WorldWideScience

Sample records for rapidly reannealing dna

  1. Very fast simulated re-annealing

    OpenAIRE

    L. Ingber

    1989-01-01

    Draft An algorithm is developed to statistically find the best global fit of a nonlinear non-convex cost-function over a D-dimensional space. It is argued that this algorithm permits an annealing schedule for ‘‘temperature’’ T decreasing exponentially in annealing-time k, T = T0 exp(−ck1/D). The introduction of re-annealing also permits adaptation to changing sensitivities in the multidimensional parameter-space. This annealing schedule is faster than fast Cauchy annealing, ...

  2. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E.; Korgsdam, A.-M.; Jørgensen, H.F.

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  3. PTFE Additive and Re-annealing Effect on Thermoluminescence Response of CaSO4:Dy Derived from Co-precipitation Method

    Science.gov (United States)

    Nuraeni, Nunung; Dwi Septianto, Ricky; Iskandar, Ferry; Haryanto, Freddy; Waris, Abdul; Hiswara, Eri

    2017-07-01

    Effect of re-annealing treatment in thermoluminescence response of thermoluminescent dosimeter (TLD) CaSO4:Dy and CaSO4:Dy with PTFE (Polytetrafluoroethylene) addition was investigated. CaSO4:Dy was prepared by a co-precipitation method. The PTFE was added before re-annealing treatment which the mass ratio of CaSO4:Dy and PTFE was fixed to 2:3. The re-annealing treatments of the samples were done at temperature 700 °C for 1 hr. The obtained samples were characterized using a Fourier-transform infrared (FTIR) and X-ray diffraction (XRD) to observe the molecule bonding in sample and crystal properties, respectively. From the experimental results, it was observed that the thermoluminescence intensity of CaSO4:Dy, CaSO4:Dy re-annealed at 700 °C, and CaSO4:Dy + PTFE re-annealed at 700 °C are 57.03, 75.15, and 1191.11 nC, respectively. The intensity of 700 °C-re-annealed CaSO4:Dy increased significantly after PTFE addition.

  4. mtSSB may sequester UNG1 at mitochondrial ssDNA and delay uracil processing until the dsDNA conformation is restored

    DEFF Research Database (Denmark)

    Wollen Steen, Kristian; Doseth, Berit; westbye, Marianne

    2012-01-01

    Single-strand DNA binding proteins protect DNA from nucleolytic damage, prevent formation of secondary structures and prevent premature reannealing of DNA in DNA metabolic transactions. In eukaryotes, the nuclear single-strand DNA binding protein RPA is essential for chromosomal DNA replication...

  5. Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

    Science.gov (United States)

    Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

    2016-01-01

    Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample

  6. Towards rapid prototyped convective microfluidic DNA amplification platform

    Science.gov (United States)

    Ajit, Smrithi; Praveen, Hemanth Mithun; Puneeth, S. B.; Dave, Abhishek; Sesham, Bharat; Mohan, K. N.; Goel, Sanket

    2017-02-01

    Today, Polymerase Chain Reaction (PCR) based DNA amplification plays an indispensable role in the field of biomedical research. Its inherent ability to exponentially amplify sample DNA has proven useful for the identification of virulent pathogens like those causing Multiple Drug-Resistant Tuberculosis (MDR-TB). The intervention of Microfluidics technology has revolutionized the concept of PCR from being a laborious and time consuming process into one that is faster, easily portable and capable of being multifunctional. The Microfluidics based PCR outweighs its traditional counterpart in terms of flexibility of varying reaction rate, operation simplicity, need of a fraction of volume and capability of being integrated with other functional elements. The scope of the present work involves the development of a real-time continuous flow microfluidic device, fabricated by 3D printing-governed rapid prototyping method, eventually leading to an automated and robust platform to process multiple DNA samples for detection of MDRTB-associated mutations. The thermal gradient characteristic to the PCR process is produced using peltier units appropriate to the microfluidic environment fully monitored and controlled by a low cost controller driven by a Data Acquisition System. The process efficiency achieved in the microfluidic environment in terms of output per cycle is expected to be on par with the traditional PCR and capable of earning the additional advantages of being faster and minimizing the handling.

  7. Rapid transfer of DNA from agarose gels to nylon membranes.

    OpenAIRE

    Reed, K C; Mann, D A

    1985-01-01

    The unique properties of nylon membranes allow for dramatic improvement in the capillary transfer of DNA restriction fragments from agarose gels (Southern blotting). By using 0.4 M NaOH as the transfer solvent following a short pre-treatment of the gel in acid, DNA is depurinated during transfer. Fragments of all sizes are eluted and retained quantitatively by the membrane; furthermore, the alkaline solvent induces covalent fixation of DNA to the membrane. The saving in time and materials aff...

  8. Rapid and inexpensive method for isolating plasmid DNA

    International Nuclear Information System (INIS)

    Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

    1997-01-01

    A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

  9. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  10. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    Total DNA of Chokanan mango (Mangifera indica L.) was extracted from the leaf for the construction of total genomic library. However, the quality of the extracted DNA was often compromised by the presence of secondary metabolites, thus interfering with the analytical applications. Improvement on the quality of the ...

  11. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  12. Capillary gel electrophoresis for rapid, high resolution DNA sequencing.

    OpenAIRE

    Swerdlow, H; Gesteland, R

    1990-01-01

    Capillary gel electrophoresis has been demonstrated for the separation and detection of DNA sequencing samples. Enzymatic dideoxy nucleotide chain termination was employed, using fluorescently tagged oligonucleotide primers and laser based on-column detection (limit of detection is 6,000 molecules per peak). Capillary gel separations were shown to be three times faster, with better resolution (2.4 x), and higher separation efficiency (5.4 x) than a conventional automated slab gel DNA sequenci...

  13. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  14. A rapid mini-prep DNA extraction method in rice (Oryza sativa)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-01-19

    Jan 19, 2009 ... homogenizer with a plastic tip is incomplete, since the leaves of these plants .... mortar and pestle with liquid nitrogen and transferred to a tube. ... rapid DNA extraction protocols for gymnosperms for application in population ...

  15. Rapid isolation of high molecular weight DNA from single dried ...

    African Journals Online (AJOL)

    ANAND

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri. Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  16. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    gels, containing 7% glycerol, and 1×TBE buffer. The gels were run under 200 .... Inc. Germany, GeneaidTM DNA Isolation Kit, Geneaid. Biotech., New Taipei City, .... C. L. and Arsenos G. 2015 Comparison of eleven methods for genomic DNA ...

  17. An optimized rapid bisulfite conversion method with high recovery of cell-free DNA.

    Science.gov (United States)

    Yi, Shaohua; Long, Fei; Cheng, Juanbo; Huang, Daixin

    2017-12-19

    Methylation analysis of cell-free DNA is a encouraging tool for tumor diagnosis, monitoring and prognosis. Sensitivity of methylation analysis is a very important matter due to the tiny amounts of cell-free DNA available in plasma. Most current methods of DNA methylation analysis are based on the difference of bisulfite-mediated deamination of cytosine between cytosine and 5-methylcytosine. However, the recovery of bisulfite-converted DNA based on current methods is very poor for the methylation analysis of cell-free DNA. We optimized a rapid method for the crucial steps of bisulfite conversion with high recovery of cell-free DNA. A rapid deamination step and alkaline desulfonation was combined with the purification of DNA on a silica column. The conversion efficiency and recovery of bisulfite-treated DNA was investigated by the droplet digital PCR. The optimization of the reaction results in complete cytosine conversion in 30 min at 70 °C and about 65% of recovery of bisulfite-treated cell-free DNA, which is higher than current methods. The method allows high recovery from low levels of bisulfite-treated cell-free DNA, enhancing the analysis sensitivity of methylation detection from cell-free DNA.

  18. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  19. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

    Science.gov (United States)

    Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

    2014-12-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

  20. Rapid DNA sequencing by horizontal ultrathin gel electrophoresis.

    OpenAIRE

    Brumley, R L; Smith, L M

    1991-01-01

    A horizontal polyacrylamide gel electrophoresis apparatus has been developed that decreases the time required to separate the DNA fragments produced in enzymatic sequencing reactions. The configuration of this apparatus and the use of circulating coolant directly under the glass plates result in heat exchange that is approximately nine times more efficient than passive thermal transfer methods commonly used. Bubble-free gels as thin as 25 microns can be routinely cast on this device. The appl...

  1. Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform

    Directory of Open Access Journals (Sweden)

    Shan Wei

    2018-05-01

    Full Text Available Real-time sequencing of short DNA reads has a wide variety of clinical and research applications including screening for mutations, target sequences and aneuploidy. We recently demonstrated that MinION, a nanopore-based DNA sequencing device the size of a USB drive, could be used for short-read DNA sequencing. In this study, an ultra-rapid multiplex library preparation and sequencing method for the MinION is presented and applied to accurately test normal diploid and aneuploidy samples’ genomic DNA in under three hours, including library preparation and sequencing. This novel method shows great promise as a clinical diagnostic test for applications requiring rapid short-read DNA sequencing.

  2. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  3. A pneumatic device for rapid loading of DNA sequencing gels.

    Science.gov (United States)

    Panussis, D A; Cook, M W; Rifkin, L L; Snider, J E; Strong, J T; McGrane, R M; Wilson, R K; Mardis, E R

    1998-05-01

    This work describes the design and construction of a device that facilitates the loading of DNA samples onto polyacrylamide gels for detection in the Perkin Elmer/Applied Biosystems (PE/ABI) 373 and 377 DNA sequencing instruments. The device is mounted onto the existing gel cassettes and makes the process of loading high-density gels less cumbersome while the associated time and errors are reduced. The principle of operation includes the simultaneous transfer of the entire batch of samples, in which a spring-loaded air cylinder generates positive pressure and flexible silica capillaries transfer the samples. A retractable capillary array carrier allows the delivery ends of the capillaries to be held up clear of the gel during loader attachment on the gel plates, while enabling their insertion in the gel wells once the device is securely mounted. Gel-loading devices capable of simultaneously transferring 72 samples onto the PE/ABI 373 and 377 are currently being used in our production sequencing groups while a 96-sample transfer prototype undergoes testing.

  4. DNA Probe Pooling for Rapid Delineation of Chromosomal Breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Kwan, Johnson; Baumgartner, Adolf; Weier, Jingly F.; Wang, Mei; Escudero, Tomas; Munne' , Santiago; Zitzelsberger, Horst F.; Weier, Heinz-Ulrich

    2009-01-30

    Structural chromosome aberrations are hallmarks of many human genetic diseases. The precise mapping of translocation breakpoints in tumors is important for identification of genes with altered levels of expression, prediction of tumor progression, therapy response, or length of disease-free survival as well as the preparation of probes for detection of tumor cells in peripheral blood. Similarly, in vitro fertilization (IVF) and preimplantation genetic diagnosis (PGD) for carriers of balanced, reciprocal translocations benefit from accurate breakpoint maps in the preparation of patient-specific DNA probes followed by a selection of normal or balanced oocytes or embryos. We expedited the process of breakpoint mapping and preparation of case-specific probes by utilizing physically mapped bacterial artificial chromosome (BAC) clones. Historically, breakpoint mapping is based on the definition of the smallest interval between proximal and distal probes. Thus, many of the DNA probes prepared for multi-clone and multi-color mapping experiments do not generate additional information. Our pooling protocol described here with examples from thyroid cancer research and PGD accelerates the delineation of translocation breakpoints without sacrificing resolution. The turnaround time from clone selection to mapping results using tumor or IVF patient samples can be as short as three to four days.

  5. Facile preparation of a DNA sensor for rapid herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Tam, Phuong Dinh, E-mail: tampd-hast@mail.hut.edu.vn [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Tuan, Mai Anh, E-mail: tuanma-itims@mail.hut.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam); Huy, Tran Quang [National Institute of Hygiene and Epidemiology (NIHE), 01 Yersin, Hai Ba Trung District, Hanoi (Viet Nam); Le, Anh-Tuan [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Hieu, Nguyen Van, E-mail: hieu@itims.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam)

    2010-10-12

    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  6. Facile preparation of a DNA sensor for rapid herpes virus detection

    International Nuclear Information System (INIS)

    Tam, Phuong Dinh; Tuan, Mai Anh; Huy, Tran Quang; Le, Anh-Tuan; Hieu, Nguyen Van

    2010-01-01

    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  7. A Rapid and Cost-Effective Method for DNA Extraction from Archival Herbarium Specimens.

    Science.gov (United States)

    Krinitsina, A A; Sizova, T V; Zaika, M A; Speranskaya, A S; Sukhorukov, A P

    2015-11-01

    Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.

  8. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  9. Photoelectrochemical Sensors for the Rapid Detection of DNA Damage Induced by Some Nanoparticles

    Directory of Open Access Journals (Sweden)

    M. Jamaluddin Ahmed

    2010-06-01

    Full Text Available Photoelectrochemcal sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy2 (dppz2+ [bpy=2, 2′ -bipyridine, dppz=dipyrido( 3, 2-a: 2′ 3′-c phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy2 (dppz2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time – dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polysterene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals.

  10. Photoelectrochemical sensors for the rapid detection of DNA damage Induced by some nanoparticles

    International Nuclear Information System (INIS)

    Ahmed, M.J.; Zhang, B.T.; Guo, L.H.

    2010-01-01

    Photoelectrochemical sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy)2 (dppz)2+ [bpy=2, 2' -bipyridine, dppz=dipyrido (3, 2-a: 2' 3'-c) phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy)2 (dppz)2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine) was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time . dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polystyrene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals. (author)

  11. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.

    Science.gov (United States)

    Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B

    2017-01-01

    Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.

  12. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  13. Rapid detection and purification of sequence specific DNA binding proteins using magnetic separation

    Directory of Open Access Journals (Sweden)

    TIJANA SAVIC

    2006-02-01

    Full Text Available In this paper, a method for the rapid identification and purification of sequence specific DNA binding proteins based on magnetic separation is presented. This method was applied to confirm the binding of the human recombinant USF1 protein to its putative binding site (E-box within the human SOX3 protomer. It has been shown that biotinylated DNA attached to streptavidin magnetic particles specifically binds the USF1 protein in the presence of competitor DNA. It has also been demonstrated that the protein could be successfully eluted from the beads, in high yield and with restored DNA binding activity. The advantage of these procedures is that they could be applied for the identification and purification of any high-affinity sequence-specific DNA binding protein with only minor modifications.

  14. The Semi-Quantitative Study of Magnetization Process on Milling and Reannealing of Barium Hexaferrite (BaO.6Fe2O3

    Directory of Open Access Journals (Sweden)

    Ridwan

    2009-07-01

    Full Text Available Barium hexaferrite (BaO.6Fe2O3 is as a hard magnetic material with good chemical stability which has been intensively used as permanent magnet components. Many works have been done in order to improve their magnetic properties either through chemical process or powders metallurgy technique. In this work, commercial BaO.6Fe2O3 was milled using high-energy milling machine for 10, 20 and 30 hours and followed by reannealing for 3 hours at 1000⁰C in air. X-ray diffraction pattern indicate no phase decomposition occurred caused the mill processing, annealing of milled powders recovered the crystal system and promoted crystallite growth. The magnetic hysteresis curve measured by vibrating sample magnetometer (VSM shows the coercivity of annealed BaO.6Fe2O3 increases to two times higher than the original one. By using Jiles-Atherton model, all the hysteresis parameters Ms, k, α, a and c, have been determined adopted to the Genetic Algorithm (GA. The analyzed hysteretic parameters obtained from this work is congruent to the change of magnetic properties of as-milled and annealed powders of barium hexaferrite.

  15. Rapid detection of cancer related DNA nanoparticulate biomarkers and nanoparticles in whole blood

    Science.gov (United States)

    Heller, Michael J.; Krishnan, Raj; Sonnenberg, Avery

    2010-08-01

    The ability to rapidly detect cell free circulating (cfc) DNA, cfc-RNA, exosomes and other nanoparticulate disease biomarkers as well as drug delivery nanoparticles directly in blood is a major challenge for nanomedicine. We now show that microarray and new high voltage dielectrophoretic (DEP) devices can be used to rapidly isolate and detect cfc-DNA nanoparticulates and nanoparticles directly from whole blood and other high conductance samples (plasma, serum, urine, etc.). At DEP frequencies of 5kHz-10kHz both fluorescent-stained high molecular weight (hmw) DNA, cfc-DNA and fluorescent nanoparticles separate from the blood and become highly concentrated at specific DEP highfield regions over the microelectrodes, while blood cells move to the DEP low field-regions. The blood cells can then be removed by a simple fluidic wash while the DNA and nanoparticles remain highly concentrated. The hmw-DNA could be detected at a level of <260ng/ml and the nanoparticles at <9.5 x 109 particles/ml, detection levels that are well within the range for viable clinical diagnostics and drug nanoparticle monitoring. Disease specific cfc-DNA materials could also be detected directly in blood from patients with Chronic Lymphocytic Leukemia (CLL) and confirmed by PCR genotyping analysis.

  16. Rapid and efficient method to extract metagenomic DNA from estuarine sediments.

    Science.gov (United States)

    Shamim, Kashif; Sharma, Jaya; Dubey, Santosh Kumar

    2017-07-01

    Metagenomic DNA from sediments of selective estuaries of Goa, India was extracted using a simple, fast, efficient and environment friendly method. The recovery of pure metagenomic DNA from our method was significantly high as compared to other well-known methods since the concentration of recovered metagenomic DNA ranged from 1185.1 to 4579.7 µg/g of sediment. The purity of metagenomic DNA was also considerably high as the ratio of absorbance at 260 and 280 nm ranged from 1.88 to 1.94. Therefore, the recovered metagenomic DNA was directly used to perform various molecular biology experiments viz. restriction digestion, PCR amplification, cloning and metagenomic library construction. This clearly proved that our protocol for metagenomic DNA extraction using silica gel efficiently removed the contaminants and prevented shearing of the metagenomic DNA. Thus, this modified method can be used to recover pure metagenomic DNA from various estuarine sediments in a rapid, efficient and eco-friendly manner.

  17. Rapid DNA multi-analyte immunoassay on a magneto-resistance biosensor

    NARCIS (Netherlands)

    Koets, M.; Wijk, van der T.; Eemeren, van J.T.W.M.; Amerongen, van A.; Prins, M.W.J.

    2009-01-01

    We present the rapid and sensitive detection of amplified DNA on a giant magneto-resistance sensor using superparamagnetic particles as a detection label. The one-step assay is performed on an integrated and miniaturized detection platform suitable for application into point-of-care devices. A

  18. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  19. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  20. RBE comparison between rapid electrons of 20 MeV and 45 MeV with survival rate, DNA synthesis, DNA reparation and nucleoid sedimentation

    International Nuclear Information System (INIS)

    Alth, G.; Weniger, P.; Turtzer, K.; Klein, W.; Kocsis, F.; Krankenhaus der Stadt Wien-Lainz; Oesterreichisches Forschungszentrum Seibersdorf G.m.b.H. Inst. fuer Biologie)

    1982-01-01

    In order to find out possible differences of the biologic efficacy of rapid electrons of different energies, the authors examined the influence of rapid electrons of 20 MeV and 45 MeV upon the survival rate of Hela cells S3, their cell growth, DNA synthesis, DNA reparation, and sedimentation of nucleoids. The results show a difference only for the nucleoid sedimentation, i.e. there are more fractured DNA cords after 45 MeV irradiation. No significant differences could be demonstrated for the parameters of the survival curve, DNA synthesis and DNA reparation. Four double tests were carried out corresponding to the indicated types of examination. (orig.) [de

  1. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples.

    Science.gov (United States)

    Guha, Pokhraj; Das, Avishek; Dutta, Somit; Chaudhuri, Tapas Kumar

    2018-01-01

    Different methods available for extraction of human genomic DNA suffer from one or more drawbacks including low yield, compromised quality, cost, time consumption, use of toxic organic solvents, and many more. Herein, we aimed to develop a method to extract DNA from 500 μL of fresh or frozen human blood. Five hundred microliters of fresh and frozen human blood samples were used for standardization of the extraction procedure. Absorbance at 260 and 280 nm, respectively, (A 260 /A 280 ) were estimated to check the quality and quantity of the extracted DNA sample. Qualitative assessment of the extracted DNA was checked by Polymerase Chain reaction and double digestion of the DNA sample. Our protocol resulted in average yield of 22±2.97 μg and 20.5±3.97 μg from 500 μL of fresh and frozen blood, respectively, which were comparable to many reference protocols and kits. Besides yielding bulk amount of DNA, our protocol is rapid, economical, and avoids toxic organic solvents such as Phenol. Due to unaffected quality, the DNA is suitable for downstream applications. The protocol may also be useful for pursuing basic molecular researches in laboratories having limited funds. © 2017 Wiley Periodicals, Inc.

  2. Rapid Sequential in Situ Multiplexing with DNA Exchange Imaging in Neuronal Cells and Tissues.

    Science.gov (United States)

    Wang, Yu; Woehrstein, Johannes B; Donoghue, Noah; Dai, Mingjie; Avendaño, Maier S; Schackmann, Ron C J; Zoeller, Jason J; Wang, Shan Shan H; Tillberg, Paul W; Park, Demian; Lapan, Sylvain W; Boyden, Edward S; Brugge, Joan S; Kaeser, Pascal S; Church, George M; Agasti, Sarit S; Jungmann, Ralf; Yin, Peng

    2017-10-11

    To decipher the molecular mechanisms of biological function, it is critical to map the molecular composition of individual cells or even more importantly tissue samples in the context of their biological environment in situ. Immunofluorescence (IF) provides specific labeling for molecular profiling. However, conventional IF methods have finite multiplexing capabilities due to spectral overlap of the fluorophores. Various sequential imaging methods have been developed to circumvent this spectral limit but are not widely adopted due to the common limitation of requiring multirounds of slow (typically over 2 h at room temperature to overnight at 4 °C in practice) immunostaining. We present here a practical and robust method, which we call DNA Exchange Imaging (DEI), for rapid in situ spectrally unlimited multiplexing. This technique overcomes speed restrictions by allowing for single-round immunostaining with DNA-barcoded antibodies, followed by rapid (less than 10 min) buffer exchange of fluorophore-bearing DNA imager strands. The programmability of DEI allows us to apply it to diverse microscopy platforms (with Exchange Confocal, Exchange-SIM, Exchange-STED, and Exchange-PAINT demonstrated here) at multiple desired resolution scales (from ∼300 nm down to sub-20 nm). We optimized and validated the use of DEI in complex biological samples, including primary neuron cultures and tissue sections. These results collectively suggest DNA exchange as a versatile, practical platform for rapid, highly multiplexed in situ imaging, potentially enabling new applications ranging from basic science, to drug discovery, and to clinical pathology.

  3. The DNA 'comet assay' as a rapid screening technique to control irradiated food

    International Nuclear Information System (INIS)

    Cerda, H.; Delincee, H.; Haine, H.; Rupp, H.

    1997-01-01

    The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded

  4. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    Science.gov (United States)

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

    2018-02-15

    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  5. A rapid and quantitative method to determine the tritium content in DNA from small tissue sampes

    International Nuclear Information System (INIS)

    Kasche, V.; Zoellner, R.

    1979-01-01

    A rapid and quantitative two-step procedure to isolate double-strand DNA from small (10-100 mg) animal tissue samples is presented. The method is developed for investigations to evaluate the relative importance of organically bound tritium for the dose factors used to calculate dose commitments due to this nuclide. In the first step the proteins in the homogenized sample are hydrolysed, at a high pH (9.0) and ionic strength (1.5) to dissociate protein from DNA, using immobilized Proteinase K as a proteolytic enzyme. The DNA is then absorbed to hydroxylapatite and separated from impurities by step-wise elution with buffers of increasing ionic strength. More than 90% of the DNA in the samples could be isolated in double-strand form by this procedure. The method has been applied to determine pool-sizes and biological half-life times of tritium in DNA from various animal (mouse) tissues. It has also been shown to be suitable in other radiobiological studies where effects on DNA are investigated. (author)

  6. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  7. Rapid turnover of 2-LTR HIV-1 DNA during early stage of highly active antiretroviral therapy.

    Directory of Open Access Journals (Sweden)

    Weijun Zhu

    Full Text Available BACKGROUND: Despite prolonged treatment with highly active antiretroviral therapy (HAART, the infectious HIV-1 continues to replicate and resides latently in the resting memory CD4+ T lymphocytes, which blocks the eradication of HIV-1. The viral persistence of HIV-1 is mainly caused by its proviral DNA being either linear nonintegrated, circular nonintegrated, or integrated. Previous reports have largely focused on the dynamics of HIV-1 DNA from the samples collected with relatively long time intervals during the process of disease and HAART treatment, which may have missed the intricate changes during the intervals in early treatment. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we investigated the dynamics of HIV-1 DNA in patients during the early phase of HARRT treatment. Using optimized real time PCR, we observed significant changes in 2-LTR during the first 12-week of treatment, while total and integrated HIV-1 DNA remained stable. The doubling time and half-life of 2-LTR were not correlated with the baseline and the rate of changes in plasma viral load and various CD4+ T-cell populations. Longitudinal analyses on 2-LTR sequences and plasma lipopolysaccharide (LPS levels did not reveal any significant changes in the same treatment period. CONCLUSIONS/SIGNIFICANCE: Our study revealed the rapid changes in 2-LTR concentration in a relatively large number of patients during the early HAART treatment. The rapid changes indicate the rapid infusion and clearance of cells bearing 2-LTR in the peripheral blood. Those changes are not expected to be caused by the blocking of viral integration, as our study did not include the integrase inhibitor raltegravir. Our study helps better understand the dynamics of HIV-DNA and its potential role as a biomarker for the diseases and for the treatment efficacy of HAART.

  8. Essential Function of Dicer in Resolving DNA Damage in the Rapidly Dividing Cells of the Developing and Malignant Cerebellum

    Directory of Open Access Journals (Sweden)

    Vijay Swahari

    2016-01-01

    Full Text Available Maintenance of genomic integrity is critical during neurodevelopment, particularly in rapidly dividing cerebellar granule neuronal precursors that experience constitutive replication-associated DNA damage. As Dicer was recently recognized to have an unexpected function in the DNA damage response, we examined whether Dicer was important for preserving genomic integrity in the developing brain. We report that deletion of Dicer in the developing mouse cerebellum resulted in the accumulation of DNA damage leading to cerebellar progenitor degeneration, which was rescued with p53 deficiency; deletion of DGCR8 also resulted in similar DNA damage and cerebellar degeneration. Dicer deficiency also resulted in DNA damage and death in other rapidly dividing cells including embryonic stem cells and the malignant cerebellar progenitors in a mouse model of medulloblastoma. Together, these results identify an essential function of Dicer in resolving the spontaneous DNA damage that occurs during the rapid proliferation of developmental progenitors and malignant cells.

  9. Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

    Science.gov (United States)

    Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

    2017-08-12

    Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

  10. Rapid detection of DNA-interstrand and DNA-protein cross-links in mammalian cells by gravity-flow alkaline elution

    International Nuclear Information System (INIS)

    Hincks, J.R.; Coulombe, R.A. Jr.

    1989-01-01

    Alkaline elution is a sensitive and commonly used technique to detect cellular DNA damage in the form of DNA strand breaks and DNA cross-links. Conventional alkaline elution procedures have extensive equipment requirements and are tedious to perform. Our laboratory recently presented a rapid, simplified, and sensitive modification of the alkaline elution technique to detect carcinogen-induced DNA strand breaks. In the present study, we have further modified this technique to enable the rapid characterization of chemically induced DNA-interstrand and DNA-protein associated cross-links in cultured epithelial cells. Cells were exposed to three known DNA cross-linking agents, nitrogen mustard (HN 2 ), mitomycin C (MMC), or ultraviolet irradiation (UV). One hour exposures of HN 2 at 0.25, 1.0, and 4.0 microM or of MMC at 20, 40, and 60 microM produced a dose-dependent induction of total DNA cross-links by these agents. Digestion with proteinase K revealed that HN 2 and MMC induced both DNA-protein cross-links and DNA-interstrand cross-links. Ultraviolet irradiation induced both DNA cross-links and DNA strand breaks, the latter of which were either protein and nonprotein associated. The results demonstrate that gravity-flow alkaline elution is a sensitive and accurate method to characterize the molecular events of DNA cross-linking. Using this procedure, elution of DNA from treated cells is completed in 1 hr, and only three fractions per sample are analyzed. This method may be useful as a rapid screening assay for genotoxicity and/or as an adjunct to other predictive assays for potential mutagenic or carcinogenic agents

  11. Rapid on-site detection of Acidovorax avenae subsp. citrulli by gold-labeled DNA strip sensor.

    Science.gov (United States)

    Zhao, Wenjun; Lu, Jie; Ma, Wenwei; Xu, Chuanlai; Kuang, Hua; Zhu, Shuifang

    2011-06-15

    Acidovorax avenae subsp. citrulli (AAC) is one of the most harmful diseases in cucurbit production. A rapid and sensitive DNA strip sensor was constructed based on gold nanoparticle-labeled oligonucleotide probes for the detection of AAC. Both the qualitative and semi-quantitative detections of target DNA were successfully achieved using the developed DNA strip sensor. The qualitative limit of detection (LOD) of the strip sensor was determined as 4 nM. The LOD for the semi-quantitative detection was calculated to be 0.48 nM in the range of 0-10 nM. The genomic DNA was detected directly using the DNA strip sensor without any further treatment. This DNA strip sensor is a potentially useful tool for rapid on-site DNA screening. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

    Science.gov (United States)

    Hebert, Paul D N; Dewaard, Jeremy R; Zakharov, Evgeny V; Prosser, Sean W J; Sones, Jayme E; McKeown, Jaclyn T A; Mantle, Beth; La Salle, John

    2013-01-01

    DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera) species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp) were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  13. Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

    Science.gov (United States)

    Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  14. Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

    Directory of Open Access Journals (Sweden)

    Lingyang Tian

    2014-01-01

    Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  15. Rapid Detection of Cell-Free Mycobacterium tuberculosis DNA in Tuberculous Pleural Effusion.

    Science.gov (United States)

    Che, Nanying; Yang, Xinting; Liu, Zichen; Li, Kun; Chen, Xiaoyou

    2017-05-01

    Tuberculous pleurisy is one of the most common types of extrapulmonary tuberculosis, but its diagnosis remains difficult. In this study, we report for the first time on the detection of cell-free Mycobacterium tuberculosis DNA in pleural effusion and an evaluation of a newly developed molecular assay for the detection of cell-free Mycobacterium tuberculosis DNA. A total of 78 patients with pleural effusion, 60 patients with tuberculous pleurisy, and 18 patients with alternative diseases were included in this study. Mycobacterial culture, the Xpert MTB/RIF assay, the adenosine deaminase assay, the T-SPOT.TB assay, and the cell-free Mycobacterium tuberculosis DNA assay were performed on all the pleural effusion samples. The cell-free Mycobacterium tuberculosis DNA assay and adenosine deaminase assay showed significantly higher sensitivities of 75.0% and 68.3%, respectively, than mycobacterial culture and the Xpert MTB/RIF assay, which had sensitivities of 26.7% and 20.0%, respectively ( P pleural effusion showed the highest sensitivity of 95.0% but the lowest specificity of 38.9%. The cell-free Mycobacterium tuberculosis DNA assay detected as few as 1.25 copies of IS 6110 per ml of pleural effusion and showed good accordance of the results between repeated tests ( r = 0.978, P = 2.84 × 10 -10 ). These data suggest that the cell-free Mycobacterium tuberculosis DNA assay is a rapid and accurate molecular test which provides direct evidence of Mycobacterium tuberculosis etiology. Copyright © 2017 American Society for Microbiology.

  16. A rapid and economic in-house DNA purification method using glass syringe filters.

    Directory of Open Access Journals (Sweden)

    Yun-Cheol Kim

    Full Text Available BACKGROUND: Purity, yield, speed and cost are important considerations in plasmid purification, but it is difficult to achieve all of these at the same time. Currently, there are many protocols and kits for DNA purification, however none maximize all four considerations. METHODOLOGY/PRINCIPAL FINDINGS: We now describe a fast, efficient and economic in-house protocol for plasmid preparation using glass syringe filters. Plasmid yield and quality as determined by enzyme digestion and transfection efficiency were equivalent to the expensive commercial kits. Importantly, the time required for purification was much less than that required using a commercial kit. CONCLUSIONS/SIGNIFICANCE: This method provides DNA yield and quality similar to that obtained with commercial kits, but is more rapid and less costly.

  17. Rapid DNA vaccination against Burkholderia pseudomallei flagellin by tattoo or intranasal application.

    Science.gov (United States)

    Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D

    2017-11-17

    Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.

  18. Rapid detection of fungal keratitis with DNA-stabilizing FTA filter paper.

    Science.gov (United States)

    Menassa, Nardine; Bosshard, Philipp P; Kaufmann, Claude; Grimm, Christian; Auffarth, Gerd U; Thiel, Michael A

    2010-04-01

    Purpose. Polymerase chain reaction (PCR) is increasingly important for the rapid detection of fungal keratitis. However, techniques of specimen collection and DNA extraction before PCR may interfere with test sensitivity. The purpose of this study was to investigate the use of DNA-stabilizing FTA filter paper (Indicating FTA filter paper; Whatman International, Ltd., Maidstone, UK) for specimen collection without DNA extraction in a single-step, nonnested PCR for fungal keratitis. Methods. Specimens were collected from ocular surfaces with FTA filter discs, which automatically lyse collected cells and stabilize nucleic acids. Filter discs were directly used in single-step PCR reactions to detect fungal DNA. Test sensitivity was evaluated with serial dilutions of Candida albicans, Fusarium oxysporum, and Aspergillus fumigatus cultures. Test specificity was analyzed by comparing 196 and 155 healthy individuals from Switzerland and Egypt, respectively, with 15 patients with a diagnosis of microbial keratitis. Results. PCR with filter discs detected 3 C. albicans, 25 F. oxysporum, and 125 A. fumigatus organisms. In healthy volunteers, fungal PCR was positive in 1.0% and 8.4% of eyes from Switzerland and Egypt, respectively. Fungal PCR remained negative in 10 cases of culture-proven bacterial keratitis, became positive in 4 cases of fungal keratitis, but missed 1 case of culture-proven A. fumigatus keratitis. Conclusions. FTA filter paper for specimen collection together with direct PCR is a promising method of detecting fungal keratitis. The analytical sensitivity is high without the need for a semi-nested or nested second PCR, the clinical specificity is 91.7% to 99.0%, and the method is rapid and inexpensive.

  19. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

  20. Rapid Extraction of Genomic DNA from Medically Important Yeasts and Filamentous Fungi by High-Speed Cell Disruption

    OpenAIRE

    Müller, Frank-Michael C.; Werner, Katherine E.; Kasai, Miki; Francesconi, Andrea; Chanock, Stephen J.; Walsh, Thomas J.

    1998-01-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolatio...

  1. Structure of the Cpf1 endonuclease R-loop complex after target DNA cleavage

    DEFF Research Database (Denmark)

    Stella, Stefano; Alcón, Pablo; Montoya, Guillermo

    2017-01-01

    involved in DNA unwinding to form a CRISPR RNA (crRNA)-DNA hybrid and a displaced DNA strand. The protospacer adjacent motif (PAM) is recognized by the PAM-interacting domain. The loop-lysine helix-loop motif in this domain contains three conserved lysine residues that are inserted in a dentate manner...... and the crRNA-DNA hybrid, avoiding DNA re-annealing. Mutations in key residues reveal a mechanism linking the PAM and DNA nuclease sites. Analysis of the Cpf1 structures proposes a singular working model of RNA-guided DNA cleavage, suggesting new avenues for redesign of Cpf1....

  2. Target-Specific Assay for Rapid and Quantitative Detection of Mycobacterium chimaera DNA.

    Science.gov (United States)

    Zozaya-Valdés, Enrique; Porter, Jessica L; Coventry, John; Fyfe, Janet A M; Carter, Glen P; Gonçalves da Silva, Anders; Schultz, Mark B; Seemann, Torsten; Johnson, Paul D R; Stewardson, Andrew J; Bastian, Ivan; Roberts, Sally A; Howden, Benjamin P; Williamson, Deborah A; Stinear, Timothy P

    2017-06-01

    Mycobacterium chimaera is an opportunistic environmental mycobacterium belonging to the Mycobacterium avium - M. intracellulare complex. Although most commonly associated with pulmonary disease, there has been growing awareness of invasive M. chimaera infections following cardiac surgery. Investigations suggest worldwide spread of a specific M. chimaera clone, associated with contaminated hospital heater-cooler units used during the surgery. Given the global dissemination of this clone, its potential to cause invasive disease, and the laboriousness of current culture-based diagnostic methods, there is a pressing need to develop rapid and accurate diagnostic assays specific for M. chimaera Here, we assessed 354 mycobacterial genome sequences and confirmed that M. chimaera is a phylogenetically coherent group. In silico comparisons indicated six DNA regions present only in M. chimaera We targeted one of these regions and developed a TaqMan quantitative PCR (qPCR) assay for M. chimaera with a detection limit of 100 CFU/ml in whole blood spiked with bacteria. In vitro screening against DNA extracted from 40 other mycobacterial species and 22 bacterial species from 21 diverse genera confirmed the in silico -predicted specificity for M. chimaera Screening 33 water samples from heater-cooler units with this assay highlighted the increased sensitivity of PCR compared to culture, with 15 of 23 culture-negative samples positive by M. chimaera qPCR. We have thus developed a robust molecular assay that can be readily and rapidly deployed to screen clinical and environmental specimens for M. chimaera . Copyright © 2017 American Society for Microbiology.

  3. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    Science.gov (United States)

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  4. DNA comet assay as a rapid detection method of irradiated bovine meat by electron beam

    International Nuclear Information System (INIS)

    Marin-Huachaca, Nelida Simona; Villavicencio, Anna Lucia C.H.

    2001-01-01

    Full text: Introduction: The presence in food of pathogenic microorganisms, such as Salmonella species, Escherichia coli 0157:H7, Listeria Monocytogenes or Yersinia enterolitica, is a problem of growing concern to public health authorities all over the world. Thus, irradiation of certain prepackaged meat products such as ground beef, minced meat, and hamburgers may help in controlling meatborne pathogens and parasites. Pathogenic microorganisms and parasites in meat products, which are commonly consumed raw, are of particular importance, Up to now, only electron-beam accelerators and gamma-ray cells have been used for commercial applications. At the international conference on 'The Acceptance, Control of, and Trade in Irradiated Food', it was recommended that governments should encourage research into detection methods (Anon, 1989), Already five international standards are available to food control agencies. A number of physical, chemical, and biological techniques of detection of irradiated foods have been discussed in the literature. A rapid and inexpensive screening test employing DNA Comet Assay to identify radiation treatment of food has been described by Cerda et al. (1997). This method is restricted to foods that have not been subjected to heat or other treatments, which also induce DNA fragmentation. Advantages are its simplicity, low cost and speed of measurement. This method was proposed to the European Committee for Standardization (CEN) as a screening protocol (presumptive) and not as a proof (definitive). The DNA comet assay have been yielded good results with chicken, pork, fish meat, exotic meat, hamburgers, fruits and cereals. In this work we studied a DNA fragmentation of bovine meat irradiated by electron beam. Experimental: Bovine meat was purchased in local shops in Sao Paulo. Irradiation was performed with electron beam of accelerator facility of Radiation Dynamics Inc., USA (E=1,5 MeV, l=25 mA). The irradiation doses were 3,5; 4,5, 5,5, and 7

  5. A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

    Science.gov (United States)

    Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

    2008-11-01

    A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

  6. DNA immunoprecipitation semiconductor sequencing (DIP-SC-seq) as a rapid method to generate genome wide epigenetic signatures

    OpenAIRE

    Thomson, John P.; Fawkes, Angie; Ottaviano, Raffaele; Hunter, Jennifer M.; Shukla, Ruchi; Mjoseng, Heidi K.; Clark, Richard; Coutts, Audrey; Murphy, Lee; Meehan, Richard R.

    2015-01-01

    Modification of DNA resulting in 5-methylcytosine (5 mC) or 5-hydroxymethylcytosine (5hmC) has been shown to influence the local chromatin environment and affect transcription. Although recent advances in next generation sequencing technology allow researchers to map epigenetic modifications across the genome, such experiments are often time-consuming and cost prohibitive. Here we present a rapid and cost effective method of generating genome wide DNA modification maps utilising commercially ...

  7. Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

    Science.gov (United States)

    Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

    2018-02-01

    The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

  8. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  9. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  10. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  11. Rapid extraction of genomic DNA from medically important yeasts and filamentous fungi by high-speed cell disruption.

    Science.gov (United States)

    Müller, F M; Werner, K E; Kasai, M; Francesconi, A; Chanock, S J; Walsh, T J

    1998-06-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolation of DNA from three medically important yeasts (Candida albicans, Cryptococcus neoformans, and Trichosporon beigelii) and two filamentous fungi (Aspergillus fumigatus and Fusarium solani). Additional extractions by HSCD were performed on Saccharomyces cerevisiae, Pseudallescheria boydii, and Rhizopus arrhizus. Two different inocula (10(8) and 10(7) CFU) were compared for optimization of obtained yields. The entire extraction procedure was performed on as many as 12 samples within 1 h compared to 6 h for PC extraction. In comparison to the PC procedure, HSCD DNA extraction demonstrated significantly greater yields for 10(8) CFU of C. albicans, T. beigelii, A. fumigatus, and F. solani (P extraction and PC extraction. For 10(7) CFU of T. beigelii, PC extraction resulted in a greater yield than did HSCD (P fungi than for yeasts by the HSCD extraction procedure (P extraction procedure, differences were not significant. For all eight organisms, the rapid extraction procedure resulted in good yield, integrity, and quality of DNA as demonstrated by restriction fragment length polymorphism, PCR, and random amplified polymorphic DNA. We conclude that mechanical disruption of fungal cells by HSCD is a safe, rapid, and efficient procedure for extracting genomic DNA from medically important yeasts and especially from filamentous fungi.

  12. DNA microarray unravels rapid changes in transcriptome of MK-801 treated rat brain

    Science.gov (United States)

    Kobayashi, Yuka; Kulikova, Sofya P; Shibato, Junko; Rakwal, Randeep; Satoh, Hiroyuki; Pinault, Didier; Masuo, Yoshinori

    2015-01-01

    AIM: To investigate the impact of MK-801 on gene expression patterns genome wide in rat brain regions. METHODS: Rats were treated with an intraperitoneal injection of MK-801 [0.08 (low-dose) and 0.16 (high-dose) mg/kg] or NaCl (vehicle control). In a first series of experiment, the frontoparietal electrocorticogram was recorded 15 min before and 60 min after injection. In a second series of experiments, the whole brain of each animal was rapidly removed at 40 min post-injection, and different regions were separated: amygdala, cerebral cortex, hippocampus, hypothalamus, midbrain and ventral striatum on ice followed by DNA microarray (4 × 44 K whole rat genome chip) analysis. RESULTS: Spectral analysis revealed that a single systemic injection of MK-801 significantly and selectively augmented the power of baseline gamma frequency (30-80 Hz) oscillations in the frontoparietal electroencephalogram. DNA microarray analysis showed the largest number (up- and down- regulations) of gene expressions in the cerebral cortex (378), midbrain (376), hippocampus (375), ventral striatum (353), amygdala (301), and hypothalamus (201) under low-dose (0.08 mg/kg) of MK-801. Under high-dose (0.16 mg/kg), ventral striatum (811) showed the largest number of gene expression changes. Gene expression changes were functionally categorized to reveal expression of genes and function varies with each brain region. CONCLUSION: Acute MK-801 treatment increases synchrony of baseline gamma oscillations, and causes very early changes in gene expressions in six individual rat brain regions, a first report. PMID:26629322

  13. Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

    Science.gov (United States)

    Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

    2018-04-01

    ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

  14. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  15. Facile and rapid DNA extraction and purification from food matrices using IFAST (immiscible filtration assisted by surface tension).

    Science.gov (United States)

    Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J

    2012-09-07

    Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.

  16. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun

    2014-11-24

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  17. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun; Lee, Kunwoo; Murthy, Niren; Pisano, Albert P

    2014-01-01

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  18. Minimal methylation classifier (MIMIC): A novel method for derivation and rapid diagnostic detection of disease-associated DNA methylation signatures.

    Science.gov (United States)

    Schwalbe, E C; Hicks, D; Rafiee, G; Bashton, M; Gohlke, H; Enshaei, A; Potluri, S; Matthiesen, J; Mather, M; Taleongpong, P; Chaston, R; Silmon, A; Curtis, A; Lindsey, J C; Crosier, S; Smith, A J; Goschzik, T; Doz, F; Rutkowski, S; Lannering, B; Pietsch, T; Bailey, S; Williamson, D; Clifford, S C

    2017-10-18

    Rapid and reliable detection of disease-associated DNA methylation patterns has major potential to advance molecular diagnostics and underpin research investigations. We describe the development and validation of minimal methylation classifier (MIMIC), combining CpG signature design from genome-wide datasets, multiplex-PCR and detection by single-base extension and MALDI-TOF mass spectrometry, in a novel method to assess multi-locus DNA methylation profiles within routine clinically-applicable assays. We illustrate the application of MIMIC to successfully identify the methylation-dependent diagnostic molecular subgroups of medulloblastoma (the most common malignant childhood brain tumour), using scant/low-quality samples remaining from the most recently completed pan-European medulloblastoma clinical trial, refractory to analysis by conventional genome-wide DNA methylation analysis. Using this approach, we identify critical DNA methylation patterns from previously inaccessible cohorts, and reveal novel survival differences between the medulloblastoma disease subgroups with significant potential for clinical exploitation.

