WorldWideScience

Sample records for rapidly evolving dna

  1. Phylogenetic utility of rapidly evolving DNA at high taxonomical levels: contrasting matK, trnT-F, and rbcL in basal angiosperms.

    Science.gov (United States)

    Müller, Kai F; Borsch, Thomas; Hilu, Khidir W

    2006-10-01

    The prevailing view in molecular systematics is that relationships among distantly related taxa should be inferred using DNA segments with low rates of evolution. However, recent analyses of sequences from the rapidly evolving matK and trnT-trnF regions yielded well resolved and highly supported trees for early diverging angiosperms. We compare here the phylogenetic structure in matK, trnT-F, and rbcL datasets for the same 42, primarily basal angiosperm taxa. Phylogenetic trees based on matK or trnT-F are far more robust than those based on rbcL. Combined analysis of the rapidly evolving regions provides support for higher-level relationships stronger than that derived from analyses of multi-gene datasets of up to several fold the number of characters analyzed here. In addition to displaying a higher percentage of parsimony-informative characters, the average phylogenetic signal per informative character is significantly higher in the datasets from rapidly evolving DNA than in the more slowly evolving rbcL, as detected using resampling of identical numbers of parsimony-informative characters from the data matrices and subjecting different statistics for overall tree robustness and phylogenetic signal to significance tests. Automated via a set of scripts, the method used here should be easily extendable to comparisons of a broader range of genomic regions for varying taxon samplings. The relative performance of markers correlates not only with a lower mean homoplasy in matK and trnT-trnF compared to rbcL, but in particular correlates negatively with the percentage of sites exhibiting maximum or close to maximum homoplasy. A likelihood ratio test confirms that the rapidly evolving gene matK evolves significantly closer to neutrality, which may be one of the underlying factors for lower levels of overall homoplasy. Our results are in line with evidence from simulation studies suggesting that the deleterious effect of multiple hits in using rapidly evolving DNA at

  2. DNA evolved to minimize frameshift mutations

    OpenAIRE

    Agoni, Valentina

    2013-01-01

    Point mutations can surely be dangerous but what is worst than to lose the reading frame?! Does DNA evolved a strategy to try to limit frameshift mutations?! Here we investigate if DNA sequences effectively evolved a system to minimize frameshift mutations analyzing the transcripts of proteins with high molecular weights.

  3. Satellite DNA: An Evolving Topic

    Directory of Open Access Journals (Sweden)

    Manuel A. Garrido-Ramos

    2017-09-01

    Full Text Available Satellite DNA represents one of the most fascinating parts of the repetitive fraction of the eukaryotic genome. Since the discovery of highly repetitive tandem DNA in the 1960s, a lot of literature has extensively covered various topics related to the structure, organization, function, and evolution of such sequences. Today, with the advent of genomic tools, the study of satellite DNA has regained a great interest. Thus, Next-Generation Sequencing (NGS, together with high-throughput in silico analysis of the information contained in NGS reads, has revolutionized the analysis of the repetitive fraction of the eukaryotic genomes. The whole of the historical and current approaches to the topic gives us a broad view of the function and evolution of satellite DNA and its role in chromosomal evolution. Currently, we have extensive information on the molecular, chromosomal, biological, and population factors that affect the evolutionary fate of satellite DNA, knowledge that gives rise to a series of hypotheses that get on well with each other about the origin, spreading, and evolution of satellite DNA. In this paper, I review these hypotheses from a methodological, conceptual, and historical perspective and frame them in the context of chromosomal organization and evolution.

  4. Satellite DNA: An Evolving Topic.

    Science.gov (United States)

    Garrido-Ramos, Manuel A

    2017-09-18

    Satellite DNA represents one of the most fascinating parts of the repetitive fraction of the eukaryotic genome. Since the discovery of highly repetitive tandem DNA in the 1960s, a lot of literature has extensively covered various topics related to the structure, organization, function, and evolution of such sequences. Today, with the advent of genomic tools, the study of satellite DNA has regained a great interest. Thus, Next-Generation Sequencing (NGS), together with high-throughput in silico analysis of the information contained in NGS reads, has revolutionized the analysis of the repetitive fraction of the eukaryotic genomes. The whole of the historical and current approaches to the topic gives us a broad view of the function and evolution of satellite DNA and its role in chromosomal evolution. Currently, we have extensive information on the molecular, chromosomal, biological, and population factors that affect the evolutionary fate of satellite DNA, knowledge that gives rise to a series of hypotheses that get on well with each other about the origin, spreading, and evolution of satellite DNA. In this paper, I review these hypotheses from a methodological, conceptual, and historical perspective and frame them in the context of chromosomal organization and evolution.

  5. Histone variant innovation in a rapidly evolving chordate lineage

    Directory of Open Access Journals (Sweden)

    Jansen Pascal WTC

    2011-07-01

    Full Text Available Abstract Background Histone variants alter the composition of nucleosomes and play crucial roles in transcription, chromosome segregation, DNA repair, and sperm compaction. Modification of metazoan histone variant lineages occurs on a background of genome architecture that shows global similarities from sponges to vertebrates, but the urochordate, Oikopleura dioica, a member of the sister group to vertebrates, exhibits profound modification of this ancestral architecture. Results We show that a histone complement of 47 gene loci encodes 31 histone variants, grouped in distinct sets of developmental expression profiles throughout the life cycle. A particularly diverse array of 15 male-specific histone variants was uncovered, including a testes-specific H4t, the first metazoan H4 sequence variant reported. Universal histone variants H3.3, CenH3, and H2A.Z are present but O. dioica lacks homologs of macroH2A and H2AX. The genome encodes many H2A and H2B variants and the repertoire of H2A.Z isoforms is expanded through alternative splicing, incrementally regulating the number of acetylatable lysine residues in the functionally important N-terminal "charge patch". Mass spectrometry identified 40 acetylation, methylation and ubiquitylation posttranslational modifications (PTMs and showed that hallmark PTMs of "active" and "repressive" chromatin were present in O. dioica. No obvious reduction in silent heterochromatic marks was observed despite high gene density in this extraordinarily compacted chordate genome. Conclusions These results show that histone gene complements and their organization differ considerably even over modest phylogenetic distances. Substantial innovation among all core and linker histone variants has evolved in concert with adaptation of specific life history traits in this rapidly evolving chordate lineage.

  6. Developing Collective Learning Extension for Rapidly Evolving Information System Courses

    Science.gov (United States)

    Agarwal, Nitin; Ahmed, Faysal

    2017-01-01

    Due to rapidly evolving Information System (IS) technologies, instructors find themselves stuck in the constant game of catching up. On the same hand students find their skills obsolete almost as soon as they graduate. As part of IS curriculum and education, we need to emphasize more on teaching the students "how to learn" while keeping…

  7. A Rapidly Evolving Active Region NOAA 8032 observed on April ...

    Indian Academy of Sciences (India)

    1997-04-15

    The active region NOAA 8032 of April 15, 1997 was observed to evolve rapidly. The GOES X-ray data showed a number of sub-flares and two C-class flares during the 8-9 hours of its evolution. The magnetic evolution of this region is studied to ascertain its role in flare production. Large changes were observed in magnetic ...

  8. ON THE NATURE OF RAPIDLY ROTATING SINGLE EVOLVED STARS

    Energy Technology Data Exchange (ETDEWEB)

    Da Silva, R. Rodrigues; Canto Martins, B. L.; De Medeiros, J. R., E-mail: renan@dfte.ufrn.br [Departamento de Física Teórica e Experimental, Universidade Federal do Rio Grande do Norte, Campus Universitário, Natal RN (Brazil)

    2015-03-01

    We present an analysis of the nature of the rapidly rotating, apparently single giant based on rotational and radial velocity measurements carried out by the CORAVEL spectrometers. From the analyzed sample, composed of 2010 spectroscopic, apparently single, evolved stars of luminosity classes IV, III, II, and Ib with spectral types G and K, we classified 30 stars that presented unusual, moderate to rapid rotation. This work reports, for the first time, the presence of these abnormal rotators among subgiant, bright giant, and Ib supergiant stars. To date, this class of stars was reported only among giant stars of luminosity class III. Most of these abnormal rotators present an IRAS infrared excess, which, in principle, can be related to dust around these stars.

  9. Microsatellites evolve more rapidly in humans than in chimpanzees

    Energy Technology Data Exchange (ETDEWEB)

    Rubinsztein, D.C.; Leggo, J.; Amos, W. [Cambridge Univ. (United Kingdom)

    1995-12-10

    Microsatellites are highly polymorphic markers consisting of varying numbers of tandem repeats. At different loci, these repeats can consist of one to five nucleotides. Microsatellites have been used in many fields of genetics, including genetic mapping, linkage disequilibrium analyses, forensic studies, and population genetics. It is important that we understand their mutational processes better so that they can be exploited optimally for studies of human diversity and evolutionary genetics. We have analyzed 24 microsatellite loci in chimpanzees, East Anglians, and Sub-Saharan Africans. The stepwise-weighted genetic distances between the humans and the chimpanzees and between the two human populations were calculated according to the method described by Deka et al. The ratio of the genetic distances between the chimpanzees and the humans relative to that between the Africans and the East Anglians was more than 10 times smaller than expected. This suggests that microsatellites have evolved more rapidly in humans than in chimpanzees. 12 refs., 1 tab.

  10. How rapidly does the human mitochondrial genome evolve?

    Energy Technology Data Exchange (ETDEWEB)

    Howell, N.; Kubacka, I. [Univ. of Texas Medical Branch, Galveston, TX (United States); Mackey, D.A. [Univ. of Melbourne (Australia)]|[Univ. of Tasmania, Launceston (Australia)

    1996-09-01

    The results of an empirical nucleotide-sequencing approach indicate that the evolution of the human mitochondrial noncoding D-loop is both more rapid and more complex than is revealed by standard phylogenetic approaches. The nucleotide sequence of the D-loop region of the mitochondrial genome was determined for 45 members of a large matrilineal Leber hereditary optic neuropathy pedigree. Two germ-line mutations have arisen in members of one branch of the family, thereby leading to triplasmic descendants with three mitochondrial genotypes. Segregation toward the homoplasmic state can occur within a single generation in some of these descendants, a result that suggests rapid fixation of mitochondrial mutations as a result of developmental bottlenecking. However, slow segregation was observed in other offspring, and therefore no single or simple pattern of segregation can be generalized from the available data. Evidence for rare mtDNA recombination within the D-loop was obtained for one family member. In addition to these germ-line mutations, a somatic mutation was found in the D-loop of one family member. When this genealogical approach was applied to the nucleotide sequences of mitochondrial coding regions, the results again indicated a very rapid rate of evolution. 44 refs., 2 figs., 2 tabs.

  11. Multivariate sexual selection in a rapidly evolving speciation phenotype.

    Science.gov (United States)

    Oh, Kevin P; Shaw, Kerry L

    2013-06-22

    Estimating the fitness surface of rapidly evolving secondary sexual traits can elucidate the origins of sexual isolation and thus speciation. Evidence suggests that sexual selection is highly complex in nature, often acting on multivariate sexual characters that sometimes include non-heritable components of variation, thus presenting a challenge for predicting patterns of sexual trait evolution. Laupala crickets have undergone an explosive species radiation marked by divergence in male courtship song and associated female preferences, yet patterns of sexual selection that might explain this diversification remain unknown. We used female phonotaxis trials to estimate the fitness surface for acoustic characters within one population of Laupala cerasina, a species with marked geographical variation in male song and female preferences. Results suggested significant directional sexual selection on three major song traits, while canonical rotation of the matrix of nonlinear selection coefficients (γ) revealed the presence of significant convex (stabilizing) sexual selection along combinations of characters. Analysis of song variation within and among males indicated significantly higher repeatability along the canonical axis of greatest stabilizing selection than along the axis of greatest linear selection. These results are largely consistent with patterns of song divergence that characterize speciation and suggest that different song characters have the potential to indicate distinct information to females during courtship.

  12. Reproductive behaviour evolves rapidly when intralocus sexual conflict is removed.

    Directory of Open Access Journals (Sweden)

    Stéphanie Bedhomme

    Full Text Available BACKGROUND: Intralocus sexual conflict can inhibit the evolution of each sex towards its own fitness optimum. In a previous study, we confirmed this prediction through the experimental removal of female selection pressures in Drosophila melanogaster, achieved by limiting the expression of all major chromosomes to males. Compared to the control populations (C(1-4 where the genomes are exposed to selection in both sexes, the populations with male-limited genomes (ML(1-4 showed rapid increases in male fitness, whereas the fitness of females expressing ML-evolved chromosomes decreased. METHODOLOGY/PRINCIPAL FINDINGS: Here we examine the behavioural phenotype underlying this sexual antagonism. We show that males expressing the ML genomes have a reduced courtship level but acquire the same number of matings. On the other hand, our data suggest that females expressing the ML genomes had reduced attractiveness, stimulating a lower rate of courtship from males. Moreover, females expressing ML genomes tend to display reduced yeast-feeding behaviour, which is probably linked to the reduction of their fecundity. CONCLUSION/SIGNIFICANCE: These results suggest that reproductive behaviour is shaped by opposing selection on males and females, and that loci influencing attractiveness and foraging were polymorphic for alleles with sexually antagonistic expression patterns prior to ML selection. Hence, intralocus sexual conflict appears to play a role in the evolution of a wide range of fitness-related traits and may be a powerful mechanism for the maintenance of genetic variation in fitness.

  13. Simulating DNA coding sequence evolution with EvolveAGene 3.

    Science.gov (United States)

    Hall, Barry G

    2008-04-01

    Phylogenetic reconstruction based upon multiple alignments of molecular sequences is important to most branches of modern biology and is central to molecular evolution. Understanding the historical relationships among macromolecules depends upon computer programs that implement a variety of analytical methods. Because it is impossible to know those historical relationships with certainty, assessment of the accuracy of methods and the programs that implement them requires the use of programs that realistically simulate the evolution of DNA sequences. EvolveAGene 3 is a realistic coding sequence simulation program that separates mutation from selection and allows the user to set selection conditions, including variable regions of selection intensity within the sequence and variation in intensity of selection over branches. Variation includes base substitutions, insertions, and deletions. To the best of my knowledge, it is the only program available that simulates the evolution of intact coding sequences. Output includes the true tree and true alignments of the resulting coding sequence and corresponding protein sequences. A log file reports the frequencies of each kind of base substitution, the ratio of transition to transversion substitutions, the ratio of indel to base substitution mutations, and the numbers of silent and amino acid replacement mutations. The realism of the data sets has been assessed by comparing the d(N)/d(S) ratio, the ratio of transition to transversion substitutions, and the ratio of indel to base substitution mutations of the simulated data sets with those parameters of real data sets from the "gold standard" BaliBase collection of structural alignments. Results show that the data sets produced by EvolveAGene 3 are very similar to real data sets, and EvolveAGene 3 is therefore a realistic simulation program that can be used to evaluate a variety of programs and methods in molecular evolution.

  14. Genetic basis for rapidly evolved tolerance in the wild ...

    Science.gov (United States)

    Atlantic killifish (Fundulus heteroclitus) residing in some urban and industrialized estuaries of the US eastern seaboard demonstrate recently evolved and extreme tolerance to toxic aryl hydrocarbon pollutants, characterized as dioxin-like compounds (DLCs). Here we provide an unusually comprehensive accounting (69%) through Quantitative Trait Locus (QTL) analysis of the genetic basis for DLC tolerance in killifish inhabiting an urban estuary contaminated with PCB congeners, the most toxic of which are DLCs. Consistent with mechanistic knowledge of DLC toxicity in fish and other vertebrates, the Aryl Hydrocarbon Receptor (ahr2) region accounts for 17% of trait variation; however, QTLs on independent linkage groups and their interactions have even greater explanatory power (44%). QTLs interpreted within the context of recently available Fundulus genomic resources and shared synteny among fish species suggest adaptation via inter-acting components of a complex stress response network. Some QTLs were also enriched in other killifish populations characterized as DLC tolerant and residing in distant urban estuaries contaminated with unique mixtures of pollutants. Together, our results suggest that DLC tolerance in killifish represents an emerging example of parallel contemporary evolution that has been driven by intense human-mediated selection on natural populations. This manuscript describes experimental studies that contribute to our understanding of the ecological

  15. A rapidly evolving secretome builds and patterns a sea shell

    Directory of Open Access Journals (Sweden)

    Green Kathryn

    2006-11-01

    Full Text Available Abstract Background Instructions to fabricate mineralized structures with distinct nanoscale architectures, such as seashells and coral and vertebrate skeletons, are encoded in the genomes of a wide variety of animals. In mollusks, the mantle is responsible for the extracellular production of the shell, directing the ordered biomineralization of CaCO3 and the deposition of architectural and color patterns. The evolutionary origins of the ability to synthesize calcified structures across various metazoan taxa remain obscure, with only a small number of protein families identified from molluskan shells. The recent sequencing of a wide range of metazoan genomes coupled with the analysis of gene expression in non-model animals has allowed us to investigate the evolution and process of biomineralization in gastropod mollusks. Results Here we show that over 25% of the genes expressed in the mantle of the vetigastropod Haliotis asinina encode secreted proteins, indicating that hundreds of proteins are likely to be contributing to shell fabrication and patterning. Almost 85% of the secretome encodes novel proteins; remarkably, only 19% of these have identifiable homologues in the full genome of the patellogastropod Lottia scutum. The spatial expression profiles of mantle genes that belong to the secretome is restricted to discrete mantle zones, with each zone responsible for the fabrication of one of the structural layers of the shell. Patterned expression of a subset of genes along the length of the mantle is indicative of roles in shell ornamentation. For example, Has-sometsuke maps precisely to pigmentation patterns in the shell, providing the first case of a gene product to be involved in molluskan shell pigmentation. We also describe the expression of two novel genes involved in nacre (mother of pearl deposition. Conclusion The unexpected complexity and evolvability of this secretome and the modular design of the molluskan mantle enables

  16. Tissue Microarray: A rapidly evolving diagnostic and research tool

    Science.gov (United States)

    Jawhar, Nazar M.T.

    2009-01-01

    Tissue microarray is a recent innovation in the field of pathology. A microarray contains many small representative tissue samples from hundreds of different cases assembled on a single histologic slide, and therefore allows high throughput analysis of multiple specimens at the same time. Tissue microarrays are paraffin blocks produced by extracting cylindrical tissue cores from different paraffin donor blocks and re-embedding these into a single recipient (microarray) block at defined array coordinates. Using this technique, up to 1000 or more tissue samples can be arrayed into a single paraffin block. It can permit simultaneous analysis of molecular targets at the DNA, mRNA, and protein levels under identical, standardized conditions on a single glass slide, and also provide maximal preservation and use of limited and irreplaceable archival tissue samples. This versatile technique, in which data analysis is automated facilitates retrospective and prospective human tissue studies. It is a practical and effective tool for high-throughput molecular analysis of tissues that is helping to identify new diagnostic and prognostic markers and targets in human cancers, and has a range of potential applications in basic research, prognostic oncology and drug discovery. This article summarizes the technical aspects of tissue microarray construction and sectioning, advantages, application, and limitations. PMID:19318744

  17. EVOLVE

    CERN Document Server

    Deutz, André; Schütze, Oliver; Legrand, Pierrick; Tantar, Emilia; Tantar, Alexandru-Adrian

    2017-01-01

    This book comprises nine selected works on numerical and computational methods for solving multiobjective optimization, game theory, and machine learning problems. It provides extended versions of selected papers from various fields of science such as computer science, mathematics and engineering that were presented at EVOLVE 2013 held in July 2013 at Leiden University in the Netherlands. The internationally peer-reviewed papers include original work on important topics in both theory and applications, such as the role of diversity in optimization, statistical approaches to combinatorial optimization, computational game theory, and cell mapping techniques for numerical landscape exploration. Applications focus on aspects including robustness, handling multiple objectives, and complex search spaces in engineering design and computational biology.

  18. DNA barcoding of the recently evolved genus Holcoglossum (Orchidaceae: Aeridinae): a test of DNA barcode candidates.

    Science.gov (United States)

    Xiang, Xiao-Guo; Hu, Hao; Wang, Wei; Jin, Xiao-Hua

    2011-11-01

    Orchidaceae is one of the largest families of flowering plants. Many species of orchid are endangered, and all species are included in Conventions on International Trade of Endangered Species of Fauna and Flora (CITES) I and II, but it is very difficult to identify orchid species, even those with fertile parts. The genus Holcoglossum (Orchidaceae: Aeridinae) has long been problematic in taxonomy. It consists of both long-evolved and radiated species and is an excellent case to use for testing DNA barcodes for Orchidaceae. We investigated the power of a subset of proposed plant barcoding loci [rbcL, matK, atpF-atpH, psbK-psbI, trnH-psbA and internal transcribed spacer (ITS)] to discriminate between species in this genus. Our results showed that all these DNA regions, except psbK-psbI and atpF-atpH, can be amplified easily from Holcoglossum and sequenced with established primers. The DNA regions matK and ITS had the highest variability. Among the six loci, matK resolved eight of the 12 Holcoglossum species and had the highest discriminatory ability. However, the combination of matK and ITS showed a greater ability to identify species than matK alone. Single or combined DNA markers discriminated between Holcoglossum species distributed in tropical areas effectively, but had less ability to identify radiated species from the temperate Hengduan Mountains of China. In the study, matK proved to be a useful DNA barcode for the genus Holcoglossum; however, complementary DNA regions are still required to accelerate the investigation and preservation of radiated species of orchid. © 2011 Blackwell Publishing Ltd.

  19. A fibre based triature interferometer for measuring rapidly evolving, ablatively driven plasma densities

    Science.gov (United States)

    Macdonald, J.; Bland, S. N.; Threadgold, J.

    2015-08-01

    We report on the first use of a fibre interferometer incorporating triature analysis for measuring rapidly evolving plasma densities of ne ˜ 1013/cm3 and above, such as those produced by simple coaxial plasma guns. The resultant system is extremely portable, easy to field in experiments, relatively cheap to produce, and—with the exception of a small open area in which the plasma is sampled—safe in operation as all laser light is enclosed.

  20. Protein coalitions in a core mammalian biochemical network linked by rapidly evolving proteins

    Directory of Open Access Journals (Sweden)

    Tsoka Sophia

    2011-05-01

    Full Text Available Abstract Background Cellular ATP levels are generated by glucose-stimulated mitochondrial metabolism and determine metabolic responses, such as glucose-stimulated insulin secretion (GSIS from the β-cells of pancreatic islets. We describe an analysis of the evolutionary processes affecting the core enzymes involved in glucose-stimulated insulin secretion in mammals. The proteins involved in this system belong to ancient enzymatic pathways: glycolysis, the TCA cycle and oxidative phosphorylation. Results We identify two sets of proteins, or protein coalitions, in this group of 77 enzymes with distinct evolutionary patterns. Members of the glycolysis, TCA cycle, metabolite transport, pyruvate and NADH shuttles have low rates of protein sequence evolution, as inferred from a human-mouse comparison, and relatively high rates of evolutionary gene duplication. Respiratory chain and glutathione pathway proteins evolve faster, exhibiting lower rates of gene duplication. A small number of proteins in the system evolve significantly faster than co-pathway members and may serve as rapidly evolving adapters, linking groups of co-evolving genes. Conclusions Our results provide insights into the evolution of the involved proteins. We find evidence for two coalitions of proteins and the role of co-adaptation in protein evolution is identified and could be used in future research within a functional context.

  1. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E; Krogsdam, A M; Jorgensen, H F

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  2. De novo ORFs in Drosophila are important to organismal fitness and evolved rapidly from previously non-coding sequences.

    Directory of Open Access Journals (Sweden)

    Josephine A Reinhardt

    Full Text Available How non-coding DNA gives rise to new protein-coding genes (de novo genes is not well understood. Recent work has revealed the origins and functions of a few de novo genes, but common principles governing the evolution or biological roles of these genes are unknown. To better define these principles, we performed a parallel analysis of the evolution and function of six putatively protein-coding de novo genes described in Drosophila melanogaster. Reconstruction of the transcriptional history of de novo genes shows that two de novo genes emerged from novel long non-coding RNAs that arose at least 5 MY prior to evolution of an open reading frame. In contrast, four other de novo genes evolved a translated open reading frame and transcription within the same evolutionary interval suggesting that nascent open reading frames (proto-ORFs, while not required, can contribute to the emergence of a new de novo gene. However, none of the genes arose from proto-ORFs that existed long before expression evolved. Sequence and structural evolution of de novo genes was rapid compared to nearby genes and the structural complexity of de novo genes steadily increases over evolutionary time. Despite the fact that these genes are transcribed at a higher level in males than females, and are most strongly expressed in testes, RNAi experiments show that most of these genes are essential in both sexes during metamorphosis. This lethality suggests that protein coding de novo genes in Drosophila quickly become functionally important.

  3. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    Abstract. There is no 'one' procedure for extracting DNA from the whole blood of both mammals and birds, since each species has a unique property that require different methods to release its own DNA. Therefore, to obtain genomic DNA, a universal, rapid, and noncostly method was developed. A very simple biological ...

  4. Snake venoms are integrated systems, but abundant venom proteins evolve more rapidly.

    Science.gov (United States)

    Aird, Steven D; Aggarwal, Shikha; Villar-Briones, Alejandro; Tin, Mandy Man-Ying; Terada, Kouki; Mikheyev, Alexander S

    2015-08-28

    While many studies have shown that extracellular proteins evolve rapidly, how selection acts on them remains poorly understood. We used snake venoms to understand the interaction between ecology, expression level, and evolutionary rate in secreted protein systems. Venomous snakes employ well-integrated systems of proteins and organic constituents to immobilize prey. Venoms are generally optimized to subdue preferred prey more effectively than non-prey, and many venom protein families manifest positive selection and rapid gene family diversification. Although previous studies have illuminated how individual venom protein families evolve, how selection acts on venoms as integrated systems, is unknown. Using next-generation transcriptome sequencing and mass spectrometry, we examined microevolution in two pitvipers, allopatrically separated for at least 1.6 million years, and their hybrids. Transcriptomes of parental species had generally similar compositions in regard to protein families, but for a given protein family, the homologs present and concentrations thereof sometimes differed dramatically. For instance, a phospholipase A2 transcript comprising 73.4 % of the Protobothrops elegans transcriptome, was barely present in the P. flavoviridis transcriptome (venoms. Protein evolutionary rates were positively correlated with transcriptomic and proteomic abundances, and the most abundant proteins showed positive selection. This pattern holds with the addition of four other published crotaline transcriptomes, from two more genera, and also for the recently published king cobra genome, suggesting that rapid evolution of abundant proteins may be generally true for snake venoms. Looking more broadly at Protobothrops, we show that rapid evolution of the most abundant components is due to positive selection, suggesting an interplay between abundance and adaptation. Given log-scale differences in toxin abundance, which are likely correlated with biosynthetic costs, we

  5. Rodent-specific alternative exons are more frequent in rapidly evolving genes and in paralogs

    Directory of Open Access Journals (Sweden)

    Mironov Andrey A

    2009-06-01

    Full Text Available Abstract Background Alternative splicing is an important mechanism for generating functional and evolutionary diversity of proteins in eukaryotes. Here, we studied the frequency and functionality of recently gained, rodent-specific alternative exons. Results We projected the data about alternative splicing of mouse genes to the rat, human, and dog genomes, and identified exons conserved in the rat genome, but missing in more distant genomes. We estimated the frequency of rodent-specific exons while controlling for possible residual conservation of spurious exons. The frequency of rodent-specific exons is higher among predominantly skipped exons and exons disrupting the reading frame. Separation of all genes by the rate of sequence evolution and by gene families has demonstrated that rodent-specific cassette exons are more frequent in rapidly evolving genes and in rodent-specific paralogs. Conclusion Thus we demonstrated that recently gained exons tend to occur in fast-evolving genes, and their inclusion rate tends to be lower than that of older exons. This agrees with the theory that gain of alternative exons is one of the major mechanisms of gene evolution.

  6. Rapid folding of DNA into nanoscale shapes at constant temperature

    National Research Council Canada - National Science Library

    Sobczak, Jean-Philippe J; Martin, Thomas G; Gerling, Thomas; Dietz, Hendrik

    2012-01-01

    .... Unfolding occurred in apparent equilibrium at higher temperatures than those for folding. Folding at optimized constant temperatures enabled the rapid production of three-dimensional DNA objects with yields that approached 100...

  7. Rapid cleanup of bacterial DNA from samples containing aerosol contaminants

    Science.gov (United States)

    Menking, Darrell E.; Kracke, Suzanne K.; Emanuel, Peter A.; Valdes, James J.

    1999-01-01

    Polymerase Chain Reaction (PCR) is an in vitro enzymatic, synthetic method used to amplify specific DNA sequences from organisms. Detection of DNA using gene probes allows for absolute identification not only of specific organisms, but also of genetic material in recombinant organisms. PCR is an exquisite biological method for detecting bacteria in aerosol samples. A major challenge facing detection of DNA from field samples is that they are almost sure to contain impurities, especially impurities that inhibit amplification through PCR. DNA is being extracted from air, sewage/stool samples, food, sputum, a water and sediment; however, multi- step, time consuming methods are required to isolate the DNA from the surrounding contamination. This research focuses on developing a method for rapid cleanup of DNA which combines extraction and purification of DNA while, at the same time, removing inhibitors from 'dirty samples' to produce purified, PCR-ready DNA. GeneReleaser produces PCR-ready DNA in a rapid five-minute protocol. GeneReleaser resin was able to clean up sample contain micrograms of typical aerosol and water contaminants. The advantages of using GR are that it is rapid, inexpensive, requires one-step, uses no hazardous material and produces PCR-ready DNA.

  8. Cancer immunotherapy: Opportunities and challenges in the rapidly evolving clinical landscape.

    Science.gov (United States)

    Emens, Leisha A; Ascierto, Paolo A; Darcy, Phillip K; Demaria, Sandra; Eggermont, Alexander M M; Redmond, William L; Seliger, Barbara; Marincola, Francesco M

    2017-08-01

    Cancer immunotherapy is now established as a powerful way to treat cancer. The recent clinical success of immune checkpoint blockade (antagonists of CTLA-4, PD-1 and PD-L1) highlights both the universal power of treating the immune system across tumour types and the unique features of cancer immunotherapy. Immune-related adverse events, atypical clinical response patterns, durable responses, and clear overall survival benefit distinguish cancer immunotherapy from cytotoxic cancer therapy. Combination immunotherapies that transform non-responders to responders are under rapid development. Current challenges facing the field include incorporating immunotherapy into adjuvant and neoadjuvant cancer therapy, refining dose, schedule and duration of treatment and developing novel surrogate endpoints that accurately capture overall survival benefit early in treatment. As the field rapidly evolves, we must prioritise the development of biomarkers to guide the use of immunotherapies in the most appropriate patients. Immunotherapy is already transforming cancer from a death sentence to a chronic disease for some patients. By making smart, evidence-based decisions in developing next generation immunotherapies, cancer should become an imminently treatable, curable and even preventable disease. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    ... of both mammals and birds, since each species has a unique property that require different methods to release its own DNA. Therefore, to obtain genomic DNA, a universal, rapid, and noncostly method was developed. A very simple biological basis is followed in this procedure, in which, when the bloodis placed in water, ...

  10. A rapid DNA extraction method suitable for human papillomavirus detection.

    Science.gov (United States)

    Brestovac, Brian; Wong, Michelle E; Costantino, Paul S; Groth, David

    2014-04-01

    Infection with oncogenic human papillomavirus (HPV) genotypes is necessary for the development of cervical cancer. Testing for HPV DNA from liquid based cervical samples can be used as an adjunct to traditional cytological screening. In addition there are ongoing viral load, genotyping, and prevalence studies. Therefore, a sensitive DNA extraction method is needed to maximize the efficiency of HPV DNA detection. The XytXtract Tissue kit is a DNA extraction kit that is rapid and so could be useful for HPV testing, particularly in screening protocols. This study was undertaken to determine the suitability of this method for HPV detection. DNA extraction from HeLa and Caski cell lines containing HPV 18 and 16 respectively together with DNA from five liquid based cervical samples were used in a HPV PCR assay. DNA was also extracted using the QIAamp DNA mini kit (Qiagen, Hilden, Germany) as a comparison. DNA extracts were serially diluted and assayed. HPV DNA was successfully detected in cell lines and cervical samples using the XytXtract Tissue kit. In addition, the XytXtract method was found to be more sensitive than the QIAmp method as determined by a dilution series of the extracted DNA. While the XytXtract method is a closed, the QIAamp method uses a spin column with possible loss of DNA through DNA binding competition of the matrix, which could impact on the final extraction efficiency. The XytXtract is a cheap, rapid and efficient method for extracting HPV DNA from both cell lines and liquid based cervical samples. © 2014 Wiley Periodicals, Inc.

  11. Rapid extraction and preservation of genomic DNA from human samples.

    Science.gov (United States)

    Kalyanasundaram, D; Kim, J-H; Yeo, W-H; Oh, K; Lee, K-H; Kim, M-H; Ryew, S-M; Ahn, S-G; Gao, D; Cangelosi, G A; Chung, J-H

    2013-02-01

    Simple and rapid extraction of human genomic DNA remains a bottleneck for genome analysis and disease diagnosis. Current methods using microfilters require cumbersome, multiple handling steps in part because salt conditions must be controlled for attraction and elution of DNA in porous silica. We report a novel extraction method of human genomic DNA from buccal swab and saliva samples. DNA is attracted onto a gold-coated microchip by an electric field and capillary action while the captured DNA is eluted by thermal heating at 70 °C. A prototype device was designed to handle four microchips, and a compatible protocol was developed. The extracted DNA using microchips was characterized by qPCR for different sample volumes, using different lengths of PCR amplicon, and nuclear and mitochondrial genes. In comparison with a commercial kit, an equivalent yield of DNA extraction was achieved with fewer steps. Room-temperature preservation for 1 month was demonstrated for captured DNA, facilitating straightforward collection, delivery, and handling of genomic DNA in an environment-friendly protocol.

  12. Rapid, Effective DNA Isolation from Osmanthus via Modified Alkaline Lysis.

    Science.gov (United States)

    Alexander, Lisa

    2016-07-01

    Variability of leaf structure and presence of secondary metabolites in mature leaf tissue present a challenge for reliable DNA extraction from Osmanthus species and cultivars. The objective of this study was to develop a universal rapid, effective, and cost-efficient method of DNA isolation for Osmanthus mature leaf tissue. Four different methods were used to isolate DNA from 8 cultivars of Osmanthus. Absorbance spectra, DNA concentration, appearance on agarose gel, and performance in PCR were used to analyze quality, quantity, and integrity of isolated DNA. Methods were ranked in order, based on total quantity, quality, and performance points as the following: 1) solid-phase extraction (SPE), 2) modified alkaline lysis (SDS), 3) cetyltrimethylammonium bromide (CTAB) with chloroform (CHL), and 4) CTAB with phenol/chloroform (PHE). Total DNA, isolated via SPE, showed the least contamination but the lowest mean quantity (9.6 ± 3.4 μg) and highest cost. The highest quantity of DNA was isolated via SDS (117 ± 54.1 μg). SPE and SDS resolved the most individuals on agarose gel, whereas the 2 CTAB methods had poorly resolved gels. All methods except PHE performed well in PCR. Additions to the modified alkaline lysis method increased A260:A230 by up to 59% without affecting yield. With the use of SDS, an average of 1000 μg/g DNA was isolated from fresh leaf tissue of 18 samples in ∼1.5 h at a cost of 0.74 U.S. dollars (USD)/sample. We recommend improved alkaline lysis as a rapid, effective, and cost-efficient method of isolating DNA from Osmanthus species.

  13. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  14. Sequence conservation in avian CR1: an interspersed repetitive DNA family evolving under functional constraints.

    Science.gov (United States)

    Chen, Z Q; Ritzel, R G; Lin, C C; Hodgetts, R B

    1991-07-01

    CR1 is a short interspersed repetitive DNA element originally identified in the domestic chicken (Gallus gallus). However, unlike virtually all other such sequences described to date, CR1 is not confined to one or a few closely related species. It is probably a ubiquitous component of the avian genome, having been detected in representatives of nine orders encompassing a wide spectrum of the class Aves. This identification was made possible by using the polymerase chain reaction (PCR), which revealed interspecific similarities not detected by conventional Southern analysis. DNA sequence comparisons between a CR1 element isolated from a sarus crane (Grus antigone) and those isolated from an emu (Dromaius novaehollandiae) showed that two short highly conserved regions are present. These are included within two regions previously characterized in the CR1 units of domestic fowl. One of these behaves as a transcriptional silencer and the other is a binding site for a nuclear protein. Our observations suggest that CR1 has evolved under functional constraints and that interspersed repetitive sequences as a class may constitute a more significant component of the eukaryotic genome than is generally acknowledged.

  15. Evolving approach and clinical significance of detecting DNA mismatch repair deficiency in colorectal carcinoma.

    Science.gov (United States)

    Shia, Jinru

    2015-09-01

    The last two decades have seen significant advancement in our understanding of colorectal tumors with DNA mismatch repair (MMR) deficiency. The ever-emerging revelations of new molecular and genetic alterations in various clinical conditions have necessitated constant refinement of disease terminology and classification. Thus, a case with the clinical condition of hereditary non-polyposis colorectal cancer as defined by the Amsterdam criteria may be one of Lynch syndrome characterized by a germline defect in one of the several MMR genes, one of the yet-to-be-defined "Lynch-like syndrome" if there is evidence of MMR deficiency in the tumor but no detectable germline MMR defect or tumor MLH1 promoter methylation, or "familial colorectal cancer type X" if there is no evidence of MMR deficiency. The detection of these conditions carries significant clinical implications. The detection tools and strategies are constantly evolving. The Bethesda guidelines symbolize a selective approach that uses clinical information and tumor histology as the basis to select high-risk individuals. Such a selective approach has subsequently been found to have limited sensitivity, and is thus gradually giving way to the alternative universal approach that tests all newly diagnosed colorectal cancers. Notably, the universal approach also has its own limitations; its cost-effectiveness in real practice, in particular, remains to be determined. Meanwhile, technological advances such as the next-generation sequencing are offering the promise of direct genetic testing for MMR deficiency at an affordable cost probably in the near future. This article reviews the up-to-date molecular definitions of the various conditions related to MMR deficiency, and discusses the tools and strategies that have been used in detecting these conditions. Special emphasis will be placed on the evolving nature and the clinical importance of the disease definitions and the detection strategies. Copyright © 2015

  16. Genome-Wide Analysis in Three Fusarium Pathogens Identifies Rapidly Evolving Chromosomes and Genes Associated with Pathogenicity

    Science.gov (United States)

    Sperschneider, Jana; Gardiner, Donald M.; Thatcher, Louise F.; Lyons, Rebecca; Singh, Karam B.; Manners, John M.; Taylor, Jennifer M.

