticorpos contra componentes da cromatina no lúpus eritematoso sistêmico juvenil (LESJ e correlacionar a presença desses autoanticorpos com manifestações clínicas e atividade da doença. MÉTODOS: Os anticorpos anticromatina (anti-CHR, antinucleossomo (anti-NCS e anti-dsDNA foram medidos em 175 indivíduos, incluindo 37 pacientes com LESJ ativo e 41 com doença inativa, 47 com doenças autoimunes não lúpicas, e 50 crianças saudáveis. Um teste ELISA in house foi desenvolvido com nucleossomos purificados a partir de timo de bezerro para determinar os anticorpos IgG e IgG3 anti-NCS. Anti-CHR e anti-dsDNA foram detectados por kits comerciais de ELISA (INOVA. RESULTADOS: Anticorpos anti-NCS e anti-CHR exibiram não só uma alta especificidade para LESJ, mas também uma frequência semelhante em LESJ ativo e inativo. Os níveis séricos de anti-CHR e IgG/IgG3 anti-NCS não diferiram entre LESJ ativo e inativo. Houve correlação entre o SLEDAI e os anticorpos anti-dsDNA, mas não com os anticorpos contra outros componentes da cromatina. Houve associação de anticorpos anti-dsDNA, anti-CHR e IgG/IgG3 anti-NCS com proteinúria e baixos níveis séricos de C4. Foram observados anticorpos anti-NCS em 14% dos pacientes com LESJ na ausência de anticorpos anti-dsDNA. CONCLUSÕES: Nossos dados indicam que os anticorpos anti-NCS e anti-CHR são marcadores diagnósticos relevantes para LESJ e parecem estar correlacionados com a atividade da nefrite lúpica no LESJ. O anticorpo IgG3 anti-NCS não parece ser mais relevante como marcador de atividade da doença ou nefrite ativa no LESJ em comparação ao anticorpo IgG anti-NCS.OBJECTIVES: To determine the frequency of antibodies to chromatin components in juvenile systemic lupus erythematosus (JSLE, and to correlate the presence of these autoantibodies with clinical manifestations and disease activity. METHODS: Anti-chromatin (anti-CHR, anti-nucleosome core

Machine cost analysis using the traditional machine-rate method and ChargeOut!

Science.gov (United States)

E. M. (Ted) Bilek

2009-01-01

Forestry operations require ever more use of expensive capital equipment. Mechanization is frequently necessary to perform cost-effective and safe operations. Increased capital should mean more sophisticated capital costing methodologies. However the machine rate method, which is the costing methodology most frequently used, dates back to 1942. CHARGEOUT!, a recently...

Semiempirical method of determining flow coefficients for pitot rake mass flow rate measurements

Science.gov (United States)

Trefny, C. J.

1985-01-01

Flow coefficients applicable to area-weighted pitot rake mass flow rate measurements are presented for fully developed, turbulent flow in an annulus. A turbulent velocity profile is generated semiempirically for a given annulus hub-to-tip radius ratio and integrated numerically to determine the ideal mass flow rate. The calculated velocities at each probe location are then summed, and the flow rate as indicated by the rake is obtained. The flow coefficient to be used with the particular rake geometry is subsequently obtained by dividing the ideal flow rate by the rake-indicated flow rate. Flow coefficients ranged from 0.903 for one probe placed at a radius dividing two equal areas to 0.984 for a 10-probe area-weighted rake. Flow coefficients were not a strong function of annulus hub-to-tip radius ratio for rakes with three or more probes. The semiempirical method used to generate the turbulent velocity profiles is described in detail.

Classical Wigner method with an effective quantum force: application to reaction rates.

Science.gov (United States)

Poulsen, Jens Aage; Li, Huaqing; Nyman, Gunnar

2009-07-14

We construct an effective "quantum force" to be used in the classical molecular dynamics part of the classical Wigner method when determining correlation functions. The quantum force is obtained by estimating the most important short time separation of the Feynman paths that enter into the expression for the correlation function. The evaluation of the force is then as easy as classical potential energy evaluations. The ideas are tested on three reaction rate problems. The resulting transmission coefficients are in much better agreement with accurate results than transmission coefficients from the ordinary classical Wigner method.

Calculation method for gamma dose rates from Gaussian puffs

Energy Technology Data Exchange (ETDEWEB)

Thykier-Nielsen, S; Deme, S; Lang, E

1995-06-01

The Lagrangian puff models are widely used for calculation of the dispersion of releases to the atmosphere. Basic output from such models is concentration of material in the air and on the ground. The most simple method for calculation of the gamma dose from the concentration of airborne activity is based on the semi-infinite cloud model. This method is however only applicable for puffs with large dispersion parameters, i.e. for receptors far away from the release point. The exact calculation of the cloud dose using volume integral requires large computer time usually exceeding what is available for real time calculations. The volume integral for gamma doses could be approximated by using the semi-infinite cloud model combined with correction factors. This type of calculation procedure is very fast, but usually the accuracy is poor because only a few of the relevant parameters are considered. A multi-parameter method for calculation of gamma doses is described here. This method uses precalculated values of the gamma dose rates as a function of E{sub {gamma}}, {sigma}{sub y}, the asymmetry factor - {sigma}{sub y}/{sigma}{sub z}, the height of puff center - H and the distance from puff center R{sub xy}. To accelerate the calculations the release energy, for each significant radionuclide in each energy group, has been calculated and tabulated. Based on the precalculated values and suitable interpolation procedure the calculation of gamma doses needs only short computing time and it is almost independent of the number of radionuclides considered. (au) 2 tabs., 15 ills., 12 refs.

Calculation method for gamma dose rates from Gaussian puffs

International Nuclear Information System (INIS)

Thykier-Nielsen, S.; Deme, S.; Lang, E.

1995-06-01

The Lagrangian puff models are widely used for calculation of the dispersion of releases to the atmosphere. Basic output from such models is concentration of material in the air and on the ground. The most simple method for calculation of the gamma dose from the concentration of airborne activity is based on the semi-infinite cloud model. This method is however only applicable for puffs with large dispersion parameters, i.e. for receptors far away from the release point. The exact calculation of the cloud dose using volume integral requires large computer time usually exceeding what is available for real time calculations. The volume integral for gamma doses could be approximated by using the semi-infinite cloud model combined with correction factors. This type of calculation procedure is very fast, but usually the accuracy is poor because only a few of the relevant parameters are considered. A multi-parameter method for calculation of gamma doses is described here. This method uses precalculated values of the gamma dose rates as a function of E γ , σ y , the asymmetry factor - σ y /σ z , the height of puff center - H and the distance from puff center R xy . To accelerate the calculations the release energy, for each significant radionuclide in each energy group, has been calculated and tabulated. Based on the precalculated values and suitable interpolation procedure the calculation of gamma doses needs only short computing time and it is almost independent of the number of radionuclides considered. (au) 2 tabs., 15 ills., 12 refs

A GPS Satellite Clock Offset Prediction Method Based on Fitting Clock Offset Rates Data

Directory of Open Access Journals (Sweden)

WANG Fuhong

2016-12-01

Full Text Available It is proposed that a satellite atomic clock offset prediction method based on fitting and modeling clock offset rates data. This method builds quadratic model or linear model combined with periodic terms to fit the time series of clock offset rates, and computes the model coefficients of trend with the best estimation. The clock offset precisely estimated at the initial prediction epoch is directly adopted to calculate the model coefficient of constant. The clock offsets in the rapid ephemeris (IGR provided by IGS are used as modeling data sets to perform certain experiments for different types of GPS satellite clocks. The results show that the clock prediction accuracies of the proposed method for 3, 6, 12 and 24 h achieve 0.43, 0.58, 0.90 and 1.47 ns respectively, which outperform the traditional prediction method based on fitting original clock offsets by 69.3%, 61.8%, 50.5% and 37.2%. Compared with the IGU real-time clock products provided by IGS, the prediction accuracies of the new method have improved about 15.7%, 23.7%, 27.4% and 34.4% respectively.

Identification of strain-rate and thermal sensitive material model with an inverse method

Directory of Open Access Journals (Sweden)

Peroni M.

2010-06-01

Full Text Available This paper describes a numerical inverse method to extract material strength parameters from the experimental data obtained via mechanical tests at different strainrates and temperatures. It will be shown that this procedure is particularly useful to analyse experimental results when the stress-strain fields in the specimen cannot be correctly described via analytical models. This commonly happens in specimens with no regular shape, in specimens with a regular shape when some instability phenomena occur (for example the necking phenomena in tensile tests that create a strongly heterogeneous stress-strain fields or in dynamic tests (where the strain-rate field is not constant due to wave propagation phenomena. Furthermore the developed procedure is useful to take into account thermal phenomena generally affecting high strain-rate tests due to the adiabatic overheating related to the conversion of plastic work. The method presented requires strong effort both from experimental and numerical point of view, anyway it allows to precisely identify the parameters of different material models. This could provide great advantages when high reliability of the material behaviour is necessary. Applicability of this method is particularly indicated for special applications in the field of aerospace engineering, ballistic, crashworthiness studies or particle accelerator technologies, where materials could be submitted to strong plastic deformations at high-strain rate in a wide range of temperature. Thermal softening effect has been investigated in a temperature range between 20°C and 1000°C.

Recent amendments of the KTA 2101.2 fire barrier resistance rating method for German NPP and comparison to the Eurocode t-equivalent method

Energy Technology Data Exchange (ETDEWEB)

Forell, Burkhard [Gesellschaft fuer Anlagen- und Reaktorsicherheit (GRS) gGmbH, Koeln (Germany)

2015-12-15

The German nuclear standard KTA2101 on ''Fire Protection in Nuclear Power Plants'', Part 2: ''Fire Protection of Structural Plant Components'' includes a simplified method for the fire resistance rating of fire barrier elements based on the t-equivalent approach. The method covers the specific features of compartments in nuclear power plant buildings in terms of the boundary conditions which have to be expected in the event of fire. The method has proven to be relatively simple and straightforward to apply. The paper gives an overview of amendments with respect to the rating method made within the regular review of the KTA 2101.2. A comparison to the method of the non-nuclear Eurocode 1 is also provided. The Eurocode method is closely connected to the German standard DIN 18230 on structural fire protection in industrial buildings. Special emphasis of the comparison is given to the ventilation factor, which has a large impact on the required fire resistance.

Regulatory cross-talk links Vibrio cholerae chromosome II replication and segregation.

Directory of Open Access Journals (Sweden)

Yoshiharu Yamaichi

2011-07-01

Full Text Available There is little knowledge of factors and mechanisms for coordinating bacterial chromosome replication and segregation. Previous studies have revealed that genes (and their products that surround the origin of replication (oriCII of Vibrio cholerae chromosome II (chrII are critical for controlling the replication and segregation of this chromosome. rctB, which flanks one side of oriCII, encodes a protein that initiates chrII replication; rctA, which flanks the other side of oriCII, inhibits rctB activity. The chrII parAB2 operon, which is essential for chrII partitioning, is located immediately downstream of rctA. Here, we explored how rctA exerts negative control over chrII replication. Our observations suggest that RctB has at least two DNA binding domains--one for binding to oriCII and initiating replication and the other for binding to rctA and thereby inhibiting RctB's ability to initiate replication. Notably, the inhibitory effect of rctA could be alleviated by binding of ParB2 to a centromere-like parS site within rctA. Furthermore, by binding to rctA, ParB2 and RctB inversely regulate expression of the parAB2 genes. Together, our findings suggest that fluctuations in binding of the partitioning protein ParB2 and the chrII initiator RctB to rctA underlie a regulatory network controlling both oriCII firing and the production of the essential chrII partitioning proteins. Thus, by binding both RctB and ParB2, rctA serves as a nexus for regulatory cross-talk coordinating chrII replication and segregation.

Synthesis and electro-optic properties of the chromophore-containing NLO polyarylate polymers

Science.gov (United States)

Ren, Haohui; Peng, Chengcheng; Bo, Shuhui; Fan, Guofang; Xu, Guangming; Zhao, Hui; Zhen, Zhen; Liu, Xinhou

2014-03-01

Base on the same two monomers, diphenolic acid (DPA) and isophthaloyl chloride (IPC), three chromophore-containing nonlinear optical (NLO) polyarylate polymers were prepared. A tricyanofuran (TCF)-acceptor type chromophore group was in main-chain (mPAR-chr1), side-chain (sPAR-chr1) and side-chain with a 1,1-bis(4-hydroxyphenyl)-1-phenyl-2,2,2-trifluoroethane (BPAPF) group (sPAR-F-chr1), respectively. The obtained polymers were characterized and evaluated by UV-Vis, 1H NMR, DSC and TGA. All the polymers exhibited good electro-optic (EO) activity. The relationship between EO coefficients (r33) and the chromophore concentration of the three polymers were also characterized and discussed. There were no obvious differences found in EO activity between mPAR-chr1 and sPAR-chr1 polyarylates with the same chromophore. The fluorinated block polyarylate sPAR-F-chr1 has the largest r33 value in these three polyarylates which is 52 pm/V at the wavelength of 1310 nm (which is almost twice the r33 value of normal polymers contained the same chormophore at the same content), when the concentration of chromophore 1 is 18wt.%. 85% of the r33 value was retained in the sPAR-F-chr1 after being heated at 85°C for 600 hours. The polymer sPAR-F-chr1, with good solubility, high Tg (above 200 °C) and side functional group at the same time, may probably be a practical NLO material. These properties make the new polyarylates have potential applications in EO devices such as EO modulators and switches.

Bypass flow rate control method

International Nuclear Information System (INIS)

Kiyama, Yoichi.

1997-01-01

In a PWR type reactor, bypass flow rate is controlled by exchanging existent jetting hole plugs of a plurality of nozzles disposed to the upper end of incore structures in order to flow a portion of primary coolants as a bypass flow to the upper portion of the pressure vessel. Two kinds of exchange plugs, namely, a first plug and a second plug each having a jetting out hole of different diameter are used as exchange plugs. The first plug has the diameter as that of an existent plug and the second plug has a jetting out hole having larger diameter than that of the existent plug. Remained extent plugs are exchanged to a combination of the first and the second plugs without exchanging existent plugs having seizing with the nozzles, in which the number and the diameter of the jetting out holes of the second plugs are previously determined based on predetermined total bypass flow rate to be jetted from the entire plugs after exchange of plugs. (N.H.)

Standard Test Method for Measuring Fast-Neutron Reaction Rates by Radioactivation of Titanium

CERN Document Server

American Society for Testing and Materials. Philadelphia

2008-01-01

1.1 This test method covers procedures for measuring reaction rates by the activation reactions 46Ti(n,p) 46Sc + 47Ti(n, np)46Sc. Note 1—Since the cross section for the (n,np) reaction is relatively small for energies less than 12 MeV and is not easily distinguished from that of the (n,p) reaction, this test method will refer to the (n,p) reaction only. 1.2 The reaction is useful for measuring neutrons with energies above approximately 4.4 MeV and for irradiation times up to about 250 days (for longer irradiations, see Practice E 261). 1.3 With suitable techniques, fission-neutron fluence rates above 109 cm–2·s–1 can be determined. However, in the presence of a high thermal-neutron fluence rate, 46Sc depletion should be investigated. 1.4 Detailed procedures for other fast-neutron detectors are referenced in Practice E 261. 1.5 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.6 This standard does not purport to address all...

Impact of seeding rate, seeding date, rate and method of phosphorus application in faba bean (Vicia faba L. minor in the absence of moisture stress

Directory of Open Access Journals (Sweden)

Turk M.A.

2002-01-01

Full Text Available Field experiments were conducted during the winter seasons of 1998-1999, 1999-2000 and 2000-2001 at the semi-arid region in north of Jordan, to study the effect of seeding dates (14 January, 28 January and 12 February, seeding rates (50, 75 and 100 plants per metre, phosphorus levels (0, 17.5, 35.0 and 52.5 kg P per ha and two methods of P placement (banding and broadcast. Seeding rate, seeding date, and rate of phosphorus had a significant effect on most of the measured traits and the yield determinates. Method of phosphorus application had only a significant effect on seed yield and seed weight per plant. In general high yields were obtained by early seeding (14 January, high seeding rate (100-plant per square metre, and P application (52.5 kg P per ha drilled with the seed after cultivation (banded.

Efficient kinetic Monte Carlo method for reaction-diffusion problems with spatially varying annihilation rates

Science.gov (United States)

Schwarz, Karsten; Rieger, Heiko

2013-03-01

We present an efficient Monte Carlo method to simulate reaction-diffusion processes with spatially varying particle annihilation or transformation rates as it occurs for instance in the context of motor-driven intracellular transport. Like Green's function reaction dynamics and first-passage time methods, our algorithm avoids small diffusive hops by propagating sufficiently distant particles in large hops to the boundaries of protective domains. Since for spatially varying annihilation or transformation rates the single particle diffusion propagator is not known analytically, we present an algorithm that generates efficiently either particle displacements or annihilations with the correct statistics, as we prove rigorously. The numerical efficiency of the algorithm is demonstrated with an illustrative example.