  19. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... Available online at http://www.academicjournals.org/AJB ... α-casein, produces PCR ready DNA at a fraction of the cost of commercial DNA extraction kits. Key words: DNA .... This experiment was performed to evaluate the efficiency of the ..... Zoetendal EG, Ben-Amor K, Akkermans AD, Abee T, De Vos WM.

  20. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Science.gov (United States)

    Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

  1. Rectangular coordination polymer nanoplates: large-scale, rapid synthesis and their application as a fluorescent sensing platform for DNA detection.

    Directory of Open Access Journals (Sweden)

    Yingwei Zhang

    Full Text Available In this paper, we report on the large-scale, rapid synthesis of uniform rectangular coordination polymer nanoplates (RCPNs assembled from Cu(II and 4,4'-bipyridine for the first time. We further demonstrate that such RCPNs can be used as a very effective fluorescent sensing platform for multiple DNA detection with a detection limit as low as 30 pM and a high selectivity down to single-base mismatch. The DNA detection is accomplished by the following two steps: (1 RCPN binds dye-labeled single-stranded DNA (ssDNA probe, which brings dye and RCPN into close proximity, leading to fluorescence quenching; (2 Specific hybridization of the probe with its target generates a double-stranded DNA (dsDNA which detaches from RCPN, leading to fluorescence recovery. It suggests that this sensing system can well discriminate complementary and mismatched DNA sequences. The exact mechanism of fluorescence quenching involved is elucidated experimentally and its use in a human blood serum system is also demonstrated successfully.

  2. Rapid purification of circular DNA by triplex-mediated affinity capture

    Science.gov (United States)

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  3. Combination of methylated-DNA precipitation and methylation-sensitive restriction enzymes (COMPARE-MS) for the rapid, sensitive and quantitative detection of DNA methylation.

    Science.gov (United States)

    Yegnasubramanian, Srinivasan; Lin, Xiaohui; Haffner, Michael C; DeMarzo, Angelo M; Nelson, William G

    2006-02-09

    Hypermethylation of CpG island (CGI) sequences is a nearly universal somatic genome alteration in cancer. Rapid and sensitive detection of DNA hypermethylation would aid in cancer diagnosis and risk stratification. We present a novel technique, called COMPARE-MS, that can rapidly and quantitatively detect CGI hypermethylation with high sensitivity and specificity in hundreds of samples simultaneously. To quantitate CGI hypermethylation, COMPARE-MS uses real-time PCR of DNA that was first digested by methylation-sensitive restriction enzymes and then precipitated by methyl-binding domain polypeptides immobilized on a magnetic solid matrix. We show that COMPARE-MS could detect five genome equivalents of methylated CGIs in a 1000- to 10,000-fold excess of unmethylated DNA. COMPARE-MS was used to rapidly quantitate hypermethylation at multiple CGIs in >155 prostate tissues, including benign and malignant prostate specimens, and prostate cell lines. This analysis showed that GSTP1, MDR1 and PTGS2 CGI hypermethylation as determined by COMPARE-MS could differentiate between malignant and benign prostate with sensitivities >95% and specificities approaching 100%. This novel technology could significantly improve our ability to detect CGI hypermethylation.

  4. Using rapid diagnostic tests as source of malaria parasite DNA for molecular analyses in the era of declining malaria prevalence

    DEFF Research Database (Denmark)

    Ishengoma, Deus S; Lwitiho, Sudi; Madebe, Rashid A

    2011-01-01

    was conducted to examine if sufficient DNA could be successfully extracted from malaria rapid diagnostic tests (RDTs), used and collected as part of routine case management services in health facilities, and thus forming the basis for molecular analyses, surveillance and quality control (QC) testing of RDTs....... continued molecular surveillance of malaria parasites is important to early identify emerging anti-malarial drug resistance, it is becoming increasingly difficult to obtain parasite samples from ongoing studies, such as routine drug efficacy trials. To explore other sources of parasite DNA, this study...

  5. SeqAnt: A web service to rapidly identify and annotate DNA sequence variations

    Directory of Open Access Journals (Sweden)

    Patel Viren

    2010-09-01

    Full Text Available Abstract Background The enormous throughput and low cost of second-generation sequencing platforms now allow research and clinical geneticists to routinely perform single experiments that identify tens of thousands to millions of variant sites. Existing methods to annotate variant sites using information from publicly available databases via web browsers are too slow to be useful for the large sequencing datasets being routinely generated by geneticists. Because sequence annotation of variant sites is required before functional characterization can proceed, the lack of a high-throughput pipeline to efficiently annotate variant sites can act as a significant bottleneck in genetics research. Results SeqAnt (Sequence Annotator is an open source web service and software package that rapidly annotates DNA sequence variants and identifies recessive or compound heterozygous loci in human, mouse, fly, and worm genome sequencing experiments. Variants are characterized with respect to their functional type, frequency, and evolutionary conservation. Annotated variants can be viewed on a web browser, downloaded in a tab-delimited text file, or directly uploaded in a BED format to the UCSC genome browser. To demonstrate the speed of SeqAnt, we annotated a series of publicly available datasets that ranged in size from 37 to 3,439,107 variant sites. The total time to completely annotate these data completely ranged from 0.17 seconds to 28 minutes 49.8 seconds. Conclusion SeqAnt is an open source web service and software package that overcomes a critical bottleneck facing research and clinical geneticists using second-generation sequencing platforms. SeqAnt will prove especially useful for those investigators who lack dedicated bioinformatics personnel or infrastructure in their laboratories.

  6. Spatiotemporal reconstruction of the Aquilegia rapid radiation through next-generation sequencing of rapidly evolving cpDNA regions.

    Science.gov (United States)

    Fior, Simone; Li, Mingai; Oxelman, Bengt; Viola, Roberto; Hodges, Scott A; Ometto, Lino; Varotto, Claudio

    2013-04-01

    Aquilegia is a well-known model system in the field of evolutionary biology, but obtaining a resolved and well-supported phylogenetic reconstruction for the genus has been hindered by its recent and rapid diversification. Here, we applied 454 next-generation sequencing to PCR amplicons of 21 of the most rapidly evolving regions of the plastome to generate c. 24 kb of sequences from each of 84 individuals from throughout the genus. The resulting phylogeny has well-supported resolution of the main lineages of the genus, although recent diversification such as in the European taxa remains unresolved. By producing a chronogram of the whole Ranunculaceae family based on published data, we inferred calibration points for dating the Aquilegia radiation. The genus originated in the upper Miocene c. 6.9 million yr ago (Ma) in Eastern Asia, and diversification occurred c. 4.8 Ma with the split of two main clades, one colonizing North America, and the other Western Eurasia through the mountains of Central Asia. This was followed by a back-to-Asia migration, originating from the European stock using a North Asian route. These results provide the first backbone phylogeny and spatiotemporal reconstruction of the Aquilegia radiation, and constitute a robust framework to address the adaptative nature of speciation within the group. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  7. Oxidants and not alkylating agents induce rapid mtDNA loss and mitochondrial dysfunction

    Science.gov (United States)

    Furda, Amy M.; Marrangoni, Adele M.; Lokshin, Anna; Van Houten, Bennett

    2013-01-01

    Mitochondrial DNA (mtDNA) is essential for proper mitochondrial function and encodes 22 tRNAs, 2 rRNAs and 13 polypeptides that make up subunits of complex I, III, IV, in the electron transport chain and complex V, the ATP synthase. Although mitochondrial dysfunction has been implicated in processes such as premature aging, neurodegeneration, and cancer, it has not been shown whether persistent mtDNA damage causes a loss of oxidative phosphorylation. We addressed this question by treating mouse embryonic fibroblasts with either hydrogen peroxide (H2O2) or the alkylating agent methyl methanesulfonate (MMS) and measuring several endpoints, including mtDNA damage and repair rates using QPCR, levels of mitochondrial- and nuclear-encoded proteins using antibody analysis, and a pharmacologic profile of mitochondria using the Seahorse Extracellular Flux Analyzer. We show that a 60 min treatment with H2O2 causes persistent mtDNA lesions, mtDNA loss, decreased levels of a nuclear-encoded mitochondrial subunit, a loss of ATP-linked oxidative phosphorylation and a loss of total reserve capacity. Conversely, a 60 min treatment with 2 mM MMS causes persistent mtDNA lesions but no mtDNA loss, no decrease in levels of a nuclear-encoded mitochondrial subunit, and no mitochondrial dysfunction. These results suggest that persistent mtDNA damage is not sufficient to cause mitochondrial dysfunction. PMID:22766155

  8. A Fluorescent Tile DNA Diagnocode System for In Situ Rapid and Selective Diagnosis of Cytosolic RNA Cancer Markers

    Science.gov (United States)

    Park, Kyung Soo; Shin, Seung Won; Jang, Min Su; Shin, Woojung; Yang, Kisuk; Min, Junhong; Cho, Seung-Woo; Oh, Byung-Keun; Bae, Jong Wook; Jung, Sunghwan; Choi, Jeong-Woo; Um, Soong Ho

    2015-01-01

    Accurate cancer diagnosis often requires extraction and purification of genetic materials from cells, and sophisticated instrumentations that follow. Otherwise in order to directly treat the diagnostic materials to cells, multiple steps to optimize dose concentration and treatment time are necessary due to diversity in cellular behaviors. These processes may offer high precision but hinder fast analysis of cancer, especially in clinical situations that need rapid detection and characterization of cancer. Here we present a novel fluorescent tile DNA nanostructure delivered to cancer cytosol by employing nanoparticle technology. Its structural anisotropicity offers easy manipulation for multifunctionalities, enabling the novel DNA nanostructure to detect intracellular cancer RNA markers with high specificity within 30 minutes post treatment, while the nanoparticle property bypasses the requirement of treatment optimization, effectively reducing the complexity of applying the system for cancer diagnosis. Altogether, the system offers a precise and rapid detection of cancer, suggesting the future use in the clinical fields. PMID:26678430

  9. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

    1989-01-01

    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  10. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  11. Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors

    DEFF Research Database (Denmark)

    Fu, Yanming; Zeng, Dongdong; Chao, Jie

    2013-01-01

    nm resolution and at the single-molecule level. We attach a pair of enzymes (horseradish peroxidase and glucose oxidase) at the inner side of DNA nanotubes and observe high coupling efficiency of enzyme cascade within this confined nanospace. Hence, DNA nanostructures with such unprecedented...

  12. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  13. Preservation and rapid purification of DNA from decomposing human tissue samples.

    Science.gov (United States)

    Sorensen, Amy; Rahman, Elizabeth; Canela, Cassandra; Gangitano, David; Hughes-Stamm, Sheree

    2016-11-01

    One of the key features to be considered in a mass disaster is victim identification. However, the recovery and identification of human remains are sometimes complicated by harsh environmental conditions, limited facilities, loss of electricity and lack of refrigeration. If human remains cannot be collected, stored, or identified immediately, bodies decompose and DNA degrades making genotyping more difficult and ultimately decreasing DNA profiling success. In order to prevent further DNA damage and degradation after collection, tissue preservatives may be used. The goal of this study was to evaluate three customized (modified TENT, DESS, LST) and two commercial DNA preservatives (RNAlater and DNAgard ® ) on fresh and decomposed human skin and muscle samples stored in hot (35°C) and humid (60-70% relative humidity) conditions for up to three months. Skin and muscle samples were harvested from the thigh of three human cadavers placed outdoors for up to two weeks. In addition, the possibility of purifying DNA directly from the preservative solutions ("free DNA") was investigated in order to eliminate lengthy tissue digestion processes and increase throughput. The efficiency of each preservative was evaluated based on the quantity of DNA recovered from both the "free DNA" in solution and the tissue sample itself in conjunction with the quality and completeness of downstream STR profiles. As expected, DNA quantity and STR success decreased with time of decomposition. However, a marked decrease in DNA quantity and STR quality was observed in all samples after the bodies entered the bloat stage (approximately six days of decomposition in this study). Similar amounts of DNA were retrieved from skin and muscle samples over time, but slightly more complete STR profiles were obtained from muscle tissue. Although higher amounts of DNA were recovered from tissue samples than from the surrounding preservative, the average number of reportable alleles from the "free DNA" was

  14. Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

    Science.gov (United States)

    Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

    2005-01-01

    A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

  15. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  16. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  17. An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens.

    Science.gov (United States)

    Riahi, M; Zarre, S; Maassoumi, A A; Attar, F; Kazempour Osaloo, S

    2010-07-13

    Three DNA extraction protocols were compared for their ability to yield DNA from the leaves of herbarium specimens of nine species from nine genera of the Papilionoideae. We tested two protocols that use classic procedures for lysis and purification with cetyl trimethylammonium bromide (CTAB); a third protocol used a Nucleospin Plant kit. DNA obtained from all three procedures was quantified and tested by PCR. Test results indicated the superiority of one of the CTAB protocols. We made some modifications, developing a protocol that produced high-quality DNA from all nine species. The modification involved the use of a lower EDTA concentration (20 mM instead of 50 mM) and a higher beta-mercaptoethanol concentration (1% instead of 0.4%) in the extraction buffer. The modified protocol avoids the necessity for a second DNA precipitation step. This new CTAB protocol includes the use of 1.4 M NaCl, 20 mM EDTA and 1% beta-mercaptoethanol in the extraction; DNA precipitation time is reduced. A reduction in contaminating metabolites (such as PCR inhibitors) in the sample mixtures and lower costs for reagents are characteristics of this modified protocol; the cost of analysis per sample was lowered, compared to previous options. The quality of DNA was suitable for PCR amplification. This is a practical alternative to more difficult, time-consuming and expensive protocols.

  18. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  19. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

    Science.gov (United States)

    Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

    2006-05-01

    A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

  20. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  1. Rapid molecular detection of invasive species in ballast and harbor water by integrating environmental DNA and light transmission spectroscopy.

    Science.gov (United States)

    Egan, Scott P; Grey, Erin; Olds, Brett; Feder, Jeffery L; Ruggiero, Steven T; Tanner, Carol E; Lodge, David M

    2015-04-07

    Invasive species introduced via the ballast water of commercial ships cause enormous environmental and economic damage worldwide. Accurate monitoring for these often microscopic and morphologically indistinguishable species is challenging but critical for mitigating damages. We apply eDNA sampling, which involves the filtering and subsequent DNA extraction of microscopic bits of tissue suspended in water, to ballast and harbor water sampled during a commercial ship's 1400 km voyage through the North American Great Lakes. Using a lab-based gel electrophoresis assay and a rapid, field-ready light transmission spectroscopy (LTS) assay, we test for the presence of two invasive species: quagga (Dreissena bugensis) and zebra (D. polymorpha) mussels. Furthermore, we spiked a set of uninfested ballast and harbor samples with zebra mussel tissue to further test each assay's detection capabilities. In unmanipulated samples, zebra mussel was not detected, while quagga mussel was detected in all samples at a rate of 85% for the gel assay and 100% for the LTS assay. In the spiked experimental samples, both assays detected zebra mussel in 94% of spiked samples and 0% of negative controls. Overall, these results demonstrate that eDNA sampling is effective for monitoring ballast-mediated invasions and that LTS has the potential for rapid, field-based detection.

  2. Rapid Diminution in the Level and Activity of DNA-Dependent Protein Kinase in Cancer Cells by a Reactive Nitro-Benzoxadiazole Compound

    Directory of Open Access Journals (Sweden)

    Viviane A. O. Silva

    2016-05-01

    Full Text Available The expression and activity of DNA-dependent protein kinase (DNA-PK is related to DNA repair status in the response of cells to exogenous and endogenous factors. Recent studies indicate that Epidermal Growth Factor Receptor (EGFR is involved in modulating DNA-PK. It has been shown that a compound 4-nitro-7-[(1-oxidopyridin-2-ylsulfanyl]-2,1,3-benzoxadiazole (NSC, bearing a nitro-benzoxadiazole (NBD scaffold, enhances tyrosine phosphorylation of EGFR and triggers downstream signaling pathways. Here, we studied the behavior of DNA-PK and other DNA repair proteins in prostate cancer cells exposed to compound NSC. We showed that both the expression and activity of DNA-PKcs (catalytic subunit of DNA-PK rapidly decreased upon exposure of cells to the compound. The decline in DNA-PKcs was associated with enhanced protein ubiquitination, indicating the activation of cellular proteasome. However, pretreatment of cells with thioglycerol abolished the action of compound NSC and restored the level of DNA-PKcs. Moreover, the decreased level of DNA-PKcs was associated with the production of intracellular hydrogen peroxide by stable dimeric forms of Cu/Zn SOD1 induced by NSC. Our findings indicate that reactive oxygen species and electrophilic intermediates, generated and accumulated during the redox transformation of NBD compounds, are primarily responsible for the rapid modulation of DNA-PKcs functions in cancer cells.

  3. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    Science.gov (United States)

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-08-06

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

  4. A rapid and inexpensive method for isolation of total DNA from Trichoderma spp (Hypocreaceae).

    Science.gov (United States)

    Vazquez-Angulo, J C; Mendez-Trujillo, V; González-Mendoza, D; Morales-Trejo, A; Grimaldo-Juarez, O; Cervantes-Díaz, L

    2012-05-15

    Extraction of high-quality genomic DNA for PCR amplification from filamentous fungi is difficult because of the complex cell wall and the high concentrations of polysaccharides and other secondary metabolites that bind to or co-precipitate with nucleic acids. We developed a modified sodium dodecyl sulfate/phenol protocol, without maceration in liquid nitrogen and without a final ethanol precipitation step. The A(260/280) absorbance ratios of isolated DNA were approximately 1.7-1.9, demonstrating that the DNA fraction is pure and can be used for analysis. Additionally, the A(260/230) values were higher than 1.6, demonstrating negligible contamination by polysaccharides. The DNA isolated by this protocol is of sufficient quality for molecular applications; this technique could be applied to other organisms that have similar substances that hinder DNA extraction. The main advantages of the method are that the mycelium is directly recovered from culture medium and it does not require the use of expensive and specialized equipment.

  5. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  6. Measurement of cell proliferation in microculture using Hoechst 33342 for the rapid semiautomated microfluorimetric determination of chromatin DNA.

    Science.gov (United States)

    Richards, W L; Song, M K; Krutzsch, H; Evarts, R P; Marsden, E; Thorgeirsson, S S

    1985-07-01

    We report the development and characterization of a semiautomated method for measurement of cell proliferation in microculture using Hoechst 33342, a non-toxic specific vital stain for DNA. In this assay, fluorescence resulting from interaction of cell chromatin DNA with Hoechst 33342 dye was measured by an instrument that automatically reads the fluorescence of each well of a 96-well microtiter plate within 1 min. Each cell line examined was shown to require different Hoechst 33342 concentrations and time of incubation with the dye to attain optimum fluorescence in the assay. In all cell lines, cell chromatin-enhanced Hoechst 33342 fluorescence was shown to be a linear function of the number of cells or cell nuclei per well when optimum assay conditions were employed. Because of this linear relation, equivalent cell doubling times were calculated from growth curves based on changes in cell counts or changes in Hoechst/DNA fluorescence and the fluorimetric assay was shown to be useful for the direct assay of the influence of growth factors on cell proliferation. The fluorimetric assay also provided a means for normalizing the incorporation of tritiated thymidine ( [3H] TdR) into DNA; normalized values of DPM per fluorescence unit closely paralleled values of percent 3H-labelled nuclei when DNA synthesis was studied as a function of the concentration of rat serum in the medium. In summary, the chromatin-enhanced Hoechst 33342 fluorimetric assay provides a rapid, simple, and reproducible means for estimating cell proliferation by direct measurement of changes in cell fluorescence or by measurement of changes in the normalized incorporation of thymidine into DNA.

  7. Rapid DNA Synthesis During Early Drosophila Embryogenesis Is Sensitive to Maternal Humpty Dumpty Protein Function.

    Science.gov (United States)

    Lesly, Shera; Bandura, Jennifer L; Calvi, Brian R

    2017-11-01

    Problems with DNA replication cause cancer and developmental malformations. It is not fully understood how DNA replication is coordinated with development and perturbed in disease. We had previously identified the Drosophila gene humpty dumpty ( hd ), and showed that null alleles cause incomplete DNA replication, tissue undergrowth, and lethality. Animals homozygous for the missense allele, hd 272-9 , were viable, but adult females had impaired amplification of eggshell protein genes in the ovary, resulting in the maternal effects of thin eggshells and embryonic lethality. Here, we show that expression of an hd transgene in somatic cells of the ovary rescues amplification and eggshell synthesis but not embryo viability. The germline of these mothers remain mutant for the hd 272-9 allele, resulting in reduced maternal Hd protein and embryonic arrest during mitosis of the first few S/M nuclear cleavage cycles with chromosome instability and chromosome bridges. Epistasis analysis of hd with the rereplication mutation plutonium indicates that the chromosome bridges of hd embryos are the result of a failed attempt to segregate incompletely replicated sister chromatids. This study reveals that maternally encoded Humpty dumpty protein is essential for DNA replication and genome integrity during the little-understood embryonic S/M cycles. Moreover, the two hd 272-9 maternal-effect phenotypes suggest that ovarian gene amplification and embryonic cleavage are two time periods in development that are particularly sensitive to mild deficits in DNA replication function. This last observation has broader relevance for interpreting why mild mutations in the human ortholog of humpty dumpty and other DNA replication genes cause tissue-specific malformations of microcephalic dwarfisms. Copyright © 2017 by the Genetics Society of America.

  8. Rapid assessment of non-indigenous species in the era of the eDNA barcoding: A Mediterranean case study

    Science.gov (United States)

    Ardura, Alba; Planes, Serge

    2017-03-01

    With only a narrow opening through the Gibraltar and Suez Canals, the Mediterranean Sea is one of the largest semi-enclosed seas. The marine flora and fauna are some of the richest in the world, relative to its size, particularly in the coastal habitats, which are also characterized by numerous endemic species although the introduction of non-indigenous species threatens its rich and unique biodiversity. Following the opening of the Suez Canal, and in combination with shipping and aquaculture activities, non-indigenous species (NIS) introduction has had measurable impacts on the Mediterranean. Lagoon ecosystems along the French coastline, with approx. 100 NIS identified, are considered hot-spot areas for these species. Rapid assessment sampling for sessile benthic species together with DNA barcoding is a rapid, easy and cheap method to detect non-indigenous species. Two nearby and different ecosystems were sampled for invertebrate species: Saint-Nazaire lagoon, a Special Protection Area within the Natura 2000 Network and Canet port, a marina in a small village. The DNA barcoding tool for species identification was used for confirming the taxonomy. This showed that, despite the Saint-Nazaire Lagoon classification within the Natura 2000 network, it is already contaminated with a single NIS that was found in high densities and is clearly beginning to dominate the system. It is proposed that a rapid assessment of the sampled environment and the DNA barcode approach are efficient and can provide sufficient information on the new target species to be used in conservation planning and ongoing management efforts.

  9. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection

    NARCIS (Netherlands)

    Wagemakers, A.; Mason, L. M. K.; Oei, A.; de Wever, B.; van der Poll, T.; Bins, A. D.; Hovius, J. W. R.

    2014-01-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method

  10. Rapid DNA extraction from dried blood spots on filter paper: potential applications in biobanking.

    Science.gov (United States)

    Choi, Eun-Hye; Lee, Sang Kwang; Ihm, Chunhwa; Sohn, Young-Hak

    2014-12-01

    Dried blood spot (DBS) technology is a microsampling alternative to traditional plasma or serum sampling for pharmaco- or toxicokinetic evaluation. DBS technology has been applied to diagnostic screening in drug discovery, nonclinical, and clinical settings. We have developed an improved elution protocol involving boiling of blood spots dried on Whatman filter paper. The purpose of this study was to compare the quality, purity, and quantity of DNA isolated from frozen blood samples and DBSs. We optimized a method for extraction and estimation of DNA from blood spots dried on filter paper (3-mm FTA card). A single DBS containing 40 μL blood was used. DNA was efficiently extracted in phosphate-buffered saline (PBS) or Tris-EDTA (TE) buffer by incubation at 37°C overnight. DNA was stable in DBSs that were stored at room temperature or frozen. The housekeeping genes GAPDH and beta-actin were used as positive standards for polymerase chain reaction (PCR) validation of general diagnostic screening. Our simple and convenient DBS storage and extraction methods are suitable for diagnostic screening by using very small volumes of blood collected on filter paper, and can be used in biobanks for blood sample storage.

  11. The use of DNA markers for rapid improvement of crops in Africa ...

    African Journals Online (AJOL)

    Genetic engineering and biotechnology are providing new tools for genetic improvement of food crops. Molecular DNA markers are some of these tools which can be used in various fields of plant breeding and germplasm management. For example, molecular markers have been used to confirm the identity of hybrids in ...

  12. A Novel Method for Rapid Hybridization of DNA to a Solid Support

    Science.gov (United States)

    Pettersson, Erik; Ahmadian, Afshin; Ståhl, Patrik L.

    2013-01-01

    Here we present a novel approach entitled Magnetic Forced Hybridization (MFH) that provides the means for efficient and direct hybridization of target nucleic acids to complementary probes immobilized on a glass surface in less than 15 seconds at ambient temperature. In addition, detection is carried out instantly since the beads become visible on the surface. The concept of MFH was tested for quality control of array manufacturing, and was combined with a multiplex competitive hybridization (MUCH) approach for typing of Human Papilloma Virus (HPV). Magnetic Forced Hybridization of bead-DNA constructs to a surface achieves a significant reduction in diagnostic testing time. In addition, readout of results by visual inspection of the unassisted eye eliminates the need for additional expensive instrumentation. The method uses the same set of beads throughout the whole process of manipulating and washing DNA constructs prior to detection, as in the actual detection step itself. PMID:23950946

  13. Rapid Identification of Seven Waterborne Exophiala Species by RCA DNA Padlock Probes.

    Science.gov (United States)

    Najafzadeh, M J; Vicente, V A; Feng, Peiying; Naseri, A; Sun, Jiufeng; Rezaei-Matehkolaei, A; de Hoog, G S

    2018-03-05

    The black yeast genus Exophiala includes numerous potential opportunistic species that potentially cause systematic and disseminated infections in immunocompetent individuals. Species causing systemic disease have ability to grow at 37-40 °C, while others consistently lack thermotolerance and are involved in diseases of cold-blooded, waterborne vertebrates and occasionally invertebrates. We explain a fast and sensitive assay for recognition and identification of waterborne Exophiala species without sequencing. The ITS rDNA region of seven Exophiala species (E. equina, E. salmonis, E. opportunistica, E. pisciphila, E. aquamarina, E. angulospora and E. castellanii) along with the close relative Veronaea botryosa was sequenced and aligned for the design of specific padlock probes for the detection of characteristic single-nucleotide polymorphisms. The assay demonstrated to successfully amplify DNA of target fungi, allowing detection at the species level. Amplification products were visualized on 1% agarose gels to confirm specificity of probe-template binding. Amounts of reagents were reduced to prevent the generation of false positive results. The simplicity, tenderness, robustness and low expenses provide padlock probe assay (RCA) a definite place as a very practical method among isothermal approaches for DNA diagnostics.

  14. DNA Sequence-Mediated, Evolutionarily Rapid Redistribution of Meiotic Recombination Hotspots

    Science.gov (United States)

    Wahls, Wayne P.; Davidson, Mari K.

    2011-01-01

    Hotspots regulate the position and frequency of Spo11 (Rec12)-initiated meiotic recombination, but paradoxically they are suicidal and are somehow resurrected elsewhere in the genome. After the DNA sequence-dependent activation of hotspots was discovered in fission yeast, nearly two decades elapsed before the key realizations that (A) DNA site-dependent regulation is broadly conserved and (B) individual eukaryotes have multiple different DNA sequence motifs that activate hotspots. From our perspective, such findings provide a conceptually straightforward solution to the hotspot paradox and can explain other, seemingly complex features of meiotic recombination. We describe how a small number of single-base-pair substitutions can generate hotspots de novo and dramatically alter their distribution in the genome. This model also shows how equilibrium rate kinetics could maintain the presence of hotspots over evolutionary timescales, without strong selective pressures invoked previously, and explains why hotspots localize preferentially to intergenic regions and introns. The model is robust enough to account for all hotspots of humans and chimpanzees repositioned since their divergence from the latest common ancestor. PMID:22084420

  15. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  16. A novel GMO biosensor for rapid ultrasensitive and simultaneous detection of multiple DNA components in GMO products.

    Science.gov (United States)

    Huang, Lin; Zheng, Lei; Chen, Yinji; Xue, Feng; Cheng, Lin; Adeloju, Samuel B; Chen, Wei

    2015-04-15

    Since the introduction of genetically modified organisms (GMOs), there has been on-going and continuous concern and debates on the commercialization of products derived from GMOs. There is an urgent need for development of highly efficient analytical methods for rapid and high throughput screening of GMOs components, as required for appropriate labeling of GMO-derived foods, as well as for on-site inspection and import/export quarantine. In this study, we describe, for the first time, a multi-labeling based electrochemical biosensor for simultaneous detection of multiple DNA components of GMO products on the same sensing interface. Two-round signal amplification was applied by using both an exonuclease enzyme catalytic reaction and gold nanoparticle-based bio-barcode related strategies, respectively. Simultaneous multiple detections of different DNA components of GMOs were successfully achieved with satisfied sensitivity using this electrochemical biosensor. Furthermore, the robustness and effectiveness of the proposed approach was successfully demonstrated by application to various GMO products, including locally obtained and confirmed commercial GMO seeds and transgenetic plants. The proposed electrochemical biosensor demonstrated unique merits that promise to gain more interest in its use for rapid and on-site simultaneous multiple screening of different components of GMO products. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Rapid and sensitive method to identify Mycobacterium avium subsp. paratuberculosis in cow's milk by DNA methylase genotyping.

    Science.gov (United States)

    Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José; Lopez, Osvaldo Jorge

    2013-03-01

    Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time.

  18. Rapid and annealing-free self-assembly of DNA building blocks for 3D hydrogel chaperoned by cationic comb-type copolymers.

    Science.gov (United States)

    Zhang, Zheng; Wu, Yuyang; Yu, Feng; Niu, Chaoqun; Du, Zhi; Chen, Yong; Du, Jie

    2017-10-01

    The construction and self-assembly of DNA building blocks are the foundation of bottom-up development of three-dimensional DNA nanostructures or hydrogels. However, most self-assembly from DNA components is impeded by the mishybridized intermediates or the thermodynamic instability. To enable rapid production of complicated DNA objects with high yields no need for annealing process, herein different DNA building blocks (Y-shaped, L- and L'-shaped units) were assembled in presence of a cationic comb-type copolymer, poly (L-lysine)-graft-dextran (PLL-g-Dex), under physiological conditions. The results demonstrated that PLL-g-Dex not only significantly promoted the self-assembly of DNA blocks with high efficiency, but also stabilized the assembled multi-level structures especially for promoting the complicated 3D DNA hydrogel formation. This study develops a novel strategy for rapid and high-yield production of DNA hydrogel even derived from instable building blocks at relatively low DNA concentrations, which would endow DNA nanotechnology for more practical applications.

  19. DNA-based genetic markers for Rapid Cycling Brassica rapa (Fast Plants type designed for the teaching laboratory.

    Directory of Open Access Journals (Sweden)

    Eryn E. Slankster

    2012-06-01

    Full Text Available We have developed DNA-based genetic markers for rapid-cycling Brassica rapa (RCBr, also known as Fast Plants. Although markers for Brassica rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP based markers and 14 variable number tandem repeat (VNTR-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a nongenic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology.

  20. Real-time DNA barcoding in a rainforest using nanopore sequencing: opportunities for rapid biodiversity assessments and local capacity building.

    Science.gov (United States)

    Pomerantz, Aaron; Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan

    2018-04-01

    Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism.

  1. Rapid, sensitive and cost effective method for isolation of viral DNA from feacal samples of dogs

    Directory of Open Access Journals (Sweden)

    Savi.

    2010-06-01

    Full Text Available A simple method for viral DNA extraction using chelex resin was developed. The method used was eco-friendly and cost effective compared to other methods such as phenol chloroform method which use health hazardous organic reagents. Further, a polymerase chain reaction (PCR based detection of canine parvovirus (CPV using primers from conserved region of VP2 gene was developed. To increase the sensitivity and specificity of reaction, nested PCR was designed. PCR reaction was optimized to amplify 747bp product of VP2 gene. The assay can be completed in few hours and doesn’t need hazardous chemicals. Thus, the sample preparation using chelating resin along with nested PCR seems to be a sensitive, specific and practical method for the detection of CPV in diarrhoeal feacal samples. [Vet. World 2010; 3(3.000: 105-106

  2. Development of bufferless gel electrophoresis chip for easy preparation and rapid DNA separation.

    Science.gov (United States)

    Oleksandrov, Sergiy; Aman, Abdurazak; Lim, Wanyoung; Kim, Younghee; Bae, Nam Ho; Lee, Kyoung G; Lee, Seok Jae; Park, Sungsu

    2018-02-01

    This work presents a handy, fast, and compact bufferless gel electrophoresis chip (BGEC), which consists of precast agarose gel confined in a disposable plastic body with electrodes. It does not require large volumes of buffer to fill reservoirs, or the process of immersing the gel in the buffer. It withstands voltages up to 28.4 V/cm, thereby allowing DNA separation within 10 min with a similar separation capability to the standard gel electrophoresis. The results suggest that our BGEC is highly suitable for in situ gel electrophoresis in forensic, epidemiological settings and crime scenes where standard gel electrophoresis equipment cannot be brought in while quick results are needed. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  4. Rapid DNA haplotyping using a multiplex heteroduplex approach: Application to Duchenne muscula dystrophy carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Wenger, G.D.; Moore, J. [Ohio State Univ., Columbus, OH (United States)] [and others

    1994-09-01

    A new strategy has been developed for rapid haplotype analysis. It is based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. The method is simple, rapid, does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using 12 commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. As a result of expanding the number of detectable polymorphisms throughout the dystrophin gene, we show how the method can easily be combined with dinucleotide analysis to improve the accuracy of carrier detection in the nondeletion cases. The technique is also shown to be used as an effective screen for improving carrier detection in several families with deletions. The finding of heterozygosity within the deletion identifies the at-risk female as a noncarrier. Using this method, we have identified and incorporated 3 new dystrophin polymorphisms (one of which in exon 16 is unique to African Americans). The method may be used other genetic diseases when mutations are unknown, or there are few dinucleotide markers in the gene proximity, or for the identification of haplotype backgrounds of mutant alleles.

  5. The development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of abalone herpesvirus DNA.

    Science.gov (United States)

    Chen, M H; Kuo, S T; Renault, T; Chang, P H

    2014-02-01

    A loop-mediated isothermal amplification (LAMP) assay was developed for the detection of abalone herpesvirus DNA. Two pairs of primers were designed, based on the sequence of the DNA polymerase gene of abalone herpesvirus. The reaction temperature and time were optimized to 63°C and 60min, respectively. LAMP amplicons were analyzed by 2% agarose gel electrophoresis or by visual inspection of a colour change emitted by fluorescent dye. The method developed was specific for the detection of abalone herpesvirus, without cross-reactions with other tested herpesviruses including ostreid herpesvirus 1 (OsHV-1), European eel herpesvirus, koi herpesvirus (KHV) and an avian herpesvirus. The LAMP assay was 100 folds more sensitive than a conventional PCR and 10 folds less sensitive than a SYBR Green PCR. These results indicate that the developed LAMP assay is a simple, rapid, sensitive, specific and reliable technique for the detection of abalone herpesvirus. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Annealing helicase HARP closes RPA-stabilized DNA bubbles non-processively.

    Science.gov (United States)

    Burnham, Daniel R; Nijholt, Bas; De Vlaminck, Iwijn; Quan, Jinhua; Yusufzai, Timur; Dekker, Cees

    2017-05-05

    We investigate the mechanistic nature of the Snf2 family protein HARP, mutations of which are responsible for Schimke immuno-osseous dysplasia. Using a single-molecule magnetic tweezers assay, we construct RPA-stabilized DNA bubbles within torsionally constrained DNA to investigate the annealing action of HARP on a physiologically relevant substrate. We find that HARP closes RPA-stabilized bubbles in a slow reaction, taking on the order of tens of minutes for ∼600 bp of DNA to be re-annealed. The data indicate that DNA re-anneals through the removal of RPA, which is observed as clear steps in the bubble-closing traces. The dependence of the closing rate on both ionic strength and HARP concentration indicates that removal of RPA occurs via an association-dissociation mechanism where HARP does not remain associated with the DNA. The enzyme exhibits classical Michaelis-Menten kinetics and acts cooperatively with a Hill coefficient of 3 ± 1. Our work also allows the determination of some important features of RPA-bubble structures at low supercoiling, including the existence of multiple bubbles and that RPA molecules are mis-registered on the two strands. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Unique mitochondrial DNA lineages in Irish stickleback populations: cryptic refugium or rapid recolonization?

    Science.gov (United States)

    Ravinet, Mark; Harrod, Chris; Eizaguirre, Christophe; Prodöhl, Paulo A

    2014-06-01

    Repeated recolonization of freshwater environments following Pleistocene glaciations has played a major role in the evolution and adaptation of anadromous taxa. Located at the western fringe of Europe, Ireland and Britain were likely recolonized rapidly by anadromous fishes from the North Atlantic following the last glacial maximum (LGM). While the presence of unique mitochondrial haplotypes in Ireland suggests that a cryptic northern refugium may have played a role in recolonization, no explicit test of this hypothesis has been conducted. The three-spined stickleback is native and ubiquitous to aquatic ecosystems throughout Ireland, making it an excellent model species with which to examine the biogeographical history of anadromous fishes in the region. We used mitochondrial and microsatellite markers to examine the presence of divergent evolutionary lineages and to assess broad-scale patterns of geographical clustering among postglacially isolated populations. Our results confirm that Ireland is a region of secondary contact for divergent mitochondrial lineages and that endemic haplotypes occur in populations in Central and Southern Ireland. To test whether a putative Irish lineage arose from a cryptic Irish refugium, we used approximate Bayesian computation (ABC). However, we found no support for this hypothesis. Instead, the Irish lineage likely diverged from the European lineage as a result of postglacial isolation of freshwater populations by rising sea levels. These findings emphasize the need to rigorously test biogeographical hypothesis and contribute further evidence that postglacial processes may have shaped genetic diversity in temperate fauna.

  8. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    OpenAIRE

    Farkhondeh Saba; Moslem Papizadeh; Javad Khansha; Mahshid Sedghi; Mehrnoosh Rasooli; Mohammad Ali Amoozegar; Mohammad Reza Soudi; Seyed Abolhassan Shahzadeh Fazeli

    2016-01-01

    Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR). Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Me...

  9. Rapid one-step selection method for generating nucleic acid aptamers: development of a DNA aptamer against α-bungarotoxin.

    Directory of Open Access Journals (Sweden)

    Lasse H Lauridsen

    Full Text Available BACKGROUND: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen®, an inhibitor of vascular endothelial growth factor (VEGF for the treatment of age related macular degeneration (AMD. Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly in one-step, technique is required for developing aptamers in limited time period. PRINCIPAL FINDINGS: Herein, we present a simple one-step selection of DNA aptamers against α-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed by PCR enrichment of the selected aptamers. One round of selection successfully identified a DNA aptamer sequence with a binding affinity of 7.58 µM. CONCLUSION: We have demonstrated a one-step method for rapid production of nucleic acid aptamers. Although the reported binding affinity is in the low micromolar range, we believe that this could be further improved by using larger targets, increasing the stringency of selection and also by combining a capillary electrophoresis separation prior to the one-step selection. Furthermore, the method presented here is a user-friendly, cheap and an easy way of deriving an aptamer unlike the time consuming conventional SELEX-based approach. The most important application of this method is that chemically-modified nucleic acid libraries can also be used for aptamer selection as it requires only one enzymatic step. This method could equally be suitable for developing RNA aptamers.

  10. Feedback-regulated poly(ADP-ribosyl)ation by PARP-1 is required for rapid response to DNA damage in living cells

    Science.gov (United States)

    Mortusewicz, Oliver; Amé, Jean-Christophe; Leonhardt, Heinrich

    2007-01-01

    Genome integrity is constantly threatened by DNA lesions arising from numerous exogenous and endogenous sources. Survival depends on immediate recognition of these lesions and rapid recruitment of repair factors. Using laser microirradiation and live cell microscopy we found that the DNA-damage dependent poly(ADP-ribose) polymerases (PARP) PARP-1 and PARP-2 are recruited to DNA damage sites, however, with different kinetics and roles. With specific PARP inhibitors and mutations, we could show that the initial recruitment of PARP-1 is mediated by the DNA-binding domain. PARP-1 activation and localized poly(ADP-ribose) synthesis then generates binding sites for a second wave of PARP-1 recruitment and for the rapid accumulation of the loading platform XRCC1 at repair sites. Further PARP-1 poly(ADP-ribosyl)ation eventually initiates the release of PARP-1. We conclude that feedback regulated recruitment of PARP-1 and concomitant local poly(ADP-ribosyl)ation at DNA lesions amplifies a signal for rapid recruitment of repair factors enabling efficient restoration of genome integrity. PMID:17982172

  11. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    Science.gov (United States)

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  12. Microfluidic method for rapid turbidimetric detection of the DNA of Mycobacterium tuberculosis using loop-mediated isothermal amplification in capillary tubes

    International Nuclear Information System (INIS)

    Rafati, Adele; Gill, Pooria

    2015-01-01

    We describe a microfluidic method for rapid isothermal turbidimetric detection of the DNA of Mycobacterium tuberculosis. Loop-mediated isothermal amplification is accomplished in capillary tubes for amplifying DNA in less than 15 min, and sensitivity and specificity were compared to conventional loop-mediated isothermal amplification (LAMP). The method can detect as little as 1 pg mL −1 DNA in a sample. Results obtained with clinical specimens indicated 90 % sensitivity and 95 % specificity for microfluidic LAMP in comparison to culture methods. No interference occurred due to the presence of nonspecific DNAs. The findings demonstrate the power of the new microfluidic LAMP test for rapid molecular detection of microorganisms even when using bare eyes. (author)

  13. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Papa Mze Nasserdine

    2016-01-01

    Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

  14. Rapid method for detecting base damage in DNA of mammalian cells: assay of U. V. -induced pyrimidine dimers in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Bryant, P E [Hammersmith Hospital, London (UK). M.R.C. Cyclotron Unit; Jansson, G; Ahnstroem, G

    1978-11-01

    Simple and rapid techniques are described for the detection of pyrimidine dimers in DNA. Human cells derived from embryonic lung tissue were UV-irradiated and subjected to either an osmotic shock procedure or detergent lysis, then treated with UV-endonuclease from Micrococcus luteus and the DNA partially denatured by treatment with weak alkali. Brief sonication reduced the molecular weight of the DNA, and the single- and double-stranded DNA could then be separated by hydroxylapatite chromatography. Approximately 40% of the expected number of pyrimidine dimers were detected by the enzyme treatment technique. The mean value of numbers of strand breaks per 10/sup 9/ dalton per J/m/sup 2/ was approximately 50% of the expected value. The method has advantages of speed and reproducibility and a large reduction in the quantities of materials used, particularly at the scintillation-counting stage.

  15. Loop-mediated isothermal amplification (LAMP) assay-A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena).

    Science.gov (United States)

    Heers, Teresa; van Neer, Abbo; Becker, André; Grilo, Miguel Luca; Siebert, Ursula; Abdulmawjood, Amir

    2017-01-01

    Carcasses of wild animals are often visited by different scavengers. However, determining which scavenger caused certain types of bite marks is particularly difficult and knowledge thereof is lacking. Therefore, a loop-mediated isothermal amplification (LAMP) assay (target sequence cytochrome b) was developed to detect red fox DNA in carcasses of harbour porpoises. The MSwab™ method for direct testing without prior DNA isolation was validated. As a detection device, the portable real-time fluorometer Genie® II was used, which yields rapid results and can be used in field studies without huge laboratory equipment. In addition to in vitro evaluation and validation, a stranded and scavenged harbour porpoise carcass was successfully examined for red fox DNA residues. The developed LAMP method is a valuable diagnostic tool for confirming presumable red fox bite wounds in harbour porpoises without further DNA isolation steps.

  16. Potassium hydroxide-ethylene diamine tetraacetic acid method for the rapid preparation of small-scale PCR template DNA from actinobacteria.