    2015-01-01

    Pathogens and hosts are in an ongoing arms race and genes involved in host–pathogen interactions are likely to undergo diversifying selection. Fusarium plant pathogens have evolved diverse infection strategies, but how they interact with their hosts in the biotrophic infection stage remains puzzling. To address this, we analyzed the genomes of three Fusarium plant pathogens for genes that are under diversifying selection. We found a two-speed genome structure both on the chromosome and gene group level. Diversifying selection acts strongly on the dispensable chromosomes in Fusarium oxysporum f. sp. lycopersici and on distinct core chromosome regions in Fusarium graminearum, all of which have associations with virulence. Members of two gene groups evolve rapidly, namely those that encode proteins with an N-terminal [SG]-P-C-[KR]-P sequence motif and proteins that are conserved predominantly in pathogens. Specifically, 29 F. graminearum genes are rapidly evolving, in planta induced and encode secreted proteins, strongly pointing toward effector function. In summary, diversifying selection in Fusarium is strongly reflected as genomic footprints and can be used to predict a small gene set likely to be involved in host–pathogen interactions for experimental verification. PMID:25994930

  17. Sensationalistic journalism and tales of snakebite: are rattlesnakes rapidly evolving more toxic venom?

    Science.gov (United States)

    Hayes, William K; Mackessy, Stephen P

    2010-03-01

    Recent reports in the lay press have suggested that bites by rattlesnakes in the last several years have been more severe than those in the past. The explanation, often citing physicians, is that rattlesnakes are evolving more toxic venom, perhaps in response to anthropogenic causes. We suggest that other explanations are more parsimonious, including factors dependent on the snake and factors associated with the bite victim's response to envenomation. Although bites could become more severe from an increased proportion of bites from larger or more provoked snakes (ie, more venom injected), the venom itself evolves much too slowly to explain the severe symptoms occasionally seen. Increased snakebite severity could also result from a number of demographic changes in the victim profile, including age and body size, behavior toward the snake (provocation), anatomical site of bite, clothing, and general health including asthma prevalence and sensitivity to foreign antigens. Clinical management of bites also changes perpetually, rendering comparisons of snakebite severity over time tenuous. Clearly, careful study taking into consideration many factors will be essential to document temporal changes in snakebite severity or venom toxicity. Presently, no published evidence for these changes exists. The sensationalistic coverage of these atypical bites and accompanying speculation is highly misleading and can produce many detrimental results, such as inappropriate fear of the outdoors and snakes, and distraction from proven snakebite management needs, including a consistent supply of antivenom, adequate health care, and training. We urge healthcare providers to avoid propagating misinformation about snakes and snakebites. Copyright (c) 2010 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  18. Extraction of DNA by magnetic ionic liquids: tunable solvents for rapid and selective DNA analysis.

    Science.gov (United States)

    Clark, Kevin D; Nacham, Omprakash; Yu, Honglian; Li, Tianhao; Yamsek, Melissa M; Ronning, Donald R; Anderson, Jared L

    2015-02-03

    DNA extraction represents a significant bottleneck in nucleic acid analysis. In this study, hydrophobic magnetic ionic liquids (MILs) were synthesized and employed as solvents for the rapid and efficient extraction of DNA from aqueous solution. The DNA-enriched microdroplets were manipulated by application of a magnetic field. The three MILs examined in this study exhibited unique DNA extraction capabilities when applied toward a variety of DNA samples and matrices. High extraction efficiencies were obtained for smaller single-stranded and double-stranded DNA using the benzyltrioctylammonium bromotrichloroferrate(III) ([(C8)3BnN(+)][FeCl3Br(-)]) MIL, while the dicationic 1,12-di(3-hexadecylbenzimidazolium)dodecane bis[(trifluoromethyl)sulfonyl]imide bromotrichloroferrate(III) ([(C16BnIM)2C12(2+)][NTf2(-), FeCl3Br(-)]) MIL produced higher extraction efficiencies for larger DNA molecules. The MIL-based method was also employed for the extraction of DNA from a complex matrix containing albumin, revealing a competitive extraction behavior for the trihexyl(tetradecyl)phosphonium tetrachloroferrate(III) ([P6,6,6,14(+)][FeCl4(-)]) MIL in contrast to the [(C8)3BnN(+)][FeCl3Br(-)] MIL, which resulted in significantly less coextraction of albumin. The MIL-DNA method was employed for the extraction of plasmid DNA from bacterial cell lysate. DNA of sufficient quality and quantity for polymerase chain reaction (PCR) amplification was recovered from the MIL extraction phase, demonstrating the feasibility of MIL-based DNA sample preparation prior to downstream analysis.

  19. Highly Rapid Amplification-Free and Quantitative DNA Imaging Assay

    Science.gov (United States)

    Klamp, Tobias; Camps, Marta; Nieto, Benjamin; Guasch, Francesc; Ranasinghe, Rohan T.; Wiedemann, Jens; Petrášek, Zdeněk; Schwille, Petra; Klenerman, David; Sauer, Markus

    2013-01-01

    There is an urgent need for rapid and highly sensitive detection of pathogen-derived DNA in a point-of-care (POC) device for diagnostics in hospitals and clinics. This device needs to work in a ‘sample-in-result-out’ mode with minimum number of steps so that it can be completely integrated into a cheap and simple instrument. We have developed a method that directly detects unamplified DNA, and demonstrate its sensitivity on realistically sized 5 kbp target DNA fragments of Micrococcus luteus in small sample volumes of 20 μL. The assay consists of capturing and accumulating of target DNA on magnetic beads with specific capture oligonucleotides, hybridization of complementary fluorescently labeled detection oligonucleotides, and fluorescence imaging on a miniaturized wide-field fluorescence microscope. Our simple method delivers results in less than 20 minutes with a limit of detection (LOD) of ~5 pM and a linear detection range spanning three orders of magnitude. PMID:23677392

  20. Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

    Science.gov (United States)

    Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

    2016-01-01

    Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample

  1. Rapid and effective DNA extraction method with bead grinding for a large amount of fungal DNA.

    Science.gov (United States)

    Watanabe, M; Lee, K; Goto, K; Kumagai, S; Sugita-Konishi, Y; Hara-Kudo, Y

    2010-06-01

    To identify a rapid method for extracting a large amount of DNA from fungi associated with food hygiene, extraction methods were compared using fungal pellets formed rapidly in liquid media. Combinations of physical and chemical methods or commercial kits were evaluated with 3 species of yeast, 10 species of ascomycetous molds, and 4 species of zygomycetous molds. Bead grinding was the physical method, followed by chemical methods involving sodium dodecyl sulfate (SDS), cetyl trimethyl ammonium bromide (CTAB), and benzyl chloride and two commercial kits. Quantity was calculated by UV absorbance at 260 nm, quality was determined by the ratio of UV absorbance at 260 and 280 nm, and gene amplifications and electrophoresis profiles of whole genomes were analyzed. Bead grinding with the SDS method was the most effective for DNA extraction for yeasts and ascomycetous molds, and bead grinding with the CTAB method was most effective with zygomycetous molds. For both groups of molds, bead grinding with the CTAB method was the best approach for DNA extraction. Because this combination also is relatively effective for yeasts, it can be used to extract a large amount of DNA from a wide range of fungi. The DNA extraction methods are useful for developing gene indexes to identify fungi with molecular techniques, such as DNA fingerprinting.

  2. Navigating the Perfect Storm: Research Strategies for Socialecological Systems in a Rapidly Evolving World

    Science.gov (United States)

    Dearing, John A.; Bullock, Seth; Costanza, Robert; Dawson, Terry P.; Edwards, Mary E.; Poppy, Guy M.; Smith, Graham M.

    2012-04-01

    The `Perfect Storm' metaphor describes a combination of events that causes a surprising or dramatic impact. It lends an evolutionary perspective to how social-ecological interactions change. Thus, we argue that an improved understanding of how social-ecological systems have evolved up to the present is necessary for the modelling, understanding and anticipation of current and future social-ecological systems. Here we consider the implications of an evolutionary perspective for designing research approaches. One desirable approach is the creation of multi-decadal records produced by integrating palaeoenvironmental, instrument and documentary sources at multiple spatial scales. We also consider the potential for improved analytical and modelling approaches by developing system dynamical, cellular and agent-based models, observing complex behaviour in social-ecological systems against which to test systems dynamical theory, and drawing better lessons from history. Alongside these is the need to find more appropriate ways to communicate complex systems, risk and uncertainty to the public and to policy-makers.

  3. From Rapid to Delayed and Remote Postconditioning: the Evolving Concept of Ischemic Postconditioning in Brain Ischemia

    Science.gov (United States)

    Zhao, Heng; Ren, Chuancheng; Chen, Xingmiao; Shen, Jiangang

    2012-01-01

    Ischemic postconditioning is a concept originally defined to contrast with that of ischemic preconditioning. While both preconditioning and postconditioning confer a neuroprotective effect on brain ischemia, preconditioning is a sublethal insult performed in advance of brain ischemia, and postconditioning, which conventionally refers to a series of brief occlusions and reperfusions of the blood vessels, is conducted after ischemia/reperfusion. In this article, we first briefly review the history of preconditioning, including the experimentation that initially uncovered its neuroprotective effects and later revealed its underlying mechanisms-of-action. We then discuss how preconditioning research evolved into that of postconditioning – a concept that now represents a broad range of stimuli or triggers, including delayed postconditioning, pharmacological postconditioning, remote postconditioning – and its underlying protective mechanisms involving the Akt, MAPK, PKC and KATP channel cell-signaling pathways. Because the concept of postconditioning is so closely associated with that of preconditioning, and both share some common protective mechanisms, we also discuss whether a combination of preconditioning and postconditioning offers greater protection than preconditioning or postconditioning alone. PMID:22204317

  4. Cloning of novel rice blast resistance genes from two rapidly evolving NBS-LRR gene families in rice.

    Science.gov (United States)

    Guo, Changjiang; Sun, Xiaoguang; Chen, Xiao; Yang, Sihai; Li, Jing; Wang, Long; Zhang, Xiaohui

    2016-01-01

    Most rice blast resistance genes (R-genes) encode proteins with nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. Our previous study has shown that more rice blast R-genes can be cloned in rapidly evolving NBS-LRR gene families. In the present study, two rapidly evolving R-gene families in rice were selected for cloning a subset of genes from their paralogs in three resistant rice lines. A total of eight functional blast R-genes were identified among nine NBS-LRR genes, and some of these showed resistance to three or more blast strains. Evolutionary analysis indicated that high nucleotide diversity of coding regions served as important parameters in the determination of gene resistance. We also observed that amino-acid variants (nonsynonymous mutations, insertions, or deletions) in essential motifs of the NBS domain contribute to the blast resistance capacity of NBS-LRR genes. These results suggested that the NBS regions might also play an important role in resistance specificity determination. On the other hand, different splicing patterns of introns were commonly observed in R-genes. The results of the present study contribute to improving the effectiveness of R-gene identification by using evolutionary analysis method and acquisition of novel blast resistance genes.

  5. Towards rapid prototyped convective microfluidic DNA amplification platform

    Science.gov (United States)

    Ajit, Smrithi; Praveen, Hemanth Mithun; Puneeth, S. B.; Dave, Abhishek; Sesham, Bharat; Mohan, K. N.; Goel, Sanket

    2017-02-01

    Today, Polymerase Chain Reaction (PCR) based DNA amplification plays an indispensable role in the field of biomedical research. Its inherent ability to exponentially amplify sample DNA has proven useful for the identification of virulent pathogens like those causing Multiple Drug-Resistant Tuberculosis (MDR-TB). The intervention of Microfluidics technology has revolutionized the concept of PCR from being a laborious and time consuming process into one that is faster, easily portable and capable of being multifunctional. The Microfluidics based PCR outweighs its traditional counterpart in terms of flexibility of varying reaction rate, operation simplicity, need of a fraction of volume and capability of being integrated with other functional elements. The scope of the present work involves the development of a real-time continuous flow microfluidic device, fabricated by 3D printing-governed rapid prototyping method, eventually leading to an automated and robust platform to process multiple DNA samples for detection of MDRTB-associated mutations. The thermal gradient characteristic to the PCR process is produced using peltier units appropriate to the microfluidic environment fully monitored and controlled by a low cost controller driven by a Data Acquisition System. The process efficiency achieved in the microfluidic environment in terms of output per cycle is expected to be on par with the traditional PCR and capable of earning the additional advantages of being faster and minimizing the handling.

  6. Multilocus DNA Sequence Comparisons Rapidly Identify Pathogenic Molds

    Science.gov (United States)

    Rakeman, Jennifer L.; Bui, Uyen; LaFe, Karen; Chen, Yi-Ching; Honeycutt, Rhonda J.; Cookson, Brad T.

    2005-01-01

    The increasing incidence of opportunistic fungal infections necessitates rapid and accurate identification of the associated fungi to facilitate optimal patient treatment. Traditional phenotype-based identification methods utilized in clinical laboratories rely on the production and recognition of reproductive structures, making identification difficult or impossible when these structures are not observed. We hypothesized that DNA sequence analysis of multiple loci is useful for rapidly identifying medically important molds. Our study included the analysis of the D1/D2 hypervariable region of the 28S ribosomal gene and the internal transcribed spacer (ITS) regions 1 and 2 of the rRNA operon. Two hundred one strains, including 143 clinical isolates and 58 reference and type strains, representing 43 recognized species and one possible new species, were examined. We generated a phenotypically validated database of 118 diagnostic alleles. DNA length polymorphisms detected among ITS1 and ITS2 PCR products can differentiate 20 of 33 species of molds tested, and ITS DNA sequence analysis permits identification of all species tested. For 42 of 44 species tested, conspecific strains displayed >99% sequence identity at ITS1 and ITS2; sequevars were detected in two species. For all 44 species, identifications by genotypic and traditional phenotypic methods were 100% concordant. Because dendrograms based on ITS sequence analysis are similar in topology to 28S-based trees, we conclude that ITS sequences provide phylogenetically valid information and can be utilized to identify clinically important molds. Additionally, this phenotypically validated database of ITS sequences will be useful for identifying new species of pathogenic molds. PMID:16000456

  7. Rapid genomic DNA changes in allotetraploid fish hybrids.

    Science.gov (United States)

    Wang, J; Ye, L H; Liu, Q Z; Peng, L Y; Liu, W; Yi, X G; Wang, Y D; Xiao, J; Xu, K; Hu, F Z; Ren, L; Tao, M; Zhang, C; Liu, Y; Hong, Y H; Liu, S J

    2015-06-01

    Rapid genomic change has been demonstrated in several allopolyploid plant systems; however, few studies focused on animals. We addressed this issue using an allotetraploid lineage (4nAT) of freshwater fish originally derived from the interspecific hybridization of red crucian carp (Carassius auratus red var., ♀, 2n=100) × common carp (Cyprinus carpio L., ♂, 2n=100). We constructed a bacterial artificial chromosome (BAC) library from allotetraploid hybrids in the 20th generation (F20) and sequenced 14 BAC clones representing a total of 592.126 kb, identified 11 functional genes and estimated the guanine-cytosine content (37.10%) and the proportion of repetitive elements (17.46%). The analysis of intron evolution using nine orthologous genes across a number of selected fish species detected a gain of 39 introns and a loss of 30 introns in the 4nAT lineage. A comparative study based on seven functional genes among 4nAT, diploid F1 hybrids (2nF1) (first generation of hybrids) and their original parents revealed that both hybrid types (2nF1 and 4nAT) not only inherited genomic DNA from their parents, but also demonstrated rapid genomic DNA changes (homoeologous recombination, parental DNA fragments loss and formation of novel genes). However, 4nAT presented more genomic variations compared with their parents than 2nF1. Interestingly, novel gene fragments were found for the iqca1 gene in both hybrid types. This study provided a preliminary genomic characterization of allotetraploid F20 hybrids and revealed evolutionary and functional genomic significance of allopolyploid animals.

  8. Origin of a rapidly evolving homeostatic control system programming testis function.

    Science.gov (United States)

    Bu, Pengli; Yagi, Shintaro; Shiota, Kunio; Alam, S M Khorshed; Vivian, Jay L; Wolfe, Michael W; Rumi, M A Karim; Chakraborty, Damayanti; Kubota, Kaiyu; Dhakal, Pramod; Soares, Michael J

    2017-08-01

    Mammals share common strategies for regulating reproduction, including a conserved hypothalamic-pituitary-gonadal axis; yet, individual species exhibit differences in reproductive performance. In this report, we describe the discovery of a species-restricted homeostatic control system programming testis growth and function. Prl3c1 is a member of the prolactin gene family and its protein product (PLP-J) was discovered as a uterine cytokine contributing to the establishment of pregnancy. We utilized mouse mutagenesis of Prl3c1 and revealed its involvement in the regulation of the male reproductive axis. The Prl3c1-null male reproductive phenotype was characterized by testiculomegaly and hyperandrogenism. The larger testes in the Prl3c1-null mice were associated with an expansion of the Leydig cell compartment. Prl3c1 locus is a template for two transcripts (Prl3c1-v1 and Prl3c1-v2) expressed in a tissue-specific pattern. Prl3c1-v1 is expressed in uterine decidua, while Prl3c1-v2 is expressed in Leydig cells of the testis. 5'RACE, chromatin immunoprecipitation and DNA methylation analyses were used to define cell-specific promoter usage and alternative transcript expression. We examined the Prl3c1 locus in five murid rodents and showed that the testicular transcript and encoded protein are the result of a recent retrotransposition event at the Mus musculus Prl3c1 locus. Prl3c1-v1 encodes PLP-J V1 and Prl3c1-v2 encodes PLP-J V2. Each protein exhibits distinct intracellular targeting and actions. PLP-J V2 possesses Leydig cell-static actions consistent with the Prl3c1-null testicular phenotype. Analysis of the biology of the Prl3c1 gene has provided insight into a previously unappreciated homeostatic setpoint control system programming testicular growth and function. © 2017 Society for Endocrinology.

  9. Consumer Health Informatics: Past, Present, and Future of a Rapidly Evolving Domain.

    Science.gov (United States)

    Demiris, G

    2016-05-20

    Consumer Health Informatics (CHI) is a rapidly growing domain within the field of biomedical and health informatics. The objective of this paper is to reflect on the past twenty five years and showcase informatics concepts and applications that led to new models of care and patient empowerment, and to predict future trends and challenges for the next 25 years. We discuss concepts and systems based on a review and analysis of published literature in the consumer health informatics domain in the last 25 years. The field was introduced with the vision that one day patients will be in charge of their own health care using informatics tools and systems. Scientific literature in the field originally focused on ways to assess the quality and validity of available printed health information, only to grow significantly to cover diverse areas such as online communities, social media, and shared decision-making. Concepts such as home telehealth, mHealth, and the quantified-self movement, tools to address transparency of health care organizations, and personal health records and portals provided significant milestones in the field. Consumers are able to actively participate in the decision-making process and to engage in health care processes and decisions. However, challenges such as health literacy and the digital divide have hindered us from maximizing the potential of CHI tools with a significant portion of underserved populations unable to access and utilize them. At the same time, at a global scale consumer tools can increase access to care for underserved populations in developing countries. The field continues to grow and emerging movements such as precision medicine and the sharing economy will introduce new opportunities and challenges.

  10. Linking rapid magma reservoir assembly and eruption trigger mechanisms at evolved Yellowstone-type supervolcanoes

    Science.gov (United States)

    Wotzlaw, J.F.; Bindeman, I.N.; Watts, Kathryn E.; Schmitt, A.K.; Caricchi, L.; Schaltegger, U.

    2014-01-01

    The geological record contains evidence of volcanic eruptions that were as much as two orders of magnitude larger than the most voluminous eruption experienced by modern civilizations, the A.D. 1815 Tambora (Indonesia) eruption. Perhaps nowhere on Earth are deposits of such supereruptions more prominent than in the Snake River Plain–Yellowstone Plateau (SRP-YP) volcanic province (northwest United States). While magmatic activity at Yellowstone is still ongoing, the Heise volcanic field in eastern Idaho represents the youngest complete caldera cycle in the SRP-YP, and thus is particularly instructive for current and future volcanic activity at Yellowstone. The Heise caldera cycle culminated 4.5 Ma ago in the eruption of the ∼1800 km3 Kilgore Tuff. Accessory zircons in the Kilgore Tuff display significant intercrystalline and intracrystalline oxygen isotopic heterogeneity, and the vast majority are 18O depleted. This suggests that zircons crystallized from isotopically distinct magma batches that were generated by remelting of subcaldera silicic rocks previously altered by low-δ18O meteoric-hydrothermal fluids. Prior to eruption these magma batches were assembled and homogenized into a single voluminous reservoir. U-Pb geochronology of isotopically diverse zircons using chemical abrasion–isotope dilution–thermal ionization mass spectrometry yielded indistinguishable crystallization ages with a weighted mean 206Pb/238U date of 4.4876 ± 0.0023 Ma (MSWD = 1.5; n = 24). These zircon crystallization ages are also indistinguishable from the sanidine 40Ar/39Ar dates, and thus zircons crystallized close to eruption. This requires that shallow crustal melting, assembly of isolated batches into a supervolcanic magma reservoir, homogenization, and eruption occurred extremely rapidly, within the resolution of our geochronology (103–104 yr). The crystal-scale image of the reservoir configuration, with several isolated magma batches, is very similar to the

  11. Rapidly evolving marmoset MSMB genes are differently expressed in the male genital tract

    Directory of Open Access Journals (Sweden)

    Ceder Yvonne

    2009-09-01

    Full Text Available Abstract Background Beta-microseminoprotein, an abundant component in prostatic fluid, is encoded by the potential tumor suppressor gene MSMB. Some New World monkeys carry several copies of this gene, in contrast to most mammals, including humans, which have one only. Here we have investigated the background for the species difference by analyzing the chromosomal organization and expression of MSMB in the common marmoset (Callithrix jacchus. Methods Genes were identified in the Callithrix jacchus genome database using bioinformatics and transcripts were analyzed by RT-PCR and quantified by real time PCR in the presence of SYBR green. Results The common marmoset has five MSMB: one processed pseudogene and four functional genes. The latter encompass homologous genomic regions of 32-35 kb, containing the genes of 12-14 kb and conserved upstream and downstream regions of 14-19 kb and 3-4 kb. One gene, MSMB1, occupies the same position on the chromosome as the single human gene. On the same chromosome, but several Mb away, is another MSMB locus situated with MSMB2, MSMB3 and MSMB4 arranged in tandem. Measurements of transcripts demonstrated that all functional genes are expressed in the male genital tract, generating very high transcript levels in the prostate. The transcript levels in seminal vesicles and testis are two and four orders of magnitude lower. A single gene, MSMB3, accounts for more than 90% of MSMB transcripts in both the prostate and the seminal vesicles, whereas in the testis around half of the transcripts originate from MSMB2. These genes display rapid evolution with a skewed distribution of mutated nucleotides; in MSMB2 they affect nucleotides encoding the N-terminal Greek key domain, whereas in MSMB3 it is the C-terminal MSMB-unique domain that is affected. Conclusion Callitrichide monkeys have four functional MSMB that are all expressed in the male genital tract, but the product from one gene, MSMB3, will predominate in seminal

  12. The Genomics, Epigenomics, and Transcriptomics of HPV-Associated Oropharyngeal Cancer--Understanding the Basis of a Rapidly Evolving Disease.

    Science.gov (United States)

    Lechner, M; Fenton, T R

    2016-01-01

    Human papillomavirus (HPV) has been shown to represent a major independent risk factor for head and neck squamous cell cancer, in particular for oropharyngeal carcinoma. This type of cancer is rapidly evolving in the Western world, with rising trends particularly in the young, and represents a distinct epidemiological, clinical, and molecular entity. It is the aim of this review to give a detailed description of genomic, epigenomic, transcriptomic, and posttranscriptional changes that underlie the phenotype of this deadly disease. The review will also link these changes and examine what is known about the interactions between the host genome and viral genome, and investigate changes specific for the viral genome. These data are then integrated into an updated model of HPV-induced head and neck carcinogenesis. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Patient with rapidly evolving neurological disease with neuropathological lesions of Creutzfeldt-Jakob disease, Lewy body dementia, chronic subcortical vascular encephalopathy and meningothelial meningioma.

    Science.gov (United States)

    Vita, Maria Gabriella; Tiple, Dorina; Bizzarro, Alessandra; Ladogana, Anna; Colaizzo, Elisa; Capellari, Sabina; Rossi, Marcello; Parchi, Piero; Masullo, Carlo; Pocchiari, Maurizio

    2017-04-01

    We report a case of rapidly evolving neurological disease in a patient with neuropathological lesions of Creutzfeldt-Jakob disease (CJD), Lewy body dementia (LBD), chronic subcortical vascular encephalopathy and meningothelial meningioma. The coexistence of severe multiple pathologies in a single patient strengthens the need to perform accurate clinical differential diagnoses in rapidly progressive dementias. © 2016 Japanese Society of Neuropathology.

  14. Rapid quantification of DNA libraries for next-generation sequencing.

    Science.gov (United States)

    Buehler, Bernd; Hogrefe, Holly H; Scott, Graham; Ravi, Harini; Pabón-Peña, Carlos; O'Brien, Scott; Formosa, Rachel; Happe, Scott

    2010-04-01

    The next-generation DNA sequencing workflows require an accurate quantification of the DNA molecules to be sequenced which assures optimal performance of the instrument. Here, we demonstrate the use of qPCR for quantification of DNA libraries used in next-generation sequencing. In addition, we find that qPCR quantification may allow improvements to current NGS workflows, including reducing the amount of library DNA required, increasing the accuracy in quantifying amplifiable DNA, and avoiding amplification bias by reducing or eliminating the need to amplify DNA before sequencing. Copyright 2010. Published by Elsevier Inc.

  15. Fast-Evolving Mitochondrial DNA in Ceriantharia: A Reflection of Hexacorallia Paraphyly?

    Science.gov (United States)

    Stampar, Sérgio N.; Maronna, Maximiliano M.; Kitahara, Marcelo V.; Reimer, James D.; Morandini, André C.

    2014-01-01

    The low evolutionary rate of mitochondrial genes in Anthozoa has challenged their utility for phylogenetic and systematic purposes, especially for DNA barcoding. However, the evolutionary rate of Ceriantharia, one of the most enigmatic “orders” within Anthozoa, has never been specifically examined. In this study, the divergence of mitochondrial DNA of Ceriantharia was compared to members of other Anthozoa and Medusozoa groups. In addition, nuclear markers were used to check the relative phylogenetic position of Ceriantharia in relation to other Cnidaria members. The results demonstrated a pattern of divergence of mitochondrial DNA completely different from those estimated for other anthozoans, and phylogenetic analyses indicate that Ceriantharia is not included within hexacorallians in most performed analyses. Thus, we propose that the Ceriantharia should be addressed as a separate clade. PMID:24475157

  16. Fast-evolving mitochondrial DNA in Ceriantharia: a reflection of hexacorallia paraphyly?

    Directory of Open Access Journals (Sweden)

    Sérgio N Stampar

    Full Text Available The low evolutionary rate of mitochondrial genes in Anthozoa has challenged their utility for phylogenetic and systematic purposes, especially for DNA barcoding. However, the evolutionary rate of Ceriantharia, one of the most enigmatic "orders" within Anthozoa, has never been specifically examined. In this study, the divergence of mitochondrial DNA of Ceriantharia was compared to members of other Anthozoa and Medusozoa groups. In addition, nuclear markers were used to check the relative phylogenetic position of Ceriantharia in relation to other Cnidaria members. The results demonstrated a pattern of divergence of mitochondrial DNA completely different from those estimated for other anthozoans, and phylogenetic analyses indicate that Ceriantharia is not included within hexacorallians in most performed analyses. Thus, we propose that the Ceriantharia should be addressed as a separate clade.

  17. Experimental phylogeny of neutrally evolving DNA sequences generated by a bifurcate series of nested polymerase chain reactions.

    Science.gov (United States)

    Sanson, Gerdine F O; Kawashita, Silvia Y; Brunstein, Adriana; Briones, Marcelo R S

    2002-02-01

    A known phylogeny was generated using a four-step serial bifurcate PCR method. The ancestor sequence (SSU rDNA) evolved in vitro for 280 nested PCR cycles, and the resulting 15 ancestor and 16 terminal sequences (2,238 bp each) were determined. Parsimony, distance, and maximum likelihood analysis of the terminal sequences reconstructed the topology of the real phylogeny and branch lengths accurately. Divergence dates and ancestor sequences were estimated with very small error, particularly at the base of the phylogeny, mostly due to insertion and deletion changes. The substitution patterns along the known phylogeny are not described by reversible models, and accordingly, the probability substitution matrix, based on the observed substitutions from ancestor to terminal nodes along the known phylogeny, was calculated. This approach is an extension of previous studies using bacteriophage serial propagation, because here mutations were allowed to occur neutrally rather than by addition of a mutagenic agent, which produced biased mutational changes. These results provide for the first time biochemical experimental support for phylogenies, divergence date estimates, and an irreversible substitution model based on neutrally evolving DNA sequences. The substitution preferences observed here (A to G and T to C) are consistent with the high G+C content of the Thermus aquaticus genome. This suggests, at least in part, that the method here described, which explores the high Taq DNA polymerase error rate, simulates the evolution of a DNA segment in a thermophilic organism. These organisms include the bacterial rod T. aquaticus and several Archaea, and thus, the method and data set described here may well contribute new insights about the genome evolution of these organisms.

  18. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    reagents for 'all in one' / ready to use tool to extract genomic. DNA (gDNA) from a very wide spectrum of blood samples. To meet these criteria, a universal and versatile DNA extrac- tion procedure should be developed with minimal chemicals and equipment. On the other hand, the interesting natural relation between RBCs ...

  19. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... To evaluate the efficiency of the genomic DNA in the processes in which DNA is used as a template, the polymerase chain reaction ... purity and concentration is of common processes in molecular research and clinical ... these methods, using chemical compounds or physical methods to lysis the cell is the ...

  20. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  1. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    Total DNA of Chokanan mango (Mangifera indica L.) was extracted from the leaf for the construction of total genomic library. However, the quality of the extracted DNA was often compromised by the presence of secondary metabolites, thus interfering with the analytical applications. Improvement on the quality of the ...

  2. LTR retrotransposons in rice (Oryza sativa, L.: recent burst amplifications followed by rapid DNA loss

    Directory of Open Access Journals (Sweden)

    Panaud Olivier

    2007-07-01

    Full Text Available Abstract Background LTR retrotransposons are one of the main causes for plant genome size and structure evolution, along with polyploidy. The characterization of their amplification and subsequent elimination of the genomes is therefore a major goal in plant evolutionary genomics. To address the extent and timing of these forces, we performed a detailed analysis of 41 LTR retrotransposon families in rice. Results Using a new method to estimate the insertion date of both truncated and complete copies, we estimated these two forces more accurately than previous studies based on other methods. We show that LTR retrotransposons have undergone bursts of amplification within the past 5 My. These bursts vary both in date and copy number among families, revealing that each family has a particular amplification history. The number of solo LTR varies among families and seems to correlate with LTR size, suggesting that solo LTR formation is a family-dependent process. The deletion rate estimate leads to the prediction that the half-life of LTR retrotransposon sequences evolving neutrally is about 19 My in rice, suggesting that other processes than the formation of small deletions are prevalent in rice DNA removal. Conclusion Our work provides insights into the dynamics of LTR retrotransposons in the rice genome. We show that transposable element families have distinct amplification patterns, and that the turn-over of LTR retrotransposons sequences is rapid in the rice genome.

  3. Rapid isolation of yeast genomic DNA: Bust n' Grab

    Directory of Open Access Journals (Sweden)

    Peterson Kenneth R

    2004-04-01

    Full Text Available Abstract Background Mutagenesis of yeast artificial chromosomes (YACs often requires analysis of large numbers of yeast clones to obtain correctly targeted mutants. Conventional ways to isolate yeast genomic DNA utilize either glass beads or enzymatic digestion to disrupt yeast cell wall. Using small glass beads is messy, whereas enzymatic digestion of the cells is expensive when many samples need to be analyzed. We sought to develop an easier and faster protocol than the existing methods for obtaining yeast genomic DNA from liquid cultures or colonies on plates. Results Repeated freeze-thawing of cells in a lysis buffer was used to disrupt the cells and release genomic DNA. Cell lysis was followed by extraction with chloroform and ethanol precipitation of DNA. Two hundred ng – 3 μg of genomic DNA could be isolated from a 1.5 ml overnight liquid culture or from a large colony. Samples were either resuspended directly in a restriction enzyme/RNase coctail mixture for Southern blot hybridization or used for several PCR reactions. We demonstrated the utility of this method by showing an analysis of yeast clones containing a mutagenized human β-globin locus YAC. Conclusion An efficient, inexpensive method for obtaining yeast genomic DNA from liquid cultures or directly from colonies was developed. This protocol circumvents the use of enzymes or glass beads, and therefore is cheaper and easier to perform when processing large numbers of samples.

  4. Rapid response to changing environments during biological invasions: DNA methylation perspectives.

    Science.gov (United States)

    Huang, Xuena; Li, Shiguo; Ni, Ping; Gao, Yangchun; Jiang, Bei; Zhou, Zunchun; Zhan, Aibin

    2017-12-01

    Dissecting complex interactions between species and their environments has long been a research hot spot in the fields of ecology and evolutionary biology. The well-recognized Darwinian evolution has well-explained long-term adaptation scenarios; however, "rapid" processes of biological responses to environmental changes remain largely unexplored, particularly molecular mechanisms such as DNA methylation that have recently been proposed to play crucial roles in rapid environmental adaptation. Invasive species, which have capacities to successfully survive rapidly changing environments during biological invasions, provide great opportunities to study molecular mechanisms of rapid environmental adaptation. Here, we used the methylation-sensitive amplified polymorphism (MSAP) technique in an invasive model ascidian, Ciona savignyi, to investigate how species interact with rapidly changing environments at the whole-genome level. We detected quite rapid DNA methylation response: significant changes of DNA methylation frequency and epigenetic differentiation between treatment and control groups occurred only after 1 hr of high-temperature exposure or after 3 hr of low-salinity challenge. In addition, we detected time-dependent hemimethylation changes and increased intragroup epigenetic divergence induced by environmental stresses. Interestingly, we found evidence of DNA methylation resilience, as most stress-induced DNA methylation variation maintained shortly (~48 hr) and quickly returned back to the control levels. Our findings clearly showed that invasive species could rapidly respond to acute environmental changes through DNA methylation modifications, and rapid environmental changes left significant epigenetic signatures at the whole-genome level. All these results provide fundamental background to deeply investigate the contribution of DNA methylation mechanisms to rapid contemporary environmental adaptation. © 2017 John Wiley & Sons Ltd.

  5. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    ONOS

    2010-09-06

    Sep 6, 2010 ... Crop improvement facilitated by modern biotechnology has largely been acknowledged as a ... ligases and restriction endonucleases (Sharma et al.,. 2002). The aim of this study is to focus on ... Chokanan mango leaf of different growth stages used in the isolation of DNA. (a) Dark purplish, soft and partially.

  6. Rapid isolation of high molecular weight DNA from single dry ...

    African Journals Online (AJOL)

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  7. Rapid purification of high activity Taq DNA polymerase expressed in ...

    African Journals Online (AJOL)

    A simplified method is described here for the preparation of a thermostable Taq DNA polymerase enzyme from Escherichia coli (E. coli) strain DH5a carrying the pTTQ18 expression vector transformed with the Taq polymerase gene. Standard purifications were done with 1 litre batch cultures of E. coli cells and produced ...

  8. Rapid isolation of high molecular weight DNA from single dried ...

    African Journals Online (AJOL)

    ANAND

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri. Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  9. Differential conductance as a promising approach for rapid DNA sequencing with nanopore-embedded electrodes

    Science.gov (United States)

    He, Yuhui; Shao, Lubing; Scheicher, Ralph H.; Grigoriev, Anton; Ahuja, Rajeev; Long, Shibing; Ji, Zhuoyu; Yu, Zhaoan; Liu, Ming

    2010-07-01

    We propose an approach for nanopore-based DNA sequencing using characteristic transverse differential conductance. Molecular dynamics and electron transport simulations show that the transverse differential conductance during the translocation of DNA through the nanopore is distinguishable enough for the detection of the base sequence and can withstand electrical noise caused by DNA structure fluctuation. Our findings demonstrate several advantages of the transverse conductance approach, which may lead to important applications in rapid genome sequencing.

  10. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  11. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

    Science.gov (United States)

    Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

    2014-12-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

  12. Rapid development of a DNA vaccine for Zika virus.

    Science.gov (United States)

    Dowd, Kimberly A; Ko, Sung-Youl; Morabito, Kaitlyn M; Yang, Eun Sung; Pelc, Rebecca S; DeMaso, Christina R; Castilho, Leda R; Abbink, Peter; Boyd, Michael; Nityanandam, Ramya; Gordon, David N; Gallagher, John Robert; Chen, Xuejun; Todd, John-Paul; Tsybovsky, Yaroslav; Harris, Audray; Huang, Yan-Jang S; Higgs, Stephen; Vanlandingham, Dana L; Andersen, Hanne; Lewis, Mark G; De La Barrera, Rafael; Eckels, Kenneth H; Jarman, Richard G; Nason, Martha C; Barouch, Dan H; Roederer, Mario; Kong, Wing-Pui; Mascola, John R; Pierson, Theodore C; Graham, Barney S

    2016-10-14

    Zika virus (ZIKV) was identified as a cause of congenital disease during the explosive outbreak in the Americas and Caribbean that began in 2015. Because of the ongoing fetal risk from endemic disease and travel-related exposures, a vaccine to prevent viremia in women of childbearing age and their partners is imperative. We found that vaccination with DNA expressing the premembrane and envelope proteins of ZIKV was immunogenic in mice and nonhuman primates, and protection against viremia after ZIKV challenge correlated with serum neutralizing activity. These data not only indicate that DNA vaccination could be a successful approach to protect against ZIKV infection, but also suggest a protective threshold of vaccine-induced neutralizing activity that prevents viremia after acute infection. Copyright © 2016, American Association for the Advancement of Science.

  13. Rapid Electrokinetic Isolation of Cancer-Related Circulating Cell-Free DNA Directly from Blood

    Science.gov (United States)

    Sonnenberg, Avery; Marciniak, Jennifer Y.; Rassenti, Laura; Ghia, Emanuela M.; Skowronski, Elaine A.; Manouchehri, Sareh; McCanna, James; Widhopf, George F.; Kipps, Thomas J.; Heller, Michael J.

    2014-01-01

    BACKGROUND Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a “liquid biopsy” may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. METHODS We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification,PCR,and DNA sequencing. The complete process, blood to PCR, required <10 min. ccf-DNA was amplified by PCR with immunoglobulin heavy chain variable region (IGHV)-specific primers to identify the unique IGHV gene expressed by the leukemic B-cell clone, and then sequenced. RESULTS PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15–20 mL blood. CONCLUSIONS Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring. PMID:24270796

  14. An economical and combined method for rapid and efficient isolation of fungal DNA.

    Science.gov (United States)

    Lech, T; Syguła-Cholewinska, J; Szostak-Kot, J

    2014-12-18

    DNA isolation is a crucial step of conducting genetic studies in any organism. However, this process is quite difficult when studying fungi because of the need to damage the fungal cell walls of specific structures. In this study, we developed a method for the rapid and efficient isolation of fungal DNA based on simultaneous mechanical and enzymatic cell wall degradation. There are several typical modifications of the standard phenol-chloroform DNA extraction method. This method can be modified to degrade the fungal cell wall. The first step of the presented DNA extraction included manual homogenization in modified lysis buffer. Next, enzymatic digestion using 2 enzymes was conducted, including lyticase and proteinase K. To carefully select the most favorable conditions, we developed an economical, rapid, and reliable method for fungal DNA extraction that ensures both high efficiency and proper purity, which are essential for further analyses.