ANSI/ASHRAE/IES Standard 90.1-2016 Performance Rating Method Reference Manual

Energy Technology Data Exchange (ETDEWEB)

Goel, Supriya [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Rosenberg, Michael I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Eley, Charles [Eley and Associates, Hobe Sound, FL (United States)

2017-09-29

This document is intended to be a reference manual for the Appendix G Performance Rating Method (PRM) of ANSI/ASHRAE/IES Standard 90.1-2016 (Standard 90.1-2016). The PRM can be used to demonstrate compliance with the standard and to rate the energy efficiency of commercial and high-rise residential buildings with designs that exceed the requirements of Standard 90.1. Use of the PRM for demonstrating compliance with Standard 90.1 is a new feature of the 2016 edition. The procedures and processes described in this manual are designed to provide consistency and accuracy by filling in gaps and providing additional details needed by users of the PRM.

Meta-analytic methods for pooling rates when follow-up duration varies: a case study.

Science.gov (United States)

Guevara, James P; Berlin, Jesse A; Wolf, Fredric M

2004-07-12

Meta-analysis can be used to pool rate measures across studies, but challenges arise when follow-up duration varies. Our objective was to compare different statistical approaches for pooling count data of varying follow-up times in terms of estimates of effect, precision, and clinical interpretability. We examined data from a published Cochrane Review of asthma self-management education in children. We selected two rate measures with the largest number of contributing studies: school absences and emergency room (ER) visits. We estimated fixed- and random-effects standardized weighted mean differences (SMD), stratified incidence rate differences (IRD), and stratified incidence rate ratios (IRR). We also fit Poisson regression models, which allowed for further adjustment for clustering by study. For both outcomes, all methods gave qualitatively similar estimates of effect in favor of the intervention. For school absences, SMD showed modest results in favor of the intervention (SMD -0.14, 95% CI -0.23 to -0.04). IRD implied that the intervention reduced school absences by 1.8 days per year (IRD -0.15 days/child-month, 95% CI -0.19 to -0.11), while IRR suggested a 14% reduction in absences (IRR 0.86, 95% CI 0.83 to 0.90). For ER visits, SMD showed a modest benefit in favor of the intervention (SMD -0.27, 95% CI: -0.45 to -0.09). IRD implied that the intervention reduced ER visits by 1 visit every 2 years (IRD -0.04 visits/child-month, 95% CI: -0.05 to -0.03), while IRR suggested a 34% reduction in ER visits (IRR 0.66, 95% CI 0.59 to 0.74). In Poisson models, adjustment for clustering lowered the precision of the estimates relative to stratified IRR results. For ER visits but not school absences, failure to incorporate study indicators resulted in a different estimate of effect (unadjusted IRR 0.77, 95% CI 0.59 to 0.99). Choice of method among the ones presented had little effect on inference but affected the clinical interpretability of the findings. Incidence rate

Dose Rate Experiment at JET for Benchmarking the Calculation Direct One Step Method

International Nuclear Information System (INIS)

Angelone, M.; Petrizzi, L.; Pillon, M.; Villari, R.; Popovichev, S.

2006-01-01

Neutrons produced by D-D and D-T plasmas induce the activation of tokamak materials and of components. The development of reliable methods to assess dose rates is a key issue for maintenance and operating nuclear machines, in normal and off-normal conditions. In the frame of the EFDA Fusion Technology work programme, a computational tool based upon MCNP Monte Carlo code has been developed to predict the dose rate after shutdown: it is called Direct One Step Method (D1S). The D1S is an innovative approach in which the decay gammas are coupled to the neutrons as in the prompt case and they are transported in one single step in the same run. Benchmarking of this new tool with experimental data taken in a complex geometry like that of a tokamak is a fundamental step to test the reliability of the D1S method. A dedicated benchmark experiment was proposed for the 2005-2006 experimental campaign of JET. Two irradiation positions have been selected for the benchmark: one inner position inside the vessel, not far from the plasma, called the 2 upper irradiation end (IE2), where neutron fluence is relatively high. The second position is just outside a vertical port in an external position (EX). Here the neutron flux is lower and the dose rate to be measured is not very far from the residual background. Passive detectors are used for in-vessel measurements: the high sensitivity Thermo Luminescent Dosimeters (TLDs) GR-200A (natural LiF), which ensure measurements down to environmental dose level. An active detector of Geiger-Muller (GM) type is used for out of vessel dose rate measurement. Before their use the detectors were calibrated in a secondary gamma-ray standard (Cs-137 and Co-60) facility in term of air-kerma. The background measurement was carried-out in the period July -September 2005 in the outside position EX using the GM tube and in September 2005 inside the vacuum vessel using TLD detectors located in the 2 Upper irradiation end IE2. In the present work

Sedimentation rate estimates in Sorsogon Bay, Philippines using 210Pb method

International Nuclear Information System (INIS)

Madrid, Jordan F.; Sta. Maria, Efren J.; Olivares, Ryan U.; Aniago, Ryan Joseph; Asa Anie Day DC; Dayaon, Jennyvi P.; Bulos, Adelina DM; Sombrito, Elvira Z.

2011-01-01

Sorsogon Bay has experienced a long history of recurring harmful algal blooms over the past few years. In an attempt to establish a chronology of events in the sediment layer, lead-210 ( 210 Pb) dating method has been utilized in estimating sedimentation rates from three selected areas along the bay. Based on the unsupported 210 Pb data and by applying the Constant Initial Concentration (CIC) model, the calculated sedimentation rates were 0.8, 1.3 and 1.8 cm yr 1 for sediment cores collected near the coastal areas of Castilla (SO-01), Sorsogon City (SO-07) and Cadacan River (SO-03), respectively. High sedimentation rates were measured in sediment cores believed to be affected from frequent volcanic ash releases and from areas near human settlement combined with intensive farming and agricultural activities. The collected sediments exhibited non-uniform down core values of dry bulk density and moisture content. This variation in measurements may indicate the general quality and composition of the sediment samples, i.e., amount of organic matter and grain size. The calculated sedimentation rates obtained provided an overview of the sedimentation processes and reflect the land use pattern around the bay which may help in understanding the history and distribution of materials and nutrient input relative to the occurrence of harmful algal bloom in the sediment columns. (author)

Water vapor mass balance method for determining air infiltration rates in houses

Science.gov (United States)

David R. DeWalle; Gordon M. Heisler

1980-01-01

A water vapor mass balance technique that includes the use of common humidity-control equipment can be used to determine average air infiltration rates in buildings. Only measurements of the humidity inside and outside the home, the mass of vapor exchanged by a humidifier/dehumidifier, and the volume of interior air space are needed. This method gives results that...

Calculation method of rate and area of sedimentation, by non-conventional mathematical process of data treatment

International Nuclear Information System (INIS)

Cota, P.L.

1987-01-01

The used methods for calculating the rate and area of sedimentation are based in techniques of graphical resolution. The solution of the problem by a mathematical resolution, using computational methods, is more fast and more accuracy. The comparison between the results from this methods and the conventional method is shown. (E.G.) [pt

Collecting Information for Rating Global Assessment of Functioning (GAF): Sources of Information and Methods for Information Collection.

Science.gov (United States)

I H, Monrad Aas

2014-11-01

Global Assessment of Functioning (GAF) is an assessment instrument that is known worldwide. It is widely used for rating the severity of illness. Results from evaluations in psychiatry should characterize the patients. Rating of GAF is based on collected information. The aim of the study is to identify the factors involved in collecting information that is relevant for rating GAF, and gaps in knowledge where it is likely that further development would play a role for improved scoring. A literature search was conducted with a combination of thorough hand search and search in the bibliographic databases PubMed, PsycINFO, Google Scholar, and Campbell Collaboration Library of Systematic Reviews. Collection of information for rating GAF depends on two fundamental factors: the sources of information and the methods for information collection. Sources of information are patients, informants, health personnel, medical records, letters of referral and police records about violence and substance abuse. Methods for information collection include the many different types of interview - unstructured, semi-structured, structured, interviews for Axis I and II disorders, semistructured interviews for rating GAF, and interviews of informants - as well as instruments for rating symptoms and functioning, and observation. The different sources of information, and methods for collection, frequently result in inconsistencies in the information collected. The variation in collected information, and lack of a generally accepted algorithm for combining collected information, is likely to be important for rated GAF values, but there is a fundamental lack of knowledge about the degree of importance. Research to improve GAF has not reached a high level. Rated GAF values are likely to be influenced by both the sources of information used and the methods employed for information collection, but the lack of research-based information about these influences is fundamental. Further development of

How Well Can We Detect Lineage-Specific Diversification-Rate Shifts? A Simulation Study of Sequential AIC Methods.

Science.gov (United States)

May, Michael R; Moore, Brian R

2016-11-01

Evolutionary biologists have long been fascinated by the extreme differences in species numbers across branches of the Tree of Life. This has motivated the development of statistical methods for detecting shifts in the rate of lineage diversification across the branches of phylogenic trees. One of the most frequently used methods, MEDUSA, explores a set of diversification-rate models, where each model assigns branches of the phylogeny to a set of diversification-rate categories. Each model is first fit to the data, and the Akaike information criterion (AIC) is then used to identify the optimal diversification model. Surprisingly, the statistical behavior of this popular method is uncharacterized, which is a concern in light of: (1) the poor performance of the AIC as a means of choosing among models in other phylogenetic contexts; (2) the ad hoc algorithm used to visit diversification models, and; (3) errors that we reveal in the likelihood function used to fit diversification models to the phylogenetic data. Here, we perform an extensive simulation study demonstrating that MEDUSA (1) has a high false-discovery rate (on average, spurious diversification-rate shifts are identified [Formula: see text] of the time), and (2) provides biased estimates of diversification-rate parameters. Understanding the statistical behavior of MEDUSA is critical both to empirical researchers-in order to clarify whether these methods can make reliable inferences from empirical datasets-and to theoretical biologists-in order to clarify the specific problems that need to be solved in order to develop more reliable approaches for detecting shifts in the rate of lineage diversification. [Akaike information criterion; extinction; lineage-specific diversification rates; phylogenetic model selection; speciation.]. © The Author(s) 2016. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

Association Mapping of Ferrous, Zinc, and Aluminum Tolerance at the Seedling Stage in Indica Rice using MAGIC Populations

Directory of Open Access Journals (Sweden)

Lijun Meng

2017-10-01

Full Text Available Excessive amounts of metal are toxic and severely affect plant growth and development. Understanding the genetic control of metal tolerance is crucial to improve rice resistance to Fe, Zn, and Al toxicity. The multi-parent advanced generation inter-cross (MAGIC populations were genotyped using a 55 K rice SNP array and screened at the seedling stage for Fe, Zn, and Al toxicity using a hydroponics system. Association analysis was conducted by implementing a mixed linear model (MLM for each of the five MAGIC populations double cross DC1 (founders were SAGC-08, HHZ5-SAL9-Y3-Y1, BP1976B-2-3-7-TB-1-1, PR33282-B-8-1-1-1-1-1, double cross DC2 (founders of double cross were FFZ1, CT 16658-5-2-2SR-2-3-6MP, IR 68, IR 02A127, eight parents population 8way (founders were SAGC-08, HHZ5-SAL9-Y3-Y1, BP1976B-2-3-7-TB-1-1, PR33282-B-8-1-1-1-1-1, FFZ1, CT 16658-5-2-2SR-2-3-6MP, IR 68, IR 02A127, DC12 (DC1+DC2 and rice multi-parent recombinant inbred line population RMPRIL (DC1+DC2+8way. A total of 21, 30, and 21 QTL were identified for Fe, Zn, and Al toxicity tolerance, respectively. For multi tolerance (MT as Fe, Zn, and Al tolerance-related traits, three genomic regions, MT1.1 (chr.1: 35.4–36.3 Mb, MT1.2 (chr.1: 35.4–36.3 Mb, and MT3.2 (chr.3: 35.4-36.2 Mb harbored QTL. The chromosomal regions MT2.1 (chr.2: 2.4–2.8 Mb, MT2.2 (chr.2: 24.5–25.8 Mb, MT4 (chr.4: 1.2 Mb Mb, MT8.1 (chr.8: 0.7–0.9 Mb, and MT8.2 (chr.8: 2.2–2.4 Mb harbored QTL for Fe and Zn tolerance, while MT2.3 (chr.2: 30.5–31.6 Mb, MT3.1 (chr.3: 12.5–12.8 Mb, and MT6 (chr.6: 2.0–3.0 Mb possessed QTL for Al and Zn tolerance. The chromosomal region MT9.1 (chr.9: 14.2–14.7 Mb possessed QTL for Fe and Al tolerance. A total of 11 QTL were detected across different MAGIC populations and 12 clustered regions were detected under different metal conditions, suggesting that these genomic regions might constitute valuable regions for further marker-assisted selection (MAS in breeding

Method of measuring the mass flow rate of a substance entering a cocurrent fluid stream

International Nuclear Information System (INIS)

Cochran, H.D. Jr.

1978-01-01

An improved method of monitoring the mass flow rate of a substance entering a coherent fluid stream is described. The method very basically consists of heating equal sections of the fluid stream above and below the point of entry of the substance to be monitored, and measuring and comparing the resulting change in temperature of the sections. Advantage is taken of the difference in thermal characteristics of the fluid and the substance to be measured to correlate temperature differences in the sections above and below the substance feed point for providing an indication of the mass flow rate of the substance

Effects of test method and participant musical training on preference ratings of stimuli with different reverberation times.

Science.gov (United States)

Lawless, Martin S; Vigeant, Michelle C

2017-10-01

Selecting an appropriate listening test design for concert hall research depends on several factors, including listening test method and participant critical-listening experience. Although expert listeners afford more reliable data, their perceptions may not be broadly representative. The present paper contains two studies that examined the validity and reliability of the data obtained from two listening test methods, a successive and a comparative method, and two types of participants, musicians and non-musicians. Participants rated their overall preference of auralizations generated from eight concert hall conditions with a range of reverberation times (0.0-7.2 s). Study 1, with 34 participants, assessed the two methods. The comparative method yielded similar results and reliability as the successive method. Additionally, the comparative method was rated as less difficult and more preferable. For study 2, an additional 37 participants rated the stimuli using the comparative method only. An analysis of variance of the responses from both studies revealed that musicians are better than non-musicians at discerning their preferences across stimuli. This result was confirmed with a k-means clustering analysis on the entire dataset that revealed five preference groups. Four groups exhibited clear preferences to the stimuli, while the fifth group, predominantly comprising non-musicians, demonstrated no clear preference.

Methods of analysis speech rate: a pilot study.

Science.gov (United States)

Costa, Luanna Maria Oliveira; Martins-Reis, Vanessa de Oliveira; Celeste, Letícia Côrrea

2016-01-01

To describe the performance of fluent adults in different measures of speech rate. The study included 24 fluent adults, of both genders, speakers of Brazilian Portuguese, who were born and still living in the metropolitan region of Belo Horizonte, state of Minas Gerais, aged between 18 and 59 years. Participants were grouped by age: G1 (18-29 years), G2 (30-39 years), G3 (40-49 years), and G4 (50-59 years). The speech samples were obtained following the methodology of the Speech Fluency Assessment Protocol. In addition to the measures of speech rate proposed by the protocol (speech rate in words and syllables per minute), the rate of speech into phonemes per second and the articulation rate with and without the disfluencies were calculated. We used the nonparametric Friedman test and the Wilcoxon test for multiple comparisons. Groups were compared using the nonparametric Kruskal Wallis. The significance level was of 5%. There were significant differences between measures of speech rate involving syllables. The multiple comparisons showed that all the three measures were different. There was no effect of age for the studied measures. These findings corroborate previous studies. The inclusion of temporal acoustic measures such as speech rate in phonemes per second and articulation rates with and without disfluencies can be a complementary approach in the evaluation of speech rate.

Standard Test Method for Measuring Fast-Neutron Reaction Rates by Radioactivation of Niobium

CERN Document Server

American Society for Testing and Materials. Philadelphia

2008-01-01

1.1 This test method describes procedures for measuring reaction rates by the activation reaction 93Nb(n,n′)93mNb. 1.2 This activation reaction is useful for monitoring neutrons with energies above approximately 0.5 MeV and for irradiation times up to about 30 years. 1.3 With suitable techniques, fast-neutron reaction rates for neutrons with energy distribution similar to fission neutrons can be determined in fast-neutron fluences above about 1016cm−2. In the presence of high thermal-neutron fluence rates (>1012cm−2·s−1), the transmutation of 93mNb due to neutron capture should be investigated. In the presence of high-energy neutron spectra such as are associated with fusion and spallation sources, the transmutation of 93mNb by reactions such as (n,2n) may occur and should be investigated. 1.4 Procedures for other fast-neutron monitors are referenced in Practice E 261. 1.5 Fast-neutron fluence rates can be determined from the reaction rates provided that the appropriate cross section information ...

Input data preprocessing method for exchange rate forecasting via neural network

Directory of Open Access Journals (Sweden)

Antić Dragan S.

2014-01-01

Full Text Available The aim of this paper is to present a method for neural network input parameters selection and preprocessing. The purpose of this network is to forecast foreign exchange rates using artificial intelligence. Two data sets are formed for two different economic systems. Each system is represented by six categories with 70 economic parameters which are used in the analysis. Reduction of these parameters within each category was performed by using the principal component analysis method. Component interdependencies are established and relations between them are formed. Newly formed relations were used to create input vectors of a neural network. The multilayer feed forward neural network is formed and trained using batch training. Finally, simulation results are presented and it is concluded that input data preparation method is an effective way for preprocessing neural network data. [Projekat Ministarstva nauke Republike Srbije, br.TR 35005, br. III 43007 i br. III 44006

Serum hepcidin-25 may replace the ferritin index in the Thomas plot in assessing iron status in anemic patients.