    Science.gov (United States)

    Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli

    2014-01-01

    Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.

  17. Simple design for DNA nanotubes from a minimal set of unmodified strands: rapid, room-temperature assembly and readily tunable structure.

    Science.gov (United States)

    Hamblin, Graham D; Hariri, Amani A; Carneiro, Karina M M; Lau, Kai L; Cosa, Gonzalo; Sleiman, Hanadi F

    2013-04-23

    DNA nanotubes have great potential as nanoscale scaffolds for the organization of materials and the templation of nanowires and as drug delivery vehicles. Current methods for making DNA nanotubes either rely on a tile-based step-growth polymerization mechanism or use a large number of component strands and long annealing times. Step-growth polymerization gives little control over length, is sensitive to stoichiometry, and is slow to generate long products. Here, we present a design strategy for DNA nanotubes that uses an alternative, more controlled growth mechanism, while using just five unmodified component strands and a long enzymatically produced backbone. These tubes form rapidly at room temperature and have numerous, orthogonal sites available for the programmable incorporation of arrays of cargo along their length. As a proof-of-concept, cyanine dyes were organized into two distinct patterns by inclusion into these DNA nanotubes.

  18. DNA-based identification of invasive alien species in relation to Canadian federal policy and law, and the basis of rapid-response management.

    Science.gov (United States)

    Thomas, Vernon G; Hanner, Robert H; Borisenko, Alex V

    2016-11-01

    Managing invasive alien species in Canada requires reliable taxonomic identification as the basis of rapid-response management. This can be challenging, especially when organisms are small and lack morphological diagnostic features. DNA-based techniques, such as DNA barcoding, offer a reliable, rapid, and inexpensive toolkit for taxonomic identification of individual or bulk samples, forensic remains, and even environmental DNA. Well suited for this requirement, they could be more broadly deployed and incorporated into the operating policy and practices of Canadian federal departments and should be authorized under these agencies' articles of law. These include Fisheries and Oceans Canada, Canadian Food Inspection Agency, Transport Canada, Environment Canada, Parks Canada, and Health Canada. These efforts should be harmonized with the appropriate provisions of provincial jurisdictions, for example, the Ontario Invasive Species Act. This approach necessitates that a network of accredited, certified laboratories exists, and that updated DNA reference libraries are readily accessible. Harmonizing this approach is vital among Canadian federal agencies, and between the federal and provincial levels of government. Canadian policy and law must also be harmonized with that of the USA when detecting, and responding to, invasive species in contiguous lands and waters. Creating capacity in legislation for use of DNA-based identifications brings the authority to fund, train, deploy, and certify staff, and to refine further developments in this molecular technology.

  19. Molecular-based rapid inventories of sympatric diversity: a comparison of DNA barcode clustering methods applied to geography-based vs clade-based sampling of amphibians.

    Science.gov (United States)

    Paz, Andrea; Crawford, Andrew J

    2012-11-01

    Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.

  20. Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

    Science.gov (United States)

    Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

    2016-11-01

    Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  1. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  2. Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques.

    Science.gov (United States)

    Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian

    2010-03-01

    The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays.

  3. Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

    Science.gov (United States)

    Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

    2018-04-04

    In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Directory of Open Access Journals (Sweden)

    Koji Hashimoto

    2016-05-01

    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond

  5. Self-cytoplasmic DNA upregulates the mutator enzyme APOBEC3A leading to chromosomal DNA damage.

    Science.gov (United States)

    Suspène, Rodolphe; Mussil, Bianka; Laude, Hélène; Caval, Vincent; Berry, Noémie; Bouzidi, Mohamed S; Thiers, Valérie; Wain-Hobson, Simon; Vartanian, Jean-Pierre

    2017-04-07

    Foreign and self-cytoplasmic DNA are recognized by numerous DNA sensor molecules leading to the production of type I interferons. Such DNA agonists should be degraded otherwise cells would be chronically stressed. Most human APOBEC3 cytidine deaminases can initiate catabolism of cytoplasmic mitochondrial DNA. Using the human myeloid cell line THP-1 with an interferon inducible APOBEC3A gene, we show that cytoplasmic DNA triggers interferon α and β production through the RNA polymerase III transcription/RIG-I pathway leading to massive upregulation of APOBEC3A. By catalyzing C→U editing in single stranded DNA fragments, the enzyme prevents them from re-annealing so attenuating the danger signal. The price to pay is chromosomal DNA damage in the form of CG→TA mutations and double stranded DNA breaks which, in the context of chronic inflammation, could drive cells down the path toward cancer. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. A simple and rapid micromethod for genomic DNA extraction from jugal epithelial cells. Application to human lymphocyte antigen typing in one large family of atopic/asthmatic probands.

    Science.gov (United States)

    Aron, Y; Swierczewski, E; Lockhart, A

    1994-10-01

    We describe a rapid and reliable micromethod for DNA isolation from buccal epithelial cells from the interior mouth mucosa. This convenient, noninvasive method could be applied to genetic typing in a small number of cells (about 2000 cells per cheek). We have shown that DNA released by this method is suitable for further amplification by polymerase chain reaction (PCR). Using this protocol, coupled with the PCR-RFLP (restriction fragment length polymorphism) method, we analyzed the allelic sequence diversity of the human lymphocyte antigen (HLA) class II genes in an extended family of 33 persons containing 14 asthmatic or atopic members. Six of eight DQA1 alleles, and 11 DQB1, 20 DPB1, and 10 DR haplotypes could be identified in a single DNA sample. Our results suggest that the DR53 group haplotype is frequently associated with allergic asthma and atopy. The micromethod described here may be useful in genetic epidemiology, especially in family studies involving small children.

  7. New LightCycler PCR for Rapid and Sensitive Quantification of Parvovirus B19 DNA Guides Therapeutic Decision-Making in Relapsing Infections

    Science.gov (United States)

    Harder, Timm C.; Hufnagel, Markus; Zahn, Katrin; Beutel, Karin; Schmitt, Heinz-Josef; Ullmann, Uwe; Rautenberg, Peter

    2001-01-01

    Detection of parvovirus B19 DNA offers diagnostic advantages over serology, particularly in persistent infections of immunocompromised patients. A rapid, novel method of B19 DNA detection and quantification is introduced. This method, a quantitative PCR assay, is based on real-time glass capillary thermocycling (LightCycler [LC]) and fluorescence resonance energy transfer (FRET). The PCR assay allowed quantification over a dynamic range of over 7 logs and could quantify as little as 250 B19 genome equivalents (geq) per ml as calculated for plasmid DNA (i.e., theoretically ≥5 geq per assay). Interrater agreement analysis demonstrated equivalence of LC-FRET PCR and conventional nested PCR in the diagnosis of an active B19 infection (kappa coefficient = 0.83). The benefit of the new method was demonstrated in an immunocompromised child with a relapsing infection, who required an attenuation of the immunosuppressive therapy in addition to repeated doses of immunoglobulin to eliminate the virus. PMID:11724854

  8. Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing

    OpenAIRE

    Wang, Huiping; Kong, Fanrong; Sorrell, Tania C; Wang, Bin; McNicholas, Paul; Pantarat, Namfon; Ellis, David; Xiao, Meng; Widmer, Fred; Chen, Sharon CA

    2009-01-01

    Abstract Background Amino acid substitutions in the target enzyme Erg11p of azole antifungals contribute to clinically-relevant azole resistance in Candida albicans. A simple molecular method for rapid detection of ERG11 gene mutations would be an advantage as a screening tool to identify potentially-resistant strains and to track their movement. To complement DNA sequencing, we developed a padlock probe and rolling circle amplification (RCA)-based method to detect a series of mutations in th...

  9. Determination of alkylation of bacterial DNA as a rapid test for toxicological evaluation of alkylating xenobiotic agents

    Energy Technology Data Exchange (ETDEWEB)

    Botzenhart, K.; Waldner-Sander, S.; Schweinsberg, F.

    1986-05-01

    Alkylated purine bases from hydrolized DNA can be separated by HPLC and quantified with a fluorescence detector. We applied this method to bacterial DNA. 7-methylguanine was detected after treatment of Serratia marcescens with iodoacetamide, dimethyl sulfate and with polluted air.

  10. A DNA Barcode-Based RPA Assay (BAR-RPA) for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao).

    Science.gov (United States)

    Tian, Enwei; Liu, Qianqian; Ye, Haoting; Li, Fang; Chao, Zhi

    2017-12-18

    Background: Wuzhimaotao (the dry root of Ficus hirta ) is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans , which contains gelsemine that is extremely neurotoxic) and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA) with species-specific primers targeting the internal transcribed spacer (ITS) region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species-specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min) of the ITS region under a constant and mild temperature range of 37-42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

  11. A DNA Barcode-Based RPA Assay (BAR-RPA for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao

    Directory of Open Access Journals (Sweden)

    Enwei Tian

    2017-12-01

    Full Text Available Background: Wuzhimaotao (the dry root of Ficus hirta is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans, which contains gelsemine that is extremely neurotoxic and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA with species–specific primers targeting the internal transcribed spacer (ITS region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species–specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min of the ITS region under a constant and mild temperature range of 37–42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

  12. Lung Basal Stem Cells Rapidly Repair DNA Damage Using the Error-Prone Nonhomologous End-Joining Pathway

    Science.gov (United States)

    Weeden, Clare E.; Chen, Yunshun; Ma, Stephen B.; Hu, Yifang; Ramm, Georg; Sutherland, Kate D.; Smyth, Gordon K.

    2017-01-01

    Lung squamous cell carcinoma (SqCC), the second most common subtype of lung cancer, is strongly associated with tobacco smoking and exhibits genomic instability. The cellular origins and molecular processes that contribute to SqCC formation are largely unexplored. Here we show that human basal stem cells (BSCs) isolated from heavy smokers proliferate extensively, whereas their alveolar progenitor cell counterparts have limited colony-forming capacity. We demonstrate that this difference arises in part because of the ability of BSCs to repair their DNA more efficiently than alveolar cells following ionizing radiation or chemical-induced DNA damage. Analysis of mice harbouring a mutation in the DNA-dependent protein kinase catalytic subunit (DNA-PKcs), a key enzyme in DNA damage repair by nonhomologous end joining (NHEJ), indicated that BSCs preferentially repair their DNA by this error-prone process. Interestingly, polyploidy, a phenomenon associated with genetically unstable cells, was only observed in the human BSC subset. Expression signature analysis indicated that BSCs are the likely cells of origin of human SqCC and that high levels of NHEJ genes in SqCC are correlated with increasing genomic instability. Hence, our results favour a model in which heavy smoking promotes proliferation of BSCs, and their predilection for error-prone NHEJ could lead to the high mutagenic burden that culminates in SqCC. Targeting DNA repair processes may therefore have a role in the prevention and therapy of SqCC. PMID:28125611

  13. Rapid point-of-care testing for epidermal growth factor receptor gene mutations in patients with lung cancer using cell-free DNA from cytology specimen supernatants.

    Science.gov (United States)

    Asaka, Shiho; Yoshizawa, Akihiko; Saito, Kazusa; Kobayashi, Yukihiro; Yamamoto, Hiroshi; Negishi, Tatsuya; Nakata, Rie; Matsuda, Kazuyuki; Yamaguchi, Akemi; Honda, Takayuki

    2018-06-01

    Epidermal growth factor receptor (EGFR) mutations are associated with responses to EGFR tyrosine kinase inhibitors (EGFR-TKIs) in non-small-cell lung cancer (NSCLC). Our previous study revealed a rapid point-of-care system for detecting EGFR mutations. This system analyzes cell pellets from cytology specimens using droplet-polymerase chain reaction (d-PCR), and has a reaction time of 10 min. The present study aimed to validate the performance of the EGFR d-PCR assay using cell-free DNA (cfDNA) from supernatants obtained from cytology specimens. Assay results from cfDNA supernatant analyses were compared with those from cell pellets for 90 patients who were clinically diagnosed with, or suspected of having, lung cancer (80 bronchial lavage fluid samples, nine pleural effusion samples and one spinal fluid sample). EGFR mutations were identified in 12 and 15 cases using cfDNA supernatants and cell pellets, respectively. The concordance rates between cfDNA-supernatant and cell‑pellet assay results were 96.7% [kappa coefficient (K)=0.87], 98.9% (K=0.94), 98.9% (K=0.79) and 98.9% (K=0.79) for total EGFR mutations, L858R, E746_A750del and T790M, respectively. All 15 patients with EGFR mutation-positive results, as determined by EGFR d-PCR assay using cfDNA supernatants or cell pellets, also displayed positive results by conventional EGFR assays using tumor tissue or cytology specimens. Notably, EGFR mutations were even detected in five cfDNA supernatants for which the cytological diagnoses of the corresponding cell pellets were 'suspicious for malignancy', 'atypical' or 'negative for malignancy.' In conclusion, this rapid point-of-care system may be considered a promising novel screening method that may enable patients with NSCLC to receive EGFR-TKI therapy more rapidly, whilst also reserving cell pellets for additional morphological and molecular analyses.

  14. Boom-Bust Turnovers of Megabase-Sized Centromeric DNA in Solanum Species: Rapid Evolution of DNA Sequences Associated with Centromeres

    Czech Academy of Sciences Publication Activity Database

    Zhang, H.Q.; Koblížková, Andrea; Wang, K.; Gong, Z.Y.; Oliveira, L.; Torres, G.A.; Wu, Y.; Zhang, W.; Novák, Petr; Buell, C.R.; Macas, Jiří; Jiang, J.

    2014-01-01

    Roč. 26, č. 4 (2014), s. 1436-1447 ISSN 1040-4651 Institutional support: RVO:60077344 Keywords : Alpha-satellite DNA * repetitive sequences * rice centromeres Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.338, year: 2014

  15. Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms.

    Science.gov (United States)

    Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc

    2010-07-01

    We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.

  16. Inhibition of exportin-1 function results in rapid cell cycle-associated DNA damage in cancer cells.

    Science.gov (United States)

    Burke, Russell T; Marcus, Joshua M; Orth, James D

    2017-06-13

    Selective inhibitors of nuclear export (SINE) are small molecules in development as anti-cancer agents. The first-in-class SINE, selinexor, is in clinical trials for blood and solid cancers. Selinexor forms a covalent bond with exportin-1 at cysteine-528, and blocks its ability to export cargos. Previous work has shown strong cell cycle effects and drug-induced cell death across many different cancer-derived cell lines. Here, we report strong cell cycle-associated DNA double-stranded break formation upon the treatment of cancer cells with SINE. In multiple cell models, selinexor treatment results in the formation of clustered DNA damage foci in 30-40% of cells within 8 hours that is dependent upon cysteine-528. DNA damage strongly correlates with G1/S-phase and decreased DNA replication. Live cell microscopy reveals an association between DNA damage and cell fate. Cells that form damage in G1-phase more often die or arrest, while those damaged in S/G2-phase frequently progress to cell division. Up to half of all treated cells form damage foci, and most cells that die after being damaged, were damaged in G1-phase. By comparison, non-transformed cell lines show strong cell cycle effects but little DNA damage and less death than cancer cells. Significant drug combination effects occur when selinexor is paired with different classes of agents that either cause DNA damage or that diminish DNA damage repair. These data present a novel effect of exportin-1 inhibition and provide a strong rationale for multiple combination treatments of selinexor with agents that are currently in use for the treatment of different solid cancers.

  17. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  18. Novel Polymerase Spiral Reaction (PSR) for rapid visual detection of Bovine Herpesvirus 1 genomic DNA from aborted bovine fetus and semen.

    Science.gov (United States)

    Malla, Javed Ahmed; Chakravarti, Soumendu; Gupta, Vikas; Chander, Vishal; Sharma, Gaurav Kumar; Qureshi, Salauddin; Mishra, Adhiraj; Gupta, Vivek Kumar; Nandi, Sukdeb

    2018-02-20

    Bovine herpesvirus-1 (BHV-1) is a major viral pathogen affecting bovines leading to various clinical manifestations and causes significant economic impediment in modern livestock production system. Rapid, accurate and sensitive detection of BHV-1 infection at frozen semen stations or at dairy herds remains a priority for control of BHV-1 spread to susceptible population. Polymerase Spiral Reaction (PSR), a novel addition in the gamut of isothermal techniques, has been successfully implemented in initial optimization for detection of BHV-1 genomic DNA and further validated in clinical samples. The developed PSR assay has been validated for detection of BHV-1 from bovine semen (n=99), a major source of transmission of BHV-1 from breeding bulls to susceptible dams in artificial insemination programs. The technique has also been used for screening of BHV-1 DNA from suspected aborted fetal tissues (n=25). The developed PSR technique is 100 fold more sensitive than conventional PCR and comparable to real-time PCR. The PSR technique has been successful in detecting 13 samples positive for BHV-1 DNA in bovine semen, 4 samples more than conventional PCR. The aborted fetal tissues were negative for presence of BHV-1 DNA. The presence of BHV-1 in bovine semen samples raises a pertinent concern for extensively screening of semen from breeding bulls before been used for artificial insemination process. PSR has all the attributes for becoming a method of choice for rapid, accurate and sensitive detection of BHV-1 DNA at frozen semen stations or at dairy herds in resource constrained settings. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

    Science.gov (United States)

    Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

    2018-05-05

    The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. A simple and rapid method for isolation of high quality genomic DNA from fruit trees and conifers using PVP.

    Science.gov (United States)

    Kim, C S; Lee, C H; Shin, J S; Chung, Y S; Hyung, N I

    1997-03-01

    Because DNA degradation is mediated by secondary plant products such as phenolic terpenoids, the isolation of high quality DNA from plants containing a high content of polyphenolics has been a difficult problem. We demonstrate an easy extraction process by modifying several existing ones. Using this process we have found it possible to isolate DNAs from four fruit trees, grape (Vitis spp.), apple (Malus spp.), pear (Pyrus spp.) and persimmon (Diospyros spp.) and four species of conifer, Pinus densiflora, Pinus koraiensis,Taxus cuspidata and Juniperus chinensis within a few hours. Compared with the existing method, we have isolated high quality intact DNAs (260/280 = 1.8-2.0) routinely yielding 250-500 ng/microl (total 7.5-15 microg DNA from four to five tissue discs).

  1. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2017-01-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  2. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2016-09-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  3. A differential mobility spectrometry/mass spectrometry platform for the rapid detection and quantitation of DNA adduct dG-ABP.

    Science.gov (United States)

    Kafle, Amol; Klaene, Joshua; Hall, Adam B; Glick, James; Coy, Stephen L; Vouros, Paul

    2013-07-15

    There is continued interest in exploring new analytical technologies for the detection and quantitation of DNA adducts, biomarkers which provide direct evidence of exposure and genetic damage in cells. With the goal of reducing clean-up steps and improving sample throughput, a Differential Mobility Spectrometry/Mass Spectrometry (DMS/MS) platform has been introduced for adduct analysis. A DMS/MS platform has been utilized for the analysis of dG-ABP, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl (4-ABP). After optimization of the DMS parameters, each sample was analyzed in just 30 s following a simple protein precipitation step of the digested DNA. A detection limit of one modification in 10^6 nucleosides has been achieved using only 2 µg of DNA. A brief comparison (quantitative and qualitative) with liquid chromatography/mass spectrometry is also presented highlighting the advantages of using the DMS/MS method as a high-throughput platform. The data presented demonstrate the successful application of a DMS/MS/MS platform for the rapid quantitation of DNA adducts using, as a model analyte, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl. Copyright © 2013 John Wiley & Sons, Ltd.

  4. Internal validation of the DNAscan/ANDE™ Rapid DNA Analysis™ platform and its associated PowerPlex® 16 high content DNA biochip cassette for use as an expert system with reference buccal swabs.

    Science.gov (United States)

    Moreno, Lilliana I; Brown, Alice L; Callaghan, Thomas F

    2017-07-01

    Rapid DNA platforms are fully integrated systems capable of producing and analyzing short tandem repeat (STR) profiles from reference sample buccal swabs in less than two hours. The technology requires minimal user interaction and experience making it possible for high quality profiles to be generated outside an accredited laboratory. The automated production of point of collection reference STR profiles could eliminate the time delay for shipment and analysis of arrestee samples at centralized laboratories. Furthermore, point of collection analysis would allow searching against profiles from unsolved crimes during the normal booking process once the infrastructure to immediately search the Combined DNA Index System (CODIS) database from the booking station is established. The DNAscan/ANDE™ Rapid DNA Analysis™ System developed by Network Biosystems was evaluated for robustness and reliability in the production of high quality reference STR profiles for database enrollment and searching applications. A total of 193 reference samples were assessed for concordance of the CODIS 13 loci. Studies to evaluate contamination, reproducibility, precision, stutter, peak height ratio, noise and sensitivity were also performed. The system proved to be robust, consistent and dependable. Results indicated an overall success rate of 75% for the 13 CODIS core loci and more importantly no incorrect calls were identified. The DNAscan/ANDE™ could be confidently used without human interaction in both laboratory and non-laboratory settings to generate reference profiles. Published by Elsevier B.V.

  5. Rapid discrimination of Isaria javanica and Isaria poprawskii from Isaria spp. using high resolution DNA melting assays

    Science.gov (United States)

    The current study evaluates the potential of using high resolution DNA melting assays to discriminate species in the genus, Isaria. The study utilizes a previously identified 103 base pair PCR amplicon, which was reported to be selective for Isaria fumosorosea. Our study finds the amplicon selective...

  6. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.

    2011-01-01

    for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were...

  7. Evaluation of a transposase protocol for rapid generation of shotgun high-throughput sequencing libraries from nanogram quantities of DNA.

    Science.gov (United States)

    Marine, Rachel; Polson, Shawn W; Ravel, Jacques; Hatfull, Graham; Russell, Daniel; Sullivan, Matthew; Syed, Fraz; Dumas, Michael; Wommack, K Eric

    2011-11-01

    Construction of DNA fragment libraries for next-generation sequencing can prove challenging, especially for samples with low DNA yield. Protocols devised to circumvent the problems associated with low starting quantities of DNA can result in amplification biases that skew the distribution of genomes in metagenomic data. Moreover, sample throughput can be slow, as current library construction techniques are time-consuming. This study evaluated Nextera, a new transposon-based method that is designed for quick production of DNA fragment libraries from a small quantity of DNA. The sequence read distribution across nine phage genomes in a mock viral assemblage met predictions for six of the least-abundant phages; however, the rank order of the most abundant phages differed slightly from predictions. De novo genome assemblies from Nextera libraries provided long contigs spanning over half of the phage genome; in four cases where full-length genome sequences were available for comparison, consensus sequences were found to match over 99% of the genome with near-perfect identity. Analysis of areas of low and high sequence coverage within phage genomes indicated that GC content may influence coverage of sequences from Nextera libraries. Comparisons of phage genomes prepared using both Nextera and a standard 454 FLX Titanium library preparation protocol suggested that the coverage biases according to GC content observed within the Nextera libraries were largely attributable to bias in the Nextera protocol rather than to the 454 sequencing technology. Nevertheless, given suitable sequence coverage, the Nextera protocol produced high-quality data for genomic studies. For metagenomics analyses, effects of GC amplification bias would need to be considered; however, the library preparation standardization that Nextera provides should benefit comparative metagenomic analyses.

  8. Potential of cross-priming amplification and DNA-based lateral-flow strip biosensor for rapid on-site GMO screening.

    Science.gov (United States)

    Huang, Xin; Zhai, Congcong; You, Qimin; Chen, Hongjun

    2014-07-01

    The requirement to monitor the presence of genetically modified organisms (GMO) in a variety of marked products has generated an increasing demand for reliable, rapid, and time and cost-effective analytical methods. Here we report an on-site method for rapid detection of cauliflower mosaic virus promoter (CaMV 35S), a common element present in most GMO, using cross-priming amplification (CPA) technology. Detection was achieved using a DNA-based contamination-proof strip biosensor. The limit of detection was 30 copies for the pBI121 plasmid containing the CaMV 35S gene. The certified reference sample of GM maize line MON810 was detectable even at the low relative mass concentration of 0.05%. The developed CPA method had high specificity for the CaMV 35S gene, as compared with other GM lines not containing this gene and non-GM products. The method was further validated using nine real-world samples, and the results were confirmed by real-time PCR analysis. Because of its simplicity, rapidity, and high sensitivity, this method of detecting the CaMV 35S gene has great commercial prospects for rapid GMO screening of high-consumption food and agriculture products.

  9. Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor.

    Science.gov (United States)

    Yu, Xiaofan; Chen, Fang; Wang, Ronghui; Li, Yanbin

    2018-01-20

    The rapid detection of foodborne pathogens is critical to ensure food safety. The objective of this study is to select aptamers specifically bound to Escherichia coli O157:H7 using the whole-bacterium SELEX (Systematic Evolution of Ligands by Exponential Enrichment) and apply the selected aptamer to a QCM (quartz crystal microbalance) sensor for rapid and sensitive detection of target bacteria. A total of 19 rounds of selection against live E. coli O157:H7 and 6 rounds of counter selection against a mixture of Staphylococcus aureus, Listeria monocytogenes, and Salmonella Typhimurium, were performed. The aptamer pool from the last round was cloned and sequenced. One sequence S1 that appeared 16 times was characterized and a dissociation constant (K d ) of 10.30nM was obtained. Subsequently, a QCM aptasensor was developed for the rapid detection of E. coli O157:H7. The limit of detection (LOD) and the detection time of the aptasensor was determined to be 1.46×10 3 CFU/ml and 50min, respectively. This study demonstrated that the ssDNA aptamer selected by the whole-bacterium SELEX possessed higher sensitivity than previous work and the potential use of the constructed QCM aptasensor in rapid screening of foodborne pathogens. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Independent, rapid and targeted loss of highly repetitive DNA in natural and synthetic allopolyploids of Nicotiana tabacum

    Czech Academy of Sciences Publication Activity Database

    Renny-Byfield, S.; Kovařík, Aleš; Chester, M.; Nichols, R.A.; Macas, Jiří; Novák, Petr; Leitch, A.R.

    2012-01-01

    Roč. 7, č. 5 (2012), e36963 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GAP501/10/0208; GA MŠk OC10037 Institutional research plan: CEZ:AV0Z50040702; CEZ:AV0Z50510513 Keywords : chromosome evolution * repetitive DNA * allopolyploid Subject RIV: BO - Biophysics; EB - Genetics ; Molecular Biology (BC-A) Impact factor: 3.730, year: 2012

  11. Rapid, large-scale purification and characterization of Ada protein (O sup 6 methylguanine-DNA methyltransferase) of E. coli

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharyya, D.; Tano, K.; Bunick, G.J.; Uberbacher, E.C.; Mitra, S. (Oak Ridge National Laboratory, TN (USA)); Behnke, W.D. (Univ. of Cincinnati College of Medicine, OH (USA))

    1988-07-25

    The E. coli Ada protein (O{sup 6}-methylguanine-DNA methyltransferase) has been purified using a high-level expression vector with a yield of about 3 mg per liter of E. coli culture. The 39-kDa protein has an extinction coefficient (E{sup 280nm}{sub 1%}) of 5.3. Its isoelectric point of 7.1 is lower than that predicted from the amino acid content. The homogeneous Ada protein is fully active as a methyl acceptor from O{sup 6}-methylguanine in DNA. Its reaction with O{sup 6}-methylguanine in a synthetic DNA has a second-order rate constant of 1.1 {times} 10{sup 9} M{sup {minus}1} min{sup {minus}1} at 0{degree}C. Both the native form and the protein methylated at Cys-69 are monomeric. The CD spectrum suggests a low {alpha}-helical content and the radius of gyration of 23 {angstrom} indicates a compact, globular shape. The middle region of the protein is sensitive to a variety of proteases, including an endogenous activity in E. coli, suggesting that the protein is composed of N-terminal and C-terminal domains connected by a hinge region. E. coli B has a higher level of this protease than does K12.

  12. Mitochondrial DNA signature for range-wide populations of Bicyclus anynana suggests a rapid expansion from recent refugia.

    Directory of Open Access Journals (Sweden)

    Maaike A de Jong

    Full Text Available This study investigates the genetic diversity, population structure and demographic history of the afrotropical butterfly Bicyclus anynana using mitochondrial DNA (mtDNA. Samples from six wild populations covering most of the species range from Uganda to South Africa were compared for the cytochrome c oxidase subunit gene (COI. Molecular diversity indices show overall high mtDNA diversity for the populations, but low nucleotide divergence between haplotypes. Our results indicate relatively little geographic population structure among the southern populations, especially given the extensive distributional range and an expectation of limited gene flow between populations. We implemented neutrality tests to assess signatures of recent historical demographic events. Tajima's D test and Fu's F(S test both suggested recent population growth for the populations. The results were only significant for the southernmost populations when applying Tajima's D, but Fu's F(S indicated significant deviations from neutrality for all populations except the one closest to the equator. Based on our own findings and those from pollen and vegetation studies, we hypothesize that the species range of B. anynana was reduced to equatorial refugia during the last glacial period, and that the species expanded southwards during the past 10.000 years. These results provide crucial background information for studies of phenotypic and molecular adaptation in wild populations of B. anynana.

  13. 3' RNA ligase mediated rapid amplification of cDNA ends for validating viroid induced cleavage at the 3' extremity of the host mRNA.

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Bru, Pierrick; Perreault, Jean-Pierre

    2017-12-01

    5' RNA ligase-mediated rapid amplification of cDNA ends (5' RLM-RACE) is a widely-accepted method for the validation of direct cleavage of a target gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). However, this method cannot be used if cleavage takes place in the 3' extremity of the target RNA, as this gives insufficient sequence length to design nested PCR primers for 5' RLM RACE. To overcome this hurdle, we have developed 3' RNA ligase-mediated rapid amplification of cDNA ends (3' RLM RACE). In this method, an oligonucleotide adapter having 5' adenylated and 3' blocked is ligated to the 3' end of the cleaved RNA followed by PCR amplification using gene specific primers. In other words, in 3' RLM RACE, 3' end is mapped using 5' fragment instead of small 3' fragment. The method developed here was verified by examining the bioinformatics predicted and parallel analysis of RNA ends (PARE) proved cleavage sites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid infected tomato plants. The 3' RLM RACE developed in this study has the potential to validate the miRNA and vd-sRNA mediated cleavage of mRNAs at its 3' untranslated region (3' UTR). Copyright © 2017 Elsevier B.V. All rights reserved.

  14. DPS - a rapid method for genome sequencing of DNA-containing bacteriophages directly from a single plaque

    DEFF Research Database (Denmark)

    Kot, Witold Piotr; Vogensen, Finn Kvist; Sørensen, Søren Johannes

    2014-01-01

    Bacteriophages (phages) coexist with bacteria in all environments and influence microbial diversity, evolution and industrial production processes. As a result of this major impact of phages on microbes, tools that allow rapid characterization of phages are needed. Today, one of the most powerful...

  15. An easy, rapid, and cost-effective method for DNA extraction from various lichen taxa and specimens suitable for analysis of fungal and algal strains.

    Science.gov (United States)

    Park, Sook-Young; Jang, Seol-Hwa; Oh, Soon-Ok; Kim, Jung A; Hur, Jae-Seoun

    2014-12-01

    Lichen studies, including biodiversity, phylogenetic relationships, and conservation concerns require definitive species identification, however many lichens can be challenging to identify at the species level. Molecular techniques have shown efficacy in discriminating among lichen taxa, however, obtaining genomic DNA from herbarium and fresh lichen thalli by conventional methods has been difficult, because lichens contain high proteins, polysaccharides, and other complex compounds in their cell walls. Here we report a rapid, easy, and inexpensive protocol for extracting PCR-quality DNA from various lichen species. This method involves the following two steps: first, cell breakage using a beadbeater; and second, extraction, isolation, and precipitation of genomic DNA. The procedure requires approximately 10 mg of lichen thalli and can be completed within 20 min. The obtained DNAs were of sufficient quality and quantity to amplify the internal transcribed spacer region from the fungal and algal lichen components, as well as to sequence the amplified products. In addition, 26 different lichen taxa were tested, resulting in successful PCR products. The results of this study validated the experimental protocols, and clearly demonstrated the efficacy and value of our KCl extraction method applied in the fungal and algal samples.

  16. Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Ellis David

    2009-08-01

    Full Text Available Abstract Background Amino acid substitutions in the target enzyme Erg11p of azole antifungals contribute to clinically-relevant azole resistance in Candida albicans. A simple molecular method for rapid detection of ERG11 gene mutations would be an advantage as a screening tool to identify potentially-resistant strains and to track their movement. To complement DNA sequencing, we developed a padlock probe and rolling circle amplification (RCA-based method to detect a series of mutations in the C. albicans ERG11 gene using "reference" azole-resistant isolates with known mutations. The method was then used to estimate the frequency of ERG11 mutations and their type in 25 Australian clinical C. albicans isolates with reduced susceptibility to fluconazole and in 23 fluconazole-susceptible isolates. RCA results were compared DNA sequencing. Results The RCA assay correctly identified all ERG11 mutations in eight "reference" C. albicans isolates. When applied to 48 test strains, the RCA method showed 100% agreement with DNA sequencing where an ERG11 mutation-specific probe was used. Of 20 different missense mutations detected by sequencing in 24 of 25 (96% isolates with reduced fluconazole susceptibility, 16 were detected by RCA. Five missense mutations were detected by both methods in 18 of 23 (78% fluconazole-susceptible strains. DNA sequencing revealed that mutations in non-susceptible isolates were all due to homozygous nucleotide changes. With the exception of the mutations leading to amino acid substitution E266D, those in fluconazole-susceptible strains were heterozygous. Amino acid substitutions common to both sets of isolates were D116E, E266D, K128T, V437I and V488I. Substitutions unique to isolates with reduced fluconazole susceptibility were G464 S (n = 4 isolates, G448E (n = 3, G307S (n = 3, K143R (n = 3 and Y123H, S405F and R467K (each n = 1. DNA sequencing revealed a novel substitution, G450V, in one isolate. Conclusion The sensitive RCA

  17. Open microfluidic gel electrophoresis: Rapid and low cost separation and analysis of DNA at the nanoliter scale.

    Science.gov (United States)

    Gutzweiler, Ludwig; Gleichmann, Tobias; Tanguy, Laurent; Koltay, Peter; Zengerle, Roland; Riegger, Lutz

    2017-07-01

    Gel electrophoresis is one of the most applied and standardized tools for separation and analysis of macromolecules and their fragments in academic research and in industry. In this work we present a novel approach for conducting on-demand electrophoretic separations of DNA molecules in open microfluidic (OM) systems on planar polymer substrates. The approach combines advantages of slab gel, capillary- and chip-based methods offering low consumable costs (<0.1$) circumventing cost-intensive microfluidic chip fabrication, short process times (5 min per analysis) and high sensitivity (4 ng/μL dsDNA) combined with reasonable resolution (17 bases). The open microfluidic separation system comprises two opposing reservoirs of 2-4 μL in volume, a semi-contact written gel line acting as separation channel interconnecting the reservoirs and sample injected into the line via non-contact droplet dispensing and thus enabling the precise control of the injection plug and sample concentration. Evaporation is prevented by covering aqueous structures with PCR-grade mineral oil while maintaining surface temperature at 15°C. The liquid gel line exhibits a semi-circular cross section of adaptable width (∼200-600 μm) and height (∼30-80 μm) as well as a typical length of 15-55 mm. Layout of such liquid structures is adaptable on-demand not requiring time consuming and repetitive fabrication steps. The approach was successfully demonstrated by the separation of a standard label-free DNA ladder (100-1000 bp) at 100 V/cm via in-line staining and laser induced fluorescent end-point detection using an automated prototype. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Optofluidics-based DNA structure-competitive aptasensor for rapid on-site detection of lead(II) in an aquatic environment.

    Science.gov (United States)

    Long, Feng; Zhu, Anna; Wang, Hongchen

    2014-11-07

    Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Competition between the DNA unwinding and strand pairing activities of the Werner and Bloom syndrome proteins

    Directory of Open Access Journals (Sweden)

    Orren David K

    2006-01-01

    Full Text Available Abstract Background The premature aging and cancer-prone Werner and Bloom syndromes are caused by defects in the RecQ helicase enzymes WRN and BLM, respectively. Recently, both WRN and BLM (as well as several other RecQ members have been shown to possess a strand annealing activity in addition to the requisite DNA unwinding activity. Since an annealing function would appear to directly oppose the action of a helicase, we have examined in this study the dynamic equilibrium between unwinding and annealing mediated by either WRN or BLM. Results Our investigation into the competition between annealing and unwinding demonstrates that, under standard reaction conditions, WRN- or BLM-mediated annealing can partially or completely mask unwinding as measured in standard helicase assays. Several strategies were employed to suppress the annealing activity so that the actual strength of WRN- or BLM-dependent unwinding could be more accurately assessed. Interestingly, if a DNA oligomer complementary to one strand of the DNA substrate to be unwound is added during the helicase reaction, both WRN and BLM unwinding is enhanced, presumably by preventing protein-mediated re-annealing. This strategy allowed measurement of WRN-catalyzed unwinding of long (80 base pair duplex regions and fully complementary, blunt-ended duplexes, both of which were otherwise quite refractory to the helicase activity of WRN. Similarly, the addition of trap strand stimulated the ability of BLM to unwind long and blunt-ended duplexes. The stimulatory effect of the human replication protein A (hRPA, the eukaryotic single-stranded DNA binding protein on both WRN- and BLM-dependent unwinding was also re-examined in light of its possible role in preventing re-annealing. Our results show that hRPA influences the outcome of WRN and BLM helicase assays by both inhibiting re-annealing and directly promoting unwinding, with the larger contribution from the latter mechanism. Conclusion These

  20. Rapid One-Step Selection Method for Generating Nucleic Acid Aptamers: Development of a DNA Aptamer against alpha-Bungarotoxin

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Shamaileh, Hadi A.; Edwards, Stacey L.

    2012-01-01

    Background: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen (R), an inhibitor of vascular endothelial growth factor (VEGF......) for the treatment of age related macular degeneration (AMD). Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly...... in one-step, technique is required for developing aptamers in limited time period. Principal Findings: Herein, we present a simple one-step selection of DNA aptamers against alpha-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed...

  1. Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

    Science.gov (United States)

    Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

    2015-01-01

    Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and

  2. [Application of DNA-based electrochemical biosensor in rapid detection of Escherichia coli exist in licorice decoction].

    Science.gov (United States)

    Zhao, Yu-Wen; Wang, Hai-Xia; Bie, Song-Tao; Shao, Qian; Wang, Chun-Hua; Wang, Dong-Heng; Li, Zheng

    2018-03-01

    A new method for detection of Escherichia coli exist in licorice decoction was developed by using DNA-based electrochemical biosensor. The thiolated capture probe was immobilized on a gold electrode at first. Then the aptamer for Escherichia coli was combined with the capture probe by hybridization. Due to the stronger interaction between the aptamer and the E. coli, the aptamer can dissociate from the capture probe in the presence of E. coli in licorice decoction. The biotinylated detection probe was hybridized with the single-strand capture probe. As a result, the electrochemical response to Escherichia coli can be measured by using differential pulse voltammetric in the presence of α-naphthyl phosphate. The plot of peak current vs. the logarithm of concentration in the range from 2.7×10² to 2.7×10⁸ CFU·mL⁻¹ displayed a linear relationship with a detection limit of 50 CFU·mL⁻¹. The relative standard deviation of 3 successive scans was 2.5%,2.1%,4.6% for 2×10²,2×10⁴,2×106:⁶ CFU·mL⁻¹ E. coli, respectively. The proposed procedure showed better specificity to E. coli in comparison to Pseudomonas aeruginosa, Staphylococcus aureus and Bacillus subtilis. In the detection of the real extractum glycyrrhizae, the results between the proposed strategy and the GB assay showed high degree of agreement, demonstrating the designed biosensor could be utilized as a powerful tool for microbial examination for traditional Chinese medicine. Copyright© by the Chinese Pharmaceutical Association.

  3. Rapid Recruitment of BRCA1 to DNA Double-Strand Breaks Is Dependent on Its Association with Ku80▿ †

    Science.gov (United States)

    Wei, Leizhen; Lan, Li; Hong, Zehui; Yasui, Akira; Ishioka, Chikashi; Chiba, Natsuko

    2008-01-01

    BRCA1 is the first susceptibility gene to be linked to breast and ovarian cancers. Although mounting evidence has indicated that BRCA1 participates in DNA double-strand break (DSB) repair pathways, its precise mechanism is still unclear. Here, we analyzed the in situ response of BRCA1 at DSBs produced by laser microirradiation. The amino (N)- and carboxyl (C)-terminal fragments of BRCA1 accumulated independently at DSBs with distinct kinetics. The N-terminal BRCA1 fragment accumulated immediately after laser irradiation at DSBs and dissociated rapidly. In contrast, the C-terminal fragment of BRCA1 accumulated more slowly at DSBs but remained at the sites. Interestingly, rapid accumulation of the BRCA1 N terminus, but not the C terminus, at DSBs depended on Ku80, which functions in the nonhomologous end-joining (NHEJ) pathway, independently of BARD1, which binds to the N terminus of BRCA1. Two small regions in the N terminus of BRCA1 independently accumulated at DSBs and interacted with Ku80. Missense mutations found within the N terminus of BRCA1 in cancers significantly changed the kinetics of its accumulation at DSBs. A P142H mutant failed to associate with Ku80 and restore resistance to irradiation in BRCA1-deficient cells. These might provide a molecular basis of the involvement of BRCA1 in the NHEJ pathway of the DSB repair process. PMID:18936166

  4. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Science.gov (United States)

    Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

    2016-01-01

    Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.

  5. Rapid MCNP simulation of DNA double strand break (DSB) relative biological effectiveness (RBE) for photons, neutrons, and light ions.

    Science.gov (United States)

    Stewart, Robert D; Streitmatter, Seth W; Argento, David C; Kirkby, Charles; Goorley, John T; Moffitt, Greg; Jevremovic, Tatjana; Sandison, George A

    2015-11-07

    To account for particle interactions in the extracellular (physical) environment, information from the cell-level Monte Carlo damage simulation (MCDS) for DNA double strand break (DSB) induction has been integrated into the general purpose Monte Carlo N-particle (MCNP) radiation transport code system. The effort to integrate these models is motivated by the need for a computationally efficient model to accurately predict particle relative biological effectiveness (RBE) in cell cultures and in vivo. To illustrate the approach and highlight the impact of the larger scale physical environment (e.g. establishing charged particle equilibrium), we examined the RBE for DSB induction (RBEDSB) of x-rays, (137)Cs γ-rays, neutrons and light ions relative to γ-rays from (60)Co in monolayer cell cultures at various depths in water. Under normoxic conditions, we found that (137)Cs γ-rays are about 1.7% more effective at creating DSB than γ-rays from (60)Co (RBEDSB  =  1.017) whereas 60-250 kV x-rays are 1.1 to 1.25 times more efficient at creating DSB than (60)Co. Under anoxic conditions, kV x-rays may have an RBEDSB up to 1.51 times as large as (60)Co γ-rays. Fission neutrons passing through monolayer cell cultures have an RBEDSB that ranges from 2.6 to 3.0 in normoxic cells, but may be as large as 9.93 for anoxic cells. For proton pencil beams, Monte Carlo simulations suggest an RBEDSB of about 1.2 at the tip of the Bragg peak and up to 1.6 a few mm beyond the Bragg peak. Bragg peak RBEDSB increases with decreasing oxygen concentration, which may create opportunities to apply proton dose painting to help address tumor hypoxia. Modeling of the particle RBE for DSB induction across multiple physical and biological scales has the potential to aid in the interpretation of laboratory experiments and provide useful information to advance the safety and effectiveness of hadron therapy in the treatment of cancer.

  6. Rapid divergence of histones in Hydrozoa (Cnidaria) and evolution of a novel histone involved in DNA damage response in hydra.

    Science.gov (United States)

    Reddy, Puli Chandramouli; Ubhe, Suyog; Sirwani, Neha; Lohokare, Rasika; Galande, Sanjeev

    2017-08-01

    Histones are fundamental components of chromatin in all eukaryotes. Hydra, an emerging model system belonging to the basal metazoan phylum Cnidaria, provides an ideal platform to understand the evolution of core histone components at the base of eumetazoan phyla. Hydra exhibits peculiar properties such as tremendous regenerative capacity, lack of organismal senescence and rarity of malignancy. In light of the role of histone modifications and histone variants in these processes it is important to understand the nature of histones themselves and their variants in hydra. Here, we report identification of the complete repertoire of histone-coding genes in the Hydra magnipapillata genome. Hydra histones were classified based on their copy numbers, gene structure and other characteristic features. Genomic organization of canonical histone genes revealed the presence of H2A-H2B and H3-H4 paired clusters in high frequency and also a cluster with all core histones along with H1. Phylogenetic analysis of identified members of H2A and H2B histones suggested rapid expansion of these groups in Hydrozoa resulting in the appearance of unique subtypes. Amino acid sequence level comparisons of H2A and H2B forms with bilaterian counterparts suggest the possibility of a highly mobile nature of nucleosomes in hydra. Absolute quantitation of transcripts confirmed the high copy number of histones and supported the canonical nature of H2A. Furthermore, functional characterization of H2A.X.1 and a unique variant H2A.X.2 in the gastric region suggest their role in the maintenance of genome integrity and differentiation processes. These findings provide insights into the evolution of histones and their variants in hydra. Copyright © 2017 Elsevier GmbH. All rights reserved.