  15. Global DNA cytosine methylation as an evolving trait: phylogenetic signal and correlated evolution with genome size in Angiosperms

    Directory of Open Access Journals (Sweden)

    Conchita eAlonso

    2015-01-01

    Full Text Available DNA cytosine methylation is a widespread epigenetic mechanism in eukaryotes, and plant genomes commonly are densely methylated. Genomic methylation can be associated with functional consequences such as mutational events, genomic instability or altered gene expression, but little is known on interspecific variation in global cytosine methylation in plants. In this paper, we compare global cytosine methylation estimates obtained by HPLC and use a phylogenetically-informed analytical approach to test for significance of evolutionary signatures of this trait across 54 angiosperm species in 25 families. We evaluate whether interspecific variation in global cytosine methylation is statistically related to phylogenetic distance and also whether it is evolutionarily correlated with genome size (C-value. Global cytosine methylation varied widely between species, ranging between 5.3% (Arabidopsis and 39.2% (Narcissus. Differences between species were related to their evolutionary trajectories, as denoted by the strong phylogenetic signal underlying interspecific variation. Global cytosine methylation and genome size were evolutionarily correlated, as revealed by the significant relationship between the corresponding phylogenetically independent contrasts. On average, a ten-fold increase in genome size entailed an increase of about 10% in global cytosine methylation. Results show that global cytosine methylation is an evolving trait in angiosperms whose evolutionary trajectory is significantly linked to changes in genome size, and suggest that the evolutionary implications of epigenetic mechanisms are likely to vary between plant lineages.

  16. DNA Probe Pooling for Rapid Delineation of Chromosomal Breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Kwan, Johnson; Baumgartner, Adolf; Weier, Jingly F.; Wang, Mei; Escudero, Tomas; Munne' , Santiago; Zitzelsberger, Horst F.; Weier, Heinz-Ulrich

    2009-01-30

    Structural chromosome aberrations are hallmarks of many human genetic diseases. The precise mapping of translocation breakpoints in tumors is important for identification of genes with altered levels of expression, prediction of tumor progression, therapy response, or length of disease-free survival as well as the preparation of probes for detection of tumor cells in peripheral blood. Similarly, in vitro fertilization (IVF) and preimplantation genetic diagnosis (PGD) for carriers of balanced, reciprocal translocations benefit from accurate breakpoint maps in the preparation of patient-specific DNA probes followed by a selection of normal or balanced oocytes or embryos. We expedited the process of breakpoint mapping and preparation of case-specific probes by utilizing physically mapped bacterial artificial chromosome (BAC) clones. Historically, breakpoint mapping is based on the definition of the smallest interval between proximal and distal probes. Thus, many of the DNA probes prepared for multi-clone and multi-color mapping experiments do not generate additional information. Our pooling protocol described here with examples from thyroid cancer research and PGD accelerates the delineation of translocation breakpoints without sacrificing resolution. The turnaround time from clone selection to mapping results using tumor or IVF patient samples can be as short as three to four days.

  17. Rapid electrokinetic isolation of cancer-related circulating cell-free DNA directly from blood.

    Science.gov (United States)

    Sonnenberg, Avery; Marciniak, Jennifer Y; Rassenti, Laura; Ghia, Emanuela M; Skowronski, Elaine A; Manouchehri, Sareh; McCanna, James; Widhopf, George F; Kipps, Thomas J; Heller, Michael J

    2014-03-01

    Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a "liquid biopsy" may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification, PCR, and DNA sequencing. The complete process, blood to PCR, required B-cell clone, and then sequenced. PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15-20 mL blood. Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring.

  18. Rapid turnover of DnaA at replication origin regions contributes to initiation control of DNA replication.

    Science.gov (United States)

    Schenk, Katrin; Hervás, Ana B; Rösch, Thomas C; Eisemann, Marc; Schmitt, Bernhard A; Dahlke, Stephan; Kleine-Borgmann, Luise; Murray, Seán M; Graumann, Peter L

    2017-02-01

    DnaA is a conserved key regulator of replication initiation in bacteria, and is homologous to ORC proteins in archaea and in eukaryotic cells. The ATPase binds to several high affinity binding sites at the origin region and upon an unknown molecular trigger, spreads to several adjacent sites, inducing the formation of a helical super structure leading to initiation of replication. Using FRAP analysis of a functional YFP-DnaA allele in Bacillus subtilis, we show that DnaA is bound to oriC with a half-time of 2.5 seconds. DnaA shows similarly high turnover at the replication machinery, where DnaA is bound to DNA polymerase via YabA. The absence of YabA increases the half time binding of DnaA at oriC, showing that YabA plays a dual role in the regulation of DnaA, as a tether at the replication forks, and as a chaser at origin regions. Likewise, a deletion of soj (encoding a ParA protein) leads to an increase in residence time and to overinitiation, while a mutation in DnaA that leads to lowered initiation frequency, due to a reduced ATPase activity, shows a decreased residence time on binding sites. Finally, our single molecule tracking experiments show that DnaA rapidly moves between chromosomal binding sites, and does not arrest for more than few hundreds of milliseconds. In Escherichia coli, DnaA also shows low residence times in the range of 200 ms and oscillates between spatially opposite chromosome regions in a time frame of one to two seconds, independently of ongoing transcription. Thus, DnaA shows extremely rapid binding turnover on the chromosome including oriC regions in two bacterial species, which is influenced by Soj and YabA proteins in B. subtilis, and is crucial for balanced initiation control, likely preventing fatal premature multimerization and strand opening of DnaA at oriC.

  19. Facile preparation of a DNA sensor for rapid herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Tam, Phuong Dinh, E-mail: tampd-hast@mail.hut.edu.vn [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Tuan, Mai Anh, E-mail: tuanma-itims@mail.hut.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam); Huy, Tran Quang [National Institute of Hygiene and Epidemiology (NIHE), 01 Yersin, Hai Ba Trung District, Hanoi (Viet Nam); Le, Anh-Tuan [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Hieu, Nguyen Van, E-mail: hieu@itims.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam)

    2010-10-12

    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  20. New rapid DNA extraction method with Chelex from Venturia inaequalis spores.

    Science.gov (United States)

    Turan, Ceren; Nanni, Irene Maja; Brunelli, Agostino; Collina, Marina

    2015-08-01

    The objective of this study was to develop a rapid method to isolate DNA from Venturia inaequalis spores for use in diagnostic DNA mutation analysis. Chelex-100 resin was evaluated and compared with a well established DNA exctraction method, utilizing CTAB in order to have a robust comparison. In this research we demonstrated that Chelex-100 efficiently makes extraction of the DNA from V. inaequalis spores available for direct use in molecular analyses. Also, the quantity and quality of extracted DNA were shown to be adequate for PCR analysis. Comparatively, the quality of DNA samples isolated using Chelex method was better than those extracted using CTAB. In conclusion, the Chelex method is recommended for PCR experiments considering its simplicity and cost-effectiveness. Copyright © 2015. Published by Elsevier B.V.

  1. Rapid emergence and predominance of a broadly recognizing and fast-evolving norovirus GII.17 variant in late 2014

    Science.gov (United States)

    Chan, Martin C. W.; Lee, Nelson; Hung, Tin-Nok; Kwok, Kirsty; Cheung, Kelton; Tin, Edith K. Y.; Lai, Raymond W. M.; Nelson, E. Anthony S.; Leung, Ting F.; Chan, Paul K. S.

    2015-01-01

    Norovirus genogroup II genotype 4 (GII.4) has been the predominant cause of viral gastroenteritis since 1996. Here we show that during the winter of 2014–2015, an emergent variant of a previously rare norovirus GII.17 genotype, Kawasaki 2014, predominated in Hong Kong and outcompeted contemporary GII.4 Sydney 2012 in hospitalized cases. GII.17 cases were significantly older than GII.4 cases. Root-to-tip and Bayesian BEAST analyses estimate GII.17 viral protein 1 (VP1) evolves one order of magnitude faster than GII.4 VP1. Residue substitutions and insertion occur in four of five inferred antigenic epitopes, suggesting immune evasion. Sequential GII.4-GII.17 infections are noted, implicating a lack of cross-protection. Virus bound to saliva of secretor histo-blood groups A, B and O, indicating broad susceptibility. This fast-evolving, broadly recognizing and probably immune-escaped emergent GII.17 variant causes severe gastroenteritis and hospitalization across all age groups, including populations who were previously less vulnerable to GII.4 variants; therefore, the global spread of GII.17 Kawasaki 2014 needs to be monitored. PMID:26625712

  2. Rapidly evolving genes in pathogens: methods for detecting positive selection and examples among fungi, bacteria, viruses and protists.

    Science.gov (United States)

    Aguileta, Gabriela; Refrégier, Guislaine; Yockteng, Roxana; Fournier, Elisabeth; Giraud, Tatiana

    2009-07-01

    The ongoing coevolutionary struggle between hosts and pathogens, with hosts evolving to escape pathogen infection and pathogens evolving to escape host defences, can generate an 'arms race', i.e., the occurrence of recurrent selective sweeps that each favours a novel resistance or virulence allele that goes to fixation. Host-pathogen coevolution can alternatively lead to a 'trench warfare', i.e., balancing selection, maintaining certain alleles at loci involved in host-pathogen recognition over long time scales. Recently, technological and methodological progress has enabled detection of footprints of selection directly on genes, which can provide useful insights into the processes of coevolution. This knowledge can also have practical applications, for instance development of vaccines or drugs. Here we review the methods for detecting genes under positive selection using divergence data (i.e., the ratio of nonsynonymous to synonymous substitution rates, d(N)/d(S)). We also review methods for detecting selection using polymorphisms, such as methods based on F(ST) measures, frequency spectrum, linkage disequilibrium and haplotype structure. In the second part, we review examples where targets of selection have been identified in pathogens using these tests. Genes under positive selection in pathogens have mostly been sought among viruses, bacteria and protists, because of their paramount importance for human health. Another focus is on fungal pathogens owing to their agronomic importance. We finally discuss promising directions in pathogen studies, such as detecting selection in non-coding regions.

  3. RAPID AND EFFICIENT METHOD FOR ENVIRONMENTAL DNA EXTRACTION AND PURIFICATION FROM SOIL

    Directory of Open Access Journals (Sweden)

    J. Hamedi

    2016-06-01

    Full Text Available Large proportion of microbial population in the world is unculturable. Extraction of total DNA from soil is usually a crucial step considering to the difficulties of study the uncultivable microorganisms. Humic acid is considered as the main inhibitory agent in the environmental DNA studies. Here, we introduced a rapid and efficient method for DNA extraction and purification from soil. Yield of DNA extraction by the presented method was 130 ng/µl. Three conventional methods of DNA extraction including liquid nitrogen incursion, bead beating and sonication were performed as control methods. Yield of DNA extraction by these methods were 110, 90 and 50 ng/µl, respectively. A rapid and efficient one step DNA purification method was introduced instead of hazardous conventional phenol-chloroform methods. Humic acid removal percentage by the introduced method was 95.8 % that is comparable with 97 % gained by the conventional gel extraction method and yield of DNA after purification was 84 % and 73 %, respectively. This study could be useful in molecular ecology and metagenomics study as a fast and reliable method.

  4. Rapid and accurate identification of microorganisms contaminating cosmetic products based on DNA sequence homology.

    Science.gov (United States)

    Fujita, Y; Shibayama, H; Suzuki, Y; Karita, S; Takamatsu, S

    2005-12-01

    The aim of this study was to develop rapid and accurate procedures to identify microorganisms contaminating cosmetic products, based on the identity of the nucleotide sequences of the internal transcribed spacer (ITS) region of the ribosomal RNA coding DNA (rDNA). Five types of microorganisms were isolated from the inner portion of lotion bottle caps, skin care lotions, and cleansing gels. The rDNA ITS region of microorganisms was amplified through the use of colony-direct PCR or ordinal PCR using DNA extracts as templates. The nucleotide sequences of the amplified DNA were determined and subjected to homology search of a publicly available DNA database. Thereby, we obtained DNA sequences possessing high similarity with the query sequences from the databases of all the five organisms analyzed. The traditional identification procedure requires expert skills, and a time period of approximately 1 month to identify the microorganisms. On the contrary, 3-7 days were sufficient to complete all the procedures employed in the current method, including isolation and cultivation of organisms, DNA sequencing, and the database homology search. Moreover, it was possible to develop the skills necessary to perform the molecular techniques required for the identification procedures within 1 week. Consequently, the current method is useful for rapid and accurate identification of microorganisms, contaminating cosmetics.

  5. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.

    Science.gov (United States)

    Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B

    2017-01-01

    Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.

  6. Rapid transport of plasmid DNA into the nucleolus via actin depolymerization using the HVJ envelope vector.

    Science.gov (United States)

    Suvanasuthi, Saroj; Tamai, Katsuto; Kaneda, Yasufumi

    2007-01-01

    Although nuclear transport of therapeutic genes is an essential requirement of human gene therapy, factors required for nuclear entry of DNA remain to be elucidated. Non-viral vector systems have led to numerous improvements in the efficiency of delivery of exogenous DNA into cells. However, nuclear transport of plasmid is difficult to achieve. We examined nuclear translocation efficiency of Cy3-labeled plasmid DNA (Cy3-pDNA) delivered by the hemagglutinating virus of Japan envelope (HVJ-E) vector, Lipofectamine or microinjection. We also examined the effect of actin depolymerization on nuclear transport of Cy3-pDNA. Cy3-pDNA reached the nucleus, particularly in the nucleolus, in 30 min after fusion-mediated delivery using the HVJ-E vector, while the DNA was retained in the cytoplasm during the observed period after the delivery by cationic liposomes. HVJ-E treatment transiently depolymerized actin filaments, and acceleration of nucleolar entry of microinjected DNA was achieved when treated with either empty HVJ-E or cytochalasin D, an inhibitor of actin depolymerization, prior to microinjection. These results suggest that plasmid DNA can be transported rapidly from the cytoplasm to the nucleolus when actin filaments are depolymerized. Thus, the HVJ-E vector can accelerate the transport of DNA to the nucleolus by actin depolymerization. Copyright 2006 John Wiley & Sons, Ltd.

  7. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    OpenAIRE

    Bi Yanzhen; Qiao Xianfeng; Hua Zaidong; Zhang Liping; Liu Ximei; Li Li; Hua Wenjun; Xiao Hongwei; Zhou Jingrong; Wei Qingxin; Zheng Xinmin

    2012-01-01

    Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to pr...

  8. Capacitive DNA sensor for rapid and sensitive detection of whole genome human herpesvirus-1 dsDNA in serum.

    Science.gov (United States)

    Cheng, Cheng; Oueslati, Rania; Wu, Jayne; Chen, Jiangang; Eda, Shigetoshi

    2017-06-01

    This work presents a rapid, highly sensitive, low-cost, and specific capacitive DNA sensor for detection of whole genome human herpesvirus-1 DNA. This sensor is capable of direct DNA detection with a response time of 30 s, and it can be used to test standard buffer or serum samples. The sensing approach for DNA detection is based on alternating current (AC) electrokinetics. By applying an inhomogeneous AC electric field on sensor electrodes, positive dielectrophoresis is induced to accelerate DNA hybridization. The same applied AC signal also directly measures the hybridization of target with the probe on the sensor surface. Experiments are conducted to optimize the AC signal, as well as the buffers for probe immobilization and target DNA hybridization. The assay is highly sensitive and specific, with no response to human herpesvirus-2 DNA at 5 ng/mL and a LOD of 1.0 pg/mL (6.5 copies/μL or 10.7 aM) in standard buffer. When testing the double stranded (ds) DNA spiked in human serum samples, the sensor yields a LOD of 20.0 pg/mL (129.5 copies/μL or 0.21 femtomolar (fM)) in neat serum. In this work, the target is whole genome dsDNA, consequently the test can be performed without the use of enzyme or amplification, which considerably simplifies the sensor operation and is highly suitable for point of care disease diagnosis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Rapidly evolving asymptomatic eosinophilia in a patient with lung adenocarcinoma causes cognitive disturbance and respiratory insufficiency: Case report.

    Science.gov (United States)

    Lo, Cheng-Hsiang; Jen, Yee-Min; Tsai, Wen-Chiuan; Chung, Ping-Ying; Kao, Woei-Yau

    2013-02-01

    Paraneoplastic eosinophilia is an unusual manifestation that usually remains asymptomatic. In this report, we presented the case of an 82-year-old patient with poorly differentiated lung adenocarcinoma and asymptomatic eosinophilia. The patient's condition worsened rapidly over a week, with episodes of cognitive disturbance, shortness of breath and acute kidney dysfunction. These symptoms were associated with a 4-fold increase in circulating eosinophil counts. The poor condition hindered further anticancer treatment. Treatment of the eosinophilia with corticosteroids and hydroxyurea significantly reduced circulating eosinophil counts to below the initial levels. Results of this case report suggested that lung cancer patients should be monitored closely for rapidly worsening symptoms of cognitive disturbance and respiratory insufficiency as signs of life-threatening asymptomatic eosinophilia, in order to initiate corticosteroid treatment.

  10. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications.

    Directory of Open Access Journals (Sweden)

    Selvaraju Gayathri Devi

    Full Text Available A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely "powdered glass method" from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil with high purity (A260/280: 1.76 ± 0.05 and reduced humic substances (A340: 0.047 ± 0.03. The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method's applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666.

  11. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications.

    Science.gov (United States)

    Devi, Selvaraju Gayathri; Fathima, Anwar Aliya; Radha, Sudhakar; Arunraj, Rex; Curtis, Wayne R; Ramya, Mohandass

    2015-01-01

    A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely "powdered glass method" from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC) as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil) with high purity (A260/280: 1.76 ± 0.05) and reduced humic substances (A340: 0.047 ± 0.03). The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method's applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666).

  12. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications

    Science.gov (United States)

    Devi, Selvaraju Gayathri; Fathima, Anwar Aliya; Radha, Sudhakar; Arunraj, Rex; Curtis, Wayne R.; Ramya, Mohandass

    2015-01-01

    A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely “powdered glass method” from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC) as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil) with high purity (A260/280: 1.76 ± 0.05) and reduced humic substances (A340: 0.047 ± 0.03). The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method’s applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666). PMID:26167854

  13. Congenic strain analysis reveals genes that are rapidly evolving components of a prezygotic isolation mechanism mediating incipient reinforcement.

    Directory of Open Access Journals (Sweden)

    Christina M Laukaitis

    Full Text Available Two decades ago, we developed a congenic strain of Mus musculus, called b-congenic, by replacing the androgen-binding protein Abpa27(a allele in the C3H/HeJ genome with the Abpa27(b allele from DBA/2J. We and other researchers used this b-congenic strain and its C3H counterpart, the a-congenic strain, to test the hypothesis that, given the choice between signals from two strains with different a27 alleles on the same genetic background, test subjects would prefer the homosubspecific one. It was our purpose in undertaking this study to characterize the segment transferred from DBA to the C3H background in producing the b-congenic strain on which a role for ABPA27 in behavior has been predicated. We determined the size of the chromosome 7 segment transferred from DBA and the genes it contains that might influence preference. We found that the "functional" DBA segment is about 1% the size of the mouse haploid genome and contains at least 29 genes expressed in salivary glands, however, only three of these encode proteins identified in the mouse salivary proteome. At least two of the three genes Abpa27, Abpbg26 and Abpbg27 encoding the subunits of androgen-binding protein ABP dimers evolved under positive selection and the third one may have also. In the sense that they are subunits of the same two functional entities, the ABP dimers, we propose that their evolutionary histories might not be independent of each other.

  14. Engineering split intein DnaE from Nostoc punctiforme for rapid protein purification.

    Science.gov (United States)

    Ramirez, Miguel; Valdes, Najla; Guan, Dongli; Chen, Zhilei

    2013-03-01

    We report the engineering of a DnaE intein able to catalyze rapid C-terminal cleavage in the absence of N-terminal cleavage. A single mutation in DnaE intein from Nostoc punctiforme PCC73102 (NpuDnaE), Asp118Gly, was introduced based on sequence alignment with a previously engineered C-terminal cleaving intein mini-MtuRecA. This mutation was able to both suppress N-terminal cleavage and significantly elevate C-terminal cleavage efficiency. Molecular modeling suggests that in NpuDnaE Asp118 forms a hydrogen bond with the penultimate Asn, preventing its spontaneous cyclization prior to N-terminal cleavage. Mutation of Asp118 to Gly essentially abolishes this restriction leading to subsequent C-terminal cleavage in the absence of N-terminal cleavage. The Gly118 NpuDnaE mutant exhibits rapid thio-dependent C-terminal cleavage kinetics with 80% completion within 3 h at room temperature. We used this newly engineered intein to develop both column-free and chromatography-based protein purification methods utilizing the elastin-like-polypeptide and chitin-binding protein as removable purification tags, respectively. We demonstrate rapid target protein purification to electrophoretic purity at yields up to 84 mg per liter of Escherichia coli culture.

  15. Rapid DNA technologies at the crime scene : ‘CSI’ fiction matching reality

    NARCIS (Netherlands)

    Mapes, A.A.

    2017-01-01

    This thesis describes how mobile Rapid DNA analysis may be implemented as a potential effective tool in modern day law enforcement. It is expected that this technology will affect the role of the forensic institutes and the tasks of professionals in the Criminal Justice System (CJS). The research in

  16. Rapidly Evolving Genes Are Key Players in Host Specialization and Virulence of the Fungal Wheat Pathogen Zymoseptoria tritici (Mycosphaerella graminicola.

    Directory of Open Access Journals (Sweden)

    Stephan Poppe

    2015-07-01

    Full Text Available The speciation of pathogens can be driven by divergent host specialization. Specialization to a new host is possible via the acquisition of advantageous mutations fixed by positive selection. Comparative genome analyses of closely related species allows for the identification of such key substitutions via inference of genome-wide signatures of positive selection. We previously used a comparative genomics framework to identify genes that have evolved under positive selection during speciation of the prominent wheat pathogen Zymoseptoria tritici (synonym Mycosphaerella graminicola. In this study, we conducted functional analyses of four genes exhibiting strong signatures of positive selection in Z. tritici. We deleted the four genes in Z. tritici and confirm a virulence-related role of three of the four genes ΔZt80707, ΔZt89160 and ΔZt103264. The two mutants ΔZt80707 and ΔZt103264 show a significant reduction in virulence during infection of wheat; the ΔZt89160 mutant causes a hypervirulent phenotype in wheat. Mutant phenotypes of ΔZt80707, ΔZt89160 and ΔZt103264 can be restored by insertion of the wild-type genes. However, the insertion of the Zt80707 and Zt89160 orthologs from Z. pseudotritici and Z. ardabiliae do not restore wild-type levels of virulence, suggesting that positively selected substitutions in Z. tritici may relate to divergent host specialization. Interestingly, the gene Zt80707 encodes also a secretion signal that targets the protein for cell secretion. This secretion signal is however only transcribed in Z. tritici, suggesting that Z. tritici-specific substitutions relate to a new function of the protein in the extracellular space of the wheat-Z. tritici interaction. Together, the results presented here highlight that Zt80707, Zt103264 and Zt89160 represent key genes involved in virulence and host-specific disease development of Z. tritici. Our findings illustrate that evolutionary predictions provide a powerful tool

  17. A history into genetic and epigenetic evolution of food tolerance: how humanity rapidly evolved by drinking milk and eating wheat.

    Science.gov (United States)

    Blanchard, Carine

    2017-12-01

    Human exposure to wheat and milk is almost global worldwide. Yet the introduction of milk and wheat is very recent (5000-10 000 years) when compared to the human evolution. The last 4 decades have seen a rise in food allergy and food intolerance to milk and wheat. Often described as plurifactorial, the cause of allergic diseases is the result from an interplay between genetic predisposition and epigenetic in the context of environmental changes. Genetic and epigenetic understanding and their contribution to allergy or other antigen-driven diseases have considerably advanced in the last few years. Yet, environmental factors are also quite difficult to identify and associate with disease risk. Can we rethink our old findings and learn from human history and recent genetic studies? More than one million years separate Homo habilis to today's mankind, more than 1 million years to develop abilities to obtain food by foraging in diverse environments. One million year to adjust and fine-tune our genetic code and adapt; and only 1% of this time, 10 000 years, to face the three biggest revolutions of the human kind: the agricultural revolution, the industrial revolution and the postindustrial revolution. With big and rapid environmental changes come adaptation but with no time for fine-tuning. Today tolerance and adverse reactions to food may be a testimony of adaptation successes and mistakes.

  18. A rapid and efficient DNA extraction method suitable for marine macroalgae.

    Science.gov (United States)

    Ramakrishnan, Gautham Subramaniam; Fathima, Anwar Aliya; Ramya, Mohandass

    2017-12-01

    Macroalgae are a diverse group of organisms. Marine macroalgae, in particular, have numerous medicinal and industrial applications. Molecular studies of macroalgae require suitable concentrations of DNA free of contaminants. At present, numerous protocols exist for DNA extraction from macroalgae. However, they are either time consuming, expensive or work only with few species. The method described in this study is rapid and efficient and applicable to different types of marine macroalgae. This method yields an average of 3.85 µg of DNA per 50 mg of algal tissue, with an average purity of 1.88. The isolated DNA was suitable for PCR amplification of universal plastid region of macroalgae.

  19. Rapid DNA extraction for specific detection and quantitation of Mycobacterium tuberculosis DNA in sputum specimens using taqman assays

    Science.gov (United States)

    Gomez, Diana I.; Mullin, Caroline S.; Mora-Guzmán, Francisco; Crespo-Solis, J. Gonzalo; Fisher-Hoch, Susan P.; McCormick, Joseph B.; Restrepo, Blanca I.

    2011-01-01

    SUMMARY Rapid tuberculosis (TB) detection is critical for disease control, and further quantitation of Mycobacterium tuberculosis (Mtb) in sputum is valuable for epidemiological and clinical studies. We evaluated a simple, robust and cost-efficient in-house DNA extraction and downstream taqman approach for detection and quantitation of Mtb genomes from sputum of newly-diagnosed TB patients and non-TB controls. DNA was extracted using guanidine isothiocyanate and silica-based spin columns in less than 2h, stored frozen, and taqman assays were used to detect Mtb with IS6110 and quantify it targeting RD1 and IS1081. The taqmans had a sensitivity > 95% in 108 culture-confirmed TB patients and specificity of 100% in 43 non-TB controls. Genome counts were correlated with the Mycobacterial Growth Indicator Tubes’ (MGIT) time-to-detection values (1/TTD×1000; rho=0.66; p<0.001) in 91 TB patients (33 excluded with MGIT contamination). This linear relationship was nearly identical between mycobacteria isolated from sputum and H37Rv Mtb grown in-vitro to its log phase. TB treatment between 3 and 7 days was associated with lower 1/TTD×1000 values but not with genome counts. Together, our protocol provides rapid, specific, inexpensive and quantitative detection of Mtb DNA in fresh or stored sputa making it a robust tool for prompt TB diagnosis, and with potential use for clinical and epidemiologic studies. PMID:22088321

  20. Rapid Sequential in Situ Multiplexing with DNA Exchange Imaging in Neuronal Cells and Tissues.

    Science.gov (United States)

    Wang, Yu; Woehrstein, Johannes B; Donoghue, Noah; Dai, Mingjie; Avendaño, Maier S; Schackmann, Ron C J; Zoeller, Jason J; Wang, Shan Shan H; Tillberg, Paul W; Park, Demian; Lapan, Sylvain W; Boyden, Edward S; Brugge, Joan S; Kaeser, Pascal S; Church, George M; Agasti, Sarit S; Jungmann, Ralf; Yin, Peng

    2017-10-11

    To decipher the molecular mechanisms of biological function, it is critical to map the molecular composition of individual cells or even more importantly tissue samples in the context of their biological environment in situ. Immunofluorescence (IF) provides specific labeling for molecular profiling. However, conventional IF methods have finite multiplexing capabilities due to spectral overlap of the fluorophores. Various sequential imaging methods have been developed to circumvent this spectral limit but are not widely adopted due to the common limitation of requiring multirounds of slow (typically over 2 h at room temperature to overnight at 4 °C in practice) immunostaining. We present here a practical and robust method, which we call DNA Exchange Imaging (DEI), for rapid in situ spectrally unlimited multiplexing. This technique overcomes speed restrictions by allowing for single-round immunostaining with DNA-barcoded antibodies, followed by rapid (less than 10 min) buffer exchange of fluorophore-bearing DNA imager strands. The programmability of DEI allows us to apply it to diverse microscopy platforms (with Exchange Confocal, Exchange-SIM, Exchange-STED, and Exchange-PAINT demonstrated here) at multiple desired resolution scales (from ∼300 nm down to sub-20 nm). We optimized and validated the use of DEI in complex biological samples, including primary neuron cultures and tissue sections. These results collectively suggest DNA exchange as a versatile, practical platform for rapid, highly multiplexed in situ imaging, potentially enabling new applications ranging from basic science, to drug discovery, and to clinical pathology.

  1. New and rapid procedure for the isolation of ultra-high molecular weight eukaryotic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Longmire, J.L.; Lewis, A.; Meincke, L.J.; Hildebrand, C.E.

    1986-05-01

    The authors have developed a novel procedure that permits the rapid extraction and isolation of ultra-high molecular weight DNA from avian or mammalian cells using dialysis against a solution of polyethylene glycol (PEG). Cells harvested by centrifugation and washed twice in ice-cold Ca/sup + +/- and Mg/sup + +/-free phosphate buffered saline were resuspended in 5 ml 0.01 M Tris-Cl (pH 8.0); 0.001 M EDTA (TE); sodium dodecyl sulfate and proteinase K were added to final concentrations of 0.1% and 0.1 mg/ml, respectively. After incubation at 37/sup 0/C overnight, the viscous solution was transferred to a mini-collodian bag and concentrated by dialysis against 4-5 changes of 20% PEG in TE over a period of 5 hours at RT. Concentrated samples were desalted by dialysis against fresh TE for two 15 minute intervals. DNA obtained using this procedure gives A/sub 260//A/sub 280/ consistently >1.8. Analysis of DNA size using pulsed field gel electrophoresis revealed a distribution of fragments >500 Kb in length. Further measurements examined were (1) restriction enzyme digestibility, (2) ligation efficiency of restricted DNA, and (3) cloning efficiency using the lambda vector Ch21A. This novel methodology offers a valuable alternative protocol for rapid purification of ultrahigh molecular weight DNA for various applications in molecular biology.

  2. The DNA 'comet assay' as a rapid screening technique to control irradiated food.

    Science.gov (United States)

    Cerda, H; Delincée, H; Haine, H; Rupp, H

    1997-04-29

    The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded.

  3. The DNA `comet assay` as a rapid screening technique to control irradiated food

    Energy Technology Data Exchange (ETDEWEB)

    Cerda, H. [Department of Radioecology, The Swedish University of Agricultural Sciences, Uppsala (Sweden); Delincee, H. [Institute of Nutritional Physiology, Federal Research Centre for Nutrition, Karlsruhe (Germany); Haine, H. [Campden and Chorleywood Food Research Association, Chipping Campden, Gloucestershire (United Kingdom); Rupp, H. [Swiss Federal Office of Public Health, Section of Food Chemistry, Berne (Switzerland)

    1997-04-29

    The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded.

  4. Rapid DNA extraction protocol from stool, suitable for molecular genetic diagnosis of colon cancer.

    Science.gov (United States)

    Abbaszadegan, Mohammad Reza; Velayati, Arash; Tavasoli, Alireza; Dadkhah, Ezzat

    2007-07-01

    Colorectal cancer (CRC) is one of the most common forms of cancers in the world and is curable if diagnosed at the early stage. Analysis of DNA extracted from stool specimens is a recent advantage to cancer diagnostics. Many protocols have been recommended for DNA extraction from stool, and almost all of them are difficult and time consuming, dealing with high amount of toxic materials like phenol. Their results vary due to sample collection method and further purification treatment. In this study, an easy and rapid method was optimized for isolating the human DNA with reduced PCR inhibitors present in stool. Fecal samples were collected from 10 colonoscopy-negative adult volunteers and 10 patients with CRC. Stool (1 g) was extracted using phenol/chloroform based protocol. The amplification of P53 exon 9 was examined to evaluate the extraction efficiency for human genomic targets and also compared its efficiency with Machiels et al. and Ito et al. protocols. The amplification of exon 9 of P53 from isolated fecal DNA was possible in most cases in 35 rounds of PCR using no additional purification procedure for elimination of the remaining inhibitors.inhibitors. A useful, rapid and easy protocol for routine extraction of DNA from stool was introduced and compared with two previous protocols.

  5. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples

    OpenAIRE

    Deb, R.; Sengar, G. S.; Singh, U.; Kumar, S.; Raja, T. V.; Alex, R.; Alyethodi, R. R.; Prakash, B.

    2017-01-01

    Animal species detection is one of the crucial steps for consumer’s food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up ...

  6. Rapid yeast DNA extraction by boiling and freeze-thawing without using chemical reagents and DNA purification

    Directory of Open Access Journals (Sweden)

    Gildo Almeida da Silva

    2012-04-01

    Full Text Available The purpose of this work was to study a rapid yeast DNA extraction by boiling and freeze-thawing processes without using chemical reagents or any purification procedures, to obtain a high grade PCR-product. A specific DNA fragment of the 18S region of Dekkera bruxellensis and Saccharomyces cerevisiae was chosen. The described boiling and freeze-thawing protocols generated the PCR-grade product preparations and could be used to process many samples. The amplification of the fragments could be observed after 30 and 35 cycles. These processes of extraction without using any kind of chemical reagents, especial water, and purification procedures proved to be efficient, reproducible, simple, fast, and inexpensive.

  7. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    Science.gov (United States)

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

    2018-02-15

    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  8. Rapid Detection of Cell-Free Mycobacterium tuberculosis DNA in Tuberculous Pleural Effusion.

    Science.gov (United States)

    Che, Nanying; Yang, Xinting; Liu, Zichen; Li, Kun; Chen, Xiaoyou

    2017-05-01

    Tuberculous pleurisy is one of the most common types of extrapulmonary tuberculosis, but its diagnosis remains difficult. In this study, we report for the first time on the detection of cell-free Mycobacterium tuberculosis DNA in pleural effusion and an evaluation of a newly developed molecular assay for the detection of cell-free Mycobacterium tuberculosis DNA. A total of 78 patients with pleural effusion, 60 patients with tuberculous pleurisy, and 18 patients with alternative diseases were included in this study. Mycobacterial culture, the Xpert MTB/RIF assay, the adenosine deaminase assay, the T-SPOT.TB assay, and the cell-free Mycobacterium tuberculosis DNA assay were performed on all the pleural effusion samples. The cell-free Mycobacterium tuberculosis DNA assay and adenosine deaminase assay showed significantly higher sensitivities of 75.0% and 68.3%, respectively, than mycobacterial culture and the Xpert MTB/RIF assay, which had sensitivities of 26.7% and 20.0%, respectively (P Mycobacterium tuberculosis DNA assay detected as few as 1.25 copies of IS6110 per ml of pleural effusion and showed good accordance of the results between repeated tests (r = 0.978, P = 2.84 × 10-10). These data suggest that the cell-free Mycobacterium tuberculosis DNA assay is a rapid and accurate molecular test which provides direct evidence of Mycobacterium tuberculosis etiology. Copyright © 2017 American Society for Microbiology.

  9. DNA Sequence Signatures for Rapid Detection of Six Target Bacterial Pathogens Using PCR Assays

    Directory of Open Access Journals (Sweden)

    Kenjiro Nagamine

    2015-01-01

    Full Text Available Using Streptococcus pyogenes as a model, we previously established a stepwise computational workflow to effectively identify species-specific DNA signatures that could be used as PCR primer sets to detect target bacteria with high specificity and sensitivity. In this study, we extended the workflow for the rapid development of PCR assays targeting Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Clostridium tetani , and Staphylococcus aureus , which are of safety concern for human tissue intended for transplantation. Twenty-one primer sets that had sensitivity of detecting 5–50 fg DNA from target bacteria with high specificity were selected. These selected primer sets can be used in a PCR array for detecting target bacteria with high sensitivity and specificity. The workflow could be widely applicable for the rapid development of PCR-based assays for a wide range of target bacteria, including those of biothreat agents.

  10. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    Directory of Open Access Journals (Sweden)

    Bi Yanzhen

    2012-07-01

    Full Text Available Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. Conclusions ABI-REC has the following advantages: (i rapid and highly efficient; (ii native DNA cloning without introduction of extra bases; (iii restriction-free; (iv easy positioning of directional and site-specific recombination owing to formulated primer design. ABI

  11. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy.

    Science.gov (United States)

    Bi, Yanzhen; Qiao, Xianfeng; Hua, Zaidong; Zhang, Liping; Liu, Ximei; Li, Li; Hua, Wenjun; Xiao, Hongwei; Zhou, Jingrong; Wei, Qingxin; Zheng, Xinmin

    2012-07-06

    Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN) promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. ABI-REC has the following advantages: (i) rapid and highly efficient; (ii) native DNA cloning without introduction of extra bases; (iii) restriction-free; (iv) easy positioning of directional and site-specific recombination owing to formulated primer design. ABI-REC is a novel approach to DNA engineering and gene functional

  12. Decomposable quantum-dots/DNA nanosphere for rapid and ultrasensitive detection of extracellular respiring bacteria.

    Science.gov (United States)

    Wen, Junlin; Zhou, Shungui; Yu, Zhen; Chen, Junhua; Yang, Guiqin; Tang, Jia

    2018-02-15

    Extracellular respiring bacteria (ERB) are a group of bacteria capable of transferring electrons to extracellular acceptors and have important application in environmental remediation. In this study, a decomposable quantum-dots (QDs)/DNA nanosphere probe was developed for rapid and ultrasensitive detection of ERB. The QDs/DNA nanosphere was self-assembled from QDs-streptavidin conjugate (QDs-SA) and Y-shaped DNA nanostructure that is constructed based on toehold-mediated strand displacement. It can release numerous fluorescent QDs-SA in immunomagnetic separation (IMS)-based immunoassay via simple biotin displacement, which remarkably amplifies the signal of antigen-antibody recognizing event. This QDs/DNA-nanosphere-based IMS-fluorescent immunoassay is ultrasensitive for model ERB Shewanella oneidensis, showing a wide detection range between 1.0 cfu/mL and 1.0 × 108 cfu/mL with a low detection limit of 1.37 cfu/mL. Moreover, the proposed IMS-fluorescent immunoassay exhibits high specificity, acceptable reproducibility and stability. Furthermore, the proposed method shows acceptable recovery (92.4-101.4%) for detection of S. oneidensis spiked in river water samples. The proposed IMS-fluorescent immunoassay advances an intelligent strategy for rapid and ultrasensitive quantitation of low-abundance analyte and thus holds promising potential in food, medical and environmental applications. Copyright © 2017. Published by Elsevier B.V.

