WorldWideScience

Sample records for rapidly reannealing dna

  1. Reannealed Fiber Bragg Gratings Demonstrated High Repeatability in Temperature Measurements

    Science.gov (United States)

    Adamovsky, Grigory; Juergens, Jeffrey R.

    2004-01-01

    Fiber Bragg gratings (FBGs) are formed by periodic variations of the refractive index of an optical fiber. These periodic variations allow an FBG to act as an embedded optical filter, passing the majority of light propagating through a fiber while reflecting back a narrow band of the incident light. The peak reflected wavelength of the FBG is known as the Bragg wavelength. Since the period and width of the refractive index variation in the fiber determines the wavelengths that are transmitted and reflected by the grating, any force acting on the fiber that alters the physical structure of the grating will change the wavelengths that are transmitted and reflected by it. Both thermal and mechanical forces acting on the grating will alter its physical characteristics, allowing the FBG sensor to detect both the temperature variations and the physical stresses and strains placed upon it. This ability to sense multiple physical forces makes the FBG a versatile sensor. To assess the feasibility of using Bragg gratings as temperature sensors for propulsion applications, researchers at the NASA Glenn Research Center evaluated the performance of Bragg gratings at elevated temperatures for up to 300 C. For these purposes, commercially available polyimide-coated high-temperature gratings were used that were annealed by the manufacturer to 300 C. To assure the most thermally stable gratings at the operating temperatures, we reannealed the gratings to 400 C at a very slow rate for 12 to 24 hr until their reflected optical powers were stabilized. The reannealed gratings were then subjected to periodic thermal cycling from room temperature to 300 C, and their peak reflected wavelengths were monitored. The setup shown is used for reannealing and thermal cycling the FBGs. Signals from the photodetectors and the spectrum analyzer were fed into a computer equipped with LabVIEW software. The software synchronously monitored the oven/furnace temperature and the optical spectrum analyzer

  2. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E; Krogsdam, A M; Jorgensen, H F

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  3. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    Abstract. There is no 'one' procedure for extracting DNA from the whole blood of both mammals and birds, since each species has a unique property that require different methods to release its own DNA. Therefore, to obtain genomic DNA, a universal, rapid, and noncostly method was developed. A very simple biological ...

  4. Rapid folding of DNA into nanoscale shapes at constant temperature

    National Research Council Canada - National Science Library

    Sobczak, Jean-Philippe J; Martin, Thomas G; Gerling, Thomas; Dietz, Hendrik

    2012-01-01

    .... Unfolding occurred in apparent equilibrium at higher temperatures than those for folding. Folding at optimized constant temperatures enabled the rapid production of three-dimensional DNA objects with yields that approached 100...

  5. Rapid cleanup of bacterial DNA from samples containing aerosol contaminants

    Science.gov (United States)

    Menking, Darrell E.; Kracke, Suzanne K.; Emanuel, Peter A.; Valdes, James J.

    1999-01-01

    Polymerase Chain Reaction (PCR) is an in vitro enzymatic, synthetic method used to amplify specific DNA sequences from organisms. Detection of DNA using gene probes allows for absolute identification not only of specific organisms, but also of genetic material in recombinant organisms. PCR is an exquisite biological method for detecting bacteria in aerosol samples. A major challenge facing detection of DNA from field samples is that they are almost sure to contain impurities, especially impurities that inhibit amplification through PCR. DNA is being extracted from air, sewage/stool samples, food, sputum, a water and sediment; however, multi- step, time consuming methods are required to isolate the DNA from the surrounding contamination. This research focuses on developing a method for rapid cleanup of DNA which combines extraction and purification of DNA while, at the same time, removing inhibitors from 'dirty samples' to produce purified, PCR-ready DNA. GeneReleaser produces PCR-ready DNA in a rapid five-minute protocol. GeneReleaser resin was able to clean up sample contain micrograms of typical aerosol and water contaminants. The advantages of using GR are that it is rapid, inexpensive, requires one-step, uses no hazardous material and produces PCR-ready DNA.

  6. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    ... of both mammals and birds, since each species has a unique property that require different methods to release its own DNA. Therefore, to obtain genomic DNA, a universal, rapid, and noncostly method was developed. A very simple biological basis is followed in this procedure, in which, when the bloodis placed in water, ...

  7. A rapid DNA extraction method suitable for human papillomavirus detection.

    Science.gov (United States)

    Brestovac, Brian; Wong, Michelle E; Costantino, Paul S; Groth, David

    2014-04-01

    Infection with oncogenic human papillomavirus (HPV) genotypes is necessary for the development of cervical cancer. Testing for HPV DNA from liquid based cervical samples can be used as an adjunct to traditional cytological screening. In addition there are ongoing viral load, genotyping, and prevalence studies. Therefore, a sensitive DNA extraction method is needed to maximize the efficiency of HPV DNA detection. The XytXtract Tissue kit is a DNA extraction kit that is rapid and so could be useful for HPV testing, particularly in screening protocols. This study was undertaken to determine the suitability of this method for HPV detection. DNA extraction from HeLa and Caski cell lines containing HPV 18 and 16 respectively together with DNA from five liquid based cervical samples were used in a HPV PCR assay. DNA was also extracted using the QIAamp DNA mini kit (Qiagen, Hilden, Germany) as a comparison. DNA extracts were serially diluted and assayed. HPV DNA was successfully detected in cell lines and cervical samples using the XytXtract Tissue kit. In addition, the XytXtract method was found to be more sensitive than the QIAmp method as determined by a dilution series of the extracted DNA. While the XytXtract method is a closed, the QIAamp method uses a spin column with possible loss of DNA through DNA binding competition of the matrix, which could impact on the final extraction efficiency. The XytXtract is a cheap, rapid and efficient method for extracting HPV DNA from both cell lines and liquid based cervical samples. © 2014 Wiley Periodicals, Inc.

  8. Rapid extraction and preservation of genomic DNA from human samples.

    Science.gov (United States)

    Kalyanasundaram, D; Kim, J-H; Yeo, W-H; Oh, K; Lee, K-H; Kim, M-H; Ryew, S-M; Ahn, S-G; Gao, D; Cangelosi, G A; Chung, J-H

    2013-02-01

    Simple and rapid extraction of human genomic DNA remains a bottleneck for genome analysis and disease diagnosis. Current methods using microfilters require cumbersome, multiple handling steps in part because salt conditions must be controlled for attraction and elution of DNA in porous silica. We report a novel extraction method of human genomic DNA from buccal swab and saliva samples. DNA is attracted onto a gold-coated microchip by an electric field and capillary action while the captured DNA is eluted by thermal heating at 70 °C. A prototype device was designed to handle four microchips, and a compatible protocol was developed. The extracted DNA using microchips was characterized by qPCR for different sample volumes, using different lengths of PCR amplicon, and nuclear and mitochondrial genes. In comparison with a commercial kit, an equivalent yield of DNA extraction was achieved with fewer steps. Room-temperature preservation for 1 month was demonstrated for captured DNA, facilitating straightforward collection, delivery, and handling of genomic DNA in an environment-friendly protocol.

  9. Rapid, Effective DNA Isolation from Osmanthus via Modified Alkaline Lysis.

    Science.gov (United States)

    Alexander, Lisa

    2016-07-01

    Variability of leaf structure and presence of secondary metabolites in mature leaf tissue present a challenge for reliable DNA extraction from Osmanthus species and cultivars. The objective of this study was to develop a universal rapid, effective, and cost-efficient method of DNA isolation for Osmanthus mature leaf tissue. Four different methods were used to isolate DNA from 8 cultivars of Osmanthus. Absorbance spectra, DNA concentration, appearance on agarose gel, and performance in PCR were used to analyze quality, quantity, and integrity of isolated DNA. Methods were ranked in order, based on total quantity, quality, and performance points as the following: 1) solid-phase extraction (SPE), 2) modified alkaline lysis (SDS), 3) cetyltrimethylammonium bromide (CTAB) with chloroform (CHL), and 4) CTAB with phenol/chloroform (PHE). Total DNA, isolated via SPE, showed the least contamination but the lowest mean quantity (9.6 ± 3.4 μg) and highest cost. The highest quantity of DNA was isolated via SDS (117 ± 54.1 μg). SPE and SDS resolved the most individuals on agarose gel, whereas the 2 CTAB methods had poorly resolved gels. All methods except PHE performed well in PCR. Additions to the modified alkaline lysis method increased A260:A230 by up to 59% without affecting yield. With the use of SDS, an average of 1000 μg/g DNA was isolated from fresh leaf tissue of 18 samples in ∼1.5 h at a cost of 0.74 U.S. dollars (USD)/sample. We recommend improved alkaline lysis as a rapid, effective, and cost-efficient method of isolating DNA from Osmanthus species.

  10. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  11. Extraction of DNA by magnetic ionic liquids: tunable solvents for rapid and selective DNA analysis.

    Science.gov (United States)

    Clark, Kevin D; Nacham, Omprakash; Yu, Honglian; Li, Tianhao; Yamsek, Melissa M; Ronning, Donald R; Anderson, Jared L

    2015-02-03

    DNA extraction represents a significant bottleneck in nucleic acid analysis. In this study, hydrophobic magnetic ionic liquids (MILs) were synthesized and employed as solvents for the rapid and efficient extraction of DNA from aqueous solution. The DNA-enriched microdroplets were manipulated by application of a magnetic field. The three MILs examined in this study exhibited unique DNA extraction capabilities when applied toward a variety of DNA samples and matrices. High extraction efficiencies were obtained for smaller single-stranded and double-stranded DNA using the benzyltrioctylammonium bromotrichloroferrate(III) ([(C8)3BnN(+)][FeCl3Br(-)]) MIL, while the dicationic 1,12-di(3-hexadecylbenzimidazolium)dodecane bis[(trifluoromethyl)sulfonyl]imide bromotrichloroferrate(III) ([(C16BnIM)2C12(2+)][NTf2(-), FeCl3Br(-)]) MIL produced higher extraction efficiencies for larger DNA molecules. The MIL-based method was also employed for the extraction of DNA from a complex matrix containing albumin, revealing a competitive extraction behavior for the trihexyl(tetradecyl)phosphonium tetrachloroferrate(III) ([P6,6,6,14(+)][FeCl4(-)]) MIL in contrast to the [(C8)3BnN(+)][FeCl3Br(-)] MIL, which resulted in significantly less coextraction of albumin. The MIL-DNA method was employed for the extraction of plasmid DNA from bacterial cell lysate. DNA of sufficient quality and quantity for polymerase chain reaction (PCR) amplification was recovered from the MIL extraction phase, demonstrating the feasibility of MIL-based DNA sample preparation prior to downstream analysis.

  12. Highly Rapid Amplification-Free and Quantitative DNA Imaging Assay

    Science.gov (United States)

    Klamp, Tobias; Camps, Marta; Nieto, Benjamin; Guasch, Francesc; Ranasinghe, Rohan T.; Wiedemann, Jens; Petrášek, Zdeněk; Schwille, Petra; Klenerman, David; Sauer, Markus

    2013-01-01

    There is an urgent need for rapid and highly sensitive detection of pathogen-derived DNA in a point-of-care (POC) device for diagnostics in hospitals and clinics. This device needs to work in a ‘sample-in-result-out’ mode with minimum number of steps so that it can be completely integrated into a cheap and simple instrument. We have developed a method that directly detects unamplified DNA, and demonstrate its sensitivity on realistically sized 5 kbp target DNA fragments of Micrococcus luteus in small sample volumes of 20 μL. The assay consists of capturing and accumulating of target DNA on magnetic beads with specific capture oligonucleotides, hybridization of complementary fluorescently labeled detection oligonucleotides, and fluorescence imaging on a miniaturized wide-field fluorescence microscope. Our simple method delivers results in less than 20 minutes with a limit of detection (LOD) of ~5 pM and a linear detection range spanning three orders of magnitude. PMID:23677392

  13. Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

    Science.gov (United States)

    Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

    2016-01-01

    Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample

  14. Rapid and effective DNA extraction method with bead grinding for a large amount of fungal DNA.

    Science.gov (United States)

    Watanabe, M; Lee, K; Goto, K; Kumagai, S; Sugita-Konishi, Y; Hara-Kudo, Y

    2010-06-01

    To identify a rapid method for extracting a large amount of DNA from fungi associated with food hygiene, extraction methods were compared using fungal pellets formed rapidly in liquid media. Combinations of physical and chemical methods or commercial kits were evaluated with 3 species of yeast, 10 species of ascomycetous molds, and 4 species of zygomycetous molds. Bead grinding was the physical method, followed by chemical methods involving sodium dodecyl sulfate (SDS), cetyl trimethyl ammonium bromide (CTAB), and benzyl chloride and two commercial kits. Quantity was calculated by UV absorbance at 260 nm, quality was determined by the ratio of UV absorbance at 260 and 280 nm, and gene amplifications and electrophoresis profiles of whole genomes were analyzed. Bead grinding with the SDS method was the most effective for DNA extraction for yeasts and ascomycetous molds, and bead grinding with the CTAB method was most effective with zygomycetous molds. For both groups of molds, bead grinding with the CTAB method was the best approach for DNA extraction. Because this combination also is relatively effective for yeasts, it can be used to extract a large amount of DNA from a wide range of fungi. The DNA extraction methods are useful for developing gene indexes to identify fungi with molecular techniques, such as DNA fingerprinting.

  15. Towards rapid prototyped convective microfluidic DNA amplification platform

    Science.gov (United States)

    Ajit, Smrithi; Praveen, Hemanth Mithun; Puneeth, S. B.; Dave, Abhishek; Sesham, Bharat; Mohan, K. N.; Goel, Sanket

    2017-02-01

    Today, Polymerase Chain Reaction (PCR) based DNA amplification plays an indispensable role in the field of biomedical research. Its inherent ability to exponentially amplify sample DNA has proven useful for the identification of virulent pathogens like those causing Multiple Drug-Resistant Tuberculosis (MDR-TB). The intervention of Microfluidics technology has revolutionized the concept of PCR from being a laborious and time consuming process into one that is faster, easily portable and capable of being multifunctional. The Microfluidics based PCR outweighs its traditional counterpart in terms of flexibility of varying reaction rate, operation simplicity, need of a fraction of volume and capability of being integrated with other functional elements. The scope of the present work involves the development of a real-time continuous flow microfluidic device, fabricated by 3D printing-governed rapid prototyping method, eventually leading to an automated and robust platform to process multiple DNA samples for detection of MDRTB-associated mutations. The thermal gradient characteristic to the PCR process is produced using peltier units appropriate to the microfluidic environment fully monitored and controlled by a low cost controller driven by a Data Acquisition System. The process efficiency achieved in the microfluidic environment in terms of output per cycle is expected to be on par with the traditional PCR and capable of earning the additional advantages of being faster and minimizing the handling.

  16. Multilocus DNA Sequence Comparisons Rapidly Identify Pathogenic Molds

    Science.gov (United States)

    Rakeman, Jennifer L.; Bui, Uyen; LaFe, Karen; Chen, Yi-Ching; Honeycutt, Rhonda J.; Cookson, Brad T.

    2005-01-01

    The increasing incidence of opportunistic fungal infections necessitates rapid and accurate identification of the associated fungi to facilitate optimal patient treatment. Traditional phenotype-based identification methods utilized in clinical laboratories rely on the production and recognition of reproductive structures, making identification difficult or impossible when these structures are not observed. We hypothesized that DNA sequence analysis of multiple loci is useful for rapidly identifying medically important molds. Our study included the analysis of the D1/D2 hypervariable region of the 28S ribosomal gene and the internal transcribed spacer (ITS) regions 1 and 2 of the rRNA operon. Two hundred one strains, including 143 clinical isolates and 58 reference and type strains, representing 43 recognized species and one possible new species, were examined. We generated a phenotypically validated database of 118 diagnostic alleles. DNA length polymorphisms detected among ITS1 and ITS2 PCR products can differentiate 20 of 33 species of molds tested, and ITS DNA sequence analysis permits identification of all species tested. For 42 of 44 species tested, conspecific strains displayed >99% sequence identity at ITS1 and ITS2; sequevars were detected in two species. For all 44 species, identifications by genotypic and traditional phenotypic methods were 100% concordant. Because dendrograms based on ITS sequence analysis are similar in topology to 28S-based trees, we conclude that ITS sequences provide phylogenetically valid information and can be utilized to identify clinically important molds. Additionally, this phenotypically validated database of ITS sequences will be useful for identifying new species of pathogenic molds. PMID:16000456

  17. Rapid genomic DNA changes in allotetraploid fish hybrids.

    Science.gov (United States)

    Wang, J; Ye, L H; Liu, Q Z; Peng, L Y; Liu, W; Yi, X G; Wang, Y D; Xiao, J; Xu, K; Hu, F Z; Ren, L; Tao, M; Zhang, C; Liu, Y; Hong, Y H; Liu, S J

    2015-06-01

    Rapid genomic change has been demonstrated in several allopolyploid plant systems; however, few studies focused on animals. We addressed this issue using an allotetraploid lineage (4nAT) of freshwater fish originally derived from the interspecific hybridization of red crucian carp (Carassius auratus red var., ♀, 2n=100) × common carp (Cyprinus carpio L., ♂, 2n=100). We constructed a bacterial artificial chromosome (BAC) library from allotetraploid hybrids in the 20th generation (F20) and sequenced 14 BAC clones representing a total of 592.126 kb, identified 11 functional genes and estimated the guanine-cytosine content (37.10%) and the proportion of repetitive elements (17.46%). The analysis of intron evolution using nine orthologous genes across a number of selected fish species detected a gain of 39 introns and a loss of 30 introns in the 4nAT lineage. A comparative study based on seven functional genes among 4nAT, diploid F1 hybrids (2nF1) (first generation of hybrids) and their original parents revealed that both hybrid types (2nF1 and 4nAT) not only inherited genomic DNA from their parents, but also demonstrated rapid genomic DNA changes (homoeologous recombination, parental DNA fragments loss and formation of novel genes). However, 4nAT presented more genomic variations compared with their parents than 2nF1. Interestingly, novel gene fragments were found for the iqca1 gene in both hybrid types. This study provided a preliminary genomic characterization of allotetraploid F20 hybrids and revealed evolutionary and functional genomic significance of allopolyploid animals.

  18. mtSSB may sequester UNG1 at mitochondrial ssDNA and delay uracil processing until the dsDNA conformation is restored

    DEFF Research Database (Denmark)

    Wollen Steen, Kristian; Doseth, Berit; westbye, Marianne

    2012-01-01

    Single-strand DNA binding proteins protect DNA from nucleolytic damage, prevent formation of secondary structures and prevent premature reannealing of DNA in DNA metabolic transactions. In eukaryotes, the nuclear single-strand DNA binding protein RPA is essential for chromosomal DNA replication a...... at the replication fork.......Single-strand DNA binding proteins protect DNA from nucleolytic damage, prevent formation of secondary structures and prevent premature reannealing of DNA in DNA metabolic transactions. In eukaryotes, the nuclear single-strand DNA binding protein RPA is essential for chromosomal DNA replication...... identified a putative surface motif in mtSSB that may recruit UNG1 to DNA-bound mtSSB. We suggest that the massive amount of mtSSB in mitochondria effectively prevents processing of uracil and other types of damaged bases to avoid introduction of nicks in single-stranded mtDNA formed during replication...

  19. Rapid quantification of DNA libraries for next-generation sequencing.

    Science.gov (United States)

    Buehler, Bernd; Hogrefe, Holly H; Scott, Graham; Ravi, Harini; Pabón-Peña, Carlos; O'Brien, Scott; Formosa, Rachel; Happe, Scott

    2010-04-01

    The next-generation DNA sequencing workflows require an accurate quantification of the DNA molecules to be sequenced which assures optimal performance of the instrument. Here, we demonstrate the use of qPCR for quantification of DNA libraries used in next-generation sequencing. In addition, we find that qPCR quantification may allow improvements to current NGS workflows, including reducing the amount of library DNA required, increasing the accuracy in quantifying amplifiable DNA, and avoiding amplification bias by reducing or eliminating the need to amplify DNA before sequencing. Copyright 2010. Published by Elsevier Inc.

  20. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    reagents for 'all in one' / ready to use tool to extract genomic. DNA (gDNA) from a very wide spectrum of blood samples. To meet these criteria, a universal and versatile DNA extrac- tion procedure should be developed with minimal chemicals and equipment. On the other hand, the interesting natural relation between RBCs ...

  1. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... To evaluate the efficiency of the genomic DNA in the processes in which DNA is used as a template, the polymerase chain reaction ... purity and concentration is of common processes in molecular research and clinical ... these methods, using chemical compounds or physical methods to lysis the cell is the ...

  2. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  3. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    Total DNA of Chokanan mango (Mangifera indica L.) was extracted from the leaf for the construction of total genomic library. However, the quality of the extracted DNA was often compromised by the presence of secondary metabolites, thus interfering with the analytical applications. Improvement on the quality of the ...

  4. Rapid isolation of yeast genomic DNA: Bust n' Grab

    Directory of Open Access Journals (Sweden)

    Peterson Kenneth R

    2004-04-01

    Full Text Available Abstract Background Mutagenesis of yeast artificial chromosomes (YACs often requires analysis of large numbers of yeast clones to obtain correctly targeted mutants. Conventional ways to isolate yeast genomic DNA utilize either glass beads or enzymatic digestion to disrupt yeast cell wall. Using small glass beads is messy, whereas enzymatic digestion of the cells is expensive when many samples need to be analyzed. We sought to develop an easier and faster protocol than the existing methods for obtaining yeast genomic DNA from liquid cultures or colonies on plates. Results Repeated freeze-thawing of cells in a lysis buffer was used to disrupt the cells and release genomic DNA. Cell lysis was followed by extraction with chloroform and ethanol precipitation of DNA. Two hundred ng – 3 μg of genomic DNA could be isolated from a 1.5 ml overnight liquid culture or from a large colony. Samples were either resuspended directly in a restriction enzyme/RNase coctail mixture for Southern blot hybridization or used for several PCR reactions. We demonstrated the utility of this method by showing an analysis of yeast clones containing a mutagenized human β-globin locus YAC. Conclusion An efficient, inexpensive method for obtaining yeast genomic DNA from liquid cultures or directly from colonies was developed. This protocol circumvents the use of enzymes or glass beads, and therefore is cheaper and easier to perform when processing large numbers of samples.

  5. Rapid response to changing environments during biological invasions: DNA methylation perspectives.

    Science.gov (United States)

    Huang, Xuena; Li, Shiguo; Ni, Ping; Gao, Yangchun; Jiang, Bei; Zhou, Zunchun; Zhan, Aibin

    2017-12-01

    Dissecting complex interactions between species and their environments has long been a research hot spot in the fields of ecology and evolutionary biology. The well-recognized Darwinian evolution has well-explained long-term adaptation scenarios; however, "rapid" processes of biological responses to environmental changes remain largely unexplored, particularly molecular mechanisms such as DNA methylation that have recently been proposed to play crucial roles in rapid environmental adaptation. Invasive species, which have capacities to successfully survive rapidly changing environments during biological invasions, provide great opportunities to study molecular mechanisms of rapid environmental adaptation. Here, we used the methylation-sensitive amplified polymorphism (MSAP) technique in an invasive model ascidian, Ciona savignyi, to investigate how species interact with rapidly changing environments at the whole-genome level. We detected quite rapid DNA methylation response: significant changes of DNA methylation frequency and epigenetic differentiation between treatment and control groups occurred only after 1 hr of high-temperature exposure or after 3 hr of low-salinity challenge. In addition, we detected time-dependent hemimethylation changes and increased intragroup epigenetic divergence induced by environmental stresses. Interestingly, we found evidence of DNA methylation resilience, as most stress-induced DNA methylation variation maintained shortly (~48 hr) and quickly returned back to the control levels. Our findings clearly showed that invasive species could rapidly respond to acute environmental changes through DNA methylation modifications, and rapid environmental changes left significant epigenetic signatures at the whole-genome level. All these results provide fundamental background to deeply investigate the contribution of DNA methylation mechanisms to rapid contemporary environmental adaptation. © 2017 John Wiley & Sons Ltd.

  6. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    ONOS

    2010-09-06

    Sep 6, 2010 ... Crop improvement facilitated by modern biotechnology has largely been acknowledged as a ... ligases and restriction endonucleases (Sharma et al.,. 2002). The aim of this study is to focus on ... Chokanan mango leaf of different growth stages used in the isolation of DNA. (a) Dark purplish, soft and partially.

  7. Rapid isolation of high molecular weight DNA from single dry ...

    African Journals Online (AJOL)

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  8. Rapid purification of high activity Taq DNA polymerase expressed in ...

    African Journals Online (AJOL)

    A simplified method is described here for the preparation of a thermostable Taq DNA polymerase enzyme from Escherichia coli (E. coli) strain DH5a carrying the pTTQ18 expression vector transformed with the Taq polymerase gene. Standard purifications were done with 1 litre batch cultures of E. coli cells and produced ...

  9. Rapid isolation of high molecular weight DNA from single dried ...

    African Journals Online (AJOL)

    ANAND

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri. Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  10. Differential conductance as a promising approach for rapid DNA sequencing with nanopore-embedded electrodes

    Science.gov (United States)

    He, Yuhui; Shao, Lubing; Scheicher, Ralph H.; Grigoriev, Anton; Ahuja, Rajeev; Long, Shibing; Ji, Zhuoyu; Yu, Zhaoan; Liu, Ming

    2010-07-01

    We propose an approach for nanopore-based DNA sequencing using characteristic transverse differential conductance. Molecular dynamics and electron transport simulations show that the transverse differential conductance during the translocation of DNA through the nanopore is distinguishable enough for the detection of the base sequence and can withstand electrical noise caused by DNA structure fluctuation. Our findings demonstrate several advantages of the transverse conductance approach, which may lead to important applications in rapid genome sequencing.

  11. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  12. The Semi-Quantitative Study of Magnetization Process on Milling and Reannealing of Barium Hexaferrite (BaO.6Fe2O3

    Directory of Open Access Journals (Sweden)

    Ridwan

    2009-07-01

    Full Text Available Barium hexaferrite (BaO.6Fe2O3 is as a hard magnetic material with good chemical stability which has been intensively used as permanent magnet components. Many works have been done in order to improve their magnetic properties either through chemical process or powders metallurgy technique. In this work, commercial BaO.6Fe2O3 was milled using high-energy milling machine for 10, 20 and 30 hours and followed by reannealing for 3 hours at 1000⁰C in air. X-ray diffraction pattern indicate no phase decomposition occurred caused the mill processing, annealing of milled powders recovered the crystal system and promoted crystallite growth. The magnetic hysteresis curve measured by vibrating sample magnetometer (VSM shows the coercivity of annealed BaO.6Fe2O3 increases to two times higher than the original one. By using Jiles-Atherton model, all the hysteresis parameters Ms, k, α, a and c, have been determined adopted to the Genetic Algorithm (GA. The analyzed hysteretic parameters obtained from this work is congruent to the change of magnetic properties of as-milled and annealed powders of barium hexaferrite.

  13. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

    Science.gov (United States)

    Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

    2014-12-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

  14. Rapid development of a DNA vaccine for Zika virus.

    Science.gov (United States)

    Dowd, Kimberly A; Ko, Sung-Youl; Morabito, Kaitlyn M; Yang, Eun Sung; Pelc, Rebecca S; DeMaso, Christina R; Castilho, Leda R; Abbink, Peter; Boyd, Michael; Nityanandam, Ramya; Gordon, David N; Gallagher, John Robert; Chen, Xuejun; Todd, John-Paul; Tsybovsky, Yaroslav; Harris, Audray; Huang, Yan-Jang S; Higgs, Stephen; Vanlandingham, Dana L; Andersen, Hanne; Lewis, Mark G; De La Barrera, Rafael; Eckels, Kenneth H; Jarman, Richard G; Nason, Martha C; Barouch, Dan H; Roederer, Mario; Kong, Wing-Pui; Mascola, John R; Pierson, Theodore C; Graham, Barney S

    2016-10-14

    Zika virus (ZIKV) was identified as a cause of congenital disease during the explosive outbreak in the Americas and Caribbean that began in 2015. Because of the ongoing fetal risk from endemic disease and travel-related exposures, a vaccine to prevent viremia in women of childbearing age and their partners is imperative. We found that vaccination with DNA expressing the premembrane and envelope proteins of ZIKV was immunogenic in mice and nonhuman primates, and protection against viremia after ZIKV challenge correlated with serum neutralizing activity. These data not only indicate that DNA vaccination could be a successful approach to protect against ZIKV infection, but also suggest a protective threshold of vaccine-induced neutralizing activity that prevents viremia after acute infection. Copyright © 2016, American Association for the Advancement of Science.

  15. Rapid Electrokinetic Isolation of Cancer-Related Circulating Cell-Free DNA Directly from Blood

    Science.gov (United States)

    Sonnenberg, Avery; Marciniak, Jennifer Y.; Rassenti, Laura; Ghia, Emanuela M.; Skowronski, Elaine A.; Manouchehri, Sareh; McCanna, James; Widhopf, George F.; Kipps, Thomas J.; Heller, Michael J.

    2014-01-01

    BACKGROUND Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a “liquid biopsy” may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. METHODS We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification,PCR,and DNA sequencing. The complete process, blood to PCR, required <10 min. ccf-DNA was amplified by PCR with immunoglobulin heavy chain variable region (IGHV)-specific primers to identify the unique IGHV gene expressed by the leukemic B-cell clone, and then sequenced. RESULTS PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15–20 mL blood. CONCLUSIONS Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring. PMID:24270796

  16. An economical and combined method for rapid and efficient isolation of fungal DNA.

    Science.gov (United States)

    Lech, T; Syguła-Cholewinska, J; Szostak-Kot, J

    2014-12-18

    DNA isolation is a crucial step of conducting genetic studies in any organism. However, this process is quite difficult when studying fungi because of the need to damage the fungal cell walls of specific structures. In this study, we developed a method for the rapid and efficient isolation of fungal DNA based on simultaneous mechanical and enzymatic cell wall degradation. There are several typical modifications of the standard phenol-chloroform DNA extraction method. This method can be modified to degrade the fungal cell wall. The first step of the presented DNA extraction included manual homogenization in modified lysis buffer. Next, enzymatic digestion using 2 enzymes was conducted, including lyticase and proteinase K. To carefully select the most favorable conditions, we developed an economical, rapid, and reliable method for fungal DNA extraction that ensures both high efficiency and proper purity, which are essential for further analyses.

  17. DNA Probe Pooling for Rapid Delineation of Chromosomal Breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Kwan, Johnson; Baumgartner, Adolf; Weier, Jingly F.; Wang, Mei; Escudero, Tomas; Munne' , Santiago; Zitzelsberger, Horst F.; Weier, Heinz-Ulrich

    2009-01-30

    Structural chromosome aberrations are hallmarks of many human genetic diseases. The precise mapping of translocation breakpoints in tumors is important for identification of genes with altered levels of expression, prediction of tumor progression, therapy response, or length of disease-free survival as well as the preparation of probes for detection of tumor cells in peripheral blood. Similarly, in vitro fertilization (IVF) and preimplantation genetic diagnosis (PGD) for carriers of balanced, reciprocal translocations benefit from accurate breakpoint maps in the preparation of patient-specific DNA probes followed by a selection of normal or balanced oocytes or embryos. We expedited the process of breakpoint mapping and preparation of case-specific probes by utilizing physically mapped bacterial artificial chromosome (BAC) clones. Historically, breakpoint mapping is based on the definition of the smallest interval between proximal and distal probes. Thus, many of the DNA probes prepared for multi-clone and multi-color mapping experiments do not generate additional information. Our pooling protocol described here with examples from thyroid cancer research and PGD accelerates the delineation of translocation breakpoints without sacrificing resolution. The turnaround time from clone selection to mapping results using tumor or IVF patient samples can be as short as three to four days.

  18. Rapid electrokinetic isolation of cancer-related circulating cell-free DNA directly from blood.

    Science.gov (United States)

    Sonnenberg, Avery; Marciniak, Jennifer Y; Rassenti, Laura; Ghia, Emanuela M; Skowronski, Elaine A; Manouchehri, Sareh; McCanna, James; Widhopf, George F; Kipps, Thomas J; Heller, Michael J

    2014-03-01

    Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a "liquid biopsy" may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification, PCR, and DNA sequencing. The complete process, blood to PCR, required B-cell clone, and then sequenced. PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15-20 mL blood. Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring.

  19. Rapid turnover of DnaA at replication origin regions contributes to initiation control of DNA replication.

    Science.gov (United States)

    Schenk, Katrin; Hervás, Ana B; Rösch, Thomas C; Eisemann, Marc; Schmitt, Bernhard A; Dahlke, Stephan; Kleine-Borgmann, Luise; Murray, Seán M; Graumann, Peter L

    2017-02-01

    DnaA is a conserved key regulator of replication initiation in bacteria, and is homologous to ORC proteins in archaea and in eukaryotic cells. The ATPase binds to several high affinity binding sites at the origin region and upon an unknown molecular trigger, spreads to several adjacent sites, inducing the formation of a helical super structure leading to initiation of replication. Using FRAP analysis of a functional YFP-DnaA allele in Bacillus subtilis, we show that DnaA is bound to oriC with a half-time of 2.5 seconds. DnaA shows similarly high turnover at the replication machinery, where DnaA is bound to DNA polymerase via YabA. The absence of YabA increases the half time binding of DnaA at oriC, showing that YabA plays a dual role in the regulation of DnaA, as a tether at the replication forks, and as a chaser at origin regions. Likewise, a deletion of soj (encoding a ParA protein) leads to an increase in residence time and to overinitiation, while a mutation in DnaA that leads to lowered initiation frequency, due to a reduced ATPase activity, shows a decreased residence time on binding sites. Finally, our single molecule tracking experiments show that DnaA rapidly moves between chromosomal binding sites, and does not arrest for more than few hundreds of milliseconds. In Escherichia coli, DnaA also shows low residence times in the range of 200 ms and oscillates between spatially opposite chromosome regions in a time frame of one to two seconds, independently of ongoing transcription. Thus, DnaA shows extremely rapid binding turnover on the chromosome including oriC regions in two bacterial species, which is influenced by Soj and YabA proteins in B. subtilis, and is crucial for balanced initiation control, likely preventing fatal premature multimerization and strand opening of DnaA at oriC.

  20. Facile preparation of a DNA sensor for rapid herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Tam, Phuong Dinh, E-mail: tampd-hast@mail.hut.edu.vn [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Tuan, Mai Anh, E-mail: tuanma-itims@mail.hut.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam); Huy, Tran Quang [National Institute of Hygiene and Epidemiology (NIHE), 01 Yersin, Hai Ba Trung District, Hanoi (Viet Nam); Le, Anh-Tuan [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Hieu, Nguyen Van, E-mail: hieu@itims.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam)

    2010-10-12

    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  1. New rapid DNA extraction method with Chelex from Venturia inaequalis spores.

    Science.gov (United States)

    Turan, Ceren; Nanni, Irene Maja; Brunelli, Agostino; Collina, Marina

    2015-08-01

    The objective of this study was to develop a rapid method to isolate DNA from Venturia inaequalis spores for use in diagnostic DNA mutation analysis. Chelex-100 resin was evaluated and compared with a well established DNA exctraction method, utilizing CTAB in order to have a robust comparison. In this research we demonstrated that Chelex-100 efficiently makes extraction of the DNA from V. inaequalis spores available for direct use in molecular analyses. Also, the quantity and quality of extracted DNA were shown to be adequate for PCR analysis. Comparatively, the quality of DNA samples isolated using Chelex method was better than those extracted using CTAB. In conclusion, the Chelex method is recommended for PCR experiments considering its simplicity and cost-effectiveness. Copyright © 2015. Published by Elsevier B.V.

  2. RAPID AND EFFICIENT METHOD FOR ENVIRONMENTAL DNA EXTRACTION AND PURIFICATION FROM SOIL

    Directory of Open Access Journals (Sweden)

    J. Hamedi

    2016-06-01

    Full Text Available Large proportion of microbial population in the world is unculturable. Extraction of total DNA from soil is usually a crucial step considering to the difficulties of study the uncultivable microorganisms. Humic acid is considered as the main inhibitory agent in the environmental DNA studies. Here, we introduced a rapid and efficient method for DNA extraction and purification from soil. Yield of DNA extraction by the presented method was 130 ng/µl. Three conventional methods of DNA extraction including liquid nitrogen incursion, bead beating and sonication were performed as control methods. Yield of DNA extraction by these methods were 110, 90 and 50 ng/µl, respectively. A rapid and efficient one step DNA purification method was introduced instead of hazardous conventional phenol-chloroform methods. Humic acid removal percentage by the introduced method was 95.8 % that is comparable with 97 % gained by the conventional gel extraction method and yield of DNA after purification was 84 % and 73 %, respectively. This study could be useful in molecular ecology and metagenomics study as a fast and reliable method.

  3. Rapid and accurate identification of microorganisms contaminating cosmetic products based on DNA sequence homology.

    Science.gov (United States)

    Fujita, Y; Shibayama, H; Suzuki, Y; Karita, S; Takamatsu, S

    2005-12-01

    The aim of this study was to develop rapid and accurate procedures to identify microorganisms contaminating cosmetic products, based on the identity of the nucleotide sequences of the internal transcribed spacer (ITS) region of the ribosomal RNA coding DNA (rDNA). Five types of microorganisms were isolated from the inner portion of lotion bottle caps, skin care lotions, and cleansing gels. The rDNA ITS region of microorganisms was amplified through the use of colony-direct PCR or ordinal PCR using DNA extracts as templates. The nucleotide sequences of the amplified DNA were determined and subjected to homology search of a publicly available DNA database. Thereby, we obtained DNA sequences possessing high similarity with the query sequences from the databases of all the five organisms analyzed. The traditional identification procedure requires expert skills, and a time period of approximately 1 month to identify the microorganisms. On the contrary, 3-7 days were sufficient to complete all the procedures employed in the current method, including isolation and cultivation of organisms, DNA sequencing, and the database homology search. Moreover, it was possible to develop the skills necessary to perform the molecular techniques required for the identification procedures within 1 week. Consequently, the current method is useful for rapid and accurate identification of microorganisms, contaminating cosmetics.

  4. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.

    Science.gov (United States)

    Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B

    2017-01-01

    Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.

  5. Rapid transport of plasmid DNA into the nucleolus via actin depolymerization using the HVJ envelope vector.

    Science.gov (United States)

    Suvanasuthi, Saroj; Tamai, Katsuto; Kaneda, Yasufumi

    2007-01-01

    Although nuclear transport of therapeutic genes is an essential requirement of human gene therapy, factors required for nuclear entry of DNA remain to be elucidated. Non-viral vector systems have led to numerous improvements in the efficiency of delivery of exogenous DNA into cells. However, nuclear transport of plasmid is difficult to achieve. We examined nuclear translocation efficiency of Cy3-labeled plasmid DNA (Cy3-pDNA) delivered by the hemagglutinating virus of Japan envelope (HVJ-E) vector, Lipofectamine or microinjection. We also examined the effect of actin depolymerization on nuclear transport of Cy3-pDNA. Cy3-pDNA reached the nucleus, particularly in the nucleolus, in 30 min after fusion-mediated delivery using the HVJ-E vector, while the DNA was retained in the cytoplasm during the observed period after the delivery by cationic liposomes. HVJ-E treatment transiently depolymerized actin filaments, and acceleration of nucleolar entry of microinjected DNA was achieved when treated with either empty HVJ-E or cytochalasin D, an inhibitor of actin depolymerization, prior to microinjection. These results suggest that plasmid DNA can be transported rapidly from the cytoplasm to the nucleolus when actin filaments are depolymerized. Thus, the HVJ-E vector can accelerate the transport of DNA to the nucleolus by actin depolymerization. Copyright 2006 John Wiley & Sons, Ltd.

  6. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    OpenAIRE

    Bi Yanzhen; Qiao Xianfeng; Hua Zaidong; Zhang Liping; Liu Ximei; Li Li; Hua Wenjun; Xiao Hongwei; Zhou Jingrong; Wei Qingxin; Zheng Xinmin

    2012-01-01

    Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to pr...

  7. Capacitive DNA sensor for rapid and sensitive detection of whole genome human herpesvirus-1 dsDNA in serum.

    Science.gov (United States)

    Cheng, Cheng; Oueslati, Rania; Wu, Jayne; Chen, Jiangang; Eda, Shigetoshi

    2017-06-01

    This work presents a rapid, highly sensitive, low-cost, and specific capacitive DNA sensor for detection of whole genome human herpesvirus-1 DNA. This sensor is capable of direct DNA detection with a response time of 30 s, and it can be used to test standard buffer or serum samples. The sensing approach for DNA detection is based on alternating current (AC) electrokinetics. By applying an inhomogeneous AC electric field on sensor electrodes, positive dielectrophoresis is induced to accelerate DNA hybridization. The same applied AC signal also directly measures the hybridization of target with the probe on the sensor surface. Experiments are conducted to optimize the AC signal, as well as the buffers for probe immobilization and target DNA hybridization. The assay is highly sensitive and specific, with no response to human herpesvirus-2 DNA at 5 ng/mL and a LOD of 1.0 pg/mL (6.5 copies/μL or 10.7 aM) in standard buffer. When testing the double stranded (ds) DNA spiked in human serum samples, the sensor yields a LOD of 20.0 pg/mL (129.5 copies/μL or 0.21 femtomolar (fM)) in neat serum. In this work, the target is whole genome dsDNA, consequently the test can be performed without the use of enzyme or amplification, which considerably simplifies the sensor operation and is highly suitable for point of care disease diagnosis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications.

    Directory of Open Access Journals (Sweden)

    Selvaraju Gayathri Devi

    Full Text Available A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely "powdered glass method" from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil with high purity (A260/280: 1.76 ± 0.05 and reduced humic substances (A340: 0.047 ± 0.03. The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method's applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666.

  9. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications.

    Science.gov (United States)

    Devi, Selvaraju Gayathri; Fathima, Anwar Aliya; Radha, Sudhakar; Arunraj, Rex; Curtis, Wayne R; Ramya, Mohandass

    2015-01-01

    A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely "powdered glass method" from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC) as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil) with high purity (A260/280: 1.76 ± 0.05) and reduced humic substances (A340: 0.047 ± 0.03). The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method's applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666).

  10. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications

    Science.gov (United States)

    Devi, Selvaraju Gayathri; Fathima, Anwar Aliya; Radha, Sudhakar; Arunraj, Rex; Curtis, Wayne R.; Ramya, Mohandass

    2015-01-01

    A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely “powdered glass method” from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC) as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil) with high purity (A260/280: 1.76 ± 0.05) and reduced humic substances (A340: 0.047 ± 0.03). The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method’s applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666). PMID:26167854

  11. Engineering split intein DnaE from Nostoc punctiforme for rapid protein purification.

    Science.gov (United States)

    Ramirez, Miguel; Valdes, Najla; Guan, Dongli; Chen, Zhilei

    2013-03-01

    We report the engineering of a DnaE intein able to catalyze rapid C-terminal cleavage in the absence of N-terminal cleavage. A single mutation in DnaE intein from Nostoc punctiforme PCC73102 (NpuDnaE), Asp118Gly, was introduced based on sequence alignment with a previously engineered C-terminal cleaving intein mini-MtuRecA. This mutation was able to both suppress N-terminal cleavage and significantly elevate C-terminal cleavage efficiency. Molecular modeling suggests that in NpuDnaE Asp118 forms a hydrogen bond with the penultimate Asn, preventing its spontaneous cyclization prior to N-terminal cleavage. Mutation of Asp118 to Gly essentially abolishes this restriction leading to subsequent C-terminal cleavage in the absence of N-terminal cleavage. The Gly118 NpuDnaE mutant exhibits rapid thio-dependent C-terminal cleavage kinetics with 80% completion within 3 h at room temperature. We used this newly engineered intein to develop both column-free and chromatography-based protein purification methods utilizing the elastin-like-polypeptide and chitin-binding protein as removable purification tags, respectively. We demonstrate rapid target protein purification to electrophoretic purity at yields up to 84 mg per liter of Escherichia coli culture.

  12. Rapid DNA technologies at the crime scene : ‘CSI’ fiction matching reality

    NARCIS (Netherlands)

    Mapes, A.A.

    2017-01-01

    This thesis describes how mobile Rapid DNA analysis may be implemented as a potential effective tool in modern day law enforcement. It is expected that this technology will affect the role of the forensic institutes and the tasks of professionals in the Criminal Justice System (CJS). The research in

  13. A rapid and efficient DNA extraction method suitable for marine macroalgae.

    Science.gov (United States)

    Ramakrishnan, Gautham Subramaniam; Fathima, Anwar Aliya; Ramya, Mohandass

    2017-12-01

    Macroalgae are a diverse group of organisms. Marine macroalgae, in particular, have numerous medicinal and industrial applications. Molecular studies of macroalgae require suitable concentrations of DNA free of contaminants. At present, numerous protocols exist for DNA extraction from macroalgae. However, they are either time consuming, expensive or work only with few species. The method described in this study is rapid and efficient and applicable to different types of marine macroalgae. This method yields an average of 3.85 µg of DNA per 50 mg of algal tissue, with an average purity of 1.88. The isolated DNA was suitable for PCR amplification of universal plastid region of macroalgae.

  14. Rapid DNA extraction for specific detection and quantitation of Mycobacterium tuberculosis DNA in sputum specimens using taqman assays

    Science.gov (United States)

    Gomez, Diana I.; Mullin, Caroline S.; Mora-Guzmán, Francisco; Crespo-Solis, J. Gonzalo; Fisher-Hoch, Susan P.; McCormick, Joseph B.; Restrepo, Blanca I.

    2011-01-01

    SUMMARY Rapid tuberculosis (TB) detection is critical for disease control, and further quantitation of Mycobacterium tuberculosis (Mtb) in sputum is valuable for epidemiological and clinical studies. We evaluated a simple, robust and cost-efficient in-house DNA extraction and downstream taqman approach for detection and quantitation of Mtb genomes from sputum of newly-diagnosed TB patients and non-TB controls. DNA was extracted using guanidine isothiocyanate and silica-based spin columns in less than 2h, stored frozen, and taqman assays were used to detect Mtb with IS6110 and quantify it targeting RD1 and IS1081. The taqmans had a sensitivity > 95% in 108 culture-confirmed TB patients and specificity of 100% in 43 non-TB controls. Genome counts were correlated with the Mycobacterial Growth Indicator Tubes’ (MGIT) time-to-detection values (1/TTD×1000; rho=0.66; p<0.001) in 91 TB patients (33 excluded with MGIT contamination). This linear relationship was nearly identical between mycobacteria isolated from sputum and H37Rv Mtb grown in-vitro to its log phase. TB treatment between 3 and 7 days was associated with lower 1/TTD×1000 values but not with genome counts. Together, our protocol provides rapid, specific, inexpensive and quantitative detection of Mtb DNA in fresh or stored sputa making it a robust tool for prompt TB diagnosis, and with potential use for clinical and epidemiologic studies. PMID:22088321

  15. Rapid Sequential in Situ Multiplexing with DNA Exchange Imaging in Neuronal Cells and Tissues.

    Science.gov (United States)

    Wang, Yu; Woehrstein, Johannes B; Donoghue, Noah; Dai, Mingjie; Avendaño, Maier S; Schackmann, Ron C J; Zoeller, Jason J; Wang, Shan Shan H; Tillberg, Paul W; Park, Demian; Lapan, Sylvain W; Boyden, Edward S; Brugge, Joan S; Kaeser, Pascal S; Church, George M; Agasti, Sarit S; Jungmann, Ralf; Yin, Peng

    2017-10-11

    To decipher the molecular mechanisms of biological function, it is critical to map the molecular composition of individual cells or even more importantly tissue samples in the context of their biological environment in situ. Immunofluorescence (IF) provides specific labeling for molecular profiling. However, conventional IF methods have finite multiplexing capabilities due to spectral overlap of the fluorophores. Various sequential imaging methods have been developed to circumvent this spectral limit but are not widely adopted due to the common limitation of requiring multirounds of slow (typically over 2 h at room temperature to overnight at 4 °C in practice) immunostaining. We present here a practical and robust method, which we call DNA Exchange Imaging (DEI), for rapid in situ spectrally unlimited multiplexing. This technique overcomes speed restrictions by allowing for single-round immunostaining with DNA-barcoded antibodies, followed by rapid (less than 10 min) buffer exchange of fluorophore-bearing DNA imager strands. The programmability of DEI allows us to apply it to diverse microscopy platforms (with Exchange Confocal, Exchange-SIM, Exchange-STED, and Exchange-PAINT demonstrated here) at multiple desired resolution scales (from ∼300 nm down to sub-20 nm). We optimized and validated the use of DEI in complex biological samples, including primary neuron cultures and tissue sections. These results collectively suggest DNA exchange as a versatile, practical platform for rapid, highly multiplexed in situ imaging, potentially enabling new applications ranging from basic science, to drug discovery, and to clinical pathology.

  16. New and rapid procedure for the isolation of ultra-high molecular weight eukaryotic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Longmire, J.L.; Lewis, A.; Meincke, L.J.; Hildebrand, C.E.

    1986-05-01

    The authors have developed a novel procedure that permits the rapid extraction and isolation of ultra-high molecular weight DNA from avian or mammalian cells using dialysis against a solution of polyethylene glycol (PEG). Cells harvested by centrifugation and washed twice in ice-cold Ca/sup + +/- and Mg/sup + +/-free phosphate buffered saline were resuspended in 5 ml 0.01 M Tris-Cl (pH 8.0); 0.001 M EDTA (TE); sodium dodecyl sulfate and proteinase K were added to final concentrations of 0.1% and 0.1 mg/ml, respectively. After incubation at 37/sup 0/C overnight, the viscous solution was transferred to a mini-collodian bag and concentrated by dialysis against 4-5 changes of 20% PEG in TE over a period of 5 hours at RT. Concentrated samples were desalted by dialysis against fresh TE for two 15 minute intervals. DNA obtained using this procedure gives A/sub 260//A/sub 280/ consistently >1.8. Analysis of DNA size using pulsed field gel electrophoresis revealed a distribution of fragments >500 Kb in length. Further measurements examined were (1) restriction enzyme digestibility, (2) ligation efficiency of restricted DNA, and (3) cloning efficiency using the lambda vector Ch21A. This novel methodology offers a valuable alternative protocol for rapid purification of ultrahigh molecular weight DNA for various applications in molecular biology.

  17. The DNA 'comet assay' as a rapid screening technique to control irradiated food.

    Science.gov (United States)

    Cerda, H; Delincée, H; Haine, H; Rupp, H

    1997-04-29

    The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded.

  18. The DNA `comet assay` as a rapid screening technique to control irradiated food

    Energy Technology Data Exchange (ETDEWEB)

    Cerda, H. [Department of Radioecology, The Swedish University of Agricultural Sciences, Uppsala (Sweden); Delincee, H. [Institute of Nutritional Physiology, Federal Research Centre for Nutrition, Karlsruhe (Germany); Haine, H. [Campden and Chorleywood Food Research Association, Chipping Campden, Gloucestershire (United Kingdom); Rupp, H. [Swiss Federal Office of Public Health, Section of Food Chemistry, Berne (Switzerland)

    1997-04-29

    The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded.

  19. Rapid DNA extraction protocol from stool, suitable for molecular genetic diagnosis of colon cancer.

    Science.gov (United States)

    Abbaszadegan, Mohammad Reza; Velayati, Arash; Tavasoli, Alireza; Dadkhah, Ezzat

    2007-07-01

    Colorectal cancer (CRC) is one of the most common forms of cancers in the world and is curable if diagnosed at the early stage. Analysis of DNA extracted from stool specimens is a recent advantage to cancer diagnostics. Many protocols have been recommended for DNA extraction from stool, and almost all of them are difficult and time consuming, dealing with high amount of toxic materials like phenol. Their results vary due to sample collection method and further purification treatment. In this study, an easy and rapid method was optimized for isolating the human DNA with reduced PCR inhibitors present in stool. Fecal samples were collected from 10 colonoscopy-negative adult volunteers and 10 patients with CRC. Stool (1 g) was extracted using phenol/chloroform based protocol. The amplification of P53 exon 9 was examined to evaluate the extraction efficiency for human genomic targets and also compared its efficiency with Machiels et al. and Ito et al. protocols. The amplification of exon 9 of P53 from isolated fecal DNA was possible in most cases in 35 rounds of PCR using no additional purification procedure for elimination of the remaining inhibitors.inhibitors. A useful, rapid and easy protocol for routine extraction of DNA from stool was introduced and compared with two previous protocols.

  20. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples

    OpenAIRE

    Deb, R.; Sengar, G. S.; Singh, U.; Kumar, S.; Raja, T. V.; Alex, R.; Alyethodi, R. R.; Prakash, B.

    2017-01-01

    Animal species detection is one of the crucial steps for consumer’s food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up ...

  1. Rapid yeast DNA extraction by boiling and freeze-thawing without using chemical reagents and DNA purification

    Directory of Open Access Journals (Sweden)

    Gildo Almeida da Silva

    2012-04-01

    Full Text Available The purpose of this work was to study a rapid yeast DNA extraction by boiling and freeze-thawing processes without using chemical reagents or any purification procedures, to obtain a high grade PCR-product. A specific DNA fragment of the 18S region of Dekkera bruxellensis and Saccharomyces cerevisiae was chosen. The described boiling and freeze-thawing protocols generated the PCR-grade product preparations and could be used to process many samples. The amplification of the fragments could be observed after 30 and 35 cycles. These processes of extraction without using any kind of chemical reagents, especial water, and purification procedures proved to be efficient, reproducible, simple, fast, and inexpensive.

  2. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    Science.gov (United States)

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

    2018-02-15

    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  3. Rapid Detection of Cell-Free Mycobacterium tuberculosis DNA in Tuberculous Pleural Effusion.

    Science.gov (United States)

    Che, Nanying; Yang, Xinting; Liu, Zichen; Li, Kun; Chen, Xiaoyou

    2017-05-01

    Tuberculous pleurisy is one of the most common types of extrapulmonary tuberculosis, but its diagnosis remains difficult. In this study, we report for the first time on the detection of cell-free Mycobacterium tuberculosis DNA in pleural effusion and an evaluation of a newly developed molecular assay for the detection of cell-free Mycobacterium tuberculosis DNA. A total of 78 patients with pleural effusion, 60 patients with tuberculous pleurisy, and 18 patients with alternative diseases were included in this study. Mycobacterial culture, the Xpert MTB/RIF assay, the adenosine deaminase assay, the T-SPOT.TB assay, and the cell-free Mycobacterium tuberculosis DNA assay were performed on all the pleural effusion samples. The cell-free Mycobacterium tuberculosis DNA assay and adenosine deaminase assay showed significantly higher sensitivities of 75.0% and 68.3%, respectively, than mycobacterial culture and the Xpert MTB/RIF assay, which had sensitivities of 26.7% and 20.0%, respectively (P Mycobacterium tuberculosis DNA assay detected as few as 1.25 copies of IS6110 per ml of pleural effusion and showed good accordance of the results between repeated tests (r = 0.978, P = 2.84 × 10-10). These data suggest that the cell-free Mycobacterium tuberculosis DNA assay is a rapid and accurate molecular test which provides direct evidence of Mycobacterium tuberculosis etiology. Copyright © 2017 American Society for Microbiology.

  4. DNA Sequence Signatures for Rapid Detection of Six Target Bacterial Pathogens Using PCR Assays

    Directory of Open Access Journals (Sweden)

    Kenjiro Nagamine

    2015-01-01

    Full Text Available Using Streptococcus pyogenes as a model, we previously established a stepwise computational workflow to effectively identify species-specific DNA signatures that could be used as PCR primer sets to detect target bacteria with high specificity and sensitivity. In this study, we extended the workflow for the rapid development of PCR assays targeting Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Clostridium tetani , and Staphylococcus aureus , which are of safety concern for human tissue intended for transplantation. Twenty-one primer sets that had sensitivity of detecting 5–50 fg DNA from target bacteria with high specificity were selected. These selected primer sets can be used in a PCR array for detecting target bacteria with high sensitivity and specificity. The workflow could be widely applicable for the rapid development of PCR-based assays for a wide range of target bacteria, including those of biothreat agents.

  5. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    Directory of Open Access Journals (Sweden)

    Bi Yanzhen

    2012-07-01

    Full Text Available Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. Conclusions ABI-REC has the following advantages: (i rapid and highly efficient; (ii native DNA cloning without introduction of extra bases; (iii restriction-free; (iv easy positioning of directional and site-specific recombination owing to formulated primer design. ABI

  6. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy.