  7. Rapid response to an emerging infectious disease - Lessons learned from development of a synthetic DNA vaccine targeting Zika virus.

    Science.gov (United States)

    Kudchodkar, Sagar B; Choi, Hyeree; Reuschel, Emma L; Esquivel, Rianne; Jin-Ah Kwon, Jackie; Jeong, Moonsup; Maslow, Joel N; Reed, Charles C; White, Scott; Kim, J Joseph; Kobinger, Gary P; Tebas, Pablo; Weiner, David B; Muthumani, Kar

    2018-03-17

    Vaccines are considered one of the greatest advances in modern medicine. The global burden of numerous infectious diseases has been significantly reduced, and in some cases, effectively eradicated through the deployment of specific vaccines. However, efforts to develop effective new vaccines against infectious pathogens such as influenza, Human immunodeficiency virus (HIV), dengue virus (DENV), chikungunya virus (CHIKV), Ebola virus, and Zika virus (ZIKV) have proven challenging. Zika virus is a mosquito-vectored flavivirus responsible for periodic outbreaks of disease in Africa, Southeast Asia, and the Pacific Islands dating back over 50 years. Over this period, ZIKV infections were subclinical in most infected individuals and resulted in mild cases of fever, arthralgia, and rash in others. Concerns about ZIKV changed over the past two years, however, as outbreaks in Brazil, Central American countries, and Caribbean islands revealed novel aspects of infection including vertical and sexual transmission modes. Cases have been reported showing dramatic neurological pathologies including microcephaly and other neurodevelopmental problems in babies born to ZIKV infected mothers, as well as an increased risk of Guillain-Barre syndrome in adults. These findings prompted the World Health Organization to declare ZIKV a public health emergency in 2016, which resulted in expanded efforts to develop ZIKV vaccines and immunotherapeutics. Several ZIKV vaccine candidates that are immunogenic and effective at blocking ZIKV infection in animal models have since been developed, with some of these now being evaluated in the clinic. Additional therapeutics under investigation include anti-ZIKV monoclonal antibodies (mAbs) that have been shown to neutralize infection in vitro as well as protect against morbidity in mouse models of ZIKV infection. In this review, we summarize the current understanding of ZIKV biology and describe our efforts to rapidly develop a vaccine against ZIKV

  8. MALDI-TOF MS performance compared to direct examination, culture, and 16S rDNA PCR for the rapid diagnosis of bone and joint infections.

    Science.gov (United States)

    Lallemand, E; Coiffier, G; Arvieux, C; Brillet, E; Guggenbuhl, P; Jolivet-Gougeon, A

    2016-05-01

    The rapid identification of bacterial species involved in bone and joint infections (BJI) is an important element to optimize the diagnosis and care of patients. The aim of this study was to evaluate the usefulness of matrix-assisted laser desorption ionization mass spectrometry (MALDI-TOF MS) for the rapid diagnosis of bone infections, directly on synovial fluid (SF) or on crushed osteoarticular samples (CS). From January to October 2013, we prospectively analyzed 111 osteoarticular samples (bone and joint samples, BJS) from 78 patients in care at the University Hospital of Rennes, France. The diagnosis procedure leading to the sample collection was linked to a suspicion of infection, inflammatory disease, arthritis, or for any bone or joint abnormalities. Standard bacteriological diagnosis and molecular biology analysis [16S rRNA polymerase chain reaction (PCR) and sequencing] were conducted. In addition, analysis by MALDI-TOF MS was performed directly on the osteoarticular samples, as soon as the amount allowed. Culture, which remains the gold standard for the diagnosis of BJI, has the highest sensitivity (85.9 %) and remains necessary to test antimicrobial susceptibility. The 16S rDNA PCR results were positive in the group with positive BJI (28.6 %) and negative in the group without infection. Direct examination remains insensitive (31.7 %) but more effective than MALDI-TOF MS directly on the sample (6.3 %). The specificity was 100 % in all cases, except for culture (74.5 %). Bacterial culture remains the gold standard, especially enrichment in blood bottles. Direct analysis of bone samples with MALDI-TOF MS is not useful, possibly due to the low inoculum of BJS.

  9. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting.

    Science.gov (United States)

    Rashed-Ul Islam, S M; Jahan, Munira; Tabassum, Shahina

    2015-01-01

    Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 10 3 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 10 3 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15.

  10. Genome-wide DNA methylation alterations of Alternanthera philoxeroides in natural and manipulated habitats: implications for epigenetic regulation of rapid responses to environmental fluctuation and phenotypic variation.

    Science.gov (United States)

    Gao, Lexuan; Geng, Yupeng; Li, Bo; Chen, Jiakuan; Yang, Ji

    2010-11-01

    Alternanthera philoxeroides (alligator weed) is an invasive weed that can colonize both aquatic and terrestrial habitats. Individuals growing in different habitats exhibit extensive phenotypic variation but little genetic differentiation in its introduced range. The mechanisms underpinning the wide range of phenotypic variation and rapid adaptation to novel and changing environments remain uncharacterized. In this study, we examined the epigenetic variation and its correlation with phenotypic variation in plants exposed to natural and manipulated environmental variability. Genome-wide methylation profiling using methylation-sensitive amplified fragment length polymorphism (MSAP) revealed considerable DNA methylation polymorphisms within and between natural populations. Plants of different source populations not only underwent significant morphological changes in common garden environments, but also underwent a genome-wide epigenetic reprogramming in response to different treatments. Methylation alterations associated with response to different water availability were detected in 78.2% (169/216) of common garden induced polymorphic sites, demonstrating the environmental sensitivity and flexibility of the epigenetic regulatory system. These data provide evidence of the correlation between epigenetic reprogramming and the reversible phenotypic response of alligator weed to particular environmental factors. © 2010 Blackwell Publishing Ltd.

  11. Rapid Convergence of Energy and Free Energy Profiles with Quantum Mechanical Size in Quantum Mechanical-Molecular Mechanical Simulations of Proton Transfer in DNA.

    Science.gov (United States)

    Das, Susanta; Nam, Kwangho; Major, Dan Thomas

    2018-03-13

    In recent years, a number of quantum mechanical-molecular mechanical (QM/MM) enzyme studies have investigated the dependence of reaction energetics on the size of the QM region using energy and free energy calculations. In this study, we revisit the question of QM region size dependence in QM/MM simulations within the context of energy and free energy calculations using a proton transfer in a DNA base pair as a test case. In the simulations, the QM region was treated with a dispersion-corrected AM1/d-PhoT Hamiltonian, which was developed to accurately describe phosphoryl and proton transfer reactions, in conjunction with an electrostatic embedding scheme using the particle-mesh Ewald summation method. With this rigorous QM/MM potential, we performed rather extensive QM/MM sampling, and found that the free energy reaction profiles converge rapidly with respect to the QM region size within ca. ±1 kcal/mol. This finding suggests that the strategy of QM/MM simulations with reasonably sized and selected QM regions, which has been employed for over four decades, is a valid approach for modeling complex biomolecular systems. We point to possible causes for the sensitivity of the energy and free energy calculations to the size of the QM region, and potential implications.

  12. Accurate and rapid modeling of iron-bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis.

    Science.gov (United States)

    Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P

    2000-05-01

    Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.

  13. Rapid classification of turmeric based on DNA fingerprint by near-infrared spectroscopy combined with moving window partial least squares-discrimination analysis

    International Nuclear Information System (INIS)

    Kasemsumran, Sumaporn; Suttiwijitpukdee, Nattaporn; Keeratinijakal, Vichein

    2017-01-01

    In this research, near-infrared (NIR) spectroscopy in combination with moving window partial least squares-discrimination analysis (MWPLS-DA) was utilized to discriminate the variety of turmeric based on DNA markers, which correlated to the quantity of curcuminoid. Curcuminoid was used as a marker compound in variety identification due to the most pharmacological properties of turmeric possessed from it. MWPLS-DA optimized informative NIR spectral regions for the fitting and prediction to {-1/1}-coded turmeric varieties, indicating variables in the development of latent variables in discrimination analysis. Consequently, MWPLS-DA benefited in the selection of combined informative NIR spectral regions of 1100 – 1260, 1300 – 1500 and 1880 – 2500 nm for classification modeling of turmeric variety with 148 calibration samples, and yielded the results better than that obtained from a partial least squares-discrimination analysis (PLS-DA) model built by using the whole NIR spectral region. An effective and rapid strategy of using NIR in combination with MWPLS-DA provided the best variety identification results of 100% in both specificity and total accuracy for 48 test samples. (author)

  14. Rapid genotyping with DNA micro-arrays for high-density linkage mapping and QTL mapping in common buckwheat (Fagopyrum esculentum Moench)

    Science.gov (United States)

    Yabe, Shiori; Hara, Takashi; Ueno, Mariko; Enoki, Hiroyuki; Kimura, Tatsuro; Nishimura, Satoru; Yasui, Yasuo; Ohsawa, Ryo; Iwata, Hiroyoshi

    2014-01-01

    For genetic studies and genomics-assisted breeding, particularly of minor crops, a genotyping system that does not require a priori genomic information is preferable. Here, we demonstrated the potential of a novel array-based genotyping system for the rapid construction of high-density linkage map and quantitative trait loci (QTL) mapping. By using the system, we successfully constructed an accurate, high-density linkage map for common buckwheat (Fagopyrum esculentum Moench); the map was composed of 756 loci and included 8,884 markers. The number of linkage groups converged to eight, which is the basic number of chromosomes in common buckwheat. The sizes of the linkage groups of the P1 and P2 maps were 773.8 and 800.4 cM, respectively. The average interval between adjacent loci was 2.13 cM. The linkage map constructed here will be useful for the analysis of other common buckwheat populations. We also performed QTL mapping for main stem length and detected four QTL. It took 37 days to process 178 samples from DNA extraction to genotyping, indicating the system enables genotyping of genome-wide markers for a few hundred buckwheat plants before the plants mature. The novel system will be useful for genomics-assisted breeding in minor crops without a priori genomic information. PMID:25914583

  15. Evaluation of powdery mildew-resistance of grape germplasm and rapid amplified polymorphic DNA markers associated with the resistant trait in Chinese wild Vitis.

    Science.gov (United States)

    Zhang, J; Zhang, Y; Yu, H; Wang, Y

    2014-05-09

    The resistance of wild Vitis germplasm, including Chinese and American wild Vitis and Vitis vinifera cultivars, to powdery mildew (Uncinula necator Burr.) was evaluated for two consecutive years under natural conditions. Most of the Chinese and North American species displayed a resistant phenotype, whereas all of the European species were highly susceptible. The Alachua and Conquistador accessions of Vitis rotundifolia species, which originated in North America, were immune to the disease, while Baihe-35-1, one of the accessions of Vitis pseudoreticulata, showed the strongest resistance among all Chinese accessions evaluated. Three rapid amplified polymorphic DNA (RAPD) markers, OPW02-1756, OPO11-964, and OPY13-661, were obtained after screening 520 random primers among various germplasm, and these markers were found to be associated with powdery mildew resistance in Baihe-35-1 and in some Chinese species, but not in any European species. Analysis of F₁ and F₂ progenies of a cross between resistant Baihe-35-1 and susceptible Carignane (V. vinifera) revealed that the three RAPD markers were linked to the powdery resistant trait in Baihe-35-1 plants. Potential applications of the identified RAPD markers for gene mapping, marker-assisted selection, and breeding were investigated in 168 F₂ progenies of the same cross. Characterization of the resistant phenotype of the selected F₂ seedlings for breeding a new disease-resistant grape cultivar is in progress.

  16. Rapid radiation in spiny lobsters (Palinurus spp) as revealed by classic and ABC methods using mtDNA and microsatellite data.

    Science.gov (United States)

    Palero, Ferran; Lopes, Joao; Abelló, Pere; Macpherson, Enrique; Pascual, Marta; Beaumont, Mark A

    2009-11-09

    Molecular tools may help to uncover closely related and still diverging species from a wide variety of taxa and provide insight into the mechanisms, pace and geography of marine speciation. There is a certain controversy on the phylogeography and speciation modes of species-groups with an Eastern Atlantic-Western Indian Ocean distribution, with previous studies suggesting that older events (Miocene) and/or more recent (Pleistocene) oceanographic processes could have influenced the phylogeny of marine taxa. The spiny lobster genus Palinurus allows for testing among speciation hypotheses, since it has a particular distribution with two groups of three species each in the Northeastern Atlantic (P. elephas, P. mauritanicus and P. charlestoni) and Southeastern Atlantic and Southwestern Indian Oceans (P. gilchristi, P. delagoae and P. barbarae). In the present study, we obtain a more complete understanding of the phylogenetic relationships among these species through a combined dataset with both nuclear and mitochondrial markers, by testing alternative hypotheses on both the mutation rate and tree topology under the recently developed approximate Bayesian computation (ABC) methods. Our analyses support a North-to-South speciation pattern in Palinurus with all the South-African species forming a monophyletic clade nested within the Northern Hemisphere species. Coalescent-based ABC methods allowed us to reject the previously proposed hypothesis of a Middle Miocene speciation event related with the closure of the Tethyan Seaway. Instead, divergence times obtained for Palinurus species using the combined mtDNA-microsatellite dataset and standard mutation rates for mtDNA agree with known glaciation-related processes occurring during the last 2 my. The Palinurus speciation pattern is a typical example of a series of rapid speciation events occurring within a group, with very short branches separating different species. Our results support the hypothesis that recent climate

  17. Proliferating Cell Nuclear Antigen-dependent Rapid Recruitment of Cdt1 and CRL4Cdt2 at DNA-damaged Sites after UV Irradiation in HeLa Cells*

    Science.gov (United States)

    Ishii, Takashi; Shiomi, Yasushi; Takami, Toshihiro; Murakami, Yusuke; Ohnishi, Naho; Nishitani, Hideo

    2010-01-01

    The licensing factor Cdt1 is degraded by CRL4Cdt2 ubiquitin ligase dependent on proliferating cell nuclear antigen (PCNA) during S phase and when DNA damage is induced in G1 phase. Association of both Cdt2 and PCNA with chromatin was observed in S phase and after UV irradiation. Here we used a micropore UV irradiation assay to examine Cdt2 accumulation at cyclobutane pyrimidine dimer-containing DNA-damaged sites in the process of Cdt1 degradation in HeLa cells. Cdt2, present in the nucleus throughout the cell cycle, accumulated rapidly at damaged DNA sites during G1 phase. The recruitment of Cdt2 is dependent on prior PCNA chromatin binding because Cdt2 association was prevented when PCNA was silenced. Cdt1 was also recruited to damaged sites soon after UV irradiation through its PIP-box. As Cdt1 was degraded, the Cdt2 signal at damaged sites was reduced, but PCNA, cyclobutane pyrimidine dimer, and XPA (xeroderma pigmentosum, complementation group A) signals remained at the same levels. These findings suggest that Cdt1 degradation following UV irradiation occurs rapidly at damaged sites due to PCNA chromatin loading and the recruitment of Cdt1 and CRL4Cdt2, before DNA damage repair is completed. PMID:20929861

  18. Magnetic bead/capture DNA/glucose-loaded nanoliposomes for amplifying the glucometer signal in the rapid screening of hepatitis C virus RNA.

    Science.gov (United States)

    Tu, Haijian; Lin, Kun; Lun, Yongzhi; Yu, Liuming

    2018-06-01

    A digital detection strategy based on a portable personal glucometer (PGM) was developed for the simple, rapid, and sensitive detection of hepatitis C virus (HCV) RNA, involving the release of glucose-loaded nanoliposomes due to coupling-site-specific cleavage by the endonuclease BamHI. The glucose-loaded nanoliposomes were synthesized using a reversed-phase evaporation method and provided an amplified signal at the PGM in the presence of HCV RNA. Initially, a 21-mer oligonucleotide complementary to HCV RNA was covalently conjugated to a magnetic bead through the amino group at the 5' end of the oligonucleotide, and then bound to a glucose-loaded liposome by typical carbodiimide coupling at its 3' end. In the presence of the target HCV RNA, the target hybridized with the oligonucleotide to form double-stranded DNA. The symmetrical duplex sequence 5'-GGATCC-3' between guanines was then catalytically cleaved by BamHI, which detached the glucose-loaded liposome from the magnetic bead. Following magnetic separation of the bead, the detached glucose-loaded liposome was lysed using Triton X-100 to release the glucose molecules within it, which were then detected as an amplified signal at the digital PGM. Under optimal conditions, the PGM signal increased with increasing HCV RNA, and displayed a strongly linear dependence on the level of HCV RNA for concentrations ranging from 10 pM to 1.0 μM. The detection limit (LOD) of the system was 1.9 pM. Good reproducibility and favorable specificity were achieved in the analysis of the target HCV RNA. Human serum samples containing HCV RNA were analyzed using this strategy, and the developed sensing platform was observed to yield satisfactory results based on a comparison with the corresponding results from a Cobas ® Amplicor HCV Test Analyzer. Graphical abstract A digital detection strategy utilizing a personal glucometer was developed for the detection of hepatitis C virus RNA. The strategy involved the use of the

  19. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...... efficiency was not optimal (AE = 139.5 %). DNA extraction methods Easy-DNA Invitrogen, MiniMAG® and NucleoSpin® Tissue produced good real-time PCR reproducibility generating standard deviations from 0.3 to 0.8 between replicates....

  20. One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

    Science.gov (United States)

    Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

    2013-01-02

    Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

  1. Rapid decrease of circulating tumor DNA predicted the treatment effect of nivolumab in a lung cancer patient within only 5 days

    Directory of Open Access Journals (Sweden)

    Yuki Iijima

    2017-01-01

    Full Text Available A 77-year-old Japanese man presented to our hospital with a 1-month history of low back pain and was diagnosed as having stage IV EGFR mutation-positive lung adenocarcinoma. After treatment with EGFR tyrosine kinase inhibitor and cytotoxic chemotherapy, nivolumab was started as fourth-line therapy. Remarkable regression of the primary tumor was observed, suggesting high anti-tumor activity of nivolumab. We retrospectively investigated the change in circulating tumor DNA (ctDNA variant allele fractions in serial plasma samples before and after the nivolumab therapy. Targeted sequencing analysis showed tumor-derived TP53R249S and EGFRL858R mutations detectable in plasma, and the timing of decrease was only 5 days, much earlier than the appearance of radiological changes. Overall, these results suggest that ctDNA might reflect tumor burden and might be a surrogate marker of the therapeutic efficacy of immune checkpoint therapy.

  2. A rapid assessment method to estimate the distribution of juvenile Chinook Salmon in tributary habitats using eDNA and occupancy estimation

    Science.gov (United States)

    Matter, A.; Falke, Jeffrey A.; López, J. Andres; Savereide, James W.

    2018-01-01

    Identification and protection of water bodies used by anadromous species are critical in light of increasing threats to fish populations, yet often challenging given budgetary and logistical limitations. Noninvasive, rapid‐assessment, sampling techniques may reduce costs and effort while increasing species detection efficiencies. We used an intrinsic potential (IP) habitat model to identify high‐quality rearing habitats for Chinook Salmon Oncorhynchus tshawytscha and select sites to sample throughout the Chena River basin, Alaska, for juvenile occupancy using an environmental DNA (eDNA) approach. Water samples were collected from 75 tributary sites in 2014 and 2015. The presence of Chinook Salmon DNA in water samples was assessed using a species‐specific quantitative PCR (qPCR) assay. The IP model predicted over 900 stream kilometers in the basin to support high‐quality (IP ≥ 0.75) rearing habitat. Occupancy estimation based on eDNA samples indicated that 80% and 56% of previously unsampled sites classified as high or low IP (IP Salmon DNA from three replicate water samples was high (p = 0.76) but varied with drainage area (km2). A power analysis indicated high power to detect proportional changes in occupancy based on parameter values estimated from eDNA occupancy models, although power curves were not symmetrical around zero, indicating greater power to detect positive than negative proportional changes in occupancy. Overall, the combination of IP habitat modeling and occupancy estimation provided a useful, rapid‐assessment method to predict and subsequently quantify the distribution of juvenile salmon in previously unsampled tributary habitats. Additionally, these methods are flexible and can be modified for application to other species and in other locations, which may contribute towards improved population monitoring and management.

  3. Utility of DNA barcoding for rapid and accurate assessment of bat diversity in Malaysia in the absence of formally described species.

    Science.gov (United States)

    Wilson, J-J; Sing, K-W; Halim, M R A; Ramli, R; Hashim, R; Sofian-Azirun, M

    2014-02-19

    Bats are important flagship species for biodiversity research; however, diversity in Southeast Asia is considerably underestimated in the current checklists and field guides. Incorporation of DNA barcoding into surveys has revealed numerous species-level taxa overlooked by conventional methods. Inclusion of these taxa in inventories provides a more informative record of diversity, but is problematic as these species lack formal description. We investigated how frequently documented, but undescribed, bat taxa are encountered in Peninsular Malaysia. We discuss whether a barcode library provides a means of recognizing and recording these taxa across biodiversity inventories. Tissue was sampled from bats trapped at Pasir Raja, Dungun Terengganu, Peninsular Malaysia. The DNA was extracted and the COI barcode region amplified and sequenced. We identified 9 species-level taxa within our samples, based on analysis of the DNA barcodes. Six specimens matched to four previously documented taxa considered candidate species but currently lacking formal taxonomic status. This study confirms the high diversity of bats within Peninsular Malaysia (9 species in 13 samples) and demonstrates how DNA barcoding allows for inventory and documentation of known taxa lacking formal taxonomic status.

  4. Rapid diagnosis of virulent Pasteurella multocida isolated from farm animals with clinical manifestation of pneumonia respiratory infection using 16S rDNA and KMT1 gene

    Directory of Open Access Journals (Sweden)

    Gamal Mohamedin Hassan

    2016-01-01

    Full Text Available Objective: To characterize intra-isolates variation between clinical isolates of Pasteurella multocida (P. multocida isolated from sheep, cattle and buffalo at molecular level to check the distribution of pneumonia and hemorrhagic septicemia in some regions of Fayoum, Egypt. Methods: These isolates were obtained from various locations in the Fayoum Governorate, Egypt and they were identified by amplifying 16S rDNA and KMT1 genes using their DNA as a template in PCR reaction. Results: The results demonstrated that the five selective isolates of P. multocida had similar size of PCR products that generated one band of 16S rDNA having 1 471 bp and KMT1 gene having 460 bp. The phylogenetic tree and similarity of the five selective isolates of P. multocida which were collected from GenBank database were calculated and analyzed for the nucleotide sequence of 16S rDNA and KMT1 genes. The sequencing result of 16S rRNA gene product (1 471 bp for the five selective isolates of P. multocida showed that the isolates of sheep (FUP2 shared 94.08%, 88.10% homology with the buffalo isolate (FUP8 and cattle isolate (FUP9 respectively, whereas, the buffalo isolate (FUP5 shared 98.18% and 94.40% homology with the cattle isolates (FUP12 and FUP9. Conclusions: The results indicated the relationships of P. multocida isolated from buffalo and cattle rather than the close relationships between P. multocida isolated from cattle and sheep. Diagnosis of P. multocida by 16S rDNA and KMT1 gene sequences was important to determine the antigen that is responsible for protective cover within the same group of animals and to help for the production of new vaccines for the control of microbial infection for domestic animals.

  5. 大豆种子DNA快速提取方法的改良及应用%Improvement and application of the rapid DNA extraction method from Soybean Seeds

    Institute of Scientific and Technical Information of China (English)

    朱振雷; 束永俊; 李勇; 柏锡; 才华; 纪巍; 朱延明

    2009-01-01

    High-quality DNA is an important base of molecular biology manipulation, such as gene cloning. There are lots of protein and fat in the soybean seeds, so the DNA extracted from them by using traditional methods is very difficult to achieve quality requirements of experiments. This study improved the SDS extraction buffer by adding NP-40 and Tween-20, and established a rapid DNA extraction method that is suitable for soybean seeds. The DNA extraction by the optimized SDS extraction method has high-quality, and the values of OD_(260)/OD_(280) ranged from 1.809 to 1.916, that means non-protein and RNA pollution. The DNA extraction method was validated by gene cloning and genotyping, and the results showed that it could be used for soybean gene cloning and molecular markers.%高质量的DNA是进行基因克隆等分子生物学试验的前提条件.因大豆种子中蛋白质和油脂含量丰富,利用传统方法提取DNA质量很难达到试验要求.研究在SDS提取液的基础上.通过添加表面活性剂NP-40和Tween-20,优化出一种适合于大豆种子DNA快速提取的方法.优化后的SDS方法提取的DNA质量较高.OD_(260)/OD_(280)在1.809~1.916之间,无蛋白质和RNA污染.对该方法提取的DNA进行了基因克隆和分子标记的试验验证,结果表明,它们能够用于大豆基因克隆、分子标记.

  6. Rapid assessment of repair of ultraviolet DNA damage with a modified host-cell reactivation assay using a luciferase reporter gene and correlation with polymorphisms of DNA repair genes in normal human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Qiao Yawei; Spitz, Margaret R.; Guo Zhaozheng; Hadeyati, Mohammad; Grossman, Lawrence; Kraemer, Kenneth H.; Wei Qingyi

    2002-11-30

    As DNA repair plays an important role in genetic susceptibility to cancer, assessment of the DNA repair phenotype is critical for molecular epidemiological studies of cancer. In this report, we compared use of the luciferase (luc) reporter gene in a host-cell reactivation (HCR) (LUC) assay of repair of ultraviolet (UV) damage to DNA to use of the chloramphenicol (cat) gene-based HCR (CAT) assay we used previously for case-control studies. We performed both the assays on cryopreserved lymphocytes from 102 healthy non-Hispanic white subjects. There was a close correlation between DNA repair capacity (DRC) as measured by the LUC and CAT assays. Although these two assays had similar variation, the LUC assay was faster and more sensitive. We also analyzed the relationship between DRC and the subjects' previously determined genotypes for four polymorphisms of two nucleotide-excision repair (NER) genes (in intron 9 of xeroderma pigmentosum (XP) C and exons 6, 10 and 23 of XPD) and one polymorphism of a base-excision repair gene in exon 10 of X-ray complementing group 1 (XRCC1). The DRC was significantly lower in subjects homozygous for one or more polymorphisms of the two NER genes than in subjects with other genotypes (P=0.010). In contrast, the polymorphic XRCC1 allele had no significant effect on DRC. These results suggest that the post-UV LUC assay measures NER phenotype and that polymorphisms of XPC and XPD genes modulate DRC. For population studies of the DNA repair phenotype, many samples need to be evaluated, and so the LUC assay has several advantages over the CAT assay: the LUC assay was more sensitive, had less variation, was not radioactive, was easier to perform, and required fewer cryopreserved cells. These features make the LUC-based HCR assay suitable for molecular epidemiological studies.

  7. Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps

    Directory of Open Access Journals (Sweden)

    Manjula Pandey

    2014-03-01

    Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.

  8. Rapid, sensitive, and selective fluorescent DNA detection using iron-based metal-organic framework nanorods: Synergies of the metal center and organic linker.

    Science.gov (United States)

    Tian, Jingqi; Liu, Qian; Shi, Jinle; Hu, Jianming; Asiri, Abdullah M; Sun, Xuping; He, Yuquan

    2015-09-15

    Considerable recent attention has been paid to homogeneous fluorescent DNA detection with the use of nanostructures as a universal "quencher", but it still remains a great challenge to develop such nanosensor with the benefits of low cost, high speed, sensitivity, and selectivity. In this work, we report the use of iron-based metal-organic framework nanorods as a high-efficient sensing platform for fluorescent DNA detection. It only takes about 4 min to complete the whole "mix-and-detect" process with a low detection limit of 10 pM and a strong discrimination of single point mutation. Control experiments reveal the remarkable sensing behavior is a consequence of the synergies of the metal center and organic linker. This work elucidates how composition control of nanostructures can significantly impact their sensing properties, enabling new opportunities for the rational design of functional materials for analytical applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Direct immobilization of DNA probes on non-modified plastics by UV irradiation and integration in microfluidic devices for rapid bioassay

    DEFF Research Database (Denmark)

    Yi, Sun; Perch-Nielsen, Ivan R.; Dufva, Martin

    2012-01-01

    that simple UV irradiation can be used to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on many different types of plastics without any surface modification. On average, five- and fourfold improvement in immobilization and hybridization efficiency have been achieved compared to surface......DNA microarrays have become one of the most powerful tools in the field of genomics and medical diagnosis. Recently, there has been increased interest in combining microfluidics with microarrays since this approach offers advantages in terms of portability, reduced analysis time, low consumption...... of reagents, and increased system integration. Polymers are widely used for microfluidic systems, but fabrication of microarrays on such materials often requires complicated chemical surface modifications, which hinders the integration of microarrays into microfluidic systems. In this paper, we demonstrate...

  10. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  11. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  12. Rapid isolation of microsatellite DNAs and identification of polymorphic mitochondrial DNA regions in the fish rotan (Perccottus glenii) invading European Russia

    Science.gov (United States)

    King, Timothy L.; Eackles, Michael S.; Reshetnikov, Andrey N.

    2015-01-01

    Human-mediated translocations and subsequent large-scale colonization by the invasive fish rotan (Perccottus glenii Dybowski, 1877; Perciformes, Odontobutidae), also known as Amur or Chinese sleeper, has resulted in dramatic transformations of small lentic ecosystems. However, no detailed genetic information exists on population structure, levels of effective movement, or relatedness among geographic populations of P. glenii within the European part of the range. We used massively parallel genomic DNA shotgun sequencing on the semiconductor-based Ion Torrent Personal Genome Machine (PGM) sequencing platform to identify nuclear microsatellite and mitochondrial DNA sequences in P. glenii from European Russia. Here we describe the characterization of nine nuclear microsatellite loci, ascertain levels of allelic diversity, heterozygosity, and demographic status of P. glenii collected from Ilev, Russia, one of several initial introduction points in European Russia. In addition, we mapped sequence reads to the complete P. glenii mitochondrial DNA sequence to identify polymorphic regions. Nuclear microsatellite markers developed for P. glenii yielded sufficient genetic diversity to: (1) produce unique multilocus genotypes; (2) elucidate structure among geographic populations; and (3) provide unique perspectives for analysis of population sizes and historical demographics. Among 4.9 million filtered P. glenii Ion Torrent PGM sequence reads, 11,304 mapped to the mitochondrial genome (NC_020350). This resulted in 100 % coverage of this genome to a mean coverage depth of 102X. A total of 130 variable sites were observed between the publicly available genome from China and the studied composite mitochondrial genome. Among these, 82 were diagnostic and monomorphic between the mitochondrial genomes and distributed among 15 genome regions. The polymorphic sites (N = 48) were distributed among 11 mitochondrial genome regions. Our results also indicate that sequence reads generated

  13. Accurate and rapid modeling of iron–bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis

    OpenAIRE

    Harsch, Andreas; Marzilli, Lisa A.; Bunt, Richard C.; Stubbe, Joanne; Vouros, Paul

    2000-01-01

    Bleomycin B2 (BLM) in the presence of iron [Fe(II)] and O2 catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe–BLM was incorporated into each an...

  14. Layer-by-Layer-Assembled AuNPs-Decorated First-Generation Poly(amidoamine) Dendrimer with Reduced Graphene Oxide Core as Highly Sensitive Biosensing Platform with Controllable 3D Nanoarchitecture for Rapid Voltammetric Analysis of Ultratrace DNA Hybridization.

    Science.gov (United States)

    Jayakumar, Kumarasamy; Camarada, María Belén; Dharuman, Venkataraman; Rajesh, Rajendiran; Venkatesan, Rengarajan; Ju, Huangxian; Maniraj, Mahalingam; Rai, Abhishek; Barman, Sudipta Roy; Wen, Yangping

    2018-06-12

    The structure and electrochemical properties of layer-by-layer-assembled gold nanoparticles (AuNPs)-decorated first-generation (G1) poly(amidoamine) dendrimer (PD) with reduced graphene oxide (rGO) core as a highly sensitive and label-free biosensing platform with a controllable three-dimensional (3D) nanoarchitecture for the rapid voltammetric analysis of DNA hybridization at ultratrace levels were characterized. Mercaptopropinoic acid (MPA) was self-assembled onto Au substrate, then GG1PD formed by the covalent functionalization between the amino terminals of G1PD and carboxyl terminals of rGO was covalently linked onto MPA, and finally AuNPs were decorated onto GG1PD by strong physicochemical interaction between AuNPs and -OH of rGO in GG1PD, which was characterized through different techniques and confirmed by computational calculation. This 3D controllable thin-film electrode was optimized and evaluated using [Fe(CN) 6 ] 3-/4- as the redox probe and employed to covalently immobilize thiol-functionalized single-stranded DNA as biorecognition element to form the DNA nanobiosensor, which achieved fast, ultrasensitive, and high-selective differential pulse voltammetric analysis of DNA hybridization in a linear range from 1 × 10 -6 to 1 × 10 -13 g m -1 with a low detection limit of 9.07 × 10 -14 g m -1 . This work will open a new pathway for the controllable 3D nanoarchitecture of the layer-by-layer-assembled metal nanoparticles-functionalized lower-generation PD with two-dimensional layered nanomaterials as cores that can be employed as ultrasensitive and label-free nanobiodevices for the fast diagnosis of specific genome diseases in the field of biomedicine.

  15. Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene

    DEFF Research Database (Denmark)

    Candiloro, Ida Lm; Mikeska, Thomas; Hokland, Peter

    2008-01-01

    ABSTRACT: BACKGROUND: Methylation-sensitive high resolution melting (MS-HRM) methodology is able to recognise heterogeneously methylated sequences by their characteristic melting profiles. To further analyse heterogeneously methylated sequences, we adopted a digital approach to MS-HRM (dMS-HRM) t......ABSTRACT: BACKGROUND: Methylation-sensitive high resolution melting (MS-HRM) methodology is able to recognise heterogeneously methylated sequences by their characteristic melting profiles. To further analyse heterogeneously methylated sequences, we adopted a digital approach to MS-HRM (d......MS-HRM) that involves the amplification of single templates after limiting dilution to quantify and to determine the degree of methylation. We used this approach to study methylation of the CDKN2B (p15) cell cycle progression inhibitor gene which is inactivated by DNA methylation in haematological malignancies...... the methylated alleles and assess the degree of methylation. Direct sequencing of selected dMS-HRM products was used to determine the exact DNA methylation pattern and confirmed the degree of methylation estimated by dMS-HRM. CONCLUSION: dMS-HRM is a powerful technique for the analysis of methylation in CDKN2B...

  16. Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

    Science.gov (United States)

    Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

    2013-06-24

    Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable

  17. Rapid Amplification of the 5'cDNA End of Reindeer Ghrelin by Inverse Nested PCR%反向嵌套PCR技术扩增驯鹿Ghrelin cDNA 5'末端序列

    Institute of Scientific and Technical Information of China (English)

    朱雪敏; 张义; 张剑平; 杨银凤

    2008-01-01

    为了研究Ghrelin在驯鹿生长发育过程中的作用和功能,以驯鹿为研究对象,采用反向嵌套PCR RACE技术原理,根据已知的序列设计1条5'末端磷酸化的特异性反转录引物和2对特异性反向嵌套PCR引物,首先进行反转录(RT),然后将反转录成的cDNA进行环化,最后进行反向嵌套巢式PCR,成功地扩增了驯鹿Ghrelin cDNA 5'末端序列.与锚定PCR相比,反向嵌套PCR法具有特异性强、扩增效率高等优点,是一种非常有效的扩增cDNA 5'末端序列的方法.

  18. Application of a Novel and Automated Branched DNA in Situ Hybridization Method for the Rapid and Sensitive Localization of mRNA Molecules in Plant Tissues

    Directory of Open Access Journals (Sweden)

    Andrew J. Bowling

    2014-04-01

    Full Text Available Premise of the study: A novel branched DNA detection technology, RNAscope in situ hybridization (ISH, originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. Methods and Results: Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC and phosphoenolpyruvate carboxykinase (PEPCK. Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. Conclusions: RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.

  19. Dietary restriction but not angiotensin II type 1 receptor blockade improves DNA damage-related vasodilator dysfunction in rapidly aging Ercc1Δ/- mice.

    Science.gov (United States)

    Wu, Haiyan; van Thiel, Bibi S; Bautista-Niño, Paula K; Reiling, Erwin; Durik, Matej; Leijten, Frank P J; Ridwan, Yanto; Brandt, Renata M C; van Steeg, Harry; Dollé, Martijn E T; Vermeij, Wilbert P; Hoeijmakers, Jan H J; Essers, Jeroen; van der Pluijm, Ingrid; Danser, A H Jan; Roks, Anton J M

    2017-08-01

    DNA damage is an important contributor to endothelial dysfunction and age-related vascular disease. Recently, we demonstrated in a DNA repair-deficient, prematurely aging mouse model ( Ercc1 Δ/- mice) that dietary restriction (DR) strongly increases life- and health span, including ameliorating endothelial dysfunction, by preserving genomic integrity. In this mouse mutant displaying prominent accelerated, age-dependent endothelial dysfunction we investigated the signaling pathways involved in improved endothelium-mediated vasodilation by DR, and explore the potential role of the renin-angiotensin system (RAS). Ercc1 Δ/- mice showed increased blood pressure and decreased aortic relaxations to acetylcholine (ACh) in organ bath experiments. Nitric oxide (NO) signaling and phospho-Ser 1177 -eNOS were compromised in Ercc1 Δ / - DR improved relaxations by increasing prostaglandin-mediated responses. Increase of cyclo-oxygenase 2 and decrease of phosphodiesterase 4B were identified as potential mechanisms. DR also prevented loss of NO signaling in vascular smooth muscle cells and normalized angiotensin II (Ang II) vasoconstrictions, which were increased in Ercc1 Δ/- mice. Ercc1 Δ/ - mutants showed a loss of Ang II type 2 receptor-mediated counter-regulation of Ang II type 1 receptor-induced vasoconstrictions. Chronic losartan treatment effectively decreased blood pressure, but did not improve endothelium-dependent relaxations. This result might relate to the aging-associated loss of treatment efficacy of RAS blockade with respect to endothelial function improvement. In summary, DR effectively prevents endothelium-dependent vasodilator dysfunction by augmenting prostaglandin-mediated responses, whereas chronic Ang II type 1 receptor blockade is ineffective. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  20. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  1. Evaluation of genetic diversity in Chinese kale (Brassica oleracea L. var. alboglabra Bailey) by using rapid amplified polymorphic DNA and sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Zhang, J; Zhang, L G

    2014-02-14

    Chinese kale is an original Chinese vegetable of the Cruciferae family. To select suitable parents for hybrid breeding, we thoroughly analyzed the genetic diversity of Chinese kale. Random amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) molecular markers were used to evaluate the genetic diversity across 21 Chinese kale accessions from AVRDC and Guangzhou in China. A total of 104 bands were detected by 11 RAPD primers, of which 66 (63.5%) were polymorphic, and 229 polymorphic bands (68.4%) were observed in 335 bands amplified by 17 SRAP primer combinations. The dendrogram showed the grouping of the 21 accessions into 4 main clusters based on RAPD data, and into 6 clusters based on SRAP and combined data (RAPD + SRAP). The clustering of accessions based on SRAP data was consistent with petal colors. The Mantel test indicated a poor fit for the RAPD and SRAP data (r = 0.16). These results have an important implication for Chinese kale germplasm characterization and improvement.

  2. DNA preservation in silk.

    Science.gov (United States)

    Liu, Yawen; Zheng, Zhaozhu; Gong, He; Liu, Meng; Guo, Shaozhe; Li, Gang; Wang, Xiaoqin; Kaplan, David L

    2017-06-27

    The structure of DNA is susceptible to alterations at high temperature and on changing pH, irradiation and exposure to DNase. Options to protect and preserve DNA during storage are important for applications in genetic diagnosis, identity authentication, drug development and bioresearch. In the present study, the stability of total DNA purified from human dermal fibroblast cells, as well as that of plasmid DNA, was studied in silk protein materials. The DNA/silk mixtures were stabilized on filter paper (silk/DNA + filter) or filter paper pre-coated with silk and treated with methanol (silk/DNA + PT-filter) as a route to practical utility. After air-drying and water extraction, 50-70% of the DNA and silk could be retrieved and showed a single band on electrophoretic gels. 6% silk/DNA + PT-filter samples provided improved stability in comparison with 3% silk/DNA + filter samples and DNA + filter samples for DNA preservation, with ∼40% of the band intensity remaining at 37 °C after 40 days and ∼10% after exposure to UV light for 10 hours. Quantitative analysis using the PicoGreen assay confirmed the results. The use of Tris/borate/EDTA (TBE) buffer enhanced the preservation and/or extraction of the DNA. The DNA extracted after storage maintained integrity and function based on serving as a functional template for PCR amplification of the gene for zinc finger protein 750 (ZNF750) and for transgene expression of red fluorescence protein (dsRed) in HEK293 cells. The high molecular weight and high content of a crystalline beta-sheet structure formed on the coated surfaces likely accounted for the preservation effects observed for the silk/DNA + PT-filter samples. Although similar preservation effects were also obtained for lyophilized silk/DNA samples, the rapid and simple processing available with the silk-DNA-filter membrane system makes it appealing for future applications.

  3. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Science.gov (United States)

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

  4. 5′ Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice

    Directory of Open Access Journals (Sweden)

    Eric Waltari

    2018-03-01

    Full Text Available Using 5′ rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM, and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

  5. 5' Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice.

    Science.gov (United States)

    Waltari, Eric; Jia, Manxue; Jiang, Caroline S; Lu, Hong; Huang, Jing; Fernandez, Cristina; Finzi, Andrés; Kaufmann, Daniel E; Markowitz, Martin; Tsuji, Moriya; Wu, Xueling

    2018-01-01

    Using 5' rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR) repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM), and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

  6. DNA repair and cancer

    International Nuclear Information System (INIS)

    Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha

    2012-01-01

    DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)

  7. Rapid detection and quantification of cell free cytomegalovirus by a high-speed centrifugation-based microculture assay: comparison to longitudinally analyzed viral DNA load and pp67 late transcript during lactation.

    Science.gov (United States)

    Hamprecht, Klaus; Witzel, Simone; Maschmann, Jens; Dietz, Klaus; Baumeister, Andrea; Mikeler, Elfriede; Goelz, Rangmar; Speer, Christian P; Jahn, Gerhard

    2003-12-01

    Human cytomegalovirus (HCMV) is reactivated in nearly every seropositive breastfeeding mother during lactation [Lancet 357 (2001) 513]. Conventional tissue culture (TC) and low-speed centrifugation-enhanced microtiter culture methods are not able to detect HCMV from milk during all stages of lactation. Development of a sensitive and quantitative microculture technique to describe the dynamics of HCMV reactivation in different milk compartments during lactation. Milk samples were collected longitudinally from seropositive breastfeeding mothers of preterm infants. Native milk samples were separated into fraction 1 (aqueous extract of milk fat), fraction 2 (cell and fat free milk whey) and fraction 3 (milk cells). Each of these fractions was screened qualitatively (TC, nPCR, pp67 late mRNA) and quantitatively (high-speed centrifugation-based microculture, quantitative PCR). Prior to low-speed centrifugation-enhanced inoculation, virus particles were concentrated by high-speed centrifugation (60 min at 50,000 x g, 4 degrees C). Using fraction 2 we were able to describe the dynamics of viral reactivation during lactation. We present the course of the quantitative virolactia and DNAlactia and qualitative detection of HCMV pp67 late mRNA in milk whey of four mothers (three transmitters and one non-transmitter). In all these cases virolactia described an unimodal and self limited course. Peak levels of virolactia for transmitters (T1: day 44; T2: day 43; T3: day 50) were closely related the onset of viruria of the corresponding preterm infants (U1: day 39; U2a/U2b: day 44/57; U3: day 60). The courses of viral load coincidence with the courses of DNA load. We present a rapid and highly sensitive microculture method for the quantification of cell free HCMV from milk whey and aqueous extracts from milk fat. Viral reactivation during lactation describes an unimodal course. Our findings have strong implications for quality control of any virus inactivation procedure.

  8. Enzymatic Ligation of Large Biomolecules to DNA

    DEFF Research Database (Denmark)

    Sørensen, Rasmus Schøler; Okholm, Anders Hauge; Schaffert, David Henning

    2013-01-01

    The ability to synthesize, characterize, and manipulate DNA forms the foundation of a range of advanced disciplines including genomics, molecular biology, and biomolecular engineering. In particular for the latter field, DNA has proven useful as a structural or functional component in nanoscale s....... As a proof of principle, parallelly labeled oligonucleotides were used to produce nanopatterned DNA origami structures, demonstrating rapid and versatile incorporation of non-DNA components into DNA nanoarchitectures....