  13. Essential Function of Dicer in Resolving DNA Damage in the Rapidly Dividing Cells of the Developing and Malignant Cerebellum

    Directory of Open Access Journals (Sweden)

    Vijay Swahari

    2016-01-01

    Full Text Available Maintenance of genomic integrity is critical during neurodevelopment, particularly in rapidly dividing cerebellar granule neuronal precursors that experience constitutive replication-associated DNA damage. As Dicer was recently recognized to have an unexpected function in the DNA damage response, we examined whether Dicer was important for preserving genomic integrity in the developing brain. We report that deletion of Dicer in the developing mouse cerebellum resulted in the accumulation of DNA damage leading to cerebellar progenitor degeneration, which was rescued with p53 deficiency; deletion of DGCR8 also resulted in similar DNA damage and cerebellar degeneration. Dicer deficiency also resulted in DNA damage and death in other rapidly dividing cells including embryonic stem cells and the malignant cerebellar progenitors in a mouse model of medulloblastoma. Together, these results identify an essential function of Dicer in resolving the spontaneous DNA damage that occurs during the rapid proliferation of developmental progenitors and malignant cells.

  14. Tuning Toehold Length and Temperature to Achieve Rapid, Colorimetric Detection of DNA from the Disassembly of DNA-Gold Nanoparticle Aggregates.

    Science.gov (United States)

    Lam, Michael K; Gadzikwa, Tendai; Nguyen, Trang; Kausar, Abu; Alladin-Mustan, B Safeenaz; Sikder, Md Delwar; Gibbs-Davis, Julianne M

    2016-02-16

    Gold nanoparticles have been widely utilized to achieve colorimetric detection for various diagnostic applications. One of the most frequently used methods for DNA detection involves the aggregation of DNA-modified gold nanoparticles driven by target DNA hybridization. This process, however, is intrinsically slow, limiting its use in rapid diagnostics. Here we take advantage of the reverse process: the disassembly of preformed aggregates triggered by the addition of target DNA via a strand displacement mechanism. A systematic study of the dependence of the disassembly rate on temperature, with and without toeholds, has delivered a system that produces an extremely rapid colorimetric response. Furthermore, using an optimal toehold length of 5 nucleotides, target triggered disassembly is rapid over a wide range of ambient temperatures. Using this overhang system, simple visualization of low picomole amounts of target DNA is possible within 10 min at room temperature.

  15. Carbon nanotube-based lateral flow biosensor for sensitive and rapid detection of DNA sequence.

    Science.gov (United States)

    Qiu, Wanwei; Xu, Hui; Takalkar, Sunitha; Gurung, Anant S; Liu, Bin; Zheng, Yafeng; Guo, Zebin; Baloda, Meenu; Baryeh, Kwaku; Liu, Guodong

    2015-02-15

    In this article, we describe a carbon nanotube (CNT)-based lateral flow biosensor (LFB) for rapid and sensitive detection of DNA sequence. Amine-modified DNA detection probe was covalently immobilized on the shortened multi-walled carbon nanotubes (MWCNTs) via diimide-activated amidation between the carboxyl groups on the CNT surface and amine groups on the detection DNA probes. Sandwich-type DNA hybridization reactions were performed on the LFB and the captured MWCNTs on test zone and control zone of LFB produced the characteristic black bands, enabling visual detection of DNA sequences. Combining the advantages of lateral flow chromatographic separation with unique physical properties of MWCNT (large surface area), the optimized LFB was capable of detecting of 0.1 nM target DNA without instrumentation. Quantitative detection could be realized by recording the intensity of the test line with the Image J software, and the detection limit of 40 pM was obtained. This detection limit is 12.5 times lower than that of gold nanoparticle (GNP)-based LFB (0.5 nM, Mao et al. Anal. Chem. 2009, 81, 1660-1668). Another important feature is that the preparation of MWCNT-DNA conjugates was robust and the use of MWCNT labels avoided the aggregation of conjugates and tedious preparation time, which were often met in the traditional GNP-based nucleic acid LFB. The applications of MWCNT-based LFB can be extended to visually detect protein biomarkers using MWCNT-antibody conjugates. The MWCNT-based LFB thus open a new door to prepare a new generation of LFB, and shows great promise for in-field and point-of-care diagnosis of genetic diseases and for the detection of infectious agents. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

    Science.gov (United States)

    Hebert, Paul D N; Dewaard, Jeremy R; Zakharov, Evgeny V; Prosser, Sean W J; Sones, Jayme E; McKeown, Jaclyn T A; Mantle, Beth; La Salle, John

    2013-01-01

    DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera) species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp) were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  17. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

    Directory of Open Access Journals (Sweden)

    Paul D N Hebert

    Full Text Available DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  18. Invader or resident? Ancient-DNA reveals rapid species turnover in New Zealand little penguins.

    Science.gov (United States)

    Grosser, Stefanie; Rawlence, Nicolas J; Anderson, Christian N K; Smith, Ian W G; Scofield, R Paul; Waters, Jonathan M

    2016-02-10

    The expansion of humans into previously unoccupied parts of the globe is thought to have driven the decline and extinction of numerous vertebrate species. In New Zealand, human settlement in the late thirteenth century AD led to the rapid demise of a distinctive vertebrate fauna, and also a number of 'turnover' events where extinct lineages were subsequently replaced by closely related taxa. The recent genetic detection of an Australian little penguin (Eudyptula novaehollandiae) in southeastern New Zealand may potentially represent an additional 'cryptic' invasion. Here we use ancient-DNA (aDNA) analysis and radiocarbon dating of pre-human, archaeological and historical Eudyptula remains to reveal that the arrival of E. novaehollandiae in New Zealand probably occurred between AD 1500 and 1900, following the anthropogenic decline of its sister taxon, the endemic Eudyptula minor. This rapid turnover event, revealed by aDNA, suggests that native species decline can be masked by invasive taxa, and highlights the potential for human-mediated biodiversity shifts. © 2016 The Author(s).

  19. A new rapid method for Clostridium difficile DNA extraction and detection in stool: toward point-of-care diagnostic testing

    National Research Council Canada - National Science Library

    Freifeld, Alison G; Simonsen, Kari A; Booth, Christine S; Zhao, Xing; Whitney, Scott E; Karre, Teresa; Iwen, Peter C; Viljoen, Hendrik J

    2012-01-01

    We describe a new method for the rapid diagnosis of Clostridium difficile infection, with stool sample preparation and DNA extraction by heat and physical disruption in a single-use lysis microreactor (LMR...

  20. Targeted disruption in mice of a neural stem cell-maintaining, KRAB-Zn finger-encoding gene that has rapidly evolved in the human lineage.

    Directory of Open Access Journals (Sweden)

    Huan-Chieh Chien

    Full Text Available Understanding the genetic basis of the physical and behavioral traits that separate humans from other primates is a challenging but intriguing topic. The adaptive functions of the expansion and/or reduction in human brain size have long been explored. From a brain transcriptome project we have identified a KRAB-Zn finger protein-encoding gene (M003-A06 that has rapidly evolved since the human-chimpanzee separation. Quantitative RT-PCR analysis of different human tissues indicates that M003-A06 expression is enriched in the human fetal brain in addition to the fetal heart. Furthermore, analysis with use of immunofluorescence staining, neurosphere culturing and Western blotting indicates that the mouse ortholog of M003-A06, Zfp568, is expressed mainly in the embryonic stem (ES cells and fetal as well as adult neural stem cells (NSCs. Conditional gene knockout experiments in mice demonstrates that Zfp568 is both an NSC maintaining- and a brain size-regulating gene. Significantly, molecular genetic analyses show that human M003-A06 consists of 2 equilibrated allelic types, H and C, one of which (H is human-specific. Combined contemporary genotyping and database mining have revealed interesting genetic associations between the different genotypes of M003-A06 and the human head sizes. We propose that M003-A06 is likely one of the genes contributing to the uniqueness of the human brain in comparison to other higher primates.

  1. Ultrasensitive, rapid and inexpensive detection of DNA using paper based lateral flow assay

    Science.gov (United States)

    Jauset-Rubio, Miriam; Svobodová, Markéta; Mairal, Teresa; McNeil, Calum; Keegan, Neil; Saeed, Ayman; Abbas, Mohammad Nooredeen; El-Shahawi, Mohammad S.; Bashammakh, Abdulaziz S.; Alyoubi, Abdulrahman O.; O´Sullivan, Ciara K.

    2016-01-01

    Sensitive, specific, rapid, inexpensive and easy-to-use nucleic acid tests for use at the point-of-need are critical for the emerging field of personalised medicine for which companion diagnostics are essential, as well as for application in low resource settings. Here we report on the development of a point-of-care nucleic acid lateral flow test for the direct detection of isothermally amplified DNA. The recombinase polymerase amplification method is modified slightly to use tailed primers, resulting in an amplicon with a duplex flanked by two single stranded DNA tails. This tailed amplicon facilitates detection via hybridisation to a surface immobilised oligonucleotide capture probe and a gold nanoparticle labelled reporter probe. A detection limit of 1 × 10−11 M (190 amol), equivalent to 8.67 × 105 copies of DNA was achieved, with the entire assay, both amplification and detection, being completed in less than 15 minutes at a constant temperature of 37 °C. The use of the tailed primers obviates the need for hapten labelling and consequent use of capture and reporter antibodies, whilst also avoiding the need for any post-amplification processing for the generation of single stranded DNA, thus presenting an assay that can facilely find application at the point of need. PMID:27886248

  2. Rapid Purification of Salmonella DNA in Minced Meat and Detection by Real-time PCR

    DEFF Research Database (Denmark)

    Jenikova, G.; Jensen, Annette Nygaard; Demnerova, K.

    2001-01-01

    of DNeasy was found to be 6-8 CFU in just 19 end-point fluorescence (C-t) values, while this was 22 C-t for a combination of DNeasy and BactXtractor. Extraction by DNeasy resulted in C-t cells per 25 g, when the samples were inoculated with Salmonella......Four rapid and simple DNA purification and sample treatment protocols were evaluated for detection of Salmonella enterica in spiked minced meat, using a fluorogenic 5' nuclease (TaqMan) PCR assay in an ABI-Prism 7700 Sequence Detector. The detection limit with the single separation treatment...... before the overnight preenrichment. The method is currently being adapted to a BioRobot 3000 platform. However, the use of paramagnetic beads (DNA Direct) resulted in poor and variable detection limit....

  3. A rapid and economic in-house DNA purification method using glass syringe filters.

    Directory of Open Access Journals (Sweden)

    Yun-Cheol Kim

    Full Text Available BACKGROUND: Purity, yield, speed and cost are important considerations in plasmid purification, but it is difficult to achieve all of these at the same time. Currently, there are many protocols and kits for DNA purification, however none maximize all four considerations. METHODOLOGY/PRINCIPAL FINDINGS: We now describe a fast, efficient and economic in-house protocol for plasmid preparation using glass syringe filters. Plasmid yield and quality as determined by enzyme digestion and transfection efficiency were equivalent to the expensive commercial kits. Importantly, the time required for purification was much less than that required using a commercial kit. CONCLUSIONS/SIGNIFICANCE: This method provides DNA yield and quality similar to that obtained with commercial kits, but is more rapid and less costly.

  4. Developmental validation of a forensic rapid DNA-STR kit: Expressmarker 16.

    Science.gov (United States)

    Zhou, Huaigu; Wu, Dan; Chen, Ronghua; Xu, Yan; Xia, Zifang; Guo, Yulin; Zhang, Fan; Zheng, Weiguo

    2014-07-01

    DNA-STR analysis is widely used in the forensic science field and has important requirements on the analysis time to obtain faster inspections. The developed forensic STR kit, referred to as Expressmarker 16 (EX16), could shorten the amplification time to a minimum of 35min. It enables 16 STR loci to be co-detected, including 13 CODIS loci, D2S1338, D6S1043 and Amelogenin loci. The kit is validated by a series of tests formed by DNA mixtures, stutter ratios, optimized PCR protocols based on annealing temperature research, species specificities, inhibitors, sensitivity, and parallel tests according to FBI QAS (2009/2011) (QAS, 2009; SWGDAM, 2010). The results demonstrated that EX16 was a useful tool for rapid criminal investigation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. Rapid DNA vaccination against Burkholderia pseudomallei flagellin by tattoo or intranasal application.

    Science.gov (United States)

    Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D

    2017-11-17

    Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.

  6. Development of a Fieldable, Rapid, Accurate and Sensitive Bio-Electronic, DNA Biosensor

    Science.gov (United States)

    2004-12-01

    single molecule of DNA or RNA and therefore does not require the use of PCR. The sensor chip can be engineered with an array of hundreds of independent test sites, which allows for confirmatory tests leading to a high level of specificity, the ability to screen for multiple threat agents simultaneously, and the capability to detect genetically engineered organisms. Biological agents continue to pose a major threat to U.S. troops as well as U.S. civilians both domestically and overseas. Rapid, accurate and sensitive detection and identification of biological agents is

  7. Radiocarbon-dating and ancient DNA reveal rapid replacement of extinct prehistoric penguins

    Science.gov (United States)

    Rawlence, Nicolas J.; Perry, George L. W.; Smith, Ian W. G.; Scofield, R. Paul; Tennyson, Alan J. D.; Matisoo-Smith, Elizabeth A.; Boessenkool, Sanne; Austin, Jeremy J.; Waters, Jonathan M.

    2015-03-01

    Prehistoric faunal extinctions dramatically reshaped biological assemblages around the world. However, the timing of such biotic shifts is often obscured by the fragmentary nature and limited temporal resolution of fossil records. We use radiocarbon-dating and ancient-DNA analysis of prehistoric (ca A.D. 1450-1834) Megadyptes penguin specimens to assess the time-frame of biological turnover in coastal New Zealand following human settlement. These data suggest that the final extirpation of the endemic Megadyptes waitaha, and subsequent replacement by the previously sub-Antarctic-limited Megadyptes antipodes, likely occurred within a narrow temporal window (e.g. a century or less). This transition represents one of the most rapid prehistoric faunal turnover events documented, and is likely linked to human demographic and cultural transitions during the 15th Century. Our results suggest that anthropogenic forces can trigger rapid biogeographic shifts.

  8. Chromosome-Specific DNA Repeats: Rapid Identification in Silico and Validation Using Fluorescence in Situ Hybridization

    Directory of Open Access Journals (Sweden)

    Heinz-Ulrich G. Weier

    2012-12-01

    Full Text Available Chromosome enumeration in interphase and metaphase cells using fluorescence in situ hybridization (FISH is an established procedure for the rapid and accurate cytogenetic analysis of cell nuclei and polar bodies, the unambiguous gender determination, as well as the definition of tumor-specific signatures. Present bottlenecks in the procedure are a limited number of commercial, non-isotopically labeled probes that can be combined in multiplex FISH assays and the relatively high price and effort to develop additional probes. We describe a streamlined approach for rapid probe definition, synthesis and validation, which is based on the analysis of publicly available DNA sequence information, also known as “database mining”. Examples of probe preparation for the human gonosomes and chromosome 16 as a selected autosome outline the probe selection strategy, define a timeline for expedited probe production and compare this novel selection strategy to more conventional probe cloning protocols.

  9. THE RAPID DIAGNOSTICS OF SEX OF SALMONIDS USING DNA-MARKERS

    Directory of Open Access Journals (Sweden)

    Yu. P. Rud

    2014-12-01

    Full Text Available Based on nucleotide sequences of sex-specific DNA-markers of salmonid fishes the oligonucleotide primers for polymerase chain reaction were selected with purpose on rapid diagnostic of sex in rainbow trout Onchorhynchus mykiss, brown trout Salmo trutta, huchen Hucho hucho and grayling Thymallus thymallus. The specify of amplification was determined by nucleotide sequence analysis of PCR-products. All amplified fragments were referred to sex-specific locuses of Y chromosomes in males of investigated fish species. The PCR-products were in size of 880, 607, 521 and 558 for rainbow trout, brown trout, grayling and huchen respectively. Thus the sex determination in above mentioned fish species and identification of genotypic males under process of hormonal sex reversion can be provided using conventional PCR. Present method relates to rapid diagnostics because the data analysis and return of results back to fish farm take one single day.

  10. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays.

    Science.gov (United States)

    Pinhal, Danillo; Yoshimura, Tatiana S; Araki, Carlos S; Martins, Cesar

    2011-05-31

    Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution.

  11. A RAPID DNA EXTRACTION METHOD IS SUCCESSFULLY APPLIED TO ITS-RFLP ANALYSIS OF MYCORRHIZAL ROOT TIPS

    Science.gov (United States)

    A rapid method for extracting DNA from intact, single root tips using a Xanthine solution was developed to handle very large numbers of analyses of ectomycorrhizas. By using an extraction without grinding we have attempted to bias the extraction towards the fungal DNA in the man...

  12. Novel sequencing strategy for repetitive DNA in a Drosophila BAC clone reveals that the centromeric region of the Y chromosome evolved from a telomere.

    Science.gov (United States)

    Méndez-Lago, María; Wild, Jadwiga; Whitehead, Siobhan L; Tracey, Alan; de Pablos, Beatriz; Rogers, Jane; Szybalski, Waclaw; Villasante, Alfredo

    2009-04-01

    The centromeric and telomeric heterochromatin of eukaryotic chromosomes is mainly composed of middle-repetitive elements, such as transposable elements and tandemly repeated DNA sequences. Because of this repetitive nature, Whole Genome Shotgun Projects have failed in sequencing these regions. We describe a novel kind of transposon-based approach for sequencing highly repetitive DNA sequences in BAC clones. The key to this strategy relies on physical mapping the precise position of the transposon insertion, which enables the correct assembly of the repeated DNA. We have applied this strategy to a clone from the centromeric region of the Y chromosome of Drosophila melanogaster. The analysis of the complete sequence of this clone has allowed us to prove that this centromeric region evolved from a telomere, possibly after a pericentric inversion of an ancestral telocentric chromosome. Our results confirm that the use of transposon-mediated sequencing, including positional mapping information, improves current finishing strategies. The strategy we describe could be a universal approach to resolving the heterochromatic regions of eukaryotic genomes.

  13. VIP Barcoding: composition vector-based software for rapid species identification based on DNA barcoding.

    Science.gov (United States)

    Fan, Long; Hui, Jerome H L; Yu, Zu Guo; Chu, Ka Hou

    2014-07-01

    Species identification based on short sequences of DNA markers, that is, DNA barcoding, has emerged as an integral part of modern taxonomy. However, software for the analysis of large and multilocus barcoding data sets is scarce. The Basic Local Alignment Search Tool (BLAST) is currently the fastest tool capable of handling large databases (e.g. >5000 sequences), but its accuracy is a concern and has been criticized for its local optimization. However, current more accurate software requires sequence alignment or complex calculations, which are time-consuming when dealing with large data sets during data preprocessing or during the search stage. Therefore, it is imperative to develop a practical program for both accurate and scalable species identification for DNA barcoding. In this context, we present VIP Barcoding: a user-friendly software in graphical user interface for rapid DNA barcoding. It adopts a hybrid, two-stage algorithm. First, an alignment-free composition vector (CV) method is utilized to reduce searching space by screening a reference database. The alignment-based K2P distance nearest-neighbour method is then employed to analyse the smaller data set generated in the first stage. In comparison with other software, we demonstrate that VIP Barcoding has (i) higher accuracy than Blastn and several alignment-free methods and (ii) higher scalability than alignment-based distance methods and character-based methods. These results suggest that this platform is able to deal with both large-scale and multilocus barcoding data with accuracy and can contribute to DNA barcoding for modern taxonomy. VIP Barcoding is free and available at http://msl.sls.cuhk.edu.hk/vipbarcoding/. © 2014 John Wiley & Sons Ltd.

  14. DNA Barcoding Evaluation and Its Taxonomic Implications in the Recently Evolved Genus Oberonia Lindl. (Orchidaceae in China

    Directory of Open Access Journals (Sweden)

    Yuling Li

    2016-12-01

    Full Text Available The orchid genus Oberonia Lindl., is a taxonomically complex genus characterized by recent species radiations and many closely related species. All Oberonia species are under conservation as listed in the CITES and the IUCN Red List Categories and Criteria. Given its difficulties in taxonomy and conservation status, Oberonia is an excellent model for developing DNA barcodes. Three analytical methods and five DNA barcoding regions (rbcL, matK, trnH-psbA, ITS and ITS2 were evaluated on 127 individuals representing 40 species and 1 variety of Oberonia from China. All the three plastid candidates tested (rbcL, matK and trnH-psbA have a lower discriminatory power than the nuclear regions (ITS and ITS2, and ITS had the highest resolution rate (82.14%. Two to four combinations of these gene sets were not better than the ITS alone, but when considering modes of inheritance, rbcL+ITS and matK+ITS were the best barcodes for identifying Oberonia species. Furthermore, the present barcoding system has many new insights in the current Oberonia taxonomy, such as correcting species identification, resolving taxonomic uncertainties, and the underlying presence of new or cryptic species in a genus with a complex speciation history.

  15. Autoclave method for rapid preparation of bacterial PCR-template DNA.

    Science.gov (United States)

    Simmon, Keith E; Steadman, Dewey D; Durkin, Sarah; Baldwin, Amy; Jeffrey, Wade H; Sheridan, Peter; Horton, Rene; Shields, Malcolm S

    2004-02-01

    An autoclave method for preparing bacterial DNA for PCR template is presented, it eliminates the use of detergents, organic solvents, and mechanical cellular disruption approaches, thereby significantly reducing processing time and costs while increasing reproducibility. Bacteria are lysed by rapid heating and depressurization in an autoclave. The lysate, cleared by microcentrifugation, was either used directly in the PCR reaction, or concentrated by ultrafiltration. This approach was compared with seven established methods of DNA template preparation from four bacterial sources which included boiling Triton X-100 and SDS, bead beating, lysozyme/proteinase K, and CTAB lysis method components. Bacteria examined were Enterococcus and Escherichia coli, a natural marine bacterial community and an Antarctic cyanobacterial-mat. DNAs were tested for their suitability as PCR templates by repetitive element random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE) analysis. The autoclave method produced PCR amplifiable template comparable or superior to the other methods, with greater reproducibility, much shorter processing time, and at a significantly lower cost.

  16. Bxb1 integrase serves as a highly efficient DNA recombinase in rapid metabolite pathway assembly.

    Science.gov (United States)

    Wang, Xianwei; Tang, Biao; Ye, Yu; Mao, Yayi; Lei, Xiaolai; Zhao, Guoping; Ding, Xiaoming

    2017-01-01

    Phage-encoded serine integrases are widely used in genetic engineering. They also have the potential to serve as efficient DNA assemblers, demonstrated by the method of site-specific recombination-based tandem assembly (SSRTA) that can combine biological parts into devices, pathways, and systems. Here, four serine integrases, ϕBT1, TG1, ϕRv1, and Bxb1, were investigated to ascertain their in vitro DNA assembly activities. Bxb1 integrase displayed the highest efficiency to obtain final products. Thus, we conclude that Bxb1 integrase is an excellent choice for DNA assembly in vitro Using this enzyme and its recognition sites, BioBrick standards were designed that are compatible with the SSRTA method for module addition. A rapid and efficient procedure was developed for the assembly of a multigene metabolic pathway in one step, directly from non-cutting plasmids containing the gene fragments. This technique is easy and convenient, and would be of interest to the synthetic biology community. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Direct loading of polymer matrices in plastic microchips for rapid DNA analysis: a comparative study.

    Science.gov (United States)

    Hurth, Cedric; Gu, Jian; Aboud, Maurice; Estes, Matthew D; Nordquist, Alan R; McCord, Bruce; Zenhausern, Frederic

    2012-08-01

    We report the design and performance validation of microfluidic separation technologies for human identification using a disposable plastic device suitable for integration into an automated rapid DNA analysis system. A fabrication process for a 15-cm long hot-embossed plastic microfluidic devices with a smooth semielliptical cross section out of cyclic olefin copolymer is presented. We propose a mixed polymer solution of 95% w/v hydroxyethylcellulose and 5% w/v polyvinylpyrrolidone for a final polymer concentration of 2.5 or 3.0% to be used as coating and sieving matrix for DNA separation. This formulation allows preparing the microchip without pretreatment in a single-loading step and provides high-resolution separation (≈1.2 bp for fragments <200 bp), which is superior to existing commercial matrices under the same conditions. The hot-embossed device performance is characterized and compared to injection-molded devices made out of cyclic olefin copolymer based on their respective injector geometry, channel shape, and surface charges. Each device design is assessed by fluorescence videomicroscopy to evaluate the formation of injection plugs, then by comparing electropherograms for the separation of a DNA size standard relevant to human identification. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    Science.gov (United States)

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  19. Use of molecular beacons for the rapid analysis of DNA damage induced by exposure to an atmospheric pressure plasma jet

    Energy Technology Data Exchange (ETDEWEB)

    Kurita, Hirofumi, E-mail: kurita@ens.tut.ac.jp, E-mail: mizuno@ens.tut.ac.jp; Miyachika, Saki; Yasuda, Hachiro; Takashima, Kazunori; Mizuno, Akira, E-mail: kurita@ens.tut.ac.jp, E-mail: mizuno@ens.tut.ac.jp [Department of Environmental and Life Sciences, Toyohashi University of Technology, Aichi 441-8580 (Japan)

    2015-12-28

    A rapid method for evaluating the damage caused to DNA molecules upon exposure to plasma is demonstrated. Here, we propose the use of a molecular beacon for rapid detection of DNA strand breaks induced by atmospheric pressure plasma jet (APPJ) irradiation. Scission of the molecular beacon by APPJ irradiation leads to separation of the fluorophore-quencher pair, resulting in an increase in fluorescence that directly correlates with the DNA strand breaks. The results show that the increase in fluorescence intensity is proportional to the exposure time and the rate of fluorescence increase is proportional to the discharge power. This simple and rapid method allows the estimation of DNA damage induced by exposure to a non-thermal plasma.

  20. DNA Barcoding Coupled with High Resolution Melting Analysis Enables Rapid and Accurate Distinction of Aspergillus species.

    Science.gov (United States)

    Fidler, Gabor; Kocsube, Sandor; Leiter, Eva; Biro, Sandor; Paholcsek, Melinda

    2017-08-01

    We describe a high-resolution melting (HRM) analysis method that is rapid, reproducible, and able to identify reference strains and further 40 clinical isolates of Aspergillus fumigatus (14), A. lentulus (3), A. terreus (7), A. flavus (8), A. niger (2), A. welwitschiae (4), and A. tubingensis (2). Asp1 and Asp2 primer sets were designed to amplify partial sequences of the Aspergillus benA (beta-tubulin) genes in a closed-, single-tube system. Human placenta DNA, further Aspergillus (3), Candida (9), Fusarium (6), and Scedosporium (2) nucleic acids from type strains and clinical isolates were also included in this study to evaluate cross reactivity with other relevant pathogens causing invasive fungal infections. The barcoding capacity of this method proved to be 100% providing distinctive binomial scores; 14, 34, 36, 35, 25, 15, 26 when tested among species, while the within-species distinction capacity of the assay proved to be 0% based on the aligned thermodynamic profiles of the Asp1, Asp2 melting clusters allowing accurate species delimitation of all tested clinical isolates. The identification limit of this HRM assay was also estimated on Aspergillus reference gDNA panels where it proved to be 10-102 genomic equivalents (GE) except the A. fumigatus panel where it was 103 only. Furthermore, misidentification was not detected with human genomic DNA or with Candida, Fusarium, and Scedosporium strains. Our DNA barcoding assay introduced here provides results within a few hours, and it may possess further diagnostic utility when analyzing standard cultures supporting adequate therapeutic decisions. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Rapid DNA amplification using a battery-powered thin-film resistive thermocycler.

    Science.gov (United States)

    Herold, Keith E; Sergeev, Nikolay; Matviyenko, Andriy; Rasooly, Avraham

    2009-01-01

    A prototype handheld, compact, rapid thermocycler was developed for multiplex analysis of nucleic acids in an inexpensive, portable configuration. Instead of the commonly used Peltier heating/cooling element, electric thin-film resistive heater and a miniature fan enable rapid heating and cooling of glass capillaries leading to a simple, low-cost Thin-Film Resistive Thermocycler (TFRT). Computer-based pulse width modulation control yields heating rates of 6-7 K/s and cooling rates of 5 K/s. The four capillaries are closely coupled to the heater, resulting in low power consumption. The energy required by a nominal PCR cycle (20 s at each temperature) was found to be 57+/-2 J yielding an average power of approximately 1.0 W (not including the computer and the control system). Thus the device can be powered by a standard 9 V alkaline battery (or other 9 V power supply). The prototype TFRT was demonstrated (in a benchtop configuration) for detection of three important food pathogens (E. coli ETEC, Shigella dysenteriae, and Salmonella enterica). PCR amplicons were analyzed by gel electrophoresis. The 35 cycle PCR protocol using a single channel was completed in less then 18 min. Simple and efficient heating/cooling, low cost, rapid amplification, and low power consumption make the device suitable for portable DNA amplification applications including clinical point of care diagnostics and field use.

  2. Rapid detection of chromosome 18 copy number in buccal smears using DNA probes and FISH

    Energy Technology Data Exchange (ETDEWEB)

    Harris, C.; Nunez, M. [Univ. of Wisconsin, WI (United States); Giraldez, R. [ONCOR, Inc., Gaithersburg, MD (United States)

    1994-09-01

    Rapid diagnosis of trisomy 18 in newborns is often critical to clinical management decisions that must be made in a minimum of time. DNA probes combined with FISH can be used to accurately to determine the copy number of chromosome 18 in interphase cells. We have used the D18Z1 alpha satellite DNA probe to determine signal frequency in normal, previously karyotyped subjects, 12 females and 6 males. We also present one clinical case of trisomy 18, confirmed by karyotype, for comparison to the results obtained from normal subjects. Buccal smears, unlike cytogenetic preparations from peripheral blood, are quite resistant to penetration of probes and detection reagents resulting in higher levels of false monosomy. We have studied 19 individuals and have obtained consistent FISH results, ranging from 64 to 90% disomy. False monosomy rates ranged from 10 to 36%, while false trisomy or tetrasomy was less than 1% in all samples. High rates of false monosomy make this test questionable for detection of low order mosaicism for monosomy, but the extremely low false hyperploidy rate suggests that this is a dependable procedure for detection of trisomy 18, enabling the use of buccal epithelium which can be collected easily from even premature and tiny infants.

  3. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers to be detac......Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...... to be detached from AuNPs when interacting with bacteria. The new strategy greatly increases the sensitivity and specificity of chip-based whole-cell biosensing....

  4. DNA methylation profile associated with rapid decline in kidney function: findings from the CRIC Study

    Science.gov (United States)

    Wing, Maria R.; Devaney, Joseph M.; Joffe, Marshall M.; Xie, Dawei; Feldman, Harold I.; Dominic, Elizabeth A.; Guzman, Nicolas J.; Ramezani, Ali; Susztak, Katalin; Herman, James G.; Cope, Leslie; Harmon, Brennan; Kwabi-Addo, Bernard; Gordish-Dressman, Heather; Go, Alan S.; He, Jiang; Lash, James P.; Kusek, John W.; Raj, Dominic S.

    2014-01-01

    Background Epigenetic mechanisms may be important in the progression of chronic kidney disease (CKD). Methods We studied the genome-wide DNA methylation pattern associated with rapid loss of kidney function using the Infinium HumanMethylation 450 K BeadChip in 40 Chronic Renal Insufficiency (CRIC) study participants (n = 3939) with the highest and lowest rates of decline in estimated glomerular filtration rate. Results The mean eGFR slope was 2.2 (1.4) and −5.1 (1.2) mL/min/1.73 m2 in the stable kidney function group and the rapid progression group, respectively. CpG islands in NPHP4, IQSEC1 and TCF3 were hypermethylated to a larger extent in subjects with stable kidney function (P-values of 7.8E−05 to 9.5E−05). These genes are involved in pathways known to promote the epithelial to mesenchymal transition and renal fibrosis. Other CKD-related genes that were differentially methylated are NOS3, NFKBIL2, CLU, NFKBIB, TGFB3 and TGFBI, which are involved in oxidative stress and inflammatory pathways (P-values of 4.5E−03 to 0.046). Pathway analysis using Ingenuity Pathway Analysis showed that gene networks related to cell signaling, carbohydrate metabolism and human behavior are epigenetically regulated in CKD. Conclusions Epigenetic modifications may be important in determining the rate of loss of kidney function in patients with established CKD. PMID:24516231

  5. DPS – A rapid method for genome sequencing of DNA-containing bacteriophages directly from a single plaque

    DEFF Research Database (Denmark)

    Kot, Witold; Vogensen, Finn Kvist; Sørensen, Søren J.

    2014-01-01

    methods for characterization of phages is determination of the whole genome using high throughput sequencing approaches. Here a direct plaque sequencing (DPS) is described, which is a rapid method that allows easy full genome sequencing of DNA-containing phages using the Nextera XT™ kit. A combination...... of host-DNA removal followed by purification and concentration of the viral DNA, allowed the construction of Illumina-compatible sequencing libraries using the Nextera™ XT technology directly from single phage plaques without any whole genome amplification step. This method was tested on three...

  6. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  7. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  8. Protocol: a rapid and economical procedure for purification of plasmid or plant DNA with diverse applications in plant biology

    Directory of Open Access Journals (Sweden)

    Li Li

    2010-01-01

    Full Text Available Abstract Research in plant molecular biology involves DNA purification on a daily basis. Although different commercial kits enable convenient extraction of high-quality DNA from E. coli cells, PCR and agarose gel samples as well as plant tissues, each kit is designed for a particular type of DNA extraction work, and the cost of purchasing these kits over a long run can be considerable. Furthermore, a simple method for the isolation of binary plasmid from Agrobacterium tumefaciens cells with satisfactory yield is lacking. Here we describe an easy protocol using homemade silicon dioxide matrix and seven simple solutions for DNA extraction from E. coli and A. tumefaciens cells, PCR and restriction digests, agarose gel slices, and plant tissues. Compared with the commercial kits, this protocol allows rapid DNA purification from diverse sources with comparable yield and purity at negligible cost. Following this protocol, we have demonstrated: (1 DNA fragments as small as a MYC-epitope tag coding sequence can be successfully recovered from an agarose gel slice; (2 Miniprep DNA from E. coli can be eluted with as little as 5 μl water, leading to high DNA concentrations (>1 μg/μl for efficient biolistic bombardment of Arabidopsis seedlings, polyethylene glycol (PEG-mediated Arabidopsis protoplast transfection and maize protoplast electroporation; (3 Binary plasmid DNA prepared from A. tumefaciens is suitable for verification by restriction analysis without the need for large scale propagation; (4 High-quality genomic DNA is readily isolated from several plant species including Arabidopsis, tobacco and maize. Thus, the silicon dioxide matrix-based DNA purification protocol offers an easy, efficient and economical way to extract DNA for various purposes in plant research.

  9. Real-time PCR using mycobacteriophage DNA for rapid phenotypic drug susceptibility results for Mycobacterium tuberculosis.

    Science.gov (United States)

    Pholwat, Suporn; Ehdaie, Beeta; Foongladda, Suporn; Kelly, Kimberly; Houpt, Eric

    2012-03-01

    Managing drug-resistant Mycobacterium tuberculosis requires drug susceptibility testing, yet conventional drug susceptibility testing is slow, and molecular testing does not yield results for all antituberculous drugs. We addressed these challenges by utilizing real-time PCR of mycobacteriophage D29 DNA to evaluate the drug resistance of clinical M. tuberculosis isolates. Mycobacteriophages infect and replicate in viable bacterial cells faster than bacterial cells replicate and have been used for detection and drug resistance testing for M. tuberculosis either by using reporter cells or phages with engineered reporter constructs. Our primary protocol involved culturing M. tuberculosis isolates for 48 h with and without drugs at critical concentrations, followed by incubation with 10(3) PFU/ml of D29 mycobacteriophage for 24 h and then real-time PCR. Many drugs could be incubated instantly with M. tuberculosis and phage for 24 h alone. The change in phage DNA real-time PCR cycle threshold (C(T)) between control M. tuberculosis and M. tuberculosis treated with drugs was calculated and correlated with conventional agar proportion drug susceptibility results. Specifically, 9 susceptible clinical isolates, 22 multidrug-resistant (MDR), and 1 extensively drug-resistant (XDR) M. tuberculosis strains were used and C(T) control-C(T) drug cutoffs of between +0.3 and -6.0 yielded 422/429 (98%) accurate results for isoniazid, rifampin, streptomycin, ethambutol, amikacin, kanamycin, capreomycin, ofloxacin, moxifloxacin, ethionamide, para-aminosalicylic acid, cycloserine, and linezolid. Moreover, the ΔC(T) values correlated with isolate MIC for most agents. This D29 quantitative PCR assay offers a rapid, accurate, 1- to 3-day phenotypic drug susceptibility test for first- and second-line drugs and may suggest an approximate MIC.

  10. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun

    2014-11-24

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  11. Rapid and sensitive diagnosis of fungal keratitis with direct PCR without template DNA extraction.

    Science.gov (United States)

    Zhao, G; Zhai, H; Yuan, Q; Sun, S; Liu, T; Xie, L

    2014-10-01

    This study was aimed at developing a direct PCR assay without template DNA extraction for the rapid and sensitive diagnosis of infectious keratitis. Eighty corneal scrapings from 67 consecutive patients with clinically suspected infectious keratitis were analysed prospectively. Direct PCR was performed with all scrapings, with specific primers for fungi, bacteria, herpes simplex virus-1 (HSV-1) and Acanthamoeba simultaneously. The results were compared with those obtained from culture, smear, and confocal microscopy. Discrepant results were resolved according to the therapeutic effects of the corresponding antimicrobial drugs. The lowest detection limit of direct PCR was ten copies of each pathogen. Sixty-six scrapings yielded positive results with direct PCR, giving a total positive detection rate of 82.5% (66/80). For 34 patients with high suspicion of fungal keratitis, the positive detection rate of direct PCR was 84.8% (39/46). This rate increased to 91.2% (31/34) when repeated scrapings were excluded, and was significantly higher than the rates obtained with culture (35.3%, 12/34) and smear (64.7%, 22/34) (p keratitis with direct PCR and culture were 98.0% and 47.1% (p keratitis, and it is expected to have an impact on the diagnosis and treatment of infectious keratitis in the future. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  12. Maintaining evolvability.

    Science.gov (United States)

    Crow, James F

    2008-12-01

    Although molecular methods, such as QTL mapping, have revealed a number of loci with large effects, it is still likely that the bulk of quantitative variability is due to multiple factors, each with small effect. Typically, these have a large additive component. Conventional wisdom argues that selection, natural or artificial, uses up additive variance and thus depletes its supply. Over time, the variance should be reduced, and at equilibrium be near zero. This is especially expected for fitness and traits highly correlated with it. Yet, populations typically have a great deal of additive variance, and do not seem to run out of genetic variability even after many generations of directional selection. Long-term selection experiments show that populations continue to retain seemingly undiminished additive variance despite large changes in the mean value. I propose that there are several reasons for this. (i) The environment is continually changing so that what was formerly most fit no longer is. (ii) There is an input of genetic variance from mutation, and sometimes from migration. (iii) As intermediate-frequency alleles increase in frequency towards one, producing less variance (as p --> 1, p(1 - p) --> 0), others that were originally near zero become more common and increase the variance. Thus, a roughly constant variance is maintained. (iv) There is always selection for fitness and for characters closely related to it. To the extent that the trait is heritable, later generations inherit a disproportionate number of genes acting additively on the trait, thus increasing genetic variance. For these reasons a selected population retains its ability to evolve. Of course, genes with large effect are also important. Conspicuous examples are the small number of loci that changed teosinte to maize, and major phylogenetic changes in the animal kingdom. The relative importance of these along with duplications, chromosome rearrangements, horizontal transmission and polyploidy

  13. Rectangular coordination polymer nanoplates: large-scale, rapid synthesis and their application as a fluorescent sensing platform for DNA detection.