Science.gov (United States)

Thomas, C; Kobold, U; Balan, S; Roeddiger, R; Thomas, L

2011-04-01

Biochemical markers of iron deficiency do not distinguish iron-deficient anemia (IDA) from the anemia of chronic disease (ACD) and the combined state of ACD/IDA. Serum hepcidin-25 might be a marker resolving this problem. We investigated the extent to which serum hepcidin-25 enables the differentiation of the states above in comparison with the ferritin index plot, the so-called Thomas plot [soluble transferrin receptor (sTfR)/log ferritin and the reticulocyte hemoglobin content (CHr)]. Serum hepcidin-25 was determined in 155 anemic patients who were classified as having latent iron deficiency (latent ID), IDA, ACD, or ACD/IDA using the ferritin index plot (Thomas plot). Hepcidin-25 was determined using an isotope-dilution micro-HPLC-tandem mass spectrometry method. The ability to discriminate among these states based on serum hepcidin-25 alone or in combination with the CHr was evaluated in a receiver operating characteristic curve analysis and a comparison with the recently established ferritin index plot. Serum hepcidin-25 correlated with ferritin and the ferritin index. Use of a hepcidin-25 cutoff level of ≤4 nmol/l allowed the differentiation of IDA from ACD and ACD/IDA. Furthermore, the discrimination of ACD/IDA from ACD required combination with CHr in a new plot (hepcidin-25 and the CHr). The hepcidin-25 plot and the ferritin index plot showed a good correspondence in the differentiation of iron states in patients with anemia. Patients with IDA can be differentiated from ACD and ACD/IDA but not ACD from ACD/IDA based on hepcidin-25 alone. The combination of hepcidin-25 with CHr in the hepcidin-25 plot was useful for the differentiation of the states above. © 2010 Blackwell Publishing Ltd.

Accretion rate in mangroves sediment at Sungai Miang, Pahang, Malaysia: 230Thexcess versus artificial horizon marker method

International Nuclear Information System (INIS)

Kamaruzzaman Yunus; Jamil Tajam; Hasrizal Shaari; Noor Azhar Mohd Shazili; Misbahul Mohd Amin

2008-01-01

Mangroves have enormous ecological value and one of their important role is to act as an efficient sediment trappers which dominantly supplied by rivers and the atmosphere to the oceans. Applying the 230 Th excess method, an average accretion rate of 0.54 cm yr -1 was obtained. this is comparable to that of an artificial horizon marker method giving an average of 0.54 cm yr -1 . The 230 Th excess method provides a rapid and simple method of evaluating 230 Th excess accumulation histories in sediment cores. Sample preparation is also significantly simplified, thus providing a relatively quick and easy method for the determination of the accretion rate in mangrove area. (author)

Comparison and limitations of three different bulk etch rate measurement methods used for gamma irradiated PM-355 detectors

Energy Technology Data Exchange (ETDEWEB)

Fazal-ur-Rehman E-mail: fazalr@kfupm.edu.sa; Abu-Jarad, F.; Al-Jarallah, M.I.; Farhat, M

2001-06-01

Samples of Nuclear Track Detectors (PM-355) were exposed to high gamma doses from 1x10{sup 5} Gy (10 Mrad) up to 1.2x10{sup 6} Gy (120 Mrad) at an incremental dose of 1x10{sup 5} Gy (10 Mrad). The gamma source was a 9.03 PBq (244 kCi) Co-60 source used for sterilization of medical syringes. The bulk etch rate (V{sub b}) was measured for various high gamma doses by three different methods: 1--thickness change method; 2--mass change method; 3--fission track diametric method. The study gives a comparison and limitations of these three methods used for bulk etch rate measurements in the detectors as a function of high gamma doses. The track etch rate (V{sub t}) and the sensitivity (V) of the detector were also measured using the fission track diametric method. It was observed that V{sub b} increases with the increase of the gamma absorbed dose at a fixed etching time in each bulk etch measuring method. The bulk etch rate decreases exponentially with the etching time at a fixed gamma absorbed dose in all three methods. The thickness change and mass change methods have successfully been applied to measure V{sub b} at higher gamma doses up to 1.2x10{sup 6} Gy (120 Mrad). The bulk etch rate determined by the mass change and thickness change methods was almost the same at a certain gamma dose and etching time whereas it was quite low in the case of the fission track diametric method due to its limitations at higher doses. Also in this method it was not possible to measure the fission fragment track diameters at higher doses due to the quick disappearance of the fission tracks and therefore the V{sub b} could not be estimated at higher gamma doses.

Investigation of the existing methodology of value estimation and methods of discount rate estimation

OpenAIRE

Plikus, Iryna

2017-01-01

The subject of research is the current practice of determining the fair value of assets and liabilities at the present (discounted) cost. One of the most problematic places is the determination of the discount rate, which belongs to the jurisdiction of a professional accountant judgment.The methods of formalization, hypothetical assumption, system approach and scientific abstraction in substantiating the formation of accounting policy with respect to the choice of the discount rate are used i...

A Globally Convergent Matrix-Free Method for Constrained Equations and Its Linear Convergence Rate

Directory of Open Access Journals (Sweden)

Min Sun

2014-01-01

Full Text Available A matrix-free method for constrained equations is proposed, which is a combination of the well-known PRP (Polak-Ribière-Polyak conjugate gradient method and the famous hyperplane projection method. The new method is not only derivative-free, but also completely matrix-free, and consequently, it can be applied to solve large-scale constrained equations. We obtain global convergence of the new method without any differentiability requirement on the constrained equations. Compared with the existing gradient methods for solving such problem, the new method possesses linear convergence rate under standard conditions, and a relax factor γ is attached in the update step to accelerate convergence. Preliminary numerical results show that it is promising in practice.

An alternative radiometric method for calculating the sedimentation rates: Application to an intertidal region (SW of Spain)

Energy Technology Data Exchange (ETDEWEB)

Ligero, R.A., E-mail: rufino.ligero@uca.e [Departamento de Fisica Aplicada, Universidad de Cadiz, 11510 Puerto Real, Cadiz (Spain); Casas-Ruiz, M. [Departamento de Fisica Aplicada, Universidad de Cadiz, 11510 Puerto Real, Cadiz (Spain); Barrera, M. [Departamento de Medio Ambiente, CIEMAT, Madrid 28040 (Spain); Barbero, L. [Departamento de Ciencias de la Tierra, Universidad de Cadiz, 11510 Puerto Real (Spain); Melendez, M.J. [Departamento de Fisica Aplicada, Universidad de Cadiz, 11510 Puerto Real, Cadiz (Spain)

2010-09-15

A new method using the inventory determined for the activity of the radionuclide {sup 137}Cs, coming from global radioactive fallout has been utilised to calculate the sedimentation rates. The method has been applied in a wide intertidal region in the Bay of Cadiz Natural Park (SW Spain). The sedimentation rates estimated by the {sup 137}Cs inventory method ranged from 0.26 cm/year to 1.72 cm/year. The average value of the sedimentation rate obtained is 0.59 cm/year, and this rate has been compared with those resulting from the application of the {sup 210}Pb dating technique. A good agreement between the two procedures has been found. From the study carried out, it has been possible for the first time, to draw a map of sedimentation rates for this zone where numerous physico-chemical, oceanographic and ecological studies converge, since it is situated in a region of great environmental interest. This area, which is representative of common environmental coastal scenarios, is particularly sensitive to perturbations related to climate change, and the results of the study will allow to make short and medium term evaluations of this change.

Single- versus multiple-sample method to measure glomerular filtration rate.

Science.gov (United States)

Delanaye, Pierre; Flamant, Martin; Dubourg, Laurence; Vidal-Petiot, Emmanuelle; Lemoine, Sandrine; Cavalier, Etienne; Schaeffner, Elke; Ebert, Natalie; Pottel, Hans

2018-01-08

There are many different ways to measure glomerular filtration rate (GFR) using various exogenous filtration markers, each having their own strengths and limitations. However, not only the marker, but also the methodology may vary in many ways, including the use of urinary or plasma clearance, and, in the case of plasma clearance, the number of time points used to calculate the area under the concentration-time curve, ranging from only one (Jacobsson method) to eight (or more) blood samples. We collected the results obtained from 5106 plasma clearances (iohexol or 51Cr-ethylenediaminetetraacetic acid (EDTA)) using three to four time points, allowing GFR calculation using the slope-intercept method and the Bröchner-Mortensen correction. For each time point, the Jacobsson formula was applied to obtain the single-sample GFR. We used Bland-Altman plots to determine the accuracy of the Jacobsson method at each time point. The single-sample method showed within 10% concordances with the multiple-sample method of 66.4%, 83.6%, 91.4% and 96.0% at the time points 120, 180, 240 and ≥300 min, respectively. Concordance was poorer at lower GFR levels, and this trend is in parallel with increasing age. Results were similar in males and females. Some discordance was found in the obese subjects. Single-sample GFR is highly concordant with a multiple-sample strategy, except in the low GFR range (<30 mL/min). © The Author 2018. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

Novel driver method to improve ordinary CCD frame rate for high-speed imaging diagnosis

Energy Technology Data Exchange (ETDEWEB)

Luo, Tong-Ding, E-mail: snuohui@126.com; Li, Bin-Kang; Yang, Shao-Hua; Guo, Ming-An; Yan, Ming

2016-06-21

The use of ordinary Charge-coupled-Device (CCD) imagers for the analysis of fast physical phenomenon is restricted because of the low-speed performance resulting from their long output times. Even though the form of Intensified-CCD (ICCD), coupled with a gated image intensifier, has extended their use for high speed imaging, the deficiency remains to be solved that ICDD could record only one image in a single shot. This paper presents a novel driver method designed to significantly improve the ordinary interline CCD burst frame rate for high-speed photography. This method is based on the use of vertical registers as storage, so that a small number of additional frames comprised of reduced-spatial-resolution images obtained via a specific sampling operation can be buffered. Hence, the interval time of the received series of images is related to the exposure and vertical transfer times only and, thus, the burst frame rate can be increased significantly. A prototype camera based on this method is designed as part of this study, exhibiting a burst rate of up to 250,000 frames per second (fps) and a capacity to record three continuous images. This device exhibits a speed enhancement of approximately 16,000 times compared with the conventional speed, with a spatial resolution reduction of only 1/4.

A high count rate position decoding and energy measuring method for nuclear cameras using Anger logic detectors

International Nuclear Information System (INIS)

Wong, W.H.; Li, H.; Uribe, J.

1998-01-01

A new method for processing signals from Anger position-sensitive detectors used in gamma cameras and PET is proposed for very high count-rate imaging where multiple-event pileups are the norm. This method is designed to sort out and recover every impinging event from multiple-event pileups while maximizing the collection of scintillation signal for every event to achieve optimal accuracy in the measurement of energy and position. For every detected event, this method cancels the remnant signals from previous events, and excludes the pileup of signals from following events. The remnant subtraction is exact even for multiple pileup events. A prototype circuit for energy recovery demonstrated that the maximum count rates can be increased by more than 10 times comparing to the pulse-shaping method, and the energy resolution is as good as pulse shaping (or fixed integration) at low count rates. At 2 x 10 6 events/sec on NaI(Tl), the true counts acquired with this method is 3.3 times more than the delay-line clipping method (256 ns clipping) due to events recovered from pileups. Pulse-height spectra up to 3.5 x 10 6 events/sec have been studied. Monte Carlo simulation studies have been performed for image-quality comparisons between different processing methods

Standard practice for measurement of the glass dissolution rate using the single-pass flow-through test method

CERN Document Server

American Society for Testing and Materials. Philadelphia

2010-01-01

1.1 This practice describes a single-pass flow-through (SPFT) test method that can be used to measure the dissolution rate of a homogeneous silicate glass, including nuclear waste glasses, in various test solutions at temperatures less than 100°C. Tests may be conducted under conditions in which the effects from dissolved species on the dissolution rate are minimized to measure the forward dissolution rate at specific values of temperature and pH, or to measure the dependence of the dissolution rate on the concentrations of various solute species. 1.2 Tests are conducted by pumping solutions in either a continuous or pulsed flow mode through a reaction cell that contains the test specimen. Tests must be conducted at several solution flow rates to evaluate the effect of the flow rate on the glass dissolution rate. 1.3 This practice excludes static test methods in which flow is simulated by manually removing solution from the reaction cell and replacing it with fresh solution. 1.4 Tests may be conducted wit...

Household projections by the headship rates method: The case of Serbia

Directory of Open Access Journals (Sweden)

Vasić Petar

2017-01-01

Full Text Available The headship rates method (HRM of household projections based on the share of household heads in the total population of the same demographic characteristics (age, sex, nationality, marital status, etc. is the most commonly used method, especially by statistical institutes and planning institutions. The specific rates of household heads by age are calculated by dividing the number of household holders of a certain age with the total number of residents of the appropriate age. The future number of households is then simply projected on the basis of population projections by age and assumptions about the future changes of HR. The HRM is based on the projection of the future age structure of the population. In that sense, the choice of methods of population projection, as well as the method of projecting HR-s have determining impact on the outcome of household projections. Given the methodological inconsistency typical for official population projections in Serbia and significant differences in addressing uncertainty of the future population change between deterministic and probabilistic approach in making population projections, the decision to use a probabilistic projection of the population of Serbia as the basis for calculating the future number of house-holds and their structure according to the age of the household head proved to be a logical choice. However, as the basic aim of this article is to show the simple method of household projections, the above-mentioned stochastic projection is used in utterly deterministic manner. The median of the prediction interval of the population distributed across age is interpreted as the most probable future, or as a prognosis. The HR-s based on the age structure estimates and estimated number of households by age of the household head from Household budget survey (HBS are used for the purpose of HR projecting so that the number of observations would be large enough for calculating inclination parameters

Time-trends in method-specific suicide rates compared with the availability of specific compounds

DEFF Research Database (Denmark)

Nordentoft, Merete; Qin, Ping; Helweg-Larsen, Karin

2006-01-01

Restriction of means for suicide is an important part of suicide preventive strategies in different countries. All suicides in Denmark between 1970 and 2000 were examined with regard to method used for suicide. Overall suicide mortality and method-specific suicide mortality was compared...... in the number of suicides by self-poisoning with these compounds. Restricted access occurred concomittantly with a 55% decrease in suicide rate....

Effects of cooking methods and starch structures on starch hydrolysis rates of rice.

Science.gov (United States)

Reed, Michael O; Ai, Yongfeng; Leutcher, Josh L; Jane, Jay-lin

2013-07-01

This study aimed to understand effects of different cooking methods, including steamed, pilaf, and traditional stir-fried, on starch hydrolysis rates of rice. Rice grains of 3 varieties, japonica, indica, and waxy, were used for the study. Rice starch was isolated from the grain and characterized. Amylose contents of starches from japonica, indica, and waxy rice were 13.5%, 18.0%, and 0.9%, respectively. The onset gelatinization temperature of indica starch (71.6 °C) was higher than that of the japonica and waxy starch (56.0 and 56.8 °C, respectively). The difference was attributed to longer amylopectin branch chains of the indica starch. Starch hydrolysis rates and resistant starch (RS) contents of the rice varieties differed after they were cooked using different methods. Stir-fried rice displayed the least starch hydrolysis rate followed by pilaf rice and steamed rice for each rice variety. RS contents of freshly steamed japonica, indica, and waxy rice were 0.7%, 6.6%, and 1.3%, respectively; those of rice pilaf were 12.1%, 13.2%, and 3.4%, respectively; and the stir-fried rice displayed the largest RS contents of 15.8%, 16.6%, and 12.1%, respectively. Mechanisms of the large RS contents of the stir-fried rice were studied. With the least starch hydrolysis rate and the largest RS content, stir-fried rice would be a desirable way of preparing rice for food to reduce postprandial blood glucose and insulin responses and to improve colon health of humans. © 2013 Institute of Food Technologists®

Tumor-specific chromosome mis-segregation controls cancer plasticity by maintaining tumor heterogeneity.

Directory of Open Access Journals (Sweden)

Yuanjie Hu

Full Text Available Aneuploidy with chromosome instability is a cancer hallmark. We studied chromosome 7 (Chr7 copy number variation (CNV in gliomas and in primary cultures derived from them. We found tumor heterogeneity with cells having Chr7-CNV commonly occurs in gliomas, with a higher percentage of cells in high-grade gliomas carrying more than 2 copies of Chr7, as compared to low-grade gliomas. Interestingly, all Chr7-aneuploid cell types in the parental culture of established glioma cell lines reappeared in single-cell-derived subcultures. We then characterized the biology of three syngeneic glioma cultures dominated by different Chr7-aneuploid cell types. We found phenotypic divergence for cells following Chr7 mis-segregation, which benefited overall tumor growth in vitro and in vivo. Mathematical modeling suggested the involvement of chromosome instability and interactions among cell subpopulations in restoring the optimal equilibrium of tumor cell types. Both our experimental data and mathematical modeling demonstrated that the complexity of tumor heterogeneity could be enhanced by the existence of chromosomes with structural abnormality, in addition to their mis-segregations. Overall, our findings show, for the first time, the involvement of chromosome instability in maintaining tumor heterogeneity, which underlies the enhanced growth, persistence and treatment resistance of cancers.