  9. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  10. Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

    Science.gov (United States)

    Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

    2017-02-01

    The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

  11. Photochemical Acceleration of DNA Strand Displacement by Using Ultrafast DNA Photo-crosslinking.

    Science.gov (United States)

    Nakamura, Shigetaka; Hashimoto, Hirokazu; Kobayashi, Satoshi; Fujimoto, Kenzo

    2017-10-18

    DNA strand displacement is an essential reaction in genetic recombination, biological processes, and DNA nanotechnology. In particular, various DNA nanodevices enable complicated calculations. However, it takes time before the output is obtained, so acceleration of DNA strand displacement is required for a rapid-response DNA nanodevice. Herein, DNA strand displacement by using DNA photo-crosslinking to accelerate this displacement is evaluated. The DNA photo-crosslinking of 3-cyanovinylcarbazole ( CNV K) was accelerated at least 20 times, showing a faster DNA strand displacement. The rate of photo-crosslinking is a key factor and the rate of DNA strand displacement is accelerated through ultrafast photo-crosslinking. The rate of DNA strand displacement was regulated by photoirradiation energy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. DNA Camouflage

    Science.gov (United States)

    2016-01-08

    1 DNA Camouflage Supplementary Information Bijan Zakeri1,2*, Timothy K. Lu1,2*, Peter A. Carr2,3* 1Department of Electrical Engineering and...ll.mit.edu). Distribution A: Public Release   2 Supplementary Figure 1 DNA camouflage with the 2-state device. (a) In the presence of Cre, DSD-2[α...10 1 + Cre 1 500 1,000 length (bp) chromatogram alignment template − Cre   4 Supplementary Figure 3 DNA camouflage with a switchable

  13. The future of forensic DNA analysis

    Science.gov (United States)

    Butler, John M.

    2015-01-01

    The author's thoughts and opinions on where the field of forensic DNA testing is headed for the next decade are provided in the context of where the field has come over the past 30 years. Similar to the Olympic motto of ‘faster, higher, stronger’, forensic DNA protocols can be expected to become more rapid and sensitive and provide stronger investigative potential. New short tandem repeat (STR) loci have expanded the core set of genetic markers used for human identification in Europe and the USA. Rapid DNA testing is on the verge of enabling new applications. Next-generation sequencing has the potential to provide greater depth of coverage for information on STR alleles. Familial DNA searching has expanded capabilities of DNA databases in parts of the world where it is allowed. Challenges and opportunities that will impact the future of forensic DNA are explored including the need for education and training to improve interpretation of complex DNA profiles. PMID:26101278

  14. DNA:DNA hybridization studies on the pink-pigmented facultative methylotrophs.

    Science.gov (United States)

    Hood, D W; Dow, C S; Green, P N

    1987-03-01

    The genomic relatedness among 36 strains of pink-pigmented facultatively methylotrophic bacteria (PPFMs) was estimated by determination of DNA base composition and by DNA:DNA hybridization studies. A reproducible hybridization system was developed for the rapid analysis of multiple DNA samples. Results indicated that the PPFMs comprise four major and several minor homology groups, and that they should remain grouped in a single genus, Methylobacterium.

  15. DNA glue

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  16. Hyperstretching DNA

    NARCIS (Netherlands)

    Schakenraad, Koen; Biebricher, Andreas S.; Sebregts, Maarten; Ten Bensel, Brian; Peterman, Erwin J.G.; Wuite, Gijs J L; Heller, Iddo; Storm, Cornelis; Van Der Schoot, Paul

    2017-01-01

    The three-dimensional structure of DNA is highly susceptible to changes by mechanical and biochemical cues in vivo and in vitro. In particular, large increases in base pair spacing compared to regular B-DNA are effected by mechanical (over)stretching and by intercalation of compounds that are widely

  17. Construction and evaluation of normalized cDNA libraries enriched with full-length sequences for rapid discovery of new genes from Sisal (Agave sisalana Perr.) different developmental stages.

    Science.gov (United States)

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-10-12

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing.

  18. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  19. DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Castelino, J

    1993-12-31

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

  20. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  1. DNA data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  2. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  3. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  4. DNA isolation from rat tail or ear

    NARCIS (Netherlands)

    Cuppen, E.

    2010-01-01

    This protocol describes a rapid procedure for isolating DNA from rat tail or ear punches. The simplest version of the protocol can be scaled for use in 96-well (deep-well) plates. The quality of the DNA is sufficient for any polymerase chain reaction (PCR)-based genotyping approach.

  5. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  6. A versatile non-radioactive assay for DNA methyltransferase activity and DNA binding

    Science.gov (United States)

    Frauer, Carina; Leonhardt, Heinrich

    2009-01-01

    We present a simple, non-radioactive assay for DNA methyltransferase activity and DNA binding. As most proteins are studied as GFP fusions in living cells, we used a GFP binding nanobody coupled to agarose beads (GFP nanotrap) for rapid one-step purification. Immobilized GFP fusion proteins were subsequently incubated with different fluorescently labeled DNA substrates. The absolute amounts and molar ratios of GFP fusion proteins and bound DNA substrates were determined by fluorescence spectroscopy. In addition to specific DNA binding of GFP fusion proteins, the enzymatic activity of DNA methyltransferases can also be determined by using suicide DNA substrates. These substrates contain the mechanism-based inhibitor 5-aza-dC and lead to irreversible covalent complex formation. We obtained covalent complexes with mammalian DNA methyltransferase 1 (Dnmt1), which were resistant to competition with non-labeled canonical DNA substrates, allowing differentiation between methyltransferase activity and DNA binding. By comparison, the Dnmt1C1229W catalytic site mutant showed DNA-binding activity, but no irreversible covalent complex formation. With this assay, we could also confirm the preference of Dnmt1 for hemimethylated CpG sequences. The rapid optical read-out in a multi-well format and the possibility to test several different substrates in direct competition allow rapid characterization of sequence-specific binding and enzymatic activity. PMID:19129216

  7. Rapid shallow breathing

    Science.gov (United States)

    Tachypnea; Breathing - rapid and shallow; Fast shallow breathing; Respiratory rate - rapid and shallow ... Shallow, rapid breathing has many possible medical causes, including: Asthma Blood clot in an artery in the ...

  8. Effects of radiation on DNA

    International Nuclear Information System (INIS)

    Medina, V.F.O.

    1978-01-01

    Irradiation has been shown to depress DNA (deoxyribonucleic acid) synthesis resulting in deficient DNA synthesis. In one experiment, Hela S 3 cells completed the next division after a dose of 500 rads to 200 kw X-rays. Another experiment showed that the amount of DNA synthesized was dependent on the stage in the generation cycle at which the cells are irradiated (Giffites and Tolmach, 1975). DNA synthesis was measured by radioactive thymidine incorporation. The smallest deficiency (20-35%) after a dose of 500 rad X-ray was observed in Hela S 3 cells irradiated in early G 1 or early G 2 , while the greatest deficiency (55-70*) after 500 rad X-ray was found in cells irradiated at mitosis or at the Gsub(1)/S transition. Using velocity sedimentation in alkaline gradients of the DNA from hamster, Elkind, et al 1972, studied repair processes as a function of X-ray dose. DNA containing material released by alkaline lysis was found initially contained in a complex-containing lipid, the sedimentation of which was anomalous relative to denatured RNA from unirradated cells. Doses of X-rays small enough to be in the range that permits high survival (100-800 rads) speed the resolution of single-stranded DNA from this DNA complex, giving rise to a species having a number average molecular weight of 2 x 10 8 daltons. Larger doses greater than 1000 to 2000 rads resulted in a degradation of these DNA strands. Incubation after irradiation resulted in the rapid repair of damage, although the rate of repair of damage to the complex resulted in a reassociation of lipid and DNA. This evidence supports the possibility that a large DNA-membrane structure is a principal target of radiation

  9. Mechanical design of DNA nanostructures

    Science.gov (United States)

    Castro, Carlos E.; Su, Hai-Jun; Marras, Alexander E.; Zhou, Lifeng; Johnson, Joshua

    2015-03-01

    Structural DNA nanotechnology is a rapidly emerging field that has demonstrated great potential for applications such as single molecule sensing, drug delivery, and templating molecular components. As the applications of DNA nanotechnology expand, a consideration of their mechanical behavior is becoming essential to understand how these structures will respond to physical interactions. This review considers three major avenues of recent progress in this area: (1) measuring and designing mechanical properties of DNA nanostructures, (2) designing complex nanostructures based on imposed mechanical stresses, and (3) designing and controlling structurally dynamic nanostructures. This work has laid the foundation for mechanically active nanomachines that can generate, transmit, and respond to physical cues in molecular systems.Structural DNA nanotechnology is a rapidly emerging field that has demonstrated great potential for applications such as single molecule sensing, drug delivery, and templating molecular components. As the applications of DNA nanotechnology expand, a consideration of their mechanical behavior is becoming essential to understand how these structures will respond to physical interactions. This review considers three major avenues of recent progress in this area: (1) measuring and designing mechanical properties of DNA nanostructures, (2) designing complex nanostructures based on imposed mechanical stresses, and (3) designing and controlling structurally dynamic nanostructures. This work has laid the foundation for mechanically active nanomachines that can generate, transmit, and respond to physical cues in molecular systems. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr07153k

  10. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  11. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  12. Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

    Energy Technology Data Exchange (ETDEWEB)

    Winston Chen, C.H.; Taranenko, N.I.; Zhu, Y.F.; Chung, C.N.; Allman, S.L.

    1997-03-01

    Since laser mass spectrometry has the potential for achieving very fast DNA analysis, the authors recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Snager`s enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. The preliminary results indicate laser mass spectrometry can possibly be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, the authors applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

  13. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson

    2013-01-01

    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  14. Template preparation for rapid PCR in Colletotrichum lindemuthianum

    Directory of Open Access Journals (Sweden)

    Roca M. Gabriela

    2003-01-01

    Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.

  15. A quick DNA extraction protocol: Without liquid nitrogen in ambient ...

    African Journals Online (AJOL)

    Marker assisted selection is an effective technique for quality traits selection in breeding program which are impossible by visual observation. Marker assisted selection in early generation requires rapid DNA extraction protocol for large number of samples in a low cost approach. A rapid and inexpensive DNA extraction ...

  16. DNA vaccines for aquacultured fish

    DEFF Research Database (Denmark)

    Lorenzen, Niels; LaPatra, S.E.

    2005-01-01

    of licensing and public acceptance of the technology. The potential benefits of DNA vaccines for farmed fish include improved animal welfare, reduced environmental impacts of aquaculture activities, increased food quality and quantity, and more sustainable production. Testing under commercial production......Deoxyribonucleic acid (DNA) vaccination is based on the administration of the gene encoding the vaccine antigen, rather than the antigen itself. Subsequent expression of the antigen by cells in the vaccinated hosts triggers the host immune system. Among the many experimental DNA vaccines tested...... in various animal species as well as in humans, the vaccines against rhabdovirus diseases in fish have given some of the most promising results. A single intramuscular (IM) injection of microgram amounts of DNA induces rapid and long-lasting protection in farmed salmonids against economically important...

  17. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)

    RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...

  18. Use of DNA markers in forest tree improvement research

    Science.gov (United States)

    D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

    1992-01-01

    DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

  19. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  20. DNA-nuclear matrix interactions and ionizing radiation sensitivity

    International Nuclear Information System (INIS)

    Schwartz, J.L.; Chicago Univ., IL; Vaughan, A.T.M.

    1993-01-01

    The association between inherent ionizing radiation sensitivity and DNA supercoil unwinding in mammalian cells suggests that the DNA-nuclear matrix attachment region (MAR) plays an important role in radiation response. In radioresistant cells, the MAR structure may exist in a more stable, open configuration, limiting DNA unwinding following strand break induction and maintaining DNA ends in close proximity for more rapid and accurate rejoining. In addition, the open configuration at these matrix attachment sites may serve to facilitate rapid DNA processing of breaks by providing (1) sites for repair proteins to collect and (2) energy to drive enzymatic reactions

  1. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    Science.gov (United States)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  2. DNA Vaccines

    Indian Academy of Sciences (India)

    diseases. Keywords. DNA vaccine, immune response, antibodies, infectious diseases. GENERAL .... tein vaccines require expensive virus/protein purification tech- niques as ... sphere continue to remain major health hazards in developing nations. ... significance since it can be produced at a very low cost and can be stored ...

  3. DNA Investigations.

    Science.gov (United States)

    Mayo, Ellen S.; Bertino, Anthony J.

    1991-01-01

    Presents a simulation activity that allow students to work through the exercise of DNA profiling and to grapple with some analytical and ethical questions involving a couple arranging with a surrogate mother to have a baby. Can be used to teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization. (MDH)

  4. Efficient DNA ligation in DNA–RNA hybrid helices by Chlorella virus DNA ligase

    Science.gov (United States)

    Lohman, Gregory J. S.; Zhang, Yinhua; Zhelkovsky, Alexander M.; Cantor, Eric J.; Evans, Thomas C.

    2014-01-01

    Single-stranded DNA molecules (ssDNA) annealed to an RNA splint are notoriously poor substrates for DNA ligases. Herein we report the unexpectedly efficient ligation of RNA-splinted DNA by Chlorella virus DNA ligase (PBCV-1 DNA ligase). PBCV-1 DNA ligase ligated ssDNA splinted by RNA with kcat ≈ 8 x 10−3 s−1 and KM DNA ligase produced only 5′-adenylylated DNA with a 20-fold lower kcat and a KM ≈ 300 nM. The rate of ligation increased with addition of Mn2+, but was strongly inhibited by concentrations of NaCl >100 mM. Abortive adenylylation was suppressed at low ATP concentrations (8, leading to increased product yields. The ligation reaction was rapid for a broad range of substrate sequences, but was relatively slower for substrates with a 5′-phosphorylated dC or dG residue on the 3′ side of the ligation junction. Nevertheless, PBCV-1 DNA ligase ligated all sequences tested with 10-fold less enzyme and 15-fold shorter incubation times than required when using T4 DNA ligase. Furthermore, this ligase was used in a ligation-based detection assay system to show increased sensitivity over T4 DNA ligase in the specific detection of a target mRNA. PMID:24203707

  5. A polarized view on DNA under tension

    Science.gov (United States)

    van Mameren, Joost; Vermeulen, Karen; Wuite, Gijs J. L.; Peterman, Erwin J. G.

    2018-03-01

    In the past decades, sensitive fluorescence microscopy techniques have contributed significantly to our understanding of the dynamics of DNA. The specific labeling of DNA using intercalating dyes has allowed for quantitative measurement of the thermal fluctuations the polymers undergo. On the other hand, recent advances in single-molecule manipulation techniques have unraveled the mechanical and elastic properties of this intricate polymer. Here, we have combined these two approaches to study the conformational dynamics of DNA under a wide range of tensions. Using polarized fluorescence microscopy in conjunction with optical-tweezers-based manipulation of YOYO-intercalated DNA, we controllably align the YOYO dyes using DNA tension, enabling us to disentangle the rapid dynamics of the dyes from that of the DNA itself. With unprecedented control of the DNA alignment, we resolve an inconsistency in reports about the tilted orientation of intercalated dyes. We find that intercalated dyes are on average oriented perpendicular to the long axis of the DNA, yet undergo fast dynamics on the time scale of absorption and fluorescence emission. In the overstretching transition of double-stranded DNA, we do not observe changes in orientation or orientational dynamics of the dyes. Only beyond the overstretching transition, a considerable depolarization is observed, presumably caused by an average tilting of the DNA base pairs. Our combined approach thus contributes to the elucidation of unique features of the molecular dynamics of DNA.

  6. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    OpenAIRE

    Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...

  7. DNA repair

    International Nuclear Information System (INIS)

    Setlow, R.

    1978-01-01

    Some topics discussed are as follows: difficulty in extrapolating data from E. coli to mammalian systems; mutations caused by UV-induced changes in DNA; mutants deficient in excision repair; other postreplication mechanisms; kinds of excision repair systems; detection of repair by biochemical or biophysical means; human mutants deficient in repair; mutagenic effects of UV on XP cells; and detection of UV-repair defects among XP individuals

  8. Optimization of DNA extraction for ISSR studies in Tectona grandis Lf

    African Journals Online (AJOL)

    GRACE

    2006-07-03

    Jul 3, 2006 ... genomic DNA, emphasizing screening of inexpensive, rapid and simple DNA extraction methods (Weishing et al., 1995). Yield and quality of DNA often varies among tree tissue types (Henry, 2001). Besides, purification of genomic DNA in trees is difficult due to co-extraction of high quantities of tannins, ...

  9. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.

    2010-01-01

    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  10. DNA repair

    International Nuclear Information System (INIS)

    Van Zeeland, A.A.

    1984-01-01

    In this chapter a series of DNA repair pathways are discussed which are available to the cell to cope with the problem of DNA damaged by chemical or physical agents. In the case of microorganisms our knowledge about the precise mechanism of each DNA repair pathway and the regulation of it has been improved considerably when mutants deficient in these repair mechanisms became available. In the case of mammalian cells in culture, until recently there were very little repair deficient mutants available, because in almost all mammalian cells in culture at least the diploid number of chromosomes is present. Therefore the frequency of repair deficient mutants in such populations is very low. Nevertheless because replica plating techniques are improving some mutants from Chinese hamsters ovary cells and L5178Y mouse lymphoma cells are now available. In the case of human cells, cultures obtained from patients with certain genetic diseases are available. A number of cells appear to be sensitive to some chemical or physical mutagens. These include cells from patients suffering from xeroderma pigmentosum, Ataxia telangiectasia, Fanconi's anemia, Cockayne's syndrome. However, only in the case of xeroderma pigmentosum cells, has the sensitivity to ultraviolet light been clearly correlated with a deficiency in excision repair of pyrimidine dimers. Furthermore the work with strains obtained from biopsies from man is difficult because these cells generally have low cloning efficiencies and also have a limited lifespan in vitro. It is therefore very important that more repair deficient mutants will become available from established cell lines from human or animal origin

  11. DNA dosimetry assessment for sunscreen genotoxic photoprotection.

    Directory of Open Access Journals (Sweden)

    André Passaglia Schuch

    Full Text Available Due to the increase of solar ultraviolet radiation (UV incidence over the last few decades, the use of sunscreen has been widely adopted for skin protection. However, considering the high efficiency of sunlight-induced DNA lesions, it is critical to improve upon the current approaches that are used to evaluate protection factors. An alternative approach to evaluate the photoprotection provided by sunscreens against daily UV radiation-induced DNA damage is provided by the systematic use of a DNA dosimeter.The Sun Protection Factor for DNA (DNA-SPF is calculated by using specific DNA repair enzymes, and it is defined as the capacity for inhibiting the generation of cyclobutane pyrimidine dimers (CPD and oxidised DNA bases compared with unprotected control samples. Five different commercial brands of sunscreen were initially evaluated, and further studies extended the analysis to include 17 other products representing various formulations and Sun Protection Factors (SPF. Overall, all of the commercial brands of SPF 30 sunscreens provided sufficient protection against simulated sunlight genotoxicity. In addition, this DNA biosensor was useful for rapidly screening the biological protection properties of the various sunscreen formulations.The application of the DNA dosimeter is demonstrated as an alternative, complementary, and reliable method for the quantification of sunscreen photoprotection at the level of DNA damage.

  12. DNA dosimetry assessment for sunscreen genotoxic photoprotection.

    Science.gov (United States)

    Schuch, André Passaglia; Lago, Juliana Carvalhães; Yagura, Teiti; Menck, Carlos Frederico Martins

    2012-01-01

    Due to the increase of solar ultraviolet radiation (UV) incidence over the last few decades, the use of sunscreen has been widely adopted for skin protection. However, considering the high efficiency of sunlight-induced DNA lesions, it is critical to improve upon the current approaches that are used to evaluate protection factors. An alternative approach to evaluate the photoprotection provided by sunscreens against daily UV radiation-induced DNA damage is provided by the systematic use of a DNA dosimeter. The Sun Protection Factor for DNA (DNA-SPF) is calculated by using specific DNA repair enzymes, and it is defined as the capacity for inhibiting the generation of cyclobutane pyrimidine dimers (CPD) and oxidised DNA bases compared with unprotected control samples. Five different commercial brands of sunscreen were initially evaluated, and further studies extended the analysis to include 17 other products representing various formulations and Sun Protection Factors (SPF). Overall, all of the commercial brands of SPF 30 sunscreens provided sufficient protection against simulated sunlight genotoxicity. In addition, this DNA biosensor was useful for rapidly screening the biological protection properties of the various sunscreen formulations. The application of the DNA dosimeter is demonstrated as an alternative, complementary, and reliable method for the quantification of sunscreen photoprotection at the level of DNA damage.

  13. DNA repair in human bronchial epithelial cells

    International Nuclear Information System (INIS)

    Fornace, A.J. Jr.; Lechner, J.F.; Grafstrom, R.C.; Harris, C.C.

    1982-01-01

    The purpose of this investigation was to compare the response of human cell types (bronchial epithelial cells and fibroblasts and skin fibroblasts) to various DNA damaging agents. Repair of DNA single strand breaks (SSB) induced by 5 krads of X-ray was similar for all cell types; approximately 90% of the DNA SSB were rejoined within one hour. During excision repair of DNA damage from u.v.-radiation, the frequencies of DNA SSB as estimated by the alkaline elution technique, were similar in all cell types. Repair replication as measured by BND cellulose chromatography was also similar in epithelial and fibroblastic cells after u.v.-irradiation. Similar levels of SSB were also observed in epithelial and fibroblastic cells after exposure to chemical carcinogens: 7,12-dimethylbenz[a]anthracene; benzo[a]pyrene diol epoxide (BPDE); or N-methyl-N-nitro-N-nitrosoguanidine. Significant repair replication of BPDE-induced DNA damage was detected in both bronchial epithelial and fibroblastic cells, although the level in fibroblasts was approximately 40% of that in epithelial cells. The pulmonary carcinogen asbestos did not damage DNA. DNA-protein crosslinks induced by formaldehyde were rapidly removed in bronchial cells. Further, epithelial and fibroblastic cells, which were incubated with formaldehyde and the polymerase inhibitor combination of cytosine arabinoside and hydroxyurea, accumulated DNA SSB at approximately equal frequencies. These results should provide a useful background for further investigations of the response of human bronchial cells to various DNA damaging agents

  14. DNA Dosimetry Assessment for Sunscreen Genotoxic Photoprotection

    Science.gov (United States)

    Schuch, André Passaglia; Lago, Juliana Carvalhães; Yagura, Teiti; Menck, Carlos Frederico Martins

    2012-01-01

    Background Due to the increase of solar ultraviolet radiation (UV) incidence over the last few decades, the use of sunscreen has been widely adopted for skin protection. However, considering the high efficiency of sunlight-induced DNA lesions, it is critical to improve upon the current approaches that are used to evaluate protection factors. An alternative approach to evaluate the photoprotection provided by sunscreens against daily UV radiation-induced DNA damage is provided by the systematic use of a DNA dosimeter. Methodology/Principal Findings The Sun Protection Factor for DNA (DNA-SPF) is calculated by using specific DNA repair enzymes, and it is defined as the capacity for inhibiting the generation of cyclobutane pyrimidine dimers (CPD) and oxidised DNA bases compared with unprotected control samples. Five different commercial brands of sunscreen were initially evaluated, and further studies extended the analysis to include 17 other products representing various formulations and Sun Protection Factors (SPF). Overall, all of the commercial brands of SPF 30 sunscreens provided sufficient protection against simulated sunlight genotoxicity. In addition, this DNA biosensor was useful for rapidly screening the biological protection properties of the various sunscreen formulations. Conclusions/Significance The application of the DNA dosimeter is demonstrated as an alternative, complementary, and reliable method for the quantification of sunscreen photoprotection at the level of DNA damage. PMID:22768281

  15. The use of mitochondrial DNA (mtDNA-investigations in Forensic Sciences

    Directory of Open Access Journals (Sweden)

    S. Dawson

    1996-07-01

    Full Text Available A variety of methods was developed to characterize mtDNA. The initial aim of these techniques was to try and link diseases with specific mitochondrial defects. As a result of the maternal inheritance trait of mtDNA these techniques facilitate studies of the phylogenetic history and population structure of the human population. It has been shown that mitochondrial DNA typing can be of great value for human identification in forensic cases. The identification of victims of mass-disasters or mass-murders, where human remains can be recovered only after many years have passed, is one of the most challenging fields of forensic identification. By using automated DNA sequencing with fluorescent labels, mitochondrial DNA sequences can be generated rapidly and accurately. Computer software facilitates the rapid comparison of individual and reference sequences.

  16. Rapid and highly fieldable viral diagnostic

    Energy Technology Data Exchange (ETDEWEB)

    McKnight, Timothy E.

    2016-12-20

    The present invention relates to a rapid, highly fieldable, nearly reagentless diagnostic to identify active RNA viral replication in a live, infected cells, and more particularly in leukocytes and tissue samples (including biopsies and nasal swabs) using an array of a plurality of vertically-aligned nanostructures that impale the cells and introduce a DNA reporter construct that is expressed and amplified in the presence of active viral replication.

  17. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    ONOS

    2010-09-06

    Sep 6, 2010 ... achieving food security and sustainable agriculture. (Hautea and Escaler, 2004). ... presence of these contaminants tends to suppress and inhibit analytical ... garden in University of Malaya, Malaysia. Leaves were harvested.

  18. Rapid Prototyping Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — The ARDEC Rapid Prototyping (RP) Laboratory was established in December 1992 to provide low cost RP capabilities to the ARDEC engineering community. The Stratasys,...

  19. To DNA, all information is equal

    DEFF Research Database (Denmark)

    Sennels, Lau; Bentin, Thomas

    2012-01-01

    Information storage capabilities are key in most aspects of society and the requirement for storage space is rapidly expanding. In principle, DNA could be a high-density medium for information storage. Church and coworkers recently demonstrated how binary data can be encoded, stored in, and retri......Information storage capabilities are key in most aspects of society and the requirement for storage space is rapidly expanding. In principle, DNA could be a high-density medium for information storage. Church and coworkers recently demonstrated how binary data can be encoded, stored in...

  20. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  1. DNA-Based Enzyme Reactors and Systems

    Directory of Open Access Journals (Sweden)

    Veikko Linko

    2016-07-01

    Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.

  2. Rapid Tooling via Stereolithography

    OpenAIRE

    Montgomery, Eva

    2006-01-01

    Approximately three years ago, composite stereolithography (SL) resins were introduced to the marketplace, offering performance features beyond what traditional SL resins could offer. In particular, the high heat deflection temperatures and high stiffness of these highly filled resins have opened the door to several new rapid prototyping (RP) applications, including wind tunnel test modelling and, more recently, rapid tooling.

  3. DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.

    Science.gov (United States)

    Sucher, Nikolaus J; Hennell, James R; Carles, Maria C

    2012-01-01

    DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

  4. Repair of DNA DSB in higher eukaryotes

    International Nuclear Information System (INIS)

    Wang, H.; Perrault, A.R.; Takeda, Y.; Iliakis, G.

    2003-01-01

    affinity of Ku for DNA ends, particularly when cooperating with DNA-PKcs, suppresses B-NHEJ by quickly and efficiently binding DNA ends and directing them to D-NHEJ for rapid joining. A model accommodating biochemical and genetic results will be presented

  5. Rapid improvement teams.

    Science.gov (United States)

    Alemi, F; Moore, S; Headrick, L; Neuhauser, D; Hekelman, F; Kizys, N

    1998-03-01

    Suggestions, most of which are supported by empirical studies, are provided on how total quality management (TQM) teams can be used to bring about faster organizationwide improvements. Ideas are offered on how to identify the right problem, have rapid meetings, plan rapidly, collect data rapidly, and make rapid whole-system changes. Suggestions for identifying the right problem include (1) postpone benchmarking when problems are obvious, (2) define the problem in terms of customer experience so as not to blame employees nor embed a solution in the problem statement, (3) communicate with the rest of the organization from the start, (4) state the problem from different perspectives, and (5) break large problems into smaller units. Suggestions for having rapid meetings include (1) choose a nonparticipating facilitator to expedite meetings, (2) meet with each team member before the team meeting, (3) postpone evaluation of ideas, and (4) rethink conclusions of a meeting before acting on them. Suggestions for rapid planning include reducing time spent on flowcharting by focusing on the future, not the present. Suggestions for rapid data collection include (1) sample patients for surveys, (2) rely on numerical estimates by process owners, and (3) plan for rapid data collection. Suggestions for rapid organizationwide implementation include (1) change membership on cross-functional teams, (2) get outside perspectives, (3) use unfolding storyboards, and (4) go beyond self-interest to motivate lasting change in the organization. Additional empirical investigations of time saved as a consequence of the strategies provided are needed. If organizations solve their problems rapidly, fewer unresolved problems may remain.

  6. DNA Repair Systems

    Indian Academy of Sciences (India)

    DNA molecule which makes it ideal for storage and propagation of genetic information. ... of these errors are broadly referred to as DNA repair. DNA can ... changes occur in the human genome per day. ..... nails, frequent physical and mental.

  7. Synthesis of DNA

    Science.gov (United States)

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  8. DNA extraction method for PCR in mycorrhizal fungi.

    Science.gov (United States)

    Manian, S; Sreenivasaprasad, S; Mills, P R

    2001-10-01

    To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

  9. Fate of exogenously supplied bacterial DNA in soybean

    Energy Technology Data Exchange (ETDEWEB)

    Ndiku, Luyindula [Commissariat des Sciences Nucleaires, Kinshasa (Zaire). Centre Regional d' Etudes Nucleaires

    1980-01-01

    The fate of exogenously supplied radiolabelled DNA from agrobacterium tumefaciens and micrococcus lysodeikticus was investigated in soybean tissues growing under various physiological conditions. The following observations are made: (a) Rapid degradation and reutilization of the donor DNA was observed in callus tissue culture. (b) Germinating seeds and five-day old seedlings were shown to degrade DNA in the incubation medium and to ultilize these degradation products for their own DNA synthesis. Reutilization could be almost totally suppressed the addition of unlabelled thymidine as a competitor. This allowed a detection of significant amounts of residuel donor closely but transiently associated with the plant tissues. (c) In soybean shoots dipped into a solution of donor DNA, partly this DNA was found to first migrate to the leaves where mostly labelled endogenous DNA was later found. Very large amounts of polymerized exogenous DNA were found in the regenerated roots after 12 days of culture.

  10. On the fate of exogenously supplied bacterial DNA in soybean

    International Nuclear Information System (INIS)

    Luyindula Ndiku

    1980-01-01

    The fate of exogenously supplied radiolabelled DNA from agrobacterium tumefaciens and micrococcus lysodeikticus was investigated in soybean tissues growing under various physiological conditions. The following observations are made: a) Rapid degradation and reutilization of the donor DNA was observed in callus tissue culture. b) Germinating seeds and five-day old seedlings were shown to degrade DNA in the incubation medium and to ultilize these degradation products for their own DNA synthesis. Reutilization could be almost totally suppressed the addition of unlabelled thymidine as a competitor. This allowed a detection of significant amounts of residuel donor closely but transiently associated with the plant tissues. c) In soybean shoots dipped into a solution of donor DNA, partly this DNA was found to first migrate to the leaves where mostly labelled endogenous DNA was later found. Very large amounts of polymerized exogenous DNA were found in the regenerated roots after 12 days of culture. (author)

  11. Rapid response systems.

    Science.gov (United States)

    Lyons, Patrick G; Edelson, Dana P; Churpek, Matthew M

    2018-07-01

    Rapid response systems are commonly employed by hospitals to identify and respond to deteriorating patients outside of the intensive care unit. Controversy exists about the benefits of rapid response systems. We aimed to review the current state of the rapid response literature, including evolving aspects of afferent (risk detection) and efferent (intervention) arms, outcome measurement, process improvement, and implementation. Articles written in English and published in PubMed. Rapid response systems are heterogeneous, with important differences among afferent and efferent arms. Clinically meaningful outcomes may include unexpected mortality, in-hospital cardiac arrest, length of stay, cost, and processes of care at end of life. Both positive and negative interventional studies have been published, although the two largest randomized trials involving rapid response systems - the Medical Early Response and Intervention Trial (MERIT) and the Effect of a Pediatric Early Warning System on All-Cause Mortality in Hospitalized Pediatric Patients (EPOCH) trial - did not find a mortality benefit with these systems, albeit with important limitations. Advances in monitoring technologies, risk assessment strategies, and behavioral ergonomics may offer opportunities for improvement. Rapid responses may improve some meaningful outcomes, although these findings remain controversial. These systems may also improve care for patients at the end of life. Rapid response systems are expected to continue evolving with novel developments in monitoring technologies, risk prediction informatics, and work in human factors. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Application of a rapid screening method to detect irradiated meat in Brazil

    International Nuclear Information System (INIS)

    Villavicencio, A.L.C.H.; Delincee, H.

    1998-01-01

    Complete text of publication follows. Based on the enormous potential for food irradiation in Brazil, and to ensure free consumer choice, there is a need to find a convenient and rapid method for detection of irradiated food. Since treatment with ionizing radiation causes DNA fragmentation, the analysis of DNA damage might be promising. In fact, DNA fragmentation measured in single cells by agarose gel electrophoresis - DNA Comet Assay - has shown to offer great potential as a rapid tool to detect whether a wide variety of foodstuffs has been radiation processed. However, more work is needed to exploit the full potential of this promising technique. In this paper, the DNA Comet Assay was used to identify exotic meat (boar, jacare and capybara), irradiated with 60 Co gamma-rays. The applied radiation doses were 0, 1.5, 3.0 and 4.5 kGy. Analysis of the DNA migration enable a rapid identification of the radiation treatment

  13. Radiobiology of DNA strand breakage

    International Nuclear Information System (INIS)

    Johansen, I.

    1975-01-01

    The yield of single-strand breaks in lambda DNA within lysogenic host bacteria was measured after exposure to 4-MeV electrons (50 msec) and rapid transfer (45 msec) to alkaline detergent. In nitrogen anoxia the yield was 1.2 x 10 -12 DNA single-strand breaks per rad per dalton, and under full oxygenation the yield increased to 5 x 10 -12 breaks per rad per dalton. A search for the presence of fast repair mechanisms failed to demonstrate the presence of any mechanism for repair of strand breaks operating within a fraction of a second. Strand breaks produced in the presence of oxygen were repaired in 30--40 sec, while breaks produced under anoxia were rejoined even slower. A functional product from the polAl gene was needed for the rejoining of the broken molecules. Intermediate levels of DNA strand breakage seen at low concentrations of oxygen are dependent on the concentration of cellular sulfhydryl compounds, suggesting that in strand breakage oxygen and hydrogen donors compete for reactions with radiation-induced transients in the DNA. Intercomparisons of data on radiation-induced lethality of cells and single-strand breaks in episomal DNA allow the distinction between two classes of radiation-induced radicals, R 1 and R 2 , with different chemical properties; R 1 reacts readily with oxygen and N-oxyls under formation of potentially lethal products. The reactivity of oxygen in this reaction is 30--40 times higher than that of TMPN. R 2 reacts 16 times more readily than R 1 with oxygen under formation of single-strand breaks in the DNA. R 2 does not react with N-oxyls

  14. Analysis of epigenetic modifications of DNA in human cells

    DEFF Research Database (Denmark)

    Kristensen, Lasse Sommer; Treppendahl, Marianne Bach; Grønbæk, Kirsten

    2013-01-01

    Epigenetics, the study of somatically heritable changes in gene expression not related to changes in the DNA sequence, is a rapidly expanding research field that plays important roles in healthy as well as in diseased cells. DNA methylation and hydroxymethylation are epigenetic modifications found...

  15. Assessment of DNA damage by panmasala, gutkha chewing and ...

    African Journals Online (AJOL)

    In the present study the comet assay was performed in buccal epithelial cells to evaluate DNA damage among pan masala or gutkha chewers and smokers. The assay is a rapid, suitable and sensitive method for detecting various forms of DNA damage at individual cell level. The study comprises 300 individuals of which 50 ...

  16. Rapid quantification and sex determination of forensic evidence materials.

    Science.gov (United States)

    Andréasson, Hanna; Allen, Marie

    2003-11-01

    DNA quantification of forensic evidence is very valuable for an optimal use of the available biological material. Moreover, sex determination is of great importance as additional information in criminal investigations as well as in identification of missing persons, no suspect cases, and ancient DNA studies. While routine forensic DNA analysis based on short tandem repeat markers includes a marker for sex determination, analysis of samples containing scarce amounts of DNA is often based on mitochondrial DNA, and sex determination is not performed. In order to allow quantification and simultaneous sex determination on minute amounts of DNA, an assay based on real-time PCR analysis of a marker within the human amelogenin gene has been developed. The sex determination is based on melting curve analysis, while an externally standardized kinetic analysis allows quantification of the nuclear DNA copy number in the sample. This real-time DNA quantification assay has proven to be highly sensitive, enabling quantification of single DNA copies. Although certain limitations were apparent, the system is a rapid, cost-effective, and flexible assay for analysis of forensic casework samples.

  17. Multifunctional DNA Nanomaterials for Biomedical Applications

    Directory of Open Access Journals (Sweden)

    Dick Yan Tam

    2015-01-01

    Full Text Available The rapidly emerging DNA nanotechnology began with pioneer Seeman’s hypothesis that DNA not only can carry genetic information but also can be used as molecular organizer to create well-designed and controllable nanomaterials for applications in materials science, nanotechnology, and biology. DNA-based self-assembly represents a versatile system for nanoscale construction due to the well-characterized conformation of DNA and its predictability in the formation of base pairs. The structural features of nucleic acids form the basis of constructing a wide variety of DNA nanoarchitectures with well-defined shapes and sizes, in addition to controllable permeability and flexibility. More importantly, self-assembled DNA nanostructures can be easily functionalized to construct artificial functional systems with nanometer scale precision for multipurposes. Apparently scientists envision artificial DNA-based nanostructures as tool for drug loading and in vivo targeted delivery because of their abilities in selective encapsulation and stimuli-triggered release of cargo. Herein, we summarize the strategies of creating multidimensional self-assembled DNA nanoarchitectures and review studies investigating their stability, toxicity, delivery efficiency, loading, and control release of cargos in addition to their site-specific targeting and delivery of drug or cargo molecules to cellular systems.

  18. FIBER OPTIC BIOSENSOR FOR DNA DAMAGE

    Science.gov (United States)

    This paper describes a fiber optic biosensor for the rapid and sensitive detection of radiation-induced or chemically-induced oxidative DNA damage. The assay is based on the hybridization and temperature-induced dissociation (melting curves) of synthetic oligonucleotides. The...

  19. Disposable electrochemical DNA biosensor for environmental ...

    Indian Academy of Sciences (India)

    been used due to its rapid, easy handling and cost effective responses for the toxicity assessment in real water ... in the application of DNA as biosensors as it is found ... used as a preclinical safety assessment tool to screen ... out the work.

  20. Application of a rapid screening method to detect irradiated meat in Brazil

    International Nuclear Information System (INIS)

    Villavicencio, A.L.C.H.; Mancini-Filho, J.; Delincee, H.

    2000-01-01

    Based on the enormous potential for food irradiation in Brazil, and to ensure free consumer choice, there is a need to find a convenient and rapid method for detection of irradiated food. Since treatment with ionising radiation causes DNA fragmentation, the analysis of DNA damage might be promising. In this paper, the DNA Comet Assay was used to identify exotic meat (boar, jacare and capybara), irradiated with 60 Co gamma rays. The applied radiation doses were 0, 1.5, 3.0 and 4.5 kGy. Analysis of the DNA migration enabled a rapid identification of the radiation treatment

  1. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  2. In vitro and in vivo assay of radio-induced damage in Escherichia Coli, DNA labelled on thymidilic fragment

    International Nuclear Information System (INIS)

    Bonicel, A.

    1977-01-01

    A technique of rapid assay for a particular and very important damage, N-formamido (DNA), is described. Using this technique, the importance of radio-induced DNA damage can be evaluated before the repair enzymatic system takes place [fr

  3. RPA coordinates DNA end resection and prevents formation of DNA hairpins.

    Science.gov (United States)

    Chen, Huan; Lisby, Michael; Symington, Lorraine S

    2013-05-23

    Replication protein A (RPA) is an essential eukaryotic single-stranded DNA binding protein with a central role in DNA metabolism. RPA directly participates in DNA double-strand break repair by stimulating 5'-3' end resection by the Sgs1/BLM helicase and Dna2 endonuclease in vitro. Here we investigated the role of RPA in end resection in vivo, using a heat-inducible degron system that allows rapid conditional depletion of RPA in Saccharomyces cerevisiae. We found that RPA depletion eliminated both the Sgs1-Dna2- and Exo1-dependent extensive resection pathways and synergized with mre11Δ to prevent end resection. The short single-stranded DNA tails formed in the absence of RPA were unstable due to 3' strand loss and the formation of fold-back hairpin structures that required resection initiation and Pol32-dependent DNA synthesis. Thus, RPA is required to generate ssDNA, and also to protect ssDNA from degradation and inappropriate annealing that could lead to genome rearrangements. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning

    Directory of Open Access Journals (Sweden)

    Masudur Rahman

    2016-10-01

    Full Text Available Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.

  5. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning

    Science.gov (United States)

    Rahman, Masudur; Neff, David; Green, Nathaniel; Norton, Michael L.

    2016-01-01

    Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material. PMID:28335324

  6. Rapid world modeling

    International Nuclear Information System (INIS)

    Little, Charles; Jensen, Ken

    2002-01-01

    Sandia National Laboratories has designed and developed systems capable of large-scale, three-dimensional mapping of unstructured environments in near real time. This mapping technique is called rapid world modeling and has proven invaluable when used by prototype systems consisting of sensory detection devices mounted on mobile platforms. These systems can be deployed into previously unmapped environments and transmit real-time 3-D visual images to operators located remotely. This paper covers a brief history of the rapid world modeling system, its implementation on mobile platforms, and the current state of the technology. Applications to the nuclear power industry are discussed. (author)

  7. JINR rapid communications

    International Nuclear Information System (INIS)

    1998-01-01

    The present collection of rapid communications from JINR, Dubna, contains seven separate records on relativistic multiparticle processes in the central rapidity region at asymptotically high energies, a new experimental study of charged K→3π decays, pre-Cherenkov radiation as a phenomenon of 'light barrier', stable S=-2 H dibaryon found in Dubna, calculation of Green functions and gluon top in some unambiguous gauges, a method of a fast selection of inelastic nucleus-nucleus collisions for the CMS experiment and the manifestation of jet quenching in differential distributions of the total transverse energy in nucleus-nucleus collisions

  8. Rapid microbiology - raising awareness.

    Science.gov (United States)

    Bailie, Jonathan

    2016-01-01

    A 'high-level overview' of some of the emerging rapid microbiology technologies designed to help healthcare engineering and infection control teams working in hospitals and other healthcare facilities more rapidly identify potentially hazardous levels of waterborne microorganisms in their water systems, enabling them to take prompt remedial action, and a look at the some of the 'pros and cons' of such testing techniques, was given by Nalco technical director, Howard Barnes, the vice-chair of the Legionella Control Association (LCA), at a recent LCA open day. HEJ editor, Jonathan Bailie, reports.

  9. JINR rapid communications

    International Nuclear Information System (INIS)

    1998-01-01

    The present collection of rapid communications from JINR, Dubna, contains seven separate records on invisible Z-boson width and restrictions on next-to-minimal supersymmetric standard model, cosmic test of honeycomb drift chambers, fission of 209 Bi, 232 Th, 235 U, 238 U and 237 Np in a spallation neutron field, rapid screening of spontaneous and radiation-induced structural changes at the vestigial gene of Drosophila melanogaster by polymerase chain reaction, gamma-ray multiplicities in sub-barrier fission of 226 Th and the decay constants of the scalar and pseudoscalar mesons in the quark models with quasilocal interaction

  10. Constructing DNA Barcode Sets Based on Particle Swarm Optimization.

    Science.gov (United States)

    Wang, Bin; Zheng, Xuedong; Zhou, Shihua; Zhou, Changjun; Wei, Xiaopeng; Zhang, Qiang; Wei, Ziqi

    2018-01-01

    Following the completion of the human genome project, a large amount of high-throughput bio-data was generated. To analyze these data, massively parallel sequencing, namely next-generation sequencing, was rapidly developed. DNA barcodes are used to identify the ownership between sequences and samples when they are attached at the beginning or end of sequencing reads. Constructing DNA barcode sets provides the candidate DNA barcodes for this application. To increase the accuracy of DNA barcode sets, a particle swarm optimization (PSO) algorithm has been modified and used to construct the DNA barcode sets in this paper. Compared with the extant results, some lower bounds of DNA barcode sets are improved. The results show that the proposed algorithm is effective in constructing DNA barcode sets.