    Science.gov (United States)

    Bi, Yanzhen; Qiao, Xianfeng; Hua, Zaidong; Zhang, Liping; Liu, Ximei; Li, Li; Hua, Wenjun; Xiao, Hongwei; Zhou, Jingrong; Wei, Qingxin; Zheng, Xinmin

    2012-07-06

    Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN) promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. ABI-REC has the following advantages: (i) rapid and highly efficient; (ii) native DNA cloning without introduction of extra bases; (iii) restriction-free; (iv) easy positioning of directional and site-specific recombination owing to formulated primer design. ABI-REC is a novel approach to DNA engineering and gene functional

  7. Decomposable quantum-dots/DNA nanosphere for rapid and ultrasensitive detection of extracellular respiring bacteria.

    Science.gov (United States)

    Wen, Junlin; Zhou, Shungui; Yu, Zhen; Chen, Junhua; Yang, Guiqin; Tang, Jia

    2018-02-15

    Extracellular respiring bacteria (ERB) are a group of bacteria capable of transferring electrons to extracellular acceptors and have important application in environmental remediation. In this study, a decomposable quantum-dots (QDs)/DNA nanosphere probe was developed for rapid and ultrasensitive detection of ERB. The QDs/DNA nanosphere was self-assembled from QDs-streptavidin conjugate (QDs-SA) and Y-shaped DNA nanostructure that is constructed based on toehold-mediated strand displacement. It can release numerous fluorescent QDs-SA in immunomagnetic separation (IMS)-based immunoassay via simple biotin displacement, which remarkably amplifies the signal of antigen-antibody recognizing event. This QDs/DNA-nanosphere-based IMS-fluorescent immunoassay is ultrasensitive for model ERB Shewanella oneidensis, showing a wide detection range between 1.0 cfu/mL and 1.0 × 108 cfu/mL with a low detection limit of 1.37 cfu/mL. Moreover, the proposed IMS-fluorescent immunoassay exhibits high specificity, acceptable reproducibility and stability. Furthermore, the proposed method shows acceptable recovery (92.4-101.4%) for detection of S. oneidensis spiked in river water samples. The proposed IMS-fluorescent immunoassay advances an intelligent strategy for rapid and ultrasensitive quantitation of low-abundance analyte and thus holds promising potential in food, medical and environmental applications. Copyright © 2017. Published by Elsevier B.V.

  8. Essential Function of Dicer in Resolving DNA Damage in the Rapidly Dividing Cells of the Developing and Malignant Cerebellum

    Directory of Open Access Journals (Sweden)

    Vijay Swahari

    2016-01-01

    Full Text Available Maintenance of genomic integrity is critical during neurodevelopment, particularly in rapidly dividing cerebellar granule neuronal precursors that experience constitutive replication-associated DNA damage. As Dicer was recently recognized to have an unexpected function in the DNA damage response, we examined whether Dicer was important for preserving genomic integrity in the developing brain. We report that deletion of Dicer in the developing mouse cerebellum resulted in the accumulation of DNA damage leading to cerebellar progenitor degeneration, which was rescued with p53 deficiency; deletion of DGCR8 also resulted in similar DNA damage and cerebellar degeneration. Dicer deficiency also resulted in DNA damage and death in other rapidly dividing cells including embryonic stem cells and the malignant cerebellar progenitors in a mouse model of medulloblastoma. Together, these results identify an essential function of Dicer in resolving the spontaneous DNA damage that occurs during the rapid proliferation of developmental progenitors and malignant cells.

  9. Tuning Toehold Length and Temperature to Achieve Rapid, Colorimetric Detection of DNA from the Disassembly of DNA-Gold Nanoparticle Aggregates.

    Science.gov (United States)

    Lam, Michael K; Gadzikwa, Tendai; Nguyen, Trang; Kausar, Abu; Alladin-Mustan, B Safeenaz; Sikder, Md Delwar; Gibbs-Davis, Julianne M

    2016-02-16

    Gold nanoparticles have been widely utilized to achieve colorimetric detection for various diagnostic applications. One of the most frequently used methods for DNA detection involves the aggregation of DNA-modified gold nanoparticles driven by target DNA hybridization. This process, however, is intrinsically slow, limiting its use in rapid diagnostics. Here we take advantage of the reverse process: the disassembly of preformed aggregates triggered by the addition of target DNA via a strand displacement mechanism. A systematic study of the dependence of the disassembly rate on temperature, with and without toeholds, has delivered a system that produces an extremely rapid colorimetric response. Furthermore, using an optimal toehold length of 5 nucleotides, target triggered disassembly is rapid over a wide range of ambient temperatures. Using this overhang system, simple visualization of low picomole amounts of target DNA is possible within 10 min at room temperature.

  10. Carbon nanotube-based lateral flow biosensor for sensitive and rapid detection of DNA sequence.

    Science.gov (United States)

    Qiu, Wanwei; Xu, Hui; Takalkar, Sunitha; Gurung, Anant S; Liu, Bin; Zheng, Yafeng; Guo, Zebin; Baloda, Meenu; Baryeh, Kwaku; Liu, Guodong

    2015-02-15

    In this article, we describe a carbon nanotube (CNT)-based lateral flow biosensor (LFB) for rapid and sensitive detection of DNA sequence. Amine-modified DNA detection probe was covalently immobilized on the shortened multi-walled carbon nanotubes (MWCNTs) via diimide-activated amidation between the carboxyl groups on the CNT surface and amine groups on the detection DNA probes. Sandwich-type DNA hybridization reactions were performed on the LFB and the captured MWCNTs on test zone and control zone of LFB produced the characteristic black bands, enabling visual detection of DNA sequences. Combining the advantages of lateral flow chromatographic separation with unique physical properties of MWCNT (large surface area), the optimized LFB was capable of detecting of 0.1 nM target DNA without instrumentation. Quantitative detection could be realized by recording the intensity of the test line with the Image J software, and the detection limit of 40 pM was obtained. This detection limit is 12.5 times lower than that of gold nanoparticle (GNP)-based LFB (0.5 nM, Mao et al. Anal. Chem. 2009, 81, 1660-1668). Another important feature is that the preparation of MWCNT-DNA conjugates was robust and the use of MWCNT labels avoided the aggregation of conjugates and tedious preparation time, which were often met in the traditional GNP-based nucleic acid LFB. The applications of MWCNT-based LFB can be extended to visually detect protein biomarkers using MWCNT-antibody conjugates. The MWCNT-based LFB thus open a new door to prepare a new generation of LFB, and shows great promise for in-field and point-of-care diagnosis of genetic diseases and for the detection of infectious agents. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

    Science.gov (United States)

    Hebert, Paul D N; Dewaard, Jeremy R; Zakharov, Evgeny V; Prosser, Sean W J; Sones, Jayme E; McKeown, Jaclyn T A; Mantle, Beth; La Salle, John

    2013-01-01

    DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera) species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp) were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  12. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

    Directory of Open Access Journals (Sweden)

    Paul D N Hebert

    Full Text Available DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  13. Invader or resident? Ancient-DNA reveals rapid species turnover in New Zealand little penguins.

    Science.gov (United States)

    Grosser, Stefanie; Rawlence, Nicolas J; Anderson, Christian N K; Smith, Ian W G; Scofield, R Paul; Waters, Jonathan M

    2016-02-10

    The expansion of humans into previously unoccupied parts of the globe is thought to have driven the decline and extinction of numerous vertebrate species. In New Zealand, human settlement in the late thirteenth century AD led to the rapid demise of a distinctive vertebrate fauna, and also a number of 'turnover' events where extinct lineages were subsequently replaced by closely related taxa. The recent genetic detection of an Australian little penguin (Eudyptula novaehollandiae) in southeastern New Zealand may potentially represent an additional 'cryptic' invasion. Here we use ancient-DNA (aDNA) analysis and radiocarbon dating of pre-human, archaeological and historical Eudyptula remains to reveal that the arrival of E. novaehollandiae in New Zealand probably occurred between AD 1500 and 1900, following the anthropogenic decline of its sister taxon, the endemic Eudyptula minor. This rapid turnover event, revealed by aDNA, suggests that native species decline can be masked by invasive taxa, and highlights the potential for human-mediated biodiversity shifts. © 2016 The Author(s).

  14. A new rapid method for Clostridium difficile DNA extraction and detection in stool: toward point-of-care diagnostic testing

    National Research Council Canada - National Science Library

    Freifeld, Alison G; Simonsen, Kari A; Booth, Christine S; Zhao, Xing; Whitney, Scott E; Karre, Teresa; Iwen, Peter C; Viljoen, Hendrik J

    2012-01-01

    We describe a new method for the rapid diagnosis of Clostridium difficile infection, with stool sample preparation and DNA extraction by heat and physical disruption in a single-use lysis microreactor (LMR...

  15. Ultrasensitive, rapid and inexpensive detection of DNA using paper based lateral flow assay

    Science.gov (United States)

    Jauset-Rubio, Miriam; Svobodová, Markéta; Mairal, Teresa; McNeil, Calum; Keegan, Neil; Saeed, Ayman; Abbas, Mohammad Nooredeen; El-Shahawi, Mohammad S.; Bashammakh, Abdulaziz S.; Alyoubi, Abdulrahman O.; O´Sullivan, Ciara K.

    2016-01-01

    Sensitive, specific, rapid, inexpensive and easy-to-use nucleic acid tests for use at the point-of-need are critical for the emerging field of personalised medicine for which companion diagnostics are essential, as well as for application in low resource settings. Here we report on the development of a point-of-care nucleic acid lateral flow test for the direct detection of isothermally amplified DNA. The recombinase polymerase amplification method is modified slightly to use tailed primers, resulting in an amplicon with a duplex flanked by two single stranded DNA tails. This tailed amplicon facilitates detection via hybridisation to a surface immobilised oligonucleotide capture probe and a gold nanoparticle labelled reporter probe. A detection limit of 1 × 10−11 M (190 amol), equivalent to 8.67 × 105 copies of DNA was achieved, with the entire assay, both amplification and detection, being completed in less than 15 minutes at a constant temperature of 37 °C. The use of the tailed primers obviates the need for hapten labelling and consequent use of capture and reporter antibodies, whilst also avoiding the need for any post-amplification processing for the generation of single stranded DNA, thus presenting an assay that can facilely find application at the point of need. PMID:27886248

  16. Rapid Purification of Salmonella DNA in Minced Meat and Detection by Real-time PCR

    DEFF Research Database (Denmark)

    Jenikova, G.; Jensen, Annette Nygaard; Demnerova, K.

    2001-01-01

    of DNeasy was found to be 6-8 CFU in just 19 end-point fluorescence (C-t) values, while this was 22 C-t for a combination of DNeasy and BactXtractor. Extraction by DNeasy resulted in C-t cells per 25 g, when the samples were inoculated with Salmonella......Four rapid and simple DNA purification and sample treatment protocols were evaluated for detection of Salmonella enterica in spiked minced meat, using a fluorogenic 5' nuclease (TaqMan) PCR assay in an ABI-Prism 7700 Sequence Detector. The detection limit with the single separation treatment...... before the overnight preenrichment. The method is currently being adapted to a BioRobot 3000 platform. However, the use of paramagnetic beads (DNA Direct) resulted in poor and variable detection limit....

  17. A rapid and economic in-house DNA purification method using glass syringe filters.

    Directory of Open Access Journals (Sweden)

    Yun-Cheol Kim

    Full Text Available BACKGROUND: Purity, yield, speed and cost are important considerations in plasmid purification, but it is difficult to achieve all of these at the same time. Currently, there are many protocols and kits for DNA purification, however none maximize all four considerations. METHODOLOGY/PRINCIPAL FINDINGS: We now describe a fast, efficient and economic in-house protocol for plasmid preparation using glass syringe filters. Plasmid yield and quality as determined by enzyme digestion and transfection efficiency were equivalent to the expensive commercial kits. Importantly, the time required for purification was much less than that required using a commercial kit. CONCLUSIONS/SIGNIFICANCE: This method provides DNA yield and quality similar to that obtained with commercial kits, but is more rapid and less costly.

  18. Developmental validation of a forensic rapid DNA-STR kit: Expressmarker 16.

    Science.gov (United States)

    Zhou, Huaigu; Wu, Dan; Chen, Ronghua; Xu, Yan; Xia, Zifang; Guo, Yulin; Zhang, Fan; Zheng, Weiguo

    2014-07-01

    DNA-STR analysis is widely used in the forensic science field and has important requirements on the analysis time to obtain faster inspections. The developed forensic STR kit, referred to as Expressmarker 16 (EX16), could shorten the amplification time to a minimum of 35min. It enables 16 STR loci to be co-detected, including 13 CODIS loci, D2S1338, D6S1043 and Amelogenin loci. The kit is validated by a series of tests formed by DNA mixtures, stutter ratios, optimized PCR protocols based on annealing temperature research, species specificities, inhibitors, sensitivity, and parallel tests according to FBI QAS (2009/2011) (QAS, 2009; SWGDAM, 2010). The results demonstrated that EX16 was a useful tool for rapid criminal investigation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  19. Structure of the Cpf1 endonuclease R-loop complex after target DNA cleavage

    DEFF Research Database (Denmark)

    Stella, Stefano; Alcón, Pablo; Montoya, Guillermo

    2017-01-01

    Cpf1 is an RNA-guided endonuclease that is emerging as a powerful genome-editing tool. Here we provide insight into its DNA-targeting mechanism by determining the structure of Francisella novicida Cpf1 with the triple-stranded R-loop generated after DNA cleavage. The structure reveals the machine...... and the crRNA-DNA hybrid, avoiding DNA re-annealing. Mutations in key residues reveal a mechanism linking the PAM and DNA nuclease sites. Analysis of the Cpf1 structures proposes a singular working model of RNA-guided DNA cleavage, suggesting new avenues for redesign of Cpf1....

  20. Rapid DNA vaccination against Burkholderia pseudomallei flagellin by tattoo or intranasal application.

    Science.gov (United States)

    Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D

    2017-11-17

    Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.

  1. Development of a Fieldable, Rapid, Accurate and Sensitive Bio-Electronic, DNA Biosensor

    Science.gov (United States)

    2004-12-01

    single molecule of DNA or RNA and therefore does not require the use of PCR. The sensor chip can be engineered with an array of hundreds of independent test sites, which allows for confirmatory tests leading to a high level of specificity, the ability to screen for multiple threat agents simultaneously, and the capability to detect genetically engineered organisms. Biological agents continue to pose a major threat to U.S. troops as well as U.S. civilians both domestically and overseas. Rapid, accurate and sensitive detection and identification of biological agents is

  2. Radiocarbon-dating and ancient DNA reveal rapid replacement of extinct prehistoric penguins

    Science.gov (United States)

    Rawlence, Nicolas J.; Perry, George L. W.; Smith, Ian W. G.; Scofield, R. Paul; Tennyson, Alan J. D.; Matisoo-Smith, Elizabeth A.; Boessenkool, Sanne; Austin, Jeremy J.; Waters, Jonathan M.

    2015-03-01

    Prehistoric faunal extinctions dramatically reshaped biological assemblages around the world. However, the timing of such biotic shifts is often obscured by the fragmentary nature and limited temporal resolution of fossil records. We use radiocarbon-dating and ancient-DNA analysis of prehistoric (ca A.D. 1450-1834) Megadyptes penguin specimens to assess the time-frame of biological turnover in coastal New Zealand following human settlement. These data suggest that the final extirpation of the endemic Megadyptes waitaha, and subsequent replacement by the previously sub-Antarctic-limited Megadyptes antipodes, likely occurred within a narrow temporal window (e.g. a century or less). This transition represents one of the most rapid prehistoric faunal turnover events documented, and is likely linked to human demographic and cultural transitions during the 15th Century. Our results suggest that anthropogenic forces can trigger rapid biogeographic shifts.

  3. Chromosome-Specific DNA Repeats: Rapid Identification in Silico and Validation Using Fluorescence in Situ Hybridization

    Directory of Open Access Journals (Sweden)

    Heinz-Ulrich G. Weier

    2012-12-01

    Full Text Available Chromosome enumeration in interphase and metaphase cells using fluorescence in situ hybridization (FISH is an established procedure for the rapid and accurate cytogenetic analysis of cell nuclei and polar bodies, the unambiguous gender determination, as well as the definition of tumor-specific signatures. Present bottlenecks in the procedure are a limited number of commercial, non-isotopically labeled probes that can be combined in multiplex FISH assays and the relatively high price and effort to develop additional probes. We describe a streamlined approach for rapid probe definition, synthesis and validation, which is based on the analysis of publicly available DNA sequence information, also known as “database mining”. Examples of probe preparation for the human gonosomes and chromosome 16 as a selected autosome outline the probe selection strategy, define a timeline for expedited probe production and compare this novel selection strategy to more conventional probe cloning protocols.

  4. THE RAPID DIAGNOSTICS OF SEX OF SALMONIDS USING DNA-MARKERS

    Directory of Open Access Journals (Sweden)

    Yu. P. Rud

    2014-12-01

    Full Text Available Based on nucleotide sequences of sex-specific DNA-markers of salmonid fishes the oligonucleotide primers for polymerase chain reaction were selected with purpose on rapid diagnostic of sex in rainbow trout Onchorhynchus mykiss, brown trout Salmo trutta, huchen Hucho hucho and grayling Thymallus thymallus. The specify of amplification was determined by nucleotide sequence analysis of PCR-products. All amplified fragments were referred to sex-specific locuses of Y chromosomes in males of investigated fish species. The PCR-products were in size of 880, 607, 521 and 558 for rainbow trout, brown trout, grayling and huchen respectively. Thus the sex determination in above mentioned fish species and identification of genotypic males under process of hormonal sex reversion can be provided using conventional PCR. Present method relates to rapid diagnostics because the data analysis and return of results back to fish farm take one single day.

  5. A RAPID DNA EXTRACTION METHOD IS SUCCESSFULLY APPLIED TO ITS-RFLP ANALYSIS OF MYCORRHIZAL ROOT TIPS

    Science.gov (United States)

    A rapid method for extracting DNA from intact, single root tips using a Xanthine solution was developed to handle very large numbers of analyses of ectomycorrhizas. By using an extraction without grinding we have attempted to bias the extraction towards the fungal DNA in the man...

  6. VIP Barcoding: composition vector-based software for rapid species identification based on DNA barcoding.

    Science.gov (United States)

    Fan, Long; Hui, Jerome H L; Yu, Zu Guo; Chu, Ka Hou

    2014-07-01

    Species identification based on short sequences of DNA markers, that is, DNA barcoding, has emerged as an integral part of modern taxonomy. However, software for the analysis of large and multilocus barcoding data sets is scarce. The Basic Local Alignment Search Tool (BLAST) is currently the fastest tool capable of handling large databases (e.g. >5000 sequences), but its accuracy is a concern and has been criticized for its local optimization. However, current more accurate software requires sequence alignment or complex calculations, which are time-consuming when dealing with large data sets during data preprocessing or during the search stage. Therefore, it is imperative to develop a practical program for both accurate and scalable species identification for DNA barcoding. In this context, we present VIP Barcoding: a user-friendly software in graphical user interface for rapid DNA barcoding. It adopts a hybrid, two-stage algorithm. First, an alignment-free composition vector (CV) method is utilized to reduce searching space by screening a reference database. The alignment-based K2P distance nearest-neighbour method is then employed to analyse the smaller data set generated in the first stage. In comparison with other software, we demonstrate that VIP Barcoding has (i) higher accuracy than Blastn and several alignment-free methods and (ii) higher scalability than alignment-based distance methods and character-based methods. These results suggest that this platform is able to deal with both large-scale and multilocus barcoding data with accuracy and can contribute to DNA barcoding for modern taxonomy. VIP Barcoding is free and available at http://msl.sls.cuhk.edu.hk/vipbarcoding/. © 2014 John Wiley & Sons Ltd.

  7. Autoclave method for rapid preparation of bacterial PCR-template DNA.

    Science.gov (United States)

    Simmon, Keith E; Steadman, Dewey D; Durkin, Sarah; Baldwin, Amy; Jeffrey, Wade H; Sheridan, Peter; Horton, Rene; Shields, Malcolm S

    2004-02-01

    An autoclave method for preparing bacterial DNA for PCR template is presented, it eliminates the use of detergents, organic solvents, and mechanical cellular disruption approaches, thereby significantly reducing processing time and costs while increasing reproducibility. Bacteria are lysed by rapid heating and depressurization in an autoclave. The lysate, cleared by microcentrifugation, was either used directly in the PCR reaction, or concentrated by ultrafiltration. This approach was compared with seven established methods of DNA template preparation from four bacterial sources which included boiling Triton X-100 and SDS, bead beating, lysozyme/proteinase K, and CTAB lysis method components. Bacteria examined were Enterococcus and Escherichia coli, a natural marine bacterial community and an Antarctic cyanobacterial-mat. DNAs were tested for their suitability as PCR templates by repetitive element random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE) analysis. The autoclave method produced PCR amplifiable template comparable or superior to the other methods, with greater reproducibility, much shorter processing time, and at a significantly lower cost.

  8. Bxb1 integrase serves as a highly efficient DNA recombinase in rapid metabolite pathway assembly.

    Science.gov (United States)

    Wang, Xianwei; Tang, Biao; Ye, Yu; Mao, Yayi; Lei, Xiaolai; Zhao, Guoping; Ding, Xiaoming

    2017-01-01

    Phage-encoded serine integrases are widely used in genetic engineering. They also have the potential to serve as efficient DNA assemblers, demonstrated by the method of site-specific recombination-based tandem assembly (SSRTA) that can combine biological parts into devices, pathways, and systems. Here, four serine integrases, ϕBT1, TG1, ϕRv1, and Bxb1, were investigated to ascertain their in vitro DNA assembly activities. Bxb1 integrase displayed the highest efficiency to obtain final products. Thus, we conclude that Bxb1 integrase is an excellent choice for DNA assembly in vitro Using this enzyme and its recognition sites, BioBrick standards were designed that are compatible with the SSRTA method for module addition. A rapid and efficient procedure was developed for the assembly of a multigene metabolic pathway in one step, directly from non-cutting plasmids containing the gene fragments. This technique is easy and convenient, and would be of interest to the synthetic biology community. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Direct loading of polymer matrices in plastic microchips for rapid DNA analysis: a comparative study.

    Science.gov (United States)

    Hurth, Cedric; Gu, Jian; Aboud, Maurice; Estes, Matthew D; Nordquist, Alan R; McCord, Bruce; Zenhausern, Frederic

    2012-08-01

    We report the design and performance validation of microfluidic separation technologies for human identification using a disposable plastic device suitable for integration into an automated rapid DNA analysis system. A fabrication process for a 15-cm long hot-embossed plastic microfluidic devices with a smooth semielliptical cross section out of cyclic olefin copolymer is presented. We propose a mixed polymer solution of 95% w/v hydroxyethylcellulose and 5% w/v polyvinylpyrrolidone for a final polymer concentration of 2.5 or 3.0% to be used as coating and sieving matrix for DNA separation. This formulation allows preparing the microchip without pretreatment in a single-loading step and provides high-resolution separation (≈1.2 bp for fragments <200 bp), which is superior to existing commercial matrices under the same conditions. The hot-embossed device performance is characterized and compared to injection-molded devices made out of cyclic olefin copolymer based on their respective injector geometry, channel shape, and surface charges. Each device design is assessed by fluorescence videomicroscopy to evaluate the formation of injection plugs, then by comparing electropherograms for the separation of a DNA size standard relevant to human identification. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    Science.gov (United States)

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  11. Use of molecular beacons for the rapid analysis of DNA damage induced by exposure to an atmospheric pressure plasma jet

    Energy Technology Data Exchange (ETDEWEB)

    Kurita, Hirofumi, E-mail: kurita@ens.tut.ac.jp, E-mail: mizuno@ens.tut.ac.jp; Miyachika, Saki; Yasuda, Hachiro; Takashima, Kazunori; Mizuno, Akira, E-mail: kurita@ens.tut.ac.jp, E-mail: mizuno@ens.tut.ac.jp [Department of Environmental and Life Sciences, Toyohashi University of Technology, Aichi 441-8580 (Japan)

    2015-12-28

    A rapid method for evaluating the damage caused to DNA molecules upon exposure to plasma is demonstrated. Here, we propose the use of a molecular beacon for rapid detection of DNA strand breaks induced by atmospheric pressure plasma jet (APPJ) irradiation. Scission of the molecular beacon by APPJ irradiation leads to separation of the fluorophore-quencher pair, resulting in an increase in fluorescence that directly correlates with the DNA strand breaks. The results show that the increase in fluorescence intensity is proportional to the exposure time and the rate of fluorescence increase is proportional to the discharge power. This simple and rapid method allows the estimation of DNA damage induced by exposure to a non-thermal plasma.

  12. DNA Barcoding Coupled with High Resolution Melting Analysis Enables Rapid and Accurate Distinction of Aspergillus species.

    Science.gov (United States)

    Fidler, Gabor; Kocsube, Sandor; Leiter, Eva; Biro, Sandor; Paholcsek, Melinda

    2017-08-01

    We describe a high-resolution melting (HRM) analysis method that is rapid, reproducible, and able to identify reference strains and further 40 clinical isolates of Aspergillus fumigatus (14), A. lentulus (3), A. terreus (7), A. flavus (8), A. niger (2), A. welwitschiae (4), and A. tubingensis (2). Asp1 and Asp2 primer sets were designed to amplify partial sequences of the Aspergillus benA (beta-tubulin) genes in a closed-, single-tube system. Human placenta DNA, further Aspergillus (3), Candida (9), Fusarium (6), and Scedosporium (2) nucleic acids from type strains and clinical isolates were also included in this study to evaluate cross reactivity with other relevant pathogens causing invasive fungal infections. The barcoding capacity of this method proved to be 100% providing distinctive binomial scores; 14, 34, 36, 35, 25, 15, 26 when tested among species, while the within-species distinction capacity of the assay proved to be 0% based on the aligned thermodynamic profiles of the Asp1, Asp2 melting clusters allowing accurate species delimitation of all tested clinical isolates. The identification limit of this HRM assay was also estimated on Aspergillus reference gDNA panels where it proved to be 10-102 genomic equivalents (GE) except the A. fumigatus panel where it was 103 only. Furthermore, misidentification was not detected with human genomic DNA or with Candida, Fusarium, and Scedosporium strains. Our DNA barcoding assay introduced here provides results within a few hours, and it may possess further diagnostic utility when analyzing standard cultures supporting adequate therapeutic decisions. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Rapid DNA amplification using a battery-powered thin-film resistive thermocycler.

    Science.gov (United States)

    Herold, Keith E; Sergeev, Nikolay; Matviyenko, Andriy; Rasooly, Avraham

    2009-01-01

    A prototype handheld, compact, rapid thermocycler was developed for multiplex analysis of nucleic acids in an inexpensive, portable configuration. Instead of the commonly used Peltier heating/cooling element, electric thin-film resistive heater and a miniature fan enable rapid heating and cooling of glass capillaries leading to a simple, low-cost Thin-Film Resistive Thermocycler (TFRT). Computer-based pulse width modulation control yields heating rates of 6-7 K/s and cooling rates of 5 K/s. The four capillaries are closely coupled to the heater, resulting in low power consumption. The energy required by a nominal PCR cycle (20 s at each temperature) was found to be 57+/-2 J yielding an average power of approximately 1.0 W (not including the computer and the control system). Thus the device can be powered by a standard 9 V alkaline battery (or other 9 V power supply). The prototype TFRT was demonstrated (in a benchtop configuration) for detection of three important food pathogens (E. coli ETEC, Shigella dysenteriae, and Salmonella enterica). PCR amplicons were analyzed by gel electrophoresis. The 35 cycle PCR protocol using a single channel was completed in less then 18 min. Simple and efficient heating/cooling, low cost, rapid amplification, and low power consumption make the device suitable for portable DNA amplification applications including clinical point of care diagnostics and field use.

  14. Rapid detection of chromosome 18 copy number in buccal smears using DNA probes and FISH

    Energy Technology Data Exchange (ETDEWEB)

    Harris, C.; Nunez, M. [Univ. of Wisconsin, WI (United States); Giraldez, R. [ONCOR, Inc., Gaithersburg, MD (United States)

    1994-09-01

    Rapid diagnosis of trisomy 18 in newborns is often critical to clinical management decisions that must be made in a minimum of time. DNA probes combined with FISH can be used to accurately to determine the copy number of chromosome 18 in interphase cells. We have used the D18Z1 alpha satellite DNA probe to determine signal frequency in normal, previously karyotyped subjects, 12 females and 6 males. We also present one clinical case of trisomy 18, confirmed by karyotype, for comparison to the results obtained from normal subjects. Buccal smears, unlike cytogenetic preparations from peripheral blood, are quite resistant to penetration of probes and detection reagents resulting in higher levels of false monosomy. We have studied 19 individuals and have obtained consistent FISH results, ranging from 64 to 90% disomy. False monosomy rates ranged from 10 to 36%, while false trisomy or tetrasomy was less than 1% in all samples. High rates of false monosomy make this test questionable for detection of low order mosaicism for monosomy, but the extremely low false hyperploidy rate suggests that this is a dependable procedure for detection of trisomy 18, enabling the use of buccal epithelium which can be collected easily from even premature and tiny infants.

  15. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers to be detac......Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...... to be detached from AuNPs when interacting with bacteria. The new strategy greatly increases the sensitivity and specificity of chip-based whole-cell biosensing....

  16. DNA methylation profile associated with rapid decline in kidney function: findings from the CRIC Study

    Science.gov (United States)

    Wing, Maria R.; Devaney, Joseph M.; Joffe, Marshall M.; Xie, Dawei; Feldman, Harold I.; Dominic, Elizabeth A.; Guzman, Nicolas J.; Ramezani, Ali; Susztak, Katalin; Herman, James G.; Cope, Leslie; Harmon, Brennan; Kwabi-Addo, Bernard; Gordish-Dressman, Heather; Go, Alan S.; He, Jiang; Lash, James P.; Kusek, John W.; Raj, Dominic S.

    2014-01-01

    Background Epigenetic mechanisms may be important in the progression of chronic kidney disease (CKD). Methods We studied the genome-wide DNA methylation pattern associated with rapid loss of kidney function using the Infinium HumanMethylation 450 K BeadChip in 40 Chronic Renal Insufficiency (CRIC) study participants (n = 3939) with the highest and lowest rates of decline in estimated glomerular filtration rate. Results The mean eGFR slope was 2.2 (1.4) and −5.1 (1.2) mL/min/1.73 m2 in the stable kidney function group and the rapid progression group, respectively. CpG islands in NPHP4, IQSEC1 and TCF3 were hypermethylated to a larger extent in subjects with stable kidney function (P-values of 7.8E−05 to 9.5E−05). These genes are involved in pathways known to promote the epithelial to mesenchymal transition and renal fibrosis. Other CKD-related genes that were differentially methylated are NOS3, NFKBIL2, CLU, NFKBIB, TGFB3 and TGFBI, which are involved in oxidative stress and inflammatory pathways (P-values of 4.5E−03 to 0.046). Pathway analysis using Ingenuity Pathway Analysis showed that gene networks related to cell signaling, carbohydrate metabolism and human behavior are epigenetically regulated in CKD. Conclusions Epigenetic modifications may be important in determining the rate of loss of kidney function in patients with established CKD. PMID:24516231

  17. DPS – A rapid method for genome sequencing of DNA-containing bacteriophages directly from a single plaque

    DEFF Research Database (Denmark)

    Kot, Witold; Vogensen, Finn Kvist; Sørensen, Søren J.

    2014-01-01

    methods for characterization of phages is determination of the whole genome using high throughput sequencing approaches. Here a direct plaque sequencing (DPS) is described, which is a rapid method that allows easy full genome sequencing of DNA-containing phages using the Nextera XT™ kit. A combination...... of host-DNA removal followed by purification and concentration of the viral DNA, allowed the construction of Illumina-compatible sequencing libraries using the Nextera™ XT technology directly from single phage plaques without any whole genome amplification step. This method was tested on three...

  18. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  19. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  20. Protocol: a rapid and economical procedure for purification of plasmid or plant DNA with diverse applications in plant biology

    Directory of Open Access Journals (Sweden)

    Li Li

    2010-01-01

    Full Text Available Abstract Research in plant molecular biology involves DNA purification on a daily basis. Although different commercial kits enable convenient extraction of high-quality DNA from E. coli cells, PCR and agarose gel samples as well as plant tissues, each kit is designed for a particular type of DNA extraction work, and the cost of purchasing these kits over a long run can be considerable. Furthermore, a simple method for the isolation of binary plasmid from Agrobacterium tumefaciens cells with satisfactory yield is lacking. Here we describe an easy protocol using homemade silicon dioxide matrix and seven simple solutions for DNA extraction from E. coli and A. tumefaciens cells, PCR and restriction digests, agarose gel slices, and plant tissues. Compared with the commercial kits, this protocol allows rapid DNA purification from diverse sources with comparable yield and purity at negligible cost. Following this protocol, we have demonstrated: (1 DNA fragments as small as a MYC-epitope tag coding sequence can be successfully recovered from an agarose gel slice; (2 Miniprep DNA from E. coli can be eluted with as little as 5 μl water, leading to high DNA concentrations (>1 μg/μl for efficient biolistic bombardment of Arabidopsis seedlings, polyethylene glycol (PEG-mediated Arabidopsis protoplast transfection and maize protoplast electroporation; (3 Binary plasmid DNA prepared from A. tumefaciens is suitable for verification by restriction analysis without the need for large scale propagation; (4 High-quality genomic DNA is readily isolated from several plant species including Arabidopsis, tobacco and maize. Thus, the silicon dioxide matrix-based DNA purification protocol offers an easy, efficient and economical way to extract DNA for various purposes in plant research.

  1. Real-time PCR using mycobacteriophage DNA for rapid phenotypic drug susceptibility results for Mycobacterium tuberculosis.

    Science.gov (United States)

    Pholwat, Suporn; Ehdaie, Beeta; Foongladda, Suporn; Kelly, Kimberly; Houpt, Eric

    2012-03-01

    Managing drug-resistant Mycobacterium tuberculosis requires drug susceptibility testing, yet conventional drug susceptibility testing is slow, and molecular testing does not yield results for all antituberculous drugs. We addressed these challenges by utilizing real-time PCR of mycobacteriophage D29 DNA to evaluate the drug resistance of clinical M. tuberculosis isolates. Mycobacteriophages infect and replicate in viable bacterial cells faster than bacterial cells replicate and have been used for detection and drug resistance testing for M. tuberculosis either by using reporter cells or phages with engineered reporter constructs. Our primary protocol involved culturing M. tuberculosis isolates for 48 h with and without drugs at critical concentrations, followed by incubation with 10(3) PFU/ml of D29 mycobacteriophage for 24 h and then real-time PCR. Many drugs could be incubated instantly with M. tuberculosis and phage for 24 h alone. The change in phage DNA real-time PCR cycle threshold (C(T)) between control M. tuberculosis and M. tuberculosis treated with drugs was calculated and correlated with conventional agar proportion drug susceptibility results. Specifically, 9 susceptible clinical isolates, 22 multidrug-resistant (MDR), and 1 extensively drug-resistant (XDR) M. tuberculosis strains were used and C(T) control-C(T) drug cutoffs of between +0.3 and -6.0 yielded 422/429 (98%) accurate results for isoniazid, rifampin, streptomycin, ethambutol, amikacin, kanamycin, capreomycin, ofloxacin, moxifloxacin, ethionamide, para-aminosalicylic acid, cycloserine, and linezolid. Moreover, the ΔC(T) values correlated with isolate MIC for most agents. This D29 quantitative PCR assay offers a rapid, accurate, 1- to 3-day phenotypic drug susceptibility test for first- and second-line drugs and may suggest an approximate MIC.

  2. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun

    2014-11-24

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  3. LTR retrotransposons in rice (Oryza sativa, L.: recent burst amplifications followed by rapid DNA loss

    Directory of Open Access Journals (Sweden)

    Panaud Olivier

    2007-07-01

    Full Text Available Abstract Background LTR retrotransposons are one of the main causes for plant genome size and structure evolution, along with polyploidy. The characterization of their amplification and subsequent elimination of the genomes is therefore a major goal in plant evolutionary genomics. To address the extent and timing of these forces, we performed a detailed analysis of 41 LTR retrotransposon families in rice. Results Using a new method to estimate the insertion date of both truncated and complete copies, we estimated these two forces more accurately than previous studies based on other methods. We show that LTR retrotransposons have undergone bursts of amplification within the past 5 My. These bursts vary both in date and copy number among families, revealing that each family has a particular amplification history. The number of solo LTR varies among families and seems to correlate with LTR size, suggesting that solo LTR formation is a family-dependent process. The deletion rate estimate leads to the prediction that the half-life of LTR retrotransposon sequences evolving neutrally is about 19 My in rice, suggesting that other processes than the formation of small deletions are prevalent in rice DNA removal. Conclusion Our work provides insights into the dynamics of LTR retrotransposons in the rice genome. We show that transposable element families have distinct amplification patterns, and that the turn-over of LTR retrotransposons sequences is rapid in the rice genome.

  4. Rapid and sensitive diagnosis of fungal keratitis with direct PCR without template DNA extraction.

    Science.gov (United States)

    Zhao, G; Zhai, H; Yuan, Q; Sun, S; Liu, T; Xie, L

    2014-10-01

    This study was aimed at developing a direct PCR assay without template DNA extraction for the rapid and sensitive diagnosis of infectious keratitis. Eighty corneal scrapings from 67 consecutive patients with clinically suspected infectious keratitis were analysed prospectively. Direct PCR was performed with all scrapings, with specific primers for fungi, bacteria, herpes simplex virus-1 (HSV-1) and Acanthamoeba simultaneously. The results were compared with those obtained from culture, smear, and confocal microscopy. Discrepant results were resolved according to the therapeutic effects of the corresponding antimicrobial drugs. The lowest detection limit of direct PCR was ten copies of each pathogen. Sixty-six scrapings yielded positive results with direct PCR, giving a total positive detection rate of 82.5% (66/80). For 34 patients with high suspicion of fungal keratitis, the positive detection rate of direct PCR was 84.8% (39/46). This rate increased to 91.2% (31/34) when repeated scrapings were excluded, and was significantly higher than the rates obtained with culture (35.3%, 12/34) and smear (64.7%, 22/34) (p keratitis with direct PCR and culture were 98.0% and 47.1% (p keratitis, and it is expected to have an impact on the diagnosis and treatment of infectious keratitis in the future. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  5. Rectangular coordination polymer nanoplates: large-scale, rapid synthesis and their application as a fluorescent sensing platform for DNA detection.

    Science.gov (United States)

    Zhang, Yingwei; Luo, Yonglan; Tian, Jingqi; Asiri, Abdullah M; Al-Youbi, Abdulrahman O; Sun, Xuping

    2012-01-01

    In this paper, we report on the large-scale, rapid synthesis of uniform rectangular coordination polymer nanoplates (RCPNs) assembled from Cu(II) and 4,4'-bipyridine for the first time. We further demonstrate that such RCPNs can be used as a very effective fluorescent sensing platform for multiple DNA detection with a detection limit as low as 30 pM and a high selectivity down to single-base mismatch. The DNA detection is accomplished by the following two steps: (1) RCPN binds dye-labeled single-stranded DNA (ssDNA) probe, which brings dye and RCPN into close proximity, leading to fluorescence quenching; (2) Specific hybridization of the probe with its target generates a double-stranded DNA (dsDNA) which detaches from RCPN, leading to fluorescence recovery. It suggests that this sensing system can well discriminate complementary and mismatched DNA sequences. The exact mechanism of fluorescence quenching involved is elucidated experimentally and its use in a human blood serum system is also demonstrated successfully.

  6. Rapid purification of circular DNA by triplex-mediated affinity capture

    Science.gov (United States)

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  7. Room temperature DNA preservation of soft tissue for rapid DNA extraction: an addition to the disaster victim identification investigators toolkit?

    Science.gov (United States)

    Graham, E A M; Turk, E E; Rutty, G N

    2008-01-01

    In mass fatality incidents, for example following a vehicle accident or terrorist event, severe fragmentation of bodies may occur, making identification by the use of traditional techniques such as fingerprinting or odontology difficult. In such situations DNA profiling can be employed for individualization and re-association of fragmented remains. As at times disrupted soft tissue may be the predominate tissue type requiring identification and re-association. We have investigated the use of two buffer solutions for preservation of soft tissue samples that may be collected during such investigations, when buccal cells, blood samples or teeth or bone may not be available. Both buffer solutions have shown sufficient DNA preservation over a 12-month period of storage at room temperature to allow for DNA profiling to be successfully performed when 5-1000 mg muscle tissue was stored in each solution.

  8. SeqAnt: A web service to rapidly identify and annotate DNA sequence variations

    Directory of Open Access Journals (Sweden)

    Patel Viren

    2010-09-01

    Full Text Available Abstract Background The enormous throughput and low cost of second-generation sequencing platforms now allow research and clinical geneticists to routinely perform single experiments that identify tens of thousands to millions of variant sites. Existing methods to annotate variant sites using information from publicly available databases via web browsers are too slow to be useful for the large sequencing datasets being routinely generated by geneticists. Because sequence annotation of variant sites is required before functional characterization can proceed, the lack of a high-throughput pipeline to efficiently annotate variant sites can act as a significant bottleneck in genetics research. Results SeqAnt (Sequence Annotator is an open source web service and software package that rapidly annotates DNA sequence variants and identifies recessive or compound heterozygous loci in human, mouse, fly, and worm genome sequencing experiments. Variants are characterized with respect to their functional type, frequency, and evolutionary conservation. Annotated variants can be viewed on a web browser, downloaded in a tab-delimited text file, or directly uploaded in a BED format to the UCSC genome browser. To demonstrate the speed of SeqAnt, we annotated a series of publicly available datasets that ranged in size from 37 to 3,439,107 variant sites. The total time to completely annotate these data completely ranged from 0.17 seconds to 28 minutes 49.8 seconds. Conclusion SeqAnt is an open source web service and software package that overcomes a critical bottleneck facing research and clinical geneticists using second-generation sequencing platforms. SeqAnt will prove especially useful for those investigators who lack dedicated bioinformatics personnel or infrastructure in their laboratories.

  9. Evaluation of rapid protocols for DNA isolation from Cercospora beticola Sacc.

    Directory of Open Access Journals (Sweden)

    Budakov Dragana

    2012-01-01

    Full Text Available The most fungal DNA isolation protocols are designed to obtain high amounts of very pure DNA, requiring large fungal cultures and extraction procedures with many purification steps. Since the PCR does not require high purity DNA, the aim of this investigation was to evaluate three fast and simple fungal DNA isolation protocols for further use in Cercospora PCR based research. The purity and quantity of isolated DNAs were determined spectrophotometrically, electrophoretically and by PCR reaction with universal primers. The amounts of DNA evaluated on agarose gels, isolated by protocols A and C, did not correspond to the spectrophotometrical values, probably due to RNA impurities. In samples isolated by protocol B these impurities were not detected and the DNA concentrations were more similar. Neither protocol eliminated impurities such as carbohydrates and phenol. The average DNA yield of protocol A was 1.04 μg/μl, protocol B 0.88 μg/μl, and protocol C 0.55 μg/μl. The DNA quality most suitable for PCR analysis was obtained by protocol A, where amplification product with universal primers was detected in all DNA samples. The amplification product was detected in 87% of samples isolated by protocol C and in only 60% of samples isolated by protocol B. Although DNA obtained by protocol A had the highest yield and best quality, the isolation protocol C should be also recommended, for it does not require phenol, chlorophorm or liquid nitrogen.

  10. Programmable DNA-Guided Artificial Restriction Enzymes.

    Science.gov (United States)

    Enghiad, Behnam; Zhao, Huimin

    2017-05-19

    Restriction enzymes are essential tools for recombinant DNA technology that have revolutionized modern biological research. However, they have limited sequence specificity and availability. Here we report a Pyrococcus furiosus Argonaute (PfAgo) based platform for generating artificial restriction enzymes (AREs) capable of recognizing and cleaving DNA sequences at virtually any arbitrary site and generating defined sticky ends of varying length. Short DNA guides are used to direct PfAgo to target sites for cleavage at high temperatures (>87 °C) followed by reannealing of the cleaved single stranded DNAs. We used this platform to generate over 18 AREs for DNA fingerprinting and molecular cloning of PCR-amplified or genomic DNAs. These AREs work as efficiently as their naturally occurring counterparts, and some of them even do not have any naturally occurring counterparts, demonstrating easy programmability, generality, versatility, and high efficiency for this new technology.

  11. Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors

    DEFF Research Database (Denmark)

    Fu, Yanming; Zeng, Dongdong; Chao, Jie

    2013-01-01

    (within only 10-20 min), exhibiting extraordinarily high cooperativity that is often observed in assembly of natural molecular machines in cells (e.g. ribosome). By exploiting the high specificity of DNA-based self-assembly, we can precisely anchor proteins on these DNA origami nanostructures with sub-10...

  12. Rapid microfluidic solid-phase extraction system for hyper-methylated DNA enrichment and epigenetic analysis

    NARCIS (Netherlands)

    De, Arpita; Sparreboom, Wouter; van den Berg, Albert; Carlen, Edwin

    Genetic sequence and hyper-methylation profile information from the promoter regions of tumor suppressor genes are important for cancer disease investigation. Since hyper-methylated DNA (hm-DNA) is typically present in ultra-low concentrations in biological samples, such as stool, urine, and saliva,

  13. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  14. Rapid shift in genotype of human mitochondrial DNA in a family with Leber's hereditary optic neuropathy

    NARCIS (Netherlands)

    Bolhuis, P. A.; Bleeker-Wagemakers, E. M.; Ponne, N. J.; van Schooneveld, M. J.; Westerveld, A.; van den Bogert, C.; Tabak, H. F.

    1990-01-01

    Mitochondrial DNA isolated from white blood cells was investigated in families suffering from Leber's hereditary optic neuropathy. A recently described mutation at nucleotide position 11778 was present in 5 out of 12 families and heteroplasmic mitochondrial DNA was observed in 2 of these 5 families.

  15. Sequences from first settlers reveal rapid evolution in Icelandic mtDNA pool.

    Science.gov (United States)

    Helgason, Agnar; Lalueza-Fox, Carles; Ghosh, Shyamali; Sigurethardóttir, Sigrún; Sampietro, Maria Lourdes; Gigli, Elena; Baker, Adam; Bertranpetit, Jaume; Arnadóttir, Lilja; Thornorsteinsdottir, Unnur; Stefánsson, Kári

    2009-01-01

    A major task in human genetics is to understand the nature of the evolutionary processes that have shaped the gene pools of contemporary populations. Ancient DNA studies have great potential to shed light on the evolution of populations because they provide the opportunity to sample from the same population at different points in time. Here, we show that a sample of mitochondrial DNA (mtDNA) control region sequences from 68 early medieval Icelandic skeletal remains is more closely related to sequences from contemporary inhabitants of Scotland, Ireland, and Scandinavia than to those from the modern Icelandic population. Due to a faster rate of genetic drift in the Icelandic mtDNA pool during the last 1,100 years, the sequences carried by the first settlers were better preserved in their ancestral gene pools than among their descendants in Iceland. These results demonstrate the inferential power gained in ancient DNA studies through the application of population genetics analyses to relatively large samples.

  16. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  17. A Rapid and Sensitive Diagnosis of Typhoid Fever Based On Nested PCR-Voltammetric DNA Biosensor Using Flagellin Gene Fragment

    Directory of Open Access Journals (Sweden)

    Yeni Wahyuni Hartati

    2016-03-01

    Full Text Available Typhoid fever caused by Salmonella typhi is an important issue for public health in the world. Laboratory methods for rapid and sensitive diagnosis are very important for disease management. The purpose of this study was to determine the performance of nested PCR–voltammetric DNA biosensor using flagellin gene (fla of S. typhi as a marker. The differential pulse voltammetry using pencil graphite electrode was applied to measure the guanine oxidation signal of probes vs synthetic target stDNA and probes vs fla PCR product hybridizations. The probe DNA selectivity was examined by hybridized probes vs non-complementary sequence. The result showed that the first round nested PCR product can not be visualized by agarose electrophoresis, whereas using the voltammetric biosensor methods can be detected both for the first or second round nested PCR product. The average peak current of hybridized probe vs first and second round of PCR product was 2.32 and 1.47 μA respectively, at 0.9 V. Detection of the DNA sequences of the infectious diseases from PCR amplified real sample was also carried out using this voltammetric DNA biosensor methods.

  18. A Simple and Rapid Method for DNA Isolation from Xylophagous Insects

    Directory of Open Access Journals (Sweden)

    Horacio Cano-Camacho

    2010-12-01

    Full Text Available Published methods to isolate DNA from insects are not always effective in xylophagous insects because they have high concentrations of phenolics and other secondary plant compounds in their digestive tracts. A simple, reliable and labor-effective cetyltrimethylammonium bromide-polyvinylpyrrolidone (CTAB-PVP method for isolation of high quality DNA from xylophagous insects is described. This method was successfully applied to PCR and restriction analysis, indicating removal of common inhibitors. DNA isolated by the CTAB-PVP method could be used in most molecular analyses.

  19. Rapid and Efficient cDNA Library Screening by Self-Ligation ofInverse PCR Products (SLIP)

    Energy Technology Data Exchange (ETDEWEB)

    Hoskins, Roger A.; Stapleton, Mark; George, Reed A.; Yu, Charles; Wan, Kenneth H.; Carlson, Joseph W.; Celniker, Susan E.

    2005-04-22

    The production of comprehensive cDNA clone collections is an important goal of the human and model organism genome projects. cDNA sequences are used to determine the structures of transcripts, including splice junctions, polyadenylation sites, and 5' and 3' untranslated regions (UTRs). cDNA collections are also valuable resources for functional studies of genes and proteins. Expressed Sequence Tag (EST)sequencing is the method of choice for recovering cDNAs representing a majority of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a library at random, so it realizes diminishing returns as the project progresses. To drive cDNA collections toward completion new methods are needed to recover cDNAs representing specific genes and alternative transcripts, including transcripts with low expression levels. We describe a simple and effective inverse-PCR-based method for screening plasmid libraries to recover intact cDNAs for specific transcripts. We tested the method by screening libraries used in our Drosophila EST projects for 153 transcription factor genes that were not yet represented by full-length cDNAs. We recovered target-specific clones for 104 of the genes: 46 exactly match, 30 improve and 28partially match current gene annotations. Successful application of the screening method depends on cDNA library complexity and quality of the gene models. The approach should be effective for improving cDNA collections for other model organisms and the human. It also provides a simple and rapid method for isolating cDNAs of interest in any system for which plasmid cDNA libraries and complete or partial gene sequences are available.

  20. Rapid virological diagnosis of central nervous system infections by use of a multiplex reverse transcription-PCR DNA microarray.

    Science.gov (United States)

    Leveque, Nicolas; Van Haecke, Adrien; Renois, Fanny; Boutolleau, David; Talmud, Deborah; Andreoletti, Laurent

    2011-11-01

    Viruses are the main etiological cause of central nervous system (CNS) infections. A rapid molecular diagnosis is recommended to improve the therapeutic management of patients. The aim of this study was to evaluate the performances of a DNA microarray, the Clart Entherpex kit (Genomica, Coslada, Spain), allowing the rapid and simultaneous detection of 9 DNA and RNA neurotropic viruses: herpes simplex virus 1 (HSV-1), HSV-2, varicella-zoster virus (VZV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), human herpesvirus 6 (HHV-6), HHV-7, HHV-8, and the human enteroviruses (HEVs). This evaluation was performed with 28 samples from the European proficiency panels (Quality Control for Molecular Diagnostics [QCMD]; Glasgow, Scotland) and then with 78 cerebrospinal fluid (CSF) specimens. The majority of the QCMD results obtained by the DNA microarray were similar to those recorded by the overall QCMD participants. The main discrepant results were observed for low concentrations of HSV-2 and HEVs. From the clinical samples, the kit detected 27 of the 28 herpesvirus CNS infections and all of the 30 HEV-positive CSF samples. No false-positive result was observed among the 20 virus-negative CSF samples. The clinical sensitivity, specificity, and negative and positive predictive values of the assay were 98.3, 100, 95.2, and 100%, respectively, when the results were compared to those of commercially available PCR assays. Interestingly, HHV-7 was detected in 11 (37%) of the 30 HEV-positive CSF samples from children suffering from aseptic meningitis causing significantly longer lengths of stay at the hospital than infection with HEVs alone (2.4 versus 1.4 days; P = 0.038). In conclusion, this preliminary study showed that this DNA microarray could be a valuable molecular diagnostic tool for single and mixed DNA and RNA virus infections of the CNS.

  1. DNA in a bottle-Rapid metabarcoding survey for early alerts of invasive species in ports.

    Science.gov (United States)

    Borrell, Yaisel J; Miralles, Laura; Do Huu, Hoang; Mohammed-Geba, Khaled; Garcia-Vazquez, Eva

    2017-01-01

    Biota monitoring in ports is increasingly needed for biosecurity reasons and safeguarding marine biodiversity from biological invasion. Present and future international biosecurity directives can be accomplished only if the biota acquired by maritime traffic in ports is controlled. Methodologies for biota inventory are diverse and now rely principally on extensive and labor-intensive sampling along with taxonomic identification by experts. In this study, we employed an extremely simplified environmental DNA (eDNA) sampling methodology from only three 1-L bottles of water per port, followed by metabarcoding (high-throughput sequencing and DNA-based species identification) using 18S rDNA and Cytochrome oxidase I as genetic barcodes. Eight Bay of Biscay ports with available inventory of fouling invertebrates were employed as a case study. Despite minimal sampling efforts, three invasive invertebrates were detected: the barnacle Austrominius modestus, the tubeworm Ficopomatus enigmaticus and the polychaete Polydora triglanda. The same species have been previously found from visual and DNA barcoding (genetic identification of individuals) surveys in the same ports. The current costs of visual surveys, conventional DNA barcoding and this simplified metabarcoding protocol were compared. The results encourage the use of metabarcoding for early biosecurity alerts.

  2. DNA in a bottle-Rapid metabarcoding survey for early alerts of invasive species in ports.

    Directory of Open Access Journals (Sweden)

    Yaisel J Borrell

    Full Text Available Biota monitoring in ports is increasingly needed for biosecurity reasons and safeguarding marine biodiversity from biological invasion. Present and future international biosecurity directives can be accomplished only if the biota acquired by maritime traffic in ports is controlled. Methodologies for biota inventory are diverse and now rely principally on extensive and labor-intensive sampling along with taxonomic identification by experts. In this study, we employed an extremely simplified environmental DNA (eDNA sampling methodology from only three 1-L bottles of water per port, followed by metabarcoding (high-throughput sequencing and DNA-based species identification using 18S rDNA and Cytochrome oxidase I as genetic barcodes. Eight Bay of Biscay ports with available inventory of fouling invertebrates were employed as a case study. Despite minimal sampling efforts, three invasive invertebrates were detected: the barnacle Austrominius modestus, the tubeworm Ficopomatus enigmaticus and the polychaete Polydora triglanda. The same species have been previously found from visual and DNA barcoding (genetic identification of individuals surveys in the same ports. The current costs of visual surveys, conventional DNA barcoding and this simplified metabarcoding protocol were compared. The results encourage the use of metabarcoding for early biosecurity alerts.

  3. DNA in a bottle—Rapid metabarcoding survey for early alerts of invasive species in ports

    Science.gov (United States)

    Miralles, Laura; Do Huu, Hoang; Mohammed-Geba, Khaled; Garcia-Vazquez, Eva

    2017-01-01

    Biota monitoring in ports is increasingly needed for biosecurity reasons and safeguarding marine biodiversity from biological invasion. Present and future international biosecurity directives can be accomplished only if the biota acquired by maritime traffic in ports is controlled. Methodologies for biota inventory are diverse and now rely principally on extensive and labor-intensive sampling along with taxonomic identification by experts. In this study, we employed an extremely simplified environmental DNA (eDNA) sampling methodology from only three 1-L bottles of water per port, followed by metabarcoding (high-throughput sequencing and DNA-based species identification) using 18S rDNA and Cytochrome oxidase I as genetic barcodes. Eight Bay of Biscay ports with available inventory of fouling invertebrates were employed as a case study. Despite minimal sampling efforts, three invasive invertebrates were detected: the barnacle Austrominius modestus, the tubeworm Ficopomatus enigmaticus and the polychaete Polydora triglanda. The same species have been previously found from visual and DNA barcoding (genetic identification of individuals) surveys in the same ports. The current costs of visual surveys, conventional DNA barcoding and this simplified metabarcoding protocol were compared. The results encourage the use of metabarcoding for early biosecurity alerts. PMID:28873426

  4. Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors.

    Science.gov (United States)

    Fu, Yanming; Zeng, Dongdong; Chao, Jie; Jin, Yanqiu; Zhang, Zhao; Liu, Huajie; Li, Di; Ma, Hongwei; Huang, Qing; Gothelf, Kurt V; Fan, Chunhai

    2013-01-16

    Self-assembled DNA origami nanostructures have shown great promise for bottom-up construction of complex objects with nanoscale addressability. Here we show that DNA origami-based 1D nanoribbons and nanotubes are one-pot assembled with controllable sizes and nanoscale addressability with high speed (within only 10-20 min), exhibiting extraordinarily high cooperativity that is often observed in assembly of natural molecular machines in cells (e.g. ribosome). By exploiting the high specificity of DNA-based self-assembly, we can precisely anchor proteins on these DNA origami nanostructures with sub-10 nm resolution and at the single-molecule level. We attach a pair of enzymes (horseradish peroxidase and glucose oxidase) at the inner side of DNA nanotubes and observe high coupling efficiency of enzyme cascade within this confined nanospace. Hence, DNA nanostructures with such unprecedented properties shed new light on the design of nanoscale bioreactors and nanomedicine and provide an artificial system for studying enzyme activities and cascade in highly organized and crowded cell-mimicking environments.