Intracavitary after loading techniques, advantages and disadvantages with high and low dose-rate methods

International Nuclear Information System (INIS)

Walstam, Rune

1980-01-01

Even though suggested as early as 1903, it is only when suitable sealed gamma sources became available, afterloading methods could be developed for interstitial as well as intracavitary work. Manual afterloading technique can be used only for low dose rate irradiation, while remote controlled afterloading technique can be used for both low and high dose-rate irradiation. Afterloading units used at the Karolinska Institute, Stockholm, are described, and experience of their use is narrated briefly. (M.G.B.)

Measurement of gastric emptying rate in humans. Simplified scanning method

Energy Technology Data Exchange (ETDEWEB)

Holt, S.; Colliver, J.; Guram, M.; Neal, C.; Verhulst, S.J.; Taylor, T.V. (Univ. of South Carolina School of Medicine, Columbia (USA))

1990-11-01

Simultaneous measurements of the gastric emptying rate of the solid and liquid phase of a dual-isotope-labeled test meal were made using a gamma camera and a simple scintillation detector, similar to that used in a hand-held probe. A simple scanning apparatus, similar to that used in a hand-held scintillation probe, was compared with simultaneous measurements made by a gamma camera in 16 healthy males. A dual-labeled test meal was utilized to measure liquid and solid emptying simultaneously. Anterior and posterior scans were taken at intervals up to 120 min using both a gamma camera and the scintillation probe. Good relative agreement between the methods was obtained both for solid-phase (correlation range 0.92-0.99, mean 0.97) and for liquid-phase data (correlation range 0.93-0.99, mean 0.97). For solid emptying data regression line slopes varied from 0.75 to 1.03 (mean 0.84). Liquid emptying data indicated that slopes ranged from 0.71 to 1.06 (mean 0.87). These results suggested that an estimate of the gamma measurement could be obtained by multiplying the scintillation measurement by a factor of 0.84 for the solid phase and 0.87 for the liquid phase. Correlation between repeat studies was 0.97 and 0.96 for solids and liquids, respectively. The application of a hand-held probe technique provides a noninvasive and inexpensive method for accurately assessing solid- and liquid-phase gastric emptying from the human stomach that correlates well with the use of a gamma camera, within the range of gastric emptying rate in the normal individuals in this study.

Measurement of gastric emptying rate in humans. Simplified scanning method

International Nuclear Information System (INIS)

Holt, S.; Colliver, J.; Guram, M.; Neal, C.; Verhulst, S.J.; Taylor, T.V.

1990-01-01

Simultaneous measurements of the gastric emptying rate of the solid and liquid phase of a dual-isotope-labeled test meal were made using a gamma camera and a simple scintillation detector, similar to that used in a hand-held probe. A simple scanning apparatus, similar to that used in a hand-held scintillation probe, was compared with simultaneous measurements made by a gamma camera in 16 healthy males. A dual-labeled test meal was utilized to measure liquid and solid emptying simultaneously. Anterior and posterior scans were taken at intervals up to 120 min using both a gamma camera and the scintillation probe. Good relative agreement between the methods was obtained both for solid-phase (correlation range 0.92-0.99, mean 0.97) and for liquid-phase data (correlation range 0.93-0.99, mean 0.97). For solid emptying data regression line slopes varied from 0.75 to 1.03 (mean 0.84). Liquid emptying data indicated that slopes ranged from 0.71 to 1.06 (mean 0.87). These results suggested that an estimate of the gamma measurement could be obtained by multiplying the scintillation measurement by a factor of 0.84 for the solid phase and 0.87 for the liquid phase. Correlation between repeat studies was 0.97 and 0.96 for solids and liquids, respectively. The application of a hand-held probe technique provides a noninvasive and inexpensive method for accurately assessing solid- and liquid-phase gastric emptying from the human stomach that correlates well with the use of a gamma camera, within the range of gastric emptying rate in the normal individuals in this study

41 CFR 302-7.14 - Are there any disadvantages to using the commuted rate method for transporting HHG, PBP&E and...

Science.gov (United States)

2010-07-01

... disadvantages to using the commuted rate method for transporting HHG, PBP&E and temporary storage? 302-7.14... disadvantages to using the commuted rate method for transporting HHG, PBP&E and temporary storage? Yes. The disadvantages to using the commuted rate method for transporting HHG, PBP&E and temporary storage are that the...

Rapid and accurate processing method for amide proton exchange rate measurement in proteins

International Nuclear Information System (INIS)

Koskela, Harri; Heikkinen, Outi; Kilpelaeinen, Ilkka; Heikkinen, Sami

2007-01-01

Exchange between protein backbone amide hydrogen and water gives relevant information about solvent accessibility and protein secondary structure stability. NMR spectroscopy provides a convenient tool to study these dynamic processes with saturation transfer experiments. Processing of this type of NMR spectra has traditionally required peak integration followed by exponential fitting, which can be tedious with large data sets. We propose here a computer-aided method that applies inverse Laplace transform in the exchange rate measurement. With this approach, the determination of exchange rates can be automated, and reliable results can be acquired rapidly without a need for manual processing

A method for studying post-fledging survival rates using data from ringing recoveries

NARCIS (Netherlands)

Thomson, D.L.; Baillie, S.R.; Peach, W.J.

1999-01-01

We present a method for studying post-fledging survival rates from data on national ringing recoveries. The approach extends the classical two-age-class models of Brownie et al. (1985) to include a third age-class of birds ringed as nestlings. The models can incorporate age-class-specific and

Effects of landforms on the erosion rate in a small watershed by the 137Cs tracing method

International Nuclear Information System (INIS)

Li Mian; Yao Wenyi; Li Zhanbin; Liu Puling; Shen Zhenzhou

2010-01-01

It's very important to analyze and evaluate quantitatively the effects of landforms on soil erosion for the prevention and treatment of soil loss in a small watershed. The objective of this study was to evaluate the effects of landform factors on erosion rate by the 137 Cs tracing method in a small watershed in the Purple Hilly Area of China. The erosion rates under different slope lengths, slope gradients and slope aspects were estimated in Xiangshuitan watershed in the Purple Hilly Area in Sichuan Basin by the 137 Cs tracing method. The results showed that the erosion rate decreased exponentially with downslope distance, and it increased with increasing slope gradient during the scope of 5 deg. - 16 deg. The slope aspect had great impact on the erosion rate, and the hillside on the sunny slope had larger erosion rate than that on the shady slope, particularly for the farmland.

Flow-rate measurement using radioactive tracers and transit time method

International Nuclear Information System (INIS)

Turtiainen, Heikki

1986-08-01

The transit time method is a flow measurement method based on tracer techniques. Measurement is done by injecting to the flow a pulse of tracer and measuring its transit time between two detection positions. From the transit time the mean flow velosity and - using the pipe cross section area - the volume flow rate can be calculated. When a radioisotope tracer is used the measurement can be done from outside the pipe and without disturbing the process (excluding the tracer injection). The use of the transit time method has been limited because of difficulties associated with handling and availability of radioactive tracers and lack of equipment suitable for routine use in industrial environments. The purpose of this study was to find out if these difficulties may be overcome by using a portable isotope generator as a tracer source and automating the measurement. In the study a test rig and measuring equipment based on the use of a ''1''3''7Cs/''1''3''7''''mBa isotope generator were constructed. They were used to study the accuracy and error sources of the method and to compare different algorithms to calculate the transit time. The usability of the method and the equipment in industrial environments were studied by carrying out over 20 flow measurements in paper and pulp mills. On the basis of the results of the study, a project for constructing a compact radiatracer flowmeter for industrial use has been started. The application range of this kind of meter is very large. The most obvious applications are in situ calibration of flowmeters, material and energy balance studies, process equipment analyses (e.g. pump efficiency analyses). At the moment tracer techniques are the only methods applicable to these measurements on-line and with sufficient accuracy

Perceived social stress and symptom severity among help-seeking adolescents with versus without clinical high-risk for psychosis.

Science.gov (United States)

Millman, Zachary B; Pitts, Steven C; Thompson, Elizabeth; Kline, Emily R; Demro, Caroline; Weintraub, Marc J; DeVylder, Jordan E; Mittal, Vijay A; Reeves, Gloria M; Schiffman, Jason

2018-02-01

Research suggests that social stress exposure influences illness presentation and course among youth at clinical high-risk (CHR) for psychosis, though less is known about the extent to which self-reported perceptions of social stress relate to the severity of positive symptoms. Importantly, despite the notion that youth at CHR are especially susceptible to elevations in positive symptoms under conditions of stress, no study has examined this presumption relative to other psychiatric groups. Extending previous work demonstrating that perceived social stress was higher in a CHR group than in a clinical group of non-CHR, help-seeking controls, the current study aimed to: (1) examine whether perceived social stress is related to the severity of attenuated positive symptoms in the full sample (N=110); and (2) determine whether CHR status moderates the stress-symptom relation. Exploratory analyses examined relations of perceived social stress to negative, disorganized, and general symptoms. Greater perceptions of social stress were associated with more severe positive symptoms in the entire sample; however, although positive symptoms and perceived social stress were higher in the CHR group, the strength of this relation was statistically indistinguishable across groups. No differential effect of perceived social stress was observed for any symptom domain. Results provide some support for the diathesis-stress model of psychosis, while also suggesting that social stress and symptomatology are related independent of clinical vulnerability to psychosis. Future research would benefit from longitudinal studies of stress-symptom relations across CHR and help-seeking control groups. Copyright © 2017 Elsevier B.V. All rights reserved.

Establishing Upper Limits for Item Ratings for the Angoff Method: Are Resulting Standards More 'Realistic'?

Science.gov (United States)

Reid, Jerry B.

This report investigates an area of uncertainty in using the Angoff method for setting standards, namely whether or not a judge's conceptualizations of borderline group performance are realistic. Ratings are usually made with reference to the performance of this hypothetical group, therefore the Angoff method's success is dependent on this point.…

Dose rate measuring device and dose rate measuring method using the same

International Nuclear Information System (INIS)

Urata, Megumu; Matsushita, Takashi; Hanazawa, Sadao; Konno, Takahiro; Chiba, Yoshinori; Yumitate, Tadahiro

1998-01-01

The device of the present invention comprises a scintillation fiber scope having a shape elongated in the direction of the height of a pressure vessel and emitting light by incident of radiation to detect radiation, a radioactivity measuring device for measuring a dose rate based on the detection of the fiber scope and a reel means for dispensing and taking up the fiber scope, and it constituted such that the dose rate of the pressure vessel and that of a shroud are determined independently. Then, when the taken out shroud is contained in an container, excessive shielding is not necessary, in addition, this device can reliably be inserted to or withdrawn from complicated places between the pressure vessel and the shroud, and further, the dose rate of the pressure vessel and that of the shroud can be measured approximately accurately even when the thickness of them is different greatly. (N.H.)

Dose rate measuring device and dose rate measuring method using the same

Energy Technology Data Exchange (ETDEWEB)

Urata, Megumu; Matsushita, Takashi; Hanazawa, Sadao; Konno, Takahiro; Chiba, Yoshinori; Yumitate, Tadahiro

1998-11-13

The device of the present invention comprises a scintillation fiber scope having a shape elongated in the direction of the height of a pressure vessel and emitting light by incident of radiation to detect radiation, a radioactivity measuring device for measuring a dose rate based on the detection of the fiber scope and a reel means for dispensing and taking up the fiber scope, and it constituted such that the dose rate of the pressure vessel and that of a shroud are determined independently. Then, when the taken out shroud is contained in an container, excessive shielding is not necessary, in addition, this device can reliably be inserted to or withdrawn from complicated places between the pressure vessel and the shroud, and further, the dose rate of the pressure vessel and that of the shroud can be measured approximately accurately even when the thickness of them is different greatly. (N.H.)

Building America Guidance for Identifying and Overcoming Code, Standard, and Rating Method Barriers

Energy Technology Data Exchange (ETDEWEB)

Cole, P. C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Halverson, M. A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

2013-09-01

This guidance document was prepared using the input from the meeting summarized in the draft CSI Roadmap to provide Building America research teams and partners with specific information and approaches to identifying and overcoming potential barriers to Building America innovations arising in and/or stemming from codes, standards, and rating methods.

Structural correlation method for model reduction and practical estimation of patient specific parameters illustrated on heart rate regulation

DEFF Research Database (Denmark)

Ottesen, Johnny T.; Mehlsen, Jesper; Olufsen, Mette

2014-01-01

We consider the inverse and patient specific problem of short term (seconds to minutes) heart rate regulation specified by a system of nonlinear ODEs and corresponding data. We show how a recent method termed the structural correlation method (SCM) can be used for model reduction and for obtaining...... a set of practically identifiable parameters. The structural correlation method includes two steps: sensitivity and correlation analysis. When combined with an optimization step, it is possible to estimate model parameters, enabling the model to fit dynamics observed in data. This method is illustrated...... in detail on a model predicting baroreflex regulation of heart rate and applied to analysis of data from a rat and healthy humans. Numerous mathematical models have been proposed for prediction of baroreflex regulation of heart rate, yet most of these have been designed to provide qualitative predictions...

Measurement of disintegration rates of small [60Co]Co sources in lead containers by the sum-peak method

International Nuclear Information System (INIS)

Kawano, Takao; Ebihara, Hiroshi

1991-01-01

The sum-peak method has been applied to determine the disintegration rates of two small [ 60 Co]Co sources (30 and 350 kBq) in lead containers with several thickness by using a NaI(Tl) detector. The experimental results showed that the sum-peak method was perfectly effective for the determination of the disintegration rates (unrelated to the thicknesses of the containers) of the 350 kBq source. The sum-peak method was also absolutely effective for the 30 kBq source in the case of containers with thicknesses of 15 mm and less, but in the cases of those with thicknesses of 21, 27 and 33 mm, the disintegration rates were under-estimated and the deviations from the true disintegration rate increased rapidly with increasing thicknesses of the containers. We presume that the under-estimation of the disintegration rates was the result of the over-estimation of the areas under the sum peaks, caused by the interference of the γ-ray (2614 keV) emitted from the naturally occurring radionuclide 208 Tl. (author)

QTL list: TSWC4 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available to TSWA5c, a homologous gene of TTG2 controlling seed size in A. thaliana), BnMINI3a (close to TSWA5b, a ho...mologous gene of MINI3 controlling seed weight in A. thaliana) 1 ... ChrC04 15.8 2.2 ... 10.1007/s00122-010-1388-4 20574694

QTL list: TSWA10 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available e to TSWA5c, a homologous gene of TTG2 controlling seed size in A. thaliana), BnMINI3a (close to TSWA5b, a h...omologous gene of MINI3 controlling seed weight in A. thaliana) 1 ... ChrA10 37.9 2.43 ... 10.1007/s00122-010-1388-4 20574694

QTL list: TSWA1 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available to TSWA5c, a homologous gene of TTG2 controlling seed size in A. thaliana), BnMINI3a (close to TSWA5b, a ho...mologous gene of MINI3 controlling seed weight in A. thaliana) 1 ... ChrA01 77.2 4.73 ... 10.1007/s00122-010-1388-4 20574694

A method for estimating failure rates for low probability events arising in PSA

International Nuclear Information System (INIS)

Thorne, M.C.; Williams, M.M.R.

1995-01-01

The authors develop a method for predicting failure rates and failure probabilities per event when, over a given test period or number of demands, no failures have occurred. A Bayesian approach is adopted to calculate a posterior probability distribution for the failure rate or failure probability per event subsequent to the test period. This posterior is then used to estimate effective failure rates or probabilities over a subsequent period of time or number of demands. In special circumstances, the authors results reduce to the well-known rules of thumb, viz: 1/N and 1/T, where N is the number of demands during the test period for no failures and T is the test period for no failures. However, the authors are able to give strict conditions on the validity of these rules of thumb and to improve on them when necessary

CHR AL IDRISSI OF KENITRA

African Journals Online (AJOL)

lanez

31 déc. 2014 ... prescription médicale, dans un objectif de diagnostic, dépistage, ... L'activité de cet emploi/métier s'exerce au sein de laboratoires (analyses médicales, recherche, ... Techniques de prélèvement biologique. Réaliser ... albicans, Pseudomonas, Syphilis, Les virus d'hépatite et le VIH) dans des prélèvements.

A new analytical method for estimating lumped parameter constants of linear viscoelastic models from strain rate tests

Science.gov (United States)

Mattei, G.; Ahluwalia, A.

2018-04-01

We introduce a new function, the apparent elastic modulus strain-rate spectrum, E_{app} ( \\dot{ɛ} ), for the derivation of lumped parameter constants for Generalized Maxwell (GM) linear viscoelastic models from stress-strain data obtained at various compressive strain rates ( \\dot{ɛ}). The E_{app} ( \\dot{ɛ} ) function was derived using the tangent modulus function obtained from the GM model stress-strain response to a constant \\dot{ɛ} input. Material viscoelastic parameters can be rapidly derived by fitting experimental E_{app} data obtained at different strain rates to the E_{app} ( \\dot{ɛ} ) function. This single-curve fitting returns similar viscoelastic constants as the original epsilon dot method based on a multi-curve global fitting procedure with shared parameters. Its low computational cost permits quick and robust identification of viscoelastic constants even when a large number of strain rates or replicates per strain rate are considered. This method is particularly suited for the analysis of bulk compression and nano-indentation data of soft (bio)materials.