    Science.gov (United States)

    Zhang, Yingwei; Luo, Yonglan; Tian, Jingqi; Asiri, Abdullah M; Al-Youbi, Abdulrahman O; Sun, Xuping

    2012-01-01

    In this paper, we report on the large-scale, rapid synthesis of uniform rectangular coordination polymer nanoplates (RCPNs) assembled from Cu(II) and 4,4'-bipyridine for the first time. We further demonstrate that such RCPNs can be used as a very effective fluorescent sensing platform for multiple DNA detection with a detection limit as low as 30 pM and a high selectivity down to single-base mismatch. The DNA detection is accomplished by the following two steps: (1) RCPN binds dye-labeled single-stranded DNA (ssDNA) probe, which brings dye and RCPN into close proximity, leading to fluorescence quenching; (2) Specific hybridization of the probe with its target generates a double-stranded DNA (dsDNA) which detaches from RCPN, leading to fluorescence recovery. It suggests that this sensing system can well discriminate complementary and mismatched DNA sequences. The exact mechanism of fluorescence quenching involved is elucidated experimentally and its use in a human blood serum system is also demonstrated successfully.

  14. Rapid purification of circular DNA by triplex-mediated affinity capture

    Science.gov (United States)

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  15. Room temperature DNA preservation of soft tissue for rapid DNA extraction: an addition to the disaster victim identification investigators toolkit?

    Science.gov (United States)

    Graham, E A M; Turk, E E; Rutty, G N

    2008-01-01

    In mass fatality incidents, for example following a vehicle accident or terrorist event, severe fragmentation of bodies may occur, making identification by the use of traditional techniques such as fingerprinting or odontology difficult. In such situations DNA profiling can be employed for individualization and re-association of fragmented remains. As at times disrupted soft tissue may be the predominate tissue type requiring identification and re-association. We have investigated the use of two buffer solutions for preservation of soft tissue samples that may be collected during such investigations, when buccal cells, blood samples or teeth or bone may not be available. Both buffer solutions have shown sufficient DNA preservation over a 12-month period of storage at room temperature to allow for DNA profiling to be successfully performed when 5-1000 mg muscle tissue was stored in each solution.

  16. SeqAnt: A web service to rapidly identify and annotate DNA sequence variations

    Directory of Open Access Journals (Sweden)

    Patel Viren

    2010-09-01

    Full Text Available Abstract Background The enormous throughput and low cost of second-generation sequencing platforms now allow research and clinical geneticists to routinely perform single experiments that identify tens of thousands to millions of variant sites. Existing methods to annotate variant sites using information from publicly available databases via web browsers are too slow to be useful for the large sequencing datasets being routinely generated by geneticists. Because sequence annotation of variant sites is required before functional characterization can proceed, the lack of a high-throughput pipeline to efficiently annotate variant sites can act as a significant bottleneck in genetics research. Results SeqAnt (Sequence Annotator is an open source web service and software package that rapidly annotates DNA sequence variants and identifies recessive or compound heterozygous loci in human, mouse, fly, and worm genome sequencing experiments. Variants are characterized with respect to their functional type, frequency, and evolutionary conservation. Annotated variants can be viewed on a web browser, downloaded in a tab-delimited text file, or directly uploaded in a BED format to the UCSC genome browser. To demonstrate the speed of SeqAnt, we annotated a series of publicly available datasets that ranged in size from 37 to 3,439,107 variant sites. The total time to completely annotate these data completely ranged from 0.17 seconds to 28 minutes 49.8 seconds. Conclusion SeqAnt is an open source web service and software package that overcomes a critical bottleneck facing research and clinical geneticists using second-generation sequencing platforms. SeqAnt will prove especially useful for those investigators who lack dedicated bioinformatics personnel or infrastructure in their laboratories.

  17. Evaluation of rapid protocols for DNA isolation from Cercospora beticola Sacc.

    Directory of Open Access Journals (Sweden)

    Budakov Dragana

    2012-01-01

    Full Text Available The most fungal DNA isolation protocols are designed to obtain high amounts of very pure DNA, requiring large fungal cultures and extraction procedures with many purification steps. Since the PCR does not require high purity DNA, the aim of this investigation was to evaluate three fast and simple fungal DNA isolation protocols for further use in Cercospora PCR based research. The purity and quantity of isolated DNAs were determined spectrophotometrically, electrophoretically and by PCR reaction with universal primers. The amounts of DNA evaluated on agarose gels, isolated by protocols A and C, did not correspond to the spectrophotometrical values, probably due to RNA impurities. In samples isolated by protocol B these impurities were not detected and the DNA concentrations were more similar. Neither protocol eliminated impurities such as carbohydrates and phenol. The average DNA yield of protocol A was 1.04 μg/μl, protocol B 0.88 μg/μl, and protocol C 0.55 μg/μl. The DNA quality most suitable for PCR analysis was obtained by protocol A, where amplification product with universal primers was detected in all DNA samples. The amplification product was detected in 87% of samples isolated by protocol C and in only 60% of samples isolated by protocol B. Although DNA obtained by protocol A had the highest yield and best quality, the isolation protocol C should be also recommended, for it does not require phenol, chlorophorm or liquid nitrogen.

  18. Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors

    DEFF Research Database (Denmark)

    Fu, Yanming; Zeng, Dongdong; Chao, Jie

    2013-01-01

    (within only 10-20 min), exhibiting extraordinarily high cooperativity that is often observed in assembly of natural molecular machines in cells (e.g. ribosome). By exploiting the high specificity of DNA-based self-assembly, we can precisely anchor proteins on these DNA origami nanostructures with sub-10...

  19. Rapid microfluidic solid-phase extraction system for hyper-methylated DNA enrichment and epigenetic analysis

    NARCIS (Netherlands)

    De, Arpita; Sparreboom, Wouter; van den Berg, Albert; Carlen, Edwin

    Genetic sequence and hyper-methylation profile information from the promoter regions of tumor suppressor genes are important for cancer disease investigation. Since hyper-methylated DNA (hm-DNA) is typically present in ultra-low concentrations in biological samples, such as stool, urine, and saliva,

  20. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  1. Rapid shift in genotype of human mitochondrial DNA in a family with Leber's hereditary optic neuropathy

    NARCIS (Netherlands)

    Bolhuis, P. A.; Bleeker-Wagemakers, E. M.; Ponne, N. J.; van Schooneveld, M. J.; Westerveld, A.; van den Bogert, C.; Tabak, H. F.

    1990-01-01

    Mitochondrial DNA isolated from white blood cells was investigated in families suffering from Leber's hereditary optic neuropathy. A recently described mutation at nucleotide position 11778 was present in 5 out of 12 families and heteroplasmic mitochondrial DNA was observed in 2 of these 5 families.

  2. Sequences from first settlers reveal rapid evolution in Icelandic mtDNA pool.

    Science.gov (United States)

    Helgason, Agnar; Lalueza-Fox, Carles; Ghosh, Shyamali; Sigurethardóttir, Sigrún; Sampietro, Maria Lourdes; Gigli, Elena; Baker, Adam; Bertranpetit, Jaume; Arnadóttir, Lilja; Thornorsteinsdottir, Unnur; Stefánsson, Kári

    2009-01-01

    A major task in human genetics is to understand the nature of the evolutionary processes that have shaped the gene pools of contemporary populations. Ancient DNA studies have great potential to shed light on the evolution of populations because they provide the opportunity to sample from the same population at different points in time. Here, we show that a sample of mitochondrial DNA (mtDNA) control region sequences from 68 early medieval Icelandic skeletal remains is more closely related to sequences from contemporary inhabitants of Scotland, Ireland, and Scandinavia than to those from the modern Icelandic population. Due to a faster rate of genetic drift in the Icelandic mtDNA pool during the last 1,100 years, the sequences carried by the first settlers were better preserved in their ancestral gene pools than among their descendants in Iceland. These results demonstrate the inferential power gained in ancient DNA studies through the application of population genetics analyses to relatively large samples.

  3. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  4. Variability among the most rapidly evolving plastid genomic regions is lineage-specific: implications of pairwise genome comparisons in Pyrus (Rosaceae and other angiosperms for marker choice.

    Directory of Open Access Journals (Sweden)

    Nadja Korotkova

    Full Text Available Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae-a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC-trnV, trnR-atpA, ndhF-rpl32, psbM-trnD, and trnQ-rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters. Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid, Olea (asterids and Cymbidium (monocots showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF-rpl32 and trnK-rps16 were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations. Sequencing

  5. A Rapid and Sensitive Diagnosis of Typhoid Fever Based On Nested PCR-Voltammetric DNA Biosensor Using Flagellin Gene Fragment

    Directory of Open Access Journals (Sweden)

    Yeni Wahyuni Hartati

    2016-03-01

    Full Text Available Typhoid fever caused by Salmonella typhi is an important issue for public health in the world. Laboratory methods for rapid and sensitive diagnosis are very important for disease management. The purpose of this study was to determine the performance of nested PCR–voltammetric DNA biosensor using flagellin gene (fla of S. typhi as a marker. The differential pulse voltammetry using pencil graphite electrode was applied to measure the guanine oxidation signal of probes vs synthetic target stDNA and probes vs fla PCR product hybridizations. The probe DNA selectivity was examined by hybridized probes vs non-complementary sequence. The result showed that the first round nested PCR product can not be visualized by agarose electrophoresis, whereas using the voltammetric biosensor methods can be detected both for the first or second round nested PCR product. The average peak current of hybridized probe vs first and second round of PCR product was 2.32 and 1.47 μA respectively, at 0.9 V. Detection of the DNA sequences of the infectious diseases from PCR amplified real sample was also carried out using this voltammetric DNA biosensor methods.

  6. A Simple and Rapid Method for DNA Isolation from Xylophagous Insects

    Directory of Open Access Journals (Sweden)

    Horacio Cano-Camacho

    2010-12-01

    Full Text Available Published methods to isolate DNA from insects are not always effective in xylophagous insects because they have high concentrations of phenolics and other secondary plant compounds in their digestive tracts. A simple, reliable and labor-effective cetyltrimethylammonium bromide-polyvinylpyrrolidone (CTAB-PVP method for isolation of high quality DNA from xylophagous insects is described. This method was successfully applied to PCR and restriction analysis, indicating removal of common inhibitors. DNA isolated by the CTAB-PVP method could be used in most molecular analyses.

  7. Rapid and Efficient cDNA Library Screening by Self-Ligation ofInverse PCR Products (SLIP)

    Energy Technology Data Exchange (ETDEWEB)

    Hoskins, Roger A.; Stapleton, Mark; George, Reed A.; Yu, Charles; Wan, Kenneth H.; Carlson, Joseph W.; Celniker, Susan E.

    2005-04-22

    The production of comprehensive cDNA clone collections is an important goal of the human and model organism genome projects. cDNA sequences are used to determine the structures of transcripts, including splice junctions, polyadenylation sites, and 5' and 3' untranslated regions (UTRs). cDNA collections are also valuable resources for functional studies of genes and proteins. Expressed Sequence Tag (EST)sequencing is the method of choice for recovering cDNAs representing a majority of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a library at random, so it realizes diminishing returns as the project progresses. To drive cDNA collections toward completion new methods are needed to recover cDNAs representing specific genes and alternative transcripts, including transcripts with low expression levels. We describe a simple and effective inverse-PCR-based method for screening plasmid libraries to recover intact cDNAs for specific transcripts. We tested the method by screening libraries used in our Drosophila EST projects for 153 transcription factor genes that were not yet represented by full-length cDNAs. We recovered target-specific clones for 104 of the genes: 46 exactly match, 30 improve and 28partially match current gene annotations. Successful application of the screening method depends on cDNA library complexity and quality of the gene models. The approach should be effective for improving cDNA collections for other model organisms and the human. It also provides a simple and rapid method for isolating cDNAs of interest in any system for which plasmid cDNA libraries and complete or partial gene sequences are available.

  8. Rapid virological diagnosis of central nervous system infections by use of a multiplex reverse transcription-PCR DNA microarray.

    Science.gov (United States)

    Leveque, Nicolas; Van Haecke, Adrien; Renois, Fanny; Boutolleau, David; Talmud, Deborah; Andreoletti, Laurent

    2011-11-01

    Viruses are the main etiological cause of central nervous system (CNS) infections. A rapid molecular diagnosis is recommended to improve the therapeutic management of patients. The aim of this study was to evaluate the performances of a DNA microarray, the Clart Entherpex kit (Genomica, Coslada, Spain), allowing the rapid and simultaneous detection of 9 DNA and RNA neurotropic viruses: herpes simplex virus 1 (HSV-1), HSV-2, varicella-zoster virus (VZV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), human herpesvirus 6 (HHV-6), HHV-7, HHV-8, and the human enteroviruses (HEVs). This evaluation was performed with 28 samples from the European proficiency panels (Quality Control for Molecular Diagnostics [QCMD]; Glasgow, Scotland) and then with 78 cerebrospinal fluid (CSF) specimens. The majority of the QCMD results obtained by the DNA microarray were similar to those recorded by the overall QCMD participants. The main discrepant results were observed for low concentrations of HSV-2 and HEVs. From the clinical samples, the kit detected 27 of the 28 herpesvirus CNS infections and all of the 30 HEV-positive CSF samples. No false-positive result was observed among the 20 virus-negative CSF samples. The clinical sensitivity, specificity, and negative and positive predictive values of the assay were 98.3, 100, 95.2, and 100%, respectively, when the results were compared to those of commercially available PCR assays. Interestingly, HHV-7 was detected in 11 (37%) of the 30 HEV-positive CSF samples from children suffering from aseptic meningitis causing significantly longer lengths of stay at the hospital than infection with HEVs alone (2.4 versus 1.4 days; P = 0.038). In conclusion, this preliminary study showed that this DNA microarray could be a valuable molecular diagnostic tool for single and mixed DNA and RNA virus infections of the CNS.

  9. DNA in a bottle-Rapid metabarcoding survey for early alerts of invasive species in ports.

    Science.gov (United States)

    Borrell, Yaisel J; Miralles, Laura; Do Huu, Hoang; Mohammed-Geba, Khaled; Garcia-Vazquez, Eva

    2017-01-01

    Biota monitoring in ports is increasingly needed for biosecurity reasons and safeguarding marine biodiversity from biological invasion. Present and future international biosecurity directives can be accomplished only if the biota acquired by maritime traffic in ports is controlled. Methodologies for biota inventory are diverse and now rely principally on extensive and labor-intensive sampling along with taxonomic identification by experts. In this study, we employed an extremely simplified environmental DNA (eDNA) sampling methodology from only three 1-L bottles of water per port, followed by metabarcoding (high-throughput sequencing and DNA-based species identification) using 18S rDNA and Cytochrome oxidase I as genetic barcodes. Eight Bay of Biscay ports with available inventory of fouling invertebrates were employed as a case study. Despite minimal sampling efforts, three invasive invertebrates were detected: the barnacle Austrominius modestus, the tubeworm Ficopomatus enigmaticus and the polychaete Polydora triglanda. The same species have been previously found from visual and DNA barcoding (genetic identification of individuals) surveys in the same ports. The current costs of visual surveys, conventional DNA barcoding and this simplified metabarcoding protocol were compared. The results encourage the use of metabarcoding for early biosecurity alerts.

  10. DNA in a bottle-Rapid metabarcoding survey for early alerts of invasive species in ports.

    Directory of Open Access Journals (Sweden)

    Yaisel J Borrell

    Full Text Available Biota monitoring in ports is increasingly needed for biosecurity reasons and safeguarding marine biodiversity from biological invasion. Present and future international biosecurity directives can be accomplished only if the biota acquired by maritime traffic in ports is controlled. Methodologies for biota inventory are diverse and now rely principally on extensive and labor-intensive sampling along with taxonomic identification by experts. In this study, we employed an extremely simplified environmental DNA (eDNA sampling methodology from only three 1-L bottles of water per port, followed by metabarcoding (high-throughput sequencing and DNA-based species identification using 18S rDNA and Cytochrome oxidase I as genetic barcodes. Eight Bay of Biscay ports with available inventory of fouling invertebrates were employed as a case study. Despite minimal sampling efforts, three invasive invertebrates were detected: the barnacle Austrominius modestus, the tubeworm Ficopomatus enigmaticus and the polychaete Polydora triglanda. The same species have been previously found from visual and DNA barcoding (genetic identification of individuals surveys in the same ports. The current costs of visual surveys, conventional DNA barcoding and this simplified metabarcoding protocol were compared. The results encourage the use of metabarcoding for early biosecurity alerts.

  11. DNA in a bottle—Rapid metabarcoding survey for early alerts of invasive species in ports

    Science.gov (United States)

    Miralles, Laura; Do Huu, Hoang; Mohammed-Geba, Khaled; Garcia-Vazquez, Eva

    2017-01-01

    Biota monitoring in ports is increasingly needed for biosecurity reasons and safeguarding marine biodiversity from biological invasion. Present and future international biosecurity directives can be accomplished only if the biota acquired by maritime traffic in ports is controlled. Methodologies for biota inventory are diverse and now rely principally on extensive and labor-intensive sampling along with taxonomic identification by experts. In this study, we employed an extremely simplified environmental DNA (eDNA) sampling methodology from only three 1-L bottles of water per port, followed by metabarcoding (high-throughput sequencing and DNA-based species identification) using 18S rDNA and Cytochrome oxidase I as genetic barcodes. Eight Bay of Biscay ports with available inventory of fouling invertebrates were employed as a case study. Despite minimal sampling efforts, three invasive invertebrates were detected: the barnacle Austrominius modestus, the tubeworm Ficopomatus enigmaticus and the polychaete Polydora triglanda. The same species have been previously found from visual and DNA barcoding (genetic identification of individuals) surveys in the same ports. The current costs of visual surveys, conventional DNA barcoding and this simplified metabarcoding protocol were compared. The results encourage the use of metabarcoding for early biosecurity alerts. PMID:28873426

  12. Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors.

    Science.gov (United States)

    Fu, Yanming; Zeng, Dongdong; Chao, Jie; Jin, Yanqiu; Zhang, Zhao; Liu, Huajie; Li, Di; Ma, Hongwei; Huang, Qing; Gothelf, Kurt V; Fan, Chunhai

    2013-01-16

    Self-assembled DNA origami nanostructures have shown great promise for bottom-up construction of complex objects with nanoscale addressability. Here we show that DNA origami-based 1D nanoribbons and nanotubes are one-pot assembled with controllable sizes and nanoscale addressability with high speed (within only 10-20 min), exhibiting extraordinarily high cooperativity that is often observed in assembly of natural molecular machines in cells (e.g. ribosome). By exploiting the high specificity of DNA-based self-assembly, we can precisely anchor proteins on these DNA origami nanostructures with sub-10 nm resolution and at the single-molecule level. We attach a pair of enzymes (horseradish peroxidase and glucose oxidase) at the inner side of DNA nanotubes and observe high coupling efficiency of enzyme cascade within this confined nanospace. Hence, DNA nanostructures with such unprecedented properties shed new light on the design of nanoscale bioreactors and nanomedicine and provide an artificial system for studying enzyme activities and cascade in highly organized and crowded cell-mimicking environments.

  13. DPS - a rapid method for genome sequencing of DNA-containing bacteriophages directly from a single plaque.

    Science.gov (United States)

    Kot, Witold; Vogensen, Finn K; Sørensen, Søren J; Hansen, Lars H

    2014-02-01

    Bacteriophages (phages) coexist with bacteria in all environments and influence microbial diversity, evolution and industrial production processes. As a result of this major impact of phages on microbes, tools that allow rapid characterization of phages are needed. Today, one of the most powerful methods for characterization of phages is determination of the whole genome using high throughput sequencing approaches. Here a direct plaque sequencing (DPS) is described, which is a rapid method that allows easy full genome sequencing of DNA-containing phages using the Nextera XT™ kit. A combination of host-DNA removal followed by purification and concentration of the viral DNA, allowed the construction of Illumina-compatible sequencing libraries using the Nextera™ XT technology directly from single phage plaques without any whole genome amplification step. This method was tested on three Caudovirales phages; ϕ29 Podoviridae, P113g Siphoviridae and T4 Myovirdae, which are representative of >96% of all known phages, and were sequenced using the Illumina MiSeq platform. Successful de novo assembly of the viral genomes was possible. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Rapid molecular detection of invasive species in ballast and harbor water by integrating environmental DNA and light transmission spectroscopy.

    Science.gov (United States)

    Egan, Scott P; Grey, Erin; Olds, Brett; Feder, Jeffery L; Ruggiero, Steven T; Tanner, Carol E; Lodge, David M

    2015-04-07

    Invasive species introduced via the ballast water of commercial ships cause enormous environmental and economic damage worldwide. Accurate monitoring for these often microscopic and morphologically indistinguishable species is challenging but critical for mitigating damages. We apply eDNA sampling, which involves the filtering and subsequent DNA extraction of microscopic bits of tissue suspended in water, to ballast and harbor water sampled during a commercial ship's 1400 km voyage through the North American Great Lakes. Using a lab-based gel electrophoresis assay and a rapid, field-ready light transmission spectroscopy (LTS) assay, we test for the presence of two invasive species: quagga (Dreissena bugensis) and zebra (D. polymorpha) mussels. Furthermore, we spiked a set of uninfested ballast and harbor samples with zebra mussel tissue to further test each assay's detection capabilities. In unmanipulated samples, zebra mussel was not detected, while quagga mussel was detected in all samples at a rate of 85% for the gel assay and 100% for the LTS assay. In the spiked experimental samples, both assays detected zebra mussel in 94% of spiked samples and 0% of negative controls. Overall, these results demonstrate that eDNA sampling is effective for monitoring ballast-mediated invasions and that LTS has the potential for rapid, field-based detection.

  15. Sequences from first settlers reveal rapid evolution in Icelandic mtDNA pool.

    Directory of Open Access Journals (Sweden)

    Agnar Helgason

    2009-01-01

    Full Text Available A major task in human genetics is to understand the nature of the evolutionary processes that have shaped the gene pools of contemporary populations. Ancient DNA studies have great potential to shed light on the evolution of populations because they provide the opportunity to sample from the same population at different points in time. Here, we show that a sample of mitochondrial DNA (mtDNA control region sequences from 68 early medieval Icelandic skeletal remains is more closely related to sequences from contemporary inhabitants of Scotland, Ireland, and Scandinavia than to those from the modern Icelandic population. Due to a faster rate of genetic drift in the Icelandic mtDNA pool during the last 1,100 years, the sequences carried by the first settlers were better preserved in their ancestral gene pools than among their descendants in Iceland. These results demonstrate the inferential power gained in ancient DNA studies through the application of population genetics analyses to relatively large samples.

  16. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  17. Rapid DNA transformation in Salmonella Typhimurium by the hydrogel exposure method.

    Science.gov (United States)

    Elabed, Hamouda; Hamza, Rim; Bakhrouf, Amina; Gaddour, Kamel

    2016-07-01

    Even with advances in molecular cloning and DNA transformation, new or alternative methods that permit DNA penetration in Salmonella enterica subspecies enterica serovar Typhimurium are required in order to use this pathogen in biotechnological or medical applications. In this work, an adapted protocol of bacterial transformation with plasmid DNA based on the "Yoshida effect" was applied and optimized on Salmonella enterica serovar Typhimurium LT2 reference strain. The plasmid transference based on the use of sepiolite as acicular materials to promote cell piercing via friction forces produced by spreading on the surface of a hydrogel. The transforming mixture containing sepiolite nanofibers, bacterial cells to be transformed and plasmid DNA were plated directly on selective medium containing 2% agar. In order to improve the procedure, three variables were tested and the transformation of Salmonella cells was accomplished using plasmids pUC19 and pBR322. Using the optimized protocol on Salmonella LT2 strain, the efficiency was about 10(5) transformed cells per 10(9) subjected to transformation with 0.2μg plasmid DNA. In summary, the procedure is fast, offers opportune efficiency and promises to become one of the widely used transformation methods in laboratories. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Rapid prototyping of 3D DNA-origami shapes with caDNAno

    Science.gov (United States)

    Douglas, Shawn M.; Marblestone, Adam H.; Teerapittayanon, Surat; Vazquez, Alejandro; Church, George M.; Shih, William M.

    2009-01-01

    DNA nanotechnology exploits the programmable specificity afforded by base-pairing to produce self-assembling macromolecular objects of custom shape. For building megadalton-scale DNA nanostructures, a long ‘scaffold’ strand can be employed to template the assembly of hundreds of oligonucleotide ‘staple’ strands into a planar antiparallel array of cross-linked helices. We recently adapted this ‘scaffolded DNA origami’ method to producing 3D shapes formed as pleated layers of double helices constrained to a honeycomb lattice. However, completing the required design steps can be cumbersome and time-consuming. Here we present caDNAno, an open-source software package with a graphical user interface that aids in the design of DNA sequences for folding 3D honeycomb-pleated shapes A series of rectangular-block motifs were designed, assembled, and analyzed to identify a well-behaved motif that could serve as a building block for future studies. The use of caDNAno significantly reduces the effort required to design 3D DNA-origami structures. The software is available at http://cadnano.org/, along with example designs and video tutorials demonstrating their construction. The source code is released under the MIT license. PMID:19531737

  19. Orbital and physical parameters of eclipsing binaries from the All-Sky Automated Survey catalogue. III. Two new low-mass systems with rapidly evolving spots

    Science.gov (United States)

    Hełminiak, K. G.; Konacki, M.; Złoczewski, K.; Ratajczak, M.; Reichart, D. E.; Ivarsen, K. M.; Haislip, J. B.; Crain, J. A.; Foster, A. C.; Nysewander, M. C.; Lacluyze, A. P.

    2011-03-01

    Aims: We present the results of our spectroscopic and photometric analysis of two newly discovered low-mass detached eclipsing binaries found in the All-Sky Automated Survey (ASAS) catalogue: ASAS J093814-0104.4 and ASAS J212954-5620.1. Methods: Using the Grating Instrument for Radiation Analysis with a Fibre-Fed Echelle (GIRAFFE) on the 1.9-m Radcliffe telescope at the South African Astronomical Observatory (SAAO) and the University College London Echelle Spectrograph (UCLES) on the 3.9-m Anglo-Australian Telescope, we obtained high-resolution spectra of both objects and derived their radial velocities (RVs) at various orbital phases. The RVs of both objects were measured with the two-dimensional cross-correlation technique (TODCOR) using synthetic template spectra as references. We also obtained V and I band photometry using the 1.0-m Elizabeth telescope at SAAO and the 0.4-m Panchromatic Robotic Optical Monitoring and Polarimetry Telescopes (PROMPT) located at the Cerro Tololo Inter-American Observatory (CTIO). The orbital and physical parameters of the systems were derived with PHOEBE and JKTEBOP codes. We compared our results with several sets of widely-used isochrones. Results: Our multi-epoch photometric observations demonstrate that both objects show significant out-of-eclipse modulations, which vary in time. We believe that this effect is caused by stellar spots, which evolve on time scales of tens of days. For this reason, we constructed our models on the basis of photometric observations spanning short time scales (less than a month). Our modeling indicates that (1) ASAS J093814-0104.04 is a main sequence active system with nearly-twin components with masses of M1 = 0.771 ± 0.033 M⊙, M2 = 0.768 ± 0.021 M⊙ and radii of R1 = 0.772 ± 0.012 R⊙ and R2 = 0.769 ± 0.013 R⊙. (2) ASAS J212954-5620.1 is a main sequence active binary with component masses of M1 = 0.833 ± 0.017 M⊙, M2 = 0.703 ± 0.013 M⊙ and radii of R1 = 0.845 ± 0.012 R⊙ and R2

  20. Rapid DNA Synthesis During EarlyDrosophilaEmbryogenesis Is Sensitive to Maternal Humpty Dumpty Protein Function.

    Science.gov (United States)

    Lesly, Shera; Bandura, Jennifer L; Calvi, Brian R

    2017-11-01

    Problems with DNA replication cause cancer and developmental malformations. It is not fully understood how DNA replication is coordinated with development and perturbed in disease. We had previously identified the Drosophila gene humpty dumpty ( hd ), and showed that null alleles cause incomplete DNA replication, tissue undergrowth, and lethality. Animals homozygous for the missense allele, hd 272-9 , were viable, but adult females had impaired amplification of eggshell protein genes in the ovary, resulting in the maternal effects of thin eggshells and embryonic lethality. Here, we show that expression of an hd transgene in somatic cells of the ovary rescues amplification and eggshell synthesis but not embryo viability. The germline of these mothers remain mutant for the hd 272-9 allele, resulting in reduced maternal Hd protein and embryonic arrest during mitosis of the first few S/M nuclear cleavage cycles with chromosome instability and chromosome bridges. Epistasis analysis of hd with the rereplication mutation plutonium indicates that the chromosome bridges of hd embryos are the result of a failed attempt to segregate incompletely replicated sister chromatids. This study reveals that maternally encoded Humpty dumpty protein is essential for DNA replication and genome integrity during the little-understood embryonic S/M cycles. Moreover, the two hd 272-9 maternal-effect phenotypes suggest that ovarian gene amplification and embryonic cleavage are two time periods in development that are particularly sensitive to mild deficits in DNA replication function. This last observation has broader relevance for interpreting why mild mutations in the human ortholog of humpty dumpty and other DNA replication genes cause tissue-specific malformations of microcephalic dwarfisms. Copyright © 2017 by the Genetics Society of America.

  1. Rapid generation of long tandem DNA repeat arrays by homologous recombination in yeast to study their function in mammalian genomes

    Directory of Open Access Journals (Sweden)

    Kouprina Natalay

    2011-10-01

    Full Text Available Abstract We describe here a method to rapidly convert any desirable DNA fragment, as small as 100 bp, into long tandem DNA arrays up to 140 kb in size that are inserted into a microbe vector. This method includes rolling-circle phi29 amplification (RCA of the sequence in vitro and assembly of the RCA products in vivo by homologous recombination in the yeast Saccharomyces cerevisiae. The method was successfully used for a functional analysis of centromeric and pericentromeric repeats and construction of new vehicles for gene delivery to mammalian cells. The method may have general application in elucidating the role of tandem repeats in chromosome organization and dynamics. Each cycle of the protocol takes ~ two weeks to complete.

  2. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.

    2011-01-01

    for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were......Fish diseases can be caused by a variety of diverse organisms, including bacteria, fungi, viruses and protozoa, and pose a universal threat to the ornamental fish industry and aquaculture. The lack of rapid, accurate and reliable means by which fish pathogens can be detected and identified has been...... one of the main limitations in fish pathogen diagnosis and fish disease management and has consequently stimulated the search for alternative diagnostic techniques. Here, we describe a method based on multiplex and broad‐range PCR amplification combined with DNA array hybridization...

  3. Microchip-based one step DNA extraction and real-time PCR in one chamber for rapid pathogen identification.

    Science.gov (United States)

    Lee, Jeong-Gun; Cheong, Kwang Ho; Huh, Nam; Kim, Suhyeon; Choi, Jeong-Woo; Ko, Christopher

    2006-07-01

    Optimal detection of a pathogen present in biological samples depends on the ability to extract DNA molecules rapidly and efficiently. In this paper, we report a novel method for efficient DNA extraction and subsequent real-time detection in a single microchip by combining laser irradiation and magnetic beads. By using a 808 nm laser and carboxyl-terminated magnetic beads, we demonstrate that a single pulse of 40 seconds lysed pathogens including E. coli and Gram-positive bacterial cells as well as the hepatitis B virus mixed with human serum. We further demonstrate that the real-time pathogen detection was performed with pre-mixed PCR reagents in a real-time PCR machine using the same microchip, after laser irradiation in a hand-held device equipped with a small laser diode. These results suggest that the new sample preparation method is well suited to be integrated into lab-on-a-chip application of the pathogen detection system.

  4. Rapid assessment of non-indigenous species in the era of the eDNA barcoding: A Mediterranean case study

    Science.gov (United States)

    Ardura, Alba; Planes, Serge

    2017-03-01

    With only a narrow opening through the Gibraltar and Suez Canals, the Mediterranean Sea is one of the largest semi-enclosed seas. The marine flora and fauna are some of the richest in the world, relative to its size, particularly in the coastal habitats, which are also characterized by numerous endemic species although the introduction of non-indigenous species threatens its rich and unique biodiversity. Following the opening of the Suez Canal, and in combination with shipping and aquaculture activities, non-indigenous species (NIS) introduction has had measurable impacts on the Mediterranean. Lagoon ecosystems along the French coastline, with approx. 100 NIS identified, are considered hot-spot areas for these species. Rapid assessment sampling for sessile benthic species together with DNA barcoding is a rapid, easy and cheap method to detect non-indigenous species. Two nearby and different ecosystems were sampled for invertebrate species: Saint-Nazaire lagoon, a Special Protection Area within the Natura 2000 Network and Canet port, a marina in a small village. The DNA barcoding tool for species identification was used for confirming the taxonomy. This showed that, despite the Saint-Nazaire Lagoon classification within the Natura 2000 network, it is already contaminated with a single NIS that was found in high densities and is clearly beginning to dominate the system. It is proposed that a rapid assessment of the sampled environment and the DNA barcode approach are efficient and can provide sufficient information on the new target species to be used in conservation planning and ongoing management efforts.

  5. Rapid and correct identification of intestinal Bacteroides spp. with chromosomal DNA probes by whole-cell dot blot hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Morotomi, M.; Ohno, T.; Mutai, M.

    1988-05-01

    A dot blot hybridization procedure with /sup 32/P-labeled whole chromosomal DNA of the type strains as probes was developed as a rapid and simple method for identification of intestinal Bacteroides species. Bacterial cells were fixed onto membrane filters by slight suction, treated with 0.5 N NaOH, and hybridized with these probes. Of 65 Bacteroides strains isolated from 19 human fecal specimens, which were identified as B. fragilis, B. thetaiotaomicron, B. ovatus, B. caccae, B. uniformis, B. stercoris, B. vulgatus, B. distasonis, and B. merdae by conventional phenotypic characterization, 62 (95%) were correctly identified with this hybridization procedure.

  6. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... 1487. Figure 1. 1% Agarose gel showing typical PCR results obtained for the amplification of the Mdh gene after the DNA .... procedure based on selective binding of bovine alpha-casein to silica particles. J. Clin. Microbiol. 37: 615-619. Boom R, Sol CJA, Salimans MMM, Jansen CL, Werthiem-Van Dillen.

  7. The use of DNA markers for rapid improvement of crops in Africa ...

    African Journals Online (AJOL)

    Genetic engineering and biotechnology are providing new tools for genetic improvement of food crops. Molecular DNA markers are some of these tools which can be used in various fields of plant breeding and germplasm management. For example, molecular markers have been used to confirm the identity of hybrids in ...

  8. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection

    NARCIS (Netherlands)

    Wagemakers, A.; Mason, L. M. K.; Oei, A.; de Wever, B.; van der Poll, T.; Bins, A. D.; Hovius, J. W. R.

    2014-01-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method

  9. rapid mini-prep DNA extraction method in rice (Oryza sativa ...

    African Journals Online (AJOL)

    method, optimized for rice, which was achieved via some modifications in present DNA extraction methods, especially in first step of cell wall lyses and the use of cheap and frequent chemicals found in every laboratory is presented. Normal quality and quantity was obtained by the method. The PCR based assays also ...

  10. DNA Mimics for the Rapid Identification of Microorganisms by Fluorescence in situ Hybridization (FISH

    Directory of Open Access Journals (Sweden)

    Maria J. Vieira

    2008-10-01

    Full Text Available Fluorescence in situ hybridization (FISH is a well-established technique that is used for a variety of purposes, ranging from pathogen detection in clinical diagnostics to the determination of chromosomal stability in stem cell research. The key step of FISH involves the detection of a nucleic acid region and as such, DNA molecules have typically been used to probe for the sequences of interest. However, since the turn of the century, an increasing number of laboratories have started to move on to the more robust DNA mimics methods, most notably peptide and locked nucleic acids (PNA and LNA. In this review, we will cover the state-of-the-art of the different DNA mimics in regard to their application as efficient markers for the presence of individual microbial cells, and consider their potential advantages and pitfalls. Available PNA probes are then reassessed in terms of sensitivity and specificity using rRNA databases. In addition, we also attempt to predict the applicability of DNA mimics in well-known techniques attempting to detect in situ low number of copies of specific nucleic acid sequences such as catalyzed reporter deposition (CARD and recognition of individual genes (RING FISH.

  11. The use of DNA markers for rapid improvement of crops in Africa ...

    African Journals Online (AJOL)

    Genetic engineering and biotechnology are providing new tools for genetic improvement of food crops. Molecular DNA markers are some of ... The polymerase chain reaction (PCR) has become a popular technique for molecular genome mapping and the diagnosis of plant pathogens. The technique ensures amplification ...

  12. DNA mimics for the rapid identification of microorganisms by fluorescence in situ hybridization (FISH).

    Science.gov (United States)

    Cerqueira, Laura; Azevedo, Nuno F; Almeida, Carina; Jardim, Tatiana; Keevil, Charles William; Vieira, Maria J

    2008-10-01

    Fluorescence in situ hybridization (FISH) is a well-established technique that is used for a variety of purposes, ranging from pathogen detection in clinical diagnostics to the determination of chromosomal stability in stem cell research. The key step of FISH involves the detection of a nucleic acid region and as such, DNA molecules have typically been used to probe for the sequences of interest. However, since the turn of the century, an increasing number of laboratories have started to move on to the more robust DNA mimics methods, most notably peptide and locked nucleic acids (PNA and LNA). In this review, we will cover the state-of-the-art of the different DNA mimics in regard to their application as efficient markers for the presence of individual microbial cells, and consider their potential advantages and pitfalls. Available PNA probes are then reassessed in terms of sensitivity and specificity using rRNA databases. In addition, we also attempt to predict the applicability of DNA mimics in well-known techniques attempting to detect in situ low number of copies of specific nucleic acid sequences such as catalyzed reporter deposition (CARD) and recognition of individual genes (RING) FISH.

  13. Optimization of real-time PCR assay for rapid and sensitive detection of eubacterial 16S ribosomal DNA in platelet concentrates.

    NARCIS (Netherlands)

    Mohammadi, T.; Reesink, H.W.; Vandenbroucke-Grauls, C.M.J.E.; Savelkoul, P.H.M.