  5. DPS - a rapid method for genome sequencing of DNA-containing bacteriophages directly from a single plaque.

    Science.gov (United States)

    Kot, Witold; Vogensen, Finn K; Sørensen, Søren J; Hansen, Lars H

    2014-02-01

    Bacteriophages (phages) coexist with bacteria in all environments and influence microbial diversity, evolution and industrial production processes. As a result of this major impact of phages on microbes, tools that allow rapid characterization of phages are needed. Today, one of the most powerful methods for characterization of phages is determination of the whole genome using high throughput sequencing approaches. Here a direct plaque sequencing (DPS) is described, which is a rapid method that allows easy full genome sequencing of DNA-containing phages using the Nextera XT™ kit. A combination of host-DNA removal followed by purification and concentration of the viral DNA, allowed the construction of Illumina-compatible sequencing libraries using the Nextera™ XT technology directly from single phage plaques without any whole genome amplification step. This method was tested on three Caudovirales phages; ϕ29 Podoviridae, P113g Siphoviridae and T4 Myovirdae, which are representative of >96% of all known phages, and were sequenced using the Illumina MiSeq platform. Successful de novo assembly of the viral genomes was possible. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Rapid molecular detection of invasive species in ballast and harbor water by integrating environmental DNA and light transmission spectroscopy.

    Science.gov (United States)

    Egan, Scott P; Grey, Erin; Olds, Brett; Feder, Jeffery L; Ruggiero, Steven T; Tanner, Carol E; Lodge, David M

    2015-04-07

    Invasive species introduced via the ballast water of commercial ships cause enormous environmental and economic damage worldwide. Accurate monitoring for these often microscopic and morphologically indistinguishable species is challenging but critical for mitigating damages. We apply eDNA sampling, which involves the filtering and subsequent DNA extraction of microscopic bits of tissue suspended in water, to ballast and harbor water sampled during a commercial ship's 1400 km voyage through the North American Great Lakes. Using a lab-based gel electrophoresis assay and a rapid, field-ready light transmission spectroscopy (LTS) assay, we test for the presence of two invasive species: quagga (Dreissena bugensis) and zebra (D. polymorpha) mussels. Furthermore, we spiked a set of uninfested ballast and harbor samples with zebra mussel tissue to further test each assay's detection capabilities. In unmanipulated samples, zebra mussel was not detected, while quagga mussel was detected in all samples at a rate of 85% for the gel assay and 100% for the LTS assay. In the spiked experimental samples, both assays detected zebra mussel in 94% of spiked samples and 0% of negative controls. Overall, these results demonstrate that eDNA sampling is effective for monitoring ballast-mediated invasions and that LTS has the potential for rapid, field-based detection.

  7. Sequences from first settlers reveal rapid evolution in Icelandic mtDNA pool.

    Directory of Open Access Journals (Sweden)

    Agnar Helgason

    2009-01-01

    Full Text Available A major task in human genetics is to understand the nature of the evolutionary processes that have shaped the gene pools of contemporary populations. Ancient DNA studies have great potential to shed light on the evolution of populations because they provide the opportunity to sample from the same population at different points in time. Here, we show that a sample of mitochondrial DNA (mtDNA control region sequences from 68 early medieval Icelandic skeletal remains is more closely related to sequences from contemporary inhabitants of Scotland, Ireland, and Scandinavia than to those from the modern Icelandic population. Due to a faster rate of genetic drift in the Icelandic mtDNA pool during the last 1,100 years, the sequences carried by the first settlers were better preserved in their ancestral gene pools than among their descendants in Iceland. These results demonstrate the inferential power gained in ancient DNA studies through the application of population genetics analyses to relatively large samples.

  8. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  9. Rapid DNA transformation in Salmonella Typhimurium by the hydrogel exposure method.

    Science.gov (United States)

    Elabed, Hamouda; Hamza, Rim; Bakhrouf, Amina; Gaddour, Kamel

    2016-07-01

    Even with advances in molecular cloning and DNA transformation, new or alternative methods that permit DNA penetration in Salmonella enterica subspecies enterica serovar Typhimurium are required in order to use this pathogen in biotechnological or medical applications. In this work, an adapted protocol of bacterial transformation with plasmid DNA based on the "Yoshida effect" was applied and optimized on Salmonella enterica serovar Typhimurium LT2 reference strain. The plasmid transference based on the use of sepiolite as acicular materials to promote cell piercing via friction forces produced by spreading on the surface of a hydrogel. The transforming mixture containing sepiolite nanofibers, bacterial cells to be transformed and plasmid DNA were plated directly on selective medium containing 2% agar. In order to improve the procedure, three variables were tested and the transformation of Salmonella cells was accomplished using plasmids pUC19 and pBR322. Using the optimized protocol on Salmonella LT2 strain, the efficiency was about 10(5) transformed cells per 10(9) subjected to transformation with 0.2μg plasmid DNA. In summary, the procedure is fast, offers opportune efficiency and promises to become one of the widely used transformation methods in laboratories. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Rapid prototyping of 3D DNA-origami shapes with caDNAno

    Science.gov (United States)

    Douglas, Shawn M.; Marblestone, Adam H.; Teerapittayanon, Surat; Vazquez, Alejandro; Church, George M.; Shih, William M.

    2009-01-01

    DNA nanotechnology exploits the programmable specificity afforded by base-pairing to produce self-assembling macromolecular objects of custom shape. For building megadalton-scale DNA nanostructures, a long ‘scaffold’ strand can be employed to template the assembly of hundreds of oligonucleotide ‘staple’ strands into a planar antiparallel array of cross-linked helices. We recently adapted this ‘scaffolded DNA origami’ method to producing 3D shapes formed as pleated layers of double helices constrained to a honeycomb lattice. However, completing the required design steps can be cumbersome and time-consuming. Here we present caDNAno, an open-source software package with a graphical user interface that aids in the design of DNA sequences for folding 3D honeycomb-pleated shapes A series of rectangular-block motifs were designed, assembled, and analyzed to identify a well-behaved motif that could serve as a building block for future studies. The use of caDNAno significantly reduces the effort required to design 3D DNA-origami structures. The software is available at http://cadnano.org/, along with example designs and video tutorials demonstrating their construction. The source code is released under the MIT license. PMID:19531737

  11. Rapid DNA Synthesis During EarlyDrosophilaEmbryogenesis Is Sensitive to Maternal Humpty Dumpty Protein Function.

    Science.gov (United States)

    Lesly, Shera; Bandura, Jennifer L; Calvi, Brian R

    2017-11-01

    Problems with DNA replication cause cancer and developmental malformations. It is not fully understood how DNA replication is coordinated with development and perturbed in disease. We had previously identified the Drosophila gene humpty dumpty ( hd ), and showed that null alleles cause incomplete DNA replication, tissue undergrowth, and lethality. Animals homozygous for the missense allele, hd 272-9 , were viable, but adult females had impaired amplification of eggshell protein genes in the ovary, resulting in the maternal effects of thin eggshells and embryonic lethality. Here, we show that expression of an hd transgene in somatic cells of the ovary rescues amplification and eggshell synthesis but not embryo viability. The germline of these mothers remain mutant for the hd 272-9 allele, resulting in reduced maternal Hd protein and embryonic arrest during mitosis of the first few S/M nuclear cleavage cycles with chromosome instability and chromosome bridges. Epistasis analysis of hd with the rereplication mutation plutonium indicates that the chromosome bridges of hd embryos are the result of a failed attempt to segregate incompletely replicated sister chromatids. This study reveals that maternally encoded Humpty dumpty protein is essential for DNA replication and genome integrity during the little-understood embryonic S/M cycles. Moreover, the two hd 272-9 maternal-effect phenotypes suggest that ovarian gene amplification and embryonic cleavage are two time periods in development that are particularly sensitive to mild deficits in DNA replication function. This last observation has broader relevance for interpreting why mild mutations in the human ortholog of humpty dumpty and other DNA replication genes cause tissue-specific malformations of microcephalic dwarfisms. Copyright © 2017 by the Genetics Society of America.

  12. Rapid generation of long tandem DNA repeat arrays by homologous recombination in yeast to study their function in mammalian genomes

    Directory of Open Access Journals (Sweden)

    Kouprina Natalay

    2011-10-01

    Full Text Available Abstract We describe here a method to rapidly convert any desirable DNA fragment, as small as 100 bp, into long tandem DNA arrays up to 140 kb in size that are inserted into a microbe vector. This method includes rolling-circle phi29 amplification (RCA of the sequence in vitro and assembly of the RCA products in vivo by homologous recombination in the yeast Saccharomyces cerevisiae. The method was successfully used for a functional analysis of centromeric and pericentromeric repeats and construction of new vehicles for gene delivery to mammalian cells. The method may have general application in elucidating the role of tandem repeats in chromosome organization and dynamics. Each cycle of the protocol takes ~ two weeks to complete.

  13. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.

    2011-01-01

    for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were......Fish diseases can be caused by a variety of diverse organisms, including bacteria, fungi, viruses and protozoa, and pose a universal threat to the ornamental fish industry and aquaculture. The lack of rapid, accurate and reliable means by which fish pathogens can be detected and identified has been...... one of the main limitations in fish pathogen diagnosis and fish disease management and has consequently stimulated the search for alternative diagnostic techniques. Here, we describe a method based on multiplex and broad‐range PCR amplification combined with DNA array hybridization...

  14. Microchip-based one step DNA extraction and real-time PCR in one chamber for rapid pathogen identification.

    Science.gov (United States)

    Lee, Jeong-Gun; Cheong, Kwang Ho; Huh, Nam; Kim, Suhyeon; Choi, Jeong-Woo; Ko, Christopher

    2006-07-01

    Optimal detection of a pathogen present in biological samples depends on the ability to extract DNA molecules rapidly and efficiently. In this paper, we report a novel method for efficient DNA extraction and subsequent real-time detection in a single microchip by combining laser irradiation and magnetic beads. By using a 808 nm laser and carboxyl-terminated magnetic beads, we demonstrate that a single pulse of 40 seconds lysed pathogens including E. coli and Gram-positive bacterial cells as well as the hepatitis B virus mixed with human serum. We further demonstrate that the real-time pathogen detection was performed with pre-mixed PCR reagents in a real-time PCR machine using the same microchip, after laser irradiation in a hand-held device equipped with a small laser diode. These results suggest that the new sample preparation method is well suited to be integrated into lab-on-a-chip application of the pathogen detection system.

  15. Rapid assessment of non-indigenous species in the era of the eDNA barcoding: A Mediterranean case study

    Science.gov (United States)

    Ardura, Alba; Planes, Serge

    2017-03-01

    With only a narrow opening through the Gibraltar and Suez Canals, the Mediterranean Sea is one of the largest semi-enclosed seas. The marine flora and fauna are some of the richest in the world, relative to its size, particularly in the coastal habitats, which are also characterized by numerous endemic species although the introduction of non-indigenous species threatens its rich and unique biodiversity. Following the opening of the Suez Canal, and in combination with shipping and aquaculture activities, non-indigenous species (NIS) introduction has had measurable impacts on the Mediterranean. Lagoon ecosystems along the French coastline, with approx. 100 NIS identified, are considered hot-spot areas for these species. Rapid assessment sampling for sessile benthic species together with DNA barcoding is a rapid, easy and cheap method to detect non-indigenous species. Two nearby and different ecosystems were sampled for invertebrate species: Saint-Nazaire lagoon, a Special Protection Area within the Natura 2000 Network and Canet port, a marina in a small village. The DNA barcoding tool for species identification was used for confirming the taxonomy. This showed that, despite the Saint-Nazaire Lagoon classification within the Natura 2000 network, it is already contaminated with a single NIS that was found in high densities and is clearly beginning to dominate the system. It is proposed that a rapid assessment of the sampled environment and the DNA barcode approach are efficient and can provide sufficient information on the new target species to be used in conservation planning and ongoing management efforts.

  16. Rapid and correct identification of intestinal Bacteroides spp. with chromosomal DNA probes by whole-cell dot blot hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Morotomi, M.; Ohno, T.; Mutai, M.

    1988-05-01

    A dot blot hybridization procedure with /sup 32/P-labeled whole chromosomal DNA of the type strains as probes was developed as a rapid and simple method for identification of intestinal Bacteroides species. Bacterial cells were fixed onto membrane filters by slight suction, treated with 0.5 N NaOH, and hybridized with these probes. Of 65 Bacteroides strains isolated from 19 human fecal specimens, which were identified as B. fragilis, B. thetaiotaomicron, B. ovatus, B. caccae, B. uniformis, B. stercoris, B. vulgatus, B. distasonis, and B. merdae by conventional phenotypic characterization, 62 (95%) were correctly identified with this hybridization procedure.

  17. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... 1487. Figure 1. 1% Agarose gel showing typical PCR results obtained for the amplification of the Mdh gene after the DNA .... procedure based on selective binding of bovine alpha-casein to silica particles. J. Clin. Microbiol. 37: 615-619. Boom R, Sol CJA, Salimans MMM, Jansen CL, Werthiem-Van Dillen.

  18. The use of DNA markers for rapid improvement of crops in Africa ...

    African Journals Online (AJOL)

    Genetic engineering and biotechnology are providing new tools for genetic improvement of food crops. Molecular DNA markers are some of these tools which can be used in various fields of plant breeding and germplasm management. For example, molecular markers have been used to confirm the identity of hybrids in ...

  19. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection

    NARCIS (Netherlands)

    Wagemakers, A.; Mason, L. M. K.; Oei, A.; de Wever, B.; van der Poll, T.; Bins, A. D.; Hovius, J. W. R.

    2014-01-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method

  20. rapid mini-prep DNA extraction method in rice (Oryza sativa ...

    African Journals Online (AJOL)

    method, optimized for rice, which was achieved via some modifications in present DNA extraction methods, especially in first step of cell wall lyses and the use of cheap and frequent chemicals found in every laboratory is presented. Normal quality and quantity was obtained by the method. The PCR based assays also ...

  1. DNA Mimics for the Rapid Identification of Microorganisms by Fluorescence in situ Hybridization (FISH

    Directory of Open Access Journals (Sweden)

    Maria J. Vieira

    2008-10-01

    Full Text Available Fluorescence in situ hybridization (FISH is a well-established technique that is used for a variety of purposes, ranging from pathogen detection in clinical diagnostics to the determination of chromosomal stability in stem cell research. The key step of FISH involves the detection of a nucleic acid region and as such, DNA molecules have typically been used to probe for the sequences of interest. However, since the turn of the century, an increasing number of laboratories have started to move on to the more robust DNA mimics methods, most notably peptide and locked nucleic acids (PNA and LNA. In this review, we will cover the state-of-the-art of the different DNA mimics in regard to their application as efficient markers for the presence of individual microbial cells, and consider their potential advantages and pitfalls. Available PNA probes are then reassessed in terms of sensitivity and specificity using rRNA databases. In addition, we also attempt to predict the applicability of DNA mimics in well-known techniques attempting to detect in situ low number of copies of specific nucleic acid sequences such as catalyzed reporter deposition (CARD and recognition of individual genes (RING FISH.

  2. The use of DNA markers for rapid improvement of crops in Africa ...

    African Journals Online (AJOL)

    Genetic engineering and biotechnology are providing new tools for genetic improvement of food crops. Molecular DNA markers are some of ... The polymerase chain reaction (PCR) has become a popular technique for molecular genome mapping and the diagnosis of plant pathogens. The technique ensures amplification ...

  3. DNA mimics for the rapid identification of microorganisms by fluorescence in situ hybridization (FISH).

    Science.gov (United States)

    Cerqueira, Laura; Azevedo, Nuno F; Almeida, Carina; Jardim, Tatiana; Keevil, Charles William; Vieira, Maria J

    2008-10-01

    Fluorescence in situ hybridization (FISH) is a well-established technique that is used for a variety of purposes, ranging from pathogen detection in clinical diagnostics to the determination of chromosomal stability in stem cell research. The key step of FISH involves the detection of a nucleic acid region and as such, DNA molecules have typically been used to probe for the sequences of interest. However, since the turn of the century, an increasing number of laboratories have started to move on to the more robust DNA mimics methods, most notably peptide and locked nucleic acids (PNA and LNA). In this review, we will cover the state-of-the-art of the different DNA mimics in regard to their application as efficient markers for the presence of individual microbial cells, and consider their potential advantages and pitfalls. Available PNA probes are then reassessed in terms of sensitivity and specificity using rRNA databases. In addition, we also attempt to predict the applicability of DNA mimics in well-known techniques attempting to detect in situ low number of copies of specific nucleic acid sequences such as catalyzed reporter deposition (CARD) and recognition of individual genes (RING) FISH.

  4. Optimization of real-time PCR assay for rapid and sensitive detection of eubacterial 16S ribosomal DNA in platelet concentrates.

    NARCIS (Netherlands)

    Mohammadi, T.; Reesink, H.W.; Vandenbroucke-Grauls, C.M.J.E.; Savelkoul, P.H.M.

    2003-01-01

    A real-time PCR assay was developed for rapid detection of eubacterial 16S ribosomal DNA in platelet concentrates. The sensitivity of this assay can be hampered by contaminating DNA in the PCR reagents. Digestion of the PCR reagents with Sau3AI prior to PCR amplification was effective in eliminating

  5. An efficient and rapid DNA minipreparation procedure suitable for PCR/SSR and RAPD analyses in tropical forest tree species

    Directory of Open Access Journals (Sweden)

    Ana Lilia Alzate-Marin

    2009-10-01

    Full Text Available An efficient and rapid DNA minipreparation modified method for frozen samples was developed for five tropical tree species: Copaifera langsdorffii, Hymenaea courbaril, Eugenia uniflora, Tabebuia roseo alba and Cariniana estrellensis. This procedure that dispenses the use of liquid nitrogen, phenol and the addition of proteinase K, is an adaptation of the CTAB-based DNA extraction method. The modifications included the use of PVP to eliminate the polyphenols, only one chloroform-isoamyl alcohol step and the addition of RNase immediately after extraction with chloroform. The yields of the DNA samples ranged from 25.7 to 42.1 µg from 100 mg leaf tissue. The DNA samples extracted by this method were successfully used for PCR (SSR and RAPD analyses in these five and other twelve tropical tree species.Este trabalho teve como objetivo otimizar um protocolo econômico, rápido e eficaz de minipreparação de DNA genômico, para as espécies florestais Copaifera langsdorffii (Óleo de Copaíba, Hymenaea courbaril (Jatobá, Eugenia uniflora (Pitanga, Tabebuia roseo alba (Ipê Branco e Cariniana estrellensis (Jequitibá Branco. Este método é uma adaptação da técnica de extração CTAB de Doyle e Doyle (1990, o qual consiste principalmente na adição de PVP para eliminar polifenoles, somente uma etapa de extração com clorofórmio-álcool isoamílico e a adição da RNase A imediatamente após a extração com clorofórmio. O método também dispensa o uso de nitrogênio líquido, o uso do fenol e a adição de proteinase K. Os DNAs das espécies florestais extraídos apresentaram alto rendimento e boa qualidade, com rendimento de 25.7 a 42.1 µg de DNA a partir de 100 mg de tecido foliar congelado. Com este protocolo, em apenas 1 dia de trabalho, uma pessoa pode completar o isolamento do DNA de aproximadamente 50 amostras de folhas (dependendo da capacidade da centrífuga. O DNA obtido pode ser usado para métodos de análise baseados em PCR (SSR e

  6. MGB probe assay for rapid detection of mtDNA11778 mutation in the Chinese LHON patients by real-time PCR*

    OpenAIRE

    Wang, Jian-yong; Gu, Yang-shun; Wang, Jing; Tong, Yi; Wang, Ying; Shao, Jun-bing; Qi, Ming

    2008-01-01

    Objective: Leber’s hereditary optic neuropathy (LHON) is a maternally inherited degeneration of the optic nerve caused by point mutations of mitochondrial DNA (mtDNA). Many unsolved questions regarding the penetrance and pathophysiological mechanism of LHON demand efficient and reliable mutation testing. This study aims to develop a minor groove binder (MGB) probe assay for rapid detection of mtDNA11778 mutation and heteroplasmy in Chinese LHON patients by real-time polymerase chain reaction ...

  7. LV Barcoding: locality sensitive hashing-based tool for rapid species identification in DNA barcoding

    OpenAIRE

    Fan, Long; Chu, Ka Hou

    2014-01-01

    DNA barcoding has emerged as a cost-effective approach for species identification. However, the scarcity of tools used for searching the booming reference database becomes an obstacle, currently with BLAST as the only practical choice. Here, we propose a program - LV Barcoding - based on both the random hyperplane projection-based locality sensitive hashing method and the composition vector-based VIP Barcoding for fast species identification. The performance of LV Barcoding is assessed on the...

  8. Rapid and Sensitive Method To Identify Mycobacterium avium subsp. paratuberculosis in Cow's Milk by DNA Methylase Genotyping

    Science.gov (United States)

    Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José

    2013-01-01

    Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time. PMID:23275511

  9. Rapid and sensitive method to identify Mycobacterium avium subsp. paratuberculosis in cow's milk by DNA methylase genotyping.

    Science.gov (United States)

    Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José; Lopez, Osvaldo Jorge

    2013-03-01

    Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time.

  10. A novel GMO biosensor for rapid ultrasensitive and simultaneous detection of multiple DNA components in GMO products.

    Science.gov (United States)

    Huang, Lin; Zheng, Lei; Chen, Yinji; Xue, Feng; Cheng, Lin; Adeloju, Samuel B; Chen, Wei

    2015-04-15

    Since the introduction of genetically modified organisms (GMOs), there has been on-going and continuous concern and debates on the commercialization of products derived from GMOs. There is an urgent need for development of highly efficient analytical methods for rapid and high throughput screening of GMOs components, as required for appropriate labeling of GMO-derived foods, as well as for on-site inspection and import/export quarantine. In this study, we describe, for the first time, a multi-labeling based electrochemical biosensor for simultaneous detection of multiple DNA components of GMO products on the same sensing interface. Two-round signal amplification was applied by using both an exonuclease enzyme catalytic reaction and gold nanoparticle-based bio-barcode related strategies, respectively. Simultaneous multiple detections of different DNA components of GMOs were successfully achieved with satisfied sensitivity using this electrochemical biosensor. Furthermore, the robustness and effectiveness of the proposed approach was successfully demonstrated by application to various GMO products, including locally obtained and confirmed commercial GMO seeds and transgenetic plants. The proposed electrochemical biosensor demonstrated unique merits that promise to gain more interest in its use for rapid and on-site simultaneous multiple screening of different components of GMO products. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. cDNA library preparation.

    Science.gov (United States)

    Kooiker, Maarten; Xue, Gang-Ping

    2014-01-01

    The construction of full-length cDNA libraries allows researchers to study gene expression and protein interactions and undertake gene discovery. Recent improvements allow the construction of high-quality cDNA libraries, with small amounts of mRNA. In parallel, these improvements allow for the incorporation of adapters into the cDNA, both at the 5' and 3' end of the cDNA. The 3' adapter is attached to the oligo-dT primer that is used by the reverse transcriptase, whereas the 5' adapter is incorporated by the template switching properties of the MMLV reverse transcriptase. This allows directional cloning and eliminates inefficient steps like adapter ligation, phosphorylation, and methylation. Another important step in the construction of high-quality cDNA libraries is the normalization. The difference in the levels of expression between genes might be several orders of magnitude. Therefore, it is essential that the cDNA library is normalized. With a recently discovered enzyme, duplex-specific nuclease, it is possible to normalize the cDNA library, based on the fact that more abundant molecules are more likely to reanneal after denaturation compared to rare molecules.

  12. DNA-based genetic markers for Rapid Cycling Brassica rapa (Fast Plants type designed for the teaching laboratory.

    Directory of Open Access Journals (Sweden)

    Eryn E. Slankster

    2012-06-01

    Full Text Available We have developed DNA-based genetic markers for rapid-cycling Brassica rapa (RCBr, also known as Fast Plants. Although markers for Brassica rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP based markers and 14 variable number tandem repeat (VNTR-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a nongenic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology.

  13. Rapid assembly of multiple DNA fragments through direct transformation of PCR products into E. coli and Lactobacillus.

    Science.gov (United States)

    Cao, Pinghua; Wang, Lei; Zhou, Guangxian; Wang, Yaoyue; Chen, Yulin

    2014-11-01

    This article describes a rapid, highly efficient and versatile method for seamlessly assembling multiple DNA fragments into a vector at any desired position. The inserted fragments and vector backbone were amplified by high-fidelity PCR containing 20 bp to 50 bp overlapping regions at 3' and/or 5' termini. These linearised fragments were equimolarly mixed, and then cyclised in a prolonged overlap extension PCR without adding primers. The resulting PCR products were DNA multimers that could be directly transformed into host strains, yielding the desired chimeric plasmid. The proposed method was illustrated by constructing an Escherichia coli co-expression vector. The feasibility of the method in Lactobacillus was further validated by assembling an E. coli-Lactobacillus shuttle vector. Results showed that three to four fragments could be simultaneously and precisely inserted in a vector in only 2-3 days using the proposed method. The acceptable transformation efficiency was determined through the tested host strains; more than 95% of the colonies were positive transformants. Therefore, the proposed method is sufficiently competent for high-efficiency insertion of multiple DNA fragments into a plasmid and has theoretically good application potential for gene cloning and protein expression because it is simple, easy to implement, flexible and yields highly positive clones. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Rapid genotyping of carcinogenic human papillomavirus by loop-mediated isothermal amplification using a new automated DNA test (Clinichip HPV™).

    Science.gov (United States)

    Satoh, Toyomi; Matsumoto, Koji; Fujii, Takuma; Sato, Osamu; Gemma, Nobuhiro; Onuki, Mamiko; Saito, Hiroshi; Aoki, Daisuke; Hirai, Yasuo; Yoshikawa, Hiroyuki

    2013-03-01

    This study was designed to evaluate the Clinichip HPV test, a new DNA test that detects carcinogenic human papillomavirus (HPV) rapidly by loop-mediated isothermal amplification and performs genotyping of all 13 carcinogenic types using automated DNA chip technology with an assay time 2.5h. Using this test, 247 Japanese women (109 with normal cytology, 43 with cervical intraepithelial neoplasia grade 1, 60 with cervical intraepithelial neoplasia grade 2/3 and 35 with invasive cervical cancer) were tested for carcinogenic HPV genotypes. The results were compared to those obtained by the polymerase chain reaction-amplified DNA sequencing using 13 type-specific primers. Overall, there was very good agreement for the detection of carcinogenic HPV between the Clinichip test and direct sequencing, with 95.5% total agreement and a kappa value of 0.91. Comparison of the detection of individual HPV types shows that the overall agreement was also high (range: 96.8-100%). In women with cervical intraepithelial neoplasia grade 2 or worse, the detection rate of carcinogenic HPV was 95.7% by both the Clinichip test and the direct-sequencing method, indicating complete agreement between the two methods. In conclusion, it was found that the Clinichip test is a promising new laboratory method for genotyping of carcinogenic HPV. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. DNA-Based Genetic Markers for Rapid Cycling Brassica Rapa (Fast Plants Type) Designed for the Teaching Laboratory

    Science.gov (United States)

    Slankster, Eryn E.; Chase, Jillian M.; Jones, Lauren A.; Wendell, Douglas L.

    2012-01-01

    We have developed DNA-based genetic markers for rapid cycling Brassica rapa (RCBr), also known as Fast Plants. Although markers for B. rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP) based markers and 14 variable number tandem repeat (VNTR)-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a non-genic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology. PMID:22675329

  16. Rapid DNA haplotyping using a multiplex heteroduplex approach: application to Duchenne muscular dystrophy carrier testing.

    Science.gov (United States)

    Prior, T W; Wenger, G D; Papp, A C; Snyder, P J; Sedra, M S; Bartolo, C; Moore, J W; Highsmith, W E

    1995-01-01

    A new strategy has been developed for rapid haplotype analysis based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. This simple, rapid method does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. The method may be used for other genetic diseases when mutations are unknown or there are few dinucleotide markers in the gene proximity, and for the identification of haplotype backgrounds of mutant alleles.

  17. A new rapid method for Clostridium difficile DNA extraction and detection in stool: toward point-of-care diagnostic testing.

    Science.gov (United States)

    Freifeld, Alison G; Simonsen, Kari A; Booth, Christine S; Zhao, Xing; Whitney, Scott E; Karre, Teresa; Iwen, Peter C; Viljoen, Hendrik J

    2012-01-01

    We describe a new method for the rapid diagnosis of Clostridium difficile infection, with stool sample preparation and DNA extraction by heat and physical disruption in a single-use lysis microreactor (LMR), followed by a rapid PCR amplification step. All steps can be accomplished in stool samples with discordant EIA results (GDH(+)/toxin(-)) were tested by both the LMR/PCR assay and the loop-mediated isothermal amplification test (LAMP) (Illumigene C. difficile; Meridian Bioscience, Cincinnati, OH). In 64/69 EIA-discordant samples, LAMP and LMR/PCR results matched (both positive in 29 sample and both negative in 35 samples); in the remaining 5 samples, results were discrepant between the LAMP assay (all five negative) and the LMR/PCR assay (all 5 positive). Overall, LMR/PCR testing matched the current algorithm of EIA and/or LAMP reflex testing in 193/198 (97.5%) samples. The present proof-of-concept study suggests that the novel LMR/PCR technique described here may be developed as an inexpensive, rapid, and reliable point-of-care diagnostic test for C. difficile infection and other infectious diseases. Copyright © 2012 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  18. Rapid Salmonella detection using an acoustic wave device combined with the RCA isothermal DNA amplification method

    Directory of Open Access Journals (Sweden)

    Antonis Kordas

    2016-12-01

    Full Text Available Salmonella enterica serovar Typhimurium is a major foodborne pathogen that causes Salmonellosis, posing a serious threat for public health and economy; thus, the development of fast and sensitive methods is of paramount importance for food quality control and safety management. In the current work, we are presenting a new approach where an isothermal amplification method is combined with an acoustic wave device for the development of a label free assay for bacteria detection. Specifically, our method utilizes a Love wave biosensor based on a Surface Acoustic Wave (SAW device combined with the isothermal Rolling Circle Amplification (RCA method; various protocols were tested regarding the DNA amplification and detection, including off-chip amplification at two different temperatures (30 °C and room temperature followed by acoustic detection and on-chip amplification and detection at room temperature, with the current detection limit being as little as 100 Bacteria Cell Equivalents (BCE/sample. Our acoustic results showed that the acoustic ratio, i.e., the amplitude over phase change observed during DNA binding, provided the only sensitive means for product detection while the measurement of amplitude or phase alone could not discriminate positive from negative samples. The method's fast analysis time together with other inherent advantages i.e., portability, potential for multi-analysis, lower sample volumes and reduced power consumption, hold great promise for employing the developed assay in a Lab on Chip (LoC platform for the integrated analysis of Salmonella in food samples.

  19. Rapid plant identification using species- and group-specific primers targeting chloroplast DNA.

    Directory of Open Access Journals (Sweden)

    Corinna Wallinger

    Full Text Available Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae, the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory.

  20. Development of bufferless gel electrophoresis chip for easy preparation and rapid DNA separation.

    Science.gov (United States)

    Oleksandrov, Sergiy; Aman, Abdurazak; Lim, Wanyoung; Kim, Younghee; Bae, Nam Ho; Lee, Kyoung G; Lee, Seok Jae; Park, Sungsu

    2017-09-27

    This work presents a handy, fast, and compact bufferless gel electrophoresis chip (BGEC), which consists of precast agarose gel confined in a disposable plastic body with electrodes. It does not require large volumes of buffer to fill reservoirs, or the process of immersing the gel in the buffer. It withstands voltages up to 28.4 V/cm, thereby allowing DNA separation within 10 min with a similar separation capability to the standard gel electrophoresis. The results suggest that our BGEC is highly suitable for in situ gel electrophoresis in forensic, epidemiological settings and crime scenes where standard gel electrophoresis equipment cannot be brought in while quick results are needed. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Rapid, sensitive and cost effective method for isolation of viral DNA from feacal samples of dogs

    Directory of Open Access Journals (Sweden)

    Savi.

    2010-06-01

    Full Text Available A simple method for viral DNA extraction using chelex resin was developed. The method used was eco-friendly and cost effective compared to other methods such as phenol chloroform method which use health hazardous organic reagents. Further, a polymerase chain reaction (PCR based detection of canine parvovirus (CPV using primers from conserved region of VP2 gene was developed. To increase the sensitivity and specificity of reaction, nested PCR was designed. PCR reaction was optimized to amplify 747bp product of VP2 gene. The assay can be completed in few hours and doesn’t need hazardous chemicals. Thus, the sample preparation using chelating resin along with nested PCR seems to be a sensitive, specific and practical method for the detection of CPV in diarrhoeal feacal samples. [Vet. World 2010; 3(3.000: 105-106

  2. Rapid identification of the botanical and entomological sources of honey using DNA metabarcoding.

    Science.gov (United States)

    Prosser, Sean W J; Hebert, Paul D N

    2017-01-01

    Honey is generated by various bee species from diverse plants, and because the value of different types of honey varies more than 100-fold, it is a target for fraud. This paper describes a protocol that employs DNA metabarcoding of three gene regions (ITS2, rbcLa, and COI) to provide an inexpensive tool to simultaneously deliver information on the botanical and entomological origins of honey. This method was used to examine seven varieties of honey: light, medium, dark, blended, pasteurized, creamed, and meliponine. Plant and insect sources were identified in five samples, but only the botanical or insect source could be identified in the other two. Two samples were found to be misrepresented. Although this method was generally successful in determining both plant and insect sources, honeys rich in polyphenolic compounds or subject to crystallization were recalcitrant to analysis, so further research is required to combat honey adulteration and mislabeling. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Rapid Veterinary Diagnosis of Bovine Reproductive Infectious Diseases from Semen using Paper-Origami DNA Microfluidics.

    Science.gov (United States)

    Yang, Zhugen; Xu, Gaolian; Reboud, Julien; Ali, Syed Atif; Kaur, Gurpreet; McGiven, John; Boby, Nongthombam; Gupta, Praveen; Chaudhuri, Pallab; Cooper, Jonathan Mark

    2018-01-11

    The health and well-being of cattle is a significant concern for global agricultural output. In dairy production within low and middle income countries (LMICs), there is a significant biosensing challenge in detecting sexually transmitted infection (STI) pathogens during animal husbandry, due in part to difficulties associated with the limited infrastructure for veterinary medicine. Here we demonstrate low-cost, multiplexed and sample-to-answer paper-origami tests for the detection of three bovine infectious reproductive diseases in semen samples, collected at a test site in rural India. Pathogen DNA from one viral pathogen, Bovine Herpes virus-1 (BoHV-1) and two bacteria (Brucella and Leptospira) was extracted, amplified (using loop-mediated isothermal amplification, LAMP) and detected fluorescently, enabling DNA to be measured. Data was collected as a fluorescence signal either visually, using a low-cost hand-held torch, or digitally with a mobile-phone camera. Limits of detection and sensitivities of the paper-origami device for the three pathogens were also evaluated using pathogen-inoculated semen samples and were as few as 50 Leptospira organisms, 50 CFU Brucella and 1 TCID50. BoHV-1. Semen samples from elite bulls at a germplasm centre were also tested in double-blind tests, as a demonstrator for a low cost, user-friendly point-of-care sensing platform, for in-the-field resource-limited regions. The sensors showed excellent levels of sensitivity and specificity, and for the first of time a demonstrated ability of the application of paper-origami devices for the diagnosis multiple infectious diseases from semen samples.

  4. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  5. Rapid DNA haplotyping using a multiplex heteroduplex approach: Application to Duchenne muscula dystrophy carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Wenger, G.D.; Moore, J. [Ohio State Univ., Columbus, OH (United States)] [and others

    1994-09-01

    A new strategy has been developed for rapid haplotype analysis. It is based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. The method is simple, rapid, does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using 12 commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. As a result of expanding the number of detectable polymorphisms throughout the dystrophin gene, we show how the method can easily be combined with dinucleotide analysis to improve the accuracy of carrier detection in the nondeletion cases. The technique is also shown to be used as an effective screen for improving carrier detection in several families with deletions. The finding of heterozygosity within the deletion identifies the at-risk female as a noncarrier. Using this method, we have identified and incorporated 3 new dystrophin polymorphisms (one of which in exon 16 is unique to African Americans). The method may be used other genetic diseases when mutations are unknown, or there are few dinucleotide markers in the gene proximity, or for the identification of haplotype backgrounds of mutant alleles.

  6. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

    Science.gov (United States)

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-04-01

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

  7. Potential use of buccal smears for rapid diagnosis of autosomal trisomy or chromosomal sex in newborn infants using DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Harris, C.; Clark, K.; Lazarski, K. [Univ. of Wisconsin, Madison, WI (United States); Wilkerson, C. [Univ. of Wisconsin Medical School, Madison, WI (United States); Meisner, L. [Univ. of Wisconsin, Madison, WI (United States)]|[Univ. of Wisconsin Medical School, Madison, WI (United States)

    1994-12-01

    Buccal smears from 3 women and 1 man were probed with alpha satellite DNA probes for chromosomes 8, 18, X, and Y. Buccal smears were also collected from an adolescent phenotypic female with uterine agenesis, as well as from newborn infants with suspected trisomy 18 and trisomy 21. The clinical cases were confirmed with conventional cytogenetic studies of peripheral lymphocytes. Overall probe efficiency at detecting expected chromosome number in interphase cells was found to be 71% {+-} 6.8%. Higher than expected n-1 signal numbers may be due to karyopyknotic intermediate epithelial cells present in all collected samples. Overall probe efficiency was found to be consistent using alpha satellite and cosmid probes, both of which accurately reflected the modal copy number of the target chromosomes. False trisomy was less than 1%. This study suggests DNA probes can be used in buccal smears for rapid diagnosis of trisomies and chromosomal sex in newborns, but because of high rates of false hydropoploid signals, probed buccal smear specimens may not be accurate at diagnosing mosaicism. 9 refs., 2 figs., 1 tab.

  8. Biodiversity inventories in high gear: DNA barcoding facilitates a rapid biotic survey of a temperate nature reserve.

    Science.gov (United States)

    Telfer, Angela C; Young, Monica R; Quinn, Jenna; Perez, Kate; Sobel, Crystal N; Sones, Jayme E; Levesque-Beaudin, Valerie; Derbyshire, Rachael; Fernandez-Triana, Jose; Rougerie, Rodolphe; Thevanayagam, Abinah; Boskovic, Adrian; Borisenko, Alex V; Cadel, Alex; Brown, Allison; Pages, Anais; Castillo, Anibal H; Nicolai, Annegret; Glenn Mockford, Barb Mockford; Bukowski, Belén; Wilson, Bill; Trojahn, Brock; Lacroix, Carole Ann; Brimblecombe, Chris; Hay, Christoper; Ho, Christmas; Steinke, Claudia; Warne, Connor P; Garrido Cortes, Cristina; Engelking, Daniel; Wright, Danielle; Lijtmaer, Dario A; Gascoigne, David; Hernandez Martich, David; Morningstar, Derek; Neumann, Dirk; Steinke, Dirk; Marco DeBruin, Donna DeBruin; Dobias, Dylan; Sears, Elizabeth; Richard, Ellen; Damstra, Emily; Zakharov, Evgeny V; Laberge, Frederic; Collins, Gemma E; Blagoev, Gergin A; Grainge, Gerrie; Ansell, Graham; Meredith, Greg; Hogg, Ian; McKeown, Jaclyn; Topan, Janet; Bracey, Jason; Guenther, Jerry; Sills-Gilligan, Jesse; Addesi, Joseph; Persi, Joshua; Layton, Kara K S; D'Souza, Kareina; Dorji, Kencho; Grundy, Kevin; Nghidinwa, Kirsti; Ronnenberg, Kylee; Lee, Kyung Min; Xie, Linxi; Lu, Liuqiong; Penev, Lyubomir; Gonzalez, Mailyn; Rosati, Margaret E; Kekkonen, Mari; Kuzmina, Maria; Iskandar, Marianne; Mutanen, Marko; Fatahi, Maryam; Pentinsaari, Mikko; Bauman, Miriam; Nikolova, Nadya; Ivanova, Natalia V; Jones, Nathaniel; Weerasuriya, Nimalka; Monkhouse, Norman; Lavinia, Pablo D; Jannetta, Paul; Hanisch, Priscila E; McMullin, R Troy; Ojeda Flores, Rafael; Mouttet, Raphaëlle; Vender, Reid; Labbee, Renee N; Forsyth, Robert; Lauder, Rob; Dickson, Ross; Kroft, Ruth; Miller, Scott E; MacDonald, Shannon; Panthi, Sishir; Pedersen, Stephanie; Sobek-Swant, Stephanie; Naik, Suresh; Lipinskaya, Tatsiana; Eagalle, Thanushi; Decaëns, Thibaud; Kosuth, Thibault; Braukmann, Thomas; Woodcock, Tom; Roslin, Tomas; Zammit, Tony; Campbell, Victoria; Dinca, Vlad; Peneva, Vlada; Hebert, Paul D N; deWaard, Jeremy R

    2015-01-01

    Comprehensive biotic surveys, or 'all taxon biodiversity inventories' (ATBI), have traditionally been limited in scale or scope due to the complications surrounding specimen sorting and species identification. To circumvent these issues, several ATBI projects have successfully integrated DNA barcoding into their identification procedures and witnessed acceleration in their surveys and subsequent increase in project scope and scale. The Biodiversity Institute of Ontario partnered with the rare Charitable Research Reserve and delegates of the 6th International Barcode of Life Conference to complete its own rapid, barcode-assisted ATBI of an established land trust in Cambridge, Ontario, Canada. The existing species inventory for the rare Charitable Research Reserve was rapidly expanded by integrating a DNA barcoding workflow with two surveying strategies - a comprehensive sampling scheme over four months, followed by a one-day bioblitz involving international taxonomic experts. The two surveys resulted in 25,287 and 3,502 specimens barcoded, respectively, as well as 127 human observations. This barcoded material, all vouchered at the Biodiversity Institute of Ontario collection, covers 14 phyla, 29 classes, 117 orders, and 531 families of animals, plants, fungi, and lichens. Overall, the ATBI documented 1,102 new species records for the nature reserve, expanding the existing long-term inventory by 49%. In addition, 2,793 distinct Barcode Index Numbers (BINs) were assigned to genus or higher level taxonomy, and represent additional species that will be added once their taxonomy is resolved. For the 3,502 specimens, the collection, sequence analysis, taxonomic assignment, data release and manuscript submission by 100+ co-authors all occurred in less than one week. This demonstrates the speed at which barcode-assisted inventories can be completed and the utility that barcoding provides in minimizing and guiding valuable taxonomic specialist time. The final product is

  9. Random amplified ribosomal DNA restriction analysis for rapid identification of thermophilic Actinomycete-like bacteria involved in hypersensitivity pneumonitis.

    Science.gov (United States)

    Harvey, I; Cormier, Y; Beaulieu, C; Akimov, V N; Mériaux, A; Duchaine, C

    2001-07-01

    Hypersensitivity pneumonitis (HP) is a pulmonary disease characterised by inflammation that can be caused by, amongst other substances, a subset of 4 thermophilic mycelial bacteria: Saccharopolyspora rectivirgula, Saccharomonospora viridis, Thermoactinomyces sacchari, and Thermoactinomyces vulgaris. Air sampling analyses in highly contaminated environments are often performed to evaluate exposure to these species which are difficult and fastidious to identify by conventional techniques. The aim of this study was to use amplified ribosomal DNA restriction analysis (ARDRA) to develop a method of identification for those thermophilic organisms that would be more rapid and simple. Strains of these 4 species were obtained from the American type culture collection (ATCC) and were characterized using biochemical tests and ARDRA patterns obtained on their partial-lenght amplified 16S rDNAs. To validate this approach, ARDRA with two restriction enzymes, TaqI and HhaI, was applied to 49 thermophilic actinomycete-like strains from environmental samples (sawmills). The results obtained show that combining some cultural characteristics and biochemical tests, such as xanthine or hypoxanthine decomposition, growth in the presence of NaCl, lysozyme or novobiocin, and spore resistance over 100 degrees C provide a rough identification and selection of the genera of interest. Consequently, target species could be confirmed by digestion of partial-lenght 16S rDNA with the use of Taql and HhaI restriction enzymes that gave specific restriction patterns. ARDRA analyses on the 49 environmental actinomycete-like organisms revealed the presence of 8 Saccharopolyspora rectivirgula, 2 Saccharomonospora viridis, and 15 Thermoactinomyces vulgaris strains, the other strains had restriction patterns different than those of the species of interest. Results of the present study will be applicable to other potential HP environments such as dairy barns, peat bogs and compost plants.

  10. [Rapid identification of Riemerella anatipestifer on the basis of specific PCR amplifying 16S rDNA].

    Science.gov (United States)

    Qu, Feng-fa; Cai, Chang; Zheng, Xian-jin; Zhang, Da-bing

    2006-02-01

    Riemerella anatipestifer (RA) infection is the main disease causing severe losses in duck production. Because RA is characterized more by the absence than by the presence of specific phenotypic properties and different scholar had the different results of biochemical detection, it can't always be identified quickly and correctly only by the phenotypic properties or biochemical characteristics. The research object was to develop a species specific PCR method for RA detection. Because of the conserved structure of rRNA and appropriate size of 16S rRNA, a multiple alignment of 16S rDNA (gene coding 16S rRNA) was processed among RA, Escherichia coli, Pasteurella multocida, Salmonella enteritidis and Salmonella gallinarum, which are the main bacteria causing duck diseases. A pair of species specific primers named 190f and 843r were selected from the variable regions of 16S rDNA depending on the result of multiple alignment. Using BLAST on NCBI website for a sequence similarity search, the results showed that this pair of primers had very high specificity, except for having a lower sequence similarity with some species of Flavobacterium and Chryseobacterium. A PCR assay was performed and the template was extracted using the bacteria genomic DNA extraction kit and boiling method respectively. A chelate resin named Chelex 100 was used in the boiling method at the same time. Under the annealing temperature of 60 degrees C, all the 26 RA strains, including 19 representative strains of serotypes 1 to approximately 19 and 7 domestic isolated strains, showed the same 654bp fragment after PCR, while there was no amplification with isolates of other bacterial species. Also a series of sensitivity experiments were performed and proved that the detection limit of this method was 50pg genomic DNA, 1.5 x 10(6) CFU/mL and 15 CFU/mL, when the template was prepared with genomic DNA extraction kit, only boiling method and boiling method with Chelex 100 respectively. 12 clinical cases

  11. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    Science.gov (United States)

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  12. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Papa Mze Nasserdine

    2016-01-01

    Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

  13. Design of a biological method for rapid detection of presence of PCR inhibitors in aged bone DNA.

    Science.gov (United States)

    Ghasemi, Akram; Mahdieh, Nejat; Tavallaei, Mahmood; Aslani, Mohammad Mehdi; Zafari, Zahra; Shirkavand, Atefeh; Farzad, Maryam Sharafi; Naderi, Mahdi; Azariyan, Sajjad Habibi; Zeinali, Sirous

    2012-01-01

    Molecular human identification is one of the most important tests performed in forensic laboratories. Some of these tests are applied for identification of human remains from natural disasters, wars, etc., but problems may occur as a result of DNA degradation and external DNA contamination. We investigated effects of bacterial DNA on identifying the presence or absence of PCR inhibitors in aged bone DNA. DNA samples were extracted from blood, bone remains and Escherichia coli. These DNA were amplified using human and bacterial specific primers. Using different blood, aged bone, and bacterial DNA dilutions along with PCR based methods; we checked their positive, negative effects, or detecting presence of inhibitors in aged bone DNA by PCR method. Our observation indicated that the addition of bacterial DNA could be a valid biological method for testing the quality of bone DNA to enable us to obtain a usable profile for the identification of human remains. This method will help to test the presence of inhibitors, quantity or even quality of DNA which are of importance in profiling archeological remains. Our method will help to determine if PCR failure is due to presence of inhibitors or lack of amplifiable DNA either because of degradation, minute amount or absence of human DNA.

  14. Loop-mediated isothermal amplification (LAMP) assay-A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena).

    Science.gov (United States)

    Heers, Teresa; van Neer, Abbo; Becker, André; Grilo, Miguel Luca; Siebert, Ursula; Abdulmawjood, Amir

    2017-01-01

    Carcasses of wild animals are often visited by different scavengers. However, determining which scavenger caused certain types of bite marks is particularly difficult and knowledge thereof is lacking. Therefore, a loop-mediated isothermal amplification (LAMP) assay (target sequence cytochrome b) was developed to detect red fox DNA in carcasses of harbour porpoises. The MSwab™ method for direct testing without prior DNA isolation was validated. As a detection device, the portable real-time fluorometer Genie® II was used, which yields rapid results and can be used in field studies without huge laboratory equipment. In addition to in vitro evaluation and validation, a stranded and scavenged harbour porpoise carcass was successfully examined for red fox DNA residues. The developed LAMP method is a valuable diagnostic tool for confirming presumable red fox bite wounds in harbour porpoises without further DNA isolation steps.

  15. Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

    Science.gov (United States)

    Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

    2016-11-01

    Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  16. DNA-based identification of invasive alien species in relation to Canadian federal policy and law, and the basis of rapid-response management.

    Science.gov (United States)

    Thomas, Vernon G; Hanner, Robert H; Borisenko, Alex V

    2016-11-01

    Managing invasive alien species in Canada requires reliable taxonomic identification as the basis of rapid-response management. This can be challenging, especially when organisms are small and lack morphological diagnostic features. DNA-based techniques, such as DNA barcoding, offer a reliable, rapid, and inexpensive toolkit for taxonomic identification of individual or bulk samples, forensic remains, and even environmental DNA. Well suited for this requirement, they could be more broadly deployed and incorporated into the operating policy and practices of Canadian federal departments and should be authorized under these agencies' articles of law. These include Fisheries and Oceans Canada, Canadian Food Inspection Agency, Transport Canada, Environment Canada, Parks Canada, and Health Canada. These efforts should be harmonized with the appropriate provisions of provincial jurisdictions, for example, the Ontario Invasive Species Act. This approach necessitates that a network of accredited, certified laboratories exists, and that updated DNA reference libraries are readily accessible. Harmonizing this approach is vital among Canadian federal agencies, and between the federal and provincial levels of government. Canadian policy and law must also be harmonized with that of the USA when detecting, and responding to, invasive species in contiguous lands and waters. Creating capacity in legislation for use of DNA-based identifications brings the authority to fund, train, deploy, and certify staff, and to refine further developments in this molecular technology.

  17. Rapid mitochondrial DNA typing using restriction enzyme digestion of polymerase chain reaction amplicons followed by capillary electrophoresis separation with laser-induced fluorescence detection.

    Science.gov (United States)

    Butler, J M; Wilson, M R; Reeder, D J

    1998-01-01

    The polymorphic control region of mitochondrial DNA (mtDNA) is becoming more commonly used in forensic applications to differentiate among individuals in a population. Two hypervariable regions (HV1 and HV2) are often sequenced following amplification of the mtDNA via the polymerase chain reaction (PCR). More rapid screening assays would reduce both the effort and the expense of comparing two samples. A methodology has been developed that first uses restriction endonuclease digestion of the PCR-amplified mtDNA using RsaI and MnlI and then capillary electrophoresis (CE) to separate and size the PCR-RFLP fragments. This rapid procedure offers an alternative method for screening of polymorphisms in amplified mtDNA samples. In addition, the presence of a T-->C transition at position 16189, which gives rise to the so-called "C-stretch" in HV1, may be predicted from the presence of nonspecific PCR products in the CE results.

  18. A novel rapid DNA microarray assay enables identification of 37 Mycoplasma species and highlights multiple Mycoplasma infections.

    Directory of Open Access Journals (Sweden)

    Christiane Schnee

    Full Text Available Mycoplasmas comprise a conglomerate of pathogens and commensals occurring in humans and animals. The genus Mycoplasma alone contains more than 120 species at present, and new members are continuously being discovered. Therefore, it seems promising to use a single highly parallel detection assay rather than develop separate tests for each individual species. In this study, we have designed a DNA microarray carrying 70 oligonucleotide probes derived from the 23S rRNA gene and 86 probes from the tuf gene target regions. Following a PCR amplification and biotinylation step, hybridization on the array was shown to specifically identify 31 Mycoplasma spp., as well as 3 Acholeplasma spp. and 3 Ureaplasma spp. Members of the Mycoplasma mycoides cluster can be recognized at subgroup level. This procedure enables parallel detection of Mollicutes spp. occurring in humans, animals or cell culture, from mono- and multiple infections, in a single run. The main advantages of the microarray assay include ease of operation, rapidity, high information content, and affordability. The new test's analytical sensitivity is equivalent to that of real-time PCR and allows examination of field samples without the need for culture. When 60 field samples from ruminants and birds previously analyzed by denaturing-gradient gel electrophoresis (DGGE were tested by the microarray assay both tests identified the same agent in 98.3% of the cases. Notably, microarray testing revealed an unexpectedly high proportion (35% of multiple mycoplasma infections, i.e., substantially more than DGGE (15%. Two of the samples were found to contain four different Mycoplasma spp. This phenomenon deserves more attention, particularly its implications for epidemiology and treatment.

  19. O-antigen and virulence profiling of Shiga toxin-producing Escherichia coli by a rapid and cost-effective DNA microarray colorimetric method

    OpenAIRE

    Beatriz eQuiñones; Swimley, Michelle S.; Koh-Eun eNarm; Patel, Ronak N.; Cooley, Michael B.; Mandrell, Robert E.

    2012-01-01

    Shiga toxin-producing Escherichia coli (STEC) is a leading cause of foodborne illness worldwide. The present study developed the use of DNA microarrays with the ampliPHOX colorimetric method to rapidly detect and genotype STEC strains. A low-density 30-mer oligonucleotide DNA microarray was designed to target O-antigen gene clusters of eleven E. coli serogroups (O26, O45, O91, O103, O104, O111, O113, O121, O128, O145 and O157) that have been associated with the majority of STEC infections. ...

  20. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    Endemic of avian influenza virus (AIV) in Asia and epizootics in some European regions have caused considerable public concern on a possible pandemic of AIV. A rapid method for virus detection and effective surveillance in wild avian, poultry production as well as in humans is required....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  1. Validation of the 16S rDNA and COI DNA barcoding technique for rapid molecular identification of stored product psocids (Insecta: Psocodea: Liposcelididae).

    Science.gov (United States)

    Yang, Qianqian; Zhao, Shuo; Kucerová, Zuzana; Stejskal, Václav; Opit, George; Qin, Meng; Cao, Yang; Li, Fujun; Li, Zhihong

    2013-02-01

    Psocids are serious storage pests, and their control is hampered by the fact that different species respond differently to insecticides used for the control of stored-product insect pests. Additionally, psocids of genus Liposcelis that are commonly associated with stored-products are difficult to identify using morphological characteristics. The goal of this study was to validate molecular identification of stored-product psocids of genus Liposcelis based on 16S rDNA and cytochrome oxidase I (COI) DNA barcoding. Unidentified liposcelids (Liposcelis DK) imported from Denmark to China were compared with 14 population samples of seven common species (L. bostrychophila, L. brunnea, L. corrodens, L. decolor, L. entomophila, L. mendax, and L. paeta). The explored species (DK) liposcelids shared >98% sequence similarity for both the 16S rDNA and COI genes with the reference L. corrodens samples (98.32 and 98.94% for 16S rDNA and COI, respectively). A neighbor-joining tree revealed that the explored DK sample and the reference L. corrodens samples belong to the same clade. These molecular results were verified by morphological identification of DK specimens, facilitated by SEM microphotography. The DNA barcoding method and the neighbor-joining phylogenetic analyses indicated that both the 16S rDNA and COI genes were suitable for Liposcelis species identification. DNA barcoding has great potential for use in fast and accurate liposcelid identification.

  2. Combining a Ru(II) "Building Block" and Rapid Screening Approach to Identify DNA Structure-Selective "Light Switch" Compounds.

    Science.gov (United States)

    Wachter, Erin; Moyá, Diego; Glazer, Edith C

    2017-02-13

    A chemically reactive Ru(II) "building block", able to undergo condensation reactions with substituted diamines, was utilized to create a small library of luminescent "light switch" dipyrido-[3,2-a:2',3'-c] phenazine (dppz) complexes. The impact of substituent identity, position, and the number of substituents on the light switch effect was investigated. An unbiased, parallel screening approach was used to evaluate the selectivity of the compounds for a variety of different biomolecules, including protein, nucleosides, single stranded DNA, duplex DNA, triplex DNA, and G-quadruplex DNA. Combining these two approaches allowed for the identification of hit molecules that showed different selectivities for biologically relevant DNA structures, particularly triplex and quadruplex DNA.

  3. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    for their effectiveness for the direct quantification (without enrichment) of Campylobacter jejuni in chicken fecal samples using real-time PCR. The presence of inhibitory substances in chicken fecal samples may reduce or even completely impede the PCR amplification process making quantification very difficult. Six rapid......Direct and accurate quantification of Campylobacter in poultry is crucial for the assessment of public health risks and the evaluation of the effectiveness of control measures against Campylobacter in poultry. The aim of this study was to assess several rapid DNA extraction methods...... of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...

  4. Rapid identification of Salmonella using Hektoen enteric agar and 16s ribosomal DNA probe-gold nanoparticle immunochromatography assay in clinical faecal specimens.