Reduced seed germination in Arabidopsis over-expressing SWI/SNF2 ATPase genes.

Science.gov (United States)

Leeggangers, Hendrika A C F; Folta, Adam; Muras, Aleksandra; Nap, Jan-Peter; Mlynarova, Ludmila

2015-02-01

In the life of flowering plants, seed germination is a critical step to ensure survival into the next generation. Generally the seed prior to germination has been in a dormant state with a low rate of metabolism. In the transition from a dormant seed to a germinating seed, various epigenetic mechanisms play a regulatory role. Here, we demonstrate that the over-expression of chromatin remodeling ATPase genes (AtCHR12 or AtCHR23) reduced the frequency of seed germination in Arabidopsis thaliana up to 30% relative to the wild-type seeds. On the other hand, single loss-of-function mutations of the two genes did not affect seed germination. The reduction of germination in over-expressing mutants was more pronounced in stress conditions (salt or high temperature), showing the impact of the environment. Reduced germinations upon over-expression coincided with increased transcript levels of seed maturation genes and with reduced degradation of their mRNAs stored in dry seeds. Our results indicate that repression of AtCHR12/23 gene expression in germinating wild-type Arabidopsis seeds is required for full germination. This establishes a functional link between chromatin modifiers and regulatory networks towards seed maturation and germination. © 2014 Scandinavian Plant Physiology Society.

Identifying functional network changing patterns in individuals at clinical high-risk for psychosis and patients with early illness schizophrenia: A group ICA study

Directory of Open Access Journals (Sweden)

Yuhui Du

2018-01-01

Full Text Available Although individuals at clinical high risk (CHR for psychosis exhibit a psychosis-risk syndrome involving attenuated forms of the positive symptoms typical of schizophrenia (SZ, it remains unclear whether their resting-state brain intrinsic functional networks (INs show attenuated or qualitatively distinct patterns of functional dysconnectivity relative to SZ patients. Based on resting-state functional magnetic imaging data from 70 healthy controls (HCs, 53 CHR individuals (among which 41 subjects were antipsychotic medication-naive, and 58 early illness SZ (ESZ patients (among which 53 patients took antipsychotic medication within five years of illness onset, we estimated subject-specific INs using a novel group information guided independent component analysis (GIG-ICA and investigated group differences in INs. We found that when compared to HCs, both CHR and ESZ groups showed significant differences, primarily in default mode, salience, auditory-related, visuospatial, sensory-motor, and parietal INs. Our findings suggest that widespread INs were diversely impacted. More than 25% of voxels in the identified significant discriminative regions (obtained using all 19 possible changing patterns excepting the no-difference pattern from six of the 15 interrogated INs exhibited monotonically decreasing Z-scores (in INs from the HC to CHR to ESZ, and the related regions included the left lingual gyrus of two vision-related networks, the right postcentral cortex of the visuospatial network, the left thalamus region of the salience network, the left calcarine region of the fronto-occipital network and fronto-parieto-occipital network. Compared to HCs and CHR individuals, ESZ patients showed both increasing and decreasing connectivity, mainly hypo-connectivity involving 15% of the altered voxels from four INs. The left supplementary motor area from the sensory-motor network and the right inferior occipital gyrus in the vision-related network showed a

Universal Rate Model Selector: A Method to Quickly Find the Best-Fit Kinetic Rate Model for an Experimental Rate Profile

Science.gov (United States)

2017-08-01

k2 – k1) 3.3 Universal Kinetic Rate Platform Development Kinetic rate models range from pure chemical reactions to mass transfer...14 8. The rate model that best fits the experimental data is a first-order or homogeneous catalytic reaction ...Avrami (7), and intraparticle diffusion (6) rate equations to name a few. A single fitting algorithm (kinetic rate model ) for a reaction does not

A new method for calculating energy release rate in tunnel excavation subjected to high in situ stress

Directory of Open Access Journals (Sweden)

Xiao Qinghua

2016-03-01

Full Text Available Based on energy theory, energy release rate (EER and local energy release rate (LEER, a new index called FERR (Fractional Energy Release Rate is proposed, and this method can not only evaluate the risk of rock burst, but also can point out the location of high risk and the scale of rockburst. The FERR index is applied to the TBM assembling tunnel in Jinping Hydro Power Station II to evaluate the scale and intensity of rockburst, as well as the location where rockburst occurs. With FDM method adopted, the energy release rate of 3 excavation plans are calculated and the scale and risk of rockburst is evaluated, and the location of high risk of rockburst is also mapped. With FERR used in the evaluation, the rockburst is nicely controlled which ensured the safety and construction schedule of the project.

A method for the direct numerical simulation of hypersonic boundary-layer instability with finite-rate chemistry

International Nuclear Information System (INIS)

Marxen, Olaf; Magin, Thierry E.; Shaqfeh, Eric S.G.; Iaccarino, Gianluca

2013-01-01

A new numerical method is presented here that allows to consider chemically reacting gases during the direct numerical simulation of a hypersonic fluid flow. The method comprises the direct coupling of a solver for the fluid mechanical model and a library providing the physio-chemical model. The numerical method for the fluid mechanical model integrates the compressible Navier–Stokes equations using an explicit time advancement scheme and high-order finite differences. This Navier–Stokes code can be applied to the investigation of laminar-turbulent transition and boundary-layer instability. The numerical method for the physio-chemical model provides thermodynamic and transport properties for different gases as well as chemical production rates, while here we exclusively consider a five species air mixture. The new method is verified for a number of test cases at Mach 10, including the one-dimensional high-temperature flow downstream of a normal shock, a hypersonic chemical reacting boundary layer in local thermodynamic equilibrium and a hypersonic reacting boundary layer with finite-rate chemistry. We are able to confirm that the diffusion flux plays an important role for a high-temperature boundary layer in local thermodynamic equilibrium. Moreover, we demonstrate that the flow for a case previously considered as a benchmark for the investigation of non-equilibrium chemistry can be regarded as frozen. Finally, the new method is applied to investigate the effect of finite-rate chemistry on boundary layer instability by considering the downstream evolution of a small-amplitude wave and comparing results with those obtained for a frozen gas as well as a gas in local thermodynamic equilibrium

Automated analysis of free speech predicts psychosis onset in high-risk youths

Science.gov (United States)

Bedi, Gillinder; Carrillo, Facundo; Cecchi, Guillermo A; Slezak, Diego Fernández; Sigman, Mariano; Mota, Natália B; Ribeiro, Sidarta; Javitt, Daniel C; Copelli, Mauro; Corcoran, Cheryl M

2015-01-01

Background/Objectives: Psychiatry lacks the objective clinical tests routinely used in other specializations. Novel computerized methods to characterize complex behaviors such as speech could be used to identify and predict psychiatric illness in individuals. AIMS: In this proof-of-principle study, our aim was to test automated speech analyses combined with Machine Learning to predict later psychosis onset in youths at clinical high-risk (CHR) for psychosis. Methods: Thirty-four CHR youths (11 females) had baseline interviews and were assessed quarterly for up to 2.5 years; five transitioned to psychosis. Using automated analysis, transcripts of interviews were evaluated for semantic and syntactic features predicting later psychosis onset. Speech features were fed into a convex hull classification algorithm with leave-one-subject-out cross-validation to assess their predictive value for psychosis outcome. The canonical correlation between the speech features and prodromal symptom ratings was computed. Results: Derived speech features included a Latent Semantic Analysis measure of semantic coherence and two syntactic markers of speech complexity: maximum phrase length and use of determiners (e.g., which). These speech features predicted later psychosis development with 100% accuracy, outperforming classification from clinical interviews. Speech features were significantly correlated with prodromal symptoms. Conclusions: Findings support the utility of automated speech analysis to measure subtle, clinically relevant mental state changes in emergent psychosis. Recent developments in computer science, including natural language processing, could provide the foundation for future development of objective clinical tests for psychiatry. PMID:27336038

Comparison of survival rates among different treatment methods of transcatheter hepatic arterial chemoembolization for hepatocellular carcinoma

Energy Technology Data Exchange (ETDEWEB)

Shim, Yong Woon; Lee, Jong Tae; Yoo, Hyung Sik; Lee, Do Yun; Jun, Pyoung Jun; Chang, So Yong [Yonsei Univ. College of Medicine, Seoul (Korea, Republic of)

1996-06-01

To compare the survival rates of patients with hepatoma using different methods of transcatheter arterial chemoemblization(THAE). Four hundred and eighty three patients with hepatoma diagnosed by biopsy, serum alpha-fetoprotein, abdominal CT scan, abdominal ultrasonography or hepatic angiography were included, but not all had received surgical treatment. They were divided onto two groups according to Child's classification and into subgroups according to different methods of THAE. Five-tear survival rates among these groups were retrospectively compared. The patients were aged between 24 and 85(mean, 58) ; male to female ratio was 324 : 61 for those who received THAE (369 : 87 when only hepatic angiography was considered.). In the group with more than a single episode of chemoembolization, regardless of Child's classification, a better survival rate compared to the other groups with or without concommitant radiotherapy or without chemoembolization was noted. There was no difference in the survival rate of patients with multiple chemoembolization. moreover, no difference in this rate was observed no matter what chemotherapeutic agents, including Adriamycin, Cis-Diaminedichloroplatinum of I-131-Lipiodol, were used. Amortization by gelfoam in conjuction with Adriamycin resulted in no difference in survival rate regardless of frequency of chemoembolization. An improved survival rate was seen when multiple episodes of chemoembolization were applied, but no difference was seen when there was concomitant application of either gelfoam or radiotherapy. Two different chemotherapeutic agents, Adriamycin and Cis-Diaminedichloroplatinum, were used, but there was no difference between them in their effect on survival rates.

QTL list: TSWA7a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available e to TSWA5c, a homologous gene of TTG2 controlling seed size in A. thaliana), BnMINI3a (close to TSWA5b, a h...omologous gene of MINI3 controlling seed weight in A. thaliana) 1 ... ChrA07 14.2 9.99 ... 10.1007/s00122-010-1388-4 20574694

QTL list: TSWA7b [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available e to TSWA5c, a homologous gene of TTG2 controlling seed size in A. thaliana), BnMINI3a (close to TSWA5b, a h...omologous gene of MINI3 controlling seed weight in A. thaliana) 1 ... ChrA07 101.1 10.37 ... 10.1007/s00122-010-1388-4 20574694

QTL list: TSWA7b [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available e to TSWA5c, a homologous gene of TTG2 controlling seed size in A. thaliana), BnMINI3a (close to TSWA5b, a h...omologous gene of MINI3 controlling seed weight in A. thaliana) 1 ... ChrA07 101.1 5.57 ... 10.1007/s00122-010-1388-4 20574694

QTL list: TSWA7a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available e to TSWA5c, a homologous gene of TTG2 controlling seed size in A. thaliana), BnMINI3a (close to TSWA5b, a h...omologous gene of MINI3 controlling seed weight in A. thaliana) 1 ... ChrA07 13 10.36 ... 10.1007/s00122-010-1388-4 20574694

QTL list: TSWA5b [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available e to TSWA5c, a homologous gene of TTG2 controlling seed size in A. thaliana), BnMINI3a (close to TSWA5b, a h...omologous gene of MINI3 controlling seed weight in A. thaliana) 1 ... ChrA05 57.8 3.88 ... 10.1007/s00122-010-1388-4 20574694

A gamma camera count rate saturation correction method for whole-body planar imaging

Science.gov (United States)

Hobbs, Robert F.; Baechler, Sébastien; Senthamizhchelvan, Srinivasan; Prideaux, Andrew R.; Esaias, Caroline E.; Reinhardt, Melvin; Frey, Eric C.; Loeb, David M.; Sgouros, George

2010-02-01

Whole-body (WB) planar imaging has long been one of the staple methods of dosimetry, and its quantification has been formalized by the MIRD Committee in pamphlet no 16. One of the issues not specifically addressed in the formalism occurs when the count rates reaching the detector are sufficiently high to result in camera count saturation. Camera dead-time effects have been extensively studied, but all of the developed correction methods assume static acquisitions. However, during WB planar (sweep) imaging, a variable amount of imaged activity exists in the detector's field of view as a function of time and therefore the camera saturation is time dependent. A new time-dependent algorithm was developed to correct for dead-time effects during WB planar acquisitions that accounts for relative motion between detector heads and imaged object. Static camera dead-time parameters were acquired by imaging decaying activity in a phantom and obtaining a saturation curve. Using these parameters, an iterative algorithm akin to Newton's method was developed, which takes into account the variable count rate seen by the detector as a function of time. The algorithm was tested on simulated data as well as on a whole-body scan of high activity Samarium-153 in an ellipsoid phantom. A complete set of parameters from unsaturated phantom data necessary for count rate to activity conversion was also obtained, including build-up and attenuation coefficients, in order to convert corrected count rate values to activity. The algorithm proved successful in accounting for motion- and time-dependent saturation effects in both the simulated and measured data and converged to any desired degree of precision. The clearance half-life calculated from the ellipsoid phantom data was calculated to be 45.1 h after dead-time correction and 51.4 h with no correction; the physical decay half-life of Samarium-153 is 46.3 h. Accurate WB planar dosimetry of high activities relies on successfully compensating

Monitoring light-induced structural changes of Channelrhodopsin-2 by UV-visible and Fourier transform infrared spectroscopy.

Science.gov (United States)

Ritter, Eglof; Stehfest, Katja; Berndt, Andre; Hegemann, Peter; Bartl, Franz J

2008-12-12

Channelrhodopsin-2 (ChR2) is a microbial type rhodopsin and a light-gated cation channel that controls phototaxis in Chlamydomonas. We expressed ChR2 in COS-cells, purified it, and subsequently investigated this unusual photoreceptor by flash photolysis and UV-visible and Fourier transform infrared difference spectroscopy. Several transient photoproducts of the wild type ChR2 were identified, and their kinetics and molecular properties were compared with those of the ChR2 mutant E90Q. Based on the spectroscopic data we developed a model of the photocycle comprising six distinguishable intermediates. This photocycle shows similarities to the photocycle of the ChR2-related Channelrhodopsin of Volvox but also displays significant differences. We show that molecular changes include retinal isomerization, changes in hydrogen bonding of carboxylic acids, and large alterations of the protein backbone structure. These alterations are stronger than those observed in the photocycle of other microbial rhodopsins like bacteriorhodopsin and are related to those occurring in animal rhodopsins. UV-visible and Fourier transform infrared difference spectroscopy revealed two late intermediates with different time constants of tau = 6 and 40 s that exist during the recovery of the dark state. The carboxylic side chain of Glu(90) is involved in the slow transition. The molecular changes during the ChR2 photocycle are discussed with respect to other members of the rhodopsin family.

Primal Decomposition-Based Method for Weighted Sum-Rate Maximization in Downlink OFDMA Systems

Directory of Open Access Journals (Sweden)

Weeraddana Chathuranga

2010-01-01

Full Text Available We consider the weighted sum-rate maximization problem in downlink Orthogonal Frequency Division Multiple Access (OFDMA systems. Motivated by the increasing popularity of OFDMA in future wireless technologies, a low complexity suboptimal resource allocation algorithm is obtained for joint optimization of multiuser subcarrier assignment and power allocation. The algorithm is based on an approximated primal decomposition-based method, which is inspired from exact primal decomposition techniques. The original nonconvex optimization problem is divided into two subproblems which can be solved independently. Numerical results are provided to compare the performance of the proposed algorithm to Lagrange relaxation based suboptimal methods as well as to optimal exhaustive search-based method. Despite its reduced computational complexity, the proposed algorithm provides close-to-optimal performance.

Measurement of fatigue crack growth rate of reactor structural material in air based on DCPD method

International Nuclear Information System (INIS)

Du Donghai; Chen Kai; Yu Lun; Zhang Lefu; Shi Xiuqiang; Xu Xuelian

2014-01-01

The principles and details of direct current potential drop (DCPD) in monitoring the crack growth of reactor structural materials was introduced in this paper. Based on this method, the fatigue crack growth rate (CGR) of typical structural materials in nuclear power systems was measured. The effects of applied load, load ratio and loading frequency on the fatigue crack growth rate of reactor structural materials were discussed. The result shows that the fatigue crack growth rate of reactor structural materials depends on the hardness of materials, and the harder the material is, the higher the rate of crack growth is. (authors)

Experimental investigation of impulse response shortening for low-complexity MLSE of a 112-Gbit/s PAM-4 transceiver

DEFF Research Database (Denmark)

Van Der Heide, Sjoerd; Eiselt, Nicklas; Griesser, Helmut

2016-01-01

An optimized channel shortening method for reduced complexity MLSE detection enables the compensation of severe inter-symbol interference. Experimental investigations demonstrate the benefit on the performance for a severely bandwidth limited 112-Gbit/s PAM-4 transmission system with residual chr...