    2003-01-01

    A real-time PCR assay was developed for rapid detection of eubacterial 16S ribosomal DNA in platelet concentrates. The sensitivity of this assay can be hampered by contaminating DNA in the PCR reagents. Digestion of the PCR reagents with Sau3AI prior to PCR amplification was effective in eliminating

  14. An efficient and rapid DNA minipreparation procedure suitable for PCR/SSR and RAPD analyses in tropical forest tree species

    Directory of Open Access Journals (Sweden)

    Ana Lilia Alzate-Marin

    2009-10-01

    Full Text Available An efficient and rapid DNA minipreparation modified method for frozen samples was developed for five tropical tree species: Copaifera langsdorffii, Hymenaea courbaril, Eugenia uniflora, Tabebuia roseo alba and Cariniana estrellensis. This procedure that dispenses the use of liquid nitrogen, phenol and the addition of proteinase K, is an adaptation of the CTAB-based DNA extraction method. The modifications included the use of PVP to eliminate the polyphenols, only one chloroform-isoamyl alcohol step and the addition of RNase immediately after extraction with chloroform. The yields of the DNA samples ranged from 25.7 to 42.1 µg from 100 mg leaf tissue. The DNA samples extracted by this method were successfully used for PCR (SSR and RAPD analyses in these five and other twelve tropical tree species.Este trabalho teve como objetivo otimizar um protocolo econômico, rápido e eficaz de minipreparação de DNA genômico, para as espécies florestais Copaifera langsdorffii (Óleo de Copaíba, Hymenaea courbaril (Jatobá, Eugenia uniflora (Pitanga, Tabebuia roseo alba (Ipê Branco e Cariniana estrellensis (Jequitibá Branco. Este método é uma adaptação da técnica de extração CTAB de Doyle e Doyle (1990, o qual consiste principalmente na adição de PVP para eliminar polifenoles, somente uma etapa de extração com clorofórmio-álcool isoamílico e a adição da RNase A imediatamente após a extração com clorofórmio. O método também dispensa o uso de nitrogênio líquido, o uso do fenol e a adição de proteinase K. Os DNAs das espécies florestais extraídos apresentaram alto rendimento e boa qualidade, com rendimento de 25.7 a 42.1 µg de DNA a partir de 100 mg de tecido foliar congelado. Com este protocolo, em apenas 1 dia de trabalho, uma pessoa pode completar o isolamento do DNA de aproximadamente 50 amostras de folhas (dependendo da capacidade da centrífuga. O DNA obtido pode ser usado para métodos de análise baseados em PCR (SSR e

  15. MGB probe assay for rapid detection of mtDNA11778 mutation in the Chinese LHON patients by real-time PCR*

    OpenAIRE

    Wang, Jian-yong; Gu, Yang-shun; Wang, Jing; Tong, Yi; Wang, Ying; Shao, Jun-bing; Qi, Ming

    2008-01-01

    Objective: Leber’s hereditary optic neuropathy (LHON) is a maternally inherited degeneration of the optic nerve caused by point mutations of mitochondrial DNA (mtDNA). Many unsolved questions regarding the penetrance and pathophysiological mechanism of LHON demand efficient and reliable mutation testing. This study aims to develop a minor groove binder (MGB) probe assay for rapid detection of mtDNA11778 mutation and heteroplasmy in Chinese LHON patients by real-time polymerase chain reaction ...

  16. LV Barcoding: locality sensitive hashing-based tool for rapid species identification in DNA barcoding

    OpenAIRE

    Fan, Long; Chu, Ka Hou

    2014-01-01

    DNA barcoding has emerged as a cost-effective approach for species identification. However, the scarcity of tools used for searching the booming reference database becomes an obstacle, currently with BLAST as the only practical choice. Here, we propose a program - LV Barcoding - based on both the random hyperplane projection-based locality sensitive hashing method and the composition vector-based VIP Barcoding for fast species identification. The performance of LV Barcoding is assessed on the...

  17. Rapid and Sensitive Method To Identify Mycobacterium avium subsp. paratuberculosis in Cow's Milk by DNA Methylase Genotyping

    Science.gov (United States)

    Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José

    2013-01-01

    Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time. PMID:23275511

  18. Rapid and sensitive method to identify Mycobacterium avium subsp. paratuberculosis in cow's milk by DNA methylase genotyping.

    Science.gov (United States)

    Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José; Lopez, Osvaldo Jorge

    2013-03-01

    Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time.

  19. A novel GMO biosensor for rapid ultrasensitive and simultaneous detection of multiple DNA components in GMO products.

    Science.gov (United States)

    Huang, Lin; Zheng, Lei; Chen, Yinji; Xue, Feng; Cheng, Lin; Adeloju, Samuel B; Chen, Wei

    2015-04-15

    Since the introduction of genetically modified organisms (GMOs), there has been on-going and continuous concern and debates on the commercialization of products derived from GMOs. There is an urgent need for development of highly efficient analytical methods for rapid and high throughput screening of GMOs components, as required for appropriate labeling of GMO-derived foods, as well as for on-site inspection and import/export quarantine. In this study, we describe, for the first time, a multi-labeling based electrochemical biosensor for simultaneous detection of multiple DNA components of GMO products on the same sensing interface. Two-round signal amplification was applied by using both an exonuclease enzyme catalytic reaction and gold nanoparticle-based bio-barcode related strategies, respectively. Simultaneous multiple detections of different DNA components of GMOs were successfully achieved with satisfied sensitivity using this electrochemical biosensor. Furthermore, the robustness and effectiveness of the proposed approach was successfully demonstrated by application to various GMO products, including locally obtained and confirmed commercial GMO seeds and transgenetic plants. The proposed electrochemical biosensor demonstrated unique merits that promise to gain more interest in its use for rapid and on-site simultaneous multiple screening of different components of GMO products. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. DNA-based genetic markers for Rapid Cycling Brassica rapa (Fast Plants type designed for the teaching laboratory.

    Directory of Open Access Journals (Sweden)

    Eryn E. Slankster

    2012-06-01

    Full Text Available We have developed DNA-based genetic markers for rapid-cycling Brassica rapa (RCBr, also known as Fast Plants. Although markers for Brassica rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP based markers and 14 variable number tandem repeat (VNTR-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a nongenic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology.

  1. Rapid assembly of multiple DNA fragments through direct transformation of PCR products into E. coli and Lactobacillus.

    Science.gov (United States)

    Cao, Pinghua; Wang, Lei; Zhou, Guangxian; Wang, Yaoyue; Chen, Yulin

    2014-11-01

    This article describes a rapid, highly efficient and versatile method for seamlessly assembling multiple DNA fragments into a vector at any desired position. The inserted fragments and vector backbone were amplified by high-fidelity PCR containing 20 bp to 50 bp overlapping regions at 3' and/or 5' termini. These linearised fragments were equimolarly mixed, and then cyclised in a prolonged overlap extension PCR without adding primers. The resulting PCR products were DNA multimers that could be directly transformed into host strains, yielding the desired chimeric plasmid. The proposed method was illustrated by constructing an Escherichia coli co-expression vector. The feasibility of the method in Lactobacillus was further validated by assembling an E. coli-Lactobacillus shuttle vector. Results showed that three to four fragments could be simultaneously and precisely inserted in a vector in only 2-3 days using the proposed method. The acceptable transformation efficiency was determined through the tested host strains; more than 95% of the colonies were positive transformants. Therefore, the proposed method is sufficiently competent for high-efficiency insertion of multiple DNA fragments into a plasmid and has theoretically good application potential for gene cloning and protein expression because it is simple, easy to implement, flexible and yields highly positive clones. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Rapid genotyping of carcinogenic human papillomavirus by loop-mediated isothermal amplification using a new automated DNA test (Clinichip HPV™).

    Science.gov (United States)

    Satoh, Toyomi; Matsumoto, Koji; Fujii, Takuma; Sato, Osamu; Gemma, Nobuhiro; Onuki, Mamiko; Saito, Hiroshi; Aoki, Daisuke; Hirai, Yasuo; Yoshikawa, Hiroyuki

    2013-03-01

    This study was designed to evaluate the Clinichip HPV test, a new DNA test that detects carcinogenic human papillomavirus (HPV) rapidly by loop-mediated isothermal amplification and performs genotyping of all 13 carcinogenic types using automated DNA chip technology with an assay time 2.5h. Using this test, 247 Japanese women (109 with normal cytology, 43 with cervical intraepithelial neoplasia grade 1, 60 with cervical intraepithelial neoplasia grade 2/3 and 35 with invasive cervical cancer) were tested for carcinogenic HPV genotypes. The results were compared to those obtained by the polymerase chain reaction-amplified DNA sequencing using 13 type-specific primers. Overall, there was very good agreement for the detection of carcinogenic HPV between the Clinichip test and direct sequencing, with 95.5% total agreement and a kappa value of 0.91. Comparison of the detection of individual HPV types shows that the overall agreement was also high (range: 96.8-100%). In women with cervical intraepithelial neoplasia grade 2 or worse, the detection rate of carcinogenic HPV was 95.7% by both the Clinichip test and the direct-sequencing method, indicating complete agreement between the two methods. In conclusion, it was found that the Clinichip test is a promising new laboratory method for genotyping of carcinogenic HPV. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. DNA-Based Genetic Markers for Rapid Cycling Brassica Rapa (Fast Plants Type) Designed for the Teaching Laboratory

    Science.gov (United States)

    Slankster, Eryn E.; Chase, Jillian M.; Jones, Lauren A.; Wendell, Douglas L.

    2012-01-01

    We have developed DNA-based genetic markers for rapid cycling Brassica rapa (RCBr), also known as Fast Plants. Although markers for B. rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP) based markers and 14 variable number tandem repeat (VNTR)-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a non-genic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology. PMID:22675329

  4. Rapid DNA haplotyping using a multiplex heteroduplex approach: application to Duchenne muscular dystrophy carrier testing.

    Science.gov (United States)

    Prior, T W; Wenger, G D; Papp, A C; Snyder, P J; Sedra, M S; Bartolo, C; Moore, J W; Highsmith, W E

    1995-01-01

    A new strategy has been developed for rapid haplotype analysis based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. This simple, rapid method does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. The method may be used for other genetic diseases when mutations are unknown or there are few dinucleotide markers in the gene proximity, and for the identification of haplotype backgrounds of mutant alleles.

  5. A new rapid method for Clostridium difficile DNA extraction and detection in stool: toward point-of-care diagnostic testing.

    Science.gov (United States)

    Freifeld, Alison G; Simonsen, Kari A; Booth, Christine S; Zhao, Xing; Whitney, Scott E; Karre, Teresa; Iwen, Peter C; Viljoen, Hendrik J

    2012-01-01

    We describe a new method for the rapid diagnosis of Clostridium difficile infection, with stool sample preparation and DNA extraction by heat and physical disruption in a single-use lysis microreactor (LMR), followed by a rapid PCR amplification step. All steps can be accomplished in stool samples with discordant EIA results (GDH(+)/toxin(-)) were tested by both the LMR/PCR assay and the loop-mediated isothermal amplification test (LAMP) (Illumigene C. difficile; Meridian Bioscience, Cincinnati, OH). In 64/69 EIA-discordant samples, LAMP and LMR/PCR results matched (both positive in 29 sample and both negative in 35 samples); in the remaining 5 samples, results were discrepant between the LAMP assay (all five negative) and the LMR/PCR assay (all 5 positive). Overall, LMR/PCR testing matched the current algorithm of EIA and/or LAMP reflex testing in 193/198 (97.5%) samples. The present proof-of-concept study suggests that the novel LMR/PCR technique described here may be developed as an inexpensive, rapid, and reliable point-of-care diagnostic test for C. difficile infection and other infectious diseases. Copyright © 2012 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  6. Rapid Salmonella detection using an acoustic wave device combined with the RCA isothermal DNA amplification method

    Directory of Open Access Journals (Sweden)

    Antonis Kordas

    2016-12-01

    Full Text Available Salmonella enterica serovar Typhimurium is a major foodborne pathogen that causes Salmonellosis, posing a serious threat for public health and economy; thus, the development of fast and sensitive methods is of paramount importance for food quality control and safety management. In the current work, we are presenting a new approach where an isothermal amplification method is combined with an acoustic wave device for the development of a label free assay for bacteria detection. Specifically, our method utilizes a Love wave biosensor based on a Surface Acoustic Wave (SAW device combined with the isothermal Rolling Circle Amplification (RCA method; various protocols were tested regarding the DNA amplification and detection, including off-chip amplification at two different temperatures (30 °C and room temperature followed by acoustic detection and on-chip amplification and detection at room temperature, with the current detection limit being as little as 100 Bacteria Cell Equivalents (BCE/sample. Our acoustic results showed that the acoustic ratio, i.e., the amplitude over phase change observed during DNA binding, provided the only sensitive means for product detection while the measurement of amplitude or phase alone could not discriminate positive from negative samples. The method's fast analysis time together with other inherent advantages i.e., portability, potential for multi-analysis, lower sample volumes and reduced power consumption, hold great promise for employing the developed assay in a Lab on Chip (LoC platform for the integrated analysis of Salmonella in food samples.

  7. Rapid plant identification using species- and group-specific primers targeting chloroplast DNA.

    Directory of Open Access Journals (Sweden)

    Corinna Wallinger

    Full Text Available Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae, the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory.

  8. Electrochemical Sensing for a Rapidly Evolving World

    Science.gov (United States)

    Mullen, Max Robertson

    This dissertation focuses on three projects involving the development of harsh environment gas sensors. The first project discusses the development of a multipurpose oxygen sensor electrode for use in sealing with the common electrolyte yttria stabilized zirconia. The purpose of the sealing function is to produce an internal reference environment maintained by a metal/metal oxide mixture, a criteria for miniaturization of potentiometric oxygen sensing technology. This sensor measures a potential between the internal reference and a sensing environment. The second project discusses the miniaturization of an oxygen sensor and the fabrication of a more generalized electrochemical sensing platform. The third project discusses the discovery of a new mechanism in the electrochemical sensing of ammonia through molecular recognition and the utilization of a sensor taking advantage of the new mechanism. An initial study involving the development of a microwave synthesized La0.8Sr0.2Al0.9Mn0.1O3 sensor electrode material illustrates the ability of the material developed to meet ionic and electronic conducting requirements for effective and Nernstian oxygen sensing. In addition the material deforms plastically under hot isostatic pressing conditions in a similar temperature and pressure regime with yttria stabilized zirconia to produce a seal and survive temperatures up to 1350 °C. In the second project we show novel methods to seal an oxygen environment inside a device cavity to produce an electrochemical sensor body using room temperature plasma-activated bonding and low temperature and pressure assisted plasma-activated bonding with silicon bodies, both in a clean room environment. The evolution from isostatic hot pressing methods towards room temperature complementary metal oxide semiconductor (CMOS) compatible technologies using single crystal silicon substrates in the clean room allows the sealing of devices on a much larger scale. Through this evolution in bonding technology we move from performing non-scalable experiments to produce one sensor at a time to scalable experiments producing six. The bonding methods we use are compatible with wafer scale processing. Practically speaking this means that the oxygen sensor design is scalable to produce thousands of sensors from one single bond. Using this bonding technology we develop a generalized sensing platform that could be used for a variety of sensing applications, including oxygen sensing, but also potentially involving CO2 or NOx as well. Future efforts will involve completing of O2 sensor construction and adaption of the design for CO2 and NOx sensing. The final project focuses on a novel ammonia sensor and sensing mechanism in Ag loaded zeolite Y. The sensor resistance changes upon exposure to ammonia due to the molecular recognition of Ag+ and ammonia, producing Ag(NH3)x+ species. The sensing mechanism is a Grothuss like mechanism based on the hoping of Ag+ centers. The hopping frequency of Ag+ changes upon introduction of ammonia due to the reduced electrostatic interactions between Ag+ and the negatively charged zeolite framework upon formation of Ag(NH3) x+. The change in hopping frequency results in a measurable change in impedance.

  9. Age-associated DNA methylation changes in naive CD4+T cells suggest an evolving autoimmune epigenotype in aging T cells.

    Science.gov (United States)

    Dozmorov, Mikhail G; Coit, Patrick; Maksimowicz-McKinnon, Kathleen; Sawalha, Amr H

    2017-04-01

    We sought to define age-associated DNA methylation changes in naive CD4 + T cells. Naive CD4 + T cells were collected from 74 healthy individuals (age 19-66 years), and age-related DNA methylation changes were characterized. We identified 11,431 age-associated CpG sites, 57% of which were hypermethylated with age. Hypermethylated sites were enriched in CpG islands and repressive transcription factor binding sites, while hypomethylated sites showed T cell specific enrichment in active enhancers marked by H3K27ac and H3K4me1. Our data emphasize cancer-related DNA methylation changes with age, and also reveal age-associated hypomethylation in immune-related pathways, such as T cell receptor signaling, FCγR-mediated phagocytosis, apoptosis and the mammalian target of rapamycin signaling pathway. The MAPK signaling pathway was hypermethylated with age, consistent with a defective MAPK signaling in aging T cells. Age-associated DNA methylation changes may alter regulatory mechanisms and signaling pathways that predispose to autoimmunity.

  10. Development of bufferless gel electrophoresis chip for easy preparation and rapid DNA separation.

    Science.gov (United States)

    Oleksandrov, Sergiy; Aman, Abdurazak; Lim, Wanyoung; Kim, Younghee; Bae, Nam Ho; Lee, Kyoung G; Lee, Seok Jae; Park, Sungsu

    2017-09-27

    This work presents a handy, fast, and compact bufferless gel electrophoresis chip (BGEC), which consists of precast agarose gel confined in a disposable plastic body with electrodes. It does not require large volumes of buffer to fill reservoirs, or the process of immersing the gel in the buffer. It withstands voltages up to 28.4 V/cm, thereby allowing DNA separation within 10 min with a similar separation capability to the standard gel electrophoresis. The results suggest that our BGEC is highly suitable for in situ gel electrophoresis in forensic, epidemiological settings and crime scenes where standard gel electrophoresis equipment cannot be brought in while quick results are needed. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Rapid, sensitive and cost effective method for isolation of viral DNA from feacal samples of dogs

    Directory of Open Access Journals (Sweden)

    Savi.

    2010-06-01

    Full Text Available A simple method for viral DNA extraction using chelex resin was developed. The method used was eco-friendly and cost effective compared to other methods such as phenol chloroform method which use health hazardous organic reagents. Further, a polymerase chain reaction (PCR based detection of canine parvovirus (CPV using primers from conserved region of VP2 gene was developed. To increase the sensitivity and specificity of reaction, nested PCR was designed. PCR reaction was optimized to amplify 747bp product of VP2 gene. The assay can be completed in few hours and doesn’t need hazardous chemicals. Thus, the sample preparation using chelating resin along with nested PCR seems to be a sensitive, specific and practical method for the detection of CPV in diarrhoeal feacal samples. [Vet. World 2010; 3(3.000: 105-106

  12. Rapid identification of the botanical and entomological sources of honey using DNA metabarcoding.

    Science.gov (United States)

    Prosser, Sean W J; Hebert, Paul D N

    2017-01-01

    Honey is generated by various bee species from diverse plants, and because the value of different types of honey varies more than 100-fold, it is a target for fraud. This paper describes a protocol that employs DNA metabarcoding of three gene regions (ITS2, rbcLa, and COI) to provide an inexpensive tool to simultaneously deliver information on the botanical and entomological origins of honey. This method was used to examine seven varieties of honey: light, medium, dark, blended, pasteurized, creamed, and meliponine. Plant and insect sources were identified in five samples, but only the botanical or insect source could be identified in the other two. Two samples were found to be misrepresented. Although this method was generally successful in determining both plant and insect sources, honeys rich in polyphenolic compounds or subject to crystallization were recalcitrant to analysis, so further research is required to combat honey adulteration and mislabeling. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Rapid Veterinary Diagnosis of Bovine Reproductive Infectious Diseases from Semen using Paper-Origami DNA Microfluidics.

    Science.gov (United States)

    Yang, Zhugen; Xu, Gaolian; Reboud, Julien; Ali, Syed Atif; Kaur, Gurpreet; McGiven, John; Boby, Nongthombam; Gupta, Praveen; Chaudhuri, Pallab; Cooper, Jonathan Mark

    2018-01-11

    The health and well-being of cattle is a significant concern for global agricultural output. In dairy production within low and middle income countries (LMICs), there is a significant biosensing challenge in detecting sexually transmitted infection (STI) pathogens during animal husbandry, due in part to difficulties associated with the limited infrastructure for veterinary medicine. Here we demonstrate low-cost, multiplexed and sample-to-answer paper-origami tests for the detection of three bovine infectious reproductive diseases in semen samples, collected at a test site in rural India. Pathogen DNA from one viral pathogen, Bovine Herpes virus-1 (BoHV-1) and two bacteria (Brucella and Leptospira) was extracted, amplified (using loop-mediated isothermal amplification, LAMP) and detected fluorescently, enabling DNA to be measured. Data was collected as a fluorescence signal either visually, using a low-cost hand-held torch, or digitally with a mobile-phone camera. Limits of detection and sensitivities of the paper-origami device for the three pathogens were also evaluated using pathogen-inoculated semen samples and were as few as 50 Leptospira organisms, 50 CFU Brucella and 1 TCID50. BoHV-1. Semen samples from elite bulls at a germplasm centre were also tested in double-blind tests, as a demonstrator for a low cost, user-friendly point-of-care sensing platform, for in-the-field resource-limited regions. The sensors showed excellent levels of sensitivity and specificity, and for the first of time a demonstrated ability of the application of paper-origami devices for the diagnosis multiple infectious diseases from semen samples.

  14. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  15. Rapid DNA haplotyping using a multiplex heteroduplex approach: Application to Duchenne muscula dystrophy carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Wenger, G.D.; Moore, J. [Ohio State Univ., Columbus, OH (United States)] [and others

    1994-09-01

    A new strategy has been developed for rapid haplotype analysis. It is based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. The method is simple, rapid, does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using 12 commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. As a result of expanding the number of detectable polymorphisms throughout the dystrophin gene, we show how the method can easily be combined with dinucleotide analysis to improve the accuracy of carrier detection in the nondeletion cases. The technique is also shown to be used as an effective screen for improving carrier detection in several families with deletions. The finding of heterozygosity within the deletion identifies the at-risk female as a noncarrier. Using this method, we have identified and incorporated 3 new dystrophin polymorphisms (one of which in exon 16 is unique to African Americans). The method may be used other genetic diseases when mutations are unknown, or there are few dinucleotide markers in the gene proximity, or for the identification of haplotype backgrounds of mutant alleles.

  16. Discovering the genetic cause of Mendelian disorders in the age of genomics : the evolving capability of next-generation DNA sequencing

    NARCIS (Netherlands)

    Monroe, G.R.|info:eu-repo/dai/nl/413967476

    2017-01-01

    The research presented in this thesis identifies the genetic cause of a diverse range of Mendelian disorders using next generation sequencing. This work reflects the extremely rapid development of NGS, beginning with target gene panel sequencing in a research setting (Chapters 2 and 3) and only 4

  17. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

    Science.gov (United States)

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-04-01

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

  18. Potential use of buccal smears for rapid diagnosis of autosomal trisomy or chromosomal sex in newborn infants using DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Harris, C.; Clark, K.; Lazarski, K. [Univ. of Wisconsin, Madison, WI (United States); Wilkerson, C. [Univ. of Wisconsin Medical School, Madison, WI (United States); Meisner, L. [Univ. of Wisconsin, Madison, WI (United States)]|[Univ. of Wisconsin Medical School, Madison, WI (United States)

    1994-12-01

    Buccal smears from 3 women and 1 man were probed with alpha satellite DNA probes for chromosomes 8, 18, X, and Y. Buccal smears were also collected from an adolescent phenotypic female with uterine agenesis, as well as from newborn infants with suspected trisomy 18 and trisomy 21. The clinical cases were confirmed with conventional cytogenetic studies of peripheral lymphocytes. Overall probe efficiency at detecting expected chromosome number in interphase cells was found to be 71% {+-} 6.8%. Higher than expected n-1 signal numbers may be due to karyopyknotic intermediate epithelial cells present in all collected samples. Overall probe efficiency was found to be consistent using alpha satellite and cosmid probes, both of which accurately reflected the modal copy number of the target chromosomes. False trisomy was less than 1%. This study suggests DNA probes can be used in buccal smears for rapid diagnosis of trisomies and chromosomal sex in newborns, but because of high rates of false hydropoploid signals, probed buccal smear specimens may not be accurate at diagnosing mosaicism. 9 refs., 2 figs., 1 tab.

  19. Evolvable synthetic neural system

    Science.gov (United States)

    Curtis, Steven A. (Inventor)

    2009-01-01

    An evolvable synthetic neural system includes an evolvable neural interface operably coupled to at least one neural basis function. Each neural basis function includes an evolvable neural interface operably coupled to a heuristic neural system to perform high-level functions and an autonomic neural system to perform low-level functions. In some embodiments, the evolvable synthetic neural system is operably coupled to one or more evolvable synthetic neural systems in a hierarchy.

  20. Biodiversity inventories in high gear: DNA barcoding facilitates a rapid biotic survey of a temperate nature reserve.

    Science.gov (United States)

    Telfer, Angela C; Young, Monica R; Quinn, Jenna; Perez, Kate; Sobel, Crystal N; Sones, Jayme E; Levesque-Beaudin, Valerie; Derbyshire, Rachael; Fernandez-Triana, Jose; Rougerie, Rodolphe; Thevanayagam, Abinah; Boskovic, Adrian; Borisenko, Alex V; Cadel, Alex; Brown, Allison; Pages, Anais; Castillo, Anibal H; Nicolai, Annegret; Glenn Mockford, Barb Mockford; Bukowski, Belén; Wilson, Bill; Trojahn, Brock; Lacroix, Carole Ann; Brimblecombe, Chris; Hay, Christoper; Ho, Christmas; Steinke, Claudia; Warne, Connor P; Garrido Cortes, Cristina; Engelking, Daniel; Wright, Danielle; Lijtmaer, Dario A; Gascoigne, David; Hernandez Martich, David; Morningstar, Derek; Neumann, Dirk; Steinke, Dirk; Marco DeBruin, Donna DeBruin; Dobias, Dylan; Sears, Elizabeth; Richard, Ellen; Damstra, Emily; Zakharov, Evgeny V; Laberge, Frederic; Collins, Gemma E; Blagoev, Gergin A; Grainge, Gerrie; Ansell, Graham; Meredith, Greg; Hogg, Ian; McKeown, Jaclyn; Topan, Janet; Bracey, Jason; Guenther, Jerry; Sills-Gilligan, Jesse; Addesi, Joseph; Persi, Joshua; Layton, Kara K S; D'Souza, Kareina; Dorji, Kencho; Grundy, Kevin; Nghidinwa, Kirsti; Ronnenberg, Kylee; Lee, Kyung Min; Xie, Linxi; Lu, Liuqiong; Penev, Lyubomir; Gonzalez, Mailyn; Rosati, Margaret E; Kekkonen, Mari; Kuzmina, Maria; Iskandar, Marianne; Mutanen, Marko; Fatahi, Maryam; Pentinsaari, Mikko; Bauman, Miriam; Nikolova, Nadya; Ivanova, Natalia V; Jones, Nathaniel; Weerasuriya, Nimalka; Monkhouse, Norman; Lavinia, Pablo D; Jannetta, Paul; Hanisch, Priscila E; McMullin, R Troy; Ojeda Flores, Rafael; Mouttet, Raphaëlle; Vender, Reid; Labbee, Renee N; Forsyth, Robert; Lauder, Rob; Dickson, Ross; Kroft, Ruth; Miller, Scott E; MacDonald, Shannon; Panthi, Sishir; Pedersen, Stephanie; Sobek-Swant, Stephanie; Naik, Suresh; Lipinskaya, Tatsiana; Eagalle, Thanushi; Decaëns, Thibaud; Kosuth, Thibault; Braukmann, Thomas; Woodcock, Tom; Roslin, Tomas; Zammit, Tony; Campbell, Victoria; Dinca, Vlad; Peneva, Vlada; Hebert, Paul D N; deWaard, Jeremy R

    2015-01-01

    Comprehensive biotic surveys, or 'all taxon biodiversity inventories' (ATBI), have traditionally been limited in scale or scope due to the complications surrounding specimen sorting and species identification. To circumvent these issues, several ATBI projects have successfully integrated DNA barcoding into their identification procedures and witnessed acceleration in their surveys and subsequent increase in project scope and scale. The Biodiversity Institute of Ontario partnered with the rare Charitable Research Reserve and delegates of the 6th International Barcode of Life Conference to complete its own rapid, barcode-assisted ATBI of an established land trust in Cambridge, Ontario, Canada. The existing species inventory for the rare Charitable Research Reserve was rapidly expanded by integrating a DNA barcoding workflow with two surveying strategies - a comprehensive sampling scheme over four months, followed by a one-day bioblitz involving international taxonomic experts. The two surveys resulted in 25,287 and 3,502 specimens barcoded, respectively, as well as 127 human observations. This barcoded material, all vouchered at the Biodiversity Institute of Ontario collection, covers 14 phyla, 29 classes, 117 orders, and 531 families of animals, plants, fungi, and lichens. Overall, the ATBI documented 1,102 new species records for the nature reserve, expanding the existing long-term inventory by 49%. In addition, 2,793 distinct Barcode Index Numbers (BINs) were assigned to genus or higher level taxonomy, and represent additional species that will be added once their taxonomy is resolved. For the 3,502 specimens, the collection, sequence analysis, taxonomic assignment, data release and manuscript submission by 100+ co-authors all occurred in less than one week. This demonstrates the speed at which barcode-assisted inventories can be completed and the utility that barcoding provides in minimizing and guiding valuable taxonomic specialist time. The final product is

  1. Natural selection promotes antigenic evolvability.

    Science.gov (United States)

    Graves, Christopher J; Ros, Vera I D; Stevenson, Brian; Sniegowski, Paul D; Brisson, Dustin

    2013-01-01

    The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios) and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish chronic infections.

  2. Natural selection promotes antigenic evolvability.

    Directory of Open Access Journals (Sweden)

    Christopher J Graves

    Full Text Available The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish

  3. Random amplified ribosomal DNA restriction analysis for rapid identification of thermophilic Actinomycete-like bacteria involved in hypersensitivity pneumonitis.

    Science.gov (United States)

    Harvey, I; Cormier, Y; Beaulieu, C; Akimov, V N; Mériaux, A; Duchaine, C

    2001-07-01

    Hypersensitivity pneumonitis (HP) is a pulmonary disease characterised by inflammation that can be caused by, amongst other substances, a subset of 4 thermophilic mycelial bacteria: Saccharopolyspora rectivirgula, Saccharomonospora viridis, Thermoactinomyces sacchari, and Thermoactinomyces vulgaris. Air sampling analyses in highly contaminated environments are often performed to evaluate exposure to these species which are difficult and fastidious to identify by conventional techniques. The aim of this study was to use amplified ribosomal DNA restriction analysis (ARDRA) to develop a method of identification for those thermophilic organisms that would be more rapid and simple. Strains of these 4 species were obtained from the American type culture collection (ATCC) and were characterized using biochemical tests and ARDRA patterns obtained on their partial-lenght amplified 16S rDNAs. To validate this approach, ARDRA with two restriction enzymes, TaqI and HhaI, was applied to 49 thermophilic actinomycete-like strains from environmental samples (sawmills). The results obtained show that combining some cultural characteristics and biochemical tests, such as xanthine or hypoxanthine decomposition, growth in the presence of NaCl, lysozyme or novobiocin, and spore resistance over 100 degrees C provide a rough identification and selection of the genera of interest. Consequently, target species could be confirmed by digestion of partial-lenght 16S rDNA with the use of Taql and HhaI restriction enzymes that gave specific restriction patterns. ARDRA analyses on the 49 environmental actinomycete-like organisms revealed the presence of 8 Saccharopolyspora rectivirgula, 2 Saccharomonospora viridis, and 15 Thermoactinomyces vulgaris strains, the other strains had restriction patterns different than those of the species of interest. Results of the present study will be applicable to other potential HP environments such as dairy barns, peat bogs and compost plants.

  4. [Rapid identification of Riemerella anatipestifer on the basis of specific PCR amplifying 16S rDNA].

    Science.gov (United States)

    Qu, Feng-fa; Cai, Chang; Zheng, Xian-jin; Zhang, Da-bing

    2006-02-01

    Riemerella anatipestifer (RA) infection is the main disease causing severe losses in duck production. Because RA is characterized more by the absence than by the presence of specific phenotypic properties and different scholar had the different results of biochemical detection, it can't always be identified quickly and correctly only by the phenotypic properties or biochemical characteristics. The research object was to develop a species specific PCR method for RA detection. Because of the conserved structure of rRNA and appropriate size of 16S rRNA, a multiple alignment of 16S rDNA (gene coding 16S rRNA) was processed among RA, Escherichia coli, Pasteurella multocida, Salmonella enteritidis and Salmonella gallinarum, which are the main bacteria causing duck diseases. A pair of species specific primers named 190f and 843r were selected from the variable regions of 16S rDNA depending on the result of multiple alignment. Using BLAST on NCBI website for a sequence similarity search, the results showed that this pair of primers had very high specificity, except for having a lower sequence similarity with some species of Flavobacterium and Chryseobacterium. A PCR assay was performed and the template was extracted using the bacteria genomic DNA extraction kit and boiling method respectively. A chelate resin named Chelex 100 was used in the boiling method at the same time. Under the annealing temperature of 60 degrees C, all the 26 RA strains, including 19 representative strains of serotypes 1 to approximately 19 and 7 domestic isolated strains, showed the same 654bp fragment after PCR, while there was no amplification with isolates of other bacterial species. Also a series of sensitivity experiments were performed and proved that the detection limit of this method was 50pg genomic DNA, 1.5 x 10(6) CFU/mL and 15 CFU/mL, when the template was prepared with genomic DNA extraction kit, only boiling method and boiling method with Chelex 100 respectively. 12 clinical cases

  5. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    Science.gov (United States)

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  6. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Papa Mze Nasserdine

    2016-01-01

    Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

  7. Design of a biological method for rapid detection of presence of PCR inhibitors in aged bone DNA.

    Science.gov (United States)

    Ghasemi, Akram; Mahdieh, Nejat; Tavallaei, Mahmood; Aslani, Mohammad Mehdi; Zafari, Zahra; Shirkavand, Atefeh; Farzad, Maryam Sharafi; Naderi, Mahdi; Azariyan, Sajjad Habibi; Zeinali, Sirous

    2012-01-01

    Molecular human identification is one of the most important tests performed in forensic laboratories. Some of these tests are applied for identification of human remains from natural disasters, wars, etc., but problems may occur as a result of DNA degradation and external DNA contamination. We investigated effects of bacterial DNA on identifying the presence or absence of PCR inhibitors in aged bone DNA. DNA samples were extracted from blood, bone remains and Escherichia coli. These DNA were amplified using human and bacterial specific primers. Using different blood, aged bone, and bacterial DNA dilutions along with PCR based methods; we checked their positive, negative effects, or detecting presence of inhibitors in aged bone DNA by PCR method. Our observation indicated that the addition of bacterial DNA could be a valid biological method for testing the quality of bone DNA to enable us to obtain a usable profile for the identification of human remains. This method will help to test the presence of inhibitors, quantity or even quality of DNA which are of importance in profiling archeological remains. Our method will help to determine if PCR failure is due to presence of inhibitors or lack of amplifiable DNA either because of degradation, minute amount or absence of human DNA.

  8. Loop-mediated isothermal amplification (LAMP) assay-A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena).

    Science.gov (United States)

    Heers, Teresa; van Neer, Abbo; Becker, André; Grilo, Miguel Luca; Siebert, Ursula; Abdulmawjood, Amir

    2017-01-01

    Carcasses of wild animals are often visited by different scavengers. However, determining which scavenger caused certain types of bite marks is particularly difficult and knowledge thereof is lacking. Therefore, a loop-mediated isothermal amplification (LAMP) assay (target sequence cytochrome b) was developed to detect red fox DNA in carcasses of harbour porpoises. The MSwab™ method for direct testing without prior DNA isolation was validated. As a detection device, the portable real-time fluorometer Genie® II was used, which yields rapid results and can be used in field studies without huge laboratory equipment. In addition to in vitro evaluation and validation, a stranded and scavenged harbour porpoise carcass was successfully examined for red fox DNA residues. The developed LAMP method is a valuable diagnostic tool for confirming presumable red fox bite wounds in harbour porpoises without further DNA isolation steps.

  9. Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

    Science.gov (United States)

    Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

    2016-11-01

    Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  10. DNA-based identification of invasive alien species in relation to Canadian federal policy and law, and the basis of rapid-response management.

    Science.gov (United States)

    Thomas, Vernon G; Hanner, Robert H; Borisenko, Alex V

    2016-11-01

    Managing invasive alien species in Canada requires reliable taxonomic identification as the basis of rapid-response management. This can be challenging, especially when organisms are small and lack morphological diagnostic features. DNA-based techniques, such as DNA barcoding, offer a reliable, rapid, and inexpensive toolkit for taxonomic identification of individual or bulk samples, forensic remains, and even environmental DNA. Well suited for this requirement, they could be more broadly deployed and incorporated into the operating policy and practices of Canadian federal departments and should be authorized under these agencies' articles of law. These include Fisheries and Oceans Canada, Canadian Food Inspection Agency, Transport Canada, Environment Canada, Parks Canada, and Health Canada. These efforts should be harmonized with the appropriate provisions of provincial jurisdictions, for example, the Ontario Invasive Species Act. This approach necessitates that a network of accredited, certified laboratories exists, and that updated DNA reference libraries are readily accessible. Harmonizing this approach is vital among Canadian federal agencies, and between the federal and provincial levels of government. Canadian policy and law must also be harmonized with that of the USA when detecting, and responding to, invasive species in contiguous lands and waters. Creating capacity in legislation for use of DNA-based identifications brings the authority to fund, train, deploy, and certify staff, and to refine further developments in this molecular technology.

  11. Rapid mitochondrial DNA typing using restriction enzyme digestion of polymerase chain reaction amplicons followed by capillary electrophoresis separation with laser-induced fluorescence detection.

    Science.gov (United States)

    Butler, J M; Wilson, M R; Reeder, D J

    1998-01-01

    The polymorphic control region of mitochondrial DNA (mtDNA) is becoming more commonly used in forensic applications to differentiate among individuals in a population. Two hypervariable regions (HV1 and HV2) are often sequenced following amplification of the mtDNA via the polymerase chain reaction (PCR). More rapid screening assays would reduce both the effort and the expense of comparing two samples. A methodology has been developed that first uses restriction endonuclease digestion of the PCR-amplified mtDNA using RsaI and MnlI and then capillary electrophoresis (CE) to separate and size the PCR-RFLP fragments. This rapid procedure offers an alternative method for screening of polymorphisms in amplified mtDNA samples. In addition, the presence of a T-->C transition at position 16189, which gives rise to the so-called "C-stretch" in HV1, may be predicted from the presence of nonspecific PCR products in the CE results.

  12. A novel rapid DNA microarray assay enables identification of 37 Mycoplasma species and highlights multiple Mycoplasma infections.