    Science.gov (United States)

    Yeung, C-Y; Liu, C-C; Tseng, Y-T; Tsai, K-C; Hsieh, M-A; Chan, W-T; Liu, H-L; Lee, H-C; Hou, S-Y

    2014-04-01

    A rapid identification of Salmonella, one of the most common foodborne pathogens worldwide, in clinical patients can enable better rational managements and prevent further outbreaks. The traditional immunochromatography using antibody-gold nanoparticles (Ab-AuNPs), such as the home pregnancy test, has been used for the Salmonella detection. In this study, we developed a new and rapid method using DNA probe-AuNPs for the detection of 16s ribosomal DNA of Salmonella. To evaluate the proposed method in clinical specimens, we performed a clinical test by identifying 159 stool samples on Hektoen agar containing black or crystalloid colonies using the method and the VITEK 2 system for confirmation. Eighty of the isolates were correctly identified as Salmonella to achieve 100% sensitivity. Seventy-five samples were correctly identified as non-Salmonella spp., but four were incorrectly identified as Salmonella. The specificity was 94·93%. The assay time is about 30 min after the DNA purification. The time-consuming and labour-intense biochemical tests can be replaced. We demonstrated that this assay is a rapid, convenient and cost-effective tool for Salmonella identification of clinical faecal samples, which is worth for further promotion and clinical use. This is the first application of using 16s ribosomal DNA probe-Au-NPs and immunochromatography on clinical samples. This is the first application of using 16s ribosomal DNA probe-gold nanoparticles and immunochromatography method on clinical samples with sensitivity 100% and specificity 94·93%. The assay time is about 30 min after the DNA purification. We find this assay a rapid, convenient, sensitive and inexpensive tool for Salmonella identification of clinical faecal samples, which is worth further promotion and clinical use and can replace the traditional time-consuming and labour-intense biochemical tests. The potential benefit of this approach is to develop a rapid point-of-care test that provides results while

  5. Rapid and Accurate Identification of Adulterants via an Electronic Nose and DNA Identification Platform: Identification of Fake Velvet Antlers as an Example

    OpenAIRE

    Guojie Xu; Chunsheng Liu; Caili Liao; Xiaolei Ren; Xinyue Zhang; Xiaorui Fu; Xueyong Wang

    2016-01-01

    Background. Adulterants in Chinese medicines had always affected the efficacy of Chinese medicines and resulted in safety problems in drug use. We aimed to take the identification of fake velvet antlers as an example for establishment of a rapid and accurate identification platform for modern pharmaceutical companies and markets of Chinese medicine. Methods. In this study, we developed a novel electronic nose and DNA identification platform for identifying fake velvet antlers. Electronic nose...

  6. Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector.

    Science.gov (United States)

    Sun, Kai; Zhao, Danyang; Liu, Yong; Huang, Changjun; Zhang, Wei; Li, Zhenghe

    2017-11-07

    The availability of infectious full-length clone is indispensable for reverse genetics studies of virus biology, pathology and construction of viral vectors. However, for RNA viruses with large genome sizes or those exhibiting inherent cloning difficulties, procedure to generate biologically active circular DNA (cDNA) clones can be time-consuming or technically challenging. Here we have constructed a yeast- Escherichia coli - Agrobacterium shuttle vector that enables highly efficient homologous recombination in yeast for assembly of Agrobacterium compatible plant virus clones. Using this vector, we show that infectious cDNA clones of a plant negative-stranded RNA virus, sonchus yellow net rhabdovirus, can be rapidly assembled. In addition, one-step assembly of infectious clones of potato virus Y in yeast, either with or without intron, was readily achieved from as many as eight overlapping DNA fragments. More importantly, the recovered yeast plasmids can be transformed directly into Agrobacterium for inoculation, thereby obviating the E. coli cloning steps and associated toxicity issues. This method is rapid, highly efficient and cost-effective and should be readily applicable to a broad range of plant viruses.

  7. Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector

    Directory of Open Access Journals (Sweden)

    Kai Sun

    2017-11-01

    Full Text Available The availability of infectious full-length clone is indispensable for reverse genetics studies of virus biology, pathology and construction of viral vectors. However, for RNA viruses with large genome sizes or those exhibiting inherent cloning difficulties, procedure to generate biologically active complementary DNA (cDNA clones can be time-consuming or technically challenging. Here we have constructed a yeast-Escherichia coli-Agrobacterium shuttle vector that enables highly efficient homologous recombination in yeast for assembly of Agrobacterium compatible plant virus clones. Using this vector, we show that infectious cDNA clones of a plant negative-stranded RNA virus, sonchus yellow net rhabdovirus, can be rapidly assembled. In addition, one-step assembly of infectious clones of potato virus Y in yeast, either with or without intron, was readily achieved from as many as eight overlapping DNA fragments. More importantly, the recovered yeast plasmids can be transformed directly into Agrobacterium for inoculation, thereby obviating the E. coli cloning steps and associated toxicity issues. This method is rapid, highly efficient and cost-effective and should be readily applicable to a broad range of plant viruses.

  8. DNA barcoding and morphological analysis for rapid identification of most economically important crop-infesting Sunn pests belonging to Eurygaster Laporte, 1833 (Hemiptera, Scutelleridae

    Directory of Open Access Journals (Sweden)

    Mikhail Y. Syromyatnikov

    2017-10-01

    Full Text Available The genus Eurygaster Laporte, 1833 includes ten species five of which inhabit the European part of Russia. The harmful species of the genus is E. integriceps. Eurygaster species identification based on the morphological traits is very difficult, while that of the species at the egg or larval stages is extremely difficult or impossible. Eurygaster integriceps, E. maura, and E. testudinaria differ only slightly between each other morphologically, E. maura and E. testudinaria being almost indiscernible. DNA barcoding based on COI sequences have shown that E. integriceps differs significantly from these closely related species, which enables its rapid and accurate identification. Based on COI nucleotide sequences, three species of Sunn pests, E. maura, E. testudinarius, E. dilaticollis, could not be differentiated from each other through DNA barcoding. The difference in the DNA sequences between the COI gene of E. integriceps and COI genes of E. maura and E. testudinarius was more than 4%. In the present study DNA barcoding of two Eurygaster species was performed for the first time on E. integriceps, the most dangerous pest in the genus, and E. dilaticollis that only inhabits natural ecosystems. The PCR-RFLP method was developed in this work for the rapid identification of E. integriceps.

  9. DNA barcoding and morphological analysis for rapid identification of most economically important crop-infesting Sunn pests belonging to Eurygaster Laporte, 1833 (Hemiptera, Scutelleridae).

    Science.gov (United States)

    Syromyatnikov, Mikhail Y; Golub, Victor B; Kokina, Anastasia V; Victoria A Soboleva; Popov, Vasily N

    2017-01-01

    The genus Eurygaster Laporte, 1833 includes ten species five of which inhabit the European part of Russia. The harmful species of the genus is E. integriceps. Eurygaster species identification based on the morphological traits is very difficult, while that of the species at the egg or larval stages is extremely difficult or impossible. Eurygaster integriceps, E. maura, and E. testudinaria differ only slightly between each other morphologically, E. maura and E. testudinaria being almost indiscernible. DNA barcoding based on COI sequences have shown that E. integriceps differs significantly from these closely related species, which enables its rapid and accurate identification. Based on COI nucleotide sequences, three species of Sunn pests, E. maura, E. testudinarius, E. dilaticollis, could not be differentiated from each other through DNA barcoding. The difference in the DNA sequences between the COI gene of E. integriceps and COI genes of E. maura and E. testudinarius was more than 4%. In the present study DNA barcoding of two Eurygaster species was performed for the first time on E. integriceps, the most dangerous pest in the genus, and E. dilaticollis that only inhabits natural ecosystems. The PCR-RFLP method was developed in this work for the rapid identification of E. integriceps.

  10. MGB probe assay for rapid detection of mtDNA11778 mutation in the Chinese LHON patients by real-time PCR*

    Science.gov (United States)

    Wang, Jian-yong; Gu, Yang-shun; Wang, Jing; Tong, Yi; Wang, Ying; Shao, Jun-bing; Qi, Ming

    2008-01-01

    Objective: Leber’s hereditary optic neuropathy (LHON) is a maternally inherited degeneration of the optic nerve caused by point mutations of mitochondrial DNA (mtDNA). Many unsolved questions regarding the penetrance and pathophysiological mechanism of LHON demand efficient and reliable mutation testing. This study aims to develop a minor groove binder (MGB) probe assay for rapid detection of mtDNA11778 mutation and heteroplasmy in Chinese LHON patients by real-time polymerase chain reaction (PCR). Methods: Forty-eight patients suspected of having LHON and their maternal relatives underwent a molecular genetic evaluation, with 20 normal individuals as a control group at the same time. A real-time PCR involving two MGB probes was used to detect the mtDNA11778 mutation and heteroplasmy. A linear standard curve was obtained by pUCmLHONG and pUCmLHONA clones. Results: All 48 LHON patients and their maternal relatives were positive for mtDNA11778 mutation in our assay, 27 heteroplasmic and 21 homoplasmic. Eighteen cases did not show an occurrence of the disease, while 9 developed the disease among the 27 heteroplasmic mutation cases. Eleven did not show an occurrence of the disease, while 10 cases developed the disease among 21 homoplasmic mutation cases. There was a significant difference in the incidence between the heteroplasmic and the homoplasmic mutation types. The time needed for running a real-time PCR assay was only 80 min. Conclusion: This real-time PCR assay is a rapid, reliable method for mtDNA mutation detection as well as heteroplasmy quantification. Detecting this ratio is very important for predicting phenotypic expression of unaffected carriers. PMID:18763310

  11. MGB probe assay for rapid detection of mtDNA11778 mutation in the Chinese LHON patients by real-time PCR.

    Science.gov (United States)

    Wang, Jian-yong; Gu, Yang-shun; Wang, Jing; Tong, Yi; Wang, Ying; Shao, Jun-bing; Qi, Ming

    2008-08-01

    Leber's hereditary optic neuropathy (LHON) is a maternally inherited degeneration of the optic nerve caused by point mutations of mitochondrial DNA (mtDNA). Many unsolved questions regarding the penetrance and pathophysiological mechanism of LHON demand efficient and reliable mutation testing. This study aims to develop a minor groove binder (MGB) probe assay for rapid detection of mtDNA11778 mutation and heteroplasmy in Chinese LHON patients by real-time polymerase chain reaction (PCR). Forty-eight patients suspected of having LHON and their maternal relatives underwent a molecular genetic evaluation, with 20 normal individuals as a control group at the same time. A real-time PCR involving two MGB probes was used to detect the mtDNA11778 mutation and heteroplasmy. A linear standard curve was obtained by pUCmLHONG and pUCmLHONA clones. All 48 LHON patients and their maternal relatives were positive for mtDNA11778 mutation in our assay, 27 heteroplasmic and 21 homoplasmic. Eighteen cases did not show an occurrence of the disease, while 9 developed the disease among the 27 heteroplasmic mutation cases. Eleven did not show an occurrence of the disease, while 10 cases developed the disease among 21 homoplasmic mutation cases. There was a significant difference in the incidence between the heteroplasmic and the homoplasmic mutation types. The time needed for running a real-time PCR assay was only 80 min. This real-time PCR assay is a rapid, reliable method for mtDNA mutation detection as well as heteroplasmy quantification. Detecting this ratio is very important for predicting phenotypic expression of unaffected carriers.

  12. Determination of alkylation of bacterial DNA as a rapid test for toxicological evaluation of alkylating xenobiotic agents

    Energy Technology Data Exchange (ETDEWEB)

    Botzenhart, K.; Waldner-Sander, S.; Schweinsberg, F.

    1986-05-01

    Alkylated purine bases from hydrolized DNA can be separated by HPLC and quantified with a fluorescence detector. We applied this method to bacterial DNA. 7-methylguanine was detected after treatment of Serratia marcescens with iodoacetamide, dimethyl sulfate and with polluted air.

  13. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Directory of Open Access Journals (Sweden)

    Koji Hashimoto

    2016-05-01

    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe.

  14. Coffee consumption rapidly reduces background DNA strand breaks in healthy humans: Results of a short-term repeated uptake intervention study.

    Science.gov (United States)

    Bakuradze, Tamara; Lang, Roman; Hofmann, Thomas; Schipp, Dorothea; Galan, Jens; Eisenbrand, Gerhard; Richling, Elke

    2016-03-01

    Intervention studies provide evidence that long-term coffee consumption correlates with reduced DNA background damage in healthy volunteers. Here, we report on short-term kinetics of this effect, showing a rapid onset after normal coffee intake. In a short-term human intervention study, we determined the effects of coffee intake on DNA integrity during 8 h. Healthy male subjects ingested coffee in 200 mL aliquots every second hour up to a total volume of 800 mL. Blood samples were taken at baseline, immediately before the first coffee intake and subsequently every 2 h, prior to the respective coffee intake. DNA integrity was assayed by the comet assay. The results show a significant (p coffee intake. Continued coffee intake was associated with further decrements in background DNA damage within the 8 h intervention (p coffee consumption). Repeated coffee consumption was associated with reduced background DNA strand breakage, clearly measurable as early as 2 h after first intake resulting in a cumulative overall reduction by about one-third of the baseline value. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Direct immobilization of DNA probes on non-modified plastics by UV irradiation and integration in microfluidic devices for rapid bioassay.

    Science.gov (United States)

    Sun, Yi; Perch-Nielsen, Ivan; Dufva, Martin; Sabourin, David; Bang, Dang Duong; Høgberg, Jonas; Wolff, Anders

    2012-01-01

    DNA microarrays have become one of the most powerful tools in the field of genomics and medical diagnosis. Recently, there has been increased interest in combining microfluidics with microarrays since this approach offers advantages in terms of portability, reduced analysis time, low consumption of reagents, and increased system integration. Polymers are widely used for microfluidic systems, but fabrication of microarrays on such materials often requires complicated chemical surface modifications, which hinders the integration of microarrays into microfluidic systems. In this paper, we demonstrate that simple UV irradiation can be used to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on many different types of plastics without any surface modification. On average, five- and fourfold improvement in immobilization and hybridization efficiency have been achieved compared to surface-modified slides with aminated DNA probes. Moreover, the TC tag only costs 30% of the commonly used amino group modifications. Using this microarray fabrication technique, a portable cyclic olefin copolymer biochip containing eight individually addressable microfluidic channels was developed and used for rapid and parallel identification of Avian Influenza Virus by DNA hybridization. The one-step, cost-effective DNA-linking method on non-modified polymers significantly simplifies microarray fabrication procedures and permits great flexibility to plastic material selection, thus making it convenient to integrate microarrays into plastic microfluidic systems.

  16. Phylogenetic utility of rapidly evolving DNA at high taxonomical levels: contrasting matK, trnT-F, and rbcL in basal angiosperms.

    Science.gov (United States)

    Müller, Kai F; Borsch, Thomas; Hilu, Khidir W

    2006-10-01

    The prevailing view in molecular systematics is that relationships among distantly related taxa should be inferred using DNA segments with low rates of evolution. However, recent analyses of sequences from the rapidly evolving matK and trnT-trnF regions yielded well resolved and highly supported trees for early diverging angiosperms. We compare here the phylogenetic structure in matK, trnT-F, and rbcL datasets for the same 42, primarily basal angiosperm taxa. Phylogenetic trees based on matK or trnT-F are far more robust than those based on rbcL. Combined analysis of the rapidly evolving regions provides support for higher-level relationships stronger than that derived from analyses of multi-gene datasets of up to several fold the number of characters analyzed here. In addition to displaying a higher percentage of parsimony-informative characters, the average phylogenetic signal per informative character is significantly higher in the datasets from rapidly evolving DNA than in the more slowly evolving rbcL, as detected using resampling of identical numbers of parsimony-informative characters from the data matrices and subjecting different statistics for overall tree robustness and phylogenetic signal to significance tests. Automated via a set of scripts, the method used here should be easily extendable to comparisons of a broader range of genomic regions for varying taxon samplings. The relative performance of markers correlates not only with a lower mean homoplasy in matK and trnT-trnF compared to rbcL, but in particular correlates negatively with the percentage of sites exhibiting maximum or close to maximum homoplasy. A likelihood ratio test confirms that the rapidly evolving gene matK evolves significantly closer to neutrality, which may be one of the underlying factors for lower levels of overall homoplasy. Our results are in line with evidence from simulation studies suggesting that the deleterious effect of multiple hits in using rapidly evolving DNA at

  17. Rapid in vitro splicing of coding sequences from genomic DNA by isothermal recombination reaction-based PCR

    Directory of Open Access Journals (Sweden)

    Wenxuan Chen

    2016-09-01

    Full Text Available Cloning of coding sequence (CDS is an important step for gene function research. Here, we reported a simple and efficient strategy for assembling multiple-exon into an intron-free CDS from genomic DNA (gDNA by an isothermal recombination reaction-based PCR (IRR-PCR method. As an example, a 2067-bp full-length CDS of the anther-specific expression gene OsABCG15, which is composed of seven exons and six introns, was generated by IRR-PCR using genomic DNA of rice leaf as the template. Actually, this approach can be wildly applied to any DNA sequences assembly to achieve CDS cloning, gene fusion and multiple site-directed mutagenesis in functional genomics studies in vitro.

  18. Optofluidics-based DNA structure-competitive aptasensor for rapid on-site detection of lead(II) in an aquatic environment.

    Science.gov (United States)

    Long, Feng; Zhu, Anna; Wang, Hongchen

    2014-11-07

    Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of <8.5%. These observations clearly illustrate that with the use of different DNA or aptamer probes, the sensing strategy presented can be easily extended to the rapid on-site monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. A tool for rapid screening of direct DNA agents using reaction rates and relative interaction potency: towards screening environmental contaminants for hazard.

    Science.gov (United States)

    Gavina, Jennilee M A; Rubab, Mamoona; Zhang, Huijuan; Zhu, Jiping; Nong, Andy; Feng, Yong-Lai

    2011-11-01

    DNA damage represents a potential biomarker for determining the exposure risk to chemicals and may provide early warning data for identifying chemical hazards to human health. Here, we have demonstrated a simple chromatography-based method that can be used to rapidly screen for the presence of chemical hazards as well as to determine parameters relevant to hazard assessment. In this proof-of-principle study, a simple in vitro system was used to determine the interaction of pollutants and probable carcinogens, phenyl glycidyl ether (PGE), tetrachlorohydroquinone (Cl(4)HQ), methylmethane sulfonate (MMS), styrene-7,8-oxide (SO), and benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), a metabolite of benzo[a]pyrene (B[a]P), with single- and double-stranded DNA probes. Differences in potency and reaction kinetics were studied for chemical and DNA type. A relative interaction potency equivalency (PEQ) of a chemical was determined by ratio of interaction potency of a chemical to BPDE as the reference chemical in the reaction with single- and double-stranded oligodeoxynucleotides. PEQs were found to be BPDE > PGE > SO > MMS > Cl(4)HQ for single-stranded oligodeoxynucleotides while they were found to be BPDE > PGE > Cl(4)HQ > MMS > SO for double-stranded oligodeoxynucleotides. Kinetics evaluation revealed that BPDE reacted with both DNA probes at a significantly faster rate, as compared to the remaining test chemicals. Equilibrium was reached within an hour for BPDE, but required a minimum of 48 h for the remaining chemicals. First-order rate constants were (1.61 ± 0.2) × 10(-3) s(-1) and (3.18 ± 0.4) × 10(-4) s(-1) for reaction of BPDE with double- and single-stranded DNA, respectively. The remaining chemicals possessed rate constants from 2 to 13 × 10(-6) s(-1) with a relative kinetic order for reaction with DNA of BPDE ≫ MMS > SO > PGE > Cl(4)HQ for ds-DNA and BPDE ≫ SO ≈ Cl(4)HQ ≈ MMS > PGE for ss-DNA. We further found that the reaction potency, defined by

  20. A Rapid and Sensitive Method for Detection of the T790M Mutation of EGFR in Plasma DNA.

    Science.gov (United States)

    Kimura, Hideharu; Nishikawa, Shingo; Koba, Hayato; Yoneda, Taro; Sone, Takashi; Kasahara, Kazuo

    2016-01-01

    Epidermal growth factor receptor (EGFR) T790M mutation is associated with resistance to EGFR tyrosine kinase inhibitors' (EGFR-TKIs) in non-small cell lung cancer (NSCLC). The aims of this study are to develop a blood-based, non-invasive approach to detecting the EGFR T790M mutation in advanced NSCLC patients, using PointMan™ EGFR DNA Enrichment Kit which is a novel method for selective amplification of genotype specific sequences.Pairs of blood samples and tumor tissues were collected from NSCLC patients with an EGFR activating mutation and who were resistant to EGFR-TKI treatment. EGFR T790M mutation in plasma DNA were detected using the PointMan™ EGFR DNA Enrichment Kit. The concentrations of plasma DNA were determined using quantitative real-time PCR.Of the 52 patients enrolled in this study, 41 of the patients' plasma samples were collected at post EGFR-TKIs. Nineteen (46.3 %) of the 41 patients had an EGFR T790M mutation in their plasma DNA as detected using the PointMan™ EGFR DNA Enrichment Kit after disease progression to EFGR-TKI. Of 11 cases with a detected T790M mutation from tumor tissues, 10 (90.9 %) also had a detectable T790M mutation in the plasma DNA. There was no difference in the progression-free survival between patients with T790M and those without T790M.The PointMan™ proved to be a useful method for determining plasma EGFR T790M mutation status.

  1. Assessing the impact of common forensic presumptive tests on the ability to obtain results using a novel rapid DNA platform.

    Science.gov (United States)

    Donachie, Gillian E; Dawnay, Nick; Ahmed, Romana; Naif, Sarah; Duxbury, Nicola J; Tribble, Nicholas D

    2015-07-01

    The rise of DNA evidence to the forefront of forensic science has led to high sample numbers being submitted for profiling by investigators to casework laboratories: bottleneck effects are often seen resulting in slow turnaround times and sample backlog. The ParaDNA(®) Screening and Intelligence Tests have been designed to guide investigators on the viability of potential sources of DNA allowing them to determine which samples should be sent for full DNA analysis. Both tests are designed to augment the arsenal of available forensic tests for end users and be used concurrently to those commonly available. Therefore, assessing the impact that common forensic tests have on such novel technology is important to measure. The systems were tested against various potential inhibitors to which samples may be exposed as part of the investigative process. Presumptive test agents for biological materials (blood, semen and saliva) and those used as fingerprint enhancement agents were both used. The Screening Test showed a drop in performance following application of aluminium powder and cyanoacrylate (CNA) on fingerprints samples; however this drop in performance was not replicated with high template DNA. No significant effect was observed for any agent using the Intelligence Test. Therefore, both tests stand up well to the chemical agents applied and can be used by investigators with confidence that system performance will be maintained. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. Rapid detection of periprosthetic joint infection using a combination of 16s rDNA polymerase chain reaction and lateral flow immunoassay: A Pilot Study.

    Science.gov (United States)

    Janz, V; Schoon, J; Morgenstern, C; Preininger, B; Reinke, S; Duda, G; Breitbach, A; Perka, C F; Geissler, S

    2018-01-01

    The objective of this study was to develop a test for the rapid (within 25 minutes) intraoperative detection of bacteria from synovial fluid to diagnose periprosthetic joint infection (PJI). The 16s rDNA test combines a polymerase chain reaction (PCR) for amplification of 16s rDNA with a lateral flow immunoassay in one fully automated system. The synovial fluid of 77 patients undergoing joint aspiration or primary or revision total hip or knee surgery was prospectively collected. The cohort was divided into a proof-of-principle cohort (n = 17) and a validation cohort (n = 60). Using the proof-of-principle cohort, an optimal cut-off for the discrimination between PJI and non-PJI samples was determined. PJI was defined as detection of the same bacterial species in a minimum of two microbiological samples, positive histology, and presence of a sinus tract or intra-articular pus. The 16s rDNA test proved to be very robust and was able to provide a result in 97% of all samples within 25 minutes. The 16s rDNA test was able to diagnose PJI with a sensitivity of 87.5% and 82%, and a specificity of 100% and 89%, in the proof-of-principle and validation cohorts, respectively. The microbiological culture of synovial fluid achieved a sensitivity of 80% and a specificity of 93% in the validation cohort. The 16s rDNA test offers reliable intraoperative detection of all bacterial species within 25 minutes with a sensitivity and specificity comparable with those of conventional microbiological culture of synovial fluid for the detection of PJI. The 16s rDNA test performance is independent of possible blood contamination, culture time and bacterial species. Cite this article : V. Janz, J. Schoon, C. Morgenstern, B. Preininger, S. Reinke, G. Duda, A. Breitbach, C. F. Perka, S. Geissler. Rapid detection of periprosthetic joint infection using a combination of 16s rDNA polymerase chain reaction and lateral flow immunoassay: A Pilot Study. Bone Joint Res 2018;7:12-19. DOI: 10

  3. Study of bacteriophage T4-encoded Dam DNA (adenine-N6)-methyltransferase binding with substrates by rapid laser UV cross-linking.

    Science.gov (United States)

    Evdokimov, Alexey A; Sclavi, Bianca; Zinoviev, Victor V; Malygin, Ernst G; Hattman, Stanley; Buckle, Malcolm

    2007-09-07

    DNA methyltransferases of the Dam family (including bacteriophage T4-encoded Dam DNA (adenine-N(6))-methyltransferase (T4Dam)) catalyze methyl group transfer from S-adenosyl-L-methionine (AdoMet), producing S-adenosyl-L-homocysteine (AdoHcy) and methylated adenine residues in palindromic GATC sequences. In this study, we describe the application of direct (i.e. no exogenous cross-linking reagents) laser UV cross-linking as a universal non-perturbing approach for studying the characteristics of T4Dam binding with substrates in the equilibrium and transient modes of interaction. UV irradiation of the enzyme.substrate complexes using an Nd(3+):yttrium aluminum garnet laser at 266 nm resulted in up to 3 and >15% yields of direct T4Dam cross-linking to DNA and AdoMet, respectively. Consequently, we were able to measure equilibrium constants and dissociation rates for enzyme.substrate complexes. In particular, we demonstrate that both reaction substrates, specific DNA and AdoMet (or product AdoHcy), stabilized the ternary complex. The improved substrate affinity for the enzyme in the ternary complex significantly reduced dissociation rates (up to 2 orders of magnitude). Several of the parameters obtained (such as dissociation rate constants for the binary T4Dam.AdoMet complex and for enzyme complexes with a nonfluorescent hemimethylated DNA duplex) were previously inaccessible by other means. However, where possible, the results of laser UV cross-linking were compared with those of fluorescence analysis. Our study suggests that rapid laser UV cross-linking efficiently complements standard DNA methyltransferase-related tools and is a method of choice to probe enzyme-substrate interactions in cases in which data cannot be acquired by other means.

  4. Competition between the DNA unwinding and strand pairing activities of the Werner and Bloom syndrome proteins.

    Science.gov (United States)

    Machwe, Amrita; Lozada, Enerlyn M; Xiao, Liren; Orren, David K

    2006-01-13

    The premature aging and cancer-prone Werner and Bloom syndromes are caused by defects in the RecQ helicase enzymes WRN and BLM, respectively. Recently, both WRN and BLM (as well as several other RecQ members) have been shown to possess a strand annealing activity in addition to the requisite DNA unwinding activity. Since an annealing function would appear to directly oppose the action of a helicase, we have examined in this study the dynamic equilibrium between unwinding and annealing mediated by either WRN or BLM. Our investigation into the competition between annealing and unwinding demonstrates that, under standard reaction conditions, WRN- or BLM-mediated annealing can partially or completely mask unwinding as measured in standard helicase assays. Several strategies were employed to suppress the annealing activity so that the actual strength of WRN- or BLM-dependent unwinding could be more accurately assessed. Interestingly, if a DNA oligomer complementary to one strand of the DNA substrate to be unwound is added during the helicase reaction, both WRN and BLM unwinding is enhanced, presumably by preventing protein-mediated re-annealing. This strategy allowed measurement of WRN-catalyzed unwinding of long (80 base pair) duplex regions and fully complementary, blunt-ended duplexes, both of which were otherwise quite refractory to the helicase activity of WRN. Similarly, the addition of trap strand stimulated the ability of BLM to unwind long and blunt-ended duplexes. The stimulatory effect of the human replication protein A (hRPA, the eukaryotic single-stranded DNA binding protein) on both WRN- and BLM-dependent unwinding was also re-examined in light of its possible role in preventing re-annealing. Our results show that hRPA influences the outcome of WRN and BLM helicase assays by both inhibiting re-annealing and directly promoting unwinding, with the larger contribution from the latter mechanism. These findings indicate that measurements of unwinding by WRN

  5. Competition between the DNA unwinding and strand pairing activities of the Werner and Bloom syndrome proteins

    Directory of Open Access Journals (Sweden)

    Orren David K

    2006-01-01

    Full Text Available Abstract Background The premature aging and cancer-prone Werner and Bloom syndromes are caused by defects in the RecQ helicase enzymes WRN and BLM, respectively. Recently, both WRN and BLM (as well as several other RecQ members have been shown to possess a strand annealing activity in addition to the requisite DNA unwinding activity. Since an annealing function would appear to directly oppose the action of a helicase, we have examined in this study the dynamic equilibrium between unwinding and annealing mediated by either WRN or BLM. Results Our investigation into the competition between annealing and unwinding demonstrates that, under standard reaction conditions, WRN- or BLM-mediated annealing can partially or completely mask unwinding as measured in standard helicase assays. Several strategies were employed to suppress the annealing activity so that the actual strength of WRN- or BLM-dependent unwinding could be more accurately assessed. Interestingly, if a DNA oligomer complementary to one strand of the DNA substrate to be unwound is added during the helicase reaction, both WRN and BLM unwinding is enhanced, presumably by preventing protein-mediated re-annealing. This strategy allowed measurement of WRN-catalyzed unwinding of long (80 base pair duplex regions and fully complementary, blunt-ended duplexes, both of which were otherwise quite refractory to the helicase activity of WRN. Similarly, the addition of trap strand stimulated the ability of BLM to unwind long and blunt-ended duplexes. The stimulatory effect of the human replication protein A (hRPA, the eukaryotic single-stranded DNA binding protein on both WRN- and BLM-dependent unwinding was also re-examined in light of its possible role in preventing re-annealing. Our results show that hRPA influences the outcome of WRN and BLM helicase assays by both inhibiting re-annealing and directly promoting unwinding, with the larger contribution from the latter mechanism. Conclusion These

  6. A differential mobility spectrometry/mass spectrometry platform for the rapid detection and quantitation of DNA adduct dG-ABP.

    Science.gov (United States)

    Kafle, Amol; Klaene, Joshua; Hall, Adam B; Glick, James; Coy, Stephen L; Vouros, Paul

    2013-07-15

    There is continued interest in exploring new analytical technologies for the detection and quantitation of DNA adducts, biomarkers which provide direct evidence of exposure and genetic damage in cells. With the goal of reducing clean-up steps and improving sample throughput, a Differential Mobility Spectrometry/Mass Spectrometry (DMS/MS) platform has been introduced for adduct analysis. A DMS/MS platform has been utilized for the analysis of dG-ABP, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl (4-ABP). After optimization of the DMS parameters, each sample was analyzed in just 30 s following a simple protein precipitation step of the digested DNA. A detection limit of one modification in 10^6 nucleosides has been achieved using only 2 µg of DNA. A brief comparison (quantitative and qualitative) with liquid chromatography/mass spectrometry is also presented highlighting the advantages of using the DMS/MS method as a high-throughput platform. The data presented demonstrate the successful application of a DMS/MS/MS platform for the rapid quantitation of DNA adducts using, as a model analyte, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl. Copyright © 2013 John Wiley & Sons, Ltd.

  7. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2017-01-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  8. Uracil-DNA glycosylase-treated reverse transcription loop-mediated isothermal amplification for rapid detection of avian influenza virus preventing carry-over contamination.

    Science.gov (United States)

    Kim, Eun-Mi; Jeon, Hyo-Sung; Kim, Ji-Jung; Shin, Yeun-Kyung; Lee, Youn-Jeong; Yeo, Sang-Geon; Park, Choi-Kyu

    2016-09-30

    Here, we describe a uracil-DNA glycosylase (UNG)-treated reverse transcription loop-mediated isothermal amplification (uRT-LAMP) for the visual detection of all subtypes of avian influenza A virus (AIV). The uRT-LAMP assay can prevent unwanted amplification by carryover contamination of the previously amplified DNA, although the detection limit of the uRT-LAMP assay is 10-fold lower than that of the RT-LAMP without a UNG treatment. To the best of our knowledge, this is the first successful application of deoxyuridine triphosphate/UNG strategy in RT-LAMP for AIV detection, and the assay can be applied for the rapid, and reliable diagnosis of AIVs, even in contaminated samples.

  9. DNA microarrays immobilized on unmodified plastics in a microfluidic biochip for rapid typing of Avian Influenza Virus

    DEFF Research Database (Denmark)

    Yi, Sun; Perch-Nielsen, Ivan R.; Dufva, Martin

    2011-01-01

    to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on non-modified plastic surfaces. This one-step, cost-effective process provides very high immobilization and hybridization efficiencies and is applicable to many different types of polymers. Using this microarray fabrication technique......, a portable cyclic olefin copolymer (COC) microarray device containing eight individually addressable microfluidic channels was developed for fast identification of Avian Influenza Virus (AIV) by DNA hybridization. This plastic biochip offers benefits of low fabrication cost and parallel processing...

  10. Internal validation of the DNAscan/ANDE™ Rapid DNA Analysis™ platform and its associated PowerPlex(®) 16 high content DNA biochip cassette for use as an expert system with reference buccal swabs.

    Science.gov (United States)

    Moreno, Lilliana I; Brown, Alice L; Callaghan, Thomas F

    2017-07-01

    Rapid DNA platforms are fully integrated systems capable of producing and analyzing short tandem repeat (STR) profiles from reference sample buccal swabs in less than two hours. The technology requires minimal user interaction and experience making it possible for high quality profiles to be generated outside an accredited laboratory. The automated production of point of collection reference STR profiles could eliminate the time delay for shipment and analysis of arrestee samples at centralized laboratories. Furthermore, point of collection analysis would allow searching against profiles from unsolved crimes during the normal booking process once the infrastructure to immediately search the Combined DNA Index System (CODIS) database from the booking station is established. The DNAscan/ANDE™ Rapid DNA Analysis™ System developed by Network Biosystems was evaluated for robustness and reliability in the production of high quality reference STR profiles for database enrollment and searching applications. A total of 193 reference samples were assessed for concordance of the CODIS 13 loci. Studies to evaluate contamination, reproducibility, precision, stutter, peak height ratio, noise and sensitivity were also performed. The system proved to be robust, consistent and dependable. Results indicated an overall success rate of 75% for the 13 CODIS core loci and more importantly no incorrect calls were identified. The DNAscan/ANDE™ could be confidently used without human interaction in both laboratory and non-laboratory settings to generate reference profiles. Published by Elsevier B.V.

  11. Development of a rapid diagnostic method for identification of Staphylococcus aureus and antimicrobial resistance in positive blood culture bottles using a PCR-DNA-chromatography method.

    Science.gov (United States)

    Ohshiro, Takeya; Miyagi, Chihiro; Tamaki, Yoshikazu; Mizuno, Takuya; Ezaki, Takayuki

    2016-06-01

    Blood culturing and the rapid reporting of results are essential for infectious disease clinics to obtain bacterial information that can affect patient prognosis. When gram-positive coccoid cells are observed in blood culture bottles, it is important to determine whether the strain is Staphylococcus aureus and whether the strain has resistance genes, such as mecA and blaZ, for proper antibiotic selection. Previous work led to the development of a PCR method that is useful for rapid identification of bacterial species and antimicrobial susceptibility. However, that method has not yet been adopted in community hospitals due to the high cost and methodological complexity. We report here the development of a quick PCR and DNA-chromatography test, based on single-tag hybridization chromatography, that permits detection of S. aureus and the mecA and blaZ genes; results can be obtained within 1 h for positive blood culture bottles. We evaluated this method using 42 clinical isolates. Detection of S. aureus and the resistance genes by the PCR-DNA-chromatography method was compared with that obtained via the conventional identification method and actual antimicrobial susceptibility testing. Our method had a sensitivity of 97.0% and a specificity of 100% for the identification of the bacterial species. For the detection of the mecA gene of S. aureus, the sensitivity was 100% and the specificity was 95.2%. For the detection of the blaZ gene of S. aureus, the sensitivity was 100% and the specificity was 88.9%. The speed and simplicity of this PCR-DNA-chromatography method suggest that our method will facilitate rapid diagnoses. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  12. O-antigen and virulence profiling of Shiga toxin-producing Escherichia coli by a rapid and cost-effective DNA microarray colorimetric method

    Directory of Open Access Journals (Sweden)

    Beatriz eQuiñones

    2012-05-01

    Full Text Available Shiga toxin-producing Escherichia coli (STEC is a leading cause of foodborne illness worldwide. The present study developed the use of DNA microarrays with the ampliPHOX colorimetric method to rapidly detect and genotype STEC strains. A low-density 30-mer oligonucleotide DNA microarray was designed to target O-antigen gene clusters of eleven E. coli serogroups (O26, O45, O91, O103, O104, O111, O113, O121, O128, O145 and O157 that have been associated with the majority of STEC infections. In addition, the DNA microarray targeted eleven virulence genes, encoding adhesins, cytotoxins, proteases, and receptor proteins, which have been implicated in conferring increased ability to cause disease for STEC. Results from the validation experiments demonstrated that this microarray-based colorimetric method allowed for a rapid and accurate genotyping of STEC reference strains from environmental and clinical sources and from distinct geographical locations. Positive hybridization signals were detected only for probes targeting serotype and virulence genes known to be present in the STEC reference strains. Quantification analysis indicated that the mean pixel intensities of the signal for probes targeting O-antigen or virulence genes were at least three times higher when compared to the background. Furthermore, this microarray-based colorimetric method was then employed to genotype a group of E. coli isolates from watershed sediment and animal fecal samples that were collected from an important region for leafy-vegetable production in the central coast of California. The results indicated an accurate identification of O-type and virulence genes in the tested isolates and confirmed that the ampliPHOX colorimetric method with low density DNA microarrays enabled a fast assessment of the virulence potential of STEC using low-cost reagents and instrumentation.

  13. Using rapid diagnostic tests as source of malaria parasite DNA for molecular analyses in the era of declining malaria prevalence

    DEFF Research Database (Denmark)

    Ishengoma, Deus S; Lwitiho, Sudi; Madebe, Rashid A

    2011-01-01

    continued molecular surveillance of malaria parasites is important to early identify emerging anti-malarial drug resistance, it is becoming increasingly difficult to obtain parasite samples from ongoing studies, such as routine drug efficacy trials. To explore other sources of parasite DNA, this study...

  14. Evaluation of rapid GeneXpert MTB/RIF method using DNA tissue specimens of vertebral bones in patients with suspected spondylitis TB.

    Science.gov (United States)

    Massi, Muhammad Nasrum; Biatko, Karya Triko; Handayani, Irda; Pratama, Muhammad Yogi; Septriani, Sari; Nurdin, Gaby Maulida; Ali, Marina B

    2017-03-01

    To detect Mycobacterium tuberculosis DNA and rifampicin resistance in vertebral bone tissue specimens from spondylitis TB suspects. The rapid GeneXpert MTB/RIF and MGIT 960 liquid culture methods have been used in the specimens. Results from 70 suspects with spondylitis TB shown that 31.42% identified positive for spondylitis TB using culture method, while 88.57% shown positive results using rapid GeneXpert MTB/RIF method. The validity of GeneXpert MTB/RIF shown sensitivity value of 100%, specificity value of 16.6%, PPV of 35.48%, and NPV of 100%. GeneXpert has a high sensitivity but low specificity value in this study.

  15. Potential of cross-priming amplification and DNA-based lateral-flow strip biosensor for rapid on-site GMO screening.

    Science.gov (United States)

    Huang, Xin; Zhai, Congcong; You, Qimin; Chen, Hongjun

    2014-07-01

    The requirement to monitor the presence of genetically modified organisms (GMO) in a variety of marked products has generated an increasing demand for reliable, rapid, and time and cost-effective analytical methods. Here we report an on-site method for rapid detection of cauliflower mosaic virus promoter (CaMV 35S), a common element present in most GMO, using cross-priming amplification (CPA) technology. Detection was achieved using a DNA-based contamination-proof strip biosensor. The limit of detection was 30 copies for the pBI121 plasmid containing the CaMV 35S gene. The certified reference sample of GM maize line MON810 was detectable even at the low relative mass concentration of 0.05%. The developed CPA method had high specificity for the CaMV 35S gene, as compared with other GM lines not containing this gene and non-GM products. The method was further validated using nine real-world samples, and the results were confirmed by real-time PCR analysis. Because of its simplicity, rapidity, and high sensitivity, this method of detecting the CaMV 35S gene has great commercial prospects for rapid GMO screening of high-consumption food and agriculture products.

  16. A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta

    Directory of Open Access Journals (Sweden)

    Coupland George

    2005-08-01

    Full Text Available Abstract Background Many established PCR-based approaches in plant molecular biology rely on lengthy and expensive methods for isolation of nucleic acids. Although several rapid DNA isolation protocols are available, they have not been tested for simultaneous RNA isolation for RT-PCR applications. In addition, traditional map-based cloning technologies often use ill-proportioned marker regions even when working with the model plant Arabidopsis thaliana, where the availability of the full genome sequence can now be exploited for the creation of a high-density marker systems. Results We designed a high-density polymorphic marker set between two frequently used ecotypes. This new polymorphic marker set allows size separation of PCR products on agarose gels and provides an initial resolution of 10 cM in linkage mapping experiments, facilitated by a rapid plant nucleic acid extraction protocol using minimal amounts of A. thaliana tissue. Using this extraction protocol, we have also characterized segregating T-DNA insertion mutations. In addition, we have shown that our rapid nucleic acid extraction protocol can also be used for monitoring transcript levels by RT-PCR amplification. Finally we have demonstrated that our nucleic acid isolation method is also suitable for other plant species, such as tobacco and barley. Conclusion To facilitate high-throughput linkage mapping and other genomic applications, our nucleic acid isolation protocol yields sufficient quality of DNA and RNA templates for PCR and RT-PCR reactions, respectively. This new technique requires considerably less time compared to other purification methods, and in combination with a new polymorphic PCR marker set dramatically reduces the workload required for linkage mapping of mutations in A. thaliana utilizing crosses between Col-0 and Landsberg erecta (Ler ecotypes.

  17. Development and Evaluation of Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Tylenchulus semipenetrans Using DNA Extracted from Soil

    Directory of Open Access Journals (Sweden)

    Zhi-Qiang Song

    2017-04-01

    Full Text Available Tylenchulus semipenetrans is an important and widespread plant-parasitic nematode of citrus worldwide and can cause citrus slow decline disease leading to significant reduction in tree growth and yield. Rapid and accurate detection of T. semipenetrans in soil is important for the disease forecasting and management. In this study, a loop-mediated isothermal amplification (LAMP assay was developed to detect T. semipenetrans using DNA extracted from soil. A set of five primers was designed from the internal transcribed spacer region (ITS1 of rDNA, and was highly specific to T. semipenetrans. The LAMP reaction was performed at 63°C for 60 min. The LAMP product was visualized directly in one reaction tube by adding SYBR Green I. The detection limit of the LAMP assay was 10−2 J2/0.5 g of soil, which was 10 times more sensitive than conventional PCR (10−1 J2/0.5 g of soil. Examination of 24 field soil samples revealed that the LAMP assay was applicable to a range of soils infested naturally with T. semipenetrans, and the total assay time was less than 2.5 h. These results indicated that the developed LAMP assay is a simple, rapid, sensitive, specific and accurate technique for detection of T. semipenetrans in field soil, and contributes to the effective management of citrus slow decline disease.

  18. Rapid method for DNA extraction from the honey bee Apis mellifera and the parasitic bee mite Varroa destructor using lysis buffer and proteinase K.

    Science.gov (United States)

    Issa, M R C; Figueiredo, V L C; De Jong, D; Sakamoto, C H; Simões, Z L P

    2013-10-22

    We developed a rapid method for extraction of DNA from honey bees, Apis mellifera, and from the parasitic bee mite, Varroa destructor. The advantages include fast processing and low toxicity of the substances that are utilized. We used lysis buffer with nonionic detergents to lyse cell walls and proteinase K to digest proteins. We tested whole thorax, thoracic muscle mass, legs, and antennae from individual bees; the mites were processed whole (1 mite/sample). Each thorax was incubated whole, without cutting, because exocuticle color pigment darkened the extraction solution, interfering with PCR results. The procedure was performed with autoclaved equipment and laboratory gloves. For each sample, we used 100 µL lysis buffer (2 mL stock solution of 0.5 M Tris/HCl, pH 8.5, 10 mL stock solution of 2 M KCl, 500 µL solution of 1 M MgCl2, 2 mL NP40, and 27.6 g sucrose, completed to 200 mL with bidistilled water and autoclaved) and 2 µL proteinase K (10 mg/mL in bidistilled water previously autoclaved, as proteinase K cannot be autoclaved). Tissues were incubated in the solutions for 1-2 h in a water bath (62°-68 °C) or overnight at 37 °C. After incubation, the tissues were removed from the extraction solution (lysis buffer + proteinase K) and the solution heated to 92 °C for 10 min, for proteinase K inactivation. Then, the solution with the extracted DNA was stored in a refrigerator (4°-8 °C) or a freezer (-20 °C). This method does not require centrifugation or phenol/chloroform extraction. The reduced number of steps allowed us to sample many individuals/day. Whole mites and bee antennae were the most rapidly processed. All bee tissues gave the same quality DNA. This method, even using a single bee antenna or a single mite, was adequate for extraction and analysis of bee genomic and mitochondrial DNA and mite genomic DNA.

  19. A rapid and sensitive GC-MS/MS method to measure deuterium labeled deoxyadenosine in DNA from limited mouse cell populations

    Science.gov (United States)

    Farthing, Don E.; Buxbaum, Nataliya P.; Bare, Catherine V.; Treadwell, Shirin M.; Kapoor, Veena; Williams, Kirsten M.; Gress, Ronald E.

    2013-01-01

    A rapid and sensitive GC-MS/MS method was developed to quantitatively measure low levels of DNA base deoxyadenosine (dA) and its isotopologues (e.g. dA M+1) from limited mouse cell populations. Mice undergoing allogeneic hematopoietic transplantation (AHSCT) received deuterated water at biologically relevant time intervals post AHSCT, allowing labeling of DNA upon cell division, which was detected as the dA M+1 isotopologue. Targeted mouse cell populations were isolated from lymphoid organs and purified by multi-parameter fluorescence activated cell sorting. Cell lysis, DNA extraction and hydrolysis were accomplished using available commercial procedures. The novel analytical method utilized a hydrophilic-lipophilic balanced sample preparation, rapid on-line hot GC inlet gas phase sample derivatization, fast GC low thermal mass technology, and a recently marketed GC-MS/MS system. Calibration standards containing dA and fortified with relevant levels of dA M+1 (0.25–20%) and dA M+5 (internal standard) were used for sample quantitation. The method employed a quadratic fit for calibration of dA M+1 (0.25–20%) and dA, demonstrated excellent accuracy and precision, and had limits of detection of 100 fg on-column for the dA isotopologues. The method was validated and required only 20,000 cells to characterize population dynamics of cells involved in the biology of chronic graft-versus-host disease, the main cause of late morbidity and non-relapse-mortality following AHSCT. The high sensitivity and specificity of the method makes it useful for investigating in vivo kinetics on limited and important cell populations (e.g. T regulatory cells) from disease conditions or in disease models that are immune-mediated, such as diabetes, HIV/AIDS, arthritis, inflammatory bowel disease, and multiple sclerosis. PMID:23541182

  20. Open microfluidic gel electrophoresis: Rapid and low cost separation and analysis of DNA at the nanoliter scale.

    Science.gov (United States)

    Gutzweiler, Ludwig; Gleichmann, Tobias; Tanguy, Laurent; Koltay, Peter; Zengerle, Roland; Riegger, Lutz

    2017-07-01

    Gel electrophoresis is one of the most applied and standardized tools for separation and analysis of macromolecules and their fragments in academic research and in industry. In this work we present a novel approach for conducting on-demand electrophoretic separations of DNA molecules in open microfluidic (OM) systems on planar polymer substrates. The approach combines advantages of slab gel, capillary- and chip-based methods offering low consumable costs (<0.1$) circumventing cost-intensive microfluidic chip fabrication, short process times (5 min per analysis) and high sensitivity (4 ng/μL dsDNA) combined with reasonable resolution (17 bases). The open microfluidic separation system comprises two opposing reservoirs of 2-4 μL in volume, a semi-contact written gel line acting as separation channel interconnecting the reservoirs and sample injected into the line via non-contact droplet dispensing and thus enabling the precise control of the injection plug and sample concentration. Evaporation is prevented by covering aqueous structures with PCR-grade mineral oil while maintaining surface temperature at 15°C. The liquid gel line exhibits a semi-circular cross section of adaptable width (∼200-600 μm) and height (∼30-80 μm) as well as a typical length of 15-55 mm. Layout of such liquid structures is adaptable on-demand not requiring time consuming and repetitive fabrication steps. The approach was successfully demonstrated by the separation of a standard label-free DNA ladder (100-1000 bp) at 100 V/cm via in-line staining and laser induced fluorescent end-point detection using an automated prototype. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Coilin is rapidly recruited to UVA-induced DNA lesions and γ-radiation affects localized movement of Cajal bodies.

    Science.gov (United States)

    Bártová, Eva; Foltánková, Veronika; Legartová, Soňa; Sehnalová, Petra; Sorokin, Dmitry V; Suchánková, Jana; Kozubek, Stanislav

    2014-01-01

    Cajal bodies are important nuclear structures containing proteins that preferentially regulate RNA-related metabolism. We investigated the cell-type specific nuclear distribution of Cajal bodies and the level of coilin, a protein of Cajal bodies, in non-irradiated and irradiated human tumor cell lines and embryonic stem (ES) cells. Cajal bodies were localized in different nuclear compartments, including DAPI-poor regions, in the proximity of chromocenters, and adjacent to nucleoli. The number of Cajal bodies per nucleus was cell cycle-dependent, with higher numbers occurring during G2 phase. Human ES cells contained a high coilin level in the nucleoplasm, but coilin-positive Cajal bodies were also identified in nuclei of mouse and human ES cells. Coilin, but not SMN, recognized UVA-induced DNA lesions, which was cell cycle-independent. Treatment with γ-radiation reduced the localized movement of Cajal bodies in many cell types and GFP-coilin fluorescence recovery after photobleaching was very fast in nucleoplasm in comparison with GFP-coilin recovery in DNA lesions. By contrast, nucleolus-localized coilin displayed very slow fluorescence recovery after photobleaching, which indicates very slow rates of protein diffusion, especially in nucleoli of mouse ES cells.

  2. Gold nanoparticle-based lateral flow biosensor for rapid visual detection of Leishmania-specific DNA amplification products.

    Science.gov (United States)

    Toubanaki, Dimitra K; Athanasiou, Evita; Karagouni, Evdokia

    2016-08-01

    Leishmaniasis is a disease, caused by Leishmania parasites, which infect humans and animals, posing a major social and economic burden worldwide. The need for accurate and sensitive disease diagnosis led to the widespread adoption of PCR amplification. Detection of the amplification products (i.e. gel electrophoresis) require time-consuming protocols performed by trained personnel, with high cost. Aim of the present study was the simplification of PCR product detection, using a nucleic acid lateral flow, combined with functionalized gold nanoparticles. Amplification reactions targeting kinetoplastid DNA of Leishmania spp were performed on canine blood samples and a positive signal was formed as a red test zone. The visual detection was completed in 20min. Extensive optimization enabled the detection of 100fmol of target DNA. Clinical samples of infected dog blood were analyzed with high specificity. Overall, the proposed lateral flow biosensor can be considered an appealing alternative platform for Leishmania-specific amplification products detection with low cost and attractive simplicity. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Development of a rapid method for identifying carryover contamination of positive control DNA, using a chimeric positive control and restriction enzyme for the diagnosis of white spot syndrome virus by nested PCR.

    Science.gov (United States)

    Kim, Hyoung Jun; Kwon, Se Ryun

    2014-12-01

    Chimeric positive plasmids have been developed to minimize false-positive reactions caused by polymerase chain reaction (PCR) contamination. Here, we developed a rapid method for identifying false-positive results while detecting white spot syndrome virus (WSSV) by nested PCR, using chimeric positive plasmids. The results of PCRs using WSSV diagnostic primer sets showed PCR products of a similar size (WSSV 1st PCR product, 1,447 bp; WSSV 2nd PCR product, 941 bp) using WSSV chimeric plasmids or DNA from shrimp infected with WSSV. The PCR products were digested with DraI for 1 h at 37 °C. The digested chimeric DNA separated into two DNA bands; however, the WSSV-infected shrimp DNA did not separate. Thus, chimeric plasmid DNA may be used as positive control DNA instead of DNA from WSSV-infected shrimp, in order to prevent PCR contamination. Thus, the use of restriction enzyme digestion allowed us to rapidly distinguish between WSSV DNA and WSSV chimeric plasmid DNA.

  4. Rapid One-Step Selection Method for Generating Nucleic Acid Aptamers: Development of a DNA Aptamer against alpha-Bungarotoxin

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Shamaileh, Hadi A.; Edwards, Stacey L.

    2012-01-01

    Background: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen (R), an inhibitor of vascular endothelial growth factor (VEGF......) for the treatment of age related macular degeneration (AMD). Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly...... in one-step, technique is required for developing aptamers in limited time period. Principal Findings: Herein, we present a simple one-step selection of DNA aptamers against alpha-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed...

  5. Rapid, Affordable, and Point-of-Care Water Monitoring Via a Microfluidic DNA Sensor and a Mobile Interface for Global Health.

    Science.gov (United States)

    Kim, Unyoung; Ghanbari, Sarah; Ravikumar, Anusha; Seubert, John; Figueira, Silvia

    2013-01-01

    Contaminated water is a serious concern in many developing countries with severe health consequences particularly for children. Current methods for monitoring waterborne pathogens are often time consuming, expensive, and labor intensive, making them not suitable for these regions. Electrochemical detection in a microfluidic platform offers many advantages such as portability, minimal use of instrumentation, and easy integration with electronics. In many parts of the world, however, the required equipment for pathogen detection through electrochemical sensors is either not available or insufficiently portable, and operators may not be trained to use these sensors and interpret results, ultimately preventing its wide adoption. Counterintuitively, these same regions often have an extensive mobile phone infrastructure, suggesting the possibility of integrating electrochemical detection of bacterial pathogens with a mobile platform. Toward a solution to water quality interventions, we demonstrate a microfluidic electrochemical sensor combined with a mobile interface that detects the sequences from bacterial pathogens, suitable for rapid, affordable, and point-of-care water monitoring. We employ the transduction of DNA hybridization into a readily detectable electric signal by means of a conformational change of DNA stem-loop structure. Using this platform, we successfully demonstrate the detection of as low as 100 nM E. coli sequences and the automatic interpretation and mapping of the detection results via a mobile application.

  6. Development of a rapid DNA extraction method and one-step nested PCR for the detection of Naegleria fowleri from the environment.

    Science.gov (United States)

    Ahmad, Arine Fadzlun; Lonnen, James; Andrew, Peter W; Kilvington, Simon

    2011-10-15

    Naegleria fowleri is a small free-living amoebo-flagellate found in natural and manmade thermal aquatic habitats worldwide. The organism is pathogenic to man causing fatal primary amoebic meningoencephalitis (PAM). Infection typically results from bathing in contaminated water and is usually fatal. It is, therefore, important to identify sites containing N. fowleri in the interests of preventive public health microbiology. Culture of environmental material is the conventional method for the isolation of N. fowleri but requires several days incubation and subsequent biochemical or molecular tests to confirm identification. Here, a nested one-step PCR test, in conjunction with a direct DNA extraction from water or sediment material, was developed for the rapid and reliable detection of N. fowleri from the environment. Here, the assay detected N, fowleri in 18/109 river water samples associated with a nuclear power plant in South West France and 0/10 from a similar site in the UK. Although culture of samples yielded numerous thermophilic free-living amoebae, none were N. fowleri or other thermophilic Naegleria spp. The availability of a rapid, reliable and sensitive one-step nested PCR method for the direct detection of N. fowleri from the environment may aid ecological studies and enable intervention to prevent PAM cases. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  7. Development of a rapid, simple, and specific real-time PCR assay for detection of pseudorabies viral DNA in domestic swine herds.

    Science.gov (United States)

    Sayler, Katherine A; Bigelow, Troy; Koster, Leo G; Swenson, Sabrina; Bounds, Courtney; Hernández, Felipe; Wisely, Samantha M

    2017-07-01

    Despite successful eradication of pseudorabies virus (PRV) from the commercial pig industry in the United States in 2004, large populations of feral swine in certain regions act as wildlife reservoirs for the virus. Given the threat of reintroduction of the virus into domestic herds, a rapid, reliable, easily implemented assay is needed for detection of PRV. Although a real-time PCR (rtPCR) assay exists, improvements in rtPCR technology and a greater understanding of the diversity of PRV strains worldwide require an assay that would be easier to implement, more cost effective, and more specific. We developed a single-tube, rapid rtPCR that is capable of detecting 10 copies of PRV glycoprotein B ( gB) DNA per 20-µL total volume reaction. The assay did not produce a false-positive in samples known to be negative for the virus. The assay was negative for genetically similar herpesviruses and other porcine viruses. Our assay is a highly specific and sensitive assay that is also highly repeatable and reproducible. The assay should be a useful tool for early detection of PRV in pigs in the case of a suspected introduction or outbreak situation.