A study on measurement on artificial radiation dose rate using the response matrix method

International Nuclear Information System (INIS)

Kidachi, Hiroshi; Ishikawa, Yoichi; Konno, Tatsuya

2004-01-01

We examined accuracy and stability of estimated artificial dose contribution which is distinguished from natural background gamma-ray dose rate using Response Matrix method. Irradiation experiments using artificial gamma-ray sources indicated that there was a linear relationship between observed dose rate and estimated artificial dose contribution, when irradiated artificial gamma-ray dose rate was higher than about 2 nGy/h. Statistical and time-series analyses of long term data made it clear that estimated artificial contribution showed almost constant values under no artificial influence from the nuclear power plants. However, variations of estimated artificial dose contribution were infrequently observed due to of rainfall, detector maintenance operation and occurrence of calibration error. Some considerations on the factors to these variations were made. (author)

Count rate balance method of measuring sediment transport of sand beds by radioactive tracers

International Nuclear Information System (INIS)

Sauzay, G.

1968-01-01

Radioactive tracers are applied to the direct measurement of the sediment transport rate of sand beds. The theoretical measurement formula is derived: the variation of the count rate balance is inverse of that of the transport thickness. Simultaneously the representativeness of the tracer is critically studied. The minimum quantity of tracer which has to be injected in order to obtain a correct statistical definition of count rate given by a low number of grains 'seen' by the detector is then studied. A field experiment was made and has let to study the technological conditions for applying this method: only the treatment of results is new, the experiment itself is carried out with conventional techniques applied with great care. (author) [fr

Determination of the Absolute Disintegration Rate of Cs-137 sources by the Tracer Method

Energy Technology Data Exchange (ETDEWEB)

Hellstroem, S; Brune, D

1963-07-15

{sup 137}Cs - sources were absolutely measured by the 'tracer method', with {sup 82}Br as a tracer nuclide and with application of the 4{pi} {beta}-{gamma} coincidence technique. A self-absorption of 6 % was found in sources obtained from a solution with a carrier-content of 400 {mu}g/ml. The precision of the method for the determination of the {beta}-emission rate was estimated to {+-} 1 %. The results were compared with those of other works.

Determination of the Absolute Disintegration Rate of Cs-137 sources by the Tracer Method

International Nuclear Information System (INIS)

Hellstroem, S.; Brune, D.

1963-07-01

137 Cs - sources were absolutely measured by the 'tracer method', with 82 Br as a tracer nuclide and with application of the 4π β-γ coincidence technique. A self-absorption of 6 % was found in sources obtained from a solution with a carrier-content of 400 μg/ml. The precision of the method for the determination of the β-emission rate was estimated to ± 1 %. The results were compared with those of other works

A Comparison of Affect Ratings Obtained with Ecological Momentary Assessment and the Day Reconstruction Method

Science.gov (United States)

Dockray, Samantha; Grant, Nina; Stone, Arthur A.; Kahneman, Daniel; Wardle, Jane

2010-01-01

Measurement of affective states in everyday life is of fundamental importance in many types of quality of life, health, and psychological research. Ecological momentary assessment (EMA) is the recognized method of choice, but the respondent burden can be high. The day reconstruction method (DRM) was developed by Kahneman and colleagues (Science, 2004, 306, 1776–1780) to assess affect, activities and time use in everyday life. We sought to validate DRM affect ratings by comparison with contemporaneous EMA ratings in a sample of 94 working women monitored over work and leisure days. Six EMA ratings of happiness, tiredness, stress, and anger/frustration were obtained over each 24 h period, and were compared with DRM ratings for the same hour, recorded retrospectively at the end of the day. Similar profiles of affect intensity were recorded with the two techniques. The between-person correlations adjusted for attenuation ranged from 0.58 (stress, working day) to 0.90 (happiness, leisure day). The strength of associations was not related to age, educational attainment, or depressed mood. We conclude that the DRM provides reasonably reliable estimates both of the intensity of affect and variations in affect over the day, so is a valuable instrument for the measurement of everyday experience in health and social research. PMID:21113328

The survey of preconditioners used for accelerating the rate of convergence in the Gauss-Seidel method

Science.gov (United States)

Niki, Hiroshi; Harada, Kyouji; Morimoto, Munenori; Sakakihara, Michio

2004-03-01

Several preconditioned iterative methods reported in the literature have been used for improving the convergence rate of the Gauss-Seidel method. In this article, on the basis of nonnegative matrix, comparisons between some splittings for such preconditioned matrices are derived. Simple numerical examples are also given.

Exploratory analysis of social cognition and neurocognition in individuals at clinical high risk for psychosis.

Science.gov (United States)

Yong, Emma; Barbato, Mariapaola; Penn, David L; Keefe, Richard S E; Woods, Scott W; Perkins, Diana O; Addington, Jean

2014-08-15

Neurocognition and social cognition are separate but related constructs known to be impaired in schizophrenia. The aim of this study was to extend the current knowledge of the relationship between social cognition and neurocognition in individuals at clinical high risk (CHR) of developing psychosis by examining, in a large sample, the associations between a wide range of neurocognitive tasks and social cognition. Participants included 136 young people at CHR. Specific domains within neurocognition and social cognition were compared using Spearman correlations. Results showed that poor theory of mind correlated with low ratings on a wide range of neurocognitive tasks. Facial affect was more often associated with low ratings on spatial working memory and attention. These results support a link between neurocognition and social cognition even at this early stage of potential psychosis, with indication that poorer performance on social cognition may be associated with deficits in attention and working memory. Understanding these early associations may have implications for early intervention. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Systemic Therapy for Youth at Clinical High Risk for Psychosis: A Pilot Study

Directory of Open Access Journals (Sweden)

Jingyu Shi

2017-10-01

Full Text Available Psychosocial intervention trials for youth at clinical high risk (CHR for psychosis have shown promising effects on treating psychotic symptoms but have not focused on psychosocial functional outcomes, and those studies have been conducted among help-seeking patients; there is a lack of research on non-clinical young CHR individuals. Systemic therapy (ST is grounded in systemic-constructivist and psychosocial resilience theories. It has a number of advantages that makes it attractive for use with CHR individuals in non-clinical context. The present study evaluated the effect of ST for students at CHR on reducing symptoms and enhancing psychosocial function. This was a single-blind randomized controlled trial for CHR young people comparing ST to supportive therapy with a 6-month treatment. Psychotic and depressive symptoms (DS as well as self-esteem and social support (SS were assessed at pre- and posttreatment. 26 CHR individuals were randomly divided into intervention group (n = 13 and control group (n = 13. There were no significant differences in severity of symptoms, level of SS and self-esteem at baseline between the two groups (P > 0.05. At posttreatment, significant improvements in positive and DS as well as SS and self-esteem were observed in the ST group (P < 0.05; in the control group, these improvements were not significant (P > 0.05. The findings indicated that systemic intervention for university students at CHR for psychosis may have a positive effect on symptoms and self-esteem as well as SS in short term. More long-term research is needed to further evaluate this intervention.

Arrays of microLEDs and astrocytes: biological amplifiers to optogenetically modulate neuronal networks reducing light requirement.

Directory of Open Access Journals (Sweden)

Rolando Berlinguer-Palmini

Full Text Available In the modern view of synaptic transmission, astrocytes are no longer confined to the role of merely supportive cells. Although they do not generate action potentials, they nonetheless exhibit electrical activity and can influence surrounding neurons through gliotransmitter release. In this work, we explored whether optogenetic activation of glial cells could act as an amplification mechanism to optical neural stimulation via gliotransmission to the neural network. We studied the modulation of gliotransmission by selective photo-activation of channelrhodopsin-2 (ChR2 and by means of a matrix of individually addressable super-bright microLEDs (μLEDs with an excitation peak at 470 nm. We combined Ca2+ imaging techniques and concurrent patch-clamp electrophysiology to obtain subsequent glia/neural activity. First, we tested the μLEDs efficacy in stimulating ChR2-transfected astrocyte. ChR2-induced astrocytic current did not desensitize overtime, and was linearly increased and prolonged by increasing μLED irradiance in terms of intensity and surface illumination. Subsequently, ChR2 astrocytic stimulation by broad-field LED illumination with the same spectral profile, increased both glial cells and neuronal calcium transient frequency and sEPSCs suggesting that few ChR2-transfected astrocytes were able to excite surrounding not-ChR2-transfected astrocytes and neurons. Finally, by using the μLEDs array to selectively light stimulate ChR2 positive astrocytes we were able to increase the synaptic activity of single neurons surrounding it. In conclusion, ChR2-transfected astrocytes and μLEDs system were shown to be an amplifier of synaptic activity in mixed corticalneuronal and glial cells culture.

Arrays of microLEDs and astrocytes: biological amplifiers to optogenetically modulate neuronal networks reducing light requirement.

Science.gov (United States)

Berlinguer-Palmini, Rolando; Narducci, Roberto; Merhan, Kamyar; Dilaghi, Arianna; Moroni, Flavio; Masi, Alessio; Scartabelli, Tania; Landucci, Elisa; Sili, Maria; Schettini, Antonio; McGovern, Brian; Maskaant, Pleun; Degenaar, Patrick; Mannaioni, Guido

2014-01-01

In the modern view of synaptic transmission, astrocytes are no longer confined to the role of merely supportive cells. Although they do not generate action potentials, they nonetheless exhibit electrical activity and can influence surrounding neurons through gliotransmitter release. In this work, we explored whether optogenetic activation of glial cells could act as an amplification mechanism to optical neural stimulation via gliotransmission to the neural network. We studied the modulation of gliotransmission by selective photo-activation of channelrhodopsin-2 (ChR2) and by means of a matrix of individually addressable super-bright microLEDs (μLEDs) with an excitation peak at 470 nm. We combined Ca2+ imaging techniques and concurrent patch-clamp electrophysiology to obtain subsequent glia/neural activity. First, we tested the μLEDs efficacy in stimulating ChR2-transfected astrocyte. ChR2-induced astrocytic current did not desensitize overtime, and was linearly increased and prolonged by increasing μLED irradiance in terms of intensity and surface illumination. Subsequently, ChR2 astrocytic stimulation by broad-field LED illumination with the same spectral profile, increased both glial cells and neuronal calcium transient frequency and sEPSCs suggesting that few ChR2-transfected astrocytes were able to excite surrounding not-ChR2-transfected astrocytes and neurons. Finally, by using the μLEDs array to selectively light stimulate ChR2 positive astrocytes we were able to increase the synaptic activity of single neurons surrounding it. In conclusion, ChR2-transfected astrocytes and μLEDs system were shown to be an amplifier of synaptic activity in mixed corticalneuronal and glial cells culture.

Testing an Adapted Modified Delphi Method: Synthesizing Multiple Stakeholder Ratings of Health Care Service Effectiveness.

Science.gov (United States)

Escaron, Anne L; Chang Weir, Rosy; Stanton, Petra; Vangala, Sitaram; Grogan, Tristan R; Clarke, Robin M

2016-03-01

The Affordable Care Act incentivizes health systems for better meeting patient needs, but often guidance about patient preferences for particular health services is limited. All too often vulnerable patient populations are excluded from these decision-making settings. A community-based participatory approach harnesses the in-depth knowledge of those experiencing barriers to health care. We made three modifications to the RAND-UCLA appropriateness method, a modified Delphi approach, involving patients, adding an advisory council group to characterize existing knowledge in this little studied area, and using effectiveness rather than "appropriateness" as the basis for rating. As a proof of concept, we tested this method by examining the broadly delivered but understudied nonmedical services that community health centers provide. This method created discrete, new knowledge about these services by defining 6 categories and 112 unique services and by prioritizing among these services based on effectiveness using a 9-point scale. Consistent with the appropriateness method, we found statistical convergence of ratings among the panelists. Challenges include time commitment and adherence to a clear definition of effectiveness of services. This diverse stakeholder engagement method efficiently addresses gaps in knowledge about the effectiveness of health care services to inform population health management. © 2015 Society for Public Health Education.

Method of measuring the disintegration rate of a beta-emitting radionuclide in a liquid sample

International Nuclear Information System (INIS)

Horrocks, D.L.

1980-01-01

A novel liquid scintillation counting method of measuring the disintegration rate of a beta-emitting radionuclide is described which involves counting the sample at at least two different quench levels. (UK)

Clinical high risk for psychosis

DEFF Research Database (Denmark)

van der Steen, Y; Gimpel-Drees, J; Lataster, T

2017-01-01

OBJECTIVE: The aim of this study was to assess associations between momentary stress and both affective and psychotic symptoms in everyday life of individuals at clinical high risk (CHR), compared to chronic psychotic patients and healthy controls, in search for evidence of early stress...... and 26 healthy controls. RESULTS: Multilevel models showed significantly larger associations between negative affect (NA) and activity-related stress for CHR patients than for psychotic patients (P = 0.008) and for CHR compared to controls (P

Preliminary psychometric properties of the brief Negative Symptom Scale in youth at Clinical High-Risk for psychosis.

Science.gov (United States)

Strauss, Gregory P; Chapman, Hannah C

2018-03-01

Preliminary psychometric properties of an adapted version of the Brief Negative Symptom Scale (BNSS) are reported in youth at Clinical High-Risk for psychosis (CHR). Participants included 29 CHR youth who met criteria for a prodromal syndrome on the Structured Interview for Prodromal Syndromes (SIPS). The adapted BNSS demonstrated excellent internal consistency, convergent validity, and discriminant validity, suggesting that the BNSS has utility for assessing negative symptoms in a CHR population. Copyright © 2017 Elsevier B.V. All rights reserved.

Computational optogenetics: empirically-derived voltage- and light-sensitive channelrhodopsin-2 model.

Directory of Open Access Journals (Sweden)

John C Williams

Full Text Available Channelrhodospin-2 (ChR2, a light-sensitive ion channel, and its variants have emerged as new excitatory optogenetic tools not only in neuroscience, but also in other areas, including cardiac electrophysiology. An accurate quantitative model of ChR2 is necessary for in silico prediction of the response to optical stimulation in realistic tissue/organ settings. Such a model can guide the rational design of new ion channel functionality tailored to different cell types/tissues. Focusing on one of the most widely used ChR2 mutants (H134R with enhanced current, we collected a comprehensive experimental data set of the response of this ion channel to different irradiances and voltages, and used these data to develop a model of ChR2 with empirically-derived voltage- and irradiance- dependence, where parameters were fine-tuned via simulated annealing optimization. This ChR2 model offers: 1 accurate inward rectification in the current-voltage response across irradiances; 2 empirically-derived voltage- and light-dependent kinetics (activation, deactivation and recovery from inactivation; and 3 accurate amplitude and morphology of the response across voltage and irradiance settings. Temperature-scaling factors (Q10 were derived and model kinetics was adjusted to physiological temperatures. Using optical action potential clamp, we experimentally validated model-predicted ChR2 behavior in guinea pig ventricular myocytes. The model was then incorporated in a variety of cardiac myocytes, including human ventricular, atrial and Purkinje cell models. We demonstrate the ability of ChR2 to trigger action potentials in human cardiomyocytes at relatively low light levels, as well as the differential response of these cells to light, with the Purkinje cells being most easily excitable and ventricular cells requiring the highest irradiance at all pulse durations. This new experimentally-validated ChR2 model will facilitate virtual experimentation in neural and

Life cycle and population growth rate of Caenorhabditis elegans studied by a new method.