  11. Function of Junk: Pericentromeric Satellite DNA in Chromosome Maintenance.

    Science.gov (United States)

    Jagannathan, Madhav; Yamashita, Yukiko M

    2018-04-02

    Satellite DNAs are simple tandem repeats that exist at centromeric and pericentromeric regions on eukaryotic chromosomes. Unlike the centromeric satellite DNA that comprises the vast majority of natural centromeres, function(s) for the much more abundant pericentromeric satellite repeats are poorly understood. In fact, the lack of coding potential allied with rapid divergence of repeat sequences across eukaryotes has led to their dismissal as "junk DNA" or "selfish parasites." Although implicated in various biological processes, a conserved function for pericentromeric satellite DNA remains unidentified. We have addressed the role of satellite DNA through studying chromocenters, a cytological aggregation of pericentromeric satellite DNA from multiple chromosomes into DNA-dense nuclear foci. We have shown that multivalent satellite DNA-binding proteins cross-link pericentromeric satellite DNA on chromosomes into chromocenters. Disruption of chromocenters results in the formation of micronuclei, which arise by budding off the nucleus during interphase. We propose a model that satellite DNAs are critical chromosome elements that are recognized by satellite DNA-binding proteins and incorporated into chromocenters. We suggest that chromocenters function to preserve the entire chromosomal complement in a single nucleus, a fundamental and unquestioned feature of eukaryotic genomes. We speculate that the rapid divergence of satellite DNA sequences between closely related species results in discordant chromocenter function and may underlie speciation and hybrid incompatibility. © 2017 Jagannathan and Yamashita; Published by Cold Spring Harbor Laboratory Press.

  12. Involvement of specialized DNA polymerases Pol II, Pol IV and DnaE2 in DNA replication in the absence of Pol I in Pseudomonas putida

    International Nuclear Information System (INIS)

    Sidorenko, Julia; Jatsenko, Tatjana; Saumaa, Signe; Teras, Riho; Tark-Dame, Mariliis; Horak, Rita; Kivisaar, Maia

    2011-01-01

    The majority of bacteria possess a different set of specialized DNA polymerases than those identified in the most common model organism Escherichia coli. Here, we have studied the ability of specialized DNA polymerases to substitute Pol I in DNA replication in Pseudomonas putida. Our results revealed that P. putida Pol I-deficient cells have severe growth defects in LB medium, which is accompanied by filamentous cell morphology. However, growth of Pol I-deficient bacteria on solid rich medium can be restored by reduction of reactive oxygen species in cells. Also, mutants with improved growth emerge rapidly. Similarly to the initial Pol I-deficient P. putida, its adapted derivatives express a moderate mutator phenotype, which indicates that DNA replication carried out in the absence of Pol I is erroneous both in the original Pol I-deficient bacteria and the adapted derivatives. Analysis of the spectra of spontaneous Rif r mutations in P. putida strains lacking different DNA polymerases revealed that the presence of specialized DNA polymerases Pol II and Pol IV influences the frequency of certain base substitutions in Pol I-proficient and Pol I-deficient backgrounds in opposite ways. Involvement of another specialized DNA polymerase DnaE2 in DNA replication in Pol I-deficient bacteria is stimulated by UV irradiation of bacteria, implying that DnaE2-provided translesion synthesis partially substitutes the absence of Pol I in cells containing heavily damaged DNA.

  13. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY TOXIC INDUSTRIAL CHEMICALS

    Science.gov (United States)

    One of the reported effects for exposure to many of the toxic industrial chemicals is DNA damage. The present study describes a simple, rapid and innovative assay to detect DNA damage resulting from exposure of surrogate DNA to toxic industrial chemicals (acrolein, allylamine, ch...

  14. Complexes of DNA with fluorescent dyes are effective reagents for detection of autoimmune antibodies

    DEFF Research Database (Denmark)

    Domljanovic, Ivana; Carstens, Annika; Okholm, Anders

    2017-01-01

    as targets for these antibodies. This is done in a simple, rapid and specific immunofluorescence assay. Specifically, employing 3D nanostructures (DNA origami), we present a new approach in the detection and study of human antibodies to DNA. We demonstrate the detection of anti-DNA antibodies...

  15. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  16. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    Rapid DNA extraction is a prerequisite for molecular studies. Generally, plant tissue is ground in liquid nitrogen to isolate DNA; but, liquid nitrogen is dangerous and volatile. Besides, liquid nitrogen is not always available in many developing countries. To investigate if high quality DNA could be obtained for downstream ...

  17. Navigate the Digital Rapids

    Science.gov (United States)

    Lindsay, Julie; Davis, Vicki

    2010-01-01

    How can teachers teach digital citizenship when the digital landscape is changing so rapidly? How can teachers teach proper online social interactions when the students are outside their classroom and thus outside their control? Will encouraging students to engage in global collaborative environments land teachers in hot water? These are the…

  18. A BIOINFORMATIC STRATEGY TO RAPIDLY CHARACTERIZE CDNA LIBRARIES

    Science.gov (United States)

    A Bioinformatic Strategy to Rapidly Characterize cDNA LibrariesG. Charles Ostermeier1, David J. Dix2 and Stephen A. Krawetz1.1Departments of Obstetrics and Gynecology, Center for Molecular Medicine and Genetics, & Institute for Scientific Computing, Wayne State Univer...

  19. Nanopore Sequencing as a Rapidly Deployable Ebola Outbreak Tool.

    Science.gov (United States)

    Hoenen, Thomas; Groseth, Allison; Rosenke, Kyle; Fischer, Robert J; Hoenen, Andreas; Judson, Seth D; Martellaro, Cynthia; Falzarano, Darryl; Marzi, Andrea; Squires, R Burke; Wollenberg, Kurt R; de Wit, Emmie; Prescott, Joseph; Safronetz, David; van Doremalen, Neeltje; Bushmaker, Trenton; Feldmann, Friederike; McNally, Kristin; Bolay, Fatorma K; Fields, Barry; Sealy, Tara; Rayfield, Mark; Nichol, Stuart T; Zoon, Kathryn C; Massaquoi, Moses; Munster, Vincent J; Feldmann, Heinz

    2016-02-01

    Rapid sequencing of RNA/DNA from pathogen samples obtained during disease outbreaks provides critical scientific and public health information. However, challenges exist for exporting samples to laboratories or establishing conventional sequencers in remote outbreak regions. We successfully used a novel, pocket-sized nanopore sequencer at a field diagnostic laboratory in Liberia during the current Ebola virus outbreak.

  20. Rapid prenatal diagnosis of cytogenetic abnormalities by array CGH analysis

    Science.gov (United States)

    Array CGH analysis has been shown to be highly accurate for rapid detection of chromosomal aneuploidies and submicroscopic deletions or duplications on fetal DNA samples in a clinical prenatal diagnostic setting. The objective of this study is to present our "post-validation phase" experience with ...

  1. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    Energy Technology Data Exchange (ETDEWEB)

    Ganesan, Shanthi, E-mail: shanthig@iastate.edu; Keating, Aileen F., E-mail: akeating@iastate.edu

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  2. Methods to maximise recovery of environmental DNA from water samples.

    Directory of Open Access Journals (Sweden)

    Rheyda Hinlo

    Full Text Available The environmental DNA (eDNA method is a detection technique that is rapidly gaining credibility as a sensitive tool useful in the surveillance and monitoring of invasive and threatened species. Because eDNA analysis often deals with small quantities of short and degraded DNA fragments, methods that maximize eDNA recovery are required to increase detectability. In this study, we performed experiments at different stages of the eDNA analysis to show which combinations of methods give the best recovery rate for eDNA. Using Oriental weatherloach (Misgurnus anguillicaudatus as a study species, we show that various combinations of DNA capture, preservation and extraction methods can significantly affect DNA yield. Filtration using cellulose nitrate filter paper preserved in ethanol or stored in a -20°C freezer and extracted with the Qiagen DNeasy kit outperformed other combinations in terms of cost and efficiency of DNA recovery. Our results support the recommendation to filter water samples within 24hours but if this is not possible, our results suggest that refrigeration may be a better option than freezing for short-term storage (i.e., 3-5 days. This information is useful in designing eDNA detection of low-density invasive or threatened species, where small variations in DNA recovery can signify the difference between detection success or failure.

  3. Polymer multilayer tattooing for enhanced DNA vaccination

    Science.gov (United States)

    Demuth, Peter C.; Min, Younjin; Huang, Bonnie; Kramer, Joshua A.; Miller, Andrew D.; Barouch, Dan H.; Hammond, Paula T.; Irvine, Darrell J.

    2013-04-01

    DNA vaccines have many potential benefits but have failed to generate robust immune responses in humans. Recently, methods such as in vivo electroporation have demonstrated improved performance, but an optimal strategy for safe, reproducible, and pain-free DNA vaccination remains elusive. Here we report an approach for rapid implantation of vaccine-loaded polymer films carrying DNA, immune-stimulatory RNA, and biodegradable polycations into the immune-cell-rich epidermis, using microneedles coated with releasable polyelectrolyte multilayers. Films transferred into the skin following brief microneedle application promoted local transfection and controlled the persistence of DNA and adjuvants in the skin from days to weeks, with kinetics determined by the film composition. These ‘multilayer tattoo’ DNA vaccines induced immune responses against a model HIV antigen comparable to electroporation in mice, enhanced memory T-cell generation, and elicited 140-fold higher gene expression in non-human primate skin than intradermal DNA injection, indicating the potential of this strategy for enhancing DNA vaccination.

  4. DNA DAMAGE QUANTITATION BY ALKALINE GEL ELECTROPHORESIS.

    Energy Technology Data Exchange (ETDEWEB)

    SUTHERLAND,B.M.; BENNETT,P.V.; SUTHERLAND, J.C.

    2004-03-24

    Physical and chemical agents in the environment, those used in clinical applications, or encountered during recreational exposures to sunlight, induce damages in DNA. Understanding the biological impact of these agents requires quantitation of the levels of such damages in laboratory test systems as well as in field or clinical samples. Alkaline gel electrophoresis provides a sensitive (down to {approx} a few lesions/5Mb), rapid method of direct quantitation of a wide variety of DNA damages in nanogram quantities of non-radioactive DNAs from laboratory, field, or clinical specimens, including higher plants and animals. This method stems from velocity sedimentation studies of DNA populations, and from the simple methods of agarose gel electrophoresis. Our laboratories have developed quantitative agarose gel methods, analytical descriptions of DNA migration during electrophoresis on agarose gels (1-6), and electronic imaging for accurate determinations of DNA mass (7-9). Although all these components improve sensitivity and throughput of large numbers of samples (7,8,10), a simple version using only standard molecular biology equipment allows routine analysis of DNA damages at moderate frequencies. We present here a description of the methods, as well as a brief description of the underlying principles, required for a simplified approach to quantitation of DNA damages by alkaline gel electrophoresis.

  5. Polymer multilayer tattooing for enhanced DNA vaccination

    Science.gov (United States)

    DeMuth, Peter C.; Min, Younjin; Huang, Bonnie; Kramer, Joshua A.; Miller, Andrew D.; Barouch, Dan H.; Hammond, Paula T.; Irvine, Darrell J.

    2014-01-01

    DNA vaccines have many potential benefits but have failed to generate robust immune responses in humans. Recently, methods such as in vivo electroporation have demonstrated improved performance, but an optimal strategy for safe, reproducible, and pain-free DNA vaccination remains elusive. Here we report an approach for rapid implantation of vaccine-loaded polymer films carrying DNA, immune-stimulatory RNA, and biodegradable polycations into the immune-cell-rich epidermis, using microneedles coated with releasable polyelectrolyte multilayers. Films transferred into the skin following brief microneedle application promoted local transfection and controlled the persistence of DNA and adjuvants in the skin from days to weeks, with kinetics determined by the film composition. These “multilayer tattoo” DNA vaccines induced immune responses against a model HIV antigen comparable to electroporation in mice, enhanced memory T-cell generation, and elicited 140-fold higher gene expression in non-human primate skin than intradermal DNA injection, indicating the potential of this strategy for enhancing DNA vaccination. PMID:23353628

  6. Rapid and highly efficient construction of TALE-based transcriptional regulators and nucleases for genome modification

    KAUST Repository

    Li, Lixin; Piatek, Marek J.; Atef, Ahmed; Piatek, Agnieszka Anna; Wibowo, Anjar Tri; Fang, Xiaoyun; Sabir, Jamal Sabir M; Zhu, Jiankang; Mahfouz, Magdy M.

    2012-01-01

    dictate the DNA sequence specificity. Because TALE repeats are nearly identical, their assembly by cloning or even by synthesis is challenging and time consuming. Here, we report the development and use of a rapid and straightforward approach

  7. Force induced DNA melting

    International Nuclear Information System (INIS)

    Santosh, Mogurampelly; Maiti, Prabal K

    2009-01-01

    When pulled along the axis, double-strand DNA undergoes a large conformational change and elongates by roughly twice its initial contour length at a pulling force of about 70 pN. The transition to this highly overstretched form of DNA is very cooperative. Applying a force perpendicular to the DNA axis (unzipping), double-strand DNA can also be separated into two single-stranded DNA, this being a fundamental process in DNA replication. We study the DNA overstretching and unzipping transition using fully atomistic molecular dynamics (MD) simulations and argue that the conformational changes of double-strand DNA associated with either of the above mentioned processes can be viewed as force induced DNA melting. As the force at one end of the DNA is increased the DNA starts melting abruptly/smoothly above a critical force depending on the pulling direction. The critical force f m , at which DNA melts completely decreases as the temperature of the system is increased. The melting force in the case of unzipping is smaller compared to the melting force when the DNA is pulled along the helical axis. In the case of melting through unzipping, the double-strand separation has jumps which correspond to the different energy minima arising due to sequence of different base pairs. The fraction of Watson-Crick base pair hydrogen bond breaking as a function of force does not show smooth and continuous behavior and consists of plateaus followed by sharp jumps.

  8. DNA damage and autophagy

    International Nuclear Information System (INIS)

    Rodriguez-Rocha, Humberto; Garcia-Garcia, Aracely; Panayiotidis, Mihalis I.; Franco, Rodrigo

    2011-01-01

    Both exogenous and endogenous agents are a threat to DNA integrity. Exogenous environmental agents such as ultraviolet (UV) and ionizing radiation, genotoxic chemicals and endogenous byproducts of metabolism including reactive oxygen species can cause alterations in DNA structure (DNA damage). Unrepaired DNA damage has been linked to a variety of human disorders including cancer and neurodegenerative disease. Thus, efficient mechanisms to detect DNA lesions, signal their presence and promote their repair have been evolved in cells. If DNA is effectively repaired, DNA damage response is inactivated and normal cell functioning resumes. In contrast, when DNA lesions cannot be removed, chronic DNA damage triggers specific cell responses such as cell death and senescence. Recently, DNA damage has been shown to induce autophagy, a cellular catabolic process that maintains a balance between synthesis, degradation, and recycling of cellular components. But the exact mechanisms by which DNA damage triggers autophagy are unclear. More importantly, the role of autophagy in the DNA damage response and cellular fate is unknown. In this review we analyze evidence that supports a role for autophagy as an integral part of the DNA damage response.

  9. DNA Open states and DNA hydratation

    International Nuclear Information System (INIS)

    Lema-Larre, B. de; Martin-Landrove, M

    1995-01-01

    It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic [es

  10. Immunoassay of DNA damage

    International Nuclear Information System (INIS)

    Gasparro, F.P.; Santella, R.M.

    1988-01-01

    The direct photomodification of DNA by ultraviolet light or the photo-induced addition of exogenous compounds to DNA components results in alterations of DNA structure ranging from subtle to profound. There are two consequences of these conformational changes. First, cells in which the DNA has been damaged are capable of executing repair steps. Second, the DNA which is usually of very low immunogenicity now becomes highly antigenic. This latter property has allowed the production of a series of monoclonal antibodies that recognize photo-induced DNA damage. Monoclonal antibodies have been generated that recognize the 4',5'-monoadduct and the crosslink of 8-methoxypsoralen in DNA. In addition, another antibody has been prepared which recognizes the furan-side monoadduct of 6,4,4'-trimethylangelicin in DNA. These monoclonal antibodies have been characterized as to sensitivity and specificity using non-competitive and competitive enzyme-linked-immunosorbent assays (ELISA). (author)

  11. Immunoassay of DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Gasparro, F P; Santella, R M

    1988-09-01

    The direct photomodification of DNA by ultraviolet light or the photo-induced addition of exogenous compounds to DNA components results in alterations of DNA structure ranging from subtle to profound. There are two consequences of these conformational changes. First, cells in which the DNA has been damaged are capable of executing repair steps. Second, the DNA which is usually of very low immunogenicity now becomes highly antigenic. This latter property has allowed the production of a series of monoclonal antibodies that recognize photo-induced DNA damage. Monoclonal antibodies have been generated that recognize the 4',5'-monoadduct and the crosslink of 8-methoxypsoralen in DNA. In addition, another antibody has been prepared which recognizes the furan-side monoadduct of 6,4,4'-trimethylangelicin in DNA. These monoclonal antibodies have been characterized as to sensitivity and specificity using non-competitive and competitive enzyme-linked-immunosorbent assays (ELISA).

  12. DNA computing models

    CERN Document Server

    Ignatova, Zoya; Zimmermann, Karl-Heinz

    2008-01-01

    In this excellent text, the reader is given a comprehensive introduction to the field of DNA computing. The book emphasizes computational methods to tackle central problems of DNA computing, such as controlling living cells, building patterns, and generating nanomachines.

  13. DNA tagged microparticles

    Science.gov (United States)

    Farquar, George Roy; Leif, Roald N; Wheeler, Elizabeth

    2015-05-05

    A simulant that includes a carrier and DNA encapsulated in the carrier. Also a method of making a simulant including the steps of providing a carrier and encapsulating DNA in the carrier to produce the simulant.

  14. Modeling DNA Replication.

    Science.gov (United States)

    Bennett, Joan

    1998-01-01

    Recommends the use of a model of DNA made out of Velcro to help students visualize the steps of DNA replication. Includes a materials list, construction directions, and details of the demonstration using the model parts. (DDR)

  15. Rapid road repair vehicle

    Science.gov (United States)

    Mara, Leo M.

    1998-01-01

    Disclosed is a rapid road repair vehicle capable of moving over a surface to be repaired at near normal posted traffic speeds to scan for and find an the high rate of speed, imperfections in the pavement surface, prepare the surface imperfection for repair by air pressure and vacuum cleaning, applying a correct amount of the correct patching material to effect the repair, smooth the resulting repaired surface, and catalog the location and quality of the repairs for maintenance records of the road surface. The rapid road repair vehicle can repair surface imperfections at lower cost, improved quality, at a higher rate of speed than was was heretofor possible, with significantly reduced exposure to safety and health hazards associated with this kind of road repair activities in the past.

  16. Rapidly processable radiographic material

    International Nuclear Information System (INIS)

    Brabandere, L.A. de; Borginon, H.A.; Pattyn, H.A.; Pollet, R.J.

    1981-01-01

    A new rapidly processable radiographic silver halide material is described for use in mammography and non-destructive testing of industrial materials. The radiographic material is used for direct exposure to penetrating radiation without the use of fluorescent-intensifying screens. It consists of a transparent support with a layer of hydrophilic colloid silver halide emulsion on one or both sides. Examples of the preparation of three different silver halide emulsions are given including the use of different chemical sensitizers. These new radiographic materials have good resistance to the formation of pressure marks in rapid processing apparatus and they have improved sensitivity for direct exposure to penetrating radiation compared to conventional radiographic emulsions. (U.K.)

  17. Automated methods for single-stranded DNA isolation and dideoxynucleotide DNA sequencing reactions on a robotic workstation

    International Nuclear Information System (INIS)

    Mardis, E.R.; Roe, B.A.

    1989-01-01

    Automated procedures have been developed for both the simultaneous isolation of 96 single-stranded M13 chimeric template DNAs in less than two hours, and for simultaneously pipetting 24 dideoxynucleotide sequencing reactions on a commercially available laboratory workstation. The DNA sequencing results obtained by either radiolabeled or fluorescent methods are consistent with the premise that automation of these portions of DNA sequencing projects will improve the reproducibility of the DNA isolation and the procedures for these normally labor-intensive steps provides an approach for rapid acquisition of large amounts of high quality, reproducible DNA sequence data

  18. Rapid manufacturing for microfluidics

    CSIR Research Space (South Africa)

    Land, K

    2012-10-01

    Full Text Available for microfluidics K. LAND, S. HUGO, M MBANJWA, L FOURIE CSIR Materials Science and Manufacturing P O Box 395, Pretoria 0001, SOUTH AFRICA Email: kland@csir.co.za INTRODUCTION Microfluidics refers to the manipulation of very small volumes of fluid.... Microfluidics is at the forefront of developing solutions for drug discovery, diagnostics (from glucose tests to malaria and TB testing) and environmental diagnostics (E-coli monitoring of drinking water). In order to quickly implement new designs, a rapid...

  19. Ultrasensitive FRET-based DNA sensor using PNA/DNA hybridization.

    Science.gov (United States)

    Yang, Lan-Hee; Ahn, Dong June; Koo, Eunhae

    2016-12-01

    In the diagnosis of genetic diseases, rapid and highly sensitive DNA detection is crucial. Therefore, many strategies for detecting target DNA have been developed, including electrical, optical, and mechanical methods. Herein, a highly sensitive FRET based sensor was developed by using PNA (Peptide Nucleic Acid) probe and QD, in which red color QDs are hybridized with capture probes, reporter probes and target DNAs by EDC-NHS coupling. The hybridized probe with target DNA gives off fluorescent signal due to the energy transfer from QD to Cy5 dye in the reporter probe. Compared to the conventional DNA sensor using DNA probes, the DNA sensor using PNA probes shows higher FRET factor and efficiency due to the higher reactivity between PNA and target DNA. In addition, to elicit the effect of the distance between the donor and the acceptor, we have investigated two types of the reporter probes having Cy5 dyes attached at the different positions of the reporter probes. Results show that the shorter the distance between QDs and Cy5s, the stronger the signal intensity. Furthermore, based on the fluorescence microscopy images using microcapillary chips, the FRET signal is enhanced to be up to 276% times stronger than the signal obtained using the cuvette by the fluorescence spectrometer. These results suggest that the PNA probe system conjugated with QDs can be used as ultrasensitive DNA nanosensors. Copyright © 2016. Published by Elsevier B.V.

  20. Tiber Personal Rapid Transit

    Directory of Open Access Journals (Sweden)

    Diego Carlo D'agostino

    2011-02-01

    Full Text Available The project “Tiber Personal Rapid Transit” have been presented by the author at the Rome City Vision Competition1 2010, an ideas competition, which challenges architects, engineers, designers, students and creatives individuals to develop visionary urban proposals with the intention of stimulating and supporting the contemporary city, in this case Rome. The Tiber PRT proposal tries to answer the competition questions with the definition of a provocative idea: a Personal Rapid transit System on the Tiber river banks. The project is located in the central section of the Tiber river and aims at the renewal of the river banks with the insertion of a Personal Rapid Transit infrastructure. The project area include the riverbank of Tiber from Rome Transtevere RFI station to Piazza del Popolo, an area where main touristic and leisure attractions are located. The intervention area is actually no used by the city users and residents and constitute itself a strong barrier in the heart of the historic city.

  1. Rapid MR imaging

    International Nuclear Information System (INIS)

    Edelman, R.R.; Buxton, R.B.; Brady, T.J.

    1988-01-01

    Conventional magnetic resonance (MR) imaging methods typically require several minutes to produce an image, but the periods of respiration, cardiac motion and peristalsis are on the order of seconds or less. The need to reduce motion artifact, as well as the need to reduce imaging time for patient comfort and efficiency, have provided a strong impetus for the development of rapid imaging methods. For abdominal imaging, motion artifacts due to respiration can be significantly reduced by collecting the entire image during one breath hold. For other applications, such as following the kinetics of administered contrast agents, rapid imaging is essential to achieve adequate time resolution. A shorter imaging time entails a cost in image signal/noise (S/N), but improvements in recent years in magnet homogeneity, gradient and radiofrequency coil design have led to steady improvements in S/N and consequently in image quality. For many chemical applications the available S/N is greater than needed, and a trade-off of lower S/N for a shorter imaging time is acceptable. In this chapter, the authors consider the underlying principles of rapid imaging as well as clinical applications of these methods. The bulk of this review concentrates on short TR imaging, but methods that provide for a more modest decrease in imaging time as well as or those that dramatically shorten the imaging time to tens of milliseconds are also discussed

  2. DNA: Structure and function

    DEFF Research Database (Denmark)

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir

    1998-01-01

    This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...

  3. Replicating animal mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Emily A. McKinney

    2013-01-01

    Full Text Available The field of mitochondrial DNA (mtDNA replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading-and lagging-strand synthesis (resembling bacterial genome replication and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS. The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase y, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase. Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.

  4. Force regulated dynamics of RPA on a DNA fork.

    Science.gov (United States)

    Kemmerich, Felix E; Daldrop, Peter; Pinto, Cosimo; Levikova, Maryna; Cejka, Petr; Seidel, Ralf

    2016-07-08

    Replication protein A (RPA) is a single-stranded DNA binding protein, involved in most aspects of eukaryotic DNA metabolism. Here, we study the behavior of RPA on a DNA substrate that mimics a replication fork. Using magnetic tweezers we show that both yeast and human RPA can open forked DNA when sufficient external tension is applied. In contrast, at low force, RPA becomes rapidly displaced by the rehybridization of the DNA fork. This process appears to be governed by the binding or the release of an RPA microdomain (toehold) of only few base-pairs length. This gives rise to an extremely rapid exchange dynamics of RPA at the fork. Fork rezipping rates reach up to hundreds of base-pairs per second, being orders of magnitude faster than RPA dissociation from ssDNA alone. Additionally, we show that RPA undergoes diffusive motion on ssDNA, such that it can be pushed over long distances by a rezipping fork. Generally the behavior of both human and yeast RPA homologs is very similar. However, in contrast to yeast RPA, the dissociation of human RPA from ssDNA is greatly reduced at low Mg(2+) concentrations, such that human RPA can melt DNA in absence of force. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. DNA damage-inducible transcripts in mammalian cells

    International Nuclear Information System (INIS)

    Fornace, A.J. Jr.; Alamo, I. Jr.; Hollander, M.C.

    1988-01-01

    Hybridization subtraction at low ratios of RNA to cDNA was used to enrich for the cDNA of transcripts increased in Chinese hamster cells after UV irradiation. Forty-nine different cDNA clones were isolated. Most coded for nonabundant transcripts rapidly induced 2- to 10-fold after UV irradiation. Only 2 of the 20 cDNA clones sequenced matched known sequences (metallothionein I and II). The predicted amino acid sequence of one cDNA had two localized areas of homology with the rat helix-destabilizing protein. These areas of homology were at the two DNA-binding sites of this nucleic acid single-strand-binding protein. The induced transcripts were separated into two general classes. Class I transcripts were induced by UV radiation and not by the alkylating agent methyl methanesulfonate. Class II transcripts were induced by UV radiation and by methyl methanesulfonate. Many class II transcripts were induced also by H2O2 and various alkylating agents but not by heat shock, phorbol 12-tetradecanoate 13-acetate, or DNA-damaging agents which do not produce high levels of base damage. Since many of the cDNA clones coded for transcripts which were induced rapidly and only by certain types of DNA-damaging agents, their induction is likely a specific response to such damage rather than a general response to cell injury

  6. DNA topology influences molecular machine lifetime in human serum

    Science.gov (United States)

    Goltry, Sara; Hallstrom, Natalya; Clark, Tyler; Kuang, Wan; Lee, Jeunghoon; Jorcyk, Cheryl; Knowlton, William B.; Yurke, Bernard; Hughes, William L.; Graugnard, Elton

    2015-06-01

    DNA nanotechnology holds the potential for enabling new tools for biomedical engineering, including diagnosis, prognosis, and therapeutics. However, applications for DNA devices are thought to be limited by rapid enzymatic degradation in serum and blood. Here, we demonstrate that a key aspect of DNA nanotechnology--programmable molecular shape--plays a substantial role in device lifetimes. These results establish the ability to operate synthetic DNA devices in the presence of endogenous enzymes and challenge the textbook view of near instantaneous degradation.DNA nanotechnology holds the potential for enabling new tools for biomedical engineering, including diagnosis, prognosis, and therapeutics. However, applications for DNA devices are thought to be limited by rapid enzymatic degradation in serum and blood. Here, we demonstrate that a key aspect of DNA nanotechnology--programmable molecular shape--plays a substantial role in device lifetimes. These results establish the ability to operate synthetic DNA devices in the presence of endogenous enzymes and challenge the textbook view of near instantaneous degradation. Electronic supplementary information (ESI) available: DNA sequences, fluorophore and quencher properties, equipment design, and degradation studies. See DOI: 10.1039/c5nr02283e

  7. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  8. Radiation and DNA

    Energy Technology Data Exchange (ETDEWEB)

    Riabchenko, N I

    1979-01-01

    Consideration is given to the effects of ionizing radiation on the structure of DNA. Physical and chemical methods of determining radiation damage to the primary (polynucleotide chain and nitrogenous base) and secondary (helical) structure of DNA are discussed, and the effects of ionizing radiation on deoxyribonucleoprotein complexes are considered. The radiolysis of DNA in vitro and in bacterial and mammalian cells is examined and cellular mechanisms for the repair of radiation-damaged DNA are considered, taking into account single-strand and double-strand breaks, gamma-radiation damage and deoxyribonucleoprotein-membrane complex damage. Postradiation DNA degradation in bacteria and lymphatic cells is also discussed.

  9. DNA-Mediated Electrochemistry

    Science.gov (United States)

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  10. Involvement of DNA polymerase δ in DNA repair synthesis in human fibroblasts at late times after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Dresler, S.L.; Gowans, B.J.; Robinson-Hill, R.M.; Hunting, D.J.

    1988-01-01

    DNA repair synthesis following UV irradiation of confluent human fibroblasts has a biphasic time course with an early phase of rapid nucleotide incorporation and a late phase of much slower nucleotide incorporation. The biphasic nature of this curve suggests that two distinct DNA repair systems may be operative. Previous studies have specifically implicated DNA polymerase δ as the enzyme involved in DNA repair synthesis occurring immediately after UV damage. In this paper, the authors describe studies of DNA polymerase involvement in DNA repair synthesis in confluent human fibroblasts at late times after UV irradiation. Late UV-induced DNA repair synthesis in both intact and permeable cells was found to be inhibited by aphidicolin, indicating the involvement of one of the aphidicolin-sensitive DNA polymerases, α or δ. In permeable cells, the process was further analyzed by using the nucleotide analogue (butylphenyl)-2'-deoxyguanosine 5'-triphosphate, which inhibits DNA polymerase α several hundred times more strongly than it inhibits DNA polymerase δ. The (butylphenyl)-2'-deoxyguanosine 5'-triphosphate inhibition curve for late UV-induced repair synthesis was very similar to that for polymerase δ. It appears that repair synthesis at late time after UV irradiation, like repair synthesis at early times, is mediated by DNA polymerase δ

  11. A duplex DNA-gold nanoparticle probe composed as a colorimetric biosensor for sequence-specific DNA-binding proteins.

    Science.gov (United States)

    Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa

    2016-03-21

    Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.

  12. TALE proteins search DNA using a rotationally decoupled mechanism.

    Science.gov (United States)

    Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M

    2016-10-01

    Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins used extensively for gene editing. Despite recent progress, however, little is known about their sequence search mechanism. Here, we use single-molecule experiments to study TALE search along DNA. Our results show that TALEs utilize a rotationally decoupled mechanism for nonspecific search, despite remaining associated with DNA templates during the search process. Our results suggest that the protein helical structure enables TALEs to adopt a loosely wrapped conformation around DNA templates during nonspecific search, facilitating rapid one-dimensional (1D) diffusion under a range of solution conditions. Furthermore, this model is consistent with a previously reported two-state mechanism for TALE search that allows these proteins to overcome the search speed-stability paradox. Taken together, our results suggest that TALE search is unique among the broad class of sequence-specific DNA-binding proteins and supports efficient 1D search along DNA.

  13. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  14. Biophysics of DNA

    CERN Document Server

    Vologodskii, Alexander

    2015-01-01

    Surveying the last sixty years of research, this book describes the physical properties of DNA in the context of its biological functioning. It is designed to enable both students and researchers of molecular biology, biochemistry and physics to better understand the biophysics of DNA, addressing key questions and facilitating further research. The chapters integrate theoretical and experimental approaches, emphasising throughout the importance of a quantitative knowledge of physical properties in building and analysing models of DNA functioning. For example, the book shows how the relationship between DNA mechanical properties and the sequence specificity of DNA-protein binding can be analyzed quantitatively by using our current knowledge of the physical and structural properties of DNA. Theoretical models and experimental methods in the field are critically considered to enable the reader to engage effectively with the current scientific literature on the physical properties of DNA.

  15. JINR rapid communications

    International Nuclear Information System (INIS)

    1998-01-01

    The present collection of rapid communications from JINR, Dubna, contains seven separate records on decays of excited strange mesons in the extended NJL model, production of heavy evaporation residues in the reactions induced by an extracted 48 Ca beam on a 208 Pb target, scaling behaviour of tensor analyzing power (A yy ) in the inelastic scattering or relativistic deuterons,two-photon collisions at very low Q 2 from LEP2: forthcoming results, high magnetic field uniformity superconducting magnet for a movable polarized target, multichannel time-to-digital converter for drift detector and wavelet-analysis: application to Gaussian signals

  16. JINR rapid communications

    International Nuclear Information System (INIS)

    1995-01-01

    The present collection of rapid communications from JINR, Dubna, contains eight separate reports on the measurement of charge radii for Ti nuclei, spectroscopy of 13 Be, concentrations of hadrons and quark-gluon plasma in mixed phase, experimental results on one-spin pion asymmetry in the d↑ + A → π±(90 0 ) + X process, new results on cumulative pion and proton production in p-D collisions, investigation of charge exchange reactions, the study of the tensor analyzing power in cumulative particle production on a deuteron beam and an evidence for the excited states of the S = -2 stable light dibaryon. 32 figs., 6 tabs

  17. JINR rapid communications

    International Nuclear Information System (INIS)

    1996-01-01

    The present collection of rapid communications from JINR, Dubna, contains five separate reports on analytic QCD running coupling with finite IR behaviour and universal α bar s (0) value, quark condensate in the interacting pion- nucleon medium at finite temperature and baryon number density, γ-π 0 discrimination with a shower maximum detector using neural networks for the solenoidal tracker at RHIC, off-specular neutron reflection from magnetic media with nondiagonal reflectivity matrices and molecular cytogenetics of radiation-induced gene mutations in Drosophila melanogaster. 21 fig., 1 tab

  18. JINR rapid communications

    International Nuclear Information System (INIS)

    1999-01-01

    The present collection of rapid communications from JINR, Dubna, contains seven separate records on additional conditions on eigenvectors in solving inverse problem for two-dimensional Schroedinger equation, on an absolute calibration of deuteron beam polarization at LHE, determination of the vector component of the polarization of the JINR synchrophasotron deuteron beam, wavelet-analysis: criterion of reliable signal selection, on asymptotics in inclusive production of antinuclei and nuclear fragments, use of neutron activation analysis at the IBR-2 reactor for atmospheric monitoring and impulse method for temperature measurement of silicon detectors

  19. JINR rapid communications

    International Nuclear Information System (INIS)

    1995-01-01

    The present collection of rapid communications from JINR, Dubna, contains six separate reports on Monte Carlo simulation of silicon detectors for the ALICE experiment at LHC, a study of single tagged multihadronic γγ* events at an average Q 2 of 90 GeV 2 , epithermal neutron activation analysis of moss, lichen and pine needles in atmospheric deposition monitoring, the theory of neutrino oscillation, coupled quadrupole and monopole vibrations of large amplitude and test of the Ellis-Jaffe sum rule using parametrization of the measured lepton-proton asymmetry. 21 figs., 18 tabs

  20. Rapidly variable relatvistic absorption

    Science.gov (United States)

    Parker, M.; Pinto, C.; Fabian, A.; Lohfink, A.; Buisson, D.; Alston, W.; Jiang, J.

    2017-10-01

    I will present results from the 1.5Ms XMM-Newton observing campaign on the most X-ray variable AGN, IRAS 13224-3809. We find a series of nine absorption lines with a velocity of 0.24c from an ultra-fast outflow. For the first time, we are able to see extremely rapid variability of the UFO features, and can link this to the X-ray variability from the inner accretion disk. We find a clear flux dependence of the outflow features, suggesting that the wind is ionized by increasing X-ray emission.

  1. Differential Nuclear and Mitochondrial DNA Preservation in Post-Mortem Teeth with Implications for Forensic and Ancient DNA Studies

    Science.gov (United States)

    Higgins, Denice; Rohrlach, Adam B.; Kaidonis, John; Townsend, Grant; Austin, Jeremy J.

    2015-01-01

    Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp) and one mitochondrial DNA fragment (77 bp) showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Futhermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using standard

  2. Global chromatin fibre compaction in response to DNA damage

    International Nuclear Information System (INIS)

    Hamilton, Charlotte; Hayward, Richard L.; Gilbert, Nick

    2011-01-01

    Highlights: ► Robust KAP1 phosphorylation in response to DNA damage in HCT116 cells. ► DNA repair foci are found in soluble chromatin. ► Biophysical analysis reveals global chromatin fibre compaction after DNA damage. ► DNA damage is accompanied by rapid linker histone dephosphorylation. -- Abstract: DNA is protected by packaging it into higher order chromatin fibres, but this can impede nuclear processes like DNA repair. Despite considerable research into the factors required for signalling and repairing DNA damage, it is unclear if there are concomitant changes in global chromatin fibre structure. In human cells DNA double strand break (DSB) formation triggers a signalling cascade resulting in H2AX phosphorylation (γH2AX), the rapid recruitment of chromatin associated proteins and the subsequent repair of damaged sites. KAP1 is a transcriptional corepressor and in HCT116 cells we found that after DSB formation by chemicals or ionising radiation there was a wave of, predominantly ATM dependent, KAP1 phosphorylation. Both KAP1 and phosphorylated KAP1 were readily extracted from cells indicating they do not have a structural role and γH2AX was extracted in soluble chromatin indicating that sites of damage are not attached to an underlying structural matrix. After DSB formation we did not find a concomitant change in the sensitivity of chromatin fibres to micrococcal nuclease digestion. Therefore to directly investigate higher order chromatin fibre structures we used a biophysical sedimentation technique based on sucrose gradient centrifugation to compare the conformation of chromatin fibres isolated from cells before and after DNA DSB formation. After damage we found global chromatin fibre compaction, accompanied by rapid linker histone dephosphorylation, consistent with fibres being more regularly folded or fibre deformation being stabilized by linker histones. We suggest that following DSB formation, although there is localised chromatin unfolding to

  3. Rapid Geophysical Surveyor

    International Nuclear Information System (INIS)

    Roybal, L.G.; Carpenter, G.S.; Josten, N.E.

    1993-01-01

    The Rapid Geophysical Surveyor (RGS) is a system designed to rapidly and economically collect closely-spaced geophysical data used for characterization of US Department of Energy waste sites. Geophysical surveys of waste sites are an important first step in the remediation and closure of these sites; especially older sites where historical records are inaccurate and survey benchmarks have changed because of refinements in coordinate controls and datum changes. Closely-spaced data are required to adequately differentiate pits, trenches, and soil vault rows whose edges may be only a few feet from each other. A prototype vehicle designed to collect magnetic field data was built at the Idaho National Engineering Laboratory (INEL) during the summer of 1992. The RGS was funded by the Buried Waste Integrated Demonstration program. This vehicle was demonstrated at the Subsurface Disposal Area (SDA) within the Radioactive Waste Management Complex at the INEL in September 1992. Magnetic data were collected over two areas in the SDA, with a total survey area of about 1.7 acres. Data were collected at a nominal density of 2 1/2 in. along survey lines spaced 1-ft apart. Over 350,000 data points were collected over a 6 day period corresponding to about 185 worker-days using conventional ground survey techniques

  4. A rapid PCR-based approach for molecular identification of filamentous fungi.

    Science.gov (United States)

    Chen, Yuanyuan; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang

    2011-08-01

    In this study, a novel rapid and efficient DNA extraction method based on alkaline lysis, which can deal with a large number of filamentous fungal isolates in the same batch, was established. The filamentous fungal genomic DNA required only 20 min to prepare and can be directly used as a template for PCR amplification. The amplified internal transcribed spacer regions were easy to identify by analysis. The extracted DNA also can be used to amplify other protein-coding genes for fungal identification. This method can be used for rapid systematic identification of filamentous fungal isolates.

  5. Development of DNA probes for Candida albicans

    International Nuclear Information System (INIS)

    Cheung, L.L.; Hudson, J.B.

    1988-01-01

    An attempt was made to produce DNA probes that could be used as a rapid and efficient means of detecting candidiasis (invasive Candida infection) in immunocompromised patients. Whole DNA from Candida albicans was digested with restriction endonuclease, and the resulting fragments were randomly cloned into a plasmid vector. Several recombinant plasmids were evaluated for cross-hybridization to various other Candida species, other fungal DNAs, and to nonfungal DNAs. Cross reactions were observed between the probes and different yeasts, but none with unrelated DNAs. Some recombinants were genus-specific, and two of these were applied to the analysis of C. albicans growth curves. It became evident that, although both 32 P- and biotin-labelled probes could be made quite sensitive, a possible limitation in their diagnostic potential was the poor liberation of Candida DNA from cells. Thus, better methods of treatment of clinical specimens will be required before such probes will be useful in routine diagnosis

  6. Development of DNA probes for Candida albicans

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, L.L.; Hudson, J.B.

    1988-07-01

    An attempt was made to produce DNA probes that could be used as a rapid and efficient means of detecting candidiasis (invasive Candida infection) in immunocompromised patients. Whole DNA from Candida albicans was digested with restriction endonuclease, and the resulting fragments were randomly cloned into a plasmid vector. Several recombinant plasmids were evaluated for cross-hybridization to various other Candida species, other fungal DNAs, and to nonfungal DNAs. Cross reactions were observed between the probes and different yeasts, but none with unrelated DNAs. Some recombinants were genus-specific, and two of these were applied to the analysis of C. albicans growth curves. It became evident that, although both /sup 32/P- and biotin-labelled probes could be made quite sensitive, a possible limitation in their diagnostic potential was the poor liberation of Candida DNA from cells. Thus, better methods of treatment of clinical specimens will be required before such probes will be useful in routine diagnosis.

  7. Delayed chromosomal instability induced by DNA damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Marder, B.A.; Day, J.P.

    1994-01-01

    Cellular exposure to DNA damaging agents rapidly results in a dose dependent increase in chromosomal breakage and gross structural chromosomal rearrangements. Over recent years, evidence has been accumulating indicating genomic instability can manifest multiple generations after cellular exposure to physical and chemical DNA damaging agents. Genomic instability manifests in the progeny of surviving cells, and has been implicated in mutation, gene application, cellular transformation, and cell killing. To investigate chromosome instability following DNA damage, we have used fluorescence in situ hybridization to detect chromosomal rearrangements in a human/hamster somatic hybrid cell line following exposure to ionizing radiation. Delayed chromosomal instability was detected when multiple populations of uniquely arranged metaphases were observed in clonal isolates raised from single cells surviving X-irradiation many generations after exposure. At higher radiation doses, chromosomal instability was observed in a relatively high frequency of surviving clones and, in general, those clones showed delayed chromosome instability also showed reduced survival as measured by colony forming ability

  8. Beyond DNA repair: DNA-PK function in cancer

    OpenAIRE

    Goodwin, Jonathan F.; Knudsen, Karen E.

    2014-01-01

    The DNA-dependent protein kinase (DNA-PK) is a pivotal component of the DNA repair machinery that governs the response to DNA damage, serving to maintain genome integrity. However, the DNA-PK kinase component was initially isolated with transcriptional complexes, and recent findings have illuminated the impact of DNA-PK-mediated transcriptional regulation on tumor progression and therapeutic response. DNA-PK expression has also been correlated with poor outcome in selected tumor types, furthe...

  9. Rapid automated nuclear chemistry

    International Nuclear Information System (INIS)

    Meyer, R.A.

    1979-01-01

    Rapid Automated Nuclear Chemistry (RANC) can be thought of as the Z-separation of Neutron-rich Isotopes by Automated Methods. The range of RANC studies of fission and its products is large. In a sense, the studies can be categorized into various energy ranges from the highest where the fission process and particle emission are considered, to low energies where nuclear dynamics are being explored. This paper presents a table which gives examples of current research using RANC on fission and fission products. The remainder of this text is divided into three parts. The first contains a discussion of the chemical methods available for the fission product elements, the second describes the major techniques, and in the last section, examples of recent results are discussed as illustrations of the use of RANC

  10. JINR rapid communications

    International Nuclear Information System (INIS)

    1999-01-01

    The present collection of rapid communications from JINR, DUBNA, contains eight separate records on symmetry in modern physics (dedicated to the 100th anniversary of the birth of academician V.A.Fock), the double φ-meson production investigation on the Serpukhov accelerator, two-leptonic η-meson decays and SUSY without R parity, charge form factors and alpha-cluster internal structure of 12 C, increasing of muon-track reconstruction efficiency in ME1/1 Dubna prototype for the CMS/LHC, study of photon-structure function F 2 γ in the reaction e + e - → e + e - + hadrons at LEP2, jets reconstruction possibility in pAu and AuAu interactions at STAR RHIC and high-vacuum nondispersable gas absorber

  11. Rapid thermal pulse annealing

    International Nuclear Information System (INIS)

    Miller, M.G.; Koehn, B.W.; Chaplin, R.L.