  8. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Directory of Open Access Journals (Sweden)

    Stefano Minguzzi

    Full Text Available Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum' detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV in Prunus.

  9. Rapid genotyping of common MeCP2 mutations with an electronic DNA microchip using serial differential hybridization.

    Science.gov (United States)

    Thistlethwaite, William A; Moses, Linda M; Hoffbuhr, Kristen C; Devaney, Joseph M; Hoffman, Eric P

    2003-05-01

    Rett syndrome is a neurodevelopmental disorder that affects females almost exclusively, and in which eight common point mutations on the X-linked MeCP2 gene are knows to cause over 70% of mutation-positive cases. We explored the use of a novel platform to detect the eight common mutations in Rett syndrome patients to expedite and simplify the process of identification of known genotypes. The Nanogen workstation consists of a two-color assay based on electric hybridization and thermal discrimination, all performed on an electronically active NanoChip. This genotyping platform was tested on 362 samples of a pre-determined genotype, which had been previously identified by a combination of DHPLC (denaturing high performance liquid chromatography) and direct sequencing. This genotyping technique proved to be rapid, facile, and displayed a specificity of 100% with 3% ambiguity. In addition, we present consecutive testing of seven mutations on a single pad of the NanoChip. This was accomplished by tagging down two amplimers together and serially hybridizing for seven different loci, allowing us to genotype samples for seven of the eight common Rett mutations on a single pad. This novel method displayed the same level of specificity and accuracy as the single amplimer reactions, and proved to be faster and more economical.

  10. Rapid divergence of histones in Hydrozoa (Cnidaria) and evolution of a novel histone involved in DNA damage response in hydra.

    Science.gov (United States)

    Reddy, Puli Chandramouli; Ubhe, Suyog; Sirwani, Neha; Lohokare, Rasika; Galande, Sanjeev

    2017-08-01

    Histones are fundamental components of chromatin in all eukaryotes. Hydra, an emerging model system belonging to the basal metazoan phylum Cnidaria, provides an ideal platform to understand the evolution of core histone components at the base of eumetazoan phyla. Hydra exhibits peculiar properties such as tremendous regenerative capacity, lack of organismal senescence and rarity of malignancy. In light of the role of histone modifications and histone variants in these processes it is important to understand the nature of histones themselves and their variants in hydra. Here, we report identification of the complete repertoire of histone-coding genes in the Hydra magnipapillata genome. Hydra histones were classified based on their copy numbers, gene structure and other characteristic features. Genomic organization of canonical histone genes revealed the presence of H2A-H2B and H3-H4 paired clusters in high frequency and also a cluster with all core histones along with H1. Phylogenetic analysis of identified members of H2A and H2B histones suggested rapid expansion of these groups in Hydrozoa resulting in the appearance of unique subtypes. Amino acid sequence level comparisons of H2A and H2B forms with bilaterian counterparts suggest the possibility of a highly mobile nature of nucleosomes in hydra. Absolute quantitation of transcripts confirmed the high copy number of histones and supported the canonical nature of H2A. Furthermore, functional characterization of H2A.X.1 and a unique variant H2A.X.2 in the gastric region suggest their role in the maintenance of genome integrity and differentiation processes. These findings provide insights into the evolution of histones and their variants in hydra. Copyright © 2017 Elsevier GmbH. All rights reserved.

  11. Rapid MCNP simulation of DNA double strand break (DSB) relative biological effectiveness (RBE) for photons, neutrons, and light ions.

    Science.gov (United States)

    Stewart, Robert D; Streitmatter, Seth W; Argento, David C; Kirkby, Charles; Goorley, John T; Moffitt, Greg; Jevremovic, Tatjana; Sandison, George A

    2015-11-07

    To account for particle interactions in the extracellular (physical) environment, information from the cell-level Monte Carlo damage simulation (MCDS) for DNA double strand break (DSB) induction has been integrated into the general purpose Monte Carlo N-particle (MCNP) radiation transport code system. The effort to integrate these models is motivated by the need for a computationally efficient model to accurately predict particle relative biological effectiveness (RBE) in cell cultures and in vivo. To illustrate the approach and highlight the impact of the larger scale physical environment (e.g. establishing charged particle equilibrium), we examined the RBE for DSB induction (RBEDSB) of x-rays, (137)Cs γ-rays, neutrons and light ions relative to γ-rays from (60)Co in monolayer cell cultures at various depths in water. Under normoxic conditions, we found that (137)Cs γ-rays are about 1.7% more effective at creating DSB than γ-rays from (60)Co (RBEDSB  =  1.017) whereas 60-250 kV x-rays are 1.1 to 1.25 times more efficient at creating DSB than (60)Co. Under anoxic conditions, kV x-rays may have an RBEDSB up to 1.51 times as large as (60)Co γ-rays. Fission neutrons passing through monolayer cell cultures have an RBEDSB that ranges from 2.6 to 3.0 in normoxic cells, but may be as large as 9.93 for anoxic cells. For proton pencil beams, Monte Carlo simulations suggest an RBEDSB of about 1.2 at the tip of the Bragg peak and up to 1.6 a few mm beyond the Bragg peak. Bragg peak RBEDSB increases with decreasing oxygen concentration, which may create opportunities to apply proton dose painting to help address tumor hypoxia. Modeling of the particle RBE for DSB induction across multiple physical and biological scales has the potential to aid in the interpretation of laboratory experiments and provide useful information to advance the safety and effectiveness of hadron therapy in the treatment of cancer.

  12. cDNA cloning and chromosomal mapping of the mouse type VII collagen gene (Col7a1): Evidence for rapid evolutionary divergence of the gene

    Energy Technology Data Exchange (ETDEWEB)

    Li, Kehua; Christiano, A.M.; Chu, Mon Li; Uitto, J. (Jefferson Medical College, Philadelphia, PA (United States) Thomas Jefferson Univ., Philadelphia, PA (United States)); Copeland, N.G.; Gilbert, D.J. (NCI-Federick Cancer Research and Development Center, Federick, MD (United States))

    1993-06-01

    Type VII collagen is the major component of anchoring fibrils, critical attachment structures at the dermal-epidermal basement membrane zone. Genetic linkage analyses with recently cloned human type VII collagen cDNAs have indicated that the corresponding gene, COL7A1, is the candidate gene in the dystrophic forms of epidermolysis bullosa. To gain insight into the evolutionary conservation of COL7A1, in this study the authors have isolated mouse type VII collagen cDNAs by screening a mouse epidermal keratinocyte cDNA library with a human COL7A1 cDNA. Two overlapping mouse cDNAs were isolated, and Northern hybridization of mouse epidermal keratinocyte RNA with one of them revealed the presence of a mRNA transcript of [approximately]9.5 kb, the approximate size of the human COL7A1 mRNA. Nucleotide sequencing of the mouse cDNAs revealed a 2760-bp open reading frame that encodes the 5[prime] half of the collagenous domain and a segment of the NC-1, the noncollagenous amino-terminal domain of type VII collagen. Comparison of the mouse amino acid sequences with the corresponding human sequences deduced from cDNAs revealed 82.5% identity. The evolutionary divergence of the gene was relatively rapid in comparison to other collagen genes. Despite the high degree of sequence variation, several sequences, including the size and the position of noncollagenous imperfections and interruptions within the Gly-X-Y repeat sequence, were precisely conserved. Finally, the mouse Col7a1 gene was located by interspecific backcross mapping to mouse Chromosome 9, a region that corresponds to human chromosome 3p21, the position of human COL7Al. This assignment confirms and extends the relationship between the mouse and the human chromosomes in this region of the genome. 33 refs., 5 figs., 1 tab.

  13. High-level rapid production of full-size monoclonal antibodies in plants by a single-vector DNA replicon system.

    Science.gov (United States)

    Huang, Zhong; Phoolcharoen, Waranyoo; Lai, Huafang; Piensook, Khanrat; Cardineau, Guy; Zeitlin, Larry; Whaley, Kevin J; Arntzen, Charles J; Mason, Hugh S; Chen, Qiang

    2010-05-01

    Plant viral vectors have great potential in rapid production of important pharmaceutical proteins. However, high-yield production of hetero-oligomeric proteins that require the expression and assembly of two or more protein subunits often suffers problems due to the "competing" nature of viral vectors derived from the same virus. Previously we reported that a bean yellow dwarf virus (BeYDV)-derived, three-component DNA replicon system allows rapid production of single recombinant proteins in plants (Huang et al., 2009. Biotechnol Bioeng 103: 706-714). In this article, we report further development of this expression system for its application in high-yield production of oligomeric protein complexes including monoclonal antibodies (mAbs) in plants. We showed that the BeYDV replicon system permits simultaneous efficient replication of two DNA replicons and thus, high-level accumulation of two recombinant proteins in the same plant cell. We also demonstrated that a single vector that contains multiple replicon cassettes was as efficient as the three-component system in driving the expression of two distinct proteins. Using either the non-competing, three-vector system or the multi-replicon single vector, we produced both the heavy and light chain subunits of a protective IgG mAb 6D8 against Ebola virus GP1 (Wilson et al., 2000. Science 287: 1664-1666) at 0.5 mg of mAb per gram leaf fresh weight within 4 days post-infiltration of Nicotiana benthamiana leaves. We further demonstrated that full-size tetrameric IgG complex containing two heavy and two light chains was efficiently assembled and readily purified, and retained its functionality in specific binding to inactivated Ebola virus. Thus, our single-vector replicon system provides high-yield production capacity for hetero-oligomeric proteins, yet eliminates the difficult task of identifying non-competing virus and the need for co-infection of multiple expression modules. The multi-replicon vector represents a

  14. Description of a PCR-based technique for DNA splicing and mutagenesis by producing 5' overhangs with run through stop DNA synthesis utilizing Ara-C

    Directory of Open Access Journals (Sweden)

    Silverman Mel

    2005-09-01

    Full Text Available Abstract Background Splicing of DNA molecules is an important task in molecular biology that facilitates cloning, mutagenesis and creation of chimeric genes. Mutagenesis and DNA splicing techniques exist, some requiring restriction enzymes, and others utilize staggered reannealing approaches. Results A method for DNA splicing and mutagenesis without restriction enzymes is described. The method is based on mild template-dependent polymerization arrest with two molecules of cytosine arabinose (Ara-C incorporated into PCR primers. Two rounds of PCR are employed: the first PCR produces 5' overhangs that are utilized for DNA splicing. The second PCR is based on polymerization running through the Ara-C molecules to produce the desired final product. To illustrate application of the run through stop mutagenesis and DNA splicing technique, we have carried out splicing of two segments of the human cofilin 1 gene and introduced a mutational deletion into the product. Conclusion We have demonstrated the utility of a new PCR-based method for carrying out DNA splicing and mutagenesis by incorporating Ara-C into the PCR primers.

  15. A rapid method for the detection of foodborne pathogens by extraction of a trace amount of DNA from raw milk based on label-free amino-modified silica-coated magnetic nanoparticles and polymerase chain reaction

    Science.gov (United States)

    A method based on amino-modified silica-coated magnetic nanoparticles (ASMNPs) and polymerase chain reaction (PCR) was developed to rapidly and sensitively detect foodborne pathogens in raw milk. After optimizing parameters such as pH, temperature, and time, a trace amount of genomic DNA of pathogen...

  16. Development of a Rapid Point-of-Use DNA Test for the Screening of Genuity® Roundup Ready 2 Yield® Soybean in Seed Samples

    Directory of Open Access Journals (Sweden)

    Dilip Chandu

    2016-01-01

    Full Text Available Testing for the presence of genetically modified material in seed samples is of critical importance for all stakeholders in the agricultural industry, including growers, seed manufacturers, and regulatory bodies. While rapid antibody-based testing for the transgenic protein has fulfilled this need in the past, the introduction of new variants of a given transgene demands new diagnostic regimen that allows distinguishing different traits at the nucleic acid level. Although such molecular tests can be performed by PCR in the laboratory, their requirement for expensive equipment and sophisticated operation have prevented its uptake in point-of-use applications. A recently developed isothermal DNA amplification technique, recombinase polymerase amplification (RPA, combines simple sample preparation and amplification work-flow procedures with the use of minimal detection equipment in real time. Here, we report the development of a highly sensitive and specific RPA-based detection system for Genuity Roundup Ready 2 Yield (RR2Y material in soybean (Glycine max seed samples and present the results of studies applying the method in both laboratory and field-type settings.

  17. Genome-wide DNA methylation alterations of Alternanthera philoxeroides in natural and manipulated habitats: implications for epigenetic regulation of rapid responses to environmental fluctuation and phenotypic variation.

    Science.gov (United States)

    Gao, Lexuan; Geng, Yupeng; Li, Bo; Chen, Jiakuan; Yang, Ji

    2010-11-01

    Alternanthera philoxeroides (alligator weed) is an invasive weed that can colonize both aquatic and terrestrial habitats. Individuals growing in different habitats exhibit extensive phenotypic variation but little genetic differentiation in its introduced range. The mechanisms underpinning the wide range of phenotypic variation and rapid adaptation to novel and changing environments remain uncharacterized. In this study, we examined the epigenetic variation and its correlation with phenotypic variation in plants exposed to natural and manipulated environmental variability. Genome-wide methylation profiling using methylation-sensitive amplified fragment length polymorphism (MSAP) revealed considerable DNA methylation polymorphisms within and between natural populations. Plants of different source populations not only underwent significant morphological changes in common garden environments, but also underwent a genome-wide epigenetic reprogramming in response to different treatments. Methylation alterations associated with response to different water availability were detected in 78.2% (169/216) of common garden induced polymorphic sites, demonstrating the environmental sensitivity and flexibility of the epigenetic regulatory system. These data provide evidence of the correlation between epigenetic reprogramming and the reversible phenotypic response of alligator weed to particular environmental factors. © 2010 Blackwell Publishing Ltd.

  18. A simple and rapid PCR-based method to isolate complete small macronuclear minichromosomes from hypotrich ciliates: 5S rDNA and S26 ribosomal protein gene of Oxytricha (Sterkiella) nova.

    Science.gov (United States)

    Callejas, Sergio; Gutiérrez, Juan Carlos

    2002-06-01

    Hypotrich ciliates present a macronuclear genome consisting of gene-sized instead of chromosome-sized DNA molecules. Exploiting this unique eukaryotic genome feature, we introduce, for the first time in ciliates, a rapid and easy PCR method using telomeric primers to isolate small complete macronuclear DNA molecules or minichromosomes. Two presumably abundant macronuclear DNA molecules, containing ribosomal genes, were amplified from the Oxytricha (Sterkiella) nova complete genome after using this method, and then were cloned and sequenced. The 5S rDNA sequence of O. (S.) nova is the third one reported among hypotrich ciliates; its primary and secondary structure is compared with other eukaryotic 5S rRNAs. The ribosomal protein S26 gene is the first one reported among ciliates. This "End-End-PCR" method might be useful to obtain similar gene-sized macronuclear molecules from other hypotrich ciliates, and, therefore, to increase our knowledge on ribosomal genes in these eukaryotic microorganisms.

  19. A selective and label-free strategy for rapid screening of telomere-binding Ligands via fluorescence regulation of DNA/silver nanocluster

    National Research Council Canada - National Science Library

    Rui Cheng; Jing Xu; Xiafei Zhang; Zhilu Shi; Qi Zhang; Yan Jin

    2017-01-01

    Herein, the conformational switch of G-rich oligonucleotide (GDNA) demonstrated the obvious functional switch of GDNA which was found to significantly affect the fluorescence of the in-situ synthesized DNA/silver nanocluster (DNA-AgNC...

  20. Rapid radiation in spiny lobsters (Palinurus spp as revealed by classic and ABC methods using mtDNA and microsatellite data

    Directory of Open Access Journals (Sweden)

    Macpherson Enrique

    2009-11-01

    Full Text Available Abstract Background Molecular tools may help to uncover closely related and still diverging species from a wide variety of taxa and provide insight into the mechanisms, pace and geography of marine speciation. There is a certain controversy on the phylogeography and speciation modes of species-groups with an Eastern Atlantic-Western Indian Ocean distribution, with previous studies suggesting that older events (Miocene and/or more recent (Pleistocene oceanographic processes could have influenced the phylogeny of marine taxa. The spiny lobster genus Palinurus allows for testing among speciation hypotheses, since it has a particular distribution with two groups of three species each in the Northeastern Atlantic (P. elephas, P. mauritanicus and P. charlestoni and Southeastern Atlantic and Southwestern Indian Oceans (P. gilchristi, P. delagoae and P. barbarae. In the present study, we obtain a more complete understanding of the phylogenetic relationships among these species through a combined dataset with both nuclear and mitochondrial markers, by testing alternative hypotheses on both the mutation rate and tree topology under the recently developed approximate Bayesian computation (ABC methods. Results Our analyses support a North-to-South speciation pattern in Palinurus with all the South-African species forming a monophyletic clade nested within the Northern Hemisphere species. Coalescent-based ABC methods allowed us to reject the previously proposed hypothesis of a Middle Miocene speciation event related with the closure of the Tethyan Seaway. Instead, divergence times obtained for Palinurus species using the combined mtDNA-microsatellite dataset and standard mutation rates for mtDNA agree with known glaciation-related processes occurring during the last 2 my. Conclusion The Palinurus speciation pattern is a typical example of a series of rapid speciation events occurring within a group, with very short branches separating different species. Our

  1. A selective and label-free strategy for rapid screening of telomere-binding Ligands via fluorescence regulation of DNA/silver nanocluster

    Science.gov (United States)

    Cheng, Rui; Xu, Jing; Zhang, Xiafei; Shi, Zhilu; Zhang, Qi; Jin, Yan

    2017-03-01

    Herein, the conformational switch of G-rich oligonucleotide (GDNA) demonstrated the obvious functional switch of GDNA which was found to significantly affect the fluorescence of the in-situ synthesized DNA/silver nanocluster (DNA-AgNC) in homogeneous solution. We envisioned that the allosteric interaction between GDNA and DNA-AgNC would be possible to be used for screening telomere-binding ligands. A unimolecular probe (12C5TG) is ingeniously designed consisting of three contiguous DNA elements: G-rich telomeric DNA (GDNA) as molecular recognition sequence, T-rich DNA as linker and C-rich DNA as template of DNA-AgNC. The quantum yield and stability of 12C5TG-AgNC is greatly improved because the nearby deoxyguanosines tended to protect DNA/AgNC against oxidation. However, in the presence of ligands, the formation of G-quadruplex obviously quenched the fluorescence of DNA-AgNC. By taking full advantage of intramolecular allosteric effect, telomere-binding ligands were selectively and label-free screened by using deoxyguanines and G-quadruplex as natural fluorescence enhancer and quencher of DNA-AgNC respectively. Therefore, the functional switching of G-rich structure offers a cost-effective, facile and reliable way to screen drugs, which holds a great potential in bioanalysis as well.

  2. Structure of the Cpf1 endonuclease R-loop complex after target DNA cleavage.

    Science.gov (United States)

    Stella, Stefano; Alcón, Pablo; Montoya, Guillermo

    2017-06-22

    Cpf1 is an RNA-guided endonuclease that is emerging as a powerful genome-editing tool. Here we provide insight into its DNA-targeting mechanism by determining the structure of Francisella novicida Cpf1 with the triple-stranded R-loop generated after DNA cleavage. The structure reveals the machinery involved in DNA unwinding to form a CRISPR RNA (crRNA)-DNA hybrid and a displaced DNA strand. The protospacer adjacent motif (PAM) is recognized by the PAM-interacting domain. The loop-lysine helix-loop motif in this domain contains three conserved lysine residues that are inserted in a dentate manner into the double-stranded DNA. Unzipping of the double-stranded DNA occurs in a cleft arranged by acidic and hydrophobic residues facilitating the crRNA-DNA hybrid formation. The PAM single-stranded DNA is funnelled towards the nuclease site through a mixed hydrophobic and basic cavity. In this catalytic conformation, the PAM-interacting domain and the helix-loop-helix motif in the REC1 domain adopt a 'rail' shape and 'flap-on' conformations, respectively, channelling the PAM strand into the cavity. A steric barrier between the RuvC-II and REC1 domains forms the 'septum', separating the displaced PAM strand and the crRNA-DNA hybrid, avoiding DNA re-annealing. Mutations in key residues reveal a mechanism linking the PAM and DNA nuclease sites. Analysis of the Cpf1 structures proposes a singular working model of RNA-guided DNA cleavage, suggesting new avenues for redesign of Cpf1.

  3. Dietary restriction but not angiotensin II type 1 receptor blockade improves DNA damage-related vasodilator dysfunction in rapidly aging Ercc1Δ/- mice.

    NARCIS (Netherlands)

    Wu, Haiyan; van Thiel, Bibi S; Bautista-Niño, Paula K; Reiling, Erwin; Durik, Matej; Leijten, Frank P J; Ridwan, Yanto; Brandt, Renata M C; van Steeg, Harry; Dollé, Martijn E T; Vermeij, Wilbert P; Hoeijmakers, Jan H J; Essers, Jeroen; van der Pluijm, Ingrid; Danser, A H Jan; Roks, Anton J M

    2017-01-01

    DNA damage is an important contributor to endothelial dysfunction and age-related vascular disease. Recently, we demonstrated in a DNA repair-deficient, prematurely aging mouse model (Ercc1Δ/- mice) that dietary restriction (DR) strongly increases life- and health span, including ameliorating

  4. Direct immobilization of DNA probes on non-modified plastics by UV irradiation and integration in microfluidic devices for rapid bioassay

    DEFF Research Database (Denmark)

    Yi, Sun; Perch-Nielsen, Ivan R.; Dufva, Martin

    2012-01-01

    that simple UV irradiation can be used to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on many different types of plastics without any surface modification. On average, five- and fourfold improvement in immobilization and hybridization efficiency have been achieved compared to surface...... and parallel identification of Avian Influenza Virus by DNA hybridization. The one-step, cost-effective DNA-linking method on non-modified polymers significantly simplifies microarray fabrication procedures and permits great flexibility to plastic material selection, thus making it convenient to integrate...... microarrays into plastic microfluidic systems....

  5. Clinical utility of circulating DNA analysis for rapid detection of actionable mutations to select metastatic colorectal patients for anti-EGFR treatment.

    Science.gov (United States)

    Thierry, A R; El Messaoudi, S; Mollevi, C; Raoul, J L; Guimbaud, R; Pezet, D; Artru, P; Assenat, E; Borg, C; Mathonnet, M; De La Fouchardière, C; Bouché, O; Gavoille, C; Fiess, C; Auzemery, B; Meddeb, R; Lopez-Crapez, E; Sanchez, C; Pastor, B; Ychou, M

    2017-09-01

    While tumor-tissue remains the 'gold standard' for genetic analysis in cancer patients, it is challenged with the advent of circulating cell-free tumor DNA (ctDNA) analysis from blood samples. Here, we broaden our previous study on the clinical validation of plasma DNA in metastatic colorectal cancer patients, by evaluating its clinical utility under standard management care. Concordance and data turnaround-time of ctDNA when compared with tumor-tissue analysis were studied in a real-time blinded prospective multicenter clinical study (n = 140 metastatic colorectal patients). Results are presented according to STARD criteria and were discussed in regard with clinical outcomes of patients. Much more mutations were found by ctDNA analysis: 59%, 11.8% and 14.4% of the patients were found KRAS, NRAS and BRAF mutant by ctDNA analysis instead of 44%, 8.8% and 7.2% by tumor-tissue analysis. Median tumor-tissue data turnaround-time was 16 days while 2 days for ctDNA analysis. Discordant samples analysis revealed that use of biopsy, long delay between tumor-tissue and blood collection and resection of the tumor at time of blood draw, tumor site, or type of tissue analyzed seem to affect concordance. Altogether, the clinical data with respect to the anti-epidermal growth factor receptor response (RAS status) and the prognosis (BRAF status) of those discordant patients do not appear contradictory to the mutational status as determined by plasma analysis. Lastly, we present the first distribution profile of the RAS and BRAF hotspot mutations as determined by ctDNA analysis (n = 119), revealing a high proportion of patients with multiple mutations (45% of the population and up to 5 mutations) and only 24% of WT scored patients for both genes. Mutation profile as determined from ctDNA analysis with using various detection thresholds highlights the importance of the test sensitivity. Our study showed that ctDNA could replace tumor-tissue analysis, and also clinical

  6. Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps

    Directory of Open Access Journals (Sweden)

    Manjula Pandey

    2014-03-01

    Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.

  7. One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

    Science.gov (United States)

    Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

    2013-01-02

    Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

  8. Rapid decrease of circulating tumor DNA predicted the treatment effect of nivolumab in a lung cancer patient within only 5 days

    Directory of Open Access Journals (Sweden)

    Yuki Iijima

    2017-01-01

    Full Text Available A 77-year-old Japanese man presented to our hospital with a 1-month history of low back pain and was diagnosed as having stage IV EGFR mutation-positive lung adenocarcinoma. After treatment with EGFR tyrosine kinase inhibitor and cytotoxic chemotherapy, nivolumab was started as fourth-line therapy. Remarkable regression of the primary tumor was observed, suggesting high anti-tumor activity of nivolumab. We retrospectively investigated the change in circulating tumor DNA (ctDNA variant allele fractions in serial plasma samples before and after the nivolumab therapy. Targeted sequencing analysis showed tumor-derived TP53R249S and EGFRL858R mutations detectable in plasma, and the timing of decrease was only 5 days, much earlier than the appearance of radiological changes. Overall, these results suggest that ctDNA might reflect tumor burden and might be a surrogate marker of the therapeutic efficacy of immune checkpoint therapy.

  9. Application of subtracted gDNA microarray-assisted Bulked Segregant Analysis for rapid discovery of molecular markers associated with day-neutrality in strawberry (Fragaria x ananassa)

    Science.gov (United States)

    Gor, Mian Chee; Mantri, Nitin; Pang, Edwin

    2016-01-01

    A Fragaria Discovery Panel (FDP; strawberry-specific SDA) containing 287 features was constructed by subtracting the pooled gDNA of nine non-angiosperm species from the pooled gDNA of five strawberry genotypes. This FDP was used for Bulk Segregant Analysis (BSA) to enable identification of molecular markers associated with day-neutrality. Analysis of hybridisation patterns of a short day (SD) DNA bulk and three day-neutral (DN) DNA bulks varying in flowering strength allowed identification of a novel feature, FaP2E11, closely linked to CYTOKININ OXIDASE 1 (CKX1) gene possibly involved in promoting flowering under non-inductive condition. The signal intensities of FaP2E11 feature obtained from the strong DN bulk (DN1) is three fold higher than the short day bulk (SD), indicating that the putative marker may linked to a CKX1 variant allele with lower enzyme activity. We propose a model for flowering regulation based on the hypothesis that flowering strength may be regulated by the copy number of FaP2E11-linked CKX1 alleles. This study demonstrates the feasibility of the SDA-based BSA approach for the identification of molecular markers associated with day-neutrality in strawberry. This innovative strategy is an efficient and cost-effective approach for molecular marker discovery. PMID:27586242

  10. A Simple Oligonucleotide Biochip Capable of Rapidly Detecting Known Mitochondrial DNA Mutations in Chinese Patients with Leber’S Hereditary Optic Neuropathy (LHON)

    Science.gov (United States)

    Du, Wei-Dong; Chen, Gang; Cao, Hui-Min; Jin, Qing-Hui; Liao, Rong-Feng; He, Xiang-Cheng; Chen, Da-Ben; Huang, Shu-Ren; Zhao, Hui; Lv, Yong-Mei; Tang, Hua-Yang; Tang, Xian-Fa; Wang, Yong-Qing; Sun, Song; Zhao, Jian-Long; Zhang, Xue-Jun

    2011-01-01

    Leber's hereditary optic neuropathy (LHON) is a maternally transmitted disease. Clinically, no efficient assay protocols have been available. In this study, we aimed to develop an oligonucleotide biochip specialized for detection of known base substitution mutations in mitochondrial DNA causing LHON and to investigate frequencies of LHON relevant variants in Anhui region of China. Thirty-two pairs of oligonucleotide probes matched with the mutations potentially linked to LHON were covalently immobilized. Cy5-lablled targets were amplified from blood DNA samples by a multiplex PCR method. Two kinds of primary mutations 11778 G > A and 14484 T > C from six confirmed LHON patients were interrogated to validate this biochip format. Further, fourteen Chinese LHON pedigrees and twenty-five unrelated healthy individuals were investigated by the LHON biochip, direct sequencing and pyrosequencing, respectively. The biochip was found to be able efficiently to discriminate homoplasmic and heteroplasmic mtDNA mutations in LHON. Biochip analysis revealed that twelve of eighteen LHON symptomatic cases from the 14 Chinese pedigree harbored the mutations either 11778G > A, 14484T > C or 3460G > A, respectively, accounting for 66.7%. The mutation 11778G > A in these patients was homoplasmic and prevalent (55.5%, 10 of 18 cases). The mutations 3460G > A and 3394T > C were found to co-exist in one LHON case. The mutation 13708G > A appeared in one LHON pedigree. Smaller amount of sampling and reaction volume, easier target preparation, fast and high-throughput were the main advantages of the biochip over direct DNA sequencing and pyrosequencing. Our findings suggested that primary mutations of 11778G > A, 14484T > C or 3460G > A are main variants of mtDNA gene leading to LHON in China. The biochip would easily be implemented in clinical diagnosis. PMID:21694444

  11. A simple oligonucleotide biochip capable of rapidly detecting known mitochondrial DNA mutations in Chinese patients with Leber's hereditary optic neuropathy (LHON).

    Science.gov (United States)

    Du, Wei-Dong; Chen, Gang; Cao, Hui-Min; Jin, Qing-Hui; Liao, Rong-Feng; He, Xiang-Cheng; Chen, Da-Ben; Huang, Shu-Ren; Zhao, Hui; Lv, Yong-Mei; Tang, Hua-Yang; Tang, Xian-Fa; Wang, Yong-Qing; Sun, Song; Zhao, Jian-Long; Zhang, Xue-Jun

    2011-01-01

    Leber's hereditary optic neuropathy (LHON) is a maternally transmitted disease. Clinically, no efficient assay protocols have been available. In this study, we aimed to develop an oligonucleotide biochip specialized for detection of known base substitution mutations in mitochondrial DNA causing LHON and to investigate frequencies of LHON relevant variants in Anhui region of China. Thirty-two pairs of oligonucleotide probes matched with the mutations potentially linked to LHON were covalently immobilized. Cy5-lablled targets were amplified from blood DNA samples by a multiplex PCR method. Two kinds of primary mutations 11778 G > A and 14484 T > C from six confirmed LHON patients were interrogated to validate this biochip format. Further, fourteen Chinese LHON pedigrees and twenty-five unrelated healthy individuals were investigated by the LHON biochip, direct sequencing and pyrosequencing, respectively. The biochip was found to be able efficiently to discriminate homoplasmic and heteroplasmic mtDNA mutations in LHON. Biochip analysis revealed that twelve of eighteen LHON symptomatic cases from the 14 Chinese pedigree harbored the mutations either 11778G > A, 14484T > C or 3460G A, respectively, accounting for 66.7%. The mutation 11778G > A in these patients was homoplasmic and prevalent (55.5%, 10 of 18 cases). The mutations 3460G > A and 3394T > C were found to co-exist in one LHON case. The mutation 13708G > A appeared in one LHON pedigree. Smaller amount of sampling and reaction volume, easier target preparation, fast and high-throughput were the main advantages of the biochip over direct DNA sequencing and pyrosequencing. Our findings suggested that primary mutations of 11778G > A, 14484T > C or 3460G > A are main variants of mtDNA gene leading to LHON in China. The biochip would easily be implemented in clinical diagnosis.

  12. A Simple Oligonucleotide Biochip Capable of Rapidly Detecting Known Mitochondrial DNA Mutations in Chinese Patients with Leber’S Hereditary Optic Neuropathy (LHON

    Directory of Open Access Journals (Sweden)

    Wei-Dong Du

    2011-01-01

    Full Text Available Leber's hereditary optic neuropathy (LHON is a maternally transmitted disease. Clinically, no efficient assay protocols have been available. In this study, we aimed to develop an oligonucleotide biochip specialized for detection of known base substitution mutations in mitochondrial DNA causing LHON and to investigate frequencies of LHON relevant variants in Anhui region of China. Thirty-two pairs of oligonucleotide probes matched with the mutations potentially linked to LHON were covalently immobilized. Cy5-lablled targets were amplified from blood DNA samples by a multiplex PCR method. Two kinds of primary mutations 11778 G > A and 14484 T > C from six confirmed LHON patients were interrogated to validate this biochip format. Further, fourteen Chinese LHON pedigrees and twenty-five unrelated healthy individuals were investigated by the LHON biochip, direct sequencing and pyrosequencing, respectively. The biochip was found to be able efficiently to discriminate homoplasmic and heteroplasmic mtDNA mutations in LHON. Biochip analysis revealed that twelve of eighteen LHON symptomatic cases from the 14 Chinese pedigree harbored the mutations either 11778G > A, 14484T > C or 3460G > A, respectively, accounting for 66.7%. The mutation 11778G > A in these patients was homoplasmic and prevalent (55.5%, 10 of 18 cases. The mutations 3460G > A and 3394T > C were found to co-exist in one LHON case. The mutation 13708G > A appeared in one LHON pedigree. Smaller amount of sampling and reaction volume, easier target preparation, fast and high-throughput were the main advantages of the biochip over direct DNA sequencing and pyrosequencing. Our findings suggested that primary mutations of 11778G > A, 14484T > C or 3460G > A are main variants of mtDNA gene leading to LHON in China. The biochip would easily be implemented in clinical diagnosis.

  13. Rapid and Simultaneous Detection of Mycobacterium tuberculosis Complex and Beijing/W Genotype in Sputum by an Optimized DNA Extraction Protocol and a Novel Multiplex Real-Time PCR ▿

    Science.gov (United States)

    Leung, Eric T. Y.; Zheng, L.; Wong, Rity Y. K.; Chan, Edward W. C.; Au, T. K.; Chan, Raphael C. Y.; Lui, Grace; Lee, Nelson; Ip, Margaret

    2011-01-01

    Rapid diagnosis and genotyping of Mycobacterium tuberculosis by molecular methods are often limited by the amount and purity of DNA extracted from body fluids. In this study, we evaluated 12 DNA extraction methods and developed a highly sensitive protocol for mycobacterial DNA extraction directly from sputa using surface-coated magnetic particles. We have also developed a novel multiplex real-time PCR for simultaneous identification of M. tuberculosis complex and the Beijing/W genotype (a hypervirulent sublineage of M. tuberculosis) by using multiple fluorogenic probes targeting both the M. tuberculosis IS6110 and the Rv0927c-pstS3 intergenic region. With reference strains and clinical isolates, our real-time PCR accurately identified 20 non-Beijing/W and 20 Beijing/W M. tuberculosis strains from 17 different species of nontuberculosis Mycobacterium (NTM). Further assessment of our DNA extraction protocol and real-time PCR with 335 nonduplicate sputum specimens correctly identified all 74 M. tuberculosis culture-positive specimens. In addition, 15 culture-negative specimens from patients with confirmed tuberculosis were also identified. No cross-reactivity was detected with NTM specimens (n = 31). The detection limit of the assay is 10 M. tuberculosis bacilli, as determined by endpoint dilution analysis. In conclusion, an optimized DNA extraction protocol coupled with a novel multiprobe multiplex real-time PCR for the direct detection of M. tuberculosis, including Beijing/W M. tuberculosis, was found to confer high sensitivity and specificity. The combined procedure has the potential to compensate for the drawbacks of conventional mycobacterial culture in routine clinical laboratory setting, such as the lengthy incubation period and the limitation to viable organisms. PMID:21593264

  14. Rapid, sensitive, and selective fluorescent DNA detection using iron-based metal-organic framework nanorods: Synergies of the metal center and organic linker.

    Science.gov (United States)

    Tian, Jingqi; Liu, Qian; Shi, Jinle; Hu, Jianming; Asiri, Abdullah M; Sun, Xuping; He, Yuquan

    2015-09-15

    Considerable recent attention has been paid to homogeneous fluorescent DNA detection with the use of nanostructures as a universal "quencher", but it still remains a great challenge to develop such nanosensor with the benefits of low cost, high speed, sensitivity, and selectivity. In this work, we report the use of iron-based metal-organic framework nanorods as a high-efficient sensing platform for fluorescent DNA detection. It only takes about 4 min to complete the whole "mix-and-detect" process with a low detection limit of 10 pM and a strong discrimination of single point mutation. Control experiments reveal the remarkable sensing behavior is a consequence of the synergies of the metal center and organic linker. This work elucidates how composition control of nanostructures can significantly impact their sensing properties, enabling new opportunities for the rational design of functional materials for analytical applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene

    DEFF Research Database (Denmark)

    Candiloro, Ida Lm; Mikeska, Thomas; Hokland, Peter

    2008-01-01

    MS-HRM) that involves the amplification of single templates after limiting dilution to quantify and to determine the degree of methylation. We used this approach to study methylation of the CDKN2B (p15) cell cycle progression inhibitor gene which is inactivated by DNA methylation in haematological malignancies...... and other heterogeneously methylated genes. It eliminates both PCR and cloning bias towards either methylated or unmethylated DNA. Potentially complex information is simplified into a digital output, allowing counting of methylated and unmethylated alleles and providing an overall picture of methylation...... at the given locus. Downstream sequencing is minimised as dMS-HRM acts as a screen to select only methylated clones for further analysis....

  16. Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

    Science.gov (United States)

    Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

    2015-12-01

    Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

  17. Multiplex PCR provides a low-cost alternative to DNA probe methods for rapid identification of Mycobacterium avium and Mycobacterium intracellulare.

    OpenAIRE

    Cousins, D; Francis, B; Dawson, D

    1996-01-01

    A multiplex PCR designed to differentiate Mycobacterium tuberculosis complex organisms from M. avium and M. intracellulare was used to test 105 isolates identified by DNA probe methods as M. avium, M. intracellulare, or M. avium complex type X. The multiple PCR correctly identified 33 of 34 isolates identified by commercial probe methods as M. avium and all 51 isolates identified as M. intracellulare. The 20 isolates identified as M. avium complex type X by probe were identified as Mycobacter...

  18. Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

    Directory of Open Access Journals (Sweden)

    Decai Tuo

    2015-12-01

    Full Text Available Papaya leaf distortion mosaic virus (PLDMV is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV. The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA, was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

  19. Rapid assessment of repair of ultraviolet DNA damage with a modified host-cell reactivation assay using a luciferase reporter gene and correlation with polymorphisms of DNA repair genes in normal human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Qiao Yawei; Spitz, Margaret R.; Guo Zhaozheng; Hadeyati, Mohammad; Grossman, Lawrence; Kraemer, Kenneth H.; Wei Qingyi

    2002-11-30

    As DNA repair plays an important role in genetic susceptibility to cancer, assessment of the DNA repair phenotype is critical for molecular epidemiological studies of cancer. In this report, we compared use of the luciferase (luc) reporter gene in a host-cell reactivation (HCR) (LUC) assay of repair of ultraviolet (UV) damage to DNA to use of the chloramphenicol (cat) gene-based HCR (CAT) assay we used previously for case-control studies. We performed both the assays on cryopreserved lymphocytes from 102 healthy non-Hispanic white subjects. There was a close correlation between DNA repair capacity (DRC) as measured by the LUC and CAT assays. Although these two assays had similar variation, the LUC assay was faster and more sensitive. We also analyzed the relationship between DRC and the subjects' previously determined genotypes for four polymorphisms of two nucleotide-excision repair (NER) genes (in intron 9 of xeroderma pigmentosum (XP) C and exons 6, 10 and 23 of XPD) and one polymorphism of a base-excision repair gene in exon 10 of X-ray complementing group 1 (XRCC1). The DRC was significantly lower in subjects homozygous for one or more polymorphisms of the two NER genes than in subjects with other genotypes (P=0.010). In contrast, the polymorphic XRCC1 allele had no significant effect on DRC. These results suggest that the post-UV LUC assay measures NER phenotype and that polymorphisms of XPC and XPD genes modulate DRC. For population studies of the DNA repair phenotype, many samples need to be evaluated, and so the LUC assay has several advantages over the CAT assay: the LUC assay was more sensitive, had less variation, was not radioactive, was easier to perform, and required fewer cryopreserved cells. These features make the LUC-based HCR assay suitable for molecular epidemiological studies.

  20. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  1. Dual-probe electrochemical DNA biosensor based on the "Y" junction structure and restriction endonuclease assisted cyclic enzymatic amplification for detection of double-strand DNA of PML/RARα related fusion gene.

    Science.gov (United States)

    Wang, Kun; Lei, Yun; Zhong, Guang-Xian; Zheng, Yan-Jie; Sun, Zhou-Liang; Peng, Hua-Ping; Chen, Wei; Liu, Ai-Lin; Chen, Yuan-Zhong; Lin, Xin-Hua

    2015-09-15

    Taking advantage of "Y" junction structure and restriction endonuclease assisted cyclic enzymatic amplification, a dual-probe electrochemical DNA (DE-DNA) biosensor was designed to detect double-stranded DNA (dsDNA) of acute promyelocytic leukemia (APL) related gene. Two groups of detection probes were designed, and each group was composed of a biotinylated capture probe and an assisted probe. They were separately complementary with two strands of target dsDNA in order to prevent the reannealing of the two separate strands from target dsDNA. First, thiol functionalized capture probes (C1 and C2) were severally assembled onto two different gold electrodes, followed by hybridizing with target dsDNA (S1a-S1b) and assistant probes to form two Y-junction-structure ternary complexes. Subsequently, restriction sites on the ternary complexes were digested by Rsa I, which can release S1a, S1b and biotins from the electrode surfaces. Meanwhile, the released S1a and S1b can further hybridize with the unhybridized corresponding detection probes and then initiate another new hybridization-cleavage-separation cycle. Finally, the current signals were produced by the enzyme-catalyzed reaction of streptavidin-horse reddish peroxidase (streptavidin-HRP). The distinct difference in current signals between different sequences allowed detection of target dsDNA down to a low detection limit of 47 fM and presented excellent specificity with discriminating only a single-base mismatched dsDNA sequence. Moreover, this biosensor was also used for assay of polymerase chain reaction (PCR) samples with satisfactory results. According to the results, the power of the DE-DNA biosensor as a promising tool for the detection of APL and other diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Ethidium Bromide Modifies The Agarose Electrophoretic Mobility of CAG•CTG Alternative DNA Structures Generated by PCR

    Directory of Open Access Journals (Sweden)

    Mário Gomes-Pereira

    2017-05-01

    Full Text Available The abnormal expansion of unstable simple sequence DNA repeats can cause human disease through a variety of mechanisms, including gene loss-of-function, toxic gain-of-function of the encoded protein and toxicity of the repeat-containing RNA transcript. Disease-associated unstable DNA repeats display unusual biophysical properties, including the ability to adopt non-B-DNA structures. CAG•CTG trinucleotide sequences, in particular, have been most extensively studied and they can fold into slipped-stranded DNA structures, which have been proposed as mutation intermediates in repeat size expansion. Here, we describe a simple assay to detect unusual DNA structures generated by PCR amplification, based on their slow electrophoretic migration in agarose and on the effects of ethidium bromide on the mobility of structural isoforms through agarose gels. Notably, the inclusion of ethidium bromide in agarose gels and running buffer eliminates the detection of additional slow-migrating DNA species, which are detected in the absence of the intercalating dye and may be incorrectly classified as mutant alleles with larger than actual expansion sizes. Denaturing and re-annealing experiments confirmed the slipped-stranded nature of the additional DNA species observed in agarose gels. Thus, we have shown that genuine non-B-DNA conformations are generated during standard PCR amplification of CAG•CTG sequences and detected by agarose gel electrophoresis. In contrast, ethidium bromide does not change the multi-band electrophoretic profiles of repeat-containing PCR products through native polyacrylamide gels. These data have implications for the analysis of trinucleotide repeat DNA and possibly other types of unstable repetitive DNA sequences by standard agarose gel electrophoresis in diagnostic and research protocols. We suggest that proper sizing of CAG•CTG PCR products in agarose gels should be performed in the presence of ethidium bromide.

  3. Ethidium Bromide Modifies The Agarose Electrophoretic Mobility of CAG•CTG Alternative DNA Structures Generated by PCR.

    Science.gov (United States)

    Gomes-Pereira, Mário; Monckton, Darren G

    2017-01-01

    The abnormal expansion of unstable simple sequence DNA repeats can cause human disease through a variety of mechanisms, including gene loss-of-function, toxic gain-of-function of the encoded protein and toxicity of the repeat-containing RNA transcript. Disease-associated unstable DNA repeats display unusual biophysical properties, including the ability to adopt non-B-DNA structures. CAG•CTG trinucleotide sequences, in particular, have been most extensively studied and they can fold into slipped-stranded DNA structures, which have been proposed as mutation intermediates in repeat size expansion. Here, we describe a simple assay to detect unusual DNA structures generated by PCR amplification, based on their slow electrophoretic migration in agarose and on the effects of ethidium bromide on the mobility of structural isoforms through agarose gels. Notably, the inclusion of ethidium bromide in agarose gels and running buffer eliminates the detection of additional slow-migrating DNA species, which are detected in the absence of the intercalating dye and may be incorrectly classified as mutant alleles with larger than actual expansion sizes. Denaturing and re-annealing experiments confirmed the slipped-stranded nature of the additional DNA species observed in agarose gels. Thus, we have shown that genuine non-B-DNA conformations are generated during standard PCR amplification of CAG•CTG sequences and detected by agarose gel electrophoresis. In contrast, ethidium bromide does not change the multi-band electrophoretic profiles of repeat-containing PCR products through native polyacrylamide gels. These data have implications for the analysis of trinucleotide repeat DNA and possibly other types of unstable repetitive DNA sequences by standard agarose gel electrophoresis in diagnostic and research protocols. We suggest that proper sizing of CAG•CTG PCR products in agarose gels should be performed in the presence of ethidium bromide.

  4. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  5. Rapid isolation of microsatellite DNAs and identification of polymorphic mitochondrial DNA regions in the fish rotan (Perccottus glenii) invading European Russia

    Science.gov (United States)

    King, Timothy L.; Eackles, Michael S.; Reshetnikov, Andrey N.

    2015-01-01

    Human-mediated translocations and subsequent large-scale colonization by the invasive fish rotan (Perccottus glenii Dybowski, 1877; Perciformes, Odontobutidae), also known as Amur or Chinese sleeper, has resulted in dramatic transformations of small lentic ecosystems. However, no detailed genetic information exists on population structure, levels of effective movement, or relatedness among geographic populations of P. glenii within the European part of the range. We used massively parallel genomic DNA shotgun sequencing on the semiconductor-based Ion Torrent Personal Genome Machine (PGM) sequencing platform to identify nuclear microsatellite and mitochondrial DNA sequences in P. glenii from European Russia. Here we describe the characterization of nine nuclear microsatellite loci, ascertain levels of allelic diversity, heterozygosity, and demographic status of P. glenii collected from Ilev, Russia, one of several initial introduction points in European Russia. In addition, we mapped sequence reads to the complete P. glenii mitochondrial DNA sequence to identify polymorphic regions. Nuclear microsatellite markers developed for P. glenii yielded sufficient genetic diversity to: (1) produce unique multilocus genotypes; (2) elucidate structure among geographic populations; and (3) provide unique perspectives for analysis of population sizes and historical demographics. Among 4.9 million filtered P. glenii Ion Torrent PGM sequence reads, 11,304 mapped to the mitochondrial genome (NC_020350). This resulted in 100 % coverage of this genome to a mean coverage depth of 102X. A total of 130 variable sites were observed between the publicly available genome from China and the studied composite mitochondrial genome. Among these, 82 were diagnostic and monomorphic between the mitochondrial genomes and distributed among 15 genome regions. The polymorphic sites (N = 48) were distributed among 11 mitochondrial genome regions. Our results also indicate that sequence reads generated

  6. ex vivo DNA assembly

    Directory of Open Access Journals (Sweden)

    Adam B Fisher

    2013-10-01

    Full Text Available Even with decreasing DNA synthesis costs there remains a need for inexpensive, rapid and reliable methods for assembling synthetic DNA into larger constructs or combinatorial libraries. Advances in cloning techniques have resulted in powerful in vitro and in vivo assembly of DNA. However, monetary and time costs have limited these approaches. Here, we report an ex vivo DNA assembly method that uses cellular lysates derived from a commonly used laboratory strain of Escherichia coli for joining double-stranded DNA with short end homologies embedded within inexpensive primers. This method concurrently shortens the time and decreases costs associated with current DNA assembly methods.

  7. Application of a Novel and Automated Branched DNA in Situ Hybridization Method for the Rapid and Sensitive Localization of mRNA Molecules in Plant Tissues

    Directory of Open Access Journals (Sweden)

    Andrew J. Bowling

    2014-04-01

    Full Text Available Premise of the study: A novel branched DNA detection technology, RNAscope in situ hybridization (ISH, originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. Methods and Results: Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC and phosphoenolpyruvate carboxykinase (PEPCK. Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. Conclusions: RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.

  8. Application of a novel and automated branched DNA in situ hybridization method for the rapid and sensitive localization of mRNA molecules in plant tissues.

    Science.gov (United States)

    Bowling, Andrew J; Pence, Heather E; Church, Jeffrey B

    2014-04-01

    A novel branched DNA detection technology, RNAscope in situ hybridization (ISH), originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. • Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE) and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC) and phosphoenolpyruvate carboxykinase (PEPCK). Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. • RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.

  9. The comet assay as a rapid test in biomonitoring occupational exposure to DNA-damaging agents and effect of confounding factors

    DEFF Research Database (Denmark)

    Møller, P; Knudsen, Lisbeth E.; Loft, S

    2000-01-01

    Within the last decade, the comet assay has been used with increasing popularity to investigate the level of DNA damage in terms of strand breaks and alkaline labile sites in biomonitoring studies. The assay is easily performed on WBCs and has been included in a wide range of biomonitoring studies...... appeared to have less power than the positive studies. Also, there were poor dose-response relationships in many of the biomonitoring studies. Many factors have been reported to produce effects by the comet assay, e.g., age, air pollution exposure, diet, exercise, gender, infection, residential radon...... exposure, smoking, and season. Until now, the use of the comet assay has been hampered by the uncertainty of the influence of confounding factors. We argue that none of the confounding factors are unequivocally positive in the majority of the studies. We recommend that age, gender, and smoking status...

  10. A streamlined collecting and preparation protocol for DNA barcoding of Lepidoptera as part of large-scale rapid biodiversity assessment projects, exemplified by the Indonesian Biodiversity Discovery and Information System (IndoBioSys).

    Science.gov (United States)

    Schmidt, Olga; Hausmann, Axel; Cancian de Araujo, Bruno; Sutrisno, Hari; Peggie, Djunijanti; Schmidt, Stefan

    2017-01-01

    Here we present a general collecting and preparation protocol for DNA barcoding of Lepidoptera as part of large-scale rapid biodiversity assessment projects, and a comparison with alternative preserving and vouchering methods. About 98% of the sequenced specimens processed using the present collecting and preparation protocol yielded sequences with more than 500 base pairs. The study is based on the first outcomes of the Indonesian Biodiversity Discovery and Information System (IndoBioSys). IndoBioSys is a German-Indonesian research project that is conducted by the Museum für Naturkunde in Berlin and the Zoologische Staatssammlung München, in close cooperation with the Research Center for Biology - Indonesian Institute of Sciences (RCB-LIPI, Bogor).

  11. Evidence for genetic association between East Asian and western North American Crataegus L. (Rosaceae) and rapid divergence of the eastern North American lineages based on multiple DNA sequences.

    Science.gov (United States)

    Lo, Eugenia Y Y; Stefanović, Sasa; Christensen, Knud Ib; Dickinson, Timothy A

    2009-05-01

    Phylogeographic relationships were constructed for 72 Old and New World Crataegus species using combinations of four chloroplast and up to five nuclear regions. Maximum parsimony, maximum likelihood, and Bayesian results yield consistent relationships among major lineages. The close associations of the East Asian and western North American species point toward ancient trans-Beringian migrations. Relationships among eastern North American species are poorly resolved and few groups are identified that are congruent with existing classifications. Scant variation and short internal branches among these species suggest rapid divergence associated with polyploidy and hybridization. Incongruence between the chloroplast and nuclear data, and morphology suggest hybrid origins of three species from an extinct European lineage (the male parent) and three different North American female parents. Europe and eastern North America are suggested as the most recent common areas for Crataegus; at least four dispersal events are inferred to explain the present distribution of the genus.

  12. Mechanisms of Action of Escapin, a Bactericidal Agent in the Ink Secretion of the Sea Hare Aplysia californica: Rapid and Long-Lasting DNA Condensation and Involvement of the OxyR-Regulated Oxidative Stress Pathway

    Science.gov (United States)

    Ko, Ko-Chun; Tai, Phang C.

    2012-01-01

    The marine snail Aplysia californica produces escapin, an l-amino acid oxidase, in its defensive ink. Escapin uses l-lysine to produce diverse products called escapin intermediate products of l-lysine (EIP-K), including α-amino-ε-caproic acid, Δ1-piperidine-2-carboxylic acid, and Δ2-piperidine-2-carboxylic acid. EIP-K and H2O2 together, but neither alone, is a powerful bactericide. Here, we report bactericidal mechanisms of escapin products on Escherichia coli. We show that EIP-K and H2O2 together cause rapid and long-lasting DNA condensation: 2-min treatment causes significant DNA condensation and killing, and 10-min treatment causes maximal effect, lasting at least 70 h. We isolated two mutants resistant to EIP-K plus H2O2, both having a single missense mutation in the oxidation regulatory gene, oxyR. A complementation assay showed that the mutated gene, oxyR(A233V), renders resistance to EIP-K plus H2O2, and a gene dosage effect leads to reduction of resistance for strains carrying wild-type oxyR. Temperature stress with EIP-K does not produce the bactericidal effect, suggesting the effect is due to a specific response to oxidative stress. The null mutant for any single DNA-binding protein—Dps, H-NS, Hup, Him, or MukB—was not resistant to EIP-K plus H2O2, suggesting that no single DNA-binding protein is necessary to mediate this bactericidal effect, but allowing for the possibility that EIP-K plus H2O2 could function through a combination of DNA-binding proteins. The bactericidal effect of EIP-K plus H2O2 was eliminated by the ferrous ion chelator 1,10-phenanthroline, and it was reduced by the hydroxyl radical scavenger thiourea, suggesting hydroxyl radicals mediate the effects of EIP-K plus H2O2. PMID:22232273

  13. Evaluation of genetic diversity in Chinese kale (Brassica oleracea L. var. alboglabra Bailey) by using rapid amplified polymorphic DNA and sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Zhang, J; Zhang, L G

    2014-02-14

    Chinese kale is an original Chinese vegetable of the Cruciferae family. To select suitable parents for hybrid breeding, we thoroughly analyzed the genetic diversity of Chinese kale. Random amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) molecular markers were used to evaluate the genetic diversity across 21 Chinese kale accessions from AVRDC and Guangzhou in China. A total of 104 bands were detected by 11 RAPD primers, of which 66 (63.5%) were polymorphic, and 229 polymorphic bands (68.4%) were observed in 335 bands amplified by 17 SRAP primer combinations. The dendrogram showed the grouping of the 21 accessions into 4 main clusters based on RAPD data, and into 6 clusters based on SRAP and combined data (RAPD + SRAP). The clustering of accessions based on SRAP data was consistent with petal colors. The Mantel test indicated a poor fit for the RAPD and SRAP data (r = 0.16). These results have an important implication for Chinese kale germplasm characterization and improvement.

  14. Target-responsive DNA hydrogel mediated "stop-flow" microfluidic paper-based analytic device for rapid, portable and visual detection of multiple targets.

    Science.gov (United States)

    Wei, Xiaofeng; Tian, Tian; Jia, Shasha; Zhu, Zhi; Ma, Yanli; Sun, Jianjun; Lin, Zhenyu; Yang, Chaoyong James

    2015-04-21

    A versatile point-of-care assay platform was developed for simultaneous detection of multiple targets based on a microfluidic paper-based analytic device (μPAD) using a target-responsive hydrogel to mediate fluidic flow and signal readout. An aptamer-cross-linked hydrogel was used as a target-responsive flow regulator in the μPAD. In the absence of a target, the hydrogel is formed in the flow channel, stopping the flow in the μPAD and preventing the colored indicator from traveling to the final observation spot, thus yielding a "signal off" readout. In contrast, in the presence of a target, no hydrogel is formed because of the preferential interaction of target and aptamer. This allows free fluidic flow in the μPAD, carrying the indicator to the observation spot and producing a "signal on" readout. The device is inexpensive to fabricate, easy to use, and disposable after detection. Testing results can be obtained within 6 min by the naked eye via a simple loading operation without the need for any auxiliary equipment. Multiple targets, including cocaine, adenosine, and Pb(2+), can be detected simultaneously, even in complex biological matrices such as urine. The reported method offers simple, low cost, rapid, user-friendly, point-of-care testing, which will be useful in many applications.