Science.gov (United States)

Muschiol, Daniel; Schroeder, Fabian; Traunspurger, Walter

2009-05-16

The free-living nematode Caenorhabditis elegans is the predominant model organism in biological research, being used by a huge number of laboratories worldwide. Many researchers have evaluated life-history traits of C. elegans in investigations covering quite different aspects such as ecotoxicology, inbreeding depression and heterosis, dietary restriction/supplement, mutations, and ageing. Such traits include juvenile growth rates, age at sexual maturity, adult body size, age-specific fecundity/mortality, total reproduction, mean and maximum lifespan, and intrinsic population growth rates. However, we found that in life-cycle experiments care is needed regarding protocol design. Here, we test a recently developed method that overcomes some problems associated with traditional cultivation techniques. In this fast and yet precise approach, single individuals are maintained within hanging drops of semi-fluid culture medium, allowing the simultaneous investigation of various life-history traits at any desired degree of accuracy. Here, the life cycles of wild-type C. elegans strains N2 (Bristol, UK) and MY6 (Münster, Germany) were compared at 20 degrees C with 5 x 10(9) Escherichia coli ml-1 as food source. High-resolution life tables and fecundity schedules of the two strains are presented. Though isolated 700 km and 60 years apart from each other, the two strains barely differed in life-cycle parameters. For strain N2 (n = 69), the intrinsic rate of natural increase (r m d(-1)), calculated according to the Lotka equation, was 1.375, the net reproductive rate (R 0) 291, the mean generation time (T) 90 h, and the minimum generation time (T min) 73.0 h. The corresponding values for strain MY6 (n = 72) were r m = 1.460, R0 = 289, T = 84 h, and T min = 67.3 h. Peak egg-laying rates in both strains exceeded 140 eggs d(-1). Juvenile and early adulthood mortality was negligible. Strain N2 lived, on average, for 16.7 d, while strain MY6 died 2 days earlier; however

Life cycle and population growth rate of Caenorhabditis elegans studied by a new method

Directory of Open Access Journals (Sweden)

Schroeder Fabian

2009-05-01

Full Text Available Abstract Background The free-living nematode Caenorhabditis elegans is the predominant model organism in biological research, being used by a huge number of laboratories worldwide. Many researchers have evaluated life-history traits of C. elegans in investigations covering quite different aspects such as ecotoxicology, inbreeding depression and heterosis, dietary restriction/supplement, mutations, and ageing. Such traits include juvenile growth rates, age at sexual maturity, adult body size, age-specific fecundity/mortality, total reproduction, mean and maximum lifespan, and intrinsic population growth rates. However, we found that in life-cycle experiments care is needed regarding protocol design. Here, we test a recently developed method that overcomes some problems associated with traditional cultivation techniques. In this fast and yet precise approach, single individuals are maintained within hanging drops of semi-fluid culture medium, allowing the simultaneous investigation of various life-history traits at any desired degree of accuracy. Here, the life cycles of wild-type C. elegans strains N2 (Bristol, UK and MY6 (Münster, Germany were compared at 20°C with 5 × 109 Escherichia coli ml-1 as food source. Results High-resolution life tables and fecundity schedules of the two strains are presented. Though isolated 700 km and 60 years apart from each other, the two strains barely differed in life-cycle parameters. For strain N2 (n = 69, the intrinsic rate of natural increase (rmd-1, calculated according to the Lotka equation, was 1.375, the net reproductive rate (R0 291, the mean generation time (T 90 h, and the minimum generation time (Tmin 73.0 h. The corresponding values for strain MY6 (n = 72 were rm = 1.460, R0 = 289, T = 84 h, and Tmin = 67.3 h. Peak egg-laying rates in both strains exceeded 140 eggs d-1. Juvenile and early adulthood mortality was negligible. Strain N2 lived, on average, for 16.7 d, while strain MY6 died 2 days

A Method for Harmonic Sources Detection based on Harmonic Distortion Power Rate

Science.gov (United States)

Lin, Ruixing; Xu, Lin; Zheng, Xian

2018-03-01

Harmonic sources detection at the point of common coupling is an essential step for harmonic contribution determination and harmonic mitigation. The harmonic distortion power rate index is proposed for harmonic source location based on IEEE Std 1459-2010 in the paper. The method only based on harmonic distortion power is not suitable when the background harmonic is large. To solve this problem, a threshold is determined by the prior information, when the harmonic distortion power is larger than the threshold, the customer side is considered as the main harmonic source, otherwise, the utility side is. A simple model of public power system was built in MATLAB/Simulink and field test results of typical harmonic loads verified the effectiveness of proposed method.

Method for the determination of the radon entry rate inside buildings; Methodik zur Bestimmung der Radonquellstaerke in Gebaeuden

Energy Technology Data Exchange (ETDEWEB)

Neugebauer, T.; Hingmann, H.; Buermeyer, J.; Grimm, V.; Spruck, K.; Breckow, J. [Technische Hochschule Mittelhessen (THM), Giessen (Germany). Inst. fuer Medizinische Physik und Strahlenschutz (IMPS)

2016-07-01

The radon entry rate describes the radon characteristics of a building, which are defined by its constructional condition (tightness of building envelope) and the geological realities (radon soil gas concentration). All possible radon sources of a building are considered. The determination of the radon entry rate is based on the measurement of the radon concentration inside a building and the determination of the air change rate. The air change rate can be calculated via several approaches, VDI 4300-7 provides the most common methods. The main approaches are based on the use of a tracer gas, which concentration is measured over the time. In a first attempt, a one-time and punctual injection of a tracer gas was used. A disadvantage was that the air change rate could be determined only for short periods. In the follow-up, the constant injection of a tracer gas at multiple spots was executed. With this method, it is possible to calculate the air change rate over several weeks on a continuous base; the data can be used to determine the radon entry rate. Based on those series of measurements a first analysis of possible dependencies of the radon entry rate was performed.

Temporal genomic evolution of bird sex chromosomes

DEFF Research Database (Denmark)

Wang, Zongji; Zhang, Jilin; Yang, Wei

2014-01-01

BACKGROUND: Sex chromosomes exhibit many unusual patterns in sequence and gene expression relative to autosomes. Birds have evolved a female heterogametic sex system (male ZZ, female ZW), through stepwise suppression of recombination between chrZ and chrW. To address the broad patterns and complex...... driving forces of Z chromosome evolution, we analyze here 45 newly available bird genomes and four species' transcriptomes, over their course of recombination loss between the sex chromosomes. RESULTS: We show Z chromosomes in general have a significantly higher substitution rate in introns and synonymous...... ('fast-Z' evolution). And species with a lower level of intronic heterozygosities tend to evolve even faster on the Z chromosome. Further analysis of fast-evolving genes' enriched functional categories and sex-biased expression patterns support that, fast-Z evolution in birds is mainly driven by genetic...

Reproducibility of CSF quantitative culture methods for estimating rate of clearance in cryptococcal meningitis.

Science.gov (United States)

Dyal, Jonathan; Akampurira, Andrew; Rhein, Joshua; Morawski, Bozena M; Kiggundu, Reuben; Nabeta, Henry W; Musubire, Abdu K; Bahr, Nathan C; Williams, Darlisha A; Bicanic, Tihana; Larsen, Robert A; Meya, David B; Boulware, David R

2016-05-01

Quantitative cerebrospinal fluid (CSF) cultures provide a measure of disease severity in cryptococcal meningitis. The fungal clearance rate by quantitative cultures has become a primary endpoint for phase II clinical trials. This study determined the inter-assay accuracy of three different quantitative culture methodologies. Among 91 participants with meningitis symptoms in Kampala, Uganda, during August-November 2013, 305 CSF samples were prospectively collected from patients at multiple time points during treatment. Samples were simultaneously cultured by three methods: (1) St. George's 100 mcl input volume of CSF with five 1:10 serial dilutions, (2) AIDS Clinical Trials Group (ACTG) method using 1000, 100, 10 mcl input volumes, and two 1:100 dilutions with 100 and 10 mcl input volume per dilution on seven agar plates; and (3) 10 mcl calibrated loop of undiluted and 1:100 diluted CSF (loop). Quantitative culture values did not statistically differ between St. George-ACTG methods (P= .09) but did for St. George-10 mcl loop (Pmethods was high (r≥0.88). For detecting sterility, the ACTG-method had the highest negative predictive value of 97% (91% St. George, 60% loop), but the ACTG-method had occasional (∼10%) difficulties in quantification due to colony clumping. For CSF clearance rate, St. George-ACTG methods did not differ overall (mean -0.05 ± 0.07 log10CFU/ml/day;P= .14) on a group level; however, individual-level clearance varied. The St. George and ACTG quantitative CSF culture methods produced comparable but not identical results. Quantitative cultures can inform treatment management strategies. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Evaluation of Technical and Yield Parameters of Wheat Seeding Methods with Different Seeding Rates in south Khuzestan

Directory of Open Access Journals (Sweden)

J Habibi Asl

2012-05-01

Full Text Available This study was conducted during two years (2007-2009 in Shawoor Agricultural Research Station on a silty-clay soil. Experiment conducted in split plots in a Randomized Complete Blocks Design in three replications. Main plots were planting methods including centrifugal broadcaster (P1, centrifugal broadcaster + furrower (P2, seed drill (P3, seed drill + furrower (P4, three lines bed drilling (P5 and four lines bed drilling (P6. Subplots were included seed rates of 120, 160, 200 and 240 kg.ha-1. The results showed that P2 method with 14.91 litter.ha-1 and P3 method with 5.02 litter.ha-1 had the highest and lowest fuel consumption respectively. P3 method with 1.462 h.ha-1 and P5 method with 0.620 h.ha-1 required maximum and minimum total operation time respectively. P2 method with 0.684 ha.h-1 had minimum field capacity. Field capacity of P5 and P6 with averagely 1.67 ha.h-1 was maximum. Field capacity of all drilling methods (P3, P4, P5 and P6 was significantly more than that of broadcasting methods (P1 and P2. The highest seed spacing uniformity (87.2% was belonged to P6 method and the lowest value (54.7% was for P1 method. By using drilling methods of P3 and P5 (or P6 instead of P1 method total cost was reduced 41% and 29% respectively. The results of variance analysis of data showed that the difference between planting methods in case of wheat grain yield and yield components was not significant. However, the seed rate had significant effect on some yield components. Suggestion for cropping of wheat Chamran variety in silty-clay soil in Khuzestan province, used P5, P6 and P3 methods are recommended respectively with seed rate of 120 - 160 kg.ha-1.

Standard Test Method for Measuring Heat Transfer Rate Using a Thin-Skin Calorimeter

CERN Document Server

American Society for Testing and Materials. Philadelphia

2005-01-01

1.1 This test method covers the design and use of a thin metallic calorimeter for measuring heat transfer rate (also called heat flux). Thermocouples are attached to the unexposed surface of the calorimeter. A one-dimensional heat flow analysis is used for calculating the heat transfer rate from the temperature measurements. Applications include aerodynamic heating, laser and radiation power measurements, and fire safety testing. 1.2 Advantages 1.2.1 Simplicity of ConstructionThe calorimeter may be constructed from a number of materials. The size and shape can often be made to match the actual application. Thermocouples may be attached to the metal by spot, electron beam, or laser welding. 1.2.2 Heat transfer rate distributions may be obtained if metals with low thermal conductivity, such as some stainless steels, are used. 1.2.3 The calorimeters can be fabricated with smooth surfaces, without insulators or plugs and the attendant temperature discontinuities, to provide more realistic flow conditions for ...

Ultrasonic 3-D Vector Flow Method for Quantitative In Vivo Peak Velocity and Flow Rate Estimation

DEFF Research Database (Denmark)

Holbek, Simon; Ewertsen, Caroline; Bouzari, Hamed

2017-01-01

Current clinical ultrasound (US) systems are limited to show blood flow movement in either 1-D or 2-D. In this paper, a method for estimating 3-D vector velocities in a plane using the transverse oscillation method, a 32×32 element matrix array, and the experimental US scanner SARUS is presented...... is validated in two phantom studies, where flow rates are measured in a flow-rig, providing a constant parabolic flow, and in a straight-vessel phantom ( ∅=8 mm) connected to a flow pump capable of generating time varying waveforms. Flow rates are estimated to be 82.1 ± 2.8 L/min in the flow-rig compared...

Review and Extension of CO2-Based Methods to Determine Ventilation Rates with Application to School Classrooms

Directory of Open Access Journals (Sweden)

Stuart Batterman

2017-02-01

Full Text Available The ventilation rate (VR is a key parameter affecting indoor environmental quality (IEQ and the energy consumption of buildings. This paper reviews the use of CO2 as a “natural” tracer gas for estimating VRs, focusing on applications in school classrooms. It provides details and guidance for the steady-state, build-up, decay and transient mass balance methods. An extension to the build-up method and an analysis of the post-exercise recovery period that can increase CO2 generation rates are presented. Measurements in four mechanically-ventilated school buildings demonstrate the methods and highlight issues affecting their applicability. VRs during the school day fell below recommended minimum levels, and VRs during evening and early morning were on the order of 0.1 h−1, reflecting shutdown of the ventilation systems. The transient mass balance method was the most flexible and advantageous method given the low air change rates and dynamic occupancy patterns observed in the classrooms. While the extension to the build-up method improved stability and consistency, the accuracy of this and the steady-state method may be limited. Decay-based methods did not reflect the VR during the school day due to heating, ventilation and air conditioning (HVAC system shutdown. Since the number of occupants in classrooms changes over the day, the VR expressed on a per person basis (e.g., L·s−1·person−1 depends on the occupancy metric. If occupancy measurements can be obtained, then the transient mass balance method likely will provide the most consistent and accurate results among the CO2-based methods. Improved VR measurements can benefit many applications, including research examining the linkage between ventilation and health.

Combining Unsupervised and Supervised Statistical Learning Methods for Currency Exchange Rate Forecasting

OpenAIRE

Vasiljeva, Polina

2016-01-01

In this thesis we revisit the challenging problem of forecasting currency exchange rate. We combine machine learning methods such as agglomerative hierarchical clustering and random forest to construct a two-step approach for predicting movements in currency exchange prices of the Swedish krona and the US dollar. We use a data set with over 200 predictors comprised of different financial and macro-economic time series and their transformations. We perform forecasting for one week ahead with d...

Methods for monitoring corals and crustose coralline algae to quantify in-situ calcification rates

Science.gov (United States)

Morrison, Jennifer M.; Kuffner, Ilsa B.; Hickey, T. Don

2013-01-01

The potential effect of global climate change on calcifying marine organisms, such as scleractinian (reef-building) corals, is becoming increasingly evident. Understanding the process of coral calcification and establishing baseline calcification rates are necessary to detect future changes in growth resulting from climate change or other stressors. Here we describe the methods used to establish a network of calcification-monitoring stations along the outer Florida Keys Reef Tract in 2009. In addition to detailing the initial setup and periodic monitoring of calcification stations, we discuss the utility and success of our design and offer suggestions for future deployments. Stations were designed such that whole coral colonies were securely attached to fixed apparati (n = 10 at each site) on the seafloor but also could be easily removed and reattached as needed for periodic weighing. Corals were weighed every 6 months, using the buoyant weight technique, to determine calcification rates in situ. Sites were visited in May and November to obtain winter and summer rates, respectively, and identify seasonal patterns in calcification. Calcification rates of the crustose coralline algal community also were measured by affixing commercially available plastic tiles, deployed vertically, at each station. Colonization by invertebrates and fleshy algae on the tiles was low, indicating relative specificity for the crustose coralline algal community. We also describe a new, nonlethal technique for sampling the corals, used following the completion of the monitoring period, in which two slabs were obtained from the center of each colony. Sampled corals were reattached to the seafloor, and most corals had completely recovered within 6 months. The station design and sampling methods described herein provide an effective approach to assessing coral and crustose coralline algal calcification rates across time and space, offering the ability to quantify the potential effects of

A method of inferring k-infinity from reaction rate measurements in thermal reactor systems

International Nuclear Information System (INIS)

Newmarch, D.A.

1967-05-01

A scheme is described for inferring a value of k-infinity from reaction rate measurements. The method is devised with the METHUSELAH group structure in mind and was developed for the analysis of S.G.H.W. reactor experiments; the underlying principles, however, are general. (author)

Assessment method to predict the rate of unresolved false alarms

International Nuclear Information System (INIS)

Reardon, P.T.; Eggers, R.F.; Heaberlin, S.W.

1982-06-01

A method has been developed to predict the rate of unresolved false alarms of material loss in a nuclear facility. The computer program DETRES-1 was developed. The program first assigns the true values of control unit components receipts, shipments, beginning and ending inventories. A normal random number generator is used to generate measured values of each component. A loss estimator is calculated from the control unit's measured values. If the loss estimator triggers a detection alarm, a response is simulated. The response simulation is divided into two phases. The first phase is to simulate remeasurement of the components of the detection loss estimator using the same or better measurement methods or inferences from surrounding control units. If this phase of response continues to indicate a material loss, phase of response simulating a production shutdown and comprehensive cleanout is initiated. A new loss estimator is found, and tested against the alarm thresholds. If the estimator value is below the threshold, the original detection alarm is considered resolved; if above the threshold, an unresolved alarm has occurred. A tally is kept of valid alarms, unresolved false alarms, and failure to alarm upon a true loss

Method of measuring the disinteration rate of beta-emitting radionuclide in a liquid sample

International Nuclear Information System (INIS)

Horrocks, D.L.

1977-01-01

A method of measuring the disintegration rate of a beta-emitting radionuclide in a liquid sample by counting at least two differently quenched versions of the sample is described. In each counting operation the sample is counted in the presence of and in the absence of a standard radioactive source. A pulse height (PH) corresponding to a unique point on the pulse height spectrum generated in the presence of the standard is determined. A zero threshold sample count rate (CPM) is derived by counting the sample once in a counting window having a zero threshold lower limit. Normalized values of the measured pulse heights (PH) are developed and correlated with the corresponding pulse counts (CPM) to determine the pulse count for a normalized pulse height value of zero and hence the sample disintegration rate

Explaining transgression in respiratory rate observation methods in the emergency department: A classic grounded theory analysis.