    Directory of Open Access Journals (Sweden)

    Christiane Schnee

    Full Text Available Mycoplasmas comprise a conglomerate of pathogens and commensals occurring in humans and animals. The genus Mycoplasma alone contains more than 120 species at present, and new members are continuously being discovered. Therefore, it seems promising to use a single highly parallel detection assay rather than develop separate tests for each individual species. In this study, we have designed a DNA microarray carrying 70 oligonucleotide probes derived from the 23S rRNA gene and 86 probes from the tuf gene target regions. Following a PCR amplification and biotinylation step, hybridization on the array was shown to specifically identify 31 Mycoplasma spp., as well as 3 Acholeplasma spp. and 3 Ureaplasma spp. Members of the Mycoplasma mycoides cluster can be recognized at subgroup level. This procedure enables parallel detection of Mollicutes spp. occurring in humans, animals or cell culture, from mono- and multiple infections, in a single run. The main advantages of the microarray assay include ease of operation, rapidity, high information content, and affordability. The new test's analytical sensitivity is equivalent to that of real-time PCR and allows examination of field samples without the need for culture. When 60 field samples from ruminants and birds previously analyzed by denaturing-gradient gel electrophoresis (DGGE were tested by the microarray assay both tests identified the same agent in 98.3% of the cases. Notably, microarray testing revealed an unexpectedly high proportion (35% of multiple mycoplasma infections, i.e., substantially more than DGGE (15%. Two of the samples were found to contain four different Mycoplasma spp. This phenomenon deserves more attention, particularly its implications for epidemiology and treatment.

  13. O-antigen and virulence profiling of Shiga toxin-producing Escherichia coli by a rapid and cost-effective DNA microarray colorimetric method

    OpenAIRE

    Beatriz eQuiñones; Swimley, Michelle S.; Koh-Eun eNarm; Patel, Ronak N.; Cooley, Michael B.; Mandrell, Robert E.

    2012-01-01

    Shiga toxin-producing Escherichia coli (STEC) is a leading cause of foodborne illness worldwide. The present study developed the use of DNA microarrays with the ampliPHOX colorimetric method to rapidly detect and genotype STEC strains. A low-density 30-mer oligonucleotide DNA microarray was designed to target O-antigen gene clusters of eleven E. coli serogroups (O26, O45, O91, O103, O104, O111, O113, O121, O128, O145 and O157) that have been associated with the majority of STEC infections. ...

  14. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    Endemic of avian influenza virus (AIV) in Asia and epizootics in some European regions have caused considerable public concern on a possible pandemic of AIV. A rapid method for virus detection and effective surveillance in wild avian, poultry production as well as in humans is required....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  15. Validation of the 16S rDNA and COI DNA barcoding technique for rapid molecular identification of stored product psocids (Insecta: Psocodea: Liposcelididae).

    Science.gov (United States)

    Yang, Qianqian; Zhao, Shuo; Kucerová, Zuzana; Stejskal, Václav; Opit, George; Qin, Meng; Cao, Yang; Li, Fujun; Li, Zhihong

    2013-02-01

    Psocids are serious storage pests, and their control is hampered by the fact that different species respond differently to insecticides used for the control of stored-product insect pests. Additionally, psocids of genus Liposcelis that are commonly associated with stored-products are difficult to identify using morphological characteristics. The goal of this study was to validate molecular identification of stored-product psocids of genus Liposcelis based on 16S rDNA and cytochrome oxidase I (COI) DNA barcoding. Unidentified liposcelids (Liposcelis DK) imported from Denmark to China were compared with 14 population samples of seven common species (L. bostrychophila, L. brunnea, L. corrodens, L. decolor, L. entomophila, L. mendax, and L. paeta). The explored species (DK) liposcelids shared >98% sequence similarity for both the 16S rDNA and COI genes with the reference L. corrodens samples (98.32 and 98.94% for 16S rDNA and COI, respectively). A neighbor-joining tree revealed that the explored DK sample and the reference L. corrodens samples belong to the same clade. These molecular results were verified by morphological identification of DK specimens, facilitated by SEM microphotography. The DNA barcoding method and the neighbor-joining phylogenetic analyses indicated that both the 16S rDNA and COI genes were suitable for Liposcelis species identification. DNA barcoding has great potential for use in fast and accurate liposcelid identification.

  16. Combining a Ru(II) "Building Block" and Rapid Screening Approach to Identify DNA Structure-Selective "Light Switch" Compounds.

    Science.gov (United States)

    Wachter, Erin; Moyá, Diego; Glazer, Edith C

    2017-02-13

    A chemically reactive Ru(II) "building block", able to undergo condensation reactions with substituted diamines, was utilized to create a small library of luminescent "light switch" dipyrido-[3,2-a:2',3'-c] phenazine (dppz) complexes. The impact of substituent identity, position, and the number of substituents on the light switch effect was investigated. An unbiased, parallel screening approach was used to evaluate the selectivity of the compounds for a variety of different biomolecules, including protein, nucleosides, single stranded DNA, duplex DNA, triplex DNA, and G-quadruplex DNA. Combining these two approaches allowed for the identification of hit molecules that showed different selectivities for biologically relevant DNA structures, particularly triplex and quadruplex DNA.

  17. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    for their effectiveness for the direct quantification (without enrichment) of Campylobacter jejuni in chicken fecal samples using real-time PCR. The presence of inhibitory substances in chicken fecal samples may reduce or even completely impede the PCR amplification process making quantification very difficult. Six rapid......Direct and accurate quantification of Campylobacter in poultry is crucial for the assessment of public health risks and the evaluation of the effectiveness of control measures against Campylobacter in poultry. The aim of this study was to assess several rapid DNA extraction methods...... of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...

  18. Rapid identification of Salmonella using Hektoen enteric agar and 16s ribosomal DNA probe-gold nanoparticle immunochromatography assay in clinical faecal specimens.

    Science.gov (United States)

    Yeung, C-Y; Liu, C-C; Tseng, Y-T; Tsai, K-C; Hsieh, M-A; Chan, W-T; Liu, H-L; Lee, H-C; Hou, S-Y

    2014-04-01

    A rapid identification of Salmonella, one of the most common foodborne pathogens worldwide, in clinical patients can enable better rational managements and prevent further outbreaks. The traditional immunochromatography using antibody-gold nanoparticles (Ab-AuNPs), such as the home pregnancy test, has been used for the Salmonella detection. In this study, we developed a new and rapid method using DNA probe-AuNPs for the detection of 16s ribosomal DNA of Salmonella. To evaluate the proposed method in clinical specimens, we performed a clinical test by identifying 159 stool samples on Hektoen agar containing black or crystalloid colonies using the method and the VITEK 2 system for confirmation. Eighty of the isolates were correctly identified as Salmonella to achieve 100% sensitivity. Seventy-five samples were correctly identified as non-Salmonella spp., but four were incorrectly identified as Salmonella. The specificity was 94·93%. The assay time is about 30 min after the DNA purification. The time-consuming and labour-intense biochemical tests can be replaced. We demonstrated that this assay is a rapid, convenient and cost-effective tool for Salmonella identification of clinical faecal samples, which is worth for further promotion and clinical use. This is the first application of using 16s ribosomal DNA probe-Au-NPs and immunochromatography on clinical samples. This is the first application of using 16s ribosomal DNA probe-gold nanoparticles and immunochromatography method on clinical samples with sensitivity 100% and specificity 94·93%. The assay time is about 30 min after the DNA purification. We find this assay a rapid, convenient, sensitive and inexpensive tool for Salmonella identification of clinical faecal samples, which is worth further promotion and clinical use and can replace the traditional time-consuming and labour-intense biochemical tests. The potential benefit of this approach is to develop a rapid point-of-care test that provides results while

  19. Rapid and Accurate Identification of Adulterants via an Electronic Nose and DNA Identification Platform: Identification of Fake Velvet Antlers as an Example

    OpenAIRE

    Guojie Xu; Chunsheng Liu; Caili Liao; Xiaolei Ren; Xinyue Zhang; Xiaorui Fu; Xueyong Wang

    2016-01-01

    Background. Adulterants in Chinese medicines had always affected the efficacy of Chinese medicines and resulted in safety problems in drug use. We aimed to take the identification of fake velvet antlers as an example for establishment of a rapid and accurate identification platform for modern pharmaceutical companies and markets of Chinese medicine. Methods. In this study, we developed a novel electronic nose and DNA identification platform for identifying fake velvet antlers. Electronic nose...

  20. Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector.

    Science.gov (United States)

    Sun, Kai; Zhao, Danyang; Liu, Yong; Huang, Changjun; Zhang, Wei; Li, Zhenghe

    2017-11-07

    The availability of infectious full-length clone is indispensable for reverse genetics studies of virus biology, pathology and construction of viral vectors. However, for RNA viruses with large genome sizes or those exhibiting inherent cloning difficulties, procedure to generate biologically active circular DNA (cDNA) clones can be time-consuming or technically challenging. Here we have constructed a yeast- Escherichia coli - Agrobacterium shuttle vector that enables highly efficient homologous recombination in yeast for assembly of Agrobacterium compatible plant virus clones. Using this vector, we show that infectious cDNA clones of a plant negative-stranded RNA virus, sonchus yellow net rhabdovirus, can be rapidly assembled. In addition, one-step assembly of infectious clones of potato virus Y in yeast, either with or without intron, was readily achieved from as many as eight overlapping DNA fragments. More importantly, the recovered yeast plasmids can be transformed directly into Agrobacterium for inoculation, thereby obviating the E. coli cloning steps and associated toxicity issues. This method is rapid, highly efficient and cost-effective and should be readily applicable to a broad range of plant viruses.

  1. Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector

    Directory of Open Access Journals (Sweden)

    Kai Sun

    2017-11-01

    Full Text Available The availability of infectious full-length clone is indispensable for reverse genetics studies of virus biology, pathology and construction of viral vectors. However, for RNA viruses with large genome sizes or those exhibiting inherent cloning difficulties, procedure to generate biologically active complementary DNA (cDNA clones can be time-consuming or technically challenging. Here we have constructed a yeast-Escherichia coli-Agrobacterium shuttle vector that enables highly efficient homologous recombination in yeast for assembly of Agrobacterium compatible plant virus clones. Using this vector, we show that infectious cDNA clones of a plant negative-stranded RNA virus, sonchus yellow net rhabdovirus, can be rapidly assembled. In addition, one-step assembly of infectious clones of potato virus Y in yeast, either with or without intron, was readily achieved from as many as eight overlapping DNA fragments. More importantly, the recovered yeast plasmids can be transformed directly into Agrobacterium for inoculation, thereby obviating the E. coli cloning steps and associated toxicity issues. This method is rapid, highly efficient and cost-effective and should be readily applicable to a broad range of plant viruses.

  2. DNA barcoding and morphological analysis for rapid identification of most economically important crop-infesting Sunn pests belonging to Eurygaster Laporte, 1833 (Hemiptera, Scutelleridae

    Directory of Open Access Journals (Sweden)

    Mikhail Y. Syromyatnikov

    2017-10-01

    Full Text Available The genus Eurygaster Laporte, 1833 includes ten species five of which inhabit the European part of Russia. The harmful species of the genus is E. integriceps. Eurygaster species identification based on the morphological traits is very difficult, while that of the species at the egg or larval stages is extremely difficult or impossible. Eurygaster integriceps, E. maura, and E. testudinaria differ only slightly between each other morphologically, E. maura and E. testudinaria being almost indiscernible. DNA barcoding based on COI sequences have shown that E. integriceps differs significantly from these closely related species, which enables its rapid and accurate identification. Based on COI nucleotide sequences, three species of Sunn pests, E. maura, E. testudinarius, E. dilaticollis, could not be differentiated from each other through DNA barcoding. The difference in the DNA sequences between the COI gene of E. integriceps and COI genes of E. maura and E. testudinarius was more than 4%. In the present study DNA barcoding of two Eurygaster species was performed for the first time on E. integriceps, the most dangerous pest in the genus, and E. dilaticollis that only inhabits natural ecosystems. The PCR-RFLP method was developed in this work for the rapid identification of E. integriceps.

  3. DNA barcoding and morphological analysis for rapid identification of most economically important crop-infesting Sunn pests belonging to Eurygaster Laporte, 1833 (Hemiptera, Scutelleridae).

    Science.gov (United States)

    Syromyatnikov, Mikhail Y; Golub, Victor B; Kokina, Anastasia V; Victoria A Soboleva; Popov, Vasily N

    2017-01-01

    The genus Eurygaster Laporte, 1833 includes ten species five of which inhabit the European part of Russia. The harmful species of the genus is E. integriceps. Eurygaster species identification based on the morphological traits is very difficult, while that of the species at the egg or larval stages is extremely difficult or impossible. Eurygaster integriceps, E. maura, and E. testudinaria differ only slightly between each other morphologically, E. maura and E. testudinaria being almost indiscernible. DNA barcoding based on COI sequences have shown that E. integriceps differs significantly from these closely related species, which enables its rapid and accurate identification. Based on COI nucleotide sequences, three species of Sunn pests, E. maura, E. testudinarius, E. dilaticollis, could not be differentiated from each other through DNA barcoding. The difference in the DNA sequences between the COI gene of E. integriceps and COI genes of E. maura and E. testudinarius was more than 4%. In the present study DNA barcoding of two Eurygaster species was performed for the first time on E. integriceps, the most dangerous pest in the genus, and E. dilaticollis that only inhabits natural ecosystems. The PCR-RFLP method was developed in this work for the rapid identification of E. integriceps.

  4. MGB probe assay for rapid detection of mtDNA11778 mutation in the Chinese LHON patients by real-time PCR*

    Science.gov (United States)

    Wang, Jian-yong; Gu, Yang-shun; Wang, Jing; Tong, Yi; Wang, Ying; Shao, Jun-bing; Qi, Ming

    2008-01-01

    Objective: Leber’s hereditary optic neuropathy (LHON) is a maternally inherited degeneration of the optic nerve caused by point mutations of mitochondrial DNA (mtDNA). Many unsolved questions regarding the penetrance and pathophysiological mechanism of LHON demand efficient and reliable mutation testing. This study aims to develop a minor groove binder (MGB) probe assay for rapid detection of mtDNA11778 mutation and heteroplasmy in Chinese LHON patients by real-time polymerase chain reaction (PCR). Methods: Forty-eight patients suspected of having LHON and their maternal relatives underwent a molecular genetic evaluation, with 20 normal individuals as a control group at the same time. A real-time PCR involving two MGB probes was used to detect the mtDNA11778 mutation and heteroplasmy. A linear standard curve was obtained by pUCmLHONG and pUCmLHONA clones. Results: All 48 LHON patients and their maternal relatives were positive for mtDNA11778 mutation in our assay, 27 heteroplasmic and 21 homoplasmic. Eighteen cases did not show an occurrence of the disease, while 9 developed the disease among the 27 heteroplasmic mutation cases. Eleven did not show an occurrence of the disease, while 10 cases developed the disease among 21 homoplasmic mutation cases. There was a significant difference in the incidence between the heteroplasmic and the homoplasmic mutation types. The time needed for running a real-time PCR assay was only 80 min. Conclusion: This real-time PCR assay is a rapid, reliable method for mtDNA mutation detection as well as heteroplasmy quantification. Detecting this ratio is very important for predicting phenotypic expression of unaffected carriers. PMID:18763310

  5. MGB probe assay for rapid detection of mtDNA11778 mutation in the Chinese LHON patients by real-time PCR.

    Science.gov (United States)

    Wang, Jian-yong; Gu, Yang-shun; Wang, Jing; Tong, Yi; Wang, Ying; Shao, Jun-bing; Qi, Ming

    2008-08-01

    Leber's hereditary optic neuropathy (LHON) is a maternally inherited degeneration of the optic nerve caused by point mutations of mitochondrial DNA (mtDNA). Many unsolved questions regarding the penetrance and pathophysiological mechanism of LHON demand efficient and reliable mutation testing. This study aims to develop a minor groove binder (MGB) probe assay for rapid detection of mtDNA11778 mutation and heteroplasmy in Chinese LHON patients by real-time polymerase chain reaction (PCR). Forty-eight patients suspected of having LHON and their maternal relatives underwent a molecular genetic evaluation, with 20 normal individuals as a control group at the same time. A real-time PCR involving two MGB probes was used to detect the mtDNA11778 mutation and heteroplasmy. A linear standard curve was obtained by pUCmLHONG and pUCmLHONA clones. All 48 LHON patients and their maternal relatives were positive for mtDNA11778 mutation in our assay, 27 heteroplasmic and 21 homoplasmic. Eighteen cases did not show an occurrence of the disease, while 9 developed the disease among the 27 heteroplasmic mutation cases. Eleven did not show an occurrence of the disease, while 10 cases developed the disease among 21 homoplasmic mutation cases. There was a significant difference in the incidence between the heteroplasmic and the homoplasmic mutation types. The time needed for running a real-time PCR assay was only 80 min. This real-time PCR assay is a rapid, reliable method for mtDNA mutation detection as well as heteroplasmy quantification. Detecting this ratio is very important for predicting phenotypic expression of unaffected carriers.

  6. Determination of alkylation of bacterial DNA as a rapid test for toxicological evaluation of alkylating xenobiotic agents

    Energy Technology Data Exchange (ETDEWEB)

    Botzenhart, K.; Waldner-Sander, S.; Schweinsberg, F.

    1986-05-01

    Alkylated purine bases from hydrolized DNA can be separated by HPLC and quantified with a fluorescence detector. We applied this method to bacterial DNA. 7-methylguanine was detected after treatment of Serratia marcescens with iodoacetamide, dimethyl sulfate and with polluted air.

  7. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Directory of Open Access Journals (Sweden)

    Koji Hashimoto

    2016-05-01

    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe.

  8. Coffee consumption rapidly reduces background DNA strand breaks in healthy humans: Results of a short-term repeated uptake intervention study.

    Science.gov (United States)

    Bakuradze, Tamara; Lang, Roman; Hofmann, Thomas; Schipp, Dorothea; Galan, Jens; Eisenbrand, Gerhard; Richling, Elke

    2016-03-01

    Intervention studies provide evidence that long-term coffee consumption correlates with reduced DNA background damage in healthy volunteers. Here, we report on short-term kinetics of this effect, showing a rapid onset after normal coffee intake. In a short-term human intervention study, we determined the effects of coffee intake on DNA integrity during 8 h. Healthy male subjects ingested coffee in 200 mL aliquots every second hour up to a total volume of 800 mL. Blood samples were taken at baseline, immediately before the first coffee intake and subsequently every 2 h, prior to the respective coffee intake. DNA integrity was assayed by the comet assay. The results show a significant (p coffee intake. Continued coffee intake was associated with further decrements in background DNA damage within the 8 h intervention (p coffee consumption). Repeated coffee consumption was associated with reduced background DNA strand breakage, clearly measurable as early as 2 h after first intake resulting in a cumulative overall reduction by about one-third of the baseline value. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Direct immobilization of DNA probes on non-modified plastics by UV irradiation and integration in microfluidic devices for rapid bioassay.

    Science.gov (United States)

    Sun, Yi; Perch-Nielsen, Ivan; Dufva, Martin; Sabourin, David; Bang, Dang Duong; Høgberg, Jonas; Wolff, Anders

    2012-01-01

    DNA microarrays have become one of the most powerful tools in the field of genomics and medical diagnosis. Recently, there has been increased interest in combining microfluidics with microarrays since this approach offers advantages in terms of portability, reduced analysis time, low consumption of reagents, and increased system integration. Polymers are widely used for microfluidic systems, but fabrication of microarrays on such materials often requires complicated chemical surface modifications, which hinders the integration of microarrays into microfluidic systems. In this paper, we demonstrate that simple UV irradiation can be used to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on many different types of plastics without any surface modification. On average, five- and fourfold improvement in immobilization and hybridization efficiency have been achieved compared to surface-modified slides with aminated DNA probes. Moreover, the TC tag only costs 30% of the commonly used amino group modifications. Using this microarray fabrication technique, a portable cyclic olefin copolymer biochip containing eight individually addressable microfluidic channels was developed and used for rapid and parallel identification of Avian Influenza Virus by DNA hybridization. The one-step, cost-effective DNA-linking method on non-modified polymers significantly simplifies microarray fabrication procedures and permits great flexibility to plastic material selection, thus making it convenient to integrate microarrays into plastic microfluidic systems.

  10. Ranking in evolving complex networks

    Science.gov (United States)

    Liao, Hao; Mariani, Manuel Sebastian; Medo, Matúš; Zhang, Yi-Cheng; Zhou, Ming-Yang

    2017-05-01

    Complex networks have emerged as a simple yet powerful framework to represent and analyze a wide range of complex systems. The problem of ranking the nodes and the edges in complex networks is critical for a broad range of real-world problems because it affects how we access online information and products, how success and talent are evaluated in human activities, and how scarce resources are allocated by companies and policymakers, among others. This calls for a deep understanding of how existing ranking algorithms perform, and which are their possible biases that may impair their effectiveness. Many popular ranking algorithms (such as Google's PageRank) are static in nature and, as a consequence, they exhibit important shortcomings when applied to real networks that rapidly evolve in time. At the same time, recent advances in the understanding and modeling of evolving networks have enabled the development of a wide and diverse range of ranking algorithms that take the temporal dimension into account. The aim of this review is to survey the existing ranking algorithms, both static and time-aware, and their applications to evolving networks. We emphasize both the impact of network evolution on well-established static algorithms and the benefits from including the temporal dimension for tasks such as prediction of network traffic, prediction of future links, and identification of significant nodes.

  11. Evolving digital ecological networks.

    Directory of Open Access Journals (Sweden)

    Miguel A Fortuna

    Full Text Available "It is hard to realize that the living world as we know it is just one among many possibilities" [1]. Evolving digital ecological networks are webs of interacting, self-replicating, and evolving computer programs (i.e., digital organisms that experience the same major ecological interactions as biological organisms (e.g., competition, predation, parasitism, and mutualism. Despite being computational, these programs evolve quickly in an open-ended way, and starting from only one or two ancestral organisms, the formation of ecological networks can be observed in real-time by tracking interactions between the constantly evolving organism phenotypes. These phenotypes may be defined by combinations of logical computations (hereafter tasks that digital organisms perform and by expressed behaviors that have evolved. The types and outcomes of interactions between phenotypes are determined by task overlap for logic-defined phenotypes and by responses to encounters in the case of behavioral phenotypes. Biologists use these evolving networks to study active and fundamental topics within evolutionary ecology (e.g., the extent to which the architecture of multispecies networks shape coevolutionary outcomes, and the processes involved.

  12. Rapid in vitro splicing of coding sequences from genomic DNA by isothermal recombination reaction-based PCR

    Directory of Open Access Journals (Sweden)

    Wenxuan Chen

    2016-09-01

    Full Text Available Cloning of coding sequence (CDS is an important step for gene function research. Here, we reported a simple and efficient strategy for assembling multiple-exon into an intron-free CDS from genomic DNA (gDNA by an isothermal recombination reaction-based PCR (IRR-PCR method. As an example, a 2067-bp full-length CDS of the anther-specific expression gene OsABCG15, which is composed of seven exons and six introns, was generated by IRR-PCR using genomic DNA of rice leaf as the template. Actually, this approach can be wildly applied to any DNA sequences assembly to achieve CDS cloning, gene fusion and multiple site-directed mutagenesis in functional genomics studies in vitro.

  13. Optofluidics-based DNA structure-competitive aptasensor for rapid on-site detection of lead(II) in an aquatic environment.

    Science.gov (United States)

    Long, Feng; Zhu, Anna; Wang, Hongchen

    2014-11-07

    Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of <8.5%. These observations clearly illustrate that with the use of different DNA or aptamer probes, the sensing strategy presented can be easily extended to the rapid on-site monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. A tool for rapid screening of direct DNA agents using reaction rates and relative interaction potency: towards screening environmental contaminants for hazard.

    Science.gov (United States)

    Gavina, Jennilee M A; Rubab, Mamoona; Zhang, Huijuan; Zhu, Jiping; Nong, Andy; Feng, Yong-Lai

    2011-11-01

    DNA damage represents a potential biomarker for determining the exposure risk to chemicals and may provide early warning data for identifying chemical hazards to human health. Here, we have demonstrated a simple chromatography-based method that can be used to rapidly screen for the presence of chemical hazards as well as to determine parameters relevant to hazard assessment. In this proof-of-principle study, a simple in vitro system was used to determine the interaction of pollutants and probable carcinogens, phenyl glycidyl ether (PGE), tetrachlorohydroquinone (Cl(4)HQ), methylmethane sulfonate (MMS), styrene-7,8-oxide (SO), and benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), a metabolite of benzo[a]pyrene (B[a]P), with single- and double-stranded DNA probes. Differences in potency and reaction kinetics were studied for chemical and DNA type. A relative interaction potency equivalency (PEQ) of a chemical was determined by ratio of interaction potency of a chemical to BPDE as the reference chemical in the reaction with single- and double-stranded oligodeoxynucleotides. PEQs were found to be BPDE > PGE > SO > MMS > Cl(4)HQ for single-stranded oligodeoxynucleotides while they were found to be BPDE > PGE > Cl(4)HQ > MMS > SO for double-stranded oligodeoxynucleotides. Kinetics evaluation revealed that BPDE reacted with both DNA probes at a significantly faster rate, as compared to the remaining test chemicals. Equilibrium was reached within an hour for BPDE, but required a minimum of 48 h for the remaining chemicals. First-order rate constants were (1.61 ± 0.2) × 10(-3) s(-1) and (3.18 ± 0.4) × 10(-4) s(-1) for reaction of BPDE with double- and single-stranded DNA, respectively. The remaining chemicals possessed rate constants from 2 to 13 × 10(-6) s(-1) with a relative kinetic order for reaction with DNA of BPDE ≫ MMS > SO > PGE > Cl(4)HQ for ds-DNA and BPDE ≫ SO ≈ Cl(4)HQ ≈ MMS > PGE for ss-DNA. We further found that the reaction potency, defined by

  15. A Rapid and Sensitive Method for Detection of the T790M Mutation of EGFR in Plasma DNA.

    Science.gov (United States)

    Kimura, Hideharu; Nishikawa, Shingo; Koba, Hayato; Yoneda, Taro; Sone, Takashi; Kasahara, Kazuo

    2016-01-01

    Epidermal growth factor receptor (EGFR) T790M mutation is associated with resistance to EGFR tyrosine kinase inhibitors' (EGFR-TKIs) in non-small cell lung cancer (NSCLC). The aims of this study are to develop a blood-based, non-invasive approach to detecting the EGFR T790M mutation in advanced NSCLC patients, using PointMan™ EGFR DNA Enrichment Kit which is a novel method for selective amplification of genotype specific sequences.Pairs of blood samples and tumor tissues were collected from NSCLC patients with an EGFR activating mutation and who were resistant to EGFR-TKI treatment. EGFR T790M mutation in plasma DNA were detected using the PointMan™ EGFR DNA Enrichment Kit. The concentrations of plasma DNA were determined using quantitative real-time PCR.Of the 52 patients enrolled in this study, 41 of the patients' plasma samples were collected at post EGFR-TKIs. Nineteen (46.3 %) of the 41 patients had an EGFR T790M mutation in their plasma DNA as detected using the PointMan™ EGFR DNA Enrichment Kit after disease progression to EFGR-TKI. Of 11 cases with a detected T790M mutation from tumor tissues, 10 (90.9 %) also had a detectable T790M mutation in the plasma DNA. There was no difference in the progression-free survival between patients with T790M and those without T790M.The PointMan™ proved to be a useful method for determining plasma EGFR T790M mutation status.

  16. The properties and applications of single-molecule DNA sequencing

    Science.gov (United States)

    2011-01-01

    Single-molecule sequencing enables DNA or RNA to be sequenced directly from biological samples, making it well-suited for diagnostic and clinical applications. Here we review the properties and applications of this rapidly evolving and promising technology. PMID:21349208

  17. Assessing the impact of common forensic presumptive tests on the ability to obtain results using a novel rapid DNA platform.

    Science.gov (United States)

    Donachie, Gillian E; Dawnay, Nick; Ahmed, Romana; Naif, Sarah; Duxbury, Nicola J; Tribble, Nicholas D

    2015-07-01

    The rise of DNA evidence to the forefront of forensic science has led to high sample numbers being submitted for profiling by investigators to casework laboratories: bottleneck effects are often seen resulting in slow turnaround times and sample backlog. The ParaDNA(®) Screening and Intelligence Tests have been designed to guide investigators on the viability of potential sources of DNA allowing them to determine which samples should be sent for full DNA analysis. Both tests are designed to augment the arsenal of available forensic tests for end users and be used concurrently to those commonly available. Therefore, assessing the impact that common forensic tests have on such novel technology is important to measure. The systems were tested against various potential inhibitors to which samples may be exposed as part of the investigative process. Presumptive test agents for biological materials (blood, semen and saliva) and those used as fingerprint enhancement agents were both used. The Screening Test showed a drop in performance following application of aluminium powder and cyanoacrylate (CNA) on fingerprints samples; however this drop in performance was not replicated with high template DNA. No significant effect was observed for any agent using the Intelligence Test. Therefore, both tests stand up well to the chemical agents applied and can be used by investigators with confidence that system performance will be maintained. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. Rapid detection of periprosthetic joint infection using a combination of 16s rDNA polymerase chain reaction and lateral flow immunoassay: A Pilot Study.

    Science.gov (United States)

    Janz, V; Schoon, J; Morgenstern, C; Preininger, B; Reinke, S; Duda, G; Breitbach, A; Perka, C F; Geissler, S

    2018-01-01

    The objective of this study was to develop a test for the rapid (within 25 minutes) intraoperative detection of bacteria from synovial fluid to diagnose periprosthetic joint infection (PJI). The 16s rDNA test combines a polymerase chain reaction (PCR) for amplification of 16s rDNA with a lateral flow immunoassay in one fully automated system. The synovial fluid of 77 patients undergoing joint aspiration or primary or revision total hip or knee surgery was prospectively collected. The cohort was divided into a proof-of-principle cohort (n = 17) and a validation cohort (n = 60). Using the proof-of-principle cohort, an optimal cut-off for the discrimination between PJI and non-PJI samples was determined. PJI was defined as detection of the same bacterial species in a minimum of two microbiological samples, positive histology, and presence of a sinus tract or intra-articular pus. The 16s rDNA test proved to be very robust and was able to provide a result in 97% of all samples within 25 minutes. The 16s rDNA test was able to diagnose PJI with a sensitivity of 87.5% and 82%, and a specificity of 100% and 89%, in the proof-of-principle and validation cohorts, respectively. The microbiological culture of synovial fluid achieved a sensitivity of 80% and a specificity of 93% in the validation cohort. The 16s rDNA test offers reliable intraoperative detection of all bacterial species within 25 minutes with a sensitivity and specificity comparable with those of conventional microbiological culture of synovial fluid for the detection of PJI. The 16s rDNA test performance is independent of possible blood contamination, culture time and bacterial species. Cite this article : V. Janz, J. Schoon, C. Morgenstern, B. Preininger, S. Reinke, G. Duda, A. Breitbach, C. F. Perka, S. Geissler. Rapid detection of periprosthetic joint infection using a combination of 16s rDNA polymerase chain reaction and lateral flow immunoassay: A Pilot Study. Bone Joint Res 2018;7:12-19. DOI: 10

  19. Study of bacteriophage T4-encoded Dam DNA (adenine-N6)-methyltransferase binding with substrates by rapid laser UV cross-linking.

    Science.gov (United States)

    Evdokimov, Alexey A; Sclavi, Bianca; Zinoviev, Victor V; Malygin, Ernst G; Hattman, Stanley; Buckle, Malcolm

    2007-09-07

    DNA methyltransferases of the Dam family (including bacteriophage T4-encoded Dam DNA (adenine-N(6))-methyltransferase (T4Dam)) catalyze methyl group transfer from S-adenosyl-L-methionine (AdoMet), producing S-adenosyl-L-homocysteine (AdoHcy) and methylated adenine residues in palindromic GATC sequences. In this study, we describe the application of direct (i.e. no exogenous cross-linking reagents) laser UV cross-linking as a universal non-perturbing approach for studying the characteristics of T4Dam binding with substrates in the equilibrium and transient modes of interaction. UV irradiation of the enzyme.substrate complexes using an Nd(3+):yttrium aluminum garnet laser at 266 nm resulted in up to 3 and >15% yields of direct T4Dam cross-linking to DNA and AdoMet, respectively. Consequently, we were able to measure equilibrium constants and dissociation rates for enzyme.substrate complexes. In particular, we demonstrate that both reaction substrates, specific DNA and AdoMet (or product AdoHcy), stabilized the ternary complex. The improved substrate affinity for the enzyme in the ternary complex significantly reduced dissociation rates (up to 2 orders of magnitude). Several of the parameters obtained (such as dissociation rate constants for the binary T4Dam.AdoMet complex and for enzyme complexes with a nonfluorescent hemimethylated DNA duplex) were previously inaccessible by other means. However, where possible, the results of laser UV cross-linking were compared with those of fluorescence analysis. Our study suggests that rapid laser UV cross-linking efficiently complements standard DNA methyltransferase-related tools and is a method of choice to probe enzyme-substrate interactions in cases in which data cannot be acquired by other means.

  20. A differential mobility spectrometry/mass spectrometry platform for the rapid detection and quantitation of DNA adduct dG-ABP.

    Science.gov (United States)

    Kafle, Amol; Klaene, Joshua; Hall, Adam B; Glick, James; Coy, Stephen L; Vouros, Paul

    2013-07-15

    There is continued interest in exploring new analytical technologies for the detection and quantitation of DNA adducts, biomarkers which provide direct evidence of exposure and genetic damage in cells. With the goal of reducing clean-up steps and improving sample throughput, a Differential Mobility Spectrometry/Mass Spectrometry (DMS/MS) platform has been introduced for adduct analysis. A DMS/MS platform has been utilized for the analysis of dG-ABP, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl (4-ABP). After optimization of the DMS parameters, each sample was analyzed in just 30 s following a simple protein precipitation step of the digested DNA. A detection limit of one modification in 10^6 nucleosides has been achieved using only 2 µg of DNA. A brief comparison (quantitative and qualitative) with liquid chromatography/mass spectrometry is also presented highlighting the advantages of using the DMS/MS method as a high-throughput platform. The data presented demonstrate the successful application of a DMS/MS/MS platform for the rapid quantitation of DNA adducts using, as a model analyte, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl. Copyright © 2013 John Wiley & Sons, Ltd.

  1. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2017-01-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  2. Uracil-DNA glycosylase-treated reverse transcription loop-mediated isothermal amplification for rapid detection of avian influenza virus preventing carry-over contamination.

    Science.gov (United States)

    Kim, Eun-Mi; Jeon, Hyo-Sung; Kim, Ji-Jung; Shin, Yeun-Kyung; Lee, Youn-Jeong; Yeo, Sang-Geon; Park, Choi-Kyu

    2016-09-30

    Here, we describe a uracil-DNA glycosylase (UNG)-treated reverse transcription loop-mediated isothermal amplification (uRT-LAMP) for the visual detection of all subtypes of avian influenza A virus (AIV). The uRT-LAMP assay can prevent unwanted amplification by carryover contamination of the previously amplified DNA, although the detection limit of the uRT-LAMP assay is 10-fold lower than that of the RT-LAMP without a UNG treatment. To the best of our knowledge, this is the first successful application of deoxyuridine triphosphate/UNG strategy in RT-LAMP for AIV detection, and the assay can be applied for the rapid, and reliable diagnosis of AIVs, even in contaminated samples.

  3. DNA microarrays immobilized on unmodified plastics in a microfluidic biochip for rapid typing of Avian Influenza Virus

    DEFF Research Database (Denmark)

    Yi, Sun; Perch-Nielsen, Ivan R.; Dufva, Martin

    2011-01-01

    to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on non-modified plastic surfaces. This one-step, cost-effective process provides very high immobilization and hybridization efficiencies and is applicable to many different types of polymers. Using this microarray fabrication technique......, a portable cyclic olefin copolymer (COC) microarray device containing eight individually addressable microfluidic channels was developed for fast identification of Avian Influenza Virus (AIV) by DNA hybridization. This plastic biochip offers benefits of low fabrication cost and parallel processing...

  4. Internal validation of the DNAscan/ANDE™ Rapid DNA Analysis™ platform and its associated PowerPlex(®) 16 high content DNA biochip cassette for use as an expert system with reference buccal swabs.

    Science.gov (United States)

    Moreno, Lilliana I; Brown, Alice L; Callaghan, Thomas F

    2017-07-01

    Rapid DNA platforms are fully integrated systems capable of producing and analyzing short tandem repeat (STR) profiles from reference sample buccal swabs in less than two hours. The technology requires minimal user interaction and experience making it possible for high quality profiles to be generated outside an accredited laboratory. The automated production of point of collection reference STR profiles could eliminate the time delay for shipment and analysis of arrestee samples at centralized laboratories. Furthermore, point of collection analysis would allow searching against profiles from unsolved crimes during the normal booking process once the infrastructure to immediately search the Combined DNA Index System (CODIS) database from the booking station is established. The DNAscan/ANDE™ Rapid DNA Analysis™ System developed by Network Biosystems was evaluated for robustness and reliability in the production of high quality reference STR profiles for database enrollment and searching applications. A total of 193 reference samples were assessed for concordance of the CODIS 13 loci. Studies to evaluate contamination, reproducibility, precision, stutter, peak height ratio, noise and sensitivity were also performed. The system proved to be robust, consistent and dependable. Results indicated an overall success rate of 75% for the 13 CODIS core loci and more importantly no incorrect calls were identified. The DNAscan/ANDE™ could be confidently used without human interaction in both laboratory and non-laboratory settings to generate reference profiles. Published by Elsevier B.V.

  5. Development of a rapid diagnostic method for identification of Staphylococcus aureus and antimicrobial resistance in positive blood culture bottles using a PCR-DNA-chromatography method.

    Science.gov (United States)

    Ohshiro, Takeya; Miyagi, Chihiro; Tamaki, Yoshikazu; Mizuno, Takuya; Ezaki, Takayuki

    2016-06-01

    Blood culturing and the rapid reporting of results are essential for infectious disease clinics to obtain bacterial information that can affect patient prognosis. When gram-positive coccoid cells are observed in blood culture bottles, it is important to determine whether the strain is Staphylococcus aureus and whether the strain has resistance genes, such as mecA and blaZ, for proper antibiotic selection. Previous work led to the development of a PCR method that is useful for rapid identification of bacterial species and antimicrobial susceptibility. However, that method has not yet been adopted in community hospitals due to the high cost and methodological complexity. We report here the development of a quick PCR and DNA-chromatography test, based on single-tag hybridization chromatography, that permits detection of S. aureus and the mecA and blaZ genes; results can be obtained within 1 h for positive blood culture bottles. We evaluated this method using 42 clinical isolates. Detection of S. aureus and the resistance genes by the PCR-DNA-chromatography method was compared with that obtained via the conventional identification method and actual antimicrobial susceptibility testing. Our method had a sensitivity of 97.0% and a specificity of 100% for the identification of the bacterial species. For the detection of the mecA gene of S. aureus, the sensitivity was 100% and the specificity was 95.2%. For the detection of the blaZ gene of S. aureus, the sensitivity was 100% and the specificity was 88.9%. The speed and simplicity of this PCR-DNA-chromatography method suggest that our method will facilitate rapid diagnoses. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  6. O-antigen and virulence profiling of Shiga toxin-producing Escherichia coli by a rapid and cost-effective DNA microarray colorimetric method

    Directory of Open Access Journals (Sweden)

    Beatriz eQuiñones

    2012-05-01

    Full Text Available Shiga toxin-producing Escherichia coli (STEC is a leading cause of foodborne illness worldwide. The present study developed the use of DNA microarrays with the ampliPHOX colorimetric method to rapidly detect and genotype STEC strains. A low-density 30-mer oligonucleotide DNA microarray was designed to target O-antigen gene clusters of eleven E. coli serogroups (O26, O45, O91, O103, O104, O111, O113, O121, O128, O145 and O157 that have been associated with the majority of STEC infections. In addition, the DNA microarray targeted eleven virulence genes, encoding adhesins, cytotoxins, proteases, and receptor proteins, which have been implicated in conferring increased ability to cause disease for STEC. Results from the validation experiments demonstrated that this microarray-based colorimetric method allowed for a rapid and accurate genotyping of STEC reference strains from environmental and clinical sources and from distinct geographical locations. Positive hybridization signals were detected only for probes targeting serotype and virulence genes known to be present in the STEC reference strains. Quantification analysis indicated that the mean pixel intensities of the signal for probes targeting O-antigen or virulence genes were at least three times higher when compared to the background. Furthermore, this microarray-based colorimetric method was then employed to genotype a group of E. coli isolates from watershed sediment and animal fecal samples that were collected from an important region for leafy-vegetable production in the central coast of California. The results indicated an accurate identification of O-type and virulence genes in the tested isolates and confirmed that the ampliPHOX colorimetric method with low density DNA microarrays enabled a fast assessment of the virulence potential of STEC using low-cost reagents and instrumentation.