  15. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  16. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Science.gov (United States)

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

  17. Penile/anal condylomas and squamous cell cancer. A HPV DNA hybridization study.

    Science.gov (United States)

    Löning, T; Riviere, A; Henke, R P; von Preyss, S; Dörner, A

    1988-01-01

    Acuminate condylomas from the penis (n = 17) and anus (six cases), three anal/penile giant condylomas, anal Bowen's disease (four cases), and intraanal squamous cell carcinomas with associated condylomatous changes (10 cases) including two verrucous carcinoma were studied for human papillomavirus (HPV) infections with nick translated, biotinylated cDNA probes for HPV 6, 11, 16 and 18. In addition, six cases of flat white penile lesions designated as lichen sclerosus et atrophicus were examined. Reannealed complementary DNA strands were detected in situ with either immunoenzyme or immunogold protocols. The in situ hybridizations resulted in 1/6 positive penile lichenoid lesions, 12/17 positive penile acuminate condylomas, 6/6 positive anal acuminate condylomas (including two condylomas with cellular atypias), 2/3 positive giant condylomas, 1/4 positive anal bowenoid lesions, and 4/10 positive keratinized squamous cell carcinomas, two of them being verrucous carcinomas. All penile/anal condylomas and two giant condylomas harboured HPV 6 and/or 11 DNA. The five positive carcinomas (carcinoma in situ/invasive cancer) contained HPV 6 and/or 11 in two cases (including the verrucous carcinomas), and HPV 16 and/or 18 in three cases (one carcinoma in situ, two invasive carcinomas). Recurrent malignancies were seen in one case to harbour the same HPV type as the primary lesions (HPV 16). In one particular patient, a double infection with HPV 16 and HPV 18 was demonstrated in distantly located malignant tumours. Our study confirms the restrictions and the value of non-isotopic hybridization methods applied to archival tissues, and extends the knowledge on the presence and distribution of HPV infections at anogenital sites.

  18. Rapid HLA class I DNA typing using microtiter plate-reverse hybridization assay (MRHA) by simple thermoregulation: high-resolution subtyping of the HLA-A2 and -B40 antigen groups.

    Science.gov (United States)

    Moribe, T; Kaneshige, T; Inagawa, A; Nakatani, S; Hirai, H; Morita, F; Ito, Y; Inoko, H

    1999-06-01

    We have established a precise, rapid, simple and economical subtyping method for alleles encoding the HLA-A2 and -B40 antigens using microtiter plate-reverse hybridization assay (MRHA), which is based on the general principle of HLA oligotyping by reverse dot blot hybridization. Amino-modified sequence-specific oligonucleotide (SSO) probes were immobilized covalently onto a carboxylate-modified microtiter plate. In order to perform high-resolution subtyping of the HLA-A2 and -B40 antigen groups, the alpha1 and alpha2 domain regions were amplified using a pair of group-specific primers composed of an unlabeled sense primer and a biotinylated antisense primer. PCR-amplified products were hybridized with SSO probes in hybridization buffer containing formamide for 1 hour at 37 degrees C. After washing with 2 X SSC at room temperature, the bound PCR products were detected by alkaline phosphatase-conjugated streptavidine followed by color development. All of 8 HLA-B40 suballeles, all of 2 HLA-B47 suballeles (B40 group-specific primers used in this study allowed also B47 amplification) and 17 out of 21 HLA-A2 suballeles were discriminated. The remaining four HLA-A2 suballeles were determined by analysis after exon 4 amplification. HLA-DNA typing by this method was easily and exactly performed regardless of sample number. The greatest advantages of this technique are strong positive signals obtained, reproducibility and the ease of thermoregulation for hybridization and washing as compared to previously reported microtiter plate hybridization methods.

  19. Rapid Prototyping

    Science.gov (United States)

    1999-01-01

    Javelin, a Lone Peak Engineering Inc. Company has introduced the SteamRoller(TM) System as a commercial product. The system was designed by Javelin during a Phase II NASA funded small commercial product. The purpose of the invention was to allow automated-feed of flexible ceramic tapes to the Laminated Object Manufacturing rapid prototyping equipment. The ceramic material that Javelin was working with during the Phase II project is silicon nitride. This engineered ceramic material is of interest for space-based component.

  20. Sanger dideoxy sequencing of DNA.

    Science.gov (United States)

    Walker, Sarah E; Lorsch, Jon

    2013-01-01

    While the ease and reduced cost of automated DNA sequencing has largely obviated the need for manual dideoxy sequencing for routine purposes, specific applications require manual DNA sequencing. For instance, in studies of enzymes or proteins that bind or modify DNA, a DNA ladder is often used to map the site at which an enzyme is bound or a modification occurs. In these cases, the Sanger method for dideoxy sequencing provides a rapid and facile method for producing a labeled DNA ladder. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

    Science.gov (United States)

    Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

    2017-02-01

    The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

  2. DNA origami: the art of folding DNA.

    Science.gov (United States)

    Saccà, Barbara; Niemeyer, Christof M

    2012-01-02

    The advent of DNA origami technology greatly simplified the design and construction of nanometer-sized DNA objects. The self-assembly of a DNA-origami structure is a straightforward process in which a long single-stranded scaffold (often from the phage M13mp18) is folded into basically any desired shape with the help of a multitude of short helper strands. This approach enables the ready generation of objects with an addressable surface area of a few thousand nm(2) and with a single "pixel" resolution of about 6 nm. The process is rapid, puts low demands on experimental conditions, and delivers target products in high yields. These features make DNA origami the method of choice in structural DNA nanotechnology when two- and three-dimensional objects are desired. This Minireview summarizes recent advances in the design of DNA origami nanostructures, which open the door to numerous exciting applications. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Rapid quantitative PCR assays for the simultaneous detection of herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and human herpesvirus 6 DNA in blood and other clinical specimens

    NARCIS (Netherlands)

    Engelmann, I.; Petzold, D. R.; Kosinska, A.; Hepkema, B. G.; Schulz, T. F.; Heim, A.

    Rapid diagnosis of human herpesvirus primary infections or reactivations is facilitated by quantitative PCRs. Quantitative PCR assays with a standard thermal cycling profile permitting simultaneous detection of herpes simplex virus (HSV), varicella zoster virus (VZV), cytomegalovirus (CMV),

  4. Visual DNA -- identification of DNA sequence variations by bead trapping.

    Science.gov (United States)

    Ståhl, Patrik L; Gantelius, Jesper; Natanaelsson, Christian; Ahmadian, Afshin; Andersson-Svahn, Helene; Lundeberg, Joakim

    2007-12-01

    In this paper we describe a method that uses the nearly covalent strength biotin-streptavidin interaction to attach a paramagnetic bead of micrometer size to a DNA molecule of nanometer size, scaling up the spatial size of a query DNA strand by a factor of 1000, making it visible to the human eye. The use of magnetic principles enables rapid binding and washing of detector beads, facilitating a readout of amplified DNA sequences in a few minutes. Here we exemplify the method on mitochondrial DNA variations using an array platform. Visual identification and documentation can be performed with an ordinary mobile phone equipped with a built-in camera.

  5. Mitochondrial DNA.

    Science.gov (United States)

    Wright, Russell G.; Bottino, Paul J.

    1986-01-01

    Provides background information for teachers on mitochondrial DNA, pointing out that it may have once been a free-living organism. Includes a ready-to-duplicate exercise titled "Using Microchondrial DNA to Measure Evolutionary Distance." (JN)

  6. A dnaN Plasmid Shuffle Strain for Rapid In Vivo Analysis of Mutant Escherichia coli β Clamps Provides Insight Into the Role of Clamp in umuDC-Mediated Cold Sensitivity

    Science.gov (United States)

    Babu, Vignesh M. P.; Sutton, Mark D.

    2014-01-01

    The E. coli umuDC gene products participate in two temporally distinct roles: UmuD2C acts in a DNA damage checkpoint control, while UmuD'2C, also known as DNA polymerase V (Pol V), catalyzes replication past DNA lesions via a process termed translesion DNA synthesis. These different roles of the umuDC gene products are managed in part by the dnaN-encoded β sliding clamp protein. Co-overexpression of the β clamp and Pol V severely blocked E. coli growth at 30°C. We previously used a genetic assay that was independent of the ability of β clamp to support E. coli viability to isolate 8 mutant clamp proteins (βQ61K, βS107L, βD150N, βG157S, βV170M, βE202K, βM204K and βP363S) that failed to block growth at 30°C when co-overexpressed with Pol V. It was unknown whether these mutant clamps were capable of supporting E. coli viability and normal umuDC functions in vivo. The goals of this study were to answer these questions. To this end, we developed a novel dnaN plasmid shuffle assay. Using this assay, βD150N and βP363S were unable to support E. coli viability. The remaining 6 mutant clamps, each of which supported viability, were indistinguishable from β+ with respect to umuDC functions in vivo. In light of these findings, we analyzed phenotypes of strains overexpressing either β clamp or Pol V alone. The strain overexpressing β+, but not those expressing mutant β clamps, displayed slowed growth irrespective of the incubation temperature. Moreover, growth of the Pol V-expressing strain was modestly slowed at 30°, but not 42°C. Taken together, these results suggest the mutant clamps were identified due to their inability to slow growth rather than an inability to interact with Pol V. They further suggest that cold sensitivity is due, at least in part, to the combination of their individual effects on growth at 30°C. PMID:24896652

  7. Human RAD52 Captures and Holds DNA Strands, Increases DNA Flexibility, and Prevents Melting of Duplex DNA: Implications for DNA Recombination

    Directory of Open Access Journals (Sweden)

    Ineke Brouwer

    2017-03-01

    Full Text Available Human RAD52 promotes annealing of complementary single-stranded DNA (ssDNA. In-depth knowledge of RAD52-DNA interaction is required to understand how its activity is integrated in DNA repair processes. Here, we visualize individual fluorescent RAD52 complexes interacting with single DNA molecules. The interaction with ssDNA is rapid, static, and tight, where ssDNA appears to wrap around RAD52 complexes that promote intra-molecular bridging. With double-stranded DNA (dsDNA, interaction is slower, weaker, and often diffusive. Interestingly, force spectroscopy experiments show that RAD52 alters the mechanics dsDNA by enhancing DNA flexibility and increasing DNA contour length, suggesting intercalation. RAD52 binding changes the nature of the overstretching transition of dsDNA and prevents DNA melting, which is advantageous for strand clamping during or after annealing. DNA-bound RAD52 is efficient at capturing ssDNA in trans. Together, these effects may help key steps in DNA repair, such as second-end capture during homologous recombination or strand annealing during RAD51-independent recombination reactions.

  8. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  9. Photochemical Acceleration of DNA Strand Displacement by Using Ultrafast DNA Photo-crosslinking.

    Science.gov (United States)

    Nakamura, Shigetaka; Hashimoto, Hirokazu; Kobayashi, Satoshi; Fujimoto, Kenzo

    2017-10-18

    DNA strand displacement is an essential reaction in genetic recombination, biological processes, and DNA nanotechnology. In particular, various DNA nanodevices enable complicated calculations. However, it takes time before the output is obtained, so acceleration of DNA strand displacement is required for a rapid-response DNA nanodevice. Herein, DNA strand displacement by using DNA photo-crosslinking to accelerate this displacement is evaluated. The DNA photo-crosslinking of 3-cyanovinylcarbazole ( CNV K) was accelerated at least 20 times, showing a faster DNA strand displacement. The rate of photo-crosslinking is a key factor and the rate of DNA strand displacement is accelerated through ultrafast photo-crosslinking. The rate of DNA strand displacement was regulated by photoirradiation energy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. The future of forensic DNA analysis

    Science.gov (United States)

    Butler, John M.

    2015-01-01

    The author's thoughts and opinions on where the field of forensic DNA testing is headed for the next decade are provided in the context of where the field has come over the past 30 years. Similar to the Olympic motto of ‘faster, higher, stronger’, forensic DNA protocols can be expected to become more rapid and sensitive and provide stronger investigative potential. New short tandem repeat (STR) loci have expanded the core set of genetic markers used for human identification in Europe and the USA. Rapid DNA testing is on the verge of enabling new applications. Next-generation sequencing has the potential to provide greater depth of coverage for information on STR alleles. Familial DNA searching has expanded capabilities of DNA databases in parts of the world where it is allowed. Challenges and opportunities that will impact the future of forensic DNA are explored including the need for education and training to improve interpretation of complex DNA profiles. PMID:26101278

  11. Making the bend: DNA tertiary structure and protein-DNA interactions.

    Science.gov (United States)

    Harteis, Sabrina; Schneider, Sabine

    2014-07-14

    DNA structure functions as an overlapping code to the DNA sequence. Rapid progress in understanding the role of DNA structure in gene regulation, DNA damage recognition and genome stability has been made. The three dimensional structure of both proteins and DNA plays a crucial role for their specific interaction, and proteins can recognise the chemical signature of DNA sequence ("base readout") as well as the intrinsic DNA structure ("shape recognition"). These recognition mechanisms do not exist in isolation but, depending on the individual interaction partners, are combined to various extents. Driving force for the interaction between protein and DNA remain the unique thermodynamics of each individual DNA-protein pair. In this review we focus on the structures and conformations adopted by DNA, both influenced by and influencing the specific interaction with the corresponding protein binding partner, as well as their underlying thermodynamics.

  12. DNA glue

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  13. DNA Vaccines

    Indian Academy of Sciences (India)

    research interests include: eukaryotic gene expres- sion and infectious diseases. Keywords. DNA vaccine, immune response, antibodies, infectious diseases. GENERAL I ... T -cells: Lymphocytes that differentiate primarily in the thymus and are central to the control and ... enhance DNA delivery into skeletal muscle.

  14. Template preparation for rapid PCR in Colletotrichum lindemuthianum

    Directory of Open Access Journals (Sweden)

    Roca M. Gabriela

    2003-01-01

    Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.

  15. Rapid identification of the medicinal plant Taraxacum formosanum ...

    African Journals Online (AJOL)

    Rapid identification of the medicinal plant Taraxacum formosanum and distinguishing of this plant from its adulterants by ribosomal DNA internal transcribed spacer (ITS) based DNA barcode. YC Chiang, WT Chang, MD Chen, GH Lai, HJ Chen, J Chao, MK Lin, YS Chang, YM Chou, MS Lee, MS Lee ...

  16. Binary DNA Nanostructures for Data Encryption

    OpenAIRE

    Halvorsen, Ken; Wong, Wesley P.

    2012-01-01

    We present a simple and secure system for encrypting and decrypting information using DNA self-assembly. Binary data is encoded in the geometry of DNA nanostructures with two distinct conformations. Removing or leaving out a single component reduces these structures to an encrypted solution of ssDNA, whereas adding back this missing "decryption key" causes the spontaneous formation of the message through self-assembly, enabling rapid read out via gel electrophoresis. Applications include auth...

  17. Binary DNA nanostructures for data encryption.

    Science.gov (United States)

    Halvorsen, Ken; Wong, Wesley P

    2012-01-01

    We present a simple and secure system for encrypting and decrypting information using DNA self-assembly. Binary data is encoded in the geometry of DNA nanostructures with two distinct conformations. Removing or leaving out a single component reduces these structures to an encrypted solution of ssDNA, whereas adding back this missing "decryption key" causes the spontaneous formation of the message through self-assembly, enabling rapid read out via gel electrophoresis. Applications include authentication, secure messaging, and barcoding.

  18. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  19. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  20. DNA data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  1. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  2. DNA Chip

    Indian Academy of Sciences (India)

    involved in the pathology of schizophrenia. In the human ge- nome, the ratio between coding and non-coding DNA is very low (less than 3% of the human .... construction of a Tm-specific chip, i.e. all the oligos/cDNA on the chip will hybridize at the same temperature. The techniques available are still not able to create a chip ...

  3. A quick DNA extraction protocol: Without liquid nitrogen in ambient ...

    African Journals Online (AJOL)

    Marker assisted selection is an effective technique for quality traits selection in breeding program which are impossible by visual observation. Marker assisted selection in early generation requires rapid DNA extraction protocol for large number of samples in a low cost approach. A rapid and inexpensive DNA extraction ...

  4. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  5. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  6. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  7. DNA vaccines for aquacultured fish

    DEFF Research Database (Denmark)

    Lorenzen, Niels; LaPatra, S.E.

    2005-01-01

    Deoxyribonucleic acid (DNA) vaccination is based on the administration of the gene encoding the vaccine antigen, rather than the antigen itself. Subsequent expression of the antigen by cells in the vaccinated hosts triggers the host immune system. Among the many experimental DNA vaccines tested...... in various animal species as well as in humans, the vaccines against rhabdovirus diseases in fish have given some of the most promising results. A single intramuscular (IM) injection of microgram amounts of DNA induces rapid and long-lasting protection in farmed salmonids against economically important...... viruses such as infectious haematopoietic necrosis virus (IHNV) and viral haemorrhagic septicaemia virus (VHSV). DNA vaccines against other types of fish pathogens, however, have so far had limited success. The most efficient delivery route at present is IM injection, and suitable delivery strategies...

  8. Leaf storage conditions and genomic DNA isolation efficiency in ...

    African Journals Online (AJOL)

    SERVER

    African Journal of Biotechnology Vol. 7 (5), pp. 557-564, 4 March, 2008 ... Storage of plant tissues for DNA is important to avoid degradation of DNA. Preliminary studies were conducted on Ocimum gratissimum L. in ..... A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acid Res.

  9. Mitochondrial DNA analysis of two Southern African indigenous ...

    African Journals Online (AJOL)

    1998-03-20

    Mar 20, 1998 ... chondrial DNA (mtDNA) has been found to be extremely useful in assessing genetic relationships between closely related species as a result of the mode of inheritance, its rapid mutation rate and lack of recombination (Brown et al., 1979). ln a number of studies, the mtDNA of cattle has been investigated.

  10. Fungal DNA barcoding.

    Science.gov (United States)

    Xu, Jianping

    2016-11-01

    Fungi are ubiquitous in both natural and human-made environments. They play important roles in the health of plants, animals, and humans, and in broad ecosystem functions. Thus, having an efficient species-level identification system could significantly enhance our ability to treat fungal diseases and to monitor the spatial and temporal patterns of fungal distributions and migrations. DNA barcoding is a potent approach for rapid identification of fungal specimens, generating novel species hypothesis, and guiding biodiversity and ecological studies. In this mini-review, I briefly summarize (i) the history of DNA sequence-based fungal identification; (ii) the emergence of the ITS region as the consensus primary fungal barcode; (iii) the use of the ITS barcodes to address a variety of issues on fungal diversity from local to global scales, including generating a large number of species hypothesis; and (iv) the problems with the ITS barcode region and the approaches to overcome these problems. Similar to DNA barcoding research on plants and animals, significant progress has been achieved over the last few years in terms of both the questions being addressed and the foundations being laid for future research endeavors. However, significant challenges remain. I suggest three broad areas of research to enhance the usefulness of fungal DNA barcoding to meet the current and future challenges: (i) develop a common set of primers and technologies that allow the amplification and sequencing of all fungi at both the primary and secondary barcode loci; (ii) compile a centralized reference database that includes all recognized fungal species as well as species hypothesis, and allows regular updates from the research community; and (iii) establish a consensus set of new species recognition criteria based on barcode DNA sequences that can be applied across the fungal kingdom.

  11. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  12. Mitogenomic analyses from ancient DNA.

    Science.gov (United States)

    Paijmans, Johanna L A; Gilbert, M Thomas P; Hofreiter, Michael

    2013-11-01

    The analysis of ancient DNA is playing an increasingly important role in conservation genetic, phylogenetic and population genetic analyses, as it allows incorporating extinct species into DNA sequence trees and adds time depth to population genetics studies. For many years, these types of DNA analyses (whether using modern or ancient DNA) were largely restricted to the analysis of short fragments of the mitochondrial genome. However, due to many technological advances during the past decade, a growing number of studies have explored the power of complete mitochondrial genome sequences (mitogenomes). Such studies were initially limited to analyses of extant organisms, but developments in both DNA sequencing technologies and general methodological aspects related to working with degraded DNA have resulted in complete mitogenomes becoming increasingly popular for ancient DNA studies as well. To date, at least 124 partially or fully assembled mitogenomes from more than 20 species have been obtained, and, given the rapid progress in sequencing technology, this number is likely to dramatically increase in the future. The increased information content offered by analysing full mitogenomes has yielded major progress with regard to both the phylogenetic positions of extinct species, as well as resolving population genetics questions in both extinct and extant species. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Monitoring endangered freshwater biodiversity using environmental DNA

    DEFF Research Database (Denmark)

    Thomsen, Philip Francis; Kielgast, Jos; Iversen, Lars Lønsmann

    2012-01-01

    that depend on practical and taxonomic expertise, which is rapidly declining. Here, we show that a diversity of rare and threatened freshwater animals-representing amphibians, fish, mammals, insects and crustaceans-can be detected and quantified based on DNA obtained directly from small water samples of lakes...... of amphibians and fish can be detected by high-throughput sequencing of DNA extracted from pond water. Our findings underpin the ubiquitous nature of DNA traces in the environment and establish environmental DNA as a tool for monitoring rare and threatened species across a wide range of taxonomic groups....

  14. Rapid and highly fieldable viral diagnostic

    Energy Technology Data Exchange (ETDEWEB)

    McKnight, Timothy E.

    2016-12-20

    The present invention relates to a rapid, highly fieldable, nearly reagentless diagnostic to identify active RNA viral replication in a live, infected cells, and more particularly in leukocytes and tissue samples (including biopsies and nasal swabs) using an array of a plurality of vertically-aligned nanostructures that impale the cells and introduce a DNA reporter construct that is expressed and amplified in the presence of active viral replication.

  15. Simultaneous elimination of carryover contamination and detection of DNA with uracil-DNA-glycosylase-supplemented loop-mediated isothermal amplification (UDG-LAMP).

    Science.gov (United States)

    Hsieh, Kuangwen; Mage, Peter L; Csordas, Andrew T; Eisenstein, Michael; Soh, H Tom

    2014-04-11

    We report a one-pot, closed-vessel enzymatic assay that eliminates carryover contamination while preserving robust DNA amplification in loop-mediated isothermal amplification (LAMP), providing reliable and rapid detection of target DNA in contaminated samples.

  16. Rapid Prototyping Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — The ARDEC Rapid Prototyping (RP) Laboratory was established in December 1992 to provide low cost RP capabilities to the ARDEC engineering community. The Stratasys,...

  17. Logic Gate Operation by DNA Translocation through Biological Nanopores.

    Directory of Open Access Journals (Sweden)

    Hiroki Yasuga

    Full Text Available Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs "1" and "0" as single-stranded DNA (ssDNA that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment.

  18. Logic Gate Operation by DNA Translocation through Biological Nanopores.

    Science.gov (United States)

    Yasuga, Hiroki; Kawano, Ryuji; Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji

    2016-01-01

    Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs "1" and "0" as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment.

  19. Rapid genetic detection of ingested Amanita phalloides.

    Science.gov (United States)

    Gausterer, Christian; Penker, Martina; Krisai-Greilhuber, Irmgard; Stein, Christina; Stimpfl, Thomas

    2014-03-01

    Mushrooms are often poorly digested by humans. Thus, their remains (tissues, spores) may persist in the gastrointestinal tract and can be detected in feces several days after mushroom consumption. In this report, we present protocols for the rapid PCR-based detection of fungal traces in a variety of complex samples. Novel primers were designed to amplify portions of ribosomal DNA from deadly poisonous European members of the genus Amanita, namely the death cap (A. phalloides), the destroying angel (A. virosa) and the fool's mushroom (A. verna), respectively. Assay sensitivity was sufficient to discover diluted DNA traces in amounts below the genomic content of a single target mushroom cell. Specificity testing was performed with DNA extracts from a variety of mushroom species. Template amplification was exclusively observed with intended targets and it was not compromised by a vast excess of non-target DNA (i.e. DNA from human and human fecal origin, respectively). A series of experiments was conducted with prepared specimens in order to follow the course of mushroom food processing and digestion. Amplification by direct PCR was successful with raw, fried and digested mixed mushrooms. To improve assay performance with fecal samples, a rapid protocol for sample pre-processing (including water-ether sedimentation and bead beating) and a modified PCR reaction mix were applied. Thereby, it was possible to detect the presence of A. phalloides DNA in spiked feces as well as in clinical samples (vomit, stool) from two independent cases of suspected mushroom poisoning. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  20. Innate immune recognition of DNA: A recent history.

    Science.gov (United States)

    Dempsey, Alan; Bowie, Andrew G

    2015-05-01

    Innate immune DNA sensing underpins many physiological and pathological responses to DNA, including anti-viral immunity to DNA viruses. Although it has been appreciated for many years that cytosolic DNA can evoke a type I interferon response, it is only within the past decade that the cellular mechanisms responsible for such a response have been defined. Here we review the discoveries that led to an appreciation of the existence of cytosolic DNA sensor proteins, and discuss two key such sensors, cGAS and IFI16, in detail. DNA sensors operate via STING, a protein shown to have a central role in controlling altered gene induction in response to DNA in vivo, and as such to be central to a rapidly expanding list of both protective and harmful responses to DNA. We also discuss recent insights into how and when DNA stimulates innate immunity, and highlight current outstanding questions in the DNA sensing field. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Efficient DNA ligation in DNA–RNA hybrid helices by Chlorella virus DNA ligase

    Science.gov (United States)

    Lohman, Gregory J. S.; Zhang, Yinhua; Zhelkovsky, Alexander M.; Cantor, Eric J.; Evans, Thomas C.

    2014-01-01

    Single-stranded DNA molecules (ssDNA) annealed to an RNA splint are notoriously poor substrates for DNA ligases. Herein we report the unexpectedly efficient ligation of RNA-splinted DNA by Chlorella virus DNA ligase (PBCV-1 DNA ligase). PBCV-1 DNA ligase ligated ssDNA splinted by RNA with kcat ≈ 8 x 10−3 s−1 and KM DNA ligase produced only 5′-adenylylated DNA with a 20-fold lower kcat and a KM ≈ 300 nM. The rate of ligation increased with addition of Mn2+, but was strongly inhibited by concentrations of NaCl >100 mM. Abortive adenylylation was suppressed at low ATP concentrations (8, leading to increased product yields. The ligation reaction was rapid for a broad range of substrate sequences, but was relatively slower for substrates with a 5′-phosphorylated dC or dG residue on the 3′ side of the ligation junction. Nevertheless, PBCV-1 DNA ligase ligated all sequences tested with 10-fold less enzyme and 15-fold shorter incubation times than required when using T4 DNA ligase. Furthermore, this ligase was used in a ligation-based detection assay system to show increased sensitivity over T4 DNA ligase in the specific detection of a target mRNA. PMID:24203707

  2. Estimation of Fish Biomass Using Environmental DNA

    Science.gov (United States)

    Takahara, Teruhiko; Minamoto, Toshifumi; Yamanaka, Hiroki; Doi, Hideyuki; Kawabata, Zen'ichiro

    2012-01-01

    Environmental DNA (eDNA) from aquatic vertebrates has recently been used to estimate the presence of a species. We hypothesized that fish release DNA into the water at a rate commensurate with their biomass. Thus, the concentration of eDNA of a target species may be used to estimate the species biomass. We developed an eDNA method to estimate the biomass of common carp (Cyprinus carpio L.) using laboratory and field experiments. In the aquarium, the concentration of eDNA changed initially, but reached an equilibrium after 6 days. Temperature had no effect on eDNA concentrations in aquaria. The concentration of eDNA was positively correlated with carp biomass in both aquaria and experimental ponds. We used this method to estimate the biomass and distribution of carp in a natural freshwater lagoon. We demonstrated that the distribution of carp eDNA concentration was explained by water temperature. Our results suggest that biomass data estimated from eDNA concentration reflects the potential distribution of common carp in the natural environment. Measuring eDNA concentration offers a non-invasive, simple, and rapid method for estimating biomass. This method could inform management plans for the conservation of ecosystems. PMID:22563411

  3. The impact of impaired DNA damage responses on cells, tissues and organisms

    NARCIS (Netherlands)

    Yi, Xia

    2007-01-01

    Current cancer therapies rely mainly on DNA damaging insults (irradiation, DNA alkylating agents, DNA synthesis inhibitors etc.). The rationale behind these treatments is that rapidly growing cancer cells suffer more from DNA damaging insults. Unfortunately, the majority of current therapies fail to

  4. Rapid Airplane Parametric Input Design (RAPID)

    Science.gov (United States)

    Smith, Robert E.

    1995-01-01

    RAPID is a methodology and software system to define a class of airplane configurations and directly evaluate surface grids, volume grids, and grid sensitivity on and about the configurations. A distinguishing characteristic which separates RAPID from other airplane surface modellers is that the output grids and grid sensitivity are directly applicable in CFD analysis. A small set of design parameters and grid control parameters govern the process which is incorporated into interactive software for 'real time' visual analysis and into batch software for the application of optimization technology. The computed surface grids and volume grids are suitable for a wide range of Computational Fluid Dynamics (CFD) simulation. The general airplane configuration has wing, fuselage, horizontal tail, and vertical tail components. The double-delta wing and tail components are manifested by solving a fourth order partial differential equation (PDE) subject to Dirichlet and Neumann boundary conditions. The design parameters are incorporated into the boundary conditions and therefore govern the shapes of the surfaces. The PDE solution yields a smooth transition between boundaries. Surface grids suitable for CFD calculation are created by establishing an H-type topology about the configuration and incorporating grid spacing functions in the PDE equation for the lifting components and the fuselage definition equations. User specified grid parameters govern the location and degree of grid concentration. A two-block volume grid about a configuration is calculated using the Control Point Form (CPF) technique. The interactive software, which runs on Silicon Graphics IRIS workstations, allows design parameters to be continuously varied and the resulting surface grid to be observed in real time. The batch software computes both the surface and volume grids and also computes the sensitivity of the output grid with respect to the input design parameters by applying the precompiler tool

  5. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Nucleotide sequence (5′ to 3′). Length product Restriction enzyme Restriction fragment. Las/I-F. ATGATCGTACAAATTGGTCGG. 600 bp. EcoRI. 400 - 200 bp. Las/I-R. GTCATGAAACCGCCATG proper results in the next molecular processes such as. PCR (Neumann et al., 1992; Bahl and Pfenninger,.

  6. Rapid shallow breathing

    Science.gov (United States)

    ... the smallest air passages of the lungs in children ( bronchiolitis ) Pneumonia or other lung infection Transient tachypnea of the newborn Anxiety and panic Other serious lung disease Home Care Rapid, shallow breathing should not be treated at home. It is ...

  7. Rapid Strep Test

    Science.gov (United States)

    ... worse than normal. Your first thoughts turn to strep throat. A rapid strep test in your doctor’s office ... your suspicions.Viruses cause most sore throats. However, strep throat is an infection caused by the Group A ...

  8. The use of mitochondrial DNA (mtDNA-investigations in Forensic Sciences

    Directory of Open Access Journals (Sweden)

    S. Dawson

    1996-07-01

    Full Text Available A variety of methods was developed to characterize mtDNA. The initial aim of these techniques was to try and link diseases with specific mitochondrial defects. As a result of the maternal inheritance trait of mtDNA these techniques facilitate studies of the phylogenetic history and population structure of the human population. It has been shown that mitochondrial DNA typing can be of great value for human identification in forensic cases. The identification of victims of mass-disasters or mass-murders, where human remains can be recovered only after many years have passed, is one of the most challenging fields of forensic identification. By using automated DNA sequencing with fluorescent labels, mitochondrial DNA sequences can be generated rapidly and accurately. Computer software facilitates the rapid comparison of individual and reference sequences.

  9. RAPID3? Aptly named!

    Science.gov (United States)

    Berthelot, J-M

    2014-01-01

    The RAPID3 score is the sum of three 0-10 patient self-report scores: pain, functional impairment on MDHAQ, and patient global estimate. It requires 5 seconds for scoring and can be used in all rheumatologic conditions, although it has mostly been used in rheumatoid arthritis where cutoffs for low disease activity (12/30) have been set. A RAPID3 score of ≤ 3/30 with 1 or 0 swollen joints (RAPID3 ≤ 3 + ≤ SJ1) provides remission criteria comparable to Boolean, SDAI, CDAI, and DAS28 remission criteria, in far less time than a formal joint count. RAPID3 performs as well as the DAS28 in separating active drugs from placebos in clinical trials. RAPID3 also predicts subsequent structural disease progression. RAPID3 can be determined at short intervals at home, allowing the determination of the area under the curve of disease activity between two visits and flare detection. However, RAPID3 should not be seen as a substitute for DAS28 and face to face visits in routine care. Monitoring patient status with only self-report information without a rheumatologist's advice (including joints and physical examination, and consideration of imaging and laboratory tests) may indeed be as undesirable for most patients than joint examination without a patient questionnaire. Conversely, combining the RAPID3 and the DAS28 may consist in faster or more sensitive confirmation that a medication is effective. Similarly, better enquiring of most important concerns of patients (pain, functional status and overall opinion on their disorder) should reinforces patients' confidence in their rheumatologist and treatments.

  10. DNA dosimetry assessment for sunscreen genotoxic photoprotection.

    Directory of Open Access Journals (Sweden)

    André Passaglia Schuch

    Full Text Available BACKGROUND: Due to the increase of solar ultraviolet radiation (UV incidence over the last few decades, the use of sunscreen has been widely adopted for skin protection. However, considering the high efficiency of sunlight-induced DNA lesions, it is critical to improve upon the current approaches that are used to evaluate protection factors. An alternative approach to evaluate the photoprotection provided by sunscreens against daily UV radiation-induced DNA damage is provided by the systematic use of a DNA dosimeter. METHODOLOGY/PRINCIPAL FINDINGS: The Sun Protection Factor for DNA (DNA-SPF is calculated by using specific DNA repair enzymes, and it is defined as the capacity for inhibiting the generation of cyclobutane pyrimidine dimers (CPD and oxidised DNA bases compared with unprotected control samples. Five different commercial brands of sunscreen were initially evaluated, and further studies extended the analysis to include 17 other products representing various formulations and Sun Protection Factors (SPF. Overall, all of the commercial brands of SPF 30 sunscreens provided sufficient protection against simulated sunlight genotoxicity. In addition, this DNA biosensor was useful for rapidly screening the biological protection properties of the various sunscreen formulations. CONCLUSIONS/SIGNIFICANCE: The application of the DNA dosimeter is demonstrated as an alternative, complementary, and reliable method for the quantification of sunscreen photoprotection at the level of DNA damage.

  11. DNA Dosimetry Assessment for Sunscreen Genotoxic Photoprotection

    Science.gov (United States)

    Schuch, André Passaglia; Lago, Juliana Carvalhães; Yagura, Teiti; Menck, Carlos Frederico Martins

    2012-01-01

    Background Due to the increase of solar ultraviolet radiation (UV) incidence over the last few decades, the use of sunscreen has been widely adopted for skin protection. However, considering the high efficiency of sunlight-induced DNA lesions, it is critical to improve upon the current approaches that are used to evaluate protection factors. An alternative approach to evaluate the photoprotection provided by sunscreens against daily UV radiation-induced DNA damage is provided by the systematic use of a DNA dosimeter. Methodology/Principal Findings The Sun Protection Factor for DNA (DNA-SPF) is calculated by using specific DNA repair enzymes, and it is defined as the capacity for inhibiting the generation of cyclobutane pyrimidine dimers (CPD) and oxidised DNA bases compared with unprotected control samples. Five different commercial brands of sunscreen were initially evaluated, and further studies extended the analysis to include 17 other products representing various formulations and Sun Protection Factors (SPF). Overall, all of the commercial brands of SPF 30 sunscreens provided sufficient protection against simulated sunlight genotoxicity. In addition, this DNA biosensor was useful for rapidly screening the biological protection properties of the various sunscreen formulations. Conclusions/Significance The application of the DNA dosimeter is demonstrated as an alternative, complementary, and reliable method for the quantification of sunscreen photoprotection at the level of DNA damage. PMID:22768281

  12. Data of expression and purification of recombinant Taq DNA polymerase

    Directory of Open Access Journals (Sweden)

    Na Fang

    2016-12-01

    Full Text Available Polymerase chain reaction (PCR technique is widely used in many experimental conditions, and Taq DNA polymerase is critical in PCR process. In this article, the Taq DNA polymerase expression plasmid is reconstructed and the protein product is obtained by rapid purification, (“Rapid purification of high-activity Taq DNA polymerase” (Pluthero, 1993 [1], “Single-step purification of a thermostable DNA polymerase expressed in Escherichia coli” (Desai and Pfaffle, 1995 [2]. Here we present the production data from protein expression and provide the analysis results of the production from two different vectors. Meanwhile, the purification data is also provided to show the purity of the protein product.

  13. DNA Microarrays

    Science.gov (United States)

    Nguyen, C.; Gidrol, X.

    Genomics has revolutionised biological and biomedical research. This revolution was predictable on the basis of its two driving forces: the ever increasing availability of genome sequences and the development of new technology able to exploit them. Up until now, technical limitations meant that molecular biology could only analyse one or two parameters per experiment, providing relatively little information compared with the great complexity of the systems under investigation. This gene by gene approach is inadequate to understand biological systems containing several thousand genes. It is essential to have an overall view of the DNA, RNA, and relevant proteins. A simple inventory of the genome is not sufficient to understand the functions of the genes, or indeed the way that cells and organisms work. For this purpose, functional studies based on whole genomes are needed. Among these new large-scale methods of molecular analysis, DNA microarrays provide a way of studying the genome and the transcriptome. The idea of integrating a large amount of data derived from a support with very small area has led biologists to call these chips, borrowing the term from the microelectronics industry. At the beginning of the 1990s, the development of DNA chips on nylon membranes [1, 2], then on glass [3] and silicon [4] supports, made it possible for the first time to carry out simultaneous measurements of the equilibrium concentration of all the messenger RNA (mRNA) or transcribed RNA in a cell. These microarrays offer a wide range of applications, in both fundamental and clinical research, providing a method for genome-wide characterisation of changes occurring within a cell or tissue, as for example in polymorphism studies, detection of mutations, and quantitative assays of gene copies. With regard to the transcriptome, it provides a way of characterising differentially expressed genes, profiling given biological states, and identifying regulatory channels.

  14. Advanced mass spectrometric characterization of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, X.; Hofstadler, S.A.; Gale, D.C. [Pacific Northwest Laboratory, Richland, WA (United States)] [and others

    1994-12-31

    Mass spectrometric characterization of DNA has progressed rapidly due to the development in electrospray ionization (ESI) and MALDI methods. ESI is especially gentle, producing multiply charged ions with high efficiency. The authors have applied ESI-MS to different aspects of DNA research. Precise molecular weight determination aids in confirming the sequence and the structure of oligonucleotides. Non-covalent associations involving DNA are essential for cellular and genomic processes. The advantages of MS in such studies include speed, sensitivity and the ability to obtain structural detail. The authors have studied interactions between duplex-DNA and minor grove binding drugs and observed distamycin-A/oligonucleotide duplex complexes with stoichiometry consistent with NMR results. A number of guanine-rich DNA sequences assemble into quadruplex structures in vitro and have been localized in several key regions in chromosomal DNA. The authors have prepared oligonucleotides designed to test the specificity of cation inclusion and observed ions with quadruplex stoichiometry. The nature and extent of cation association were determined using high resolution MS. With ESI, the high efficiency and the use of liquid samples holds significant promises for rapid DNA sequencing. In developing a method for MS sizing of sequencing mixtures, the authors have attempted to address the problem of multiple-charging by charge-state reduction of oligonucleotide ions. The authors are also investigating a more ambitious approach based on the ability to follow the reactions of individual ions. In progress to date the authors have shown that very large DNA molecules can be ionized intact and measured, potentially opening the door to rapid sequencing by gas-phase DNA degradation.

  15. DNA detection using recombination proteins.

    Directory of Open Access Journals (Sweden)

    Olaf Piepenburg

    2006-07-01

    Full Text Available DNA amplification is essential to most nucleic acid testing strategies, but established techniques require sophisticated equipment or complex experimental procedures, and their uptake outside specialised laboratories has been limited. Our novel approach, recombinase polymerase amplification (RPA, couples isothermal recombinase-driven primer targeting of template material with strand-displacement DNA synthesis. It achieves exponential amplification with no need for pretreatment of sample DNA. Reactions are sensitive, specific, and rapid and operate at constant low temperature. We have also developed a probe-based detection system. Key aspects of the combined RPA amplification/detection process are illustrated by a test for the pathogen methicillin-resistant Staphylococcus aureus. The technology proves to be sensitive to fewer than ten copies of genomic DNA. Furthermore, products can be detected in a simple sandwich assay, thereby establishing an instrument-free DNA testing system. This unique combination of properties is a significant advance in the development of portable and widely accessible nucleic acid-based tests.

  16. Trypanosomatid protozoa: a simplified DNA isolation procedure.

    Science.gov (United States)

    Rotureau, Brice; Gego, Audrey; Carme, Bernard

    2005-11-01

    A non-toxic and versatile protein salting-out DNA extraction method is here described for convenient and rapid extraction of nuclear DNA molecules from trypanosomatids. The procedure just involves four manipulations, does not require any organic solvent, and is performed in less than 1h in a single tube. DNA yields obtained were similar to those from commercial kits and phenol-chloroform procedures. Samples extracted by this method were suitable for PCR and subsequent analyses. The reduced manual labour involved was perceived as an important benefit in medical diagnosis routine use as well as for large-scale taxonomic and eco-epidemiological studies of trypanosomatids.

  17. Binary DNA nanostructures for data encryption.

    Directory of Open Access Journals (Sweden)

    Ken Halvorsen

    Full Text Available We present a simple and secure system for encrypting and decrypting information using DNA self-assembly. Binary data is encoded in the geometry of DNA nanostructures with two distinct conformations. Removing or leaving out a single component reduces these structures to an encrypted solution of ssDNA, whereas adding back this missing "decryption key" causes the spontaneous formation of the message through self-assembly, enabling rapid read out via gel electrophoresis. Applications include authentication, secure messaging, and barcoding.

  18. DATEL: A Scarless and Sequence-Independent DNA Assembly Method Using Thermostable Exonucleases and Ligase.

    Science.gov (United States)

    Jin, Peng; Ding, Wenwen; Du, Guocheng; Chen, Jian; Kang, Zhen

    2016-09-16

    DNA assembly is a pivotal technique in synthetic biology. Here, we report a scarless and sequence-independent DNA assembly method using thermal exonucleases (Taq and Pfu DNA polymerases) and Taq DNA ligase (DATEL). Under the optimized conditions, DATEL allows rapid assembly of 2-10 DNA fragments (1-2 h) with high accuracy (between 74 and 100%). Owing to the simple operation system with denaturation-annealing-cleavage-ligation temperature cycles in one tube, DATEL is expected to be a desirable choice for both manual and automated high-throughput assembly of DNA fragments, which will greatly facilitate the rapid progress of synthetic biology and metabolic engineering.

  19. Rapid small lot manufacturing

    Energy Technology Data Exchange (ETDEWEB)

    Harrigan, R.W.

    1998-05-09

    The direct connection of information, captured in forms such as CAD databases, to the factory floor is enabling a revolution in manufacturing. Rapid response to very dynamic market conditions is becoming the norm rather than the exception. In order to provide economical rapid fabrication of small numbers of variable products, one must design with manufacturing constraints in mind. In addition, flexible manufacturing systems must be programmed automatically to reduce the time for product change over in the factory and eliminate human errors. Sensor based machine control is needed to adapt idealized, model based machine programs to uncontrolled variables such as the condition of raw materials and fabrication tolerances.

  20. DNA-Based Enzyme Reactors and Systems

    Directory of Open Access Journals (Sweden)

    Veikko Linko

    2016-07-01

    Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.

  1. The future of forensic DNA analysis.

    Science.gov (United States)

    Butler, John M

    2015-08-05

    The author's thoughts and opinions on where the field of forensic DNA testing is headed for the next decade are provided in the context of where the field has come over the past 30 years. Similar to the Olympic motto of 'faster, higher, stronger', forensic DNA protocols can be expected to become more rapid and sensitive and provide stronger investigative potential. New short tandem repeat (STR) loci have expanded the core set of genetic markers used for human identification in Europe and the USA. Rapid DNA testing is on the verge of enabling new applications. Next-generation sequencing has the potential to provide greater depth of coverage for information on STR alleles. Familial DNA searching has expanded capabilities of DNA databases in parts of the world where it is allowed. Challenges and opportunities that will impact the future of forensic DNA are explored including the need for education and training to improve interpretation of complex DNA profiles. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  2. Rapid Cycling and Its Treatment

    Science.gov (United States)

    ... Announcements Public Service Announcements Partnering with DBSA Rapid Cycling and its Treatment What is bipolar disorder? Bipolar ... to Depression and Manic Depression . What is rapid cycling? Rapid cycling is defined as four or more ...

  3. Rapid manufacturing for microfluidics

    CSIR Research Space (South Africa)

    Land, K

    2012-10-01

    Full Text Available . Microfluidics is at the forefront of developing solutions for drug discovery, diagnostics (from glucose tests to malaria and TB testing) and environmental diagnostics (E-coli monitoring of drinking water). In order to quickly implement new designs, a rapid...

  4. Rapid Prototyping in PVS

    Science.gov (United States)

    Munoz, Cesar A.; Butler, Ricky (Technical Monitor)

    2003-01-01

    PVSio is a conservative extension to the PVS prelude library that provides basic input/output capabilities to the PVS ground evaluator. It supports rapid prototyping in PVS by enhancing the specification language with built-in constructs for string manipulation, floating point arithmetic, and input/output operations.

  5. Rapid Prototyping Reconsidered

    Science.gov (United States)

    Desrosier, James

    2011-01-01

    Continuing educators need additional strategies for developing new programming that can both reduce the time to market and lower the cost of development. Rapid prototyping, a time-compression technique adapted from the high technology industry, represents one such strategy that merits renewed evaluation. Although in higher education rapid…

  6. Comparison of Five Commercial DNA Extraction Kits for the Recovery of Francisella Tularensis DNA from Spiked Soil Samples

    Science.gov (United States)

    2007-01-01

    DNA Stool Mini kit, Epicentre SoilMasterTM DNA extraction kit, MoBio UltraCleanTM kit, or the MoBio PowerMaxTM soil DNA isolation kit according... extraction and purification of microbial DNA from sediments. J Microbiol Methods 1987;7: 57–66. [19] Smalla K, Creswell N, Mendonca-Hagler L, Wolters A, van...Herrick JB, Silva MC, Ghiorse WC, Madsen EL. Quantitative cell lysis of indigenous microorganisms and rapid extraction of microbial DNA from sediment. Appl

  7. Single-Stranded DNA Uptake during Gonococcal Transformation.

    Science.gov (United States)

    Hepp, Christof; Gangel, Heike; Henseler, Katja; Günther, Niklas; Maier, Berenike

    2016-09-15

    Neisseria gonorrhoeae is naturally competent for transformation. The first step of the transformation process is the uptake of DNA from the environment into the cell. This transport step is driven by a powerful molecular machine. Here, we addressed the question whether this machine imports single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) at similar rates. The fluorescence signal associated with the uptake of short DNA fragments labeled with a single fluorescent marker molecule was quantified. We found that ssDNA with a double-stranded DNA uptake sequence (DUS) was taken up with a similar efficiency as dsDNA. Imported ssDNA was degraded rapidly, and the thermonuclease Nuc was required for degradation. In a nuc deletion background, dsDNA and ssDNA with a double-stranded DUS were imported and used as the substrates for transformation, whereas the import and transformation efficiencies of ssDNA with single-stranded DUS were below the detection limits. We conclude that the DNA uptake machine requires a double-stranded DUS for efficient DNA recognition and transports ssDNA and dsDNA with comparable efficiencies. Bacterial transformation enables bacteria to exchange genetic information. It can speed up adaptive evolution and enhances the potential of DNA repair. The transport of DNA through the outer membrane is the first step of transformation in Gram-negative species. It is driven by a powerful molecular machine whose mechanism remains elusive. Here, we show for Neisseria gonorrhoeae that the machine transports single- and double-stranded DNA at comparable rates, provided that the species-specific DNA uptake sequence is double stranded. Moreover, we found that single-stranded DNA taken up into the periplasm is rapidly degraded by the thermonuclease Nuc. We conclude that the secondary structure of transforming DNA is important for the recognition of self DNA but not for the process of transport through the outer membrane. Copyright © 2016, American Society

  8. Nutritional Control of DNA Replication Initiation through the Proteolysis and Regulated Translation of DnaA.

    Directory of Open Access Journals (Sweden)

    David J Leslie

    2015-07-01

    Full Text Available Bacteria can arrest their own growth and proliferation upon nutrient depletion and under various stressful conditions to ensure their survival. However, the molecular mechanisms responsible for suppressing growth and arresting the cell cycle under such conditions remain incompletely understood. Here, we identify post-transcriptional mechanisms that help enforce a cell-cycle arrest in Caulobacter crescentus following nutrient limitation and during entry into stationary phase by limiting the accumulation of DnaA, the conserved replication initiator protein. DnaA is rapidly degraded by the Lon protease following nutrient limitation. However, the rate of DnaA degradation is not significantly altered by changes in nutrient availability. Instead, we demonstrate that decreased nutrient availability downregulates dnaA translation by a mechanism involving the 5' untranslated leader region of the dnaA transcript; Lon-dependent proteolysis of DnaA then outpaces synthesis, leading to the elimination of DnaA and the arrest of DNA replication. Our results demonstrate how regulated translation and constitutive degradation provide cells a means of precisely and rapidly modulating the concentration of key regulatory proteins in response to environmental inputs.

  9. Synthesis of DNA

    Science.gov (United States)

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  10. A rapid cloning method employing orthogonal end protection

    NARCIS (Netherlands)

    Jakobi, A.J.|info:eu-repo/dai/nl/311489621; Huizinga, E.G.|info:eu-repo/dai/nl/12314969X

    2012-01-01

    We describe a novel in vitro cloning strategy that combines standard tools in molecular biology with a basic protecting group concept to create a versatile framework for the rapid and seamless assembly of modular DNA building blocks into functional open reading frames. Analogous to chemical

  11. A BIOINFORMATIC STRATEGY TO RAPIDLY CHARACTERIZE CDNA LIBRARIES

    Science.gov (United States)

    A Bioinformatic Strategy to Rapidly Characterize cDNA LibrariesG. Charles Ostermeier1, David J. Dix2 and Stephen A. Krawetz1.1Departments of Obstetrics and Gynecology, Center for Molecular Medicine and Genetics, & Institute for Scientific Computing, Wayne State Univer...

  12. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    Administrator

    2010-11-08

    Nov 8, 2010 ... Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 16: 11141-11156. Fang H, Hedin G (2003). Rapid screening and identification of methicillin-resistant Staphylococcus aureus from clinical samples by selective-broth and real-time PCR assay.

  13. DNA Methylation Signature Analysis: How Easy Is It to Perform?

    Science.gov (United States)

    Piperi, Christina; Farmaki, Elena; Vlastos, Fotis; Papavassiliou, Athanasios G.; Martinet, Nadine

    2008-01-01

    Epigenetic changes, or heritable alterations in gene function that do not affect DNA sequence, are rapidly gaining acceptance as co-conspirators in carcinogenesis. Although DNA methylation signature analysis by methylation-specific polymerase chain reaction has been a breakthrough method in speed and sensitivity for gene methylation studies, several factors still limit its application as a routine diagnostic and prognostic test. PMID:19183791

  14. Assessment of DNA damage by panmasala, gutkha chewing and ...

    African Journals Online (AJOL)

    Smita Jyoti

    2013-09-04

    Sep 4, 2013 ... Abstract In the present study the comet assay was performed in buccal epithelial cells to evaluate. DNA damage among pan masala or gutkha chewers and smokers. The assay is a rapid, suitable and sensitive method for detecting various forms of DNA damage at individual cell level. The study comprises ...

  15. Assessment of DNA damage by panmasala, gutkha chewing and ...

    African Journals Online (AJOL)

    In the present study the comet assay was performed in buccal epithelial cells to evaluate DNA damage among pan masala or gutkha chewers and smokers. The assay is a rapid, suitable and sensitive method for detecting various forms of DNA damage at individual cell level. The study comprises 300 individuals of which 50 ...

  16. Transposon-containing DNA cloning vector and uses thereof

    Science.gov (United States)

    Berg, Claire M.; Berg, Douglas E.; Wang, Gan

    1997-01-01

    The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed.

  17. Random amplified polymorphic DNA based genetic characterization ...

    African Journals Online (AJOL)

    DIRECTOR

    2013-07-10

    Jul 10, 2013 ... Establishing multilocus markers RAPD analysis of genomes provides a versatile and rapid technology requiring low infrastructural input and use of arbitrary primers for developing plant DNA fingerprinting. In the present study, a comparative genetic analysis of four species of bamboo B. bambus, P. ritcheyi, ...

  18. DNA nanoparticles as ocular drug delivery platform

    NARCIS (Netherlands)

    de Vries, Jan Willem

    2015-01-01

    The field of DNA nanotechnology has progressed rapidly in recent years and now offers facile fabrication of a large variety of nanostructures of different shapes and geometries. In this thesis, short nucleic acid sequences are functionalized with hydrophobic units to form the basis of an ocular drug

  19. Rapid manufacturing facilitated customisation

    OpenAIRE

    Tuck, Christopher John; Hague, Richard; Ruffo, Massimiliano; Ransley, Michelle; Adams, Paul Russell

    2008-01-01

    Abstract This paper describes the production of body-fitting customised seat profiles utilising the following digital methods: three dimensional laser scanning, reverse engineering and Rapid Manufacturing (RM). The seat profiles have been manufactured in order to influence the comfort characteristics of an existing ejector seat manufactured by Martin Baker Aircraft Ltd. The seat, known as Navy Aircrew Common Ejection Seat (NACES), was originally designed with a generic profile. ...

  20. Rapid Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    David Perlin

    2005-08-14

    Pathogen identification is a crucial first defense against bioterrorism. A major emphasis of our national biodefense strategy is to establish fast, accurate and sensitive assays for diagnosis of infectious diseases agents. Such assays will ensure early and appropriate treatment of infected patients. Rapid diagnostics can also support infection control measures, which monitor and limit the spread of infectious diseases agents. Many select agents are highly transmissible in the early stages of disease, and it is critical to identify infected patients and limit the risk to the remainder of the population and to stem potential panic in the general population. Nucleic acid-based molecular approaches for identification overcome many of the deficiencies associated with conventional culture methods by exploiting both large- and small-scale genomic differences between organisms. PCR-based amplification of highly conserved ribosomal RNA (rRNA) genes, intergenic sequences, and specific toxin genes is currently the most reliable approach for bacterial, fungal and many viral pathogenic agents. When combined with fluorescence-based oligonucleotide detection systems, this approach provides real-time, quantitative, high fidelity analysis capable of single nucleotide allelic discrimination (4). These probe systems offer rapid turn around time (<2 h) and are suitable for high throughput, automated multiplex operations that are critical for clinical diagnostic laboratories. In this pilot program, we have used molecular beacon technology invented at the Public health Research Institute to develop a new generation of molecular probes to rapidly detect important agents of infectious diseases. We have also developed protocols to rapidly extract nucleic acids from a variety of clinical specimen including and blood and tissue to for detection in the molecular assays. This work represented a cooperative research development program between the Kramer-Tyagi/Perlin labs on probe development

  1. Tiber Personal Rapid Transit

    Directory of Open Access Journals (Sweden)

    Diego Carlo D'agostino

    2011-02-01

    Full Text Available The project “Tiber Personal Rapid Transit” have been presented by the author at the Rome City Vision Competition1 2010, an ideas competition, which challenges architects, engineers, designers, students and creatives individuals to develop visionary urban proposals with the intention of stimulating and supporting the contemporary city, in this case Rome. The Tiber PRT proposal tries to answer the competition questions with the definition of a provocative idea: a Personal Rapid transit System on the Tiber river banks. The project is located in the central section of the Tiber river and aims at the renewal of the river banks with the insertion of a Personal Rapid Transit infrastructure. The project area include the riverbank of Tiber from Rome Transtevere RFI station to Piazza del Popolo, an area where main touristic and leisure attractions are located. The intervention area is actually no used by the city users and residents and constitute itself a strong barrier in the heart of the historic city.

  2. Methylation of DNA in cancer.

    Science.gov (United States)

    Watanabe, Yoshihisa; Maekawa, Masato

    2010-01-01

    Epigenetic mechanisms are essential for normal development and maintenance of tissue-specific gene expression patterns in mammals. Disruption of epigenetic processes can lead to altered gene function and malignant cellular transformation. Global changes in the epigenetic landscape are a hallmark of cancer. Methylation of cytosine bases in DNA provides a layer of epigenetic control in many eukaryotes that has important implications for normal biology and disease. DNA methylation is a crucial epigenetic modification of the genome that is involved in regulating many cellular processes. These include embryonic development, transcription, chromatin structure, X-chromosome inactivation, genomic imprinting, and chromosome stability. Consistent with these important roles, a growing number of human diseases including cancer have been found to be associated with aberrant DNA methylation. Recent advancements in the rapidly evolving field of cancer epigenetics have described extensive reprogramming of every component of the epigenetic machinery in cancer, such as DNA demethylation. Hypomethylation of the genome largely affects the intergenic and intronic regions of the DNA, particularly repeat sequences and transposable elements, and it is believed to result in chromosomal instability and increased mutation events. Therefore, we propose that R/G-chromosome band boundaries, which correspond with the early/late-switch regions of replication timing and a transition in relative GC content, correspond to "unstable" genomic regions in which concentrated occurrences of repetitive sequences and transposable elements including LINE and Alu elements are hypomethylated during tumorigenesis. In this review, we discuss the current understanding of alterations in DNA methylation composing the epigenetic landscape that occurs in cancer compared with normal cells, the roles of these changes in cancer initiation and progression, and the potential use of this knowledge in designing more

  3. A bacteriophage T4 in vitro system to clone long DNA molecules. Final report, June 1, 1990--January 31, 1996

    Energy Technology Data Exchange (ETDEWEB)

    Rao, V.B.