Science.gov (United States)

Flenady, Tracy; Dwyer, Trudy; Applegarth, Judith

2017-09-01

Abnormal respiratory rates are one of the first indicators of clinical deterioration in emergency department(ED) patients. Despite the importance of respiratory rate observations, this vital sign is often inaccurately recorded on ED observation charts, compromising patient safety. Concurrently, there is a paucity of research reporting why this phenomenon occurs. To develop a substantive theory explaining ED registered nurses' reasoning when they miss or misreport respiratory rate observations. This research project employed a classic grounded theory analysis of qualitative data. Seventy-nine registered nurses currently working in EDs within Australia. Data collected included detailed responses from individual interviews and open-ended responses from an online questionnaire. Classic grounded theory (CGT) research methods were utilised, therefore coding was central to the abstraction of data and its reintegration as theory. Constant comparison synonymous with CGT methods were employed to code data. This approach facilitated the identification of the main concern of the participants and aided in the generation of theory explaining how the participants processed this issue. The main concern identified is that ED registered nurses do not believe that collecting an accurate respiratory rate for ALL patients at EVERY round of observations is a requirement, and yet organizational requirements often dictate that a value for the respiratory rate be included each time vital signs are collected. The theory 'Rationalising Transgression', explains how participants continually resolve this problem. The study found that despite feeling professionally conflicted, nurses often erroneously record respiratory rate observations, and then rationalise this behaviour by employing strategies that adjust the significance of the organisational requirement. These strategies include; Compensating, when nurses believe they are compensating for errant behaviour by enhancing the patient's outcome

An application of the variable-r method to subpopulation growth rates in a 19th century agricultural population

Directory of Open Access Journals (Sweden)

Corey Sparks

2009-07-01

Full Text Available This paper presents an analysis of the differential growth rates of the farming and non-farming segments of a rural Scottish community during the 19th and early 20th centuries using the variable-r method allowing for net migration. Using this method, I find that the farming population of Orkney, Scotland, showed less variability in their reproduction and growth rates than the non-farming population during a period of net population decline. I conclude by suggesting that the variable-r method can be used in general cases where the relative growth of subpopulations or subpopulation reproduction is of interest.

The Role of Noble Metal Addition Methods on BWR Shut Down Dose Rates

International Nuclear Information System (INIS)

Cowan, Robert L.; Garcia Susan, E.

2012-09-01

Noble metal addition technology was developed for the BWR as a means of establishing low electrochemical corrosion potentials (ECP) on structural materials to mitigate intergranular stress corrosion cracking (IGSCC). When the reactor water molar ratio of H 2 / (O 2 +H 2 O 2 ) is > 2 on noble metal treated surfaces, the resulting ECP is near -500 mV (SHE), well into the mitigation range. This ratio can be achieved in most areas of the reactor with feedwater hydrogen additions in the range of 0.2 mg/kg, a condition that does not increase the radiation level in the main steam, a side effect of conventional hydrogen water chemistry (HWC). The resulting low ECP on the surface of stainless steel piping and components results in a change in form of the stable corrosion film to a spinel structure. Since it is the 60 Co incorporated into the corrosion film that is the primary source term of shutdown dose rates in BWRs, the structure and composition of the film can have a large influence in the resulting dose rates. The results of the first generation of noble metal technology, noble metal chemical addition (NMCA), showed that the reactor water ratio of 60 Co (s)/Zn (s) was a key parameter in determining shut down dose rate values. This paper will review that history and provide mechanistic understanding of how initial post NMCA dose rates are established and change with time. On-line noble metal chemical addition (OLNC) is the second generation of noble metal technology. The method utilizes the on-line injection of dilute Na 2 Pt (OH) 6 into the feedwater over a period of approximately 10 days. The first application of OLNC occurred at a European reactor in July of 2005 and to date over 20 BWRs have applied the technology, with many more applications scheduled. It is expected that OLNC will become the de facto standard because it eliminates 60 hours of outage application time and it addresses the crack flanking concerns that can arise under certain conditions. Because both

A prediction method for the wax deposition rate based on a radial basis function neural network

Directory of Open Access Journals (Sweden)

Ying Xie

2017-06-01

Full Text Available The radial basis function neural network is a popular supervised learning tool based on machinery learning technology. Its high precision having been proven, the radial basis function neural network has been applied in many areas. The accumulation of deposited materials in the pipeline may lead to the need for increased pumping power, a decreased flow rate or even to the total blockage of the line, with losses of production and capital investment, so research on predicting the wax deposition rate is significant for the safe and economical operation of an oil pipeline. This paper adopts the radial basis function neural network to predict the wax deposition rate by considering four main influencing factors, the pipe wall temperature gradient, pipe wall wax crystal solubility coefficient, pipe wall shear stress and crude oil viscosity, by the gray correlational analysis method. MATLAB software is employed to establish the RBF neural network. Compared with the previous literature, favorable consistency exists between the predicted outcomes and the experimental results, with a relative error of 1.5%. It can be concluded that the prediction method of wax deposition rate based on the RBF neural network is feasible.

Effects of landforms on the erosion rate in a small watershed by the {sup 137}Cs tracing method

Energy Technology Data Exchange (ETDEWEB)

Li Mian, E-mail: hnli-mian@163.co [Yellow River Institute of Hydraulic Research, Key Laboratory of Sediment Research of Yellow River of Ministry of Water Resources, Zhengzhou, Henan 450003 (China); Yao Wenyi [Yellow River Institute of Hydraulic Research, Key Laboratory of Sediment Research of Yellow River of Ministry of Water Resources, Zhengzhou, Henan 450003 (China); Li Zhanbin [Xi' an University of Technology, Xi' an, Shaanxi 710048 (China); Institute of Soil and Water Conservation, Chinese Academy of Sciences and Ministry of Water Resources, Yangling, Shaanxi 712100 (China); Liu Puling [Institute of Soil and Water Conservation, Chinese Academy of Sciences and Ministry of Water Resources, Yangling, Shaanxi 712100 (China); Shen Zhenzhou [Yellow River Institute of Hydraulic Research, Key Laboratory of Sediment Research of Yellow River of Ministry of Water Resources, Zhengzhou, Henan 450003 (China)

2010-05-15

It's very important to analyze and evaluate quantitatively the effects of landforms on soil erosion for the prevention and treatment of soil loss in a small watershed. The objective of this study was to evaluate the effects of landform factors on erosion rate by the {sup 137}Cs tracing method in a small watershed in the Purple Hilly Area of China. The erosion rates under different slope lengths, slope gradients and slope aspects were estimated in Xiangshuitan watershed in the Purple Hilly Area in Sichuan Basin by the {sup 137}Cs tracing method. The results showed that the erosion rate decreased exponentially with downslope distance, and it increased with increasing slope gradient during the scope of 5 deg. - 16 deg. The slope aspect had great impact on the erosion rate, and the hillside on the sunny slope had larger erosion rate than that on the shady slope, particularly for the farmland.

Deficient Suppression of Default Mode Regions during Working Memory in Individuals with Early Psychosis and at Clinical High-Risk for Psychosis.

Science.gov (United States)

Fryer, Susanna L; Woods, Scott W; Kiehl, Kent A; Calhoun, Vince D; Pearlson, Godfrey D; Roach, Brian J; Ford, Judith M; Srihari, Vinod H; McGlashan, Thomas H; Mathalon, Daniel H

2013-01-01

The default mode network (DMN) is a set of brain regions typically activated at rest and suppressed during extrinsic cognition. Schizophrenia has been associated with deficient DMN suppression, though the extent to which DMN dysfunction predates psychosis onset is unclear. This study examined DMN suppression during working memory (WM) performance in youth at clinical high-risk (CHR) for psychosis, early schizophrenia (ESZ) patients, and healthy controls (HC). We hypothesized that the DMN would show load-dependent suppression during WM retrieval in HC but not in ESZ, with CHR participants showing an intermediate pattern. fMRI data were collected from CHR (n = 32), ESZ (n = 22), and HC (n = 54) participants, ages 12-30. DMN regions were defined via seed-based connectivity analysis of resting-state fMRI data from an independent HC sample. Load-dependent deactivations of these DMN regions in response to WM probes were interrogated. Healthy controls showed linear load-dependent increases in DMN deactivation. Significant Group-by-Load interactions were observed in DMN regions including medial prefrontal and lateral posterior parietal cortices. Group-by-Load effects in posterior DMN nodes resulted from less suppression at higher WM loads in ESZ relative to HC, with CHR differing from neither group. In medial prefrontal cortex, suppression of activity at higher WM loads was significantly diminished in both CHR and ESZ groups, relative to HC. In addition, investigation of dorsolateral prefrontal cortex (DLPFC) activations revealed that ESZ activated right DLPFC significantly more than HC, with CHR differing from neither group. While HC showed WM load-dependent modulation of DMN suppression, CHR individuals had deficient higher-load DMN suppression that was similar to, but less pronounced than, the distributed suppression deficits evident in ESZ patients. These results suggest that DMN dysregulation associated with schizophrenia predates psychosis onset.

Prdm9 incompatibility controls oligospermia and delayed fertility but no selfish transmission in mouse intersubspecific hybrids.

Science.gov (United States)

Flachs, Petr; Bhattacharyya, Tanmoy; Mihola, Ondřej; Piálek, Jaroslav; Forejt, Jiří; Trachtulec, Zdenek

2014-01-01

PR-domain 9 (Prdm9) is the first hybrid sterility gene identified in mammals. The incompatibility between Prdm9 from Mus musculus domesticus (Mmd; the B6 strain) and the Hstx2 region of chromosome (Chr) X from M. m. musculus (Mmm; the PWD strain) participates in the complete meiotic arrest of mouse intersubspecific (PWD×B6)F1 hybrid males. Other studies suggest that also semisterile intersubspecific hybrids are relevant for mouse speciation, but the genes responsible remain unknown. To investigate the causes of this semisterility, we analyzed the role of Prdm9 and Chr X in hybrids resulting from the crosses of PWK, another Mmm-derived inbred strain. We demonstrate that Prdm9 and Chr X control the partial meiotic arrest and reduced sperm count in (PWK×B6)F1 males. Asynapsis of heterosubspecific chromosomes and semisterility were partially suppressed by removal of the B6 allele of Prdm9. Polymorphisms between PWK and PWD on Chr X but not in the Prdm9 region were responsible for the modification of the outcome of Prdm9-Chr X F1 hybrid incompatibility. Furthermore, (PWK×B6)F1 hybrid males displayed delayed fertility dependent on the Prdm9 incompatibility. While the Drosophila hybrid sterility gene Overdrive causes both delayed fertility and increased transmission of its own chromosome to the offspring, the segregation of Chr X and the Prdm9 region from the mouse (PWK×B6)F1 males was normal. Our results indicate extended functional consequences of Prdm9-Chr X intersubspecific incompatibility on the fertility of hybrids and should influence the design of fertility analyses in hybrid zones and of laboratory crosses between Mmm and Mmd strains.

Prdm9 incompatibility controls oligospermia and delayed fertility but no selfish transmission in mouse intersubspecific hybrids.

Directory of Open Access Journals (Sweden)

Petr Flachs

Full Text Available PR-domain 9 (Prdm9 is the first hybrid sterility gene identified in mammals. The incompatibility between Prdm9 from Mus musculus domesticus (Mmd; the B6 strain and the Hstx2 region of chromosome (Chr X from M. m. musculus (Mmm; the PWD strain participates in the complete meiotic arrest of mouse intersubspecific (PWD×B6F1 hybrid males. Other studies suggest that also semisterile intersubspecific hybrids are relevant for mouse speciation, but the genes responsible remain unknown. To investigate the causes of this semisterility, we analyzed the role of Prdm9 and Chr X in hybrids resulting from the crosses of PWK, another Mmm-derived inbred strain. We demonstrate that Prdm9 and Chr X control the partial meiotic arrest and reduced sperm count in (PWK×B6F1 males. Asynapsis of heterosubspecific chromosomes and semisterility were partially suppressed by removal of the B6 allele of Prdm9. Polymorphisms between PWK and PWD on Chr X but not in the Prdm9 region were responsible for the modification of the outcome of Prdm9-Chr X F1 hybrid incompatibility. Furthermore, (PWK×B6F1 hybrid males displayed delayed fertility dependent on the Prdm9 incompatibility. While the Drosophila hybrid sterility gene Overdrive causes both delayed fertility and increased transmission of its own chromosome to the offspring, the segregation of Chr X and the Prdm9 region from the mouse (PWK×B6F1 males was normal. Our results indicate extended functional consequences of Prdm9-Chr X intersubspecific incompatibility on the fertility of hybrids and should influence the design of fertility analyses in hybrid zones and of laboratory crosses between Mmm and Mmd strains.

Direct risk standardisation: a new method for comparing casemix adjusted event rates using complex models.

Science.gov (United States)

Nicholl, Jon; Jacques, Richard M; Campbell, Michael J

2013-10-29

Comparison of outcomes between populations or centres may be confounded by any casemix differences and standardisation is carried out to avoid this. However, when the casemix adjustment models are large and complex, direct standardisation has been described as "practically impossible", and indirect standardisation may lead to unfair comparisons. We propose a new method of directly standardising for risk rather than standardising for casemix which overcomes these problems. Using a casemix model which is the same model as would be used in indirect standardisation, the risk in individuals is estimated. Risk categories are defined, and event rates in each category for each centre to be compared are calculated. A weighted sum of the risk category specific event rates is then calculated. We have illustrated this method using data on 6 million admissions to 146 hospitals in England in 2007/8 and an existing model with over 5000 casemix combinations, and a second dataset of 18,668 adult emergency admissions to 9 centres in the UK and overseas and a published model with over 20,000 casemix combinations and a continuous covariate. Substantial differences between conventional directly casemix standardised rates and rates from direct risk standardisation (DRS) were found. Results based on DRS were very similar to Standardised Mortality Ratios (SMRs) obtained from indirect standardisation, with similar standard errors. Direct risk standardisation using our proposed method is as straightforward as using conventional direct or indirect standardisation, always enables fair comparisons of performance to be made, can use continuous casemix covariates, and was found in our examples to have similar standard errors to the SMR. It should be preferred when there is a risk that conventional direct or indirect standardisation will lead to unfair comparisons.

Luminance and chromatic contributions to a hyperacuity task: isolation by contrast polarity and target separation.

Science.gov (United States)

Sun, Hao; Cooper, Bonnie; Lee, Barry B

2012-03-01

Vernier thresholds are known to be elevated when a target pair has opposite contrast polarity. Polarity reversal is used to assess the role of luminance and chromatic pathways in hyperacuity performance. Psychophysical hyperacuity thresholds were measured for pairs of gratings of various combinations of luminance (Lum) and chromatic (Chr) contrast polarities, at different ratios of luminance to chromatic contrast. With two red-green gratings of matched luminance and chromatic polarity (+Lum+Chr), there was an elevation of threshold at isoluminance. When both luminance and chromatic polarity were mismatched (-Lum-Chr), thresholds were substantially elevated under all conditions. With the same luminance contrast polarity and opposite chromatic polarity (+Lum-Chr) thresholds were only elevated close to isoluminance; in the reverse condition (-Lum+Chr), thresholds were elevated as in the -Lum-Chr condition except close to equiluminance. Similar data were obtained for gratings isolating the short-wavelength cone mechanism. Further psychophysical measurements assessed the role of target separation with matched or mismatched contrast polarity; similar results were found for luminance and chromatic gratings. Comparison physiological data were collected from parafoveal ganglion cells of the macaque retina. Positional precision of ganglion cell signals was assessed under conditions related to the psychophysical measurements. On the basis of these combined observations, it is argued that both magnocellular, parvocellular, and koniocellular pathways have access to cortical positional mechanisms associated with vernier acuity. Copyright © 2012 Elsevier Ltd. All rights reserved.

Identification of quantitative trait loci underlying seed protein content of soybean including main, epistatic, and QTL × environment effects in different regions of Northeast China.

Science.gov (United States)

Teng, Weili; Li, Wen; Zhang, Qi; Wu, Depeng; Zhao, Xue; Li, Haiyan; Han, Yingpeng; Li, Wenbin

2017-08-01

The objective here was to identify QTL underlying soybean protein content (PC), and to evaluate the additive and epistatic effects of the QTLs. A mapping population, consisting of 129 recombinant inbred lines (RILs), was created by crossing 'Dongnong 46' and 'L-100'. Phenotypic data of the parents and RILs were collected for 4 years in three locations of Heilongjiang Province of China. A total of 213 SSR markers were used to construct a genetic linkage map. Eight QTLs, located on seven chromosomes (Chr), were identified to be associated with PC among the 10 tested environments. Of the seven QTLs, five QTLs, qPR-2 (Satt710, on Chr9), qPR-3 (Sat_122, on Chr12), qPR-5 (Satt543, on Chr17), qPR-7 (Satt163, on Chr18), and qPR-8 (Satt614, on Chr20), were detected in six, seven, seven, six, and seven environments, respectively, implying relatively stable QTLs. qPR-3 could explain 3.33%-11.26% of the phenotypic variation across eight tested environments. qPR-5 and qPR-8 explained 3.64%-10.1% and 11.86%-18.40% of the phenotypic variation, respectively, across seven tested environments. Eight QTLs associated with PC exhibited additive and (or) additive × environment interaction effects. The results showed that environment-independent QTLs often had higher additive effects. Moreover, five epistatic pairwise QTLs were identified in the 10 environments.

GenBank blastx search result: AK059350 [KOME

Lifescience Database Archive (English)

Full Text Available r SLU7; DNA segment, Chr 11, ERATO Doi 730, expressed; DNA segment, Chr 3, Brigham & Womens Genetics 0878 expressed, mRNA (cDNA clone IMAGE:6890616), partial cds.|ROD ROD 1e-103 +3 ...

AcEST: DK956057 [AcEST

Lifescience Database Archive (English)

Full Text Available FIHLYISNCISTCEQIKDKYMQN 228 >tr|B0BNA9|B0BNA9_RAT Similar to DNA segment, Chr 1, Brigham & Women...s Genetics 0212 expressed (Similar to DNA segment, Chr 1, Brigham & Womens Genetics 0212 expr