    1976-01-01

    Characteristics of recovery processes have been investigated for cases of heating a sample to successively higher temperatures by means of isochronal annealing or by using a rapid pulse annealing. A recovery spectra shows the same features independent of which annealing procedure is used. In order to determine which technique provides the best resolution, a study was made of how two independent first-order processes are separated for different heating rates and time increments of the annealing pulses. It is shown that the pulse anneal method offers definite advantages over isochronal annealing when annealing for short time increments. Experimental data by means of the pulse anneal techniques are given for the various substages of stage I of aluminium. (author)

  12. JINR rapid communications

    International Nuclear Information System (INIS)

    1996-01-01

    The present collection of rapid communications from JINR, Dubna, contains seven separate reports on the identification of events with a secondary vertex in the experiment EXCHARM, the zero degree calorimeter for CERN WA-98 experiment, a new approach to increase the resource of installation elements for super-high energy physics, a method of the in-flight production of exotic systems in the charge-exchange reactions, the neutron activation analysis for monitoring northern terrestrial ecosystems, a search for 28 O and study of the neutron-rich nuclei near the neutron closure N=20, a search for new neutron-rich nuclei with a 70A MeV 48 Ca beam. 33 figs., 4 tabs

  13. JINR Rapid Communications. Collection

    International Nuclear Information System (INIS)

    1994-01-01

    The present collection of rapid communications from JINR, Dubna, contains nine separate reports on quasi-classical description of one-nucleon transfer reactions with heavy ions, elastic and inelastic scattering in the high energy approximation, experimental study of fission and evaporation cross sections for 6 He + 209 Bi reaction, d ↑ + 12 C → p + X at Θ p = 0 o in the region of high internal momenta in the deuteron, the Nuclotron internal targets, actively screened superconducting magnets, using of polarized target in backward elastic dp scattering, application of transputers in the data acquisition system of the INESS-ALPHA spectrometer, narrow dibaryon resonances with isotopic spin I=2. 93 refs., 27 figs., 4 tabs

  14. JINR Rapid Communications. Collection

    International Nuclear Information System (INIS)

    1994-01-01

    The present collection of rapid communications from JINR, Dubna, contains eight separate reports on Lorentz transformations with superluminal velocities, photo chromic effect in HTSC films, the investigation of hypernuclei in the Nuclotron accelerator, a new hadron jets finding algorithm in the four-dimensional velocity space, investigations of neutral particle production by relativistic nuclei on the LHE 90-channel γ-spectrometer (results and perspectives), coherent meson production in the dp → 3 HeX reaction, the relativistic projectile nuclei fragmentation and A-dependence of nucleon Fermi-momenta, energy spectra of γ-quanta from d-propane interactions at momentum P d = 1.25 GeV/c per nucleon. 86 refs., 26 figs., 4 tabs

  15. JINR rapid communications

    International Nuclear Information System (INIS)

    1999-01-01

    The present collection of rapid communications from JINR, Dubna, contains seven separate records on measurements of the total cross section difference Δσ L (np) at 1.59, 1.79, and 2.20 GeV, to the estimation of angular distributions of double charged spectator fragments in nucleus-nucleus interactions at superhigh energies, simulation dE/dx analysis results for silicon inner tracking system of ALICE set-up at LHC accelerator, high-multiplicity processes, triggering of high-multiplicity events using calorimetry, ORBIT-3.0 - a computer code for simulation and correction of the closed orbit and first turn in synchrotrons and determination of memory performance

  16. JINR rapid communications

    International Nuclear Information System (INIS)

    1999-01-01

    The present collection of rapid communications from JINR, Dubna, contains seven separate records on yields of the rare-earth neutron-deficient isotopes in the reactions of Mo isotopes with 40 Ca ions, observations of slow components of solitonic-type wave structure excited by e-beam in massive copper sample, development and investigation of low-mass multilayer drift chambers (MDC-2) for inner part of the HADES spectrometer, temperature measurement of the uranium sample irradiated with secondary neutrons, edge effects in multiwire proportional chambers, the influence of the dielectric frame, an object-oriented framework for the hadronic Monte-Carlo event generators and uranium-238 as a source for electronuclear power production. 32 figs., 3 tabs

  17. JINR rapid communications

    International Nuclear Information System (INIS)

    1997-01-01

    The present collection of rapid communications from JINR, Dubna, contains nine separate reports on collective energy dissipation and fluctuations in elastoplastic systems, diagnostics system of the circulating beam of the NUCLOTRON based on microchannel plates, time-of-flight detector for WA98 CERN experiment, fractal structure formation on the surfaces of solids subjected to high intensity electron and ion treatment, production of nuclei in 32,34,36 S-induced reactions in the energy range 6-75 MeV/A, rare-earth elements in soil and pine needle from northern terrestrial ecosystems, 'thermal' multifragmentation in p + Au collisions at relativistic energies, search for effects of the OZI rule violation in φ and ω mesons production in polarized deuteron beam interaction with polarized proton target (project DPHE3) and fast detector for triggering on charged particle multiplicity for relativistic nucleus-nucleus collisions

  18. JINR rapid communications

    International Nuclear Information System (INIS)

    1997-01-01

    The present collection of rapid communications from JINR, Dubna, contains seven separate reports on observation of transversal handedness in the diffractive production of pion triples, a possible experiment on the research of dibaryon states, Cherenkov beam counter system of the CERES/NA45 spectrometer for investigation with 160 GeV/n. lead ions, a profile-based gaseous detector with capacitive pad readout as the prototype of the shower maximum detector for the end-cap electromagnetic calorimeter for the STAR experiment, what DELPHI can get with an upgraded position for the very small angle tagger, estimation of the radiation environment and the shielding aspect for the point 2 area of the LHC and the orthopositronium decay puzzle

  19. Rapid chemical separations

    CERN Document Server

    Trautmann, N

    1976-01-01

    A survey is given on the progress of fast chemical separation procedures during the last few years. Fast, discontinuous separation techniques are illustrated by a procedure for niobium. The use of such techniques for the chemical characterization of the heaviest known elements is described. Other rapid separation methods from aqueous solutions are summarized. The application of the high speed liquid chromatography to the separation of chemically similar elements is outlined. The use of the gas jet recoil transport method for nuclear reaction products and its combination with a continuous solvent extraction technique and with a thermochromatographic separation is presented. Different separation methods in the gas phase are briefly discussed and the attachment of a thermochromatographic technique to an on-line mass separator is shown. (45 refs).

  20. JINR rapid communications

    International Nuclear Information System (INIS)

    1997-01-01

    The present collection of rapid communications from JINR, Dubna, contains seven separate reports on investigation of the tensor analyzing power A yy in the reaction A(d polarized, p)X at large transverse momenta of proton, double-differential ionization cross section calculations for fast collisions of ions and atoms, a study of the two-photon interactions tagged at an average 2 > of 90 GeV 2 , cluster and single-particle distributions in nucleus-nucleus interactions, the Coulomb interaction of charged pions in CC-and CTa-collisions at 4.2 A GeV/c, influence of nitrogen and oxygen gas admixtures on the response of the DELPHI HCAL and MUS detectors and an automation of physics research on base of open standards

  1. JINR rapid communications

    International Nuclear Information System (INIS)

    1997-01-01

    The present collection of rapid communications from JINR, Dubna, contains nine separate reports on effects arising from charged particles overcoming of the light velocity barrier, deformable templates for circle recognition, scintillation detectors for precise time measurements, atomic form factors and incoherent scattering functions of atoms and ions with the number of electrons N ≤ 10, experimental set-up ANOMALON for measurement of relativistic nuclear fragmentation cross sections, superconducting dipole magnet for ALICE dimuon arm spectrometer, analysis of transverse mass dependence of Bose-Einstein correlation radii using the DELPHI data, low-energy theorem in softly broken supersymmetry and study of the characteristics of particles in reactions π - , p, d, He, C + C with the total disintegration on carbon nucleus

  2. JINR rapid communications

    International Nuclear Information System (INIS)

    1998-01-01

    The present collection of rapid communications from JINR, Dubna, contains six separate records on test of a threshold aerogel Cherenkov counter on cosmic particles, first results of study of transversal dimension of region of cumulative particles production in d + C and d + Cu reactions for energy 2 GeV/nucleon, the evidence of σ[0 + (0 ++ 0)] meson at a mass of M π + π - = 750 ± 5 MeV/c 2 observed in π + π - combinations from the reaction np → npπ + π - at an incident momentum of P n (5.20 ± 0.16 GeV/c, inclusive spectra of protons and π - mesons emitted in 4 HeC and 12 CC interactions with total disintegration of nuclei, heavy quark-antiquark pair production by double pomeron exchange in pp and AA collisions on the CMS and global features of nucleus-nucleus collisions in ultrarelativistic domain

  3. Rapid Refresh (RAP) [13 km

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Rapid Refresh (RAP) numerical weather model took the place of the Rapid Update Cycle (RUC) on May 1, 2012. Run by the National Centers for Environmental...

  4. Rapid Refresh (RAP) [20 km

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Rapid Refresh (RAP) numerical weather model took the place of the Rapid Update Cycle (RUC) on May 1, 2012. Run by the National Centers for Environmental...

  5. Rapid population growth.

    Science.gov (United States)

    1972-01-01

    At the current rate of population growth, world population by 2000 is expected to reach 7 billion or more, with developing countries accounting for some 5.4 billion, and economically advanced nations accounting for 1.6 billion. 'Population explosion' is the result of falling mortality rates and continuing high birth rates. Many European countries, and Japan, have already completed what is termed as demographic transition, that is, birth rates have fallen to below 20 births per 1000 population, death rates to 10/1000 population, and annual growth rates are 1% or less; annual growth rates for less developed countries ranged from 2 to 3.5%. Less developed countries can be divided into 3 groups: 1) countries with both high birth and death rates; 2) countries with high birth rates and low death rates; and 3) countries with intermediate and declining birth rates and low death rates. Rapid population growth has serious economic consequences. It encourages inequities in income distribution; it limits rate of growth of gross national product by holding down level of savings and capital investments; it exerts pressure on agricultural production and land; and it creates unemployment problems. In addition, the quality of education for increasing number of chidren is adversely affected, as high proportions of children reduce the amount that can be spent for the education of each child out of the educational budget; the cost and adequacy of health and welfare services are affected in a similar way. Other serious consequences of rapid population growth are maternal death and illness, and physical and mental retardation of children of very poor families. It is very urgent that over a billion births be prevented in the next 30 years to reduce annual population growth rate from the current 2% to 1% per year.

  6. Rapid geophysical surveyor

    International Nuclear Information System (INIS)

    Roybal, L.G.; Carpenter, G.S.; Josten, N.E.

    1993-01-01

    The Rapid Geophysical Surveyor (RGS) is a system designed to rapidly and economically collect closely-spaced geophysical data used for characterization of Department of Energy (DOE) waste sites. Geophysical surveys of waste sites are an important first step in the remediation and closure of these sites; especially older sties where historical records are inaccurate and survey benchmarks have changed due to refinements in coordinate controls and datum changes. Closely-spaced data are required to adequately differentiate pits, trenches, and soil vault rows whose edges may be only a few feet from each other. A prototype vehicle designed to collect magnetic field data was built at the Idaho national Engineering Laboratory (INEL) during the summer of 1992. The RGS was one of several projects funded by the Buried Waste Integrated Demonstration (BWID) program. This vehicle was demonstrated at the Subsurface Disposal Area (SDA) within the Radioactive Waste Management Complex (RWMC) on the INEL in September of 1992. Magnetic data were collected over two areas in the SDA, with a total survey area of about 1.7 acres. Data were collected at a nominal density of 2 1/2 inches along survey lines spaced 1 foot apart. Over 350,000 data points were collected over a 6 day period corresponding to about 185 man-days using conventional ground survey techniques. This report documents the design and demonstration of the RGS concept including the presentation of magnetic data collected at the SDA. The surveys were able to show pit and trench boundaries and determine details of their spatial orientation never before achieved

  7. A role for recombination junctions in the segregation of mitochondrial DNA in yeast.

    Science.gov (United States)

    Lockshon, D; Zweifel, S G; Freeman-Cook, L L; Lorimer, H E; Brewer, B J; Fangman, W L

    1995-06-16

    In S. cerevisiae, mitochondrial DNA (mtDNA) molecules, in spite of their high copy number, segregate as if there were a small number of heritable units. The rapid segregation of mitochondrial genomes can be analyzed using mtDNA deletion variants. These small, amplified genomes segregate preferentially from mixed zygotes relative to wild-type mtDNA. This segregation advantage is abolished by mutations in a gene, MGT1, that encodes a recombination junction-resolving enzyme. We show here that resolvase deficiency causes a larger proportion of molecules to be linked together by recombination junctions, resulting in the aggregation of mtDNA into a small number of cytological structures. This change in mtDNA structure can account for the increased mitotic loss of mtDNA and the altered pattern of mtDNA segregation from zygotes. We propose that the level of unresolved recombination junctions influences the number of heritable units of mtDNA.

  8. DNA topology and transcription

    Science.gov (United States)

    Kouzine, Fedor; Levens, David; Baranello, Laura

    2014-01-01

    Chromatin is a complex assembly that compacts DNA inside the nucleus while providing the necessary level of accessibility to regulatory factors conscripted by cellular signaling systems. In this superstructure, DNA is the subject of mechanical forces applied by variety of molecular motors. Rather than being a rigid stick, DNA possesses dynamic structural variability that could be harnessed during critical steps of genome functioning. The strong relationship between DNA structure and key genomic processes necessitates the study of physical constrains acting on the double helix. Here we provide insight into the source, dynamics, and biology of DNA topological domains in the eukaryotic cells and summarize their possible involvement in gene transcription. We emphasize recent studies that might inspire and impact future experiments on the involvement of DNA topology in cellular functions. PMID:24755522

  9. Eukaryotic DNA Replication Fork.

    Science.gov (United States)

    Burgers, Peter M J; Kunkel, Thomas A

    2017-06-20

    This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.

  10. Optimised Pre-Analytical Methods Improve KRAS Mutation Detection in Circulating Tumour DNA (ctDNA) from Patients with Non-Small Cell Lung Cancer (NSCLC)

    Science.gov (United States)

    Sherwood, James L.; Corcoran, Claire; Brown, Helen; Sharpe, Alan D.; Musilova, Milena; Kohlmann, Alexander

    2016-01-01

    Introduction Non-invasive mutation testing using circulating tumour DNA (ctDNA) is an attractive premise. This could enable patients without available tumour sample to access more treatment options. Materials & Methods Peripheral blood and matched tumours were analysed from 45 NSCLC patients. We investigated the impact of pre-analytical variables on DNA yield and/or KRAS mutation detection: sample collection tube type, incubation time, centrifugation steps, plasma input volume and DNA extraction kits. Results 2 hr incubation time and double plasma centrifugation (2000 x g) reduced overall DNA yield resulting in lowered levels of contaminating genomic DNA (gDNA). Reduced “contamination” and increased KRAS mutation detection was observed using cell-free DNA Blood Collection Tubes (cfDNA BCT) (Streck), after 72 hrs following blood draw compared to EDTA tubes. Plasma input volume and use of different DNA extraction kits impacted DNA yield. Conclusion This study demonstrated that successful ctDNA recovery for mutation detection in NSCLC is dependent on pre-analytical steps. Development of standardised methods for the detection of KRAS mutations from ctDNA specimens is recommended to minimise the impact of pre-analytical steps on mutation detection rates. Where rapid sample processing is not possible the use of cfDNA BCT tubes would be advantageous. PMID:26918901

  11. Optimised Pre-Analytical Methods Improve KRAS Mutation Detection in Circulating Tumour DNA (ctDNA from Patients with Non-Small Cell Lung Cancer (NSCLC.

    Directory of Open Access Journals (Sweden)

    James L Sherwood

    Full Text Available Non-invasive mutation testing using circulating tumour DNA (ctDNA is an attractive premise. This could enable patients without available tumour sample to access more treatment options.Peripheral blood and matched tumours were analysed from 45 NSCLC patients. We investigated the impact of pre-analytical variables on DNA yield and/or KRAS mutation detection: sample collection tube type, incubation time, centrifugation steps, plasma input volume and DNA extraction kits.2 hr incubation time and double plasma centrifugation (2000 x g reduced overall DNA yield resulting in lowered levels of contaminating genomic DNA (gDNA. Reduced "contamination" and increased KRAS mutation detection was observed using cell-free DNA Blood Collection Tubes (cfDNA BCT (Streck, after 72 hrs following blood draw compared to EDTA tubes. Plasma input volume and use of different DNA extraction kits impacted DNA yield.This study demonstrated that successful ctDNA recovery for mutation detection in NSCLC is dependent on pre-analytical steps. Development of standardised methods for the detection of KRAS mutations from ctDNA specimens is recommended to minimise the impact of pre-analytical steps on mutation detection rates. Where rapid sample processing is not possible the use of cfDNA BCT tubes would be advantageous.

  12. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Science.gov (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  13. DNA-based machines.

    Science.gov (United States)

    Wang, Fuan; Willner, Bilha; Willner, Itamar

    2014-01-01

    The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.

  14. Nonisotopic DNA probe techniques

    National Research Council Canada - National Science Library

    Kricka, Larry J

    1992-01-01

    The objective of this book is to bring together descriptions of the principal nonisotopic methods for DNA hybridization assays, together with experimental details of the methods, including labelling...

  15. DNA replication and cancer

    DEFF Research Database (Denmark)

    Boyer, Anne-Sophie; Walter, David; Sørensen, Claus Storgaard

    2016-01-01

    A dividing cell has to duplicate its DNA precisely once during the cell cycle to preserve genome integrity avoiding the accumulation of genetic aberrations that promote diseases such as cancer. A large number of endogenous impacts can challenge DNA replication and cells harbor a battery of pathways...... causing DNA replication stress and genome instability. Further, we describe cellular and systemic responses to these insults with a focus on DNA replication restart pathways. Finally, we discuss the therapeutic potential of exploiting intrinsic replicative stress in cancer cells for targeted therapy....

  16. Forensic DNA testing.

    Science.gov (United States)

    Butler, John M

    2011-12-01

    Forensic DNA testing has a number of applications, including parentage testing, identifying human remains from natural or man-made disasters or terrorist attacks, and solving crimes. This article provides background information followed by an overview of the process of forensic DNA testing, including sample collection, DNA extraction, PCR amplification, short tandem repeat (STR) allele separation and sizing, typing and profile interpretation, statistical analysis, and quality assurance. The article concludes with discussions of possible problems with the data and other forensic DNA testing techniques.

  17. Structure of DNA toroids and electrostatic attraction of DNA duplexes

    International Nuclear Information System (INIS)

    Cherstvy, A G

    2005-01-01

    DNA-DNA electrostatic attraction is considered as the driving force for the formation of DNA toroids in the presence of DNA condensing cations. This attraction comes from the DNA helical charge distribution and favours hexagonal toroidal cross-sections. The latter is in agreement with recent cryo-electron microscopy studies on DNA condensed with cobalt hexammine. We treat the DNA-DNA interactions within the modern theory of electrostatic interaction between helical macromolecules. The size and thickness of the toroids is calculated within a simple model; other models of stability of DNA toroids are discussed and compared

  18. DNA fingerprinting in botany: past, present, future.

    Science.gov (United States)

    Nybom, Hilde; Weising, Kurt; Rotter, Björn

    2014-01-03

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67-73 and Nature 1985, 316:76-79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined "Fingerprint News" was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on "DNA fingerprinting: approaches and applications". Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting ("the past") was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as "DNA fingerprinting in the present", and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA sequencing

  19. Next Generation DNA Sequencing and the Future of Genomic Medicine

    OpenAIRE

    Anderson, Matthew W.; Schrijver, Iris

    2010-01-01

    In the years since the first complete human genome sequence was reported, there has been a rapid development of technologies to facilitate high-throughput sequence analysis of DNA (termed “next-generation” sequencing). These novel approaches to DNA sequencing offer the promise of complete genomic analysis at a cost feasible for routine clinical diagnostics. However, the ability to more thoroughly interrogate genomic sequence raises a number of important issues with regard to result interpreta...

  20. Rapid Evaporation of microbubbles

    Science.gov (United States)

    Gautam, Jitendra; Esmaeeli, Asghar

    2008-11-01

    When a liquid is heated to a temperature far above its boiling point, it evaporates abruptly. Boiling of liquid at high temperatures can be explosive and destructive, and poses a potential hazard for a host of industrial processes. Explosive boiling may occur if a cold and volatile liquid is brought into contact with a hot and non-volatile liquid, or if a liquid is superheated or depressurized rapidly. Such possibilities are realized, for example, in the depressurization of low boiling point liquefied natural gas (LNG) in the pipelines or storage tanks as a result of a leak. While boiling of highly heated liquids can be destructive at macroscale, the (nearly) instantaneous pace of the process and the release of large amount of kinetic energy make the phenomena extremely attractive at microscale where it is possible to utilize the released energy to derive micromechanical systems. For instance, there is currently a growing interest in micro-explosion of liquid for generation of micro bubbles for actuation purposes. The aim of the current study is to gain a fundamental understanding of the subject using direct numerical simulations. In particular, we seek to investigate the boundary between stable and unstable nucleus growth in terms of the degree of liquid superheat and to compare the dynamics of unstable and stable growth.

  1. Rapid flow imaging method

    International Nuclear Information System (INIS)

    Pelc, N.J.; Spritzer, C.E.; Lee, J.N.

    1988-01-01

    A rapid, phase-contrast, MR imaging method of imaging flow has been implemented. The method, called VIGRE (velocity imaging with gradient recalled echoes), consists of two interleaved, narrow flip angle, gradient-recalled acquisitions. One is flow compensated while the second has a specified flow encoding (both peak velocity and direction) that causes signals to contain additional phase in proportion to velocity in the specified direction. Complex image data from the first acquisition are used as a phase reference for the second, yielding immunity from phase accumulation due to causes other than motion. Images with pixel values equal to MΔΘ where M is the magnitude of the flow compensated image and ΔΘ is the phase difference at the pixel, are produced. The magnitude weighting provides additional vessel contrast, suppresses background noise, maintains the flow direction information, and still allows quantitative data to be retrieved. The method has been validated with phantoms and is undergoing initial clinical evaluation. Early results are extremely encouraging

  2. JINR rapid communications

    International Nuclear Information System (INIS)

    1995-01-01

    The present collection of rapid communications from JINR, Dubna, contains twelve separate reports on an estimation of the possibility of fusion reactions in water molecules, an analysis of pion spectra of the charge-exchange reaction Mg(t, 3 He), the results of simulation of e + e - pair production and detection in the ALICE experiment, the data on the edge effects in multiwire proportional chambers, standard and nonstandard applications of wavelet analysis, the design and study of light readout system for scintillator shower maximum detector for the endcap electromagnetic calorimeter for the STAR experiment at RHIC, a study of multiparticle azimuthal correlations in high energy interactions, coherent multifragmentation of relativistic nuclei, superposition of neutrino eigenstates and neutrino oscillation, simulation results and suggestions for possible design of gaseous shower maximum detector for the endcap electromagnetic calorimeter for the STAR experiment at RHIC, determination of the sizes of the pion emission region in np-interactions at P n =(5.2±0.16)GeV/c using the interference correlation method for identical particles, inelasticity of nucleus-nucleus collisions in the CMS experiment. 65 figs., 19 tabs

  3. Rapid Polymer Sequencer

    Science.gov (United States)

    Stolc, Viktor (Inventor); Brock, Matthew W (Inventor)

    2013-01-01

    Method and system for rapid and accurate determination of each of a sequence of unknown polymer components, such as nucleic acid components. A self-assembling monolayer of a selected substance is optionally provided on an interior surface of a pipette tip, and the interior surface is immersed in a selected liquid. A selected electrical field is impressed in a longitudinal direction, or in a transverse direction, in the tip region, a polymer sequence is passed through the tip region, and a change in an electrical current signal is measured as each polymer component passes through the tip region. Each of the measured changes in electrical current signals is compared with a database of reference electrical change signals, with each reference signal corresponding to an identified polymer component, to identify the unknown polymer component with a reference polymer component. The nanopore preferably has a pore inner diameter of no more than about 40 nm and is prepared by heating and pulling a very small section of a glass tubing.

  4. Physical signals for protein–DNA recognition

    International Nuclear Information System (INIS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

    2009-01-01

    This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein–DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do

  5. On site DNA barcoding by nanopore sequencing.

    Directory of Open Access Journals (Sweden)

    Michele Menegon

    Full Text Available Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet's biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities.

  6. DNA Barcoding of Marine Metazoa

    Science.gov (United States)

    Bucklin, Ann; Steinke, Dirk; Blanco-Bercial, Leocadio

    2011-01-01

    More than 230,000 known species representing 31 metazoan phyla populate the world's oceans. Perhaps another 1,000,000 or more species remain to be discovered. There is reason for concern that species extinctions may outpace discovery, especially in diverse and endangered marine habitats such as coral reefs. DNA barcodes (i.e., short DNA sequences for species recognition and discrimination) are useful tools to accelerate species-level analysis of marine biodiversity and to facilitate conservation efforts. This review focuses on the usual barcode region for metazoans: a ˜648 base-pair region of the mitochondrial cytochrome c oxidase subunit I (COI) gene. Barcodes have also been used for population genetic and phylogeographic analysis, identification of prey in gut contents, detection of invasive species, forensics, and seafood safety. More controversially, barcodes have been used to delimit species boundaries, reveal cryptic species, and discover new species. Emerging frontiers are the use of barcodes for rapid and increasingly automated biodiversity assessment by high-throughput sequencing, including environmental barcoding and the use of barcodes to detect species for which formal identification or scientific naming may never be possible.

  7. Effects of thiourea and ammonium bicarbonate on the formation and stability of bifunctional cisplatin-DNA adducts : consequences for the accurate quantification of adducts in (cellular) DNA

    NARCIS (Netherlands)

    Fichtinger-Schepman, A.M.J.; Dijk-Knijnenburg, H.C.M. van; Dijt, F.J.; Velde-Visser, S.D. van der; Berends, F.; Baan, R.A.

    1995-01-01

    Cisplatin reacts with DNA by forming mainly bifunctional adducts via reactive monofunctional intermediates. When freshly platinated DNA was postincubated with thiourea (10 mM, at 23 or 37°C) for periods of up to 24 h, followed by determination of mono- and diadducts, a rapid initial decrease was

  8. Extended DNA Tile Actuators

    DEFF Research Database (Denmark)

    Kristiansen, Martin; Kryger, Mille; Zhang, Zhao

    2012-01-01

    A dynamic linear DNA tile actuator is expanded to three new structures of higher complexity. The original DNA actuator was constructed from a central roller strand which hybridizes with two piston strands by forming two half-crossover junctions. A linear expansion of the actuator is obtained...

  9. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  10. DNA Repair Systems

    Indian Academy of Sciences (India)

    Thanks to the pioneering research work of Lindahl, Sancar, Modrich and their colleagues, we now have an holistic awareness of how DNA damage occurs and how the damage is rectified in bacteria as well as in higher organisms including human beings. A comprehensive understanding of DNA repair has proven crucial ...

  11. DNA repair genes

    International Nuclear Information System (INIS)

    Morimyo, Mitsuoki

    1995-01-01

    Fission yeast S. pombe is assumed to be a good model for cloning of human DNA repair genes, because human gene is normally expressed in S. pombe and has a very similar protein sequence to yeast protein. We have tried to elucidate the DNA repair mechanisms of S. pombe as a model system for those of mammals. (J.P.N.)

  12. DNA-cell conjugates

    Science.gov (United States)

    Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki

    2018-05-15

    The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.

  13. Characterization of muntjac DNA

    International Nuclear Information System (INIS)

    Davis, R.C.

    1981-01-01

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange

  14. DNA-cell conjugates

    Science.gov (United States)

    Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki

    2016-05-03

    The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.

  15. Characterization of muntjac DNA

    Energy Technology Data Exchange (ETDEWEB)

    Davis, R.C.

    1981-05-27

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange.

  16. Whose DNA is this?

    DEFF Research Database (Denmark)

    Taroni, Franco; Biedermann, Alex; Vuille, Joëlle

    2013-01-01

    This communication seeks to draw the attention of researchers and practitioners dealing with forensic DNA profiling analyses to the following question: is a scientist's report, offering support to a hypothesis according to which a particular individual is the source of DNA detected during...... evoked during the international conference "The hidden side of DNA profiles. Artifacts, errors and uncertain evidence" held in Rome (April 27th to 28th, 2012). Indeed, despite the fact that this conference brought together some of the world's leading forensic DNA specialists, it appeared clearly...... talk considerably different languages. It thus is fundamental to address this issue of communication about results of forensic DNA analyses, and open a dialogue with practicing non-scientists at large who need to make meaningful use of scientific results to approach and help solve judicial cases...

  17. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  18. Racemic DNA crystallography.

    Science.gov (United States)

    Mandal, Pradeep K; Collie, Gavin W; Kauffmann, Brice; Huc, Ivan

    2014-12-22

    Racemates increase the chances of crystallization by allowing molecular contacts to be formed in a greater number of ways. With the advent of protein synthesis, the production of protein racemates and racemic-protein crystallography are now possible. Curiously, racemic DNA crystallography had not been investigated despite the commercial availability of L- and D-deoxyribo-oligonucleotides. Here, we report a study into racemic DNA crystallography showing the strong propensity of racemic DNA mixtures to form racemic crystals. We describe racemic crystal structures of various DNA sequences and folded conformations, including duplexes, quadruplexes, and a four-way junction, showing that the advantages of racemic crystallography should extend to DNA. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Excitonic AND Logic Gates on DNA Brick Nanobreadboards

    Science.gov (United States)

    2015-01-01

    A promising application of DNA self-assembly is the fabrication of chromophore-based excitonic devices. DNA brick assembly is a compelling method for creating programmable nanobreadboards on which chromophores may be rapidly and easily repositioned to prototype new excitonic devices, optimize device operation, and induce reversible switching. Using DNA nanobreadboards, we have demonstrated each of these functions through the construction and operation of two different excitonic AND logic gates. The modularity and high chromophore density achievable via this brick-based approach provide a viable path toward developing information processing and storage systems. PMID:25839049

  20. DNA Damage among Wood Workers Assessed with the Comet Assay

    Science.gov (United States)

    Bruschweiler, Evin Danisman; Wild, Pascal; Huynh, Cong Khanh; Savova-Bianchi, Dessislava; Danuser, Brigitta; Hopf, Nancy B.

    2016-01-01

    Exposure to wood dust, a human carcinogen, is common in wood-related industries, and millions of workers are occupationally exposed to wood dust worldwide. The comet assay is a rapid, simple, and sensitive method for determining DNA damage. The objective of this study was to investigate the DNA damage associated with occupational exposure to wood dust using the comet assay (peripheral blood samples) among nonsmoking wood workers (n = 31, furniture and construction workers) and controls (n = 19). DNA damage was greater in the group exposed to composite wood products compared to the group exposed to natural woods and controls (P < 0.001). No difference in DNA damage was observed between workers exposed to natural woods and controls (P = 0.13). Duration of exposure and current dust concentrations had no effect on DNA damage. In future studies, workers’ exposures should include cumulative dust concentrations and exposures originating from the binders used in composite wood products. PMID:27398027

  1. Forensic utilization of familial searches in DNA databases.

    Science.gov (United States)

    Gershaw, Cassandra J; Schweighardt, Andrew J; Rourke, Linda C; Wallace, Margaret M

    2011-01-01

    DNA evidence is widely recognized as an invaluable tool in the process of investigation and identification, as well as one of the most sought after types of evidence for presentation to a jury. In the United States, the development of state and federal DNA databases has greatly impacted the forensic community by creating an efficient, searchable system that can be used to eliminate or include suspects in an investigation based on matching DNA profiles - the profile already in the database to the profile of the unknown sample in evidence. Recent changes in legislation have begun to allow for the possibility to expand the parameters of DNA database searches, taking into account the possibility of familial searches. This article discusses prospective positive outcomes of utilizing familial DNA searches and acknowledges potential negative outcomes, thereby presenting both sides of this very complicated, rapidly evolving situation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  2. Secondary and subsequent DNA transfer during criminal investigation.

    Science.gov (United States)

    Fonneløp, Ane Elida; Egeland, Thore; Gill, Peter

    2015-07-01

    With the introduction of new multiplex PCR kits and instrumentation such as the Applied Biosystems 3500xl, there has recently been a rapid change in technology that has greatly increased sensitivity of detection so that a DNA profile can routinely be obtained from only a few cells. Research to evaluate the risks of passive transfer has not kept pace with this development; hence the risk of innocent DNA transfer at the crime-scene is currently not properly understood. The purpose of this study was to investigate the possibility of investigator-mediated transfer of DNA traces with disposable nitrile-gloves used during crime-scene examinations. We investigated the primary transfer of freshly deposited DNA from touched plastic, wood or metal substrates and secondary and tertiary transfer by a person wearing disposable nitrile-gloves and onto a third object. We show that with use of the new highly sensitive technologies available in forensic DNA analysis there is an enhanced probability to obtain a DNA-profile which has not been directly deposited on the object but is an outcome of one or more transfer events. The nitrile-gloves used by investigators during exhibit examination can act as a vector for DNA transfer from one item to another. We have shown that the amount of DNA deposited on an object affects the probability of transfer. Secondly, the type of substrate material that DNA is deposited onto has an impact on transfer rates. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Dynamics of extracellular DNA in the marine environment

    International Nuclear Information System (INIS)

    Paul, J.H.; Jeffrey, W.H.; DeFlaun, M.F.

    1987-01-01

    The production and turnover of dissolved DNA in subtropical estuarine and oligotrophic oceanic environments were investigated. Actively growing heterotrophic bacterioplankton (i.e., those capable of [ 3 H]thymidine incorporation) were found to produce dissolved DNA, presumably through the processes of death and lysis, grazing by bacteriovores, and excretion. Production of dissolved DNA as determined by [ 3 H]thymidine incorporation was ≤4% of the ambient dissolved DNA concentration per day. In turnover studies, the addition of [ 3 H]DNA (Escherichia coli chromosomal) to seawater resulted in rapid hydrolysis and uptake of radioactivity by microbial populations. DNA was hydrolyzed by both cell-associated and extracellular nucleases, in both estuarine and offshore environments. Kinetic analysis performed for a eutrophic estuary indicated a turnover time for dissolved DNA as short as 6.5 h. Microautoradiographic studies of bacterial populations in Tampa Bay indicated that filamentous and attached bacteria took up most of the radioactivity from [ 3 H]DNA. Dissolved DNA is therefore a dynamic component of the dissolved organic matter in the marine environment, and bacterioplankton play a key role in the cycling of this material

  4. MICA: desktop software for comprehensive searching of DNA databases

    Directory of Open Access Journals (Sweden)

    Glick Benjamin S

    2006-10-01

    Full Text Available Abstract Background Molecular biologists work with DNA databases that often include entire genomes. A common requirement is to search a DNA database to find exact matches for a nondegenerate or partially degenerate query. The software programs available for such purposes are normally designed to run on remote servers, but an appealing alternative is to work with DNA databases stored on local computers. We describe a desktop software program termed MICA (K-Mer Indexing with Compact Arrays that allows large DNA databases to be searched efficiently using very little memory. Results MICA rapidly indexes a DNA database. On a Macintosh G5 computer, the complete human genome could be indexed in about 5 minutes. The indexing algorithm recognizes all 15 characters of the DNA alphabet and fully captures the information in any DNA sequence, yet for a typical sequence of length L, the index occupies only about 2L bytes. The index can be searched to return a complete list of exact matches for a nondegenerate or partially degenerate query of any length. A typical search of a long DNA sequence involves reading only a small fraction of the index into memory. As a result, searches are fast even when the available RAM is limited. Conclusion MICA is suitable as a search engine for desktop DNA analysis software.

  5. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    Science.gov (United States)

    Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

  6. Dynamic and Progressive Control of DNA Origami Conformation by Modulating DNA Helicity with Chemical Adducts.

    Science.gov (United States)

    Chen, Haorong; Zhang, Hanyu; Pan, Jing; Cha, Tae-Gon; Li, Shiming; Andréasson, Joakim; Choi, Jong Hyun

    2016-05-24

    DNA origami has received enormous attention for its ability to program complex nanostructures with a few nanometer precision. Dynamic origami structures that change conformation in response to environmental cues or external signals hold great promises in sensing and actuation at the nanoscale. The reconfiguration mechanism of existing dynamic origami structures is mostly limited to single-stranded hinges and relies almost exclusively on DNA hybridization or strand displacement. Here, we show an alternative approach by demonstrating on-demand conformation changes with DNA-binding molecules, which intercalate between base pairs and unwind DNA double helices. The unwinding effect modulates the helicity mismatch in DNA origami, which significantly influences the internal stress and the global conformation of the origami structure. We demonstrate the switching of a polymerized origami nanoribbon between different twisting states and a well-constrained torsional deformation in a monomeric origami shaft. The structural transformation is shown to be reversible, and binding isotherms confirm the reconfiguration mechanism. This approach provides a rapid and reversible means to change DNA origami conformation, which can be used for dynamic and progressive control at the nanoscale.

  7. DNA repair is responsible for the presence of oxidatively damaged DNA lesions in urine

    International Nuclear Information System (INIS)

    Cooke, Marcus S.; Evans, Mark D.; Dove, Rosamund; Rozalski, Rafal; Gackowski, Daniel; Siomek, Agnieszka; Lunec, Joseph; Olinski, Ryszard

    2005-01-01

    The repair of oxidatively damaged DNA is integral to the maintenance of genomic stability, and hence prevention of a wide variety of pathological conditions, such as aging, cancer and cardiovascular disease. The ability to non-invasively assess DNA repair may provide information regarding repair pathways, variability in repair capacity, and susceptibility to disease. The development of assays to measure urinary DNA lesions offered this potential, although it rapidly became clear that possible contribution from diet and cell turnover may influence urinary lesion levels. Whilst early studies attempted to address these issues, up until now, much of the data appears conflicting. However, recent work from our laboratories, in which human volunteers were fed highly oxidatively modified 15 N-labelled DNA demonstrates that diet does not appear to contribute to urinary levels of 8-hydroxyguanine and 7,8-dihydro-8-oxo-2'-deoxyguanosine. Furthermore, we propose that a number of literature reports form an argument against a contribution from cell death. Indeed we, and others, have presented evidence, which strongly suggests the involvement of cell death to be minimal. Taken together, these data would appear to rule out various confounding factors, leaving DNA repair pathways as the principal source of urinary purine, if not DNA, lesions enabling such measurements to be used as indicators of repair

  8. Hda inactivation of DnaA is the predominant mechanism preventing hyperinitiation of Escherichia coli DNA replication.

    Science.gov (United States)

    Camara, Johanna E; Breier, Adam M; Brendler, Therese; Austin, Stuart; Cozzarelli, Nicholas R; Crooke, Elliott

    2005-08-01

    Initiation of DNA replication from the Escherichia coli chromosomal origin is highly regulated, assuring that replication occurs precisely once per cell cycle. Three mechanisms for regulation of replication initiation have been proposed: titration of free DnaA initiator protein by the datA locus, sequestration of newly replicated origins by SeqA protein and regulatory inactivation of DnaA (RIDA), in which active ATP-DnaA is converted to the inactive ADP-bound form. DNA microarray analyses showed that the level of initiation in rapidly growing cells that lack datA was indistinguishable from that in wild-type cells, and that the absence of SeqA protein caused only a modest increase in initiation, in agreement with flow-cytometry data. In contrast, cells lacking Hda overinitiated replication twofold, implicating RIDA as the predominant mechanism preventing extra initiation events in a cell cycle.

  9. Analysis of the distribution of DNA repair patches in the DNA-nuclear matrix complex from human cells

    International Nuclear Information System (INIS)

    Mullenders, L.H.F.

    1983-01-01

    The distribution of ultraviolet-induced repair patches along DNA loops attached to the nuclear matrix, was investigated by digestion with DNA-degrading enzymes and neutral sucrose gradient centrifugation. When DNA was gradually removed by DNAase 1, pulse label incorporated by ultraviolet-irradiated cells during 10 min in the presence of hydroxyurea or hydroxyurea/arabinosylcytosine showed similar degradation kinetics as prelabelled DNA. No preferential association of pulse label with the nuclear matrix was observed, neither within 30 min nor 13 h after iiradiation. When the pulse label was incorporated by replicative synthesis under the same conditions, a preferential association of newly-synthesized DNA with the nuclear matrix was observed. Single-strand specific digestion with nuclease S 1 of nuclear lysates from ultraviolet-irradiated cells, pulse labelled in the presence of hydroxyurea/arabinosylcytosine, caused a release of about 70% of the prelabelled DNA and 90% of the pulse-labelled DNA from the rapidly sedimenting material in sucrose gradients. The results suggest no specific involvement of the nuclear matrix in repair synthesis, a random distribution of repair patches along the DNA loops, and simultaneously multiple incision events per DNA loop. (Auth.)

  10. Analysis of the distribution of DNA repair patches in the DNA-nuclear matrix complex from human cells

    Energy Technology Data Exchange (ETDEWEB)

    Mullenders, L.H.F. (Rijksuniversiteit Leiden (Netherlands). Lab. voor Stralengenetica en Chemische Mutagenese); Zeeland, A.A. van; Natarajan, A.T. (Cohen (J.A.) Inst. voor Radiopathologie en Stralenbescherming, Leiden (Netherlands))

    1983-09-09

    The distribution of ultraviolet-induced repair patches along DNA loops attached to the nuclear matrix, was investigated by digestion with DNA-degrading enzymes and neutral sucrose gradient centrifugation. When DNA was gradually removed by DNAase 1, pulse label incorporated by ultraviolet-irradiated cells during 10 min in the presence of hydroxyurea or hydroxyurea/arabinosylcytosine showed similar degradation kinetics as prelabelled DNA. No preferential association of pulse label with the nuclear matrix was observed, neither within 30 min nor 13 h after irradiation. When the pulse label was incorporated by replicative synthesis under the same conditions, a preferential association of newly-synthesized DNA with the nuclear matrix was observed. Single-strand specific digestion with nuclease S/sub 1/ of nuclear lysates from ultraviolet-irradiated cells, pulse labelled in the presence of hydroxyurea/arabinosylcytosine, caused a release of about 70% of the prelabelled DNA and 90% of the pulse-labelled DNA from the rapidly sedimenting material in sucrose gradients. The results suggest no specific involvement of the nuclear matrix in repair synthesis, a random distribution of repair patches along the DNA loops, and simultaneously multiple incision events per DNA loop.

  11. Internal validation of the RapidHIT® ID system.

    Science.gov (United States)

    Wiley, Rachel; Sage, Kelly; LaRue, Bobby; Budowle, Bruce

    2017-11-01

    Traditionally, forensic DNA analysis has required highly skilled forensic geneticists in a dedicated laboratory to generate short tandem repeat (STR) profiles. STR profiles are routinely used either to associate or exclude potential donors of forensic biological evidence. The typing of forensic reference samples has become more demanding, especially with the requirement in some jurisdictions to DNA profile arrestees. The Rapid DNA (RDNA) platform, the RapidHIT ® ID (IntegenX ® , Pleasanton, CA), is a fully automated system capable of processing reference samples in approximately 90min with minimal human intervention. Thus, the RapidHIT ID instrument can be deployed to non-laboratory environments (e.g., booking stations) and run by trained atypical personnel such as law enforcement. In order to implement the RapidHIT ID platform, validation studies are needed to define the performance and limitations of the system. Internal validation studies were undertaken with four early-production RapidHIT ID units. Reliable and concordant STR profiles were obtained from reference buccal swabs. Throughout the study, no contamination was observed. The overall first-pass success rate with an "expert-like system" was 72%, which is comparable to another current RDNA platform commercially available. The system's second-pass success rate (involving manual interpretation on first-pass inconclusive results) increased to 90%. Inhibitors (i.e., coffee, smoking tobacco, and chewing tobacco) did not appear to affect typing by the instrument system; however, substrate (i.e., swab type) did impact typing success. Additionally, one desirable feature not available with other Rapid systems is that in the event of a system failed run, a swab can be recovered and subsequently re-analyzed in a new sample cartridge. Therefore, rarely should additional sampling or swab consumption be necessary. The RapidHIT ID system is a robust and reliable tool capable of generating complete STR profiles within

  12. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

    Science.gov (United States)

    Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

    2018-01-01

    ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

  13. Analysis of DNA vulnerability to damage, repair and degradation in tissues of irradiated animals

    International Nuclear Information System (INIS)

    Ryabchenko, N.I.; Ivannik, B.P.