    1997-09-01

    A summary is presented of the following objectives: development of a bacteriophage T4 in vitro system, and techniques to clone long segments of foreign DNA; development of a giant prohead DNA packaging system that could potentially be used to clone even a megabase size DNA; and development of techniques to rapidly map the cloned DNA inserts.

  4. Multifunctional DNA Nanomaterials for Biomedical Applications

    Directory of Open Access Journals (Sweden)

    Dick Yan Tam

    2015-01-01

    Full Text Available The rapidly emerging DNA nanotechnology began with pioneer Seeman’s hypothesis that DNA not only can carry genetic information but also can be used as molecular organizer to create well-designed and controllable nanomaterials for applications in materials science, nanotechnology, and biology. DNA-based self-assembly represents a versatile system for nanoscale construction due to the well-characterized conformation of DNA and its predictability in the formation of base pairs. The structural features of nucleic acids form the basis of constructing a wide variety of DNA nanoarchitectures with well-defined shapes and sizes, in addition to controllable permeability and flexibility. More importantly, self-assembled DNA nanostructures can be easily functionalized to construct artificial functional systems with nanometer scale precision for multipurposes. Apparently scientists envision artificial DNA-based nanostructures as tool for drug loading and in vivo targeted delivery because of their abilities in selective encapsulation and stimuli-triggered release of cargo. Herein, we summarize the strategies of creating multidimensional self-assembled DNA nanoarchitectures and review studies investigating their stability, toxicity, delivery efficiency, loading, and control release of cargos in addition to their site-specific targeting and delivery of drug or cargo molecules to cellular systems.

  5. Electrochemical biosensing strategies for DNA methylation analysis.

    Science.gov (United States)

    Hossain, Tanvir; Mahmudunnabi, Golam; Masud, Mostafa Kamal; Islam, Md Nazmul; Ooi, Lezanne; Konstantinov, Konstantin; Hossain, Md Shahriar Al; Martinac, Boris; Alici, Gursel; Nguyen, Nam-Trung; Shiddiky, Muhammad J A

    2017-08-15

    DNA methylation is one of the key epigenetic modifications of DNA that results from the enzymatic addition of a methyl group at the fifth carbon of the cytosine base. It plays a crucial role in cellular development, genomic stability and gene expression. Aberrant DNA methylation is responsible for the pathogenesis of many diseases including cancers. Over the past several decades, many methodologies have been developed to detect DNA methylation. These methodologies range from classical molecular biology and optical approaches, such as bisulfite sequencing, microarrays, quantitative real-time PCR, colorimetry, Raman spectroscopy to the more recent electrochemical approaches. Among these, electrochemical approaches offer sensitive, simple, specific, rapid, and cost-effective analysis of DNA methylation. Additionally, electrochemical methods are highly amenable to miniaturization and possess the potential to be multiplexed. In recent years, several reviews have provided information on the detection strategies of DNA methylation. However, to date, there is no comprehensive evaluation of electrochemical DNA methylation detection strategies. Herein, we address the recent developments of electrochemical DNA methylation detection approaches. Furthermore, we highlight the major technical and biological challenges involved in these strategies and provide suggestions for the future direction of this important field. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  7. Rapid electrochemiluminescence assays of polymerase chain reaction products.

    Science.gov (United States)

    Kenten, J H; Casadei, J; Link, J; Lupold, S; Willey, J; Powell, M; Rees, A; Massey, R

    1991-09-01

    We demonstrate the first use of an electrochemiluminescent (ECL) label, [4-(N-succimidyloxycarbonylpropyl)-4'-methyl-2,2'- bipyridine]ruthenium(II) dihexafluorophosphate (Origen label; IGEN Inc.), in DNA probe assays. This label allows rapid (less than 25 min) quantification and detection of polymerase chain reaction (PCR)-amplified products from oncogenes, viruses, and cloned genes. For the PCR, we used labeled oligonucleotide primers complementary to human papiloma virus and the Ha-ras oncogene. These samples were followed by ECL analysis or hybridization with specific, Origen-labeled oligonucleotide probes. These studies demonstrate the speed, specificity, and effectiveness of the new ECL labels, compared with 32P, for nucleic acid probe applications. We describe formats involving conventional methodologies and a new format that requires no wash step, allowing simple and rapid sample analysis. These rapid assays also reduce PCR contamination, by requiring less sample handling. Improvements in ECL detectability are currently under investigation for use in DNA probe assays without amplification.

  8. Field Effect Transistor Using Carbon Nanotubes and DNA as Electrical Gate

    Science.gov (United States)

    Abdalla, S.; Al-Marzouki, F. M.; Al-Ghamdi, Ahmed A.

    2017-02-01

    We present an electronic sensor in the molecular scale, which is very sensitive for detection and sensing of DNA characteristics and DNA activities in particular activities between DNA duplex and any protein. Here, the device shows that DNA is electronically inserted to be on the same time as an electrical device transducer and as a biological target in a carbon nanotube-DNA-carbon nanotube electronic sensor. We have performed a DNA binding through an amide group by the electron transfer through amide group. The presented device has shown an efficient and rapid procedure to bind the electrical vulnerability of DNA with the detection of enzymatic effectiveness leading to high efficient biosensor.

  9. Rapidly variable relatvistic absorption

    Science.gov (United States)

    Parker, M.; Pinto, C.; Fabian, A.; Lohfink, A.; Buisson, D.; Alston, W.; Jiang, J.

    2017-10-01

    I will present results from the 1.5Ms XMM-Newton observing campaign on the most X-ray variable AGN, IRAS 13224-3809. We find a series of nine absorption lines with a velocity of 0.24c from an ultra-fast outflow. For the first time, we are able to see extremely rapid variability of the UFO features, and can link this to the X-ray variability from the inner accretion disk. We find a clear flux dependence of the outflow features, suggesting that the wind is ionized by increasing X-ray emission.

  10. Rapid prototype and test

    Energy Technology Data Exchange (ETDEWEB)

    Gregory, D.L.; Hansche, B.D.

    1996-06-01

    In order to support advanced manufacturing, Sandia has acquired the capability to produce plastic prototypes using stereolithography. Currently, these prototypes are used mainly to verify part geometry and ``fit and form`` checks. This project investigates methods for rapidly testing these plastic prototypes, and inferring from prototype test data actual metal part performance and behavior. Performances examined include static load/stress response, and structural dynamic (modal) and vibration behavior. The integration of advanced non-contacting measurement techniques including scanning laser velocimetry, laser holography, and thermoelasticity into testing of these prototypes is described. Photoelastic properties of the epoxy prototypes to reveal full field stress/strain fields are also explored.

  11. Right-Rapid-Rough

    Science.gov (United States)

    Lawrence, Craig

    2003-01-01

    IDEO (pronounced 'eye-dee-oh') is an international design, engineering, and innovation firm that has developed thousands of products and services for clients across a wide range of industries. Its process and culture attracted the attention of academics, businesses, and journalists around the world, and are the subject of a bestselling book, The Art of Innovation by Tom Kelley. One of the keys to IDEO's success is its use of prototyping as a tool for rapid innovation. This story covers some of IDEO's projects, and gives reasons for why they were successful.

  12. Nanogravimetric and voltammetric DNA-hybridization biosensors for studies of DNA damage by common toxicants and pollutants.

    Science.gov (United States)

    Nowicka, Anna M; Kowalczyk, Agata; Stojek, Zbigniew; Hepel, Maria

    2010-01-01

    Electrochemical and nanogravimetric DNA-hybridization biosensors have been developed for sensing single mismatches in the probe-target ssDNA sequences. The voltammetric transduction was achieved by coupling ferrocene moiety to streptavidin linked to biotinylated tDNA. The mass-related frequency transduction was implemented by immobilizing the sensory pDNA on a gold-coated quartz crystal piezoresonators oscillating in the 10MHz band. The high sensitivity of these sensors enabled us to study DNA damage caused by representative toxicants and environmental pollutants, including Cr(VI) species, common pesticides and herbicides. We have found that the sensor responds rapidly to any damage caused by Cr(VI) species, with more severe DNA damage observed for Cr(2)O(7)(2-) and for CrO(4)(2-) in the presence of H(2)O(2) as compared to CrO(4)(2-) alone. All herbicides and pesticides examined caused DNA damage or structural alterations leading to the double-helix unwinding. Among these compounds, paraoxon-ethyl and atrazine caused the fastest and most severe damage to DNA. The physico-chemical mechanism of damaging interactions between toxicants and DNA has been proposed. The methodology of testing voltammetric and nanogravimetric DNA-hybridization biosensors developed in this work can be employed as a simple protocol to obtain rapid comparative data concerning DNA damage caused by herbicide, pesticides and other toxic pollutants. The DNA-hybridization biosensor can, therefore, be utilized as a rapid screening device for classifying environmental pollutants and to evaluate DNA damage induced by these compounds.

  13. DNA methyltransferase 1 and DNA methylation patterning contribute to germinal center B-cell differentiation

    DEFF Research Database (Denmark)

    Shaknovich, Rita; Cerchietti, Leandro; Tsikitas, Lucas

    2011-01-01

    The phenotype of germinal center (GC) B cells includes the unique ability to tolerate rapid proliferation and the mutagenic actions of activation induced cytosine deaminase (AICDA). Given the importance of epigenetic patterning in determining cellular phenotypes, we examined DNA methylation...... and the role of DNA methyltransferases in the formation of GCs. DNA methylation profiling revealed a marked shift in DNA methylation patterning in GC B cells versus resting/naive B cells. This shift included significant differential methylation of 235 genes, with concordant inverse changes in gene expression...... affecting most notably genes of the NFkB and MAP kinase signaling pathways. GC B cells were predominantly hypomethylated compared with naive B cells and AICDA binding sites were highly overrepresented among hypomethylated loci. GC B cells also exhibited greater DNA methylation heterogeneity than naive B...

  14. Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus

    Directory of Open Access Journals (Sweden)

    Wendy Ribble

    2015-01-01

    Full Text Available DNA replication in bacteria is accomplished by a multicomponent replicase, the DNA polymerase III holoenzyme (pol III HE. The three essential components of the pol III HE are the α polymerase, the β sliding clamp processivity factor, and the DnaX clamp-loader complex. We report here the assembly of the functional holoenzyme from Thermus thermophilus (Tth, an extreme thermophile. The minimal holoenzyme capable of DNA synthesis consists of α, β and DnaX (τ and γ, δ and δ′ components of the clamp-loader complex. The proteins were each cloned and expressed in a native form. Each component of the system was purified extensively. The minimum holoenzyme from these five purified subunits reassembled is sufficient for rapid and processive DNA synthesis. In an isolated form the α polymerase was found to be unstable at temperatures above 65°C. We were able to increase the thermostability of the pol III HE to 98°C by addition and optimization of various buffers and cosolvents. In the optimized buffer system we show that a replicative polymerase apparatus, Tth pol III HE, is capable of rapid amplification of regions of DNA up to 15,000 base pairs in PCR reactions.

  15. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning.

    Science.gov (United States)

    Rahman, Masudur; Neff, David; Green, Nathaniel; Norton, Michael L

    2016-10-31

    Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.

  16. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning

    Directory of Open Access Journals (Sweden)

    Masudur Rahman

    2016-10-01

    Full Text Available Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.

  17. Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

    Science.gov (United States)

    Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

    2016-05-19

    Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

  18. Rapid mineralocorticoid receptor trafficking.

    Science.gov (United States)

    Gekle, M; Bretschneider, M; Meinel, S; Ruhs, S; Grossmann, C

    2014-03-01

    The mineralocorticoid receptor (MR) is a ligand-dependent transcription factor that physiologically regulates water-electrolyte homeostasis and controls blood pressure. The MR can also elicit inflammatory and remodeling processes in the cardiovascular system and the kidneys, which require the presence of additional pathological factors like for example nitrosative stress. However, the underlying molecular mechanism(s) for pathophysiological MR effects remain(s) elusive. The inactive MR is located in the cytosol associated with chaperone molecules including HSP90. After ligand binding, the MR monomer rapidly translocates into the nucleus while still being associated to HSP90 and after dissociation from HSP90 binds to hormone-response-elements called glucocorticoid response elements (GREs) as a dimer. There are indications that rapid MR trafficking is modulated in the presence of high salt, oxidative or nitrosative stress, hypothetically by induction or posttranslational modifications. Additionally, glucocorticoids and the enzyme 11beta hydroxysteroid dehydrogenase may also influence MR activation. Because MR trafficking and its modulation by micro-milieu factors influence MR cellular localization, it is not only relevant for genomic but also for nongenomic MR effects. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Rapid response manufacturing (RRM)

    Energy Technology Data Exchange (ETDEWEB)

    Cain, W.D. [Lockheed Martin Energy Systems, Inc., Oak Ridge, TN (United States); Waddell, W.L. [National Centers for Manufacturing Sciences, Ann Arbor, MI (United States)

    1997-02-18

    US industry is fighting to maintain its competitive edge in the global market place. Today markets fluctuate rapidly. Companies, to survive, have to be able to respond with quick-to-market, improved, high quality, cost efficient products. The way products are developed and brought to market can be improved and made more efficient through the proper incorporation of emerging technologies. The RRM project was established to leverage the expertise and resources of US private industries and federal agencies to develop, integrate, and deploy new technologies that meet critical needs for effective product realization. The RRM program addressed a needed change in the US Manufacturing infrastructure that will ensure US competitiveness in world market typified by mass customization. This project provided the effort needed to define, develop and establish a customizable infrastructure for rapid response product development design and manufacturing. A major project achievement was the development of a broad-based framework for automating and integrating the product and process design and manufacturing activities involved with machined parts. This was accomplished by coordinating and extending the application of feature-based product modeling, knowledge-based systems, integrated data management, and direct manufacturing technologies in a cooperative integrated computing environment. Key technological advancements include a product model that integrates product and process data in a consistent, minimally redundant manner, an advanced computer-aided engineering environment, knowledge-based software aids for design and process planning, and new production technologies to make products directly from design application software.

  20. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    Rapid DNA extraction is a prerequisite for molecular studies. Generally, plant tissue is ground in liquid nitrogen to isolate DNA; but, liquid nitrogen is dangerous and volatile. Besides, liquid nitrogen is not always available in many developing countries. To investigate if high quality DNA could be obtained for downstream ...

  1. Molecular cloning of growth hormone encoding cDNA of Indian ...

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  2. cDNA cloning and characterization of a mannose-binding lectin from ...

    Indian Academy of Sciences (India)

    Using RNA extracted from Zingiber officinale rhizomes and primers designed according to the conservative regions of monocot mannose-binding lectins, the full-length cDNA of Z. officinale agglutinin (ZOA) was cloned by rapid amplification of cDNA ends (RACE). The full-length cDNA of zoa was 746 bp and contained a ...

  3. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENNTIAL FLUORESENCE ASSAY

    Science.gov (United States)

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...

  4. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAY

    Science.gov (United States)

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...

  5. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    uwerhiavwe

    2013-04-17

    Apr 17, 2013 ... Rapid DNA extraction is a prerequisite for molecular studies. Generally, plant tissue is ground in liquid nitrogen to isolate DNA; but, liquid nitrogen is dangerous and volatile. Besides, liquid nitrogen is not always available in many developing countries. To investigate if high quality DNA could be obtained for.

  6. DNA sequences at a glance.

    Directory of Open Access Journals (Sweden)

    Armando J Pinho

    Full Text Available Data summarization and triage is one of the current top challenges in visual analytics. The goal is to let users visually inspect large data sets and examine or request data with particular characteristics. The need for summarization and visual analytics is also felt when dealing with digital representations of DNA sequences. Genomic data sets are growing rapidly, making their analysis increasingly more difficult, and raising the need for new, scalable tools. For example, being able to look at very large DNA sequences while immediately identifying potentially interesting regions would provide the biologist with a flexible exploratory and analytical tool. In this paper we present a new concept, the "information profile", which provides a quantitative measure of the local complexity of a DNA sequence, independently of the direction of processing. The computation of the information profiles is computationally tractable: we show that it can be done in time proportional to the length of the sequence. We also describe a tool to compute the information profiles of a given DNA sequence, and use the genome of the fission yeast Schizosaccharomyces pombe strain 972 h(- and five human chromosomes 22 for illustration. We show that information profiles are useful for detecting large-scale genomic regularities by visual inspection. Several discovery strategies are possible, including the standalone analysis of single sequences, the comparative analysis of sequences from individuals from the same species, and the comparative analysis of sequences from different organisms. The comparison scale can be varied, allowing the users to zoom-in on specific details, or obtain a broad overview of a long segment. Software applications have been made available for non-commercial use at http://bioinformatics.ua.pt/software/dna-at-glance.

  7. Rapid Refresh (RAP) [13 km

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Rapid Refresh (RAP) numerical weather model took the place of the Rapid Update Cycle (RUC) on May 1, 2012. Run by the National Centers for Environmental...

  8. Rapid Refresh (RAP) [20 km

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Rapid Refresh (RAP) numerical weather model took the place of the Rapid Update Cycle (RUC) on May 1, 2012. Run by the National Centers for Environmental...

  9. Methods to maximise recovery of environmental DNA from water samples.

    Directory of Open Access Journals (Sweden)

    Rheyda Hinlo

    Full Text Available The environmental DNA (eDNA method is a detection technique that is rapidly gaining credibility as a sensitive tool useful in the surveillance and monitoring of invasive and threatened species. Because eDNA analysis often deals with small quantities of short and degraded DNA fragments, methods that maximize eDNA recovery are required to increase detectability. In this study, we performed experiments at different stages of the eDNA analysis to show which combinations of methods give the best recovery rate for eDNA. Using Oriental weatherloach (Misgurnus anguillicaudatus as a study species, we show that various combinations of DNA capture, preservation and extraction methods can significantly affect DNA yield. Filtration using cellulose nitrate filter paper preserved in ethanol or stored in a -20°C freezer and extracted with the Qiagen DNeasy kit outperformed other combinations in terms of cost and efficiency of DNA recovery. Our results support the recommendation to filter water samples within 24hours but if this is not possible, our results suggest that refrigeration may be a better option than freezing for short-term storage (i.e., 3-5 days. This information is useful in designing eDNA detection of low-density invasive or threatened species, where small variations in DNA recovery can signify the difference between detection success or failure.

  10. Methods to maximise recovery of environmental DNA from water samples.

    Science.gov (United States)

    Hinlo, Rheyda; Gleeson, Dianne; Lintermans, Mark; Furlan, Elise

    2017-01-01

    The environmental DNA (eDNA) method is a detection technique that is rapidly gaining credibility as a sensitive tool useful in the surveillance and monitoring of invasive and threatened species. Because eDNA analysis often deals with small quantities of short and degraded DNA fragments, methods that maximize eDNA recovery are required to increase detectability. In this study, we performed experiments at different stages of the eDNA analysis to show which combinations of methods give the best recovery rate for eDNA. Using Oriental weatherloach (Misgurnus anguillicaudatus) as a study species, we show that various combinations of DNA capture, preservation and extraction methods can significantly affect DNA yield. Filtration using cellulose nitrate filter paper preserved in ethanol or stored in a -20°C freezer and extracted with the Qiagen DNeasy kit outperformed other combinations in terms of cost and efficiency of DNA recovery. Our results support the recommendation to filter water samples within 24hours but if this is not possible, our results suggest that refrigeration may be a better option than freezing for short-term storage (i.e., 3-5 days). This information is useful in designing eDNA detection of low-density invasive or threatened species, where small variations in DNA recovery can signify the difference between detection success or failure.

  11. Universal primers for rapid detection of hytrosaviruses.

    Science.gov (United States)

    Abd-Alla, Adly M M; Salem, Tamer Z; Parker, Andrew G; Wang, Yongjie; Jehle, Johannes A; Vreysen, Marc J B; Boucias, Drion

    2011-01-01

    Hytrosaviridae is a proposed virus family encompassing viruses that cause salivary gland hypertrophy (SGH) syndrome in infected insects and reduce the fertility in their dipteran insect hosts. They contain a large, double stranded DNA genome of 120-190 kbp. To date, these viruses have been detected only in adult Diptera. These include hytrosaviruses detected in various tsetse fly species (Glossina spp.), the narcissus bulb fly Merodon equestris and the house fly Musca domestica. The limited number of hytrosaviruses reported to date may be a reflection of the frequent absence of external symptoms in infected adult flies and the fact that the virus does not cause rapid mortality. Based on the complete genome sequence of Glossinia pallidipes (GpSGHV) and Musca domestica (MdSGHV) salivary gland hypertrophy viruses, a PCR based methodology was developed to detect the viruses in these species. To be able to detect hytrosaviruses in other Diptera, five degenerate primer pairs were designed and tested on GpSGHV and MdSGHV DNA using gradient PCR with annealing temperatures from 37 to 61°C. Two pairs of primers were selected from p74, two pairs from PIF-1 and one pair from ODV-e66 homologous proteins. Four primer pairs generated a virus specific PCR product on both MdSGHV and GpSGHV at all tested annealing temperatures, while the ODV-e66 based primers did not generate a virus specific product with annealing temperatures higher that 47°C. No non-specific PCR product was found when using genomic DNA of infected flies as template DNA. These results offer new sets of primers that could be used to detect hytrosaviruses in other insects. Copyright © 2010 Elsevier B.V. All rights reserved.

  12. Optimal purification and sensitive quantification of DNA from fecal samples

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hoorfar, Jeffrey

    2002-01-01

    Application of reliable, rapid and sensitive methods to laboratory diagnosis of zoonotic infections continues to challenge microbiological laboratories. The recovery of DNA from a swine fecal sample and a bacterial culture extracted by a conventional phenol-chloroform extraction method was compared...... to a rapid silica-membrane spin-column method (DNeasy Tissue or QIAamp Stool Kit, QIAGEN GmbH). Me two spin column methods yielded 3.5 and 2.7 mug of DNA, respectively, when the elution volume was 200 muL, compared to 1.3 and 1.5 mug of DNA, respectively, with the phenol-chloroform method. In addition......, the detection range of X-DNA of a spectrophotometric and a fluorometric (PicoGreen) method was compared. The PicoGreen showed a quantification limit of 1 ng/mL, consistent triplicate measurements, and finally a linear relationship between the concentrations of DNA standards and the fluorescence readings (R-2...

  13. Persistence of DNA studied in different ex vivo and in vivo rat models simulating the human gut situation

    DEFF Research Database (Denmark)

    Wilcks, Andrea; van Hoek, A.H.A.M.; Joosten, R.G.

    2004-01-01

    This study aimed to evaluate the possibility of DNA sequences from genetically modified plants to persist in the gastrointestinal (GI) tract. PCR analysis and transformation assays were used to study DNA persistence and integrity in various ex vivo and in vivo systems using gnotobiotic rats. DNA...... studied was either plasmid DNA, naked plant DNA or plant DNA embedded in maize flour. Ex vivo experiments performed by incubating plant DNA in intestinal samples, showed that DNA is rapidly degraded in the upper part of the GI tract whereas degradation is less severe in the lower part. In contrast...

  14. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    Energy Technology Data Exchange (ETDEWEB)

    Ganesan, Shanthi, E-mail: shanthig@iastate.edu; Keating, Aileen F., E-mail: akeating@iastate.edu

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  15. DNA DAMAGE QUANTITATION BY ALKALINE GEL ELECTROPHORESIS.

    Energy Technology Data Exchange (ETDEWEB)

    SUTHERLAND,B.M.; BENNETT,P.V.; SUTHERLAND, J.C.

    2004-03-24

    Physical and chemical agents in the environment, those used in clinical applications, or encountered during recreational exposures to sunlight, induce damages in DNA. Understanding the biological impact of these agents requires quantitation of the levels of such damages in laboratory test systems as well as in field or clinical samples. Alkaline gel electrophoresis provides a sensitive (down to {approx} a few lesions/5Mb), rapid method of direct quantitation of a wide variety of DNA damages in nanogram quantities of non-radioactive DNAs from laboratory, field, or clinical specimens, including higher plants and animals. This method stems from velocity sedimentation studies of DNA populations, and from the simple methods of agarose gel electrophoresis. Our laboratories have developed quantitative agarose gel methods, analytical descriptions of DNA migration during electrophoresis on agarose gels (1-6), and electronic imaging for accurate determinations of DNA mass (7-9). Although all these components improve sensitivity and throughput of large numbers of samples (7,8,10), a simple version using only standard molecular biology equipment allows routine analysis of DNA damages at moderate frequencies. We present here a description of the methods, as well as a brief description of the underlying principles, required for a simplified approach to quantitation of DNA damages by alkaline gel electrophoresis.

  16. Polymer multilayer tattooing for enhanced DNA vaccination

    Science.gov (United States)

    Demuth, Peter C.; Min, Younjin; Huang, Bonnie; Kramer, Joshua A.; Miller, Andrew D.; Barouch, Dan H.; Hammond, Paula T.; Irvine, Darrell J.

    2013-04-01

    DNA vaccines have many potential benefits but have failed to generate robust immune responses in humans. Recently, methods such as in vivo electroporation have demonstrated improved performance, but an optimal strategy for safe, reproducible, and pain-free DNA vaccination remains elusive. Here we report an approach for rapid implantation of vaccine-loaded polymer films carrying DNA, immune-stimulatory RNA, and biodegradable polycations into the immune-cell-rich epidermis, using microneedles coated with releasable polyelectrolyte multilayers. Films transferred into the skin following brief microneedle application promoted local transfection and controlled the persistence of DNA and adjuvants in the skin from days to weeks, with kinetics determined by the film composition. These ‘multilayer tattoo’ DNA vaccines induced immune responses against a model HIV antigen comparable to electroporation in mice, enhanced memory T-cell generation, and elicited 140-fold higher gene expression in non-human primate skin than intradermal DNA injection, indicating the potential of this strategy for enhancing DNA vaccination.

  17. Structural DNA nanotechnology for intelligent drug delivery.

    Science.gov (United States)

    Chao, Jie; Liu, Huajie; Su, Shao; Wang, Lianhui; Huang, Wei; Fan, Chunhai

    2014-11-01

    Drug delivery carriers have been popularly employed to improve solubility, stability, and efficacy of chemical and biomolecular drugs. Despite the rapid progress in this field, it remains a great challenge to develop an ideal carrier with minimal cytotoxicity, high biocompatibility and intelligence for targeted controlled release. The emergence of DNA nanotechnology offers unprecedented opportunities in this regard. Due to the unparalleled self-recognition properties of DNA molecules, it is possible to create numerous artificial DNA nanostructures with well-defined structures and DNA nanodevices with precisely controlled motions. More importantly, recent studies have proven that DNA nanostructures possess greater permeability to the membrane barrier of cells, which pave the way to developing new drug delivery carriers with nucleic acids, are summarized. In this Concept, recent advances on the design and fabrication of both static and dynamic DNA nanostructures, and the use of these nanostructures for the delivery of various types of drugs, are highlighted. It is also demonstrated that dynamic DNA nanostructures provide the required intelligence to realize logically controlled drug release. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A DNA enzyme that cleaves RNA

    Science.gov (United States)

    Breaker, R. R.; Joyce, G. F.; Hoyce, G. F. (Principal Investigator)

    1994-01-01

    BACKGROUND: Several types of RNA enzymes (ribozymes) have been identified in biological systems and generated in the laboratory. Considering the variety of known RNA enzymes and the similarity of DNA and RNA, it is reasonable to imagine that DNA might be able to function as an enzyme as well. No such DNA enzyme has been found in nature, however. We set out to identify a metal-dependent DNA enzyme using in vitro selection methodology. RESULTS: Beginning with a population of 10(14) DNAs containing 50 random nucleotides, we carried out five successive rounds of selective amplification, enriching for individuals that best promote the Pb(2+)-dependent cleavage of a target ribonucleoside 3'-O-P bond embedded within an otherwise all-DNA sequence. By the fifth round, the population as a whole carried out this reaction at a rate of 0.2 min-1. Based on the sequence of 20 individuals isolated from this population, we designed a simplified version of the catalytic domain that operates in an intermolecular context with a turnover rate of 1 min-1. This rate is about 10(5)-fold increased compared to the uncatalyzed reaction. CONCLUSIONS: Using in vitro selection techniques, we obtained a DNA enzyme that catalyzes the Pb(2+)-dependent cleavage of an RNA phosphoester in a reaction that proceeds with rapid turnover. The catalytic rate compares favorably to that of known RNA enzymes. We expect that other examples of DNA enzymes will soon be forthcoming.

  19. Rapid chemical separations

    CERN Document Server

    Trautmann, N

    1976-01-01

    A survey is given on the progress of fast chemical separation procedures during the last few years. Fast, discontinuous separation techniques are illustrated by a procedure for niobium. The use of such techniques for the chemical characterization of the heaviest known elements is described. Other rapid separation methods from aqueous solutions are summarized. The application of the high speed liquid chromatography to the separation of chemically similar elements is outlined. The use of the gas jet recoil transport method for nuclear reaction products and its combination with a continuous solvent extraction technique and with a thermochromatographic separation is presented. Different separation methods in the gas phase are briefly discussed and the attachment of a thermochromatographic technique to an on-line mass separator is shown. (45 refs).

  20. Direct nanomaterial-DNA contact effects on DNA and mutation induction.

    Science.gov (United States)

    Thongkumkoon, P; Sangwijit, K; Chaiwong, C; Thongtem, S; Singjai, P; Yu, L D

    2014-04-07

    The toxicity of nanomaterials has been well known, but mechanisms involved have been little known. This study was aimed at looking at direct interaction between nanomaterials and naked DNA for some fundamental understanding. Two different types of nanomaterials, carbon nanotubes (CNTs) and tungsten trioxide (WO₃) nanoplates, were simply mixed with naked DNA plasmid, respectively, in two different contact modes, dry or wet (in solution), for varied time periods. DNA topological forms were analyzed for changes using gel electrophoresis and fluoro-spectrometry. The nanomaterial-contacted DNA was transferred into bacteria Escherichia coli (E. coli) cells for mutation observation. Certain types and degrees of DNA damage were observed, such as single strand break and double strand break, and bacterial mutation was confirmed. The DNA damage increased with the contacting time in an exponential manner and increased more rapidly in the initial stage for the wet contact. The nanomaterials-contacted DNA transferred bacteria had about less than 10% survival but almost 100% mutation for the surviving cells. The CNTs were more offensive than the metal oxide nanomaterials. The mutation spectrum from the DNA sequencing analysis showed that DNA point mutation was dominated by transversion, which was dominated by guanine changes in the wet contact condition while by cytosine changes in the dry contact condition. The point mutation occurrence in the wet contact was more than in the dry contact, confirming the wet contact more active and thus dangerous than dry contact. This experiment, although as a model study, revealed that direct simple contacts between nanomaterials and DNA could cause DNA changes and thus induce mutations which might potentially lead to cancers, diseases and genetic changes. This could be a mechanism for nanomaterial genotoxicity to the cells and also provided a caution to applications in using nanomaterials for DNA delivery. Copyright © 2014 Elsevier Ireland

  1. To DNA, all information is equal

    DEFF Research Database (Denmark)

    Sennels, Lau; Bentin, Thomas

    2012-01-01

    Information storage capabilities are key in most aspects of society and the requirement for storage space is rapidly expanding. In principle, DNA could be a high-density medium for information storage. Church and coworkers recently demonstrated how binary data can be encoded, stored in, and retri......Information storage capabilities are key in most aspects of society and the requirement for storage space is rapidly expanding. In principle, DNA could be a high-density medium for information storage. Church and coworkers recently demonstrated how binary data can be encoded, stored in......, and retrieved from a library of oligonucleotides, increasing by several orders of magnitude the amount and density of manmade information stored in DNA to date. The technology remains in its infancy and important hurdles have yet to be overcome in order to realize its potential. However, DNA may be particularly...... useful as a storage-medium over long time-scales (centuries), because data-access is compatible with any large-scale DNA-sequencing and -synthesis technology....

  2. Automated methods for single-stranded DNA isolation and dideoxynucleotide DNA sequencing reactions on a robotic workstation.

    Science.gov (United States)

    Mardis, E R; Roe, B A

    1989-09-01

    Automated procedures have been developed for both the simultaneous isolation of 96 single-stranded M13 chimeric template DNAs in less than two hours, and for simultaneously pipetting 24 dideoxynucleotide sequencing reactions on a commercially available laboratory workstation. The DNA sequencing results obtained by either radiolabeled or fluorescent methods are consistent with the premise that automation of these portions of DNA sequencing projects will improve the reproducibility of the DNA isolation and the procedures for these normally labor-intensive steps provides an approach for rapid acquisition of large amounts of high quality, reproducible DNA sequence data.

  3. Building a rapid response team.

    Science.gov (United States)

    Halvorsen, Lisa; Garolis, Salomeja; Wallace-Scroggs, Allyson; Stenstrom, Judy; Maunder, Richard

    2007-01-01

    The use of rapid response teams is a relatively new approach for decreasing or eliminating codes in acute care hospitals. Based on the principles of a code team for cardiac and/or respiratory arrest in non-critical care units, the rapid response teams have specially trained nursing, respiratory, and medical personnel to respond to calls from general care units to assess and manage decompensating or rapidly changing patients before their conditions escalate to a full code situation. This article describes the processes used to develop a rapid response team, clinical indicators for triggering a rapid response team call, topics addressed in an educational program for the rapid response team members, and methods for evaluating effectiveness of the rapid response team.

  4. DNA Targeting Sequence Improves Magnetic Nanoparticle-Based Plasmid DNA Transfection Efficiency in Model Neurons.

    Science.gov (United States)

    Vernon, Matthew M; Dean, David A; Dobson, Jon

    2015-08-17

    Efficient non-viral plasmid DNA transfection of most stem cells, progenitor cells and primary cell lines currently presents an obstacle for many applications within gene therapy research. From a standpoint of efficiency and cell viability, magnetic nanoparticle-based DNA transfection is a promising gene vectoring technique because it has demonstrated rapid and improved transfection outcomes when compared to alternative non-viral methods. Recently, our research group introduced oscillating magnet arrays that resulted in further improvements to this novel plasmid DNA (pDNA) vectoring technology. Continued improvements to nanomagnetic transfection techniques have focused primarily on magnetic nanoparticle (MNP) functionalization and transfection parameter optimization: cell confluence, growth media, serum starvation, magnet oscillation parameters, etc. Noting that none of these parameters can assist in the nuclear translocation of delivered pDNA following MNP-pDNA complex dissociation in the cell's cytoplasm, inclusion of a cassette feature for pDNA nuclear translocation is theoretically justified. In this study incorporation of a DNA targeting sequence (DTS) feature in the transfecting plasmid improved transfection efficiency in model neurons, presumably from increased nuclear translocation. This observation became most apparent when comparing the response of the dividing SH-SY5Y precursor cell to the non-dividing and differentiated SH-SY5Y neuroblastoma cells.

  5. Ultrasensitive FRET-based DNA sensor using PNA/DNA hybridization.

    Science.gov (United States)

    Yang, Lan-Hee; Ahn, Dong June; Koo, Eunhae

    2016-12-01

    In the diagnosis of genetic diseases, rapid and highly sensitive DNA detection is crucial. Therefore, many strategies for detecting target DNA have been developed, including electrical, optical, and mechanical methods. Herein, a highly sensitive FRET based sensor was developed by using PNA (Peptide Nucleic Acid) probe and QD, in which red color QDs are hybridized with capture probes, reporter probes and target DNAs by EDC-NHS coupling. The hybridized probe with target DNA gives off fluorescent signal due to the energy transfer from QD to Cy5 dye in the reporter probe. Compared to the conventional DNA sensor using DNA probes, the DNA sensor using PNA probes shows higher FRET factor and efficiency due to the higher reactivity between PNA and target DNA. In addition, to elicit the effect of the distance between the donor and the acceptor, we have investigated two types of the reporter probes having Cy5 dyes attached at the different positions of the reporter probes. Results show that the shorter the distance between QDs and Cy5s, the stronger the signal intensity. Furthermore, based on the fluorescence microscopy images using microcapillary chips, the FRET signal is enhanced to be up to 276% times stronger than the signal obtained using the cuvette by the fluorescence spectrometer. These results suggest that the PNA probe system conjugated with QDs can be used as ultrasensitive DNA nanosensors. Copyright © 2016. Published by Elsevier B.V.

  6. A method suitable for DNA extraction from humus-rich soil.

    Science.gov (United States)

    Miao, Tianjin; Gao, Song; Jiang, Shengwei; Kan, Guoshi; Liu, Pengju; Wu, Xianming; An, Yingfeng; Yao, Shuo

    2014-11-01

    A rapid and convenient method for extracting DNA from soil is presented. Soil DNA is extracted by direct cell lysis in the presence of EDTA, SDS, phenol, chloroform and isoamyl alcohol (3-methyl-1-butanol) followed by precipitation with 2-propanol. The extracted DNA is purified by modified DNA purification kit and DNA gel extraction kit. With this method, DNA extracted from humus-rich dark brown forest soil was free from humic substances and, therefore, could be used for efficient PCR amplification and restriction digestion. In contrast, DNA sample extracted with the traditional CTAB-based method had lower yield and purity, and no DNA could be extracted from the same soil sample with a commonly-used commercial soil DNA isolation kit. In addition, this method is time-saving and convenient, providing an efficient choice especially for DNA extraction from humus-rich soils.

  7. Problems of rapid growth.

    Science.gov (United States)

    Kim, T D

    1980-01-01

    South Korea's export-oriented development strategy has achieved a remarkable growth record, but it has also brought 2 different problems: 1) since the country's exports accounted for about 1% of total world export volume, the 1st world has become fearful about Korea's aggressive export drive; and 2) the fact that exports account for over 30% of its total gross national product (GNP) exposes the vulnerability of South Korea's economy itself. South Korea continues to be a poor nation, although it is rated as 1 of the most rapidly growing middle income economies. A World Bank 1978 report shows Korea to be 28th of 58 middle income countries in terms of per capita GNP in 1976. Of 11 newly industrializing countries (NIC), 5 in the European continent are more advanced than the others. A recent emphasis on the basic human needs approach has tended to downgrade the concept of GNP. Korea has only an abundant labor force and is without any natural resources. Consequently, Korea utilized an export-oriented development strategy. Oil requirements are met with imports, and almost all raw materials to be processed into exportable products must be imported. To pay import bills Korea must export and earn foreign exchange. It must be emphasized that foreign trade must always be 2-way traffic. In order to export more to middle income countries like Korea, the countries of the 1st world need to ease their protectionist measures against imports from developing countries.

  8. Rapid Polymer Sequencer

    Science.gov (United States)

    Stolc, Viktor (Inventor); Brock, Matthew W (Inventor)

    2013-01-01

    Method and system for rapid and accurate determination of each of a sequence of unknown polymer components, such as nucleic acid components. A self-assembling monolayer of a selected substance is optionally provided on an interior surface of a pipette tip, and the interior surface is immersed in a selected liquid. A selected electrical field is impressed in a longitudinal direction, or in a transverse direction, in the tip region, a polymer sequence is passed through the tip region, and a change in an electrical current signal is measured as each polymer component passes through the tip region. Each of the measured changes in electrical current signals is compared with a database of reference electrical change signals, with each reference signal corresponding to an identified polymer component, to identify the unknown polymer component with a reference polymer component. The nanopore preferably has a pore inner diameter of no more than about 40 nm and is prepared by heating and pulling a very small section of a glass tubing.

  9. Rapidly rotating red giants

    Science.gov (United States)

    Gehan, Charlotte; Mosser, Benoît; Michel, Eric

    2017-10-01

    Stellar oscillations give seismic information on the internal properties of stars. Red giants are targets of interest since they present mixed modes, wich behave as pressure modes in the convective envelope and as gravity modes in the radiative core. Mixed modes thus directly probe red giant cores, and allow in particular the study of their mean core rotation. The high-quality data obtained by CoRoT and Kepler satellites represent an unprecedented perspective to obtain thousands of measurements of red giant core rotation, in order to improve our understanding of stellar physics in deep stellar interiors. We developed an automated method to obtain such core rotation measurements and validated it for stars on the red giant branch. In this work, we particularly focus on the specific application of this method to red giants having a rapid core rotation. They show complex spectra where it is tricky to disentangle rotational splittings from mixed-mode period spacings. We demonstrate that the method based on the identification of mode crossings is precise and efficient. The determination of the mean core rotation directly derives from the precise measurement of the asymptotic period spacing ΔΠ1 and of the frequency at which the crossing of the rotational components is observed.

  10. Escaping introns in COI through cDNA barcoding of mushrooms: Pleurotus as a test case

    OpenAIRE

    Avin, Farhat A.; Subha, Bhassu; Tan, Yee?Shin; Braukmann, Thomas W. A.; Vikineswary, Sabaratnam; Hebert, Paul D. N.

    2017-01-01

    Abstract DNA barcoding involves the use of one or more short, standardized DNA fragments for the rapid identification of species. A 648?bp segment near the 5? terminus of the mitochondrial cytochrome c oxidase subunit I (COI) gene has been adopted as the universal DNA barcode for members of the animal kingdom, but its utility in mushrooms is complicated by the frequent occurrence of large introns. As a consequence, ITS has been adopted as the standard DNA barcode marker for mushrooms despite ...

  11. DNA tagged microparticles

    Science.gov (United States)

    Farquar, George Roy; Leif, Roald N; Wheeler, Elizabeth

    2015-05-05

    A simulant that includes a carrier and DNA encapsulated in the carrier. Also a method of making a simulant including the steps of providing a carrier and encapsulating DNA in the carrier to produce the simulant.

  12. DNA computing models

    CERN Document Server

    Ignatova, Zoya; Zimmermann, Karl-Heinz

    2008-01-01

    In this excellent text, the reader is given a comprehensive introduction to the field of DNA computing. The book emphasizes computational methods to tackle central problems of DNA computing, such as controlling living cells, building patterns, and generating nanomachines.

  13. Modeling DNA Replication.

    Science.gov (United States)

    Bennett, Joan

    1998-01-01

    Recommends the use of a model of DNA made out of Velcro to help students visualize the steps of DNA replication. Includes a materials list, construction directions, and details of the demonstration using the model parts. (DDR)

  14. Low-Dose Formaldehyde Delays DNA Damage Recognition and DNA Excision Repair in Human Cells

    Science.gov (United States)

    Luch, Andreas; Frey, Flurina C. Clement; Meier, Regula; Fei, Jia; Naegeli, Hanspeter

    2014-01-01

    Objective Formaldehyde is still widely employed as a universal crosslinking agent, preservative and disinfectant, despite its proven carcinogenicity in occupationally exposed workers. Therefore, it is of paramount importance to understand the possible impact of low-dose formaldehyde exposures in the general population. Due to the concomitant occurrence of multiple indoor and outdoor toxicants, we tested how formaldehyde, at micromolar concentrations, interferes with general DNA damage recognition and excision processes that remove some of the most frequently inflicted DNA lesions. Methodology/Principal Findings The overall mobility of the DNA damage sensors UV-DDB (ultraviolet-damaged DNA-binding) and XPC (xeroderma pigmentosum group C) was analyzed by assessing real-time protein dynamics in the nucleus of cultured human cells exposed to non-cytotoxic (formaldehyde concentrations. The DNA lesion-specific recruitment of these damage sensors was tested by monitoring their accumulation at local irradiation spots. DNA repair activity was determined in host-cell reactivation assays and, more directly, by measuring the excision of DNA lesions from chromosomes. Taken together, these assays demonstrated that formaldehyde obstructs the rapid nuclear trafficking of DNA damage sensors and, consequently, slows down their relocation to DNA damage sites thus delaying the excision repair of target lesions. A concentration-dependent effect relationship established a threshold concentration of as low as 25 micromolar for the inhibition of DNA excision repair. Conclusions/Significance A main implication of the retarded repair activity is that low-dose formaldehyde may exert an adjuvant role in carcinogenesis by impeding the excision of multiple mutagenic base lesions. In view of this generally disruptive effect on DNA repair, we propose that formaldehyde exposures in the general population should be further decreased to help reducing cancer risks. PMID:24722772

  15. Rapid Detection of miRNA Using Nucleic Acids-templated AgNCs

    DEFF Research Database (Denmark)

    Shah, Pratik

    MicroRNAs (miRNAs) are small ubiquitous RNA molecules (20-24nt) that negatively regulate target gene expression at the post-transcriptional level. Due to their roles in a variety of biological processes, the levels of miRNAs are dynamically changed in response to cellular and environmental signals....../AgNCs). I have showed that rapid, simple, sensitive and specific miRNA detection is possible. Two aspects of my research are 1) the implication of DNA secondary structure on the photoluminescence properties of DNA/AgNCs, 2) the development of a novel tool for miRNA detection in complex biological samples....... In the former, I revealed that the mismatched secondary structures of DNA-templates are important for the rapid formation of bright red fluorescence. Further, I suggest that the chromatic properties of DNA/AgNCs are modulated not only by sequence but also by secondary structure of DNA-templates. Moreover...

  16. Micro-RNA quantification using DNA polymerase and pyrophosphate quantification.

    Science.gov (United States)

    Yu, Hsiang-Ping; Hsiao, Yi-Ling; Pan, Hung-Yin; Huang, Chih-Hung; Hou, Shao-Yi

    2011-12-15

    A rapid quantification method for micro-RNA based on DNA polymerase activity and pyrophosphate quantification has been developed. The tested micro-RNA serves as the primer, unlike the DNA primer in all DNA sequencing methods, and the DNA probe serves as the template for DNA replication. After the DNA synthesis, the pyrophosphate detection and quantification indicate the existence and quantity of the tested miRNA. Five femtomoles of the synthetic RNA could be detected. In 20-100 μg RNA samples purified from SiHa cells, the measurement was done using the proposed assay in which hsa-miR-16 and hsa-miR-21 are 0.34 fmol/μg RNA and 0.71 fmol/μg RNA, respectively. This simple and inexpensive assay takes less than 5 min after total RNA purification and preparation. The quantification is not affected by the pre-miRNA which cannot serve as the primer for the DNA synthesis in this assay. This assay is general for the detection of the target RNA or DNA with a known matched DNA template probe, which could be widely used for detection of small RNA, messenger RNA, RNA viruses, and DNA. Therefore, the method could be widely used in RNA and DNA assays. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Replicating animal mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Emily A. McKinney

    2013-01-01

    Full Text Available The field of mitochondrial DNA (mtDNA replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading-and lagging-strand synthesis (resembling bacterial genome replication and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS. The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase y, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase. Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.

  18. DNA damage response

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); A. Zotter (Angelika); W. Vermeulen (Wim)

    2011-01-01

    textabstractStructural changes to DNA severely affect its functions, such as replication and transcription, and play a major role in age-related diseases and cancer. A complicated and entangled network ofDNA damage response (DDR) mechanisms, including multiple DNA repair pathways, damage tolerance

  19. DNA Repair Systems

    Indian Academy of Sciences (India)

    nal factors such as UV radiation, high energy radiation such as X-. Keywords. DNA repair, DNA damage, base excision repair, nucleotide exci- sion repair, methlyl-directed mis- match repair, Nobel Prize. rays and gamma rays, mutagenic chemicals and viruses. Different types of DNA ... be especially important in plants.

  20. Rapid mixing kinetic techniques.

    Science.gov (United States)

    Martin, Stephen R; Schilstra, Maria J

    2013-01-01

    Almost all of the elementary steps in a biochemical reaction scheme are either unimolecular or bimolecular processes that frequently occur on sub-second, often sub-millisecond, time scales. The traditional approach in kinetic studies is to mix two or more reagents and monitor the changes in concentrations with time. Conventional spectrophotometers cannot generally be used to study reactions that are complete within less than about 20 s, as it takes that amount of time to manually mix the reagents and activate the instrument. Rapid mixing techniques, which generally achieve mixing in less than 2 ms, overcome this limitation. This chapter is concerned with the use of these techniques in the study of reactions which reach equilibrium; the application of these methods to the study of enzyme kinetics is described in several excellent texts (Cornish-Bowden, Fundamentals of enzyme kinetics. Portland Press, 1995; Gutfreund, Kinetics for the life sciences. Receptors, transmitters and catalysis. Cambridge University Press, 1995).There are various ways to monitor changes in concentration of reactants, intermediates and products after mixing, but the most common way is to use changes in optical signals (absorbance or fluorescence) which often accompany reactions. Although absorbance can sometimes be used, fluorescence is often preferred because of its greater sensitivity, particularly in monitoring conformational changes. Such methods are continuous with good time resolution but they seldom permit the direct determination of the concentrations of individual species. Alternatively, samples may be taken from the reaction volume, mixed with a chemical quenching agent to stop the reaction, and their contents assessed by techniques such as HPLC. These methods can directly determine the concentrations of different species, but are discontinuous and have a limited time resolution.

  1. DNA nanotechnology: new adventures for an old warhorse.

    Science.gov (United States)

    Zakeri, Bijan; Lu, Timothy K

    2015-10-01

    As the blueprint of life, the natural exploits of DNA are admirable. However, DNA should not only be viewed within a biological context. It is an elegantly simple yet functionally complex chemical polymer with properties that make it an ideal platform for engineering new nanotechnologies. Rapidly advancing synthesis and sequencing technologies are enabling novel unnatural applications for DNA beyond the realm of genetics. Here we explore the chemical biology of DNA nanotechnology for emerging applications in communication and digital data storage. Early studies of DNA as an alternative to magnetic and optical storage mediums have not only been promising, but have demonstrated the potential of DNA to revolutionize the way we interact with digital data in the future. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Straightforward Procedure for Laboratory Production of DNA Ladder

    Directory of Open Access Journals (Sweden)

    Vo Thi Thuong Lan

    2012-01-01

    Full Text Available DNA ladder is commonly used to determine the size of DNA fragments by electrophoresis in routine molecular biology laboratories. In this study, we report a new procedure to prepare a DNA ladder that consists of 10 fragments from 100 to 1000 bp. This protocol is a combination of routinely employed methods: cloning, PCR, and partial digestion with restriction enzymes. DNA fragments of 100 bp with unique restriction site at both ends were self-ligated to create a tandem repeat. Once being cloned, the tandem repeat was rapidly amplified by PCR and partially digested by restriction enzymes to produce a ladder containing multimers of the repeated DNA fragments. Our procedure for production of DNA ladder could be simple, time saving, and inexpensive in comparison with current ones widely used in most laboratories.

  3. The mechanism of DNA replication termination in vertebrates

    Science.gov (United States)

    Dewar, James M.; Budzowska, Magda; Walter, Johannes C.

    2015-01-01

    Eukaryotic DNA replication terminates when replisomes from adjacent replication origins converge. Termination involves local completion of DNA synthesis, decatenation of daughter molecules, and replisome disassembly. Termination has been difficult to study because termination events are generally asynchronous and sequence non-specific. To overcome these challenges, we paused converging replisomes with a site-specific barrier in Xenopus egg extracts. Upon removal of the barrier, forks underwent synchronous and site-specific termination, allowing mechanistic dissection of this process. We show that DNA synthesis does not slow detectably as forks approach each other and that leading strands pass each other unhindered before undergoing ligation to downstream lagging strands. Dissociation of CMG helicases occurs only after the final ligation step, and is not required for completion of DNA synthesis, strongly suggesting that converging CMGs pass one another and dissociate from double-stranded DNA. This termination mechanism allows rapid completion of DNA synthesis while avoiding premature replisome disassembly PMID:26322582

  4. Binding by the hepatitis C virus NS3 helicase partially melts duplex DNA.

    Science.gov (United States)

    Raney, Veronica M; Reynolds, Kimberly A; Harrison, Melody K; Harrison, David K; Cameron, Craig E; Raney, Kevin D

    2012-09-25

    Binding of NS3 helicase to DNA was investigated by footprinting with KMnO(4), which reacts preferentially with thymidine residues in single-stranded DNA (ssDNA) compared to those in double-stranded DNA (dsDNA). A distinct pattern of reactivity was observed on ssDNA, which repeated every 8 nucleotides (nt) and is consistent with the known binding site size of NS3. Binding to a DNA substrate containing a partial duplex was also investigated. The DNA contained a 15 nt overhang made entirely of thymidine residues adjacent to a 22 bp duplex that contained thymidine at every other position. Surprisingly, the KMnO(4) reactivity pattern extended from the ssDNA into the dsDNA region of the substrate. Lengthening the partial duplex to 30 bp revealed a similar pattern extending from the ssDNA into the dsDNA, indicating that NS3 binds within the duplex region. Increasing the length of the ssDNA portion of the partial duplex by 4 nt resulted in a shift in the footprinting pattern for the ssDNA by 4 nt, which is consistent with binding to the 3'-end of the ssDNA. However, the footprinting pattern in the dsDNA region was shifted by only 1-2 bp, indicating that binding to the ssDNA-dsDNA region was preferred. Footprinting performed as a function of time indicated that NS3 binds to the ssDNA rapidly, followed by slower binding to the duplex. Hence, multiple molecules of NS3 can bind along a ssDNA-dsDNA partial duplex by interacting with the ssDNA as well as the duplex DNA.

  5. Plasmonic SERS biosensing nanochips for DNA detection.

    Science.gov (United States)

    Ngo, Hoan T; Wang, Hsin-Neng; Fales, Andrew M; Vo-Dinh, Tuan

    2016-03-01

    The development of rapid, cost-effective DNA detection methods for molecular diagnostics at the point-of-care (POC) has been receiving increasing interest. This article reviews several DNA detection techniques based on plasmonic-active nanochip platforms developed in our laboratory over the last 5 years, including the molecular sentinel-on-chip (MSC), the multiplex MSC, and the inverse molecular sentinel-on-chip (iMS-on-Chip). DNA probes were used as the recognition elements, and surface-enhanced Raman scattering (SERS) was used as the signal detection method. Sensing mechanisms were based on hybridization of target sequences and DNA probes, resulting in a distance change between SERS reporters and the nanochip's plasmonic-active surface. As the field intensity of the surface plasmon decays exponentially as a function of distance, the distance change in turn affects SERS signal intensity, thus indicating the presence and capture of the target sequences. Our techniques were single-step DNA detection techniques. Target sequences were detected by simple delivery of sample solutions onto DNA probe-functionalized nanochips and measuring the SERS signal after appropriate incubation times. Target sequence labeling or washing to remove unreacted components was not required, making the techniques simple, easy-to-use, and cost-effective. The usefulness of the nanochip platform-based techniques for medical diagnostics was illustrated by the detection of host genetic biomarkers for respiratory viral infection and of the dengue virus gene.

  6. Monitoring endangered freshwater biodiversity using environmental DNA.

    Science.gov (United States)

    Thomsen, Philip Francis; Kielgast, Jos; Iversen, Lars L; Wiuf, Carsten; Rasmussen, Morten; Gilbert, M Thomas P; Orlando, Ludovic; Willerslev, Eske

    2012-06-01

    Freshwater ecosystems are among the most endangered habitats on Earth, with thousands of animal species known to be threatened or already extinct. Reliable monitoring of threatened organisms is crucial for data-driven conservation actions but remains a challenge owing to nonstandardized methods that depend on practical and taxonomic expertise, which is rapidly declining. Here, we show that a diversity of rare and threatened freshwater animals--representing amphibians, fish, mammals, insects and crustaceans--can be detected and quantified based on DNA obtained directly from small water samples of lakes, ponds and streams. We successfully validate our findings in a controlled mesocosm experiment and show that DNA becomes undetectable within 2 weeks after removal of animals, indicating that DNA traces are near contemporary with presence of the species. We further demonstrate that entire faunas of amphibians and fish can be detected by high-throughput sequencing of DNA extracted from pond water. Our findings underpin the ubiquitous nature of DNA traces in the environment and establish environmental DNA as a tool for monitoring rare and threatened species across a wide range of taxonomic groups. © 2011 Blackwell Publishing Ltd.

  7. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  8. DNA: Structure and function

    DEFF Research Database (Denmark)

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir

    1998-01-01

    This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...... for a long period of time before its information is accessed by the cell. Although DNA plays a critical role as an informational storage molecule, it is by no means as unexciting as a computer tape or disk drive. The structure of the DNA described by Watson and Crick in 1953 is a right handed helix of two...

  9. Archaeal DNA replication.

    Science.gov (United States)

    Kelman, Lori M; Kelman, Zvi

    2014-01-01

    DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed.