    1982-01-01

    Single-strand and paired ruptures of DNA were found to result in appearance of locally denaturated areas in its secondary structure and to disordered protein-DNA interaction. It was shown with the use of the viscosimeter method of measuring the molecular mass of single stranded high-polymeric DNA that cells of various tissues by the intensity of DNA repair can be divided into two groups, rapid- and slow-repair ones. Tissue specificity of enzyme function of the repair systems and systems responsible for post-irradiation DNA degradation depends on the activity of endonucleases synthesized by the cells both in health and in their irradiation-induced synthesis

  14. Intracellular Delivery of a Planar DNA Origami Structure by the Transferrin-Receptor Internalization Pathway

    DEFF Research Database (Denmark)

    Schaffert, David Henning; Okholm, Anders Hauge; Sørensen, Rasmus Schøler

    2016-01-01

    DNA origami provides rapid access to easily functionalized, nanometer-sized structures making it an intriguing platform for the development of defined drug delivery and sensor systems. Low cellular uptake of DNA nanostructures is a major obstacle in the development of DNA-based delivery platforms....... Herein, significant strong increase in cellular uptake in an established cancer cell line by modifying a planar DNA origami structure with the iron transport protein transferrin (Tf) is demonstrated. A variable number of Tf molecules are coupled to the origami structure using a DNA-directed, site...... on the origami surface....

  15. Effect of 5-fluorodeoxyuridine on DNA replication in ultraviolet-irradiated HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Brozmanova, J.; Masek, F.; Synzynys, B.I.; Saenko, A.S.

    1985-11-05

    In HeLa cells precultivated for 6 hours with 5-fluorodeoxyuridine (FUdR) and for 18 hours in FUdR-free medium, DNA synthesis was much more resistant to UV irradiation than that of untreated cells. DNA synthesized in FUdR-pretreated and UV irradiated cells represents a semiconservative DNA replication and shows more rapid shift of the pulse-labelled chased DNA to high molecular weight. This DNA synthesis is not induced by synchronization of the cell cycle. It is assumed that either the changes of chromatine structure, or an enhanced level of some enzymes might be involved in the replication of the damaged template. (author).

  16. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  17. Nanostructures via DNA scaffold metallization

    OpenAIRE

    Ning, C.; Zinchenko, A.; Baigl, D.; Pyshkina, O.; Sergeyev, V.; Endo, Kazunaka; Yoshikawa, K.

    2005-01-01

    The critical role of polymers in process of noble metals nanostructures formation is well known, however, the use of DNA chain template in this process is yet largely unknown. In this study we demonstrate different ways of silver deposition on DNA template and report the influence of silver nanostructures formation on DNA conformational state. Metallization of DNA chain proceeds by two different scenarios depending on DNA conformation. If DNA chain is unfolded (elongated) chain, silver reduct...

  18. DNA damage and polyploidization.

    Science.gov (United States)

    Chow, Jeremy; Poon, Randy Y C

    2010-01-01

    A growing body of evidence indicates that polyploidization triggers chromosomal instability and contributes to tumorigenesis. DNA damage is increasingly being recognized for its roles in promoting polyploidization. Although elegant mechanisms known as the DNA damage checkpoints are responsible for halting the cell cycle after DNA damage, agents that uncouple the checkpoints can induce unscheduled entry into mitosis. Likewise, defects of the checkpoints in several disorders permit mitotic entry even in the presence of DNA damage. Forcing cells with damaged DNA into mitosis causes severe chromosome segregation defects, including lagging chromosomes, chromosomal fragments and chromosomal bridges. The presence of these lesions in the cleavage plane is believed to abort cytokinesis. It is postulated that if cytokinesis failure is coupled with defects of the p53-dependent postmitotic checkpoint pathway, cells can enter S phase and become polyploids. Progress in the past several years has unraveled some of the underlying principles of these pathways and underscored the important role of DNA damage in polyploidization. Furthermore, polyploidization per se may also be an important determinant of sensitivity to DNA damage, thereby may offer an opportunity for novel therapies.

  19. Quantitive DNA Fiber Mapping

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  20. Regulating DNA Self-assembly by DNA-Surface Interactions.

    Science.gov (United States)

    Liu, Longfei; Li, Yulin; Wang, Yong; Zheng, Jianwei; Mao, Chengde

    2017-12-14

    DNA self-assembly provides a powerful approach for preparation of nanostructures. It is often studied in bulk solution and involves only DNA-DNA interactions. When confined to surfaces, DNA-surface interactions become an additional, important factor to DNA self-assembly. However, the way in which DNA-surface interactions influence DNA self-assembly is not well studied. In this study, we showed that weak DNA-DNA interactions could be stabilized by DNA-surface interactions to allow large DNA nanostructures to form. In addition, the assembly can be conducted isothermally at room temperature in as little as 5 seconds. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. DNA nanocarriers for systemic administration: characterization and in vivo bioimaging in healthy mice.

    Science.gov (United States)

    David, Stephanie; Passirani, Catherine; Carmoy, Nathalie; Morille, Marie; Mevel, Mathieu; Chatin, Benoit; Benoit, Jean-Pierre; Montier, Tristan; Pitard, Bruno

    2013-01-08

    We hereby present different DNA nanocarriers consisting of new multimodular systems (MMS), containing the cationic lipid dioleylaminesuccinylparomomycin (DNA MMS DOSP), or bis (guanidinium)-tren-cholesterol (DNA MMS BGTC), and DNA lipid nanocapsules (DNA LNCs). Active targeting of the asialoglycoprotein receptor (ASGP-R) using galactose as a ligand for DNA MMS (GAL DNA MMS) and passive targeting using a polyethylene glycol coating for DNA LNCs (PEG DNA LNCs) should improve the properties of these DNA nanocarriers. All systems were characterized via physicochemical methods and the DNA payload of DNA LNCs was quantified for the first time. Afterwards, their biodistribution in healthy mice was analyzed after encapsulation of a fluorescent dye via in vivo biofluorescence imaging (BFI), revealing various distribution profiles depending on the cationic lipid used and their surface characteristics. Furthermore, the two vectors with the best prolonged circulation profile were administered twice in healthy mice revealing that the new DNA MMS DOSP vectors showed no toxicity and the same distribution profile for both injections, contrary to PEG DNA LNCs which showed a rapid clearance after the second injection, certainly due to the accelerated blood clearance phenomenon.Molecular Therapy - Nucleic Acids (2013) 2, e64; doi:10.1038/mtna.2012.56; published online 8 January 2013.

  2. Partial Purification of a Megadalton DNA Replication Complex by Free Flow Electrophoresis.

    Directory of Open Access Journals (Sweden)

    Caroline M Li

    Full Text Available We describe a gentle and rapid method to purify the intact multiprotein DNA replication complex using free flow electrophoresis (FFE. In particular, we applied FFE to purify the human cell DNA synthesome, which is a multiprotein complex that is fully competent to carry-out all phases of the DNA replication process in vitro using a plasmid containing the simian virus 40 (SV40 origin of DNA replication and the viral large tumor antigen (T-antigen protein. The isolated native DNA synthesome can be of use in studying the mechanism by which mammalian DNA replication is carried-out and how anti-cancer drugs disrupt the DNA replication or repair process. Partially purified extracts from HeLa cells were fractionated in a native, liquid based separation by FFE. Dot blot analysis showed co-elution of many proteins identified as part of the DNA synthesome, including proliferating cell nuclear antigen (PCNA, DNA topoisomerase I (topo I, DNA polymerase δ (Pol δ, DNA polymerase ɛ (Pol ɛ, replication protein A (RPA and replication factor C (RFC. Previously identified DNA synthesome proteins co-eluted with T-antigen dependent and SV40 origin-specific DNA polymerase activity at the same FFE fractions. Native gels show a multiprotein PCNA containing complex migrating with an apparent relative mobility in the megadalton range. When PCNA containing bands were excised from the native gel, mass spectrometric sequencing analysis identified 23 known DNA synthesome associated proteins or protein subunits.

  3. DNA Nanocarriers for Systemic Administration: Characterization and In Vivo Bioimaging in Healthy Mice

    Directory of Open Access Journals (Sweden)

    Stephanie David

    2013-01-01

    Full Text Available We hereby present different DNA nanocarriers consisting of new multimodular systems (MMS, containing the cationic lipid dioleylaminesuccinylparomomycin (DNA MMS DOSP, or bis (guanidinium-tren-cholesterol (DNA MMS BGTC, and DNA lipid nanocapsules (DNA LNCs. Active targeting of the asialoglycoprotein receptor (ASGP-R using galactose as a ligand for DNA MMS (GAL DNA MMS and passive targeting using a polyethylene glycol coating for DNA LNCs (PEG DNA LNCs should improve the properties of these DNA nanocarriers. All systems were characterized via physicochemical methods and the DNA payload of DNA LNCs was quantified for the first time. Afterwards, their biodistribution in healthy mice was analyzed after encapsulation of a fluorescent dye via in vivo biofluorescence imaging (BFI, revealing various distribution profiles depending on the cationic lipid used and their surface characteristics. Furthermore, the two vectors with the best prolonged circulation profile were administered twice in healthy mice revealing that the new DNA MMS DOSP vectors showed no toxicity and the same distribution profile for both injections, contrary to PEG DNA LNCs which showed a rapid clearance after the second injection, certainly due to the accelerated blood clearance phenomenon.

  4. Fluorescent carbon nanoparticle-based lateral flow biosensor for ultrasensitive detection of DNA.

    Science.gov (United States)

    Takalkar, Sunitha; Baryeh, Kwaku; Liu, Guodong

    2017-12-15

    We report a fluorescent carbon nanoparticle (FCN)-based lateral flow biosensor for ultrasensitive detection of DNA. Fluorescent carbon nanoparticle with a diameter of around 15nm was used as a tag to label a detection DNA probe, which was complementary with the part of target DNA. A capture DNA probe was immobilized on the test zone of the lateral flow biosensor. Sandwich-type hybridization reactions among the FCN-labeled DNA probe, target DNA and capture DNA probe were performed on the lateral flow biosensor. In the presence of target DNA, FCNs were captured on the test zone of the biosensor and the fluorescent intensity of the captured FCNs was measured with a portable fluorescent reader. After systematic optimizations of experimental parameters (the components of running buffers, the concentration of detection DNA probe used in the preparation of FCN-DNA conjugates, the amount of FCN-DNA dispensed on the conjugate pad and the dispensing cycles of the capture DNA probes on the test-zone), the biosensor could detect a minimum concentration of 0.4 fM DNA. This study provides a rapid and low-cost approach for DNA detection with high sensitivity, showing great promise for clinical application and biomedical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Partial Purification of a Megadalton DNA Replication Complex by Free Flow Electrophoresis.

    Science.gov (United States)

    Li, Caroline M; Miao, Yunan; Lingeman, Robert G; Hickey, Robert J; Malkas, Linda H

    2016-01-01

    We describe a gentle and rapid method to purify the intact multiprotein DNA replication complex using free flow electrophoresis (FFE). In particular, we applied FFE to purify the human cell DNA synthesome, which is a multiprotein complex that is fully competent to carry-out all phases of the DNA replication process in vitro using a plasmid containing the simian virus 40 (SV40) origin of DNA replication and the viral large tumor antigen (T-antigen) protein. The isolated native DNA synthesome can be of use in studying the mechanism by which mammalian DNA replication is carried-out and how anti-cancer drugs disrupt the DNA replication or repair process. Partially purified extracts from HeLa cells were fractionated in a native, liquid based separation by FFE. Dot blot analysis showed co-elution of many proteins identified as part of the DNA synthesome, including proliferating cell nuclear antigen (PCNA), DNA topoisomerase I (topo I), DNA polymerase δ (Pol δ), DNA polymerase ɛ (Pol ɛ), replication protein A (RPA) and replication factor C (RFC). Previously identified DNA synthesome proteins co-eluted with T-antigen dependent and SV40 origin-specific DNA polymerase activity at the same FFE fractions. Native gels show a multiprotein PCNA containing complex migrating with an apparent relative mobility in the megadalton range. When PCNA containing bands were excised from the native gel, mass spectrometric sequencing analysis identified 23 known DNA synthesome associated proteins or protein subunits.

  6. DNA isolation by Chelex-100: an efficient approach to consider in leptospirosis early stages

    Directory of Open Access Journals (Sweden)

    Angel Alberto Noda

    2014-06-01

    Full Text Available Objective: To compare the value of leptospiral DNA extraction procedures from clinical samples for the early diagnosis of leptospirosis. Methods: Three DNA extraction procedures were applied for microbiological analysis, results of QIAmp DNA mini kit (QIAGEN, Germany, CLART HPV kit (GENOMICA, Spain and Chelex-100 assay were compared concerning extraction efficiency, DNA purity and DNA suitability for amplification by specific polymerase chain reaction for pathogenic leptospires from blood, plasma and serum artificially infected. Results: The comparison of extraction methods highlighted the efficiency of Chelex-100 and QIAmp DNA mini kit. Chelex-100 achieved the isolation of the highest concentration of leptospiral DNA from the culture and the spiked samples, with acceptable purities and without inhibitors to PCR. Conclusions: Chelex-100 assay is a rapid and effective approach for DNA isolation in clinical samples having pathogenic leptospires and it could be useful in the early diagnosis of leptospirosis.

  7. Method for assessing damage to mitochondrial DNA caused by radiation and epichlorohydrin

    International Nuclear Information System (INIS)

    Singh, G.; Hauswirth, W.W.; Ross, W.E.; Neims, A.H.

    1985-01-01

    This paper describes a rapid and reliable method for quantification of damage to mitochondrial DNA (mtDNA), especially strand breaks. The degree of damage to mtDNA is assessed by the proportion of physical forms (i.e., supercoiled versus open-circular and linear forms) upon agarose gel electrophoresis, blotting, and visualization by hybridization with [ 32 P]mtDNA probes. The use of a radiolabeled probe is a crucial step in the procedure because it provides both a means to quantify by radioautography and to obtain the mtDNA specificity required to eliminate misinterpretation due to nuclear DNA contamination. To demonstrate the utility of this technique, X-irradiation and epichlorohydrin are shown to damage both isolated mtDNA and mtDNA in whole cells in a dose-dependent fashion

  8. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    Science.gov (United States)

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  9. "Artifactual" arsenate DNA

    DEFF Research Database (Denmark)

    Nielsen, Peter E

    2012-01-01

    The recent claim by Wolfe-Simon et al. that the Halomonas bacterial strain GFAJ-1 when grown in arsenate-containing medium with limiting phosphate is able to substitute phosphate with arsenate in biomolecules including nucleic acids and in particular DNA(1) arose much skepticism, primarily due...... to the very limited chemical stability of arsenate esters (see ref. 2 and references therein). A major part of the criticisms was concerned with the insufficient (bio)chemical evidence in the Wolfe-Simon study for the actual chemical incorporation of arsenate in DNA (and/or RNA). Redfield et al. now present...... evidence that the identification of arsenate DNA was artifactual....

  10. Evidence that DNA polymerase δ contributes to initiating leading strand DNA replication in Saccharomyces cerevisiae.

    Science.gov (United States)

    Garbacz, Marta A; Lujan, Scott A; Burkholder, Adam B; Cox, Phillip B; Wu, Qiuqin; Zhou, Zhi-Xiong; Haber, James E; Kunkel, Thomas A

    2018-02-27

    To investigate nuclear DNA replication enzymology in vivo, we have studied Saccharomyces cerevisiae strains containing a pol2-16 mutation that inactivates the catalytic activities of DNA polymerase ε (Pol ε). Although pol2-16 mutants survive, they present very tiny spore colonies, increased doubling time, larger than normal cells, aberrant nuclei, and rapid acquisition of suppressor mutations. These phenotypes reveal a severe growth defect that is distinct from that of strains that lack only Pol ε proofreading (pol2-4), consistent with the idea that Pol ε is the major leading-strand polymerase used for unstressed DNA replication. Ribonucleotides are incorporated into the pol2-16 genome in patterns consistent with leading-strand replication by Pol δ when Pol ε is absent. More importantly, ribonucleotide distributions at replication origins suggest that in strains encoding all three replicases, Pol δ contributes to initiation of leading-strand replication. We describe two possible models.

  11. Symposium cellular response to DNA damage the role of poly(ADP-ribose) poly(ADP-ribose) in the cellular response to DNA damage

    International Nuclear Information System (INIS)

    Berger, N.A.

    1985-01-01

    Poly(ADP-ribose) polymerase is a chromatin-bound enzyme which, on activation by DNA strand breaks, catalyzes the successive transfer of ADP-ribose units from NAD to nuclear proteins. Poly(ADP-ribose) synthesis is stimulated by DNA strand breaks, and the polymer may alter the structure and/or function of chromosomal proteins to facilitate the DNA repair process. Inhibitors of Poly(ADP-ribose) polymerase or deficiencies of the substrate, NAD, lead to retardation of the DNA repair process. When DNA strand breaks are extensive or when breaks fail to be repaired, the stimulus for activation of Poly(ADP-ribose) persists and the activated enzyme is capable of totaly consuming cellular pools of NAD. Depletion of NAD and consequent lowering of cellular ATP pools, due to activation of Poly(ADP-ribose) polymerase, may account for rapid cell death before DNA repair takes place and before the genetic effects of DNA damage become manifest

  12. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  13. Rapid prototyping: een veelbelovende methode

    NARCIS (Netherlands)

    Haverman, T.M.; Karagozoglu, K.H.; Prins, H.; Schulten, E.A.J.M.; Forouzanfar, T.

    2013-01-01

    Rapid prototyping is a method which makes it possible to produce a three-dimensional model based on two-dimensional imaging. Various rapid prototyping methods are available for modelling, such as stereolithography, selective laser sintering, direct laser metal sintering, two-photon polymerization,

  14. DNA from keratinous tissue

    DEFF Research Database (Denmark)

    Bengtsson, Camilla F.; Olsen, Maja E.; Brandt, Luise Ørsted

    2011-01-01

    Keratinous tissues such as nail, hair, horn, scales and feather have been used as a source of DNA for over 20 years. Particular benefits of such tissues include the ease with which they can be sampled, the relative stability of DNA in such tissues once sampled, and, in the context of ancient...... genetic analyses, the fact that sampling generally causes minimal visual damage to valuable specimens. Even when freshly sampled, however, the DNA quantity and quality in the fully keratinized parts of such tissues is extremely poor in comparison to other tissues such as blood and muscle – although little...... systematic research has been undertaken to characterize how such degradation may relate to sample source. In this review paper we present the current understanding of the quality and limitations of DNA in two key keratinous tissues, nail and hair. The findings indicate that although some fragments of nuclear...

  15. DNA fusion gene vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with viral-vectored vaccines, various synergistic components may need to be incorporated into DNA vaccines. From the perspective of the future clinical use of DNA vaccines, it has been suggested that antigen presentation should be improved and cytokine coadministration attempted. However, even...

  16. DNA Sampling Hook

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The DNA Sampling Hook is a significant improvement on a method of obtaining a tissue sample from a live fish in situ from an aquatic environment. A tissue sample...

  17. Retroviral DNA Integration

    Science.gov (United States)

    2016-01-01

    The integration of a DNA copy of the viral RNA genome into host chromatin is the defining step of retroviral replication. This enzymatic process is catalyzed by the virus-encoded integrase protein, which is conserved among retroviruses and LTR-retrotransposons. Retroviral integration proceeds via two integrase activities: 3′-processing of the viral DNA ends, followed by the strand transfer of the processed ends into host cell chromosomal DNA. Herein we review the molecular mechanism of retroviral DNA integration, with an emphasis on reaction chemistries and architectures of the nucleoprotein complexes involved. We additionally discuss the latest advances on anti-integrase drug development for the treatment of AIDS and the utility of integrating retroviral vectors in gene therapy applications. PMID:27198982

  18. DNA damage and carcinogenesis

    International Nuclear Information System (INIS)

    Stelow, R.B.

    1980-01-01

    Although cancer may arise as a result of many different types of molecular changes, there is little reason to doubt that changes to DNA are one of the more important ones in cancer initiation. Although DNA repair mechanisms seem able to eliminate a very large fraction of deleterious changes to DNA, we not only have little insight into the molecular mechanisms involved in such repair, but have a negligible amount of information to permit us to estimate the shape of dose response relations at low doses. The case of skin cancer is a special one, in that the average population is exposed to sufficient solar uv so that the effects of small increments in uv dose may be estimated. An approximate 85% reduction in DNA repair increases skin cancer incidence 10 4 fold

  19. DNA-Origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Gothelf, Kurt Vesterager

    2010-01-01

    DNA-nanostrukturer giver nye muligheder for studier af individuelle molekyler. Ved at udnytte DNAs unikke selvsamlende egenskaber kan man designe systemer, hvorpå der kan studeres kemiske reaktioner, fluoroforer og biiomolekyler på enkeltmolekyle-niveau....

  20. DNA Microarray Technology

    Science.gov (United States)

    Skip to main content DNA Microarray Technology Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

  1. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  2. Close encounters with DNA

    Science.gov (United States)

    Maffeo, C.; Yoo, J.; Comer, J.; Wells, D. B.; Luan, B.; Aksimentiev, A.

    2014-01-01

    Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena and we review the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field. PMID:25238560

  3. Gomphid DNA sequence data

    Data.gov (United States)

    U.S. Environmental Protection Agency — DNA sequence data for several genetic loci. This dataset is not publicly accessible because: It's already publicly available on GenBank. It can be accessed through...

  4. HPV DNA test

    Science.gov (United States)

    ... test; Cancer of cervix - HPV DNA test References Hacker NF. Cervical dysplasia and cancer. In: Hacker NF, Gambone JC, Hobel CJ, eds. Hacker and Moore's Essentials of Obstetrics and Gynecology . 6th ...

  5. Close encounters with DNA.

    Science.gov (United States)

    Maffeo, C; Yoo, J; Comer, J; Wells, D B; Luan, B; Aksimentiev, A

    2014-10-15

    Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena. We also discuss the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field.

  6. FBI's DNA analysis program

    Science.gov (United States)

    Brown, John R.

    1994-03-01

    Forensic DNA profiling technology is a significant law enforcement tool due to its superior discriminating power. Applying the principles of population genetics to the DNA profile obtained in violent crime investigations results in low frequency of occurrence estimates for the DNA profile. These estimates often range from a frequency of occurrence of 1 in 50 unrelated individuals to 1 in a million unrelated individuals or even smaller. It is this power to discriminate among individuals in the population that has propelled forensic DNA technology to the forefront of forensic testing in violent crime cases. Not only is the technology extremely powerful in including or excluding a criminal suspect as the perpetrator, but it also gives rise to the potential of identifying criminal suspects in cases where the investigators of unknown suspect cases have exhausted all other available leads.

  7. Making DNA Fingerprints.

    Science.gov (United States)

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  8. Radiation damage in DNA

    International Nuclear Information System (INIS)

    Lafleur, V.

    1978-01-01

    A number of experiments are described with the purpose to obtain a better insight in the chemical nature and the biological significance of radiation-induced damage in DNA, with some emphasis on the significance of alkali-labile sites. It is shown that not only reactions of OH radicals but also of H radicals introduce breaks and other inactivating damage in single-standed phiX174 DNA. It is found that phosphate buffer is very suitable for the study of the reactions of H radicals with DNA, as the H 2 PO 4 - ions convert the hydrated electrons into H radicals. The hydrated electron, which does react with DNA, does not cause a detectable inactivation. (Auth.)

  9. DNA to DNA transcription might exist in eukaryotic cells

    OpenAIRE

    Li, Gao-De

    2016-01-01

    Till now, in biological sciences, the term, transcription, mainly refers to DNA to RNA transcription. But our recently published experimental findings obtained from Plasmodium falciparum strongly suggest the existence of DNA to DNA transcription in the genome of eukaryotic cells, which could shed some light on the functions of certain noncoding DNA in the human and other eukaryotic genomes.

  10. Patterning nanocrystals using DNA

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Shara Carol [Univ. of California, Berkeley, CA (United States)

    2003-01-01

    One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices

  11. Das DNA-Puzzle

    Science.gov (United States)

    Kirchner, Stefan

    Im Jahre 1953 wurde von James Watson und Francis Crick erstmalig der strukturelle Aufbau der sogenannten DNA (Desoxyribonukleinsäure) beschrieben, welche das Erbgut jedes Lebewesens enthält. Der wesentliche Teil des Erbguts wird dabei durch eine sehr lange Folge der vier Basen Adenin (A), Cytosin (C), Guanin (G) und Thymin (T) codiert. Seit einigen Jahren ist es möglich, die Folge der vier Basen zu einer gegebenen DNA zu bestimmen. Biologen bezeichnen diesen Vorgang als Sequenzierung.

  12. PDA: Pooled DNA analyzer

    Directory of Open Access Journals (Sweden)

    Lin Chin-Yu

    2006-04-01

    Full Text Available Abstract Background Association mapping using abundant single nucleotide polymorphisms is a powerful tool for identifying disease susceptibility genes for complex traits and exploring possible genetic diversity. Genotyping large numbers of SNPs individually is performed routinely but is cost prohibitive for large-scale genetic studies. DNA pooling is a reliable and cost-saving alternative genotyping method. However, no software has been developed for complete pooled-DNA analyses, including data standardization, allele frequency estimation, and single/multipoint DNA pooling association tests. This motivated the development of the software, 'PDA' (Pooled DNA Analyzer, to analyze pooled DNA data. Results We develop the software, PDA, for the analysis of pooled-DNA data. PDA is originally implemented with the MATLAB® language, but it can also be executed on a Windows system without installing the MATLAB®. PDA provides estimates of the coefficient of preferential amplification and allele frequency. PDA considers an extended single-point association test, which can compare allele frequencies between two DNA pools constructed under different experimental conditions. Moreover, PDA also provides novel chromosome-wide multipoint association tests based on p-value combinations and a sliding-window concept. This new multipoint testing procedure overcomes a computational bottleneck of conventional haplotype-oriented multipoint methods in DNA pooling analyses and can handle data sets having a large pool size and/or large numbers of polymorphic markers. All of the PDA functions are illustrated in the four bona fide examples. Conclusion PDA is simple to operate and does not require that users have a strong statistical background. The software is available at http://www.ibms.sinica.edu.tw/%7Ecsjfann/first%20flow/pda.htm.

  13. Racemic DNA Crystallography

    OpenAIRE

    Mandal , Pradeep K.; Collie , Gavin W.; Kauffmann , Brice; Huc , Ivan

    2014-01-01

    International audience; Racemates increase the chances of crystallization by allowing molecular contacts to be formed in a greater number of ways. With the advent of protein synthesis, the production of protein racemates and racemic-protein crystallography are now possible. Curiously, racemic DNA crystallography had not been investigated despite the commercial availability of Land D-deoxyribo-oligonucleotides. Here, we report a study into racemic DNA crystallography showing the strong propens...

  14. Celebrating DNA's Repair Crew.

    Science.gov (United States)

    Kunkel, Thomas A

    2015-12-03

    This year, the Nobel Prize in Chemistry has been awarded to Tomas Lindahl, Aziz Sancar, and Paul Modrich for their seminal studies of the mechanisms by which cells from bacteria to man repair DNA damage that is generated by normal cellular metabolism and stress from the environment. These studies beautifully illustrate the remarkable power of DNA repair to influence life from evolution through disease susceptibility. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Quantification of cellular uptake of DNA nanostructures by qPCR

    DEFF Research Database (Denmark)

    Okholm, Anders Hauge; Nielsen, Jesper Sejrup; Vinther, Mathias

    2014-01-01

    interactions and structural and functional features of the DNA delivery device must be thoroughly investigated. Here, we present a rapid and robust method for the precise quantification of the component materials of DNA origami structures capable of entering cells in vitro. The quantification is performed...

  16. Recovery of DNA from agarose gel by trap method | Xia | African ...

    African Journals Online (AJOL)

    Recovery of DNA from agarose gel electrophoresis is a basic operation during molecular cloning. Circular or linear DNA fragments which vary from 1.5 to 6.5 kb and correspond to 1 kb marker can be recovered from 0.8 to 1.0% agarose gel smoothly with a simple and rapid trap method. The recovery efficiency could be ...

  17. Tousled-like kinases phosphorylate Asf1 to promote histone supply during DNA replication

    DEFF Research Database (Denmark)

    Klimovskaia, Ilnaz M; Young, Clifford; Strømme, Caroline B

    2014-01-01

    During DNA replication, nucleosomes are rapidly assembled on newly synthesized DNA to restore chromatin organization. Asf1, a key histone H3-H4 chaperone required for this process, is phosphorylated by Tousled-like kinases (TLKs). Here, we identify TLK phosphorylation sites by mass spectrometry...

  18. Introduction to DNA methods

    International Nuclear Information System (INIS)

    Delincee, H.

    1991-01-01

    The purpose of this session is to discuss the various possibilities for detecting modifications in DNA after irradiation and whether these changes can be utilized as an indicator for the irradiation treatment of foods. The requirement to be fulfilled is that the method be able to distinguish irradiated food without the presence of a control sample, thus the measured response after irradiation must be large enough to supersede background levels from other treatments. Much work has been performed on the effects of radiation on DNA, particularly due to its importance in radiation biology. The main lesions of DNA as a result of irradiation are base damage, damage of the sugar moiety, single strand and double strand breaks. Crosslinking between bases also occurs, e.g. production of thymine dimers, or between DNA and protein. A valuable review on how to utilize these DNA changes for detection purposes has already appeared. Tables 1, 2 and 3 list the proposed methods of detecting changes in irradiated DNA, some identified products as examples for a possible irradiation indicator, in the case of immunoassay the substance used as antigen, and some selected literature references. In this short review, it is not intended to provide a complete literature survey

  19. Variations in brain DNA

    Directory of Open Access Journals (Sweden)

    Jesus eAvila

    2014-11-01

    Full Text Available It is assumed that DNA sequences are conserved in the diverse cell types present in a multicellular organism like the human being. Thus, in order to compare the sequences in the genome of DNA from different individuals, nucleic acid is commonly isolated from a single tissue. In this regard, blood cells are widely used for this purpose because of their availability. Thus blood DNA has been used to study genetic familiar diseases that affect other tissues and organs, such as the liver, heart, and brain. While this approach is valid for the identification of familial diseases in which mutations are present in parental germinal cells and, therefore, in all the cells of a given organism, it is not suitable to identify sporadic diseases in which mutations might occur in specific somatic cells. This review addresses somatic DNA variations in different tissues or cells (mainly in the brain of single individuals and discusses whether the dogma of DNA invariance between cell types is indeed correct. We will also discuss how single nucleotide somatic variations arise, focusing on the presence of specific DNA mutations in the brain.

  20. Pengujian Kartu Fta Sebagai Alat Sampling Dna Jamur Patogen Dariberbagi Bagian Tanaman Yang Terinfeksi

    OpenAIRE

    Sulistyawati, Purnamila

    2011-01-01

    FTA card offers a simple and fast method for retrieval of DNA samples at room temperature and storage of DNA in the short and long term. This will fasiliate the detection and identification of plant pathogens rapidly; increasing the number of samples can be collected, stored and transported in the field, especially from remote locations. The purpose of this study is to investigate the suitability of FTA cards as a new method for sampling DNA from multiple infected of plant tissues such as ...

  1. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  2. Current developments in forensic interpretation of mixed DNA samples (Review)

    Science.gov (United States)

    HU, NA; CONG, BIN; LI, SHUJIN; MA, CHUNLING; FU, LIHONG; ZHANG, XIAOJING

    2014-01-01

    A number of recent improvements have provided contemporary forensic investigations with a variety of tools to improve the analysis of mixed DNA samples in criminal investigations, producing notable improvements in the analysis of complex trace samples in cases of sexual assult and homicide. Mixed DNA contains DNA from two or more contributors, compounding DNA analysis by combining DNA from one or more major contributors with small amounts of DNA from potentially numerous minor contributors. These samples are characterized by a high probability of drop-out or drop-in combined with elevated stutter, significantly increasing analysis complexity. At some loci, minor contributor alleles may be completely obscured due to amplification bias or over-amplification, creating the illusion of additional contributors. Thus, estimating the number of contributors and separating contributor genotypes at a given locus is significantly more difficult in mixed DNA samples, requiring the application of specialized protocols that have only recently been widely commercialized and standardized. Over the last decade, the accuracy and repeatability of mixed DNA analyses available to conventional forensic laboratories has greatly advanced in terms of laboratory technology, mathematical models and biostatistical software, generating more accurate, rapid and readily available data for legal proceedings and criminal cases. PMID:24748965

  3. DNA damage mediated transcription arrest: Step back to go forward.

    Science.gov (United States)

    Mullenders, Leon

    2015-12-01

    The disturbance of DNA helix conformation by bulky DNA damage poses hindrance to transcription elongating due to stalling of RNA polymerase at transcription blocking lesions. Stalling of RNA polymerase provokes the formation of R-loops, i.e. the formation of a DNA-RNA hybrid and a displaced single stranded DNA strand as well as displacement of spliceosomes. R-loops are processed into DNA single and double strand breaks by NER factors depending on TC-NER factors leading to genome instability. Moreover, stalling of RNA polymerase induces a strong signal for cell cycle arrest and apoptosis. These toxic and mutagenic effects are counteracted by a rapid recruitment of DNA repair proteins to perform transcription coupled nucleotide excision repair (TC-NER) to remove the blocking DNA lesions and to restore transcription. Recent studies have highlighted the role of backtracking of RNA polymerase to facilitate TC-NER and identified novel factors that play key roles in TC-NER and in restoration of transcription. On the molecular level these factors facilitate stability of the repair complex by promotion and regulation of various post-translational modifications of NER factors and chromatin substrate. In addition, the continuous flow of new factors that emerge from screening assays hints to several regulatory levels to safeguard the integrity of transcription elongation after disturbance by DNA damage that have yet to be explored. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. A simple method for purification of herpesvirus DNA

    DEFF Research Database (Denmark)

    Christensen, Laurids Siig; Normann, Preben

    1992-01-01

    A rapid and reliable method for purification of herpesvirus DNA from cell cultures is described. The method is based on the isolation of virus particles and/or nucleocapsids by differential centrifugation and exploits the solubilizing and denaturing capabilities of cesium trifluoroacetate during...

  5. DNA from soil mirrors plant taxonomic and growth form diversity

    DEFF Research Database (Denmark)

    Yoccoz, N. G.; Bråthen, K. A.; Gielly, L.

    2012-01-01

    Ecosystems across the globe are threatened by climate change and human activities. New rapid survey approaches for monitoring biodiversity would greatly advance assessment and understanding of these threats. Taking advantage of next-generation DNA sequencing, we tested an approach we call...

  6. DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

    Science.gov (United States)

    A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

  7. How Rapid is Rapid Prototyping? Analysis of ESPADON Programme Results

    Directory of Open Access Journals (Sweden)

    Ian D. Alston

    2003-05-01

    Full Text Available New methodologies, engineering processes, and support environments are beginning to emerge for embedded signal processing systems. The main objectives are to enable defence industry to field state-of-the-art products in less time and with lower costs, including retrofits and upgrades, based predominately on commercial off the shelf (COTS components and the model-year concept. One of the cornerstones of the new methodologies is the concept of rapid prototyping. This is the ability to rapidly and seamlessly move from functional design to the architectural design to the implementation, through automatic code generation tools, onto real-time COTS test beds. In this paper, we try to quantify the term “rapid” and provide results, the metrics, from two independent benchmarks, a radar and sonar beamforming application subset. The metrics show that the rapid prototyping process may be sixteen times faster than a conventional process.

  8. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  9. Cerium chloride stimulated controlled conversion of B-to-Z DNA in self-assembled nanostructures

    International Nuclear Information System (INIS)

    Bhanjadeo, Madhabi M.; Nayak, Ashok K.; Subudhi, Umakanta

    2017-01-01

    DNA adopts different conformation not only because of novel base pairs but also while interacting with inorganic or organic compounds. Self-assembled branched DNA (bDNA) structures or DNA origami that change conformation in response to environmental cues hold great promises in sensing and actuation at the nanoscale. Recently, the B-Z transition in DNA is being explored to design various nanomechanical devices. In this communication we have demonstrated that Cerium chloride binds to the phosphate backbone of self-assembled bDNA structure and induce B-to-Z transition at physiological concentration. The mechanism of controlled conversion from right-handed to left-handed has been assayed by various dye binding studies using CD and fluorescence spectroscopy. Three different bDNA structures have been identified to display B-Z transition. This approach provides a rapid and reversible means to change bDNA conformation, which can be used for dynamic and progressive control at the nanoscale. - Highlights: • Cerium-induced B-to-Z DNA transition in self-assembled nanostructures. • Lower melting temperature of Z-DNA than B-DNA confirmed by CD spectroscopy. • Binding mechanism of cerium chloride is explained using fluorescence spectroscopy. • Right-handed to left-handed DNA conformation is also noticed in modified bDNA structure.

  10. Blood extracellular DNA after irradiation

    International Nuclear Information System (INIS)

    Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.

    1993-01-01

    It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action

  11. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    International Nuclear Information System (INIS)

    Okamura, K; Hisada, T; Takata, K; Hiraishi, A

    2013-01-01

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  12. Sequencing intractable DNA to close microbial genomes.

    Directory of Open Access Journals (Sweden)

    Richard A Hurt

    Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  13. Sequencing Intractable DNA to Close Microbial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL

    2012-01-01

    Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  14. DNA Knots: Theory and Experiments

    Science.gov (United States)

    Sumners, D. W.

    Cellular DNA is a long, thread-like molecule with remarkably complex topology. Enzymes that manipulate the geometry and topology of cellular DNA perform many vital cellular processes (including segregation of daughter chromosomes, gene regulation, DNA repair, and generation of antibody diversity). Some enzymes pass DNA through itself via enzyme-bridged transient breaks in the DNA; other enzymes break the DNA apart and reconnect it to different ends. In the topological approach to enzymology, circular DNA is incubated with an enzyme, producing an enzyme signature in the form of DNA knots and links. By observing the changes in DNA geometry (supercoiling) and topology (knotting and linking) due to enzyme action, the enzyme binding and mechanism can often be characterized. This paper will discuss some personal research history, and the tangle model for the analysis of site-specific recombination experiments on circular DNA.

  15. DNA & Protein detection based on microbead agglutination

    KAUST Repository

    Kodzius, Rimantas

    2012-06-06

    We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microparticles in the presence of a specific analyte thus enabling the macroscopic observation. Agglutination-based tests are most often used to explore the antibody-antigen reactions. Agglutination has been used for mode protein assays using a biotin/streptavidin two-component system, as well as a hybridization based two-component assay; however, as our work shows, two-component systems are prone to self-termination of the linking analyte and thus have a lower sensitivity. Three component systems have also been used with DNA hybridization, as in our work; however, their assay requires 48 hours for incubation, while our assay is performed in 5 minutes making it a real candidate for POC testing. We demonstrate three assays: a two-component biotin/streptavidin assay, a three-component hybridization assay using single stranded DNA (ssDNA) molecules and a stepped three-component hybridization assay. The comparison of these three assays shows our simple stepped three-component agglutination assay to be rapid at room temperature and more sensitive than the two-component version by an order of magnitude. An agglutination assay was also performed in a PDMS microfluidic chip where agglutinated beads were trapped by filter columns for easy observation. We developed a rapid (5 minute) room temperature assay, which is based on microbead agglutination. Our three-component assay solves the linker self-termination issue allowing an order of magnitude increase in sensitivity over two–component assays. Our stepped version of the three-component assay solves the issue with probe site saturation thus enabling a wider range of detection. Detection of the agglutinated beads with the naked eye by trapping in microfluidic channels has been shown.

  16. Transcription-induced DNA supercoiling: New roles of intranucleosomal DNA loops in DNA repair and transcription.

    Science.gov (United States)

    Gerasimova, N S; Pestov, N A; Kulaeva, O I; Clark, D J; Studitsky, V M

    2016-05-26

    RNA polymerase II (Pol II) transcription through chromatin is accompanied by formation of small intranucleosomal DNA loops. Pol II captured within a small loop drives accumulation of DNA supercoiling, facilitating further transcription. DNA breaks relieve supercoiling and induce Pol II arrest, allowing detection of DNA damage hidden in chromatin structure.

  17. Rapid deployment intrusion detection system

    International Nuclear Information System (INIS)

    Graham, R.H.

    1997-01-01

    A rapidly deployable security system is one that provides intrusion detection, assessment, communications, and annunciation capabilities; is easy to install and configure; can be rapidly deployed, and is reusable. A rapidly deployable intrusion detection system (RADIDS) has many potential applications within the DOE Complex: back-up protection for failed zones in a perimeter intrusion detection and assessment system, intrusion detection and assessment capabilities in temporary locations, protection of assets during Complex reconfiguration, and protection in hazardous locations, protection of assets during Complex reconfiguration, and protection in hazardous locations. Many DOE user-need documents have indicated an interest in a rapidly deployable intrusion detection system. The purpose of the RADIDS project is to design, develop, and implement such a system. 2 figs

  18. Rapid Continuous Multimaterial Extrusion Bioprinting

    NARCIS (Netherlands)

    Liu, Wanjun; Zhang, Yu Shrike; Heinrich, Marcel A.; De Ferrari, F; Jang, HL; Bakht, SM; Alvarez, MM; Yang, J; Li, YC; Trujillo-de Stantiago, G; Miri, AK; Zhu, K; Khoshakhlagh, P; Prakash, G; Cheng, H; Guan, X; Zhong, Z; Ju, J; Zhu, GH; Jin, X; Ryon Shin, Su; Dokmeci, M.R.; Khademhosseini, Ali

    The development of a multimaterial extrusion bioprinting platform is reported. This platform is capable of depositing multiple coded bioinks in a continuous manner with fast and smooth switching among different reservoirs for rapid fabrication of complex constructs, through digitally controlled

  19. Eukaryotic DNA Replicases

    KAUST Repository

    Zaher, Manal S.; Oke, Muse; Hamdan, Samir

    2014-01-01

    The current model of the eukaryotic DNA replication fork includes three replicative DNA polymerases, polymerase α/primase complex (Pol α), polymerase δ (Pol δ), and polymerase ε (Pol ε). The primase synthesizes 8–12 nucleotide RNA primers that are extended by the DNA polymerization activity of Pol α into 30–35 nucleotide RNA-DNA primers. Replication factor C (RFC) opens the polymerase clamp-like processivity factor, proliferating cell nuclear antigen (PCNA), and loads it onto the primer-template. Pol δ utilizes PCNA to mediate highly processive DNA synthesis, while Pol ε has intrinsic high processivity that is modestly stimulated by PCNA. Pol ε replicates the leading strand and Pol δ replicates the lagging strand in a division of labor that is not strict. The three polymerases are comprised of multiple subunits and share unifying features in their large catalytic and B subunits. The remaining subunits are evolutionarily not related and perform diverse functions. The catalytic subunits are members of family B, which are distinguished by their larger sizes due to inserts in their N- and C-terminal regions. The sizes of these inserts vary among the three polymerases, and their functions remain largely unknown. Strikingly, the quaternary structures of Pol α, Pol δ, and Pol ε are arranged similarly. The catalytic subunits adopt a globular structure that is linked via its conserved C-terminal region to the B subunit. The remaining subunits are linked to the catalytic and B subunits in a highly flexible manner.

  20. Eukaryotic DNA Replicases

    KAUST Repository

    Zaher, Manal S.

    2014-11-21

    The current model of the eukaryotic DNA replication fork includes three replicative DNA polymerases, polymerase α/primase complex (Pol α), polymerase δ (Pol δ), and polymerase ε (Pol ε). The primase synthesizes 8–12 nucleotide RNA primers that are extended by the DNA polymerization activity of Pol α into 30–35 nucleotide RNA-DNA primers. Replication factor C (RFC) opens the polymerase clamp-like processivity factor, proliferating cell nuclear antigen (PCNA), and loads it onto the primer-template. Pol δ utilizes PCNA to mediate highly processive DNA synthesis, while Pol ε has intrinsic high processivity that is modestly stimulated by PCNA. Pol ε replicates the leading strand and Pol δ replicates the lagging strand in a division of labor that is not strict. The three polymerases are comprised of multiple subunits and share unifying features in their large catalytic and B subunits. The remaining subunits are evolutionarily not related and perform diverse functions. The catalytic subunits are members of family B, which are distinguished by their larger sizes due to inserts in their N- and C-terminal regions. The sizes of these inserts vary among the three polymerases, and their functions remain largely unknown. Strikingly, the quaternary structures of Pol α, Pol δ, and Pol ε are arranged similarly. The catalytic subunits adopt a globular structure that is linked via its conserved C-terminal region to the B subunit. The remaining subunits are linked to the catalytic and B subunits in a highly flexible manner.