  10. Rapid Active Sampling Package

    Science.gov (United States)

    Peters, Gregory

    2010-01-01

    A field-deployable, battery-powered Rapid Active Sampling Package (RASP), originally designed for sampling strong materials during lunar and planetary missions, shows strong utility for terrestrial geological use. The technology is proving to be simple and effective for sampling and processing materials of strength. Although this originally was intended for planetary and lunar applications, the RASP is very useful as a powered hand tool for geologists and the mining industry to quickly sample and process rocks in the field on Earth. The RASP allows geologists to surgically acquire samples of rock for later laboratory analysis. This tool, roughly the size of a wrench, allows the user to cut away swaths of weathering rinds, revealing pristine rock surfaces for observation and subsequent sampling with the same tool. RASPing deeper (.3.5 cm) exposes single rock strata in-situ. Where a geologist fs hammer can only expose unweathered layers of rock, the RASP can do the same, and then has the added ability to capture and process samples into powder with particle sizes less than 150 microns, making it easier for XRD/XRF (x-ray diffraction/x-ray fluorescence). The tool uses a rotating rasp bit (or two counter-rotating bits) that resides inside or above the catch container. The container has an open slot to allow the bit to extend outside the container and to allow cuttings to enter and be caught. When the slot and rasp bit are in contact with a substrate, the bit is plunged into it in a matter of seconds to reach pristine rock. A user in the field may sample a rock multiple times at multiple depths in minutes, instead of having to cut out huge, heavy rock samples for transport back to a lab for analysis. Because of the speed and accuracy of the RASP, hundreds of samples can be taken in one day. RASP-acquired samples are small and easily carried. A user can characterize more area in less time than by using conventional methods. The field-deployable RASP used a Ni

  11. Total serum DNA and DNA integrity: diagnostic value in patients with hepatitis B virus-related hepatocellular carcinoma.

    Science.gov (United States)

    Chen, Hui; Sun, Ling-Yu; Zheng, Hong-Qun; Zhang, Qi-Fan; Jin, Xiao-Ming

    2012-06-01

    This study aimed to test the diagnostic utility of the total serum cell-free DNA (cfDNA) and DNA integrity index for detection of hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC). We initially evaluated the sodium iodide (NaI) method, Triton/Heat/Phenol (THP) protocol and QIAamp Kit for cfDNA extraction. Then cfDNA was isolated from the sera of 80 patients with HBV-related HCC, 80 patients with chronic HBV infection and 50 healthy subjects, and quantified by realtime quantitative polymerase chain reaction (qPCR) amplification of beta-actin genomic DNA fragments using two sets of primers of 100 and 400 bp. DNA integrity was calculated as the ratio of 400 bp to 100 bp β-actin fragments. The THP approach was not only superior to the other two methods in terms of DNA quantity, but also was simpler, more rapid, and less costly. Serum DNA integrity in HCC patients was significantly higher than that in HBV patients or healthy controls. As for total cfDNA levels, although a significant difference was found between HCC patients and healthy individuals, no significant difference was found between HBV patients with and without HCC. DNA integrity was associated with tumour size, TNM stage, lymph node and distant metastasis. DNA integrity had a higher sensitivity and specificity in discriminating HCC from HBV patients than total DNA. The THP method is preferred for extraction of cfDNA. DNA integrity is a promising molecular biomarker for detecting HCC in patients with chronic HBV infection; it reflects the progression and metastatic potential of the tumour. Copyright © 2012 Royal College of Pathologists of Australasia. Published by Elsevier B.V. All rights reserved.

  12. Differential nuclear and mitochondrial DNA preservation in post-mortem teeth with implications for forensic and ancient DNA studies.

    Directory of Open Access Journals (Sweden)

    Denice Higgins

    Full Text Available Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp and one mitochondrial DNA fragment (77 bp showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Furthermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using

  13. Inhibition of cellular DNA synthesis by vesicular stomatitis virus

    Energy Technology Data Exchange (ETDEWEB)

    McGowan, J.J.; Wagner, R.R.

    1981-04-01

    DNA synthesis in mouse myeloma (MPC-11) cells and L cells was rapidly and progressively inhibited by infection with vesicular stomatitis virus (VSV). No significant difference in cellular DNA synthesis inhibition was noted between synchronized and unsynchronized cells, nor did synchronized cells vary in their susceptibility to VSV infection after release from successive thymidine and hydroxyurea blocks. Cellular RNA synthesis was inhibited to about the same extent as DNA synthesis, but cellular protein synthesis was less affected by VSV at the same multiplicity of infection. The effect of VSV on cellular DNA synthesis could not be attributed to degradation of existing DNA or to decreased uptake of deoxynucleoside triphosphates, nor were DNA polymerase and thymidine kinase activities significantly different in VSV-infected and uninfected cell extracts. Analysis by alkaline sucrose gradients of DNA in pulse-labeled uninfected and VSV-infected cells indicated that VSV infection did not appear to influence DNA chain elongation. Cellular DNA synthesis was not significantly inhibited by infection with the VSV polymerase mutant tsG114(I) at the restrictive temperature or by infection with defective-interfering VSV DI-011 (5' end of the genome), but DI-HR-LT (3' end of genome) exhibited initially rapid but not prolonged inhibition of MPC-11 cell DNA synthesis. DNA synthesis inhibitory activity of wild-type VSV was only slowly and partially inactivated by very large doses of UV irradiation. These data suggest that, as in the effect of VSV on cellular RNA synthesis inhibition of cellular DNA synthesis by VSV requires transcription of a small segment of the viral genome.

  14. Rapid Robot Design Validation Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Energid Technologies will create a comprehensive software infrastructure for rapid validation of robotic designs. The software will support push-button validation...

  15. Rapid Robot Design Validation Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Energid Technologies will create a comprehensive software infrastructure for rapid validation of robot designs. The software will support push-button validation...

  16. A rapid molecular approach for chromosomal phasing.

    Directory of Open Access Journals (Sweden)

    John F Regan

    Full Text Available Determining the chromosomal phase of pairs of sequence variants - the arrangement of specific alleles as haplotypes - is a routine challenge in molecular genetics. Here we describe Drop-Phase, a molecular method for quickly ascertaining the phase of pairs of DNA sequence variants (separated by 1-200 kb without cloning or manual single-molecule dilution. In each Drop-Phase reaction, genomic DNA segments are isolated in tens of thousands of nanoliter-sized droplets together with allele-specific fluorescence probes, in a single reaction well. Physically linked alleles partition into the same droplets, revealing their chromosomal phase in the co-distribution of fluorophores across droplets. We demonstrated the accuracy of this method by phasing members of trios (revealing 100% concordance with inheritance information, and demonstrate a common clinical application by phasing CFTR alleles at genomic distances of 11-116 kb in the genomes of cystic fibrosis patients. Drop-Phase is rapid (requiring less than 4 hours, scalable (to hundreds of samples, and effective at long genomic distances (200 kb.

  17. DNA structure and function.

    Science.gov (United States)

    Travers, Andrew; Muskhelishvili, Georgi

    2015-06-01

    The proposal of a double-helical structure for DNA over 60 years ago provided an eminently satisfying explanation for the heritability of genetic information. But why is DNA, and not RNA, now the dominant biological information store? We argue that, in addition to its coding function, the ability of DNA, unlike RNA, to adopt a B-DNA structure confers advantages both for information accessibility and for packaging. The information encoded by DNA is both digital - the precise base specifying, for example, amino acid sequences - and analogue. The latter determines the sequence-dependent physicochemical properties of DNA, for example, its stiffness and susceptibility to strand separation. Most importantly, DNA chirality enables the formation of supercoiling under torsional stress. We review recent evidence suggesting that DNA supercoiling, particularly that generated by DNA translocases, is a major driver of gene regulation and patterns of chromosomal gene organization, and in its guise as a promoter of DNA packaging enables DNA to act as an energy store to facilitate the passage of translocating enzymes such as RNA polymerase. © 2015 FEBS.

  18. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  19. Biophysics of DNA

    CERN Document Server

    Vologodskii, Alexander

    2015-01-01

    Surveying the last sixty years of research, this book describes the physical properties of DNA in the context of its biological functioning. It is designed to enable both students and researchers of molecular biology, biochemistry and physics to better understand the biophysics of DNA, addressing key questions and facilitating further research. The chapters integrate theoretical and experimental approaches, emphasising throughout the importance of a quantitative knowledge of physical properties in building and analysing models of DNA functioning. For example, the book shows how the relationship between DNA mechanical properties and the sequence specificity of DNA-protein binding can be analyzed quantitatively by using our current knowledge of the physical and structural properties of DNA. Theoretical models and experimental methods in the field are critically considered to enable the reader to engage effectively with the current scientific literature on the physical properties of DNA.

  20. Development of DNA probes for Candida albicans

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, L.L.; Hudson, J.B.

    1988-07-01

    An attempt was made to produce DNA probes that could be used as a rapid and efficient means of detecting candidiasis (invasive Candida infection) in immunocompromised patients. Whole DNA from Candida albicans was digested with restriction endonuclease, and the resulting fragments were randomly cloned into a plasmid vector. Several recombinant plasmids were evaluated for cross-hybridization to various other Candida species, other fungal DNAs, and to nonfungal DNAs. Cross reactions were observed between the probes and different yeasts, but none with unrelated DNAs. Some recombinants were genus-specific, and two of these were applied to the analysis of C. albicans growth curves. It became evident that, although both /sup 32/P- and biotin-labelled probes could be made quite sensitive, a possible limitation in their diagnostic potential was the poor liberation of Candida DNA from cells. Thus, better methods of treatment of clinical specimens will be required before such probes will be useful in routine diagnosis.

  1. nDNA-Prot: identification of DNA-binding proteins based on unbalanced classification.

    Science.gov (United States)

    Song, Li; Li, Dapeng; Zeng, Xiangxiang; Wu, Yunfeng; Guo, Li; Zou, Quan

    2014-09-08

    DNA-binding proteins are vital for the study of cellular processes. In recent genome engineering studies, the identification of proteins with certain functions has become increasingly important and needs to be performed rapidly and efficiently. In previous years, several approaches have been developed to improve the identification of DNA-binding proteins. However, the currently available resources are insufficient to accurately identify these proteins. Because of this, the previous research has been limited by the relatively unbalanced accuracy rate and the low identification success of the current methods. In this paper, we explored the practicality of modelling DNA binding identification and simultaneously employed an ensemble classifier, and a new predictor (nDNA-Prot) was designed. The presented framework is comprised of two stages: a 188-dimension feature extraction method to obtain the protein structure and an ensemble classifier designated as imDC. Experiments using different datasets showed that our method is more successful than the traditional methods in identifying DNA-binding proteins. The identification was conducted using a feature that selected the minimum Redundancy and Maximum Relevance (mRMR). An accuracy rate of 95.80% and an Area Under the Curve (AUC) value of 0.986 were obtained in a cross validation. A test dataset was tested in our method and resulted in an 86% accuracy, versus a 76% using iDNA-Prot and a 68% accuracy using DNA-Prot. Our method can help to accurately identify DNA-binding proteins, and the web server is accessible at http://datamining.xmu.edu.cn/~songli/nDNA. In addition, we also predicted possible DNA-binding protein sequences in all of the sequences from the UniProtKB/Swiss-Prot database.

  2. Rapid and precise genotyping of porcine microsatellites.

    Science.gov (United States)

    Yue, G H; Beeckmann, P; Bartenschlager, H; Moser, G; Geldermann, H

    1999-11-01

    Microsatellites are useful markers for genetic mapping and linkage analysis because they are highly polymorphic, abundant in genomes and relatively easily scored with polymerase chain reaction (PCR). A rapid genotyping system for microsatellites was developed, which included multiplex PCRs, multiple use of Hydrolink gels, automated fluorescent detection of fragments on an A.L.F. DNA sequencer, automatic assignment of alleles to each locus and verification of genotypes with a self-developed computer program "Fragtest". Eight multiplex PCRs have been developed to genotype 29 microsatellites for genetic and quantitative trait loci (QTL) mapping on pig chromosomes 6, 7, 12 and 13. Three to six microsatellites could be amplified in one multiplex PCR. Each multiplex reaction required only different concentrations of each pair of primers and a low concentration of dNTP (100 microM). A dNTP concentration of 100 microM proved to be optimal for the coamplification of microsatellites under the concentration of 1.5 mM MgCl2. Using four internal size standards added in each sample, the 5% Hydrolink gel could subsequently be used up to five times (total running time of 500 min) on the A.L.F. automated sequencer without significant loss of resolution and precision of fragment length analysis. Automatic assignment of alleles on each locus using "Fragtest" significantly increased the efficiency and precision of the genotyping. This system is thus a rapid, cheap, and highly discriminating genotyping system.

  3. High-Affinity LNA-DNA Mixmer Probes for Detection of Chromosome-Specific Polymorphisms of 5S rDNA Repeats in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Probst, Aline V

    2018-01-01

    Fluorescence in situ hybridization is a standard technique to visualize specific DNA sequences by hybridization with fluorescent probes and, most commonly, relies on DNA probes generated by nick translation. In this chapter, we describe the use of directly labeled LNA-DNA mixmer probes for the rapid detection of repetitive sequences on Arabidopsis thaliana nuclei spreads. We further demonstrate that due to the high thermal stability of the heteroduplexes and the resulting elevated binding affinity of LNA-DNA mixmer probes for their target DNA, these probes can be used to discriminate between repetitive sequences differing by only a few single nucleotide polymorphisms.

  4. DNA barcodes for biosecurity: invasive species identification

    Science.gov (United States)

    Armstrong, K.F; Ball, S.L

    2005-01-01

    Biosecurity encompasses protecting against any risk through ‘biological harm’, not least being the economic impact from the spread of pest insects. Molecular diagnostic tools provide valuable support for the rapid and accurate identification of morphologically indistinct alien species. However, these tools currently lack standardization. They are not conducive to adaptation by multiple sectors or countries, or to coping with changing pest priorities. The data presented here identifies DNA barcodes as a very promising opportunity to address this. DNA of tussock moth and fruit fly specimens intercepted at the New Zealand border over the last decade were reanalysed using the cox1 sequence barcode approach. Species identifications were compared with the historical dataset obtained by PCR–RFLP of nuclear rDNA. There was 90 and 96% agreement between the methods for these species, respectively. Improvements included previous tussock moth ‘unknowns’ being placed to family, genera or species and further resolution within fruit fly species complexes. The analyses highlight several advantages of DNA barcodes, especially their adaptability and predictive value. This approach is a realistic platform on which to build a much more flexible system, with the potential to be adopted globally for the rapid and accurate identification of invasive alien species. PMID:16214740

  5. Rapid prototyping in medical sciences

    Directory of Open Access Journals (Sweden)

    Ákos Márk Horváth

    2015-09-01

    Full Text Available Even if it sound a bit incredible rapid prototyping (RPT as production method has been used for decades in other professions. Nevertheless medical science just started discover the possibilities of this technology and use the offered benefits of 3D printing. In this paper authors have investigated the pharmaceutical usage of rapid prototyping.

  6. Single molecule study of a processivity clamp sliding on DNA

    Energy Technology Data Exchange (ETDEWEB)

    Laurence, T A; Kwon, Y; Johnson, A; Hollars, C; O?Donnell, M; Camarero, J A; Barsky, D

    2007-07-05

    Using solution based single molecule spectroscopy, we study the motion of the polIII {beta}-subunit DNA sliding clamp ('{beta}-clamp') on DNA. Present in all cellular (and some viral) forms of life, DNA sliding clamps attach to polymerases and allow rapid, processive replication of DNA. In the absence of other proteins, the DNA sliding clamps are thought to 'freely slide' along the DNA; however, the abundance of positively charged residues along the inner surface may create favorable electrostatic contact with the highly negatively charged DNA. We have performed single-molecule measurements on a fluorescently labeled {beta}-clamp loaded onto freely diffusing plasmids annealed with fluorescently labeled primers of up to 90 bases. We find that the diffusion constant for 1D diffusion of the {beta}-clamp on DNA satisfies D {le} 10{sup -14} cm{sup 2}/s, much slower than the frictionless limit of D = 10{sup -10} cm{sup 2}/s. We find that the {beta} clamp remains at the 3-foot end in the presence of E. coli single-stranded binding protein (SSB), which would allow for a sliding clamp to wait for binding of the DNA polymerase. Replacement of SSB with Human RP-A eliminates this interaction; free movement of sliding clamp and poor binding of clamp loader to the junction allows sliding clamp to accumulate on DNA. This result implies that the clamp not only acts as a tether, but also a placeholder.

  7. Application of forensic DNA testing in the legal system.

    Science.gov (United States)

    Primorac, D; Schanfield, M S

    2000-03-01

    DNA technology has taken an irreplaceable position in the field of the forensic sciences. Since 1985, when Peter Gill and Alex Jeffreys first applied DNA technology to forensic problems, to the present, more than 50,000 cases worldwide have been solved through the use of DNA based technology. Although the development of DNA typing in forensic science has been extremely rapid, today we are witnessing a new era of DNA technology including automation and miniaturization. In forensic science, DNA analysis has become "the new form of scientific evidence" and has come under public scrutiny and the demand to show competence. More and more courts admit the DNA based evidence. We believe that in the near future this technology will be generally accepted in the legal system. There are two main applications of DNA analysis in forensic medicine: criminal investigation and paternity testing. In this article we present background information on DNA, human genetics, and the application of DNA analysis to legal problems, as well as the commonly applied respective mathematics.

  8. DNA methylation in plants.

    Science.gov (United States)

    Vanyushin, B F

    2006-01-01

    DNA in plants is highly methylated, containing 5-methylcytosine (m5C) and N6-methyladenine (m6A); m5C is located mainly in symmetrical CG and CNG sequences but it may occur also in other non-symmetrical contexts. m6A but not m5C was found in plant mitochondrial DNA. DNA methylation in plants is species-, tissue-, organelle- and age-specific. It is controlled by phytohormones and changes on seed germination, flowering and under the influence of various pathogens (viral, bacterial, fungal). DNA methylation controls plant growth and development, with particular involvement in regulation of gene expression and DNA replication. DNA replication is accompanied by the appearance of under-methylated, newly formed DNA strands including Okazaki fragments; asymmetry of strand DNA methylation disappears until the end of the cell cycle. A model for regulation of DNA replication by methylation is suggested. Cytosine DNA methylation in plants is more rich and diverse compared with animals. It is carried out by the families of specific enzymes that belong to at least three classes of DNA methyltransferases. Open reading frames (ORF) for adenine DNA methyltransferases are found in plant and animal genomes, and a first eukaryotic (plant) adenine DNA methyltransferase (wadmtase) is described; the enzyme seems to be involved in regulation of the mitochondria replication. Like in animals, DNA methylation in plants is closely associated with histone modifications and it affects binding of specific proteins to DNA and formation of respective transcription complexes in chromatin. The same gene (DRM2) in Arabidopsis thaliana is methylated both at cytosine and adenine residues; thus, at least two different, and probably interdependent, systems of DNA modification are present in plants. Plants seem to have a restriction-modification (R-M) system. RNA-directed DNA methylation has been observed in plants; it involves de novo methylation of almost all cytosine residues in a region of siRNA-DNA

  9. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

    Science.gov (United States)

    Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

    2018-01-01

    ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

  10. Optimised Pre-Analytical Methods Improve KRAS Mutation Detection in Circulating Tumour DNA (ctDNA from Patients with Non-Small Cell Lung Cancer (NSCLC.

    Directory of Open Access Journals (Sweden)

    James L Sherwood

    Full Text Available Non-invasive mutation testing using circulating tumour DNA (ctDNA is an attractive premise. This could enable patients without available tumour sample to access more treatment options.Peripheral blood and matched tumours were analysed from 45 NSCLC patients. We investigated the impact of pre-analytical variables on DNA yield and/or KRAS mutation detection: sample collection tube type, incubation time, centrifugation steps, plasma input volume and DNA extraction kits.2 hr incubation time and double plasma centrifugation (2000 x g reduced overall DNA yield resulting in lowered levels of contaminating genomic DNA (gDNA. Reduced "contamination" and increased KRAS mutation detection was observed using cell-free DNA Blood Collection Tubes (cfDNA BCT (Streck, after 72 hrs following blood draw compared to EDTA tubes. Plasma input volume and use of different DNA extraction kits impacted DNA yield.This study demonstrated that successful ctDNA recovery for mutation detection in NSCLC is dependent on pre-analytical steps. Development of standardised methods for the detection of KRAS mutations from ctDNA specimens is recommended to minimise the impact of pre-analytical steps on mutation detection rates. Where rapid sample processing is not possible the use of cfDNA BCT tubes would be advantageous.

  11. A simple method for purification of herpesvirus DNA

    DEFF Research Database (Denmark)

    Christensen, Laurids Siig; Normann, Preben

    1992-01-01

    A rapid and reliable method for purification of herpesvirus DNA from cell cultures is described. The method is based on the isolation of virus particles and/or nucleocapsids by differential centrifugation and exploits the solubilizing and denaturing capabilities of cesium trifluoroacetate during...... isopycnic centrifugation, so that phenol/chloroform extractions can be omitted. The method was used for the purification of DNA from several members of the Alfaherpesvirinae subfamily....

  12. DNA barcoding and its application to marine zooplankton ecology

    OpenAIRE

    Chaolun Li; Minxiao Wang; Fangping Cheng; Song Sun

    2011-01-01

    As the main components of marine biota, zooplankton play vital roles in the marine biodiversity, trophic relationships and ecosystem dynamics. However, morphological identification of zooplankton is time-consuming and even impossible for some taxa, especially for pelagic larvae. Diversity of marine zooplankton is believed to be underestimated. DNA Barcodes (short DNA sequences for species recognition and discrimination) provide powerful tools for rapid species identification and are quickly a...

  13. Long Dwell-Time Passage of DNA through Nanometer-Scale Pores : Kinetics and Sequence Dependence of Motion

    NARCIS (Netherlands)

    Jetha, N.N.; Feehan, C.; Wiggin, M.; Tabard-Cossa, V.; Marziali, A.

    2011-01-01

    A detailed understanding of the kinetics of DNA motion though nanometer-scale pores is important for the successful development of many of the proposed next-generation rapid DNA sequencing and analysis methods. Many of these approaches require DNA motion through nanopores to be slowed by several

  14. Directed Molecular Evolution Improves the Immunogenicity and Protective Efficacy of a Venezuelan Equine Encephalitis Virus DNA Vaccine

    Science.gov (United States)

    2009-05-01

    Rapid evolution of a protein in vitro by DNA shuffling. Nature 1994;370(6488):389–91. 15] Locher CP, Soong NW, Whalen RG, Punnonen J. Development of...novel vac- cines using DNA shuffling and screening strategies. Curr Opin Mol Ther 2004;6(1):34–9. 16] Whalen RG, Kaiwar R, Soong NW, Punnonen J. DNA

  15. DNA replication and cancer

    DEFF Research Database (Denmark)

    Boyer, Anne-Sophie; Walter, David; Sørensen, Claus Storgaard

    2016-01-01

    A dividing cell has to duplicate its DNA precisely once during the cell cycle to preserve genome integrity avoiding the accumulation of genetic aberrations that promote diseases such as cancer. A large number of endogenous impacts can challenge DNA replication and cells harbor a battery of pathways...... to promote genome integrity during DNA replication. This includes suppressing new replication origin firing, stabilization of replicating forks, and the safe restart of forks to prevent any loss of genetic information. Here, we describe mechanisms by which oncogenes can interfere with DNA replication thereby...... causing DNA replication stress and genome instability. Further, we describe cellular and systemic responses to these insults with a focus on DNA replication restart pathways. Finally, we discuss the therapeutic potential of exploiting intrinsic replicative stress in cancer cells for targeted therapy....

  16. DNA barcoding fishes.

    Science.gov (United States)

    Weigt, Lee A; Driskell, Amy C; Baldwin, Carole C; Ormos, Andrea

    2012-01-01

    This chapter is an overview of the techniques for DNA barcoding of fishes from field collection to DNA sequence analysis. Recommendations for modifications of field protocols and best tissue sampling practices are made. A variety of DNA extraction protocols is provided, including high-throughput robot-assisted methods. A pair of well-tested forward and reverse primers for PCR amplification and sequencing are presented. These primers have been successfully used for DNA barcode on a wide array of marine fish taxa and also work well in most freshwater and cartilaginous fishes. Recipes and cycling protocols for both PCR amplification and sequencing and cleanup methods for the reaction products are provided. A method for the consistent production of high-quality DNA barcodes from DNA sequence data is given and stringent guidelines for judging the quality of raw sequence data are laid out.

  17. Eukaryotic DNA Replication Fork.

    Science.gov (United States)

    Burgers, Peter M J; Kunkel, Thomas A

    2017-06-20

    This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.

  18. How Rapid is Rapid Prototyping? Analysis of ESPADON Programme Results

    Directory of Open Access Journals (Sweden)

    Ian D. Alston

    2003-05-01

    Full Text Available New methodologies, engineering processes, and support environments are beginning to emerge for embedded signal processing systems. The main objectives are to enable defence industry to field state-of-the-art products in less time and with lower costs, including retrofits and upgrades, based predominately on commercial off the shelf (COTS components and the model-year concept. One of the cornerstones of the new methodologies is the concept of rapid prototyping. This is the ability to rapidly and seamlessly move from functional design to the architectural design to the implementation, through automatic code generation tools, onto real-time COTS test beds. In this paper, we try to quantify the term “rapid” and provide results, the metrics, from two independent benchmarks, a radar and sonar beamforming application subset. The metrics show that the rapid prototyping process may be sixteen times faster than a conventional process.

  19. MITOCHONDRIAL DNA- REVOLUTIONARY EVOLUTION

    Directory of Open Access Journals (Sweden)

    Vaidhehi Narayan Nayak

    2017-07-01

    Full Text Available BACKGROUND Mitochondrion, the sausage-shaped organelle residing in the cytoplasm of all eukaryotic cells, apart from being the power house, represents endosymbiotic evolution of a free living organism to intracellular structure. Anthropologically, mitochondrial DNA is the fossilised source to trace the human ancestry particularly of maternal lineage. This article attempts to highlight the various biological functions of mitochondrial DNA (mtDNA with a note on its forensic application.

  20. Effects of thiourea and ammonium bicarbonate on the formation and stability of bifunctional cisplatin-DNA adducts : consequences for the accurate quantification of adducts in (cellular) DNA

    NARCIS (Netherlands)

    Fichtinger-Schepman, A.M.J.; Dijk-Knijnenburg, H.C.M. van; Dijt, F.J.; Velde-Visser, S.D. van der; Berends, F.; Baan, R.A.

    1995-01-01

    Cisplatin reacts with DNA by forming mainly bifunctional adducts via reactive monofunctional intermediates. When freshly platinated DNA was postincubated with thiourea (10 mM, at 23 or 37°C) for periods of up to 24 h, followed by determination of mono- and diadducts, a rapid initial decrease was

  1. DNA ELECTROPHORESIS AT SURFACES

    Energy Technology Data Exchange (ETDEWEB)

    RAFAILOVICH, MIRIAM; SOKOLOV, JONATHAN; GERSAPPE, DILIP

    2003-09-01

    During this year we performed two major projects: I. We developed a detailed theoretical model which complements our experiments on surface DNA electrophoresis. We found that it was possible to enhance the separation of DNA chains by imposing a chemical nanoscale pattern on the surface. This approach utilized the surface interaction effect of the DNA chains with the substrate and is a refinement to our previous method in which DNA chains were separated on homogeneous flat surfaces. By introducing the nano-patterns on the surface, the conformational changes of DNA chains of different lengths can be amplified, which results in the different friction strengths with the substrate surface. Our results also show that, when compared to the DNA electrophoresis performed on homogeneous flat surfaces, nanopatterned surfaces offer a larger window in choosing different surface interactions to achieve separation. II. In collaboration with a large international manufacturer of skin care products we also embarked on a project involving photo toxicity of titanium dioxide nanoparticles, which are a key ingredient in sunscreen and cosmetic lotions. The results clearly implicated the nanoparticles in catalyzing damage to chromosomal DNA. We then used this knowledge to develop a polymer/anti-oxidant coating which prevented the photocatalytic reaction on DNA while still retaining the UV absorptive properties of the nanoparticles. The standard gel electrophoresis was not sufficient in determining the extent of the DNA damage. The conclusions of this study were based predominantly on analysis obtained with the surface electrophoresis method.

  2. DNA origami nanopores.

    Science.gov (United States)

    Bell, Nicholas A W; Engst, Christian R; Ablay, Marc; Divitini, Giorgio; Ducati, Caterina; Liedl, Tim; Keyser, Ulrich F

    2012-01-11

    We demonstrate the assembly of functional hybrid nanopores for single molecule sensing by inserting DNA origami structures into solid-state nanopores. In our experiments, single artificial nanopores based on DNA origami are repeatedly inserted in and ejected from solid-state nanopores with diameters around 15 nm. We show that these hybrid nanopores can be employed for the detection of λ-DNA molecules. Our approach paves the way for future development of adaptable single-molecule nanopore sensors based on the combination of solid-state nanopores and DNA self-assembly. © 2011 American Chemical Society

  3. On site DNA barcoding by nanopore sequencing.

    Directory of Open Access Journals (Sweden)

    Michele Menegon

    Full Text Available Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet's biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities.

  4. DNA Barcoding of Marine Metazoa

    Science.gov (United States)

    Bucklin, Ann; Steinke, Dirk; Blanco-Bercial, Leocadio

    2011-01-01

    More than 230,000 known species representing 31 metazoan phyla populate the world's oceans. Perhaps another 1,000,000 or more species remain to be discovered. There is reason for concern that species extinctions may outpace discovery, especially in diverse and endangered marine habitats such as coral reefs. DNA barcodes (i.e., short DNA sequences for species recognition and discrimination) are useful tools to accelerate species-level analysis of marine biodiversity and to facilitate conservation efforts. This review focuses on the usual barcode region for metazoans: a ˜648 base-pair region of the mitochondrial cytochrome c oxidase subunit I (COI) gene. Barcodes have also been used for population genetic and phylogeographic analysis, identification of prey in gut contents, detection of invasive species, forensics, and seafood safety. More controversially, barcodes have been used to delimit species boundaries, reveal cryptic species, and discover new species. Emerging frontiers are the use of barcodes for rapid and increasingly automated biodiversity assessment by high-throughput sequencing, including environmental barcoding and the use of barcodes to detect species for which formal identification or scientific naming may never be possible.

  5. Probing DNA-DNA electrostatic friction in tight superhelical DNA plies.

    Science.gov (United States)

    Cherstvy, A G

    2009-04-23

    We estimate theoretically the strength of DNA-DNA electrostatic friction forces emerging upon a slow drag of one DNA over another one in a close juxtaposition. For ideally helical DNA duplexes, this friction occurs due to correlations in electrostatic potential near the DNA surface. The latter originate from the intrinsic helicity of DNA phosphates and adsorbed cations on a scale of 3.4 nm. They produce positive-negative charge interlocking along the DNA-DNA contact. For realistic nonideally helical DNAs, where electrostatic potential barriers become decorrelated due to accumulation of mismatches in DNA structure, DNA-DNA frictional forces are strongly impeded. We discuss possibilities of probing the DNA-DNA intermolecular interactions in strongly confined DNA superhelical plies, as obtained in single-molecule experiments.

  6. Excitonic AND Logic Gates on DNA Brick Nanobreadboards

    Science.gov (United States)

    2015-01-01

    A promising application of DNA self-assembly is the fabrication of chromophore-based excitonic devices. DNA brick assembly is a compelling method for creating programmable nanobreadboards on which chromophores may be rapidly and easily repositioned to prototype new excitonic devices, optimize device operation, and induce reversible switching. Using DNA nanobreadboards, we have demonstrated each of these functions through the construction and operation of two different excitonic AND logic gates. The modularity and high chromophore density achievable via this brick-based approach provide a viable path toward developing information processing and storage systems. PMID:25839049

  7. Analysis of epigenetic modifications of DNA in human cells

    DEFF Research Database (Denmark)

    Kristensen, Lasse Sommer; Treppendahl, Marianne Bach; Grønbæk, Kirsten

    2013-01-01

    Epigenetics, the study of somatically heritable changes in gene expression not related to changes in the DNA sequence, is a rapidly expanding research field that plays important roles in healthy as well as in diseased cells. DNA methylation and hydroxymethylation are epigenetic modifications found...... in human cells, which are deeply implicated in normal cellular processes as well as in several major human diseases. Here, a range of different methods for the analyses of DNA methylation and hydroxymethylation at locus-specific and genome-wide scales is described....

  8. A Rapid Coliform Detector Project

    Data.gov (United States)

    National Aeronautics and Space Administration — ORBITEC, in collaboration with Lucigen, proposes a rapid genetic detector for spaceflight water systems to enable real-time detection of E-coli with minimal...

  9. Rapid Multiplex Microbial Detector Project

    Data.gov (United States)

    National Aeronautics and Space Administration — ORBITEC, in collaboration with Lucigen, proposes a rapid nucleic acid-based detector for spaceflight water systems to enable simultaneous quantification of multiple...

  10. Forensic utilization of familial searches in DNA databases.

    Science.gov (United States)

    Gershaw, Cassandra J; Schweighardt, Andrew J; Rourke, Linda C; Wallace, Margaret M

    2011-01-01

    DNA evidence is widely recognized as an invaluable tool in the process of investigation and identification, as well as one of the most sought after types of evidence for presentation to a jury. In the United States, the development of state and federal DNA databases has greatly impacted the forensic community by creating an efficient, searchable system that can be used to eliminate or include suspects in an investigation based on matching DNA profiles - the profile already in the database to the profile of the unknown sample in evidence. Recent changes in legislation have begun to allow for the possibility to expand the parameters of DNA database searches, taking into account the possibility of familial searches. This article discusses prospective positive outcomes of utilizing familial DNA searches and acknowledges potential negative outcomes, thereby presenting both sides of this very complicated, rapidly evolving situation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  11. DNA Damage among Wood Workers Assessed with the Comet Assay

    Science.gov (United States)

    Bruschweiler, Evin Danisman; Wild, Pascal; Huynh, Cong Khanh; Savova-Bianchi, Dessislava; Danuser, Brigitta; Hopf, Nancy B.

    2016-01-01

    Exposure to wood dust, a human carcinogen, is common in wood-related industries, and millions of workers are occupationally exposed to wood dust worldwide. The comet assay is a rapid, simple, and sensitive method for determining DNA damage. The objective of this study was to investigate the DNA damage associated with occupational exposure to wood dust using the comet assay (peripheral blood samples) among nonsmoking wood workers (n = 31, furniture and construction workers) and controls (n = 19). DNA damage was greater in the group exposed to composite wood products compared to the group exposed to natural woods and controls (P < 0.001). No difference in DNA damage was observed between workers exposed to natural woods and controls (P = 0.13). Duration of exposure and current dust concentrations had no effect on DNA damage. In future studies, workers’ exposures should include cumulative dust concentrations and exposures originating from the binders used in composite wood products. PMID:27398027

  12. Recovery of DNA from human teeth by cryogenic grinding.

    Science.gov (United States)

    Sweet, D; Hildebrand, D

    1998-11-01

    DNA has been previously recovered from human teeth for RFLP and PCR-based forensic analysis. In some cases, the maximum amount of undisturbed tooth structure is required for ulterior forensic analysis. But, in most cases, following comprehensive documentation, it is possible to section the tooth longitudinally or horizontally, or crush it to access the DNA-rich core. This technical report describes an alternative method to recover DNA from whole extracted human molar teeth. A 6700 freezer mill was used to pulverize 20 teeth under frozen preparation in liquid nitrogen and sterile conditions. The mean yield of DNA was 30.9 micrograms (18.4 micrograms DNA per gm tooth powder). The resulting fine powder was subjected to organic extraction and subsequently quantified using slot blot hybridization. Aliquots were successfully amplified at three short tandem repeat polymorphic loci. The technique is simple and relatively rapid. Isolation of the samples during pulverization minimizes the risk of contamination.

  13. Hypochlorite-induced damage to DNA, RNA, and polynucleotides

    DEFF Research Database (Denmark)

    Hawkins, Clare Louise; Davies, Michael Jonathan

    2002-01-01

    HOCl damage to DNA, RNA, and polynucleotides. Reaction of HOCl with these materials is shown to yield multiple semistable chloramines (RNHCl/RR'NCl), which are the major initial products, and account for 50-95% of the added HOCl. These chloramines decay by thermal and metal-ion catalyzed processes...... favored exocyclic amines. EPR experiments have also provided evidence for the rapid addition of pyrimidine-derived nitrogen-centered radicals to other nucleobases to give dimers and the oxidation of DNA by radicals derived from preformed nucleoside chloramines. Direct reaction of HOCl with plasmid DNA...... rationalize the preferential formation of chlorinated 2'-deoxycytidine and 2'-deoxyadenosine in DNA and suggest that DNA damage induced by HOCl, and preformed chloramines, occurs at sequence-specific sites....

  14. Conformational dynamics of Thermus aquaticus DNA polymerase I during catalysis.

    Science.gov (United States)

    Xu, Cuiling; Maxwell, Brian A; Suo, Zucai

    2014-08-12

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been performed to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. MICA: desktop software for comprehensive searching of DNA databases

    Directory of Open Access Journals (Sweden)

    Glick Benjamin S

    2006-10-01

    Full Text Available Abstract Background Molecular biologists work with DNA databases that often include entire genomes. A common requirement is to search a DNA database to find exact matches for a nondegenerate or partially degenerate query. The software programs available for such purposes are normally designed to run on remote servers, but an appealing alternative is to work with DNA databases stored on local computers. We describe a desktop software program termed MICA (K-Mer Indexing with Compact Arrays that allows large DNA databases to be searched efficiently using very little memory. Results MICA rapidly indexes a DNA database. On a Macintosh G5 computer, the complete human genome could be indexed in about 5 minutes. The indexing algorithm recognizes all 15 characters of the DNA alphabet and fully captures the information in any DNA sequence, yet for a typical sequence of length L, the index occupies only about 2L bytes. The index can be searched to return a complete list of exact matches for a nondegenerate or partially degenerate query of any length. A typical search of a long DNA sequence involves reading only a small fraction of the index into memory. As a result, searches are fast even when the available RAM is limited. Conclusion MICA is suitable as a search engine for desktop DNA analysis software.

  16. Sensing Viruses by Mechanical Tension of DNA in Responsive Hydrogels

    Directory of Open Access Journals (Sweden)

    Jaeoh Shin

    2014-04-01

    Full Text Available The rapid worldwide spread of severe viral infections, often involving novel mutations of viruses, poses major challenges to our health-care systems. This means that tools that can efficiently and specifically diagnose viruses are much needed. To be relevant for broad applications in local health-care centers, such tools should be relatively cheap and easy to use. In this paper, we discuss the biophysical potential for the macroscopic detection of viruses based on the induction of a mechanical stress in a bundle of prestretched DNA molecules upon binding of viruses to the DNA. We show that the affinity of the DNA to the charged virus surface induces a local melting of the double helix into two single-stranded DNA. This process effects a mechanical stress along the DNA chains leading to an overall contraction of the DNA. Our results suggest that when such DNA bundles are incorporated in a supporting matrix such as a responsive hydrogel, the presence of viruses may indeed lead to a significant, macroscopic mechanical deformation of the matrix. We discuss the biophysical basis for this effect and characterize the physical properties of the associated DNA melting transition. In particular, we reveal several scaling relations between the relevant physical parameters of the system. We promote this DNA-based assay as a possible tool for efficient and specific virus screening.

  17. Deregulated origin licensing leads to chromosomal breaks by rereplication of a gapped DNA template

    National Research Council Canada - National Science Library

    Neelsen, Kai J; Zanini, Isabella M Y; Mijic, Sofija; Herrador, Raquel; Zellweger, Ralph; Ray Chaudhuri, Arnab; Creavin, Kevin D; Blow, J Julian; Lopes, Massimo

    2013-01-01

    .... Investigating the consequences of Early mitotic inhibitor 1 (Emi1) depletion in human cells, previously associated with rereplication, we show by DNA fiber labeling that origin reactivation occurs rapidly, well before accumulation of cells...

  18. DNA barcoding of Cryptosporidium.

    Science.gov (United States)

    Šlapeta, Jan

    2017-11-08

    Cryptosporidium spp. (Apicomplexa) causing cryptosporidiosis are of medical and veterinary significance. The genus Cryptosporidium has benefited from the application of what is considered a DNA-barcoding approach, even before the term 'DNA barcoding' was formally coined. Here, the objective to define the DNA barcode diversity of Cryptosporidium infecting mammals is reviewed and considered to be accomplished. Within the Cryptosporidium literature, the distinction between DNA barcoding and DNA taxonomy is indistinct. DNA barcoding and DNA taxonomy are examined using the latest additions to the growing spectrum of named Cryptosporidium species and within-species and between-species identity is revisited. Ease and availability of whole-genome DNA sequencing of the relatively small Cryptosporidium genome offer an initial perspective on the intra-host diversity. The opportunity emerges to apply a metagenomic approach to purified field/clinical Cryptosporidum isolates. The outstanding question remains a reliable definition of Cryptosporidium phenotype. The complementary experimental infections and metagenome approach will need to be applied simultaneously to address Cryptosporidium phenotype with carefully chosen clinical evaluations enabling identification of virulence factors.

  19. Actinomycin and DNA transcription.

    OpenAIRE

    Sobell, H M

    1985-01-01

    Recent advances in understanding how actinomycin binds to DNA have suggested its mechanism of action. Actinomycin binds to a premelted DNA conformation present within the transcriptional complex. This immobilizes the complex, interfering with the elongation of growing RNA chains. The model has a number of implications for understanding RNA synthesis.

  20. Actinomycin and DNA transcription.

    Science.gov (United States)

    Sobell, H M

    1985-01-01

    Recent advances in understanding how actinomycin binds to DNA have suggested its mechanism of action. Actinomycin binds to a premelted DNA conformation present within the transcriptional complex. This immobilizes the complex, interfering with the elongation of growing RNA chains. The model has a number of implications for understanding RNA synthesis. Images PMID:2410919

  1. Characterization of muntjac DNA

    Energy Technology Data Exchange (ETDEWEB)

    Davis, R.C.

    1981-05-27

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange.

  2. Whose DNA is this?

    DEFF Research Database (Denmark)

    Taroni, Franco; Biedermann, Alex; Vuille, Joëlle

    2013-01-01

    evoked during the international conference "The hidden side of DNA profiles. Artifacts, errors and uncertain evidence" held in Rome (April 27th to 28th, 2012). Indeed, despite the fact that this conference brought together some of the world's leading forensic DNA specialists, it appeared clearly...

  3. Extended DNA Tile Actuators

    DEFF Research Database (Denmark)

    Kristiansen, Martin; Kryger, Mille; Zhang, Zhao

    2012-01-01

    A dynamic linear DNA tile actuator is expanded to three new structures of higher complexity. The original DNA actuator was constructed from a central roller strand which hybridizes with two piston strands by forming two half-crossover junctions. A linear expansion of the actuator is obtained...

  4. Actinomycin and DNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Sobell, H.M.

    1985-08-01

    Recent advances in understanding how actinomycin binds to DNA have suggested its mechanism of action. Actinomycin binds to a premelted DNA conformation present within the transcriptional complex. This immobilizes the complex, interfering with the elongation of growing RNA chains. The model has a number of implications for understanding RNA synthesis.

  5. DNA-cell conjugates

    Science.gov (United States)

    Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki

    2016-05-03

    The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.

  6. Intracellular Delivery of a Planar DNA Origami Structure by the Transferrin-Receptor Internalization Pathway

    DEFF Research Database (Denmark)

    Schaffert, David Henning; Okholm, Anders Hauge; Sørensen, Rasmus Schøler

    2017-01-01

    DNA origami provides rapid access to easily functionalized, nanometer-sized structures making it an intriguing platform for the development of defined drug delivery and sensor systems. Low cellular uptake of DNA nanostructures is a major obstacle in the development of DNA-based delivery platforms....... Herein, significant strong increase in cellular uptake in an established cancer cell line by modifying a planar DNA origami structure with the iron transport protein transferrin (Tf) is demonstrated. A variable number of Tf molecules are coupled to the origami structure using a DNA-directed, site...... on the origami surface....

  7. Premeltons in DNA.

    Science.gov (United States)

    Sobell, Henry M

    2016-03-01

    Premeltons are examples of emergent-structures (i.e., structural-solitons) that arise spontaneously in DNA due to the presence of nonlinear-excitations in its structure. They are of two kinds: B-B (or A-A) premeltons form at specific DNA-regions to nucleate site-specific DNA melting. These are stationary and, being globally-nontopological, undergo breather-motions that allow drugs and dyes to intercalate into DNA. B-A (or A-B) premeltons, on the other hand, are mobile, and being globally-topological, act as phase-boundaries transforming B- into A-DNA during the structural phase-transition. They are not expected to undergo breather motions. A key feature of both types of premeltons is the presence of an intermediate structural-form in their central regions (proposed as being a transition-state intermediate in DNA-melting and in the B- to A-transition), which differs from either A- or B-DNA. Called beta-DNA, this is both metastable and hyperflexible--and contains an alternating sugar-puckering pattern along the polymer backbone combined with the partial unstacking (in its lower energy-forms) of every-other base-pair. Beta-DNA is connected to either B- or to A-DNA on either side by boundaries possessing a gradation of nonlinear structural-change, these being called the kink and the antikink regions. The presence of premeltons in DNA leads to a unifying theory to understand much of DNA physical chemistry and molecular biology. In particular, premeltons are predicted to define the 5' and 3' ends of genes in naked-DNA and DNA in active-chromatin, this having important implications for understanding physical aspects of the initiation, elongation and termination of RNA-synthesis during transcription. For these and other reasons, the model will be of broader interest to the general-audience working in these areas. The model explains a wide variety of data, and carries with it a number of experimental predictions--all readily testable--as will be described in this review.

  8. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...

  9. Advances in DNA photonics

    Science.gov (United States)

    Heckman, Emily M.; Aga, Roberto S.; Fehrman Cory, Emily M.; Ouchen, Fahima; Lesko, Alyssa; Telek, Brian; Lombardi, Jack; Bartsch, Carrie M.; Grote, James G.

    2012-10-01

    In this paper we present our current research in exploring a DNA biopolymer for photonics applications. A new processing technique has been adopted that employs a modified soxhlet-dialysis (SD) rinsing technique to completely remove excess ionic contaminants from the DNA biopolymer, resulting in a material with greater mechanical stability and enhanced performance reproducibility. This newly processed material has been shown to be an excellent material for cladding layers in poled polymer electro-optic (EO) waveguide modulator applications. Thin film poling results are reported for materials using the DNA biopolymer as a cladding layer, as are results for beam steering devices also using the DNA biopolymer. Finally, progress on fabrication of a Mach Zehnder EO modulator with DNA biopolymer claddings using nanoimprint lithography techniques is reported.

  10. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  11. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including......In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  12. Fidelity of DNA polymerases in DNA amplification

    Energy Technology Data Exchange (ETDEWEB)

    Keohavong, P.; Thilly, W.G. (Massachusetts Institute of Technology, Cambridge (USA))

    1989-12-01

    Denaturing gradient gel electrophoresis (DGGE) was used to separate and isolate the products of DNA amplification by polymerase chain reaction (PCR). The strategy permitted direct enumeration and identification of point mutations created by T4, modified T7, Klenow fragment of polymerase I, and Thermus aquaticus (Tag) DNA polymerases. Incorrectly synthesized sequences were separated from the wild type by DGGE as mutant/wild-type heteroduplexes and the heteroduplex fraction was used to calculate the average error rate (mutations per base duplication). The error rate induced in the 104-base-pair low-temperature melting domain of exon 3 of the human hypoxanthine/guanine phosphoribosyltransferase (HPRT) gene was {approx} 3.4 {times} 10{sup {minus}5} for modified T7, 1.3 {times} 10{sup {minus}4} for Klenow fragment, and 2.1 {times} 10{sup {minus}4} for Taq polymerases after a 10{sup 6}-fold amplification. The error rate for T4 DNA polymerase was not more than 3 {times} 10{sup {minus}6} error per base duplication. The predominant mutations were sequenced and found to be transitions of G{center dot}C to A{center dot}T for T4 and modified T7 DNA polymerases, and A{center dot}T to G{center dot}C for Taq polymerase. Klenow fragment induced both possible transitions and deletions of 2 and 4 base pairs.

  13. An effective method for isolation of DNA from pig faeces and comparison of five different methods.

    Science.gov (United States)

    Tang, Jun-ni; Zeng, Zhi-guang; Wang, Hong-ning; Yang, Tai; Zhang, Peng-ju; Li, Yu-ling; Zhang, An-yun; Fan, Wen-qiao; Zhang, Yi; Yang, Xin; Zhao, Su-jun; Tian, Guo-bao; Zou, Li-kou

    2008-12-01

    Polymerase chain reaction (PCR) detection of microorganism in faecal specimens is hampered by poor recovery of DNA and by the presence of PCR inhibitors. In this paper, we describe a new modified method for extracting PCR-quality microbial community DNA from pig faecal samples, which combines the pretreatment with polyformaldehyde, and subsequent DNA lysis in the presence of CTAB, salt, PVP, and beta-mercaptoethanol, followed by isolation of nucleic acids using chloroform (no phenol) based protocol. The method resulted in a 1.3- to 11-fold increase in DNA yield when compared to four other widely used methods. Genomic DNA extracted from all five methods was assessed by both agarose gel electrophoresis and polymerase chain reaction for amplification of 16S rDNA specific fragments. The results showed that the improved method represented a reproducible, simple, and rapid technique for routine DNA extraction from faecal specimens and was notably better than using the QIAamp DNA Stool Mini Kit.

  14. DNA isolation by Chelex-100: an efficient approach to consider in leptospirosis early stages

    Directory of Open Access Journals (Sweden)

    Angel Alberto Noda

    2014-06-01

    Full Text Available Objective: To compare the value of leptospiral DNA extraction procedures from clinical samples for the early diagnosis of leptospirosis. Methods: Three DNA extraction procedures were applied for microbiological analysis, results of QIAmp DNA mini kit (QIAGEN, Germany, CLART HPV kit (GENOMICA, Spain and Chelex-100 assay were compared concerning extraction efficiency, DNA purity and DNA suitability for amplification by specific polymerase chain reaction for pathogenic leptospires from blood, plasma and serum artificially infected. Results: The comparison of extraction methods highlighted the efficiency of Chelex-100 and QIAmp DNA mini kit. Chelex-100 achieved the isolation of the highest concentration of leptospiral DNA from the culture and the spiked samples, with acceptable purities and without inhibitors to PCR. Conclusions: Chelex-100 assay is a rapid and effective approach for DNA isolation in clinical samples having pathogenic leptospires and it could be useful in the early diagnosis of leptospirosis.

  15. An efficient and cost-effective method for DNA extraction from athalassohaline soil using a newly formulated cell extraction buffer

    OpenAIRE

    Narayan, Avinash; Jain, Kunal; Shah, Amita R.; Madamwar, Datta

    2016-01-01

    The present study describes the rapid and efficient indirect lysis method for environmental DNA extraction from athalassohaline soil by newly formulated cell extraction buffer. The available methods are mostly based on direct lysis which leads to DNA shearing and co-extraction of extra cellular DNA that influences the community and functional analysis. Moreover, during extraction of DNA by direct lysis from athalassohaline soil, it was observed that, upon addition of poly ethylene glycol (PEG...

  16. Evaluation of a PCR/DNA Probe Colorimetric Membrane Assay for Identification of Campylobacter spp. in Human Stool Specimens

    OpenAIRE

    Collins, Evelyn; Glennon, Maura; Hanley, Shirley; Murray, Anne-Marie; Cormican, Martin; Smith, Terry; Maher, Majella

    2001-01-01

    DNA was extracted from 50 human stool specimens using the QIAamp DNA stool minikit. PCR amplification was followed by post-PCR hybridization to DNA probes specific for the Campylobacter genus, Campylobacter jejuni, and Campylobacter coli in a colorimetric membrane assay. Thirty-two of 38 culture-positive specimens were PCR/DNA probe positive for C. jejuni. The assay is rapid and simple and can be applied to stool specimens for the detection of Campylobacter.

  17. Partial Purification of a Megadalton DNA Replication Complex by Free Flow Electrophoresis.

    Science.gov (United States)

    Li, Caroline M; Miao, Yunan; Lingeman, Robert G; Hickey, Robert J; Malkas, Linda H

    2016-01-01

    We describe a gentle and rapid method to purify the intact multiprotein DNA replication complex using free flow electrophoresis (FFE). In particular, we applied FFE to purify the human cell DNA synthesome, which is a multiprotein complex that is fully competent to carry-out all phases of the DNA replication process in vitro using a plasmid containing the simian virus 40 (SV40) origin of DNA replication and the viral large tumor antigen (T-antigen) protein. The isolated native DNA synthesome can be of use in studying the mechanism by which mammalian DNA replication is carried-out and how anti-cancer drugs disrupt the DNA replication or repair process. Partially purified extracts from HeLa cells were fractionated in a native, liquid based separation by FFE. Dot blot analysis showed co-elution of many proteins identified as part of the DNA synthesome, including proliferating cell nuclear antigen (PCNA), DNA topoisomerase I (topo I), DNA polymerase δ (Pol δ), DNA polymerase ɛ (Pol ɛ), replication protein A (RPA) and replication factor C (RFC). Previously identified DNA synthesome proteins co-eluted with T-antigen dependent and SV40 origin-specific DNA polymerase activity at the same FFE fractions. Native gels show a multiprotein PCNA containing complex migrating with an apparent relative mobility in the megadalton range. When PCNA containing bands were excised from the native gel, mass spectrometric sequencing analysis identified 23 known DNA synthesome associated proteins or protein subunits.

  18. Fluorescent carbon nanoparticle-based lateral flow biosensor for ultrasensitive detection of DNA.

    Science.gov (United States)

    Takalkar, Sunitha; Baryeh, Kwaku; Liu, Guodong

    2017-12-15

    We report a fluorescent carbon nanoparticle (FCN)-based lateral flow biosensor for ultrasensitive detection of DNA. Fluorescent carbon nanoparticle with a diameter of around 15nm was used as a tag to label a detection DNA probe, which was complementary with the part of target DNA. A capture DNA probe was immobilized on the test zone of the lateral flow biosensor. Sandwich-type hybridization reactions among the FCN-labeled DNA probe, target DNA and capture DNA probe were performed on the lateral flow biosensor. In the presence of target DNA, FCNs were captured on the test zone of the biosensor and the fluorescent intensity of the captured FCNs was measured with a portable fluorescent reader. After systematic optimizations of experimental parameters (the components of running buffers, the concentration of detection DNA probe used in the preparation of FCN-DNA conjugates, the amount of FCN-DNA dispensed on the conjugate pad and the dispensing cycles of the capture DNA probes on the test-zone), the biosensor could detect a minimum concentration of 0.4 fM DNA. This study provides a rapid and low-cost approach for DNA detection with high sensitivity, showing great promise for clinical application and biomedical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. DNA Nanocarriers for Systemic Administration: Characterization and In Vivo Bioimaging in Healthy Mice

    Directory of Open Access Journals (Sweden)

    Stephanie David

    2013-01-01

    Full Text Available We hereby present different DNA nanocarriers consisting of new multimodular systems (MMS, containing the cationic lipid dioleylaminesuccinylparomomycin (DNA MMS DOSP, or bis (guanidinium-tren-cholesterol (DNA MMS BGTC, and DNA lipid nanocapsules (DNA LNCs. Active targeting of the asialoglycoprotein receptor (ASGP-R using galactose as a ligand for DNA MMS (GAL DNA MMS and passive targeting using a polyethylene glycol coating for DNA LNCs (PEG DNA LNCs should improve the properties of these DNA nanocarriers. All systems were characterized via physicochemical methods and the DNA payload of DNA LNCs was quantified for the first time. Afterwards, their biodistribution in healthy mice was analyzed after encapsulation of a fluorescent dye via in vivo biofluorescence imaging (BFI, revealing various distribution profiles depending on the cationic lipid used and their surface characteristics. Furthermore, the two vectors with the best prolonged circulation profile were administered twice in healthy mice revealing that the new DNA MMS DOSP vectors showed no toxicity and the same distribution profile for both injections, contrary to PEG DNA LNCs which showed a rapid clearance after the second injection, certainly due to the accelerated blood clearance phenomenon.

  20. Partial Purification of a Megadalton DNA Replication Complex by Free Flow Electrophoresis.

    Directory of Open Access Journals (Sweden)

    Caroline M Li

    Full Text Available We describe a gentle and rapid method to purify the intact multiprotein DNA replication complex using free flow electrophoresis (FFE. In particular, we applied FFE to purify the human cell DNA synthesome, which is a multiprotein complex that is fully competent to carry-out all phases of the DNA replication process in vitro using a plasmid containing the simian virus 40 (SV40 origin of DNA replication and the viral large tumor antigen (T-antigen protein. The isolated native DNA synthesome can be of use in studying the mechanism by which mammalian DNA replication is carried-out and how anti-cancer drugs disrupt the DNA replication or repair process. Partially purified extracts from HeLa cells were fractionated in a native, liquid based separation by FFE. Dot blot analysis showed co-elution of many proteins identified as part of the DNA synthesome, including proliferating cell nuclear antigen (PCNA, DNA topoisomerase I (topo I, DNA polymerase δ (Pol δ, DNA polymerase ɛ (Pol ɛ, replication protein A (RPA and replication factor C (RFC. Previously identified DNA synthesome proteins co-eluted with T-antigen dependent and SV40 origin-specific DNA polymerase activity at the same FFE fractions. Native gels show a multiprotein PCNA containing complex migrating with an apparent relative mobility in the megadalton range. When PCNA containing bands were excised from the native gel, mass spectrometric sequencing analysis identified 23 known DNA synthesome associated proteins or protein subunits.