  7. Using rapid diagnostic tests as source of malaria parasite DNA for molecular analyses in the era of declining malaria prevalence

    DEFF Research Database (Denmark)

    Ishengoma, Deus S; Lwitiho, Sudi; Madebe, Rashid A

    2011-01-01

    continued molecular surveillance of malaria parasites is important to early identify emerging anti-malarial drug resistance, it is becoming increasingly difficult to obtain parasite samples from ongoing studies, such as routine drug efficacy trials. To explore other sources of parasite DNA, this study...

  8. Evaluation of rapid GeneXpert MTB/RIF method using DNA tissue specimens of vertebral bones in patients with suspected spondylitis TB.

    Science.gov (United States)

    Massi, Muhammad Nasrum; Biatko, Karya Triko; Handayani, Irda; Pratama, Muhammad Yogi; Septriani, Sari; Nurdin, Gaby Maulida; Ali, Marina B

    2017-03-01

    To detect Mycobacterium tuberculosis DNA and rifampicin resistance in vertebral bone tissue specimens from spondylitis TB suspects. The rapid GeneXpert MTB/RIF and MGIT 960 liquid culture methods have been used in the specimens. Results from 70 suspects with spondylitis TB shown that 31.42% identified positive for spondylitis TB using culture method, while 88.57% shown positive results using rapid GeneXpert MTB/RIF method. The validity of GeneXpert MTB/RIF shown sensitivity value of 100%, specificity value of 16.6%, PPV of 35.48%, and NPV of 100%. GeneXpert has a high sensitivity but low specificity value in this study.

  9. Mentoring: An Evolving Relationship.

    Science.gov (United States)

    Block, Michelle; Florczak, Kristine L

    2017-04-01

    The column concerns itself with mentoring as an evolving relationship between mentor and mentee. The collegiate mentoring model, the transformational transcendence model, and the humanbecoming mentoring model are considered in light of a dialogue with mentors at a Midwest university and conclusions are drawn.

  10. Measurably evolving populations

    DEFF Research Database (Denmark)

    Drummond, Alexei James; Pybus, Oliver George; Rambaut, Andrew

    2003-01-01

    processes through time. Populations for which such studies are possible � measurably evolving populations (MEPs) � are characterized by sufficiently long or numerous sampled sequences and a fast mutation rate relative to the available range of sequence sampling times. The impact of sequences sampled through...... understanding of evolutionary processes in diverse organisms, from viruses to vertebrates....

  11. Potential of cross-priming amplification and DNA-based lateral-flow strip biosensor for rapid on-site GMO screening.

    Science.gov (United States)

    Huang, Xin; Zhai, Congcong; You, Qimin; Chen, Hongjun

    2014-07-01

    The requirement to monitor the presence of genetically modified organisms (GMO) in a variety of marked products has generated an increasing demand for reliable, rapid, and time and cost-effective analytical methods. Here we report an on-site method for rapid detection of cauliflower mosaic virus promoter (CaMV 35S), a common element present in most GMO, using cross-priming amplification (CPA) technology. Detection was achieved using a DNA-based contamination-proof strip biosensor. The limit of detection was 30 copies for the pBI121 plasmid containing the CaMV 35S gene. The certified reference sample of GM maize line MON810 was detectable even at the low relative mass concentration of 0.05%. The developed CPA method had high specificity for the CaMV 35S gene, as compared with other GM lines not containing this gene and non-GM products. The method was further validated using nine real-world samples, and the results were confirmed by real-time PCR analysis. Because of its simplicity, rapidity, and high sensitivity, this method of detecting the CaMV 35S gene has great commercial prospects for rapid GMO screening of high-consumption food and agriculture products.

  12. A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta

    Directory of Open Access Journals (Sweden)

    Coupland George

    2005-08-01

    Full Text Available Abstract Background Many established PCR-based approaches in plant molecular biology rely on lengthy and expensive methods for isolation of nucleic acids. Although several rapid DNA isolation protocols are available, they have not been tested for simultaneous RNA isolation for RT-PCR applications. In addition, traditional map-based cloning technologies often use ill-proportioned marker regions even when working with the model plant Arabidopsis thaliana, where the availability of the full genome sequence can now be exploited for the creation of a high-density marker systems. Results We designed a high-density polymorphic marker set between two frequently used ecotypes. This new polymorphic marker set allows size separation of PCR products on agarose gels and provides an initial resolution of 10 cM in linkage mapping experiments, facilitated by a rapid plant nucleic acid extraction protocol using minimal amounts of A. thaliana tissue. Using this extraction protocol, we have also characterized segregating T-DNA insertion mutations. In addition, we have shown that our rapid nucleic acid extraction protocol can also be used for monitoring transcript levels by RT-PCR amplification. Finally we have demonstrated that our nucleic acid isolation method is also suitable for other plant species, such as tobacco and barley. Conclusion To facilitate high-throughput linkage mapping and other genomic applications, our nucleic acid isolation protocol yields sufficient quality of DNA and RNA templates for PCR and RT-PCR reactions, respectively. This new technique requires considerably less time compared to other purification methods, and in combination with a new polymorphic PCR marker set dramatically reduces the workload required for linkage mapping of mutations in A. thaliana utilizing crosses between Col-0 and Landsberg erecta (Ler ecotypes.

  13. Development and Evaluation of Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Tylenchulus semipenetrans Using DNA Extracted from Soil

    Directory of Open Access Journals (Sweden)

    Zhi-Qiang Song

    2017-04-01

    Full Text Available Tylenchulus semipenetrans is an important and widespread plant-parasitic nematode of citrus worldwide and can cause citrus slow decline disease leading to significant reduction in tree growth and yield. Rapid and accurate detection of T. semipenetrans in soil is important for the disease forecasting and management. In this study, a loop-mediated isothermal amplification (LAMP assay was developed to detect T. semipenetrans using DNA extracted from soil. A set of five primers was designed from the internal transcribed spacer region (ITS1 of rDNA, and was highly specific to T. semipenetrans. The LAMP reaction was performed at 63°C for 60 min. The LAMP product was visualized directly in one reaction tube by adding SYBR Green I. The detection limit of the LAMP assay was 10−2 J2/0.5 g of soil, which was 10 times more sensitive than conventional PCR (10−1 J2/0.5 g of soil. Examination of 24 field soil samples revealed that the LAMP assay was applicable to a range of soils infested naturally with T. semipenetrans, and the total assay time was less than 2.5 h. These results indicated that the developed LAMP assay is a simple, rapid, sensitive, specific and accurate technique for detection of T. semipenetrans in field soil, and contributes to the effective management of citrus slow decline disease.

  14. Rapid method for DNA extraction from the honey bee Apis mellifera and the parasitic bee mite Varroa destructor using lysis buffer and proteinase K.

    Science.gov (United States)

    Issa, M R C; Figueiredo, V L C; De Jong, D; Sakamoto, C H; Simões, Z L P

    2013-10-22

    We developed a rapid method for extraction of DNA from honey bees, Apis mellifera, and from the parasitic bee mite, Varroa destructor. The advantages include fast processing and low toxicity of the substances that are utilized. We used lysis buffer with nonionic detergents to lyse cell walls and proteinase K to digest proteins. We tested whole thorax, thoracic muscle mass, legs, and antennae from individual bees; the mites were processed whole (1 mite/sample). Each thorax was incubated whole, without cutting, because exocuticle color pigment darkened the extraction solution, interfering with PCR results. The procedure was performed with autoclaved equipment and laboratory gloves. For each sample, we used 100 µL lysis buffer (2 mL stock solution of 0.5 M Tris/HCl, pH 8.5, 10 mL stock solution of 2 M KCl, 500 µL solution of 1 M MgCl2, 2 mL NP40, and 27.6 g sucrose, completed to 200 mL with bidistilled water and autoclaved) and 2 µL proteinase K (10 mg/mL in bidistilled water previously autoclaved, as proteinase K cannot be autoclaved). Tissues were incubated in the solutions for 1-2 h in a water bath (62°-68 °C) or overnight at 37 °C. After incubation, the tissues were removed from the extraction solution (lysis buffer + proteinase K) and the solution heated to 92 °C for 10 min, for proteinase K inactivation. Then, the solution with the extracted DNA was stored in a refrigerator (4°-8 °C) or a freezer (-20 °C). This method does not require centrifugation or phenol/chloroform extraction. The reduced number of steps allowed us to sample many individuals/day. Whole mites and bee antennae were the most rapidly processed. All bee tissues gave the same quality DNA. This method, even using a single bee antenna or a single mite, was adequate for extraction and analysis of bee genomic and mitochondrial DNA and mite genomic DNA.

  15. A rapid and sensitive GC-MS/MS method to measure deuterium labeled deoxyadenosine in DNA from limited mouse cell populations

    Science.gov (United States)

    Farthing, Don E.; Buxbaum, Nataliya P.; Bare, Catherine V.; Treadwell, Shirin M.; Kapoor, Veena; Williams, Kirsten M.; Gress, Ronald E.

    2013-01-01

    A rapid and sensitive GC-MS/MS method was developed to quantitatively measure low levels of DNA base deoxyadenosine (dA) and its isotopologues (e.g. dA M+1) from limited mouse cell populations. Mice undergoing allogeneic hematopoietic transplantation (AHSCT) received deuterated water at biologically relevant time intervals post AHSCT, allowing labeling of DNA upon cell division, which was detected as the dA M+1 isotopologue. Targeted mouse cell populations were isolated from lymphoid organs and purified by multi-parameter fluorescence activated cell sorting. Cell lysis, DNA extraction and hydrolysis were accomplished using available commercial procedures. The novel analytical method utilized a hydrophilic-lipophilic balanced sample preparation, rapid on-line hot GC inlet gas phase sample derivatization, fast GC low thermal mass technology, and a recently marketed GC-MS/MS system. Calibration standards containing dA and fortified with relevant levels of dA M+1 (0.25–20%) and dA M+5 (internal standard) were used for sample quantitation. The method employed a quadratic fit for calibration of dA M+1 (0.25–20%) and dA, demonstrated excellent accuracy and precision, and had limits of detection of 100 fg on-column for the dA isotopologues. The method was validated and required only 20,000 cells to characterize population dynamics of cells involved in the biology of chronic graft-versus-host disease, the main cause of late morbidity and non-relapse-mortality following AHSCT. The high sensitivity and specificity of the method makes it useful for investigating in vivo kinetics on limited and important cell populations (e.g. T regulatory cells) from disease conditions or in disease models that are immune-mediated, such as diabetes, HIV/AIDS, arthritis, inflammatory bowel disease, and multiple sclerosis. PMID:23541182

  16. EVOLVE 2014 International Conference

    CERN Document Server

    Tantar, Emilia; Sun, Jian-Qiao; Zhang, Wei; Ding, Qian; Schütze, Oliver; Emmerich, Michael; Legrand, Pierrick; Moral, Pierre; Coello, Carlos

    2014-01-01

    This volume encloses research articles that were presented at the EVOLVE 2014 International Conference in Beijing, China, July 1–4, 2014.The book gathers contributions that emerged from the conference tracks, ranging from probability to set oriented numerics and evolutionary computation; all complemented by the bridging purpose of the conference, e.g. Complex Networks and Landscape Analysis, or by the more application oriented perspective. The novelty of the volume, when considering the EVOLVE series, comes from targeting also the practitioner’s view. This is supported by the Machine Learning Applied to Networks and Practical Aspects of Evolutionary Algorithms tracks, providing surveys on new application areas, as in the networking area and useful insights in the development of evolutionary techniques, from a practitioner’s perspective. Complementary to these directions, the conference tracks supporting the volume, follow on the individual advancements of the subareas constituting the scope of the confe...

  17. Evolvable Neural Software System

    Science.gov (United States)

    Curtis, Steven A.

    2009-01-01

    The Evolvable Neural Software System (ENSS) is composed of sets of Neural Basis Functions (NBFs), which can be totally autonomously created and removed according to the changing needs and requirements of the software system. The resulting structure is both hierarchical and self-similar in that a given set of NBFs may have a ruler NBF, which in turn communicates with other sets of NBFs. These sets of NBFs may function as nodes to a ruler node, which are also NBF constructs. In this manner, the synthetic neural system can exhibit the complexity, three-dimensional connectivity, and adaptability of biological neural systems. An added advantage of ENSS over a natural neural system is its ability to modify its core genetic code in response to environmental changes as reflected in needs and requirements. The neural system is fully adaptive and evolvable and is trainable before release. It continues to rewire itself while on the job. The NBF is a unique, bilevel intelligence neural system composed of a higher-level heuristic neural system (HNS) and a lower-level, autonomic neural system (ANS). Taken together, the HNS and the ANS give each NBF the complete capabilities of a biological neural system to match sensory inputs to actions. Another feature of the NBF is the Evolvable Neural Interface (ENI), which links the HNS and ANS. The ENI solves the interface problem between these two systems by actively adapting and evolving from a primitive initial state (a Neural Thread) to a complicated, operational ENI and successfully adapting to a training sequence of sensory input. This simulates the adaptation of a biological neural system in a developmental phase. Within the greater multi-NBF and multi-node ENSS, self-similar ENI s provide the basis for inter-NBF and inter-node connectivity.

  18. Open microfluidic gel electrophoresis: Rapid and low cost separation and analysis of DNA at the nanoliter scale.

    Science.gov (United States)

    Gutzweiler, Ludwig; Gleichmann, Tobias; Tanguy, Laurent; Koltay, Peter; Zengerle, Roland; Riegger, Lutz

    2017-07-01

    Gel electrophoresis is one of the most applied and standardized tools for separation and analysis of macromolecules and their fragments in academic research and in industry. In this work we present a novel approach for conducting on-demand electrophoretic separations of DNA molecules in open microfluidic (OM) systems on planar polymer substrates. The approach combines advantages of slab gel, capillary- and chip-based methods offering low consumable costs (<0.1$) circumventing cost-intensive microfluidic chip fabrication, short process times (5 min per analysis) and high sensitivity (4 ng/μL dsDNA) combined with reasonable resolution (17 bases). The open microfluidic separation system comprises two opposing reservoirs of 2-4 μL in volume, a semi-contact written gel line acting as separation channel interconnecting the reservoirs and sample injected into the line via non-contact droplet dispensing and thus enabling the precise control of the injection plug and sample concentration. Evaporation is prevented by covering aqueous structures with PCR-grade mineral oil while maintaining surface temperature at 15°C. The liquid gel line exhibits a semi-circular cross section of adaptable width (∼200-600 μm) and height (∼30-80 μm) as well as a typical length of 15-55 mm. Layout of such liquid structures is adaptable on-demand not requiring time consuming and repetitive fabrication steps. The approach was successfully demonstrated by the separation of a standard label-free DNA ladder (100-1000 bp) at 100 V/cm via in-line staining and laser induced fluorescent end-point detection using an automated prototype. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Coilin is rapidly recruited to UVA-induced DNA lesions and γ-radiation affects localized movement of Cajal bodies.

    Science.gov (United States)

    Bártová, Eva; Foltánková, Veronika; Legartová, Soňa; Sehnalová, Petra; Sorokin, Dmitry V; Suchánková, Jana; Kozubek, Stanislav

    2014-01-01

    Cajal bodies are important nuclear structures containing proteins that preferentially regulate RNA-related metabolism. We investigated the cell-type specific nuclear distribution of Cajal bodies and the level of coilin, a protein of Cajal bodies, in non-irradiated and irradiated human tumor cell lines and embryonic stem (ES) cells. Cajal bodies were localized in different nuclear compartments, including DAPI-poor regions, in the proximity of chromocenters, and adjacent to nucleoli. The number of Cajal bodies per nucleus was cell cycle-dependent, with higher numbers occurring during G2 phase. Human ES cells contained a high coilin level in the nucleoplasm, but coilin-positive Cajal bodies were also identified in nuclei of mouse and human ES cells. Coilin, but not SMN, recognized UVA-induced DNA lesions, which was cell cycle-independent. Treatment with γ-radiation reduced the localized movement of Cajal bodies in many cell types and GFP-coilin fluorescence recovery after photobleaching was very fast in nucleoplasm in comparison with GFP-coilin recovery in DNA lesions. By contrast, nucleolus-localized coilin displayed very slow fluorescence recovery after photobleaching, which indicates very slow rates of protein diffusion, especially in nucleoli of mouse ES cells.

  20. Gold nanoparticle-based lateral flow biosensor for rapid visual detection of Leishmania-specific DNA amplification products.

    Science.gov (United States)

    Toubanaki, Dimitra K; Athanasiou, Evita; Karagouni, Evdokia

    2016-08-01

    Leishmaniasis is a disease, caused by Leishmania parasites, which infect humans and animals, posing a major social and economic burden worldwide. The need for accurate and sensitive disease diagnosis led to the widespread adoption of PCR amplification. Detection of the amplification products (i.e. gel electrophoresis) require time-consuming protocols performed by trained personnel, with high cost. Aim of the present study was the simplification of PCR product detection, using a nucleic acid lateral flow, combined with functionalized gold nanoparticles. Amplification reactions targeting kinetoplastid DNA of Leishmania spp were performed on canine blood samples and a positive signal was formed as a red test zone. The visual detection was completed in 20min. Extensive optimization enabled the detection of 100fmol of target DNA. Clinical samples of infected dog blood were analyzed with high specificity. Overall, the proposed lateral flow biosensor can be considered an appealing alternative platform for Leishmania-specific amplification products detection with low cost and attractive simplicity. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Information theory, evolutionary innovations and evolvability.

    Science.gov (United States)

    Wagner, Andreas

    2017-12-05

    How difficult is it to 'discover' an evolutionary adaptation or innovation? I here suggest that information theory, in combination with high-throughput DNA sequencing, can help answer this question by quantifying a new phenotype's information content. I apply this framework to compute the phenotypic information associated with novel gene regulation and with the ability to use novel carbon sources. The framework can also help quantify how DNA duplications affect evolvability, estimate the complexity of phenotypes and clarify the meaning of 'progress' in Darwinian evolution.This article is part of the themed issue 'Process and pattern in innovations from cells to societies'. © 2017 The Author(s).

  2. Development of a rapid method for identifying carryover contamination of positive control DNA, using a chimeric positive control and restriction enzyme for the diagnosis of white spot syndrome virus by nested PCR.

    Science.gov (United States)

    Kim, Hyoung Jun; Kwon, Se Ryun

    2014-12-01

    Chimeric positive plasmids have been developed to minimize false-positive reactions caused by polymerase chain reaction (PCR) contamination. Here, we developed a rapid method for identifying false-positive results while detecting white spot syndrome virus (WSSV) by nested PCR, using chimeric positive plasmids. The results of PCRs using WSSV diagnostic primer sets showed PCR products of a similar size (WSSV 1st PCR product, 1,447 bp; WSSV 2nd PCR product, 941 bp) using WSSV chimeric plasmids or DNA from shrimp infected with WSSV. The PCR products were digested with DraI for 1 h at 37 °C. The digested chimeric DNA separated into two DNA bands; however, the WSSV-infected shrimp DNA did not separate. Thus, chimeric plasmid DNA may be used as positive control DNA instead of DNA from WSSV-infected shrimp, in order to prevent PCR contamination. Thus, the use of restriction enzyme digestion allowed us to rapidly distinguish between WSSV DNA and WSSV chimeric plasmid DNA.

  3. Rapid One-Step Selection Method for Generating Nucleic Acid Aptamers: Development of a DNA Aptamer against alpha-Bungarotoxin

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Shamaileh, Hadi A.; Edwards, Stacey L.

    2012-01-01

    Background: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen (R), an inhibitor of vascular endothelial growth factor (VEGF......) for the treatment of age related macular degeneration (AMD). Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly...... in one-step, technique is required for developing aptamers in limited time period. Principal Findings: Herein, we present a simple one-step selection of DNA aptamers against alpha-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed...

  4. Regolith Evolved Gas Analyzer

    Science.gov (United States)

    Hoffman, John H.; Hedgecock, Jud; Nienaber, Terry; Cooper, Bonnie; Allen, Carlton; Ming, Doug

    2000-01-01

    The Regolith Evolved Gas Analyzer (REGA) is a high-temperature furnace and mass spectrometer instrument for determining the mineralogical composition and reactivity of soil samples. REGA provides key mineralogical and reactivity data that is needed to understand the soil chemistry of an asteroid, which then aids in determining in-situ which materials should be selected for return to earth. REGA is capable of conducting a number of direct soil measurements that are unique to this instrument. These experimental measurements include: (1) Mass spectrum analysis of evolved gases from soil samples as they are heated from ambient temperature to 900 C; and (2) Identification of liberated chemicals, e.g., water, oxygen, sulfur, chlorine, and fluorine. REGA would be placed on the surface of a near earth asteroid. It is an autonomous instrument that is controlled from earth but does the analysis of regolith materials automatically. The REGA instrument consists of four primary components: (1) a flight-proven mass spectrometer, (2) a high-temperature furnace, (3) a soil handling system, and (4) a microcontroller. An external arm containing a scoop or drill gathers regolith samples. A sample is placed in the inlet orifice where the finest-grained particles are sifted into a metering volume and subsequently moved into a crucible. A movable arm then places the crucible in the furnace. The furnace is closed, thereby sealing the inner volume to collect the evolved gases for analysis. Owing to the very low g forces on an asteroid compared to Mars or the moon, the sample must be moved from inlet to crucible by mechanical means rather than by gravity. As the soil sample is heated through a programmed pattern, the gases evolved at each temperature are passed through a transfer tube to the mass spectrometer for analysis and identification. Return data from the instrument will lead to new insights and discoveries including: (1) Identification of the molecular masses of all of the gases

  5. Rapid, Affordable, and Point-of-Care Water Monitoring Via a Microfluidic DNA Sensor and a Mobile Interface for Global Health.

    Science.gov (United States)

    Kim, Unyoung; Ghanbari, Sarah; Ravikumar, Anusha; Seubert, John; Figueira, Silvia

    2013-01-01

    Contaminated water is a serious concern in many developing countries with severe health consequences particularly for children. Current methods for monitoring waterborne pathogens are often time consuming, expensive, and labor intensive, making them not suitable for these regions. Electrochemical detection in a microfluidic platform offers many advantages such as portability, minimal use of instrumentation, and easy integration with electronics. In many parts of the world, however, the required equipment for pathogen detection through electrochemical sensors is either not available or insufficiently portable, and operators may not be trained to use these sensors and interpret results, ultimately preventing its wide adoption. Counterintuitively, these same regions often have an extensive mobile phone infrastructure, suggesting the possibility of integrating electrochemical detection of bacterial pathogens with a mobile platform. Toward a solution to water quality interventions, we demonstrate a microfluidic electrochemical sensor combined with a mobile interface that detects the sequences from bacterial pathogens, suitable for rapid, affordable, and point-of-care water monitoring. We employ the transduction of DNA hybridization into a readily detectable electric signal by means of a conformational change of DNA stem-loop structure. Using this platform, we successfully demonstrate the detection of as low as 100 nM E. coli sequences and the automatic interpretation and mapping of the detection results via a mobile application.

  6. Evolving haloalkane dehalogenases

    NARCIS (Netherlands)

    Janssen, D.B.

    Mechanistic insight into the biochemistry of carbon–halogen bond cleavage is rapidly growing because of recent structural, biochemical and computational studies that have provided further insight into how haloalkane dehalogenases achieve their impressive catalytic activity. An occluded water-free

  7. Development of a rapid DNA extraction method and one-step nested PCR for the detection of Naegleria fowleri from the environment.

    Science.gov (United States)

    Ahmad, Arine Fadzlun; Lonnen, James; Andrew, Peter W; Kilvington, Simon

    2011-10-15

    Naegleria fowleri is a small free-living amoebo-flagellate found in natural and manmade thermal aquatic habitats worldwide. The organism is pathogenic to man causing fatal primary amoebic meningoencephalitis (PAM). Infection typically results from bathing in contaminated water and is usually fatal. It is, therefore, important to identify sites containing N. fowleri in the interests of preventive public health microbiology. Culture of environmental material is the conventional method for the isolation of N. fowleri but requires several days incubation and subsequent biochemical or molecular tests to confirm identification. Here, a nested one-step PCR test, in conjunction with a direct DNA extraction from water or sediment material, was developed for the rapid and reliable detection of N. fowleri from the environment. Here, the assay detected N, fowleri in 18/109 river water samples associated with a nuclear power plant in South West France and 0/10 from a similar site in the UK. Although culture of samples yielded numerous thermophilic free-living amoebae, none were N. fowleri or other thermophilic Naegleria spp. The availability of a rapid, reliable and sensitive one-step nested PCR method for the direct detection of N. fowleri from the environment may aid ecological studies and enable intervention to prevent PAM cases. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  8. Development of a rapid, simple, and specific real-time PCR assay for detection of pseudorabies viral DNA in domestic swine herds.

    Science.gov (United States)

    Sayler, Katherine A; Bigelow, Troy; Koster, Leo G; Swenson, Sabrina; Bounds, Courtney; Hernández, Felipe; Wisely, Samantha M

    2017-07-01

    Despite successful eradication of pseudorabies virus (PRV) from the commercial pig industry in the United States in 2004, large populations of feral swine in certain regions act as wildlife reservoirs for the virus. Given the threat of reintroduction of the virus into domestic herds, a rapid, reliable, easily implemented assay is needed for detection of PRV. Although a real-time PCR (rtPCR) assay exists, improvements in rtPCR technology and a greater understanding of the diversity of PRV strains worldwide require an assay that would be easier to implement, more cost effective, and more specific. We developed a single-tube, rapid rtPCR that is capable of detecting 10 copies of PRV glycoprotein B ( gB) DNA per 20-µL total volume reaction. The assay did not produce a false-positive in samples known to be negative for the virus. The assay was negative for genetically similar herpesviruses and other porcine viruses. Our assay is a highly specific and sensitive assay that is also highly repeatable and reproducible. The assay should be a useful tool for early detection of PRV in pigs in the case of a suspected introduction or outbreak situation.

  9. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Directory of Open Access Journals (Sweden)

    Stefano Minguzzi

    Full Text Available Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum' detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV in Prunus.

  10. Rapid genotyping of common MeCP2 mutations with an electronic DNA microchip using serial differential hybridization.

    Science.gov (United States)

    Thistlethwaite, William A; Moses, Linda M; Hoffbuhr, Kristen C; Devaney, Joseph M; Hoffman, Eric P

    2003-05-01

    Rett syndrome is a neurodevelopmental disorder that affects females almost exclusively, and in which eight common point mutations on the X-linked MeCP2 gene are knows to cause over 70% of mutation-positive cases. We explored the use of a novel platform to detect the eight common mutations in Rett syndrome patients to expedite and simplify the process of identification of known genotypes. The Nanogen workstation consists of a two-color assay based on electric hybridization and thermal discrimination, all performed on an electronically active NanoChip. This genotyping platform was tested on 362 samples of a pre-determined genotype, which had been previously identified by a combination of DHPLC (denaturing high performance liquid chromatography) and direct sequencing. This genotyping technique proved to be rapid, facile, and displayed a specificity of 100% with 3% ambiguity. In addition, we present consecutive testing of seven mutations on a single pad of the NanoChip. This was accomplished by tagging down two amplimers together and serially hybridizing for seven different loci, allowing us to genotype samples for seven of the eight common Rett mutations on a single pad. This novel method displayed the same level of specificity and accuracy as the single amplimer reactions, and proved to be faster and more economical.

  11. Rapid divergence of histones in Hydrozoa (Cnidaria) and evolution of a novel histone involved in DNA damage response in hydra.

    Science.gov (United States)

    Reddy, Puli Chandramouli; Ubhe, Suyog; Sirwani, Neha; Lohokare, Rasika; Galande, Sanjeev

    2017-08-01

    Histones are fundamental components of chromatin in all eukaryotes. Hydra, an emerging model system belonging to the basal metazoan phylum Cnidaria, provides an ideal platform to understand the evolution of core histone components at the base of eumetazoan phyla. Hydra exhibits peculiar properties such as tremendous regenerative capacity, lack of organismal senescence and rarity of malignancy. In light of the role of histone modifications and histone variants in these processes it is important to understand the nature of histones themselves and their variants in hydra. Here, we report identification of the complete repertoire of histone-coding genes in the Hydra magnipapillata genome. Hydra histones were classified based on their copy numbers, gene structure and other characteristic features. Genomic organization of canonical histone genes revealed the presence of H2A-H2B and H3-H4 paired clusters in high frequency and also a cluster with all core histones along with H1. Phylogenetic analysis of identified members of H2A and H2B histones suggested rapid expansion of these groups in Hydrozoa resulting in the appearance of unique subtypes. Amino acid sequence level comparisons of H2A and H2B forms with bilaterian counterparts suggest the possibility of a highly mobile nature of nucleosomes in hydra. Absolute quantitation of transcripts confirmed the high copy number of histones and supported the canonical nature of H2A. Furthermore, functional characterization of H2A.X.1 and a unique variant H2A.X.2 in the gastric region suggest their role in the maintenance of genome integrity and differentiation processes. These findings provide insights into the evolution of histones and their variants in hydra. Copyright © 2017 Elsevier GmbH. All rights reserved.

  12. Rapid MCNP simulation of DNA double strand break (DSB) relative biological effectiveness (RBE) for photons, neutrons, and light ions.

    Science.gov (United States)

    Stewart, Robert D; Streitmatter, Seth W; Argento, David C; Kirkby, Charles; Goorley, John T; Moffitt, Greg; Jevremovic, Tatjana; Sandison, George A

    2015-11-07

    To account for particle interactions in the extracellular (physical) environment, information from the cell-level Monte Carlo damage simulation (MCDS) for DNA double strand break (DSB) induction has been integrated into the general purpose Monte Carlo N-particle (MCNP) radiation transport code system. The effort to integrate these models is motivated by the need for a computationally efficient model to accurately predict particle relative biological effectiveness (RBE) in cell cultures and in vivo. To illustrate the approach and highlight the impact of the larger scale physical environment (e.g. establishing charged particle equilibrium), we examined the RBE for DSB induction (RBEDSB) of x-rays, (137)Cs γ-rays, neutrons and light ions relative to γ-rays from (60)Co in monolayer cell cultures at various depths in water. Under normoxic conditions, we found that (137)Cs γ-rays are about 1.7% more effective at creating DSB than γ-rays from (60)Co (RBEDSB  =  1.017) whereas 60-250 kV x-rays are 1.1 to 1.25 times more efficient at creating DSB than (60)Co. Under anoxic conditions, kV x-rays may have an RBEDSB up to 1.51 times as large as (60)Co γ-rays. Fission neutrons passing through monolayer cell cultures have an RBEDSB that ranges from 2.6 to 3.0 in normoxic cells, but may be as large as 9.93 for anoxic cells. For proton pencil beams, Monte Carlo simulations suggest an RBEDSB of about 1.2 at the tip of the Bragg peak and up to 1.6 a few mm beyond the Bragg peak. Bragg peak RBEDSB increases with decreasing oxygen concentration, which may create opportunities to apply proton dose painting to help address tumor hypoxia. Modeling of the particle RBE for DSB induction across multiple physical and biological scales has the potential to aid in the interpretation of laboratory experiments and provide useful information to advance the safety and effectiveness of hadron therapy in the treatment of cancer.

  13. Fat: an evolving issue

    Directory of Open Access Journals (Sweden)

    John R. Speakman

    2012-09-01

    Work on obesity is evolving, and obesity is a consequence of our evolutionary history. In the space of 50 years, we have become an obese species. The reasons why can be addressed at a number of different levels. These include separating between whether the primary cause lies on the food intake or energy expenditure side of the energy balance equation, and determining how genetic and environmental effects contribute to weight variation between individuals. Opinion on whether increased food intake or decreased energy expenditure drives the obesity epidemic is still divided, but recent evidence favours the idea that food intake, rather than altered expenditure, is most important. There is more of a consensus that genetics explains most (probably around 65% of weight variation between individuals. Recent advances in genome-wide association studies have identified many polymorphisms that are linked to obesity, yet much of the genetic variance remains unexplained. Finding the causes of this unexplained variation will be an impetus of genetic and epigenetic research on obesity over the next decade. Many environmental factors – including gut microbiota, stress and endocrine disruptors – have been linked to the risk of developing obesity. A better understanding of gene-by-environment interactions will also be key to understanding obesity in the years to come.

  14. Evolving Concepts of Asthma

    Science.gov (United States)

    Ray, Anuradha; Wenzel, Sally E.

    2015-01-01

    Our understanding of asthma has evolved over time from a singular disease to a complex of various phenotypes, with varied natural histories, physiologies, and responses to treatment. Early therapies treated most patients with asthma similarly, with bronchodilators and corticosteroids, but these therapies had varying degrees of success. Similarly, despite initial studies that identified an underlying type 2 inflammation in the airways of patients with asthma, biologic therapies targeted toward these type 2 pathways were unsuccessful in all patients. These observations led to increased interest in phenotyping asthma. Clinical approaches, both biased and later unbiased/statistical approaches to large asthma patient cohorts, identified a variety of patient characteristics, but they also consistently identified the importance of age of onset of disease and the presence of eosinophils in determining clinically relevant phenotypes. These paralleled molecular approaches to phenotyping that developed an understanding that not all patients share a type 2 inflammatory pattern. Using biomarkers to select patients with type 2 inflammation, repeated trials of biologics directed toward type 2 cytokine pathways saw newfound success, confirming the importance of phenotyping in asthma. Further research is needed to clarify additional clinical and molecular phenotypes, validate predictive biomarkers, and identify new areas for possible interventions. PMID:26161792

  15. Evolving endoscopic surgery.

    Science.gov (United States)

    Sakai, Paulo; Faintuch, Joel

    2014-06-01

    Since the days of Albukasim in medieval Spain, natural orifices have been regarded not only as a rather repugnant source of bodily odors, fluids and excreta, but also as a convenient invitation to explore and treat the inner passages of the organism. However, surgical ingenuity needed to be matched by appropriate tools and devices. Lack of technologically advanced instrumentation was a strong deterrent during almost a millennium until recent decades when a quantum jump materialized. Endoscopic surgery is currently a vibrant and growing subspecialty, which successfully handles millions of patients every year. Additional opportunities lie ahead which might benefit millions more, however, requiring even more sophisticated apparatuses, particularly in the field of robotics, artificial intelligence, and tissue repair (surgical suturing). This is a particularly exciting and worthwhile challenge, namely of larger and safer endoscopic interventions, followed by seamless and scarless recovery. In synthesis, the future is widely open for those who use together intelligence and creativity to develop new prototypes, new accessories and new techniques. Yet there are many challenges in the path of endoscopic surgery. In this new era of robotic endoscopy, one will likely need a virtual simulator to train and assess the performance of younger doctors. More evidence will be essential in multiple evolving fields, particularly to elucidate whether more ambitious and complex pathways, such as intrathoracic and intraperitoneal surgery via natural orifice transluminal endoscopic surgery (NOTES), are superior or not to conventional techniques. © 2014 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  16. Asymmetric evolving random networks

    Science.gov (United States)

    Coulomb, S.; Bauer, M.

    2003-10-01

    We generalize the Poissonian evolving random graph model of M. Bauer and D. Bernard (2003), to deal with arbitrary degree distributions. The motivation comes from biological networks, which are well-known to exhibit non Poissonian degree distributions. A node is added at each time step and is connected to the rest of the graph by oriented edges emerging from older nodes. This leads to a statistical asymmetry between incoming and outgoing edges. The law for the number of new edges at each time step is fixed but arbitrary. Thermodynamical behavior is expected when this law has a large time limit. Although (by construction) the incoming degree distributions depend on this law, this is not the case for most qualitative features concerning the size distribution of connected components, as long as the law has a finite variance. As the variance grows above 1/4, the average being < 1/2, a giant component emerges, which connects a finite fraction of the vertices. Below this threshold, the distribution of component sizes decreases algebraically with a continuously varying exponent. The transition is of infinite order, in sharp contrast with the case of static graphs. The local-in-time profiles for the components of finite size allow to give a refined description of the system.

  17. Evolving a photosynthetic organelle

    Directory of Open Access Journals (Sweden)

    Nakayama Takuro

    2012-04-01

    Full Text Available Abstract The evolution of plastids from cyanobacteria is believed to represent a singularity in the history of life. The enigmatic amoeba Paulinella and its 'recently' acquired photosynthetic inclusions provide a fascinating system through which to gain fresh insight into how endosymbionts become organelles. The plastids, or chloroplasts, of algae and plants evolved from cyanobacteria by endosymbiosis. This landmark event conferred on eukaryotes the benefits of photosynthesis - the conversion of solar energy into chemical energy - and in so doing had a huge impact on the course of evolution and the climate of Earth 1. From the present state of plastids, however, it is difficult to trace the evolutionary steps involved in this momentous development, because all modern-day plastids have fully integrated into their hosts. Paulinella chromatophora is a unicellular eukaryote that bears photosynthetic entities called chromatophores that are derived from cyanobacteria and has thus received much attention as a possible example of an organism in the early stages of organellogenesis. Recent studies have unlocked the genomic secrets of its chromatophore 23 and provided concrete evidence that the Paulinella chromatophore is a bona fide photosynthetic organelle 4. The question is how Paulinella can help us to understand the process by which an endosymbiont is converted into an organelle.

  18. Assessing SfM-Photogrammetry potential at micro-scale on a rapidly evolving mud-bank: case study on a mesocosm study within pioneer mangroves in French Guiana (South America)

    Science.gov (United States)

    Fleury, Jules; Brunier, Guillaume; Michaud, Emma; Anthony, Edward; Dussouillez, Philippe; Morvan, Sylvain

    2016-04-01

    Mud banks are the loci of rich bio-geo-chemical processes occuring rapidly at infra-tide frequency. Their surface topography is commonly affected by many of these processes, including bioturbation, water drainage or dessication. Quantifying surface morphology and changes on a mud bank at the micro-scale is a challenging task due to a number of issues. First, the water-saturated nature of the soil makes it difficult to measure High Resolution Topography (HRT) with classical methods. Second, setting up an instrumented experiment without disrupting the signal being studied is hardly achieved at micro-scale. Finally, the highly mobile nature of this environment enhancing strong spatio-temporal heterogeneity is hard to capture. Terrestrial Laser Scanning (TLS) and SfM (Surface from Motion)-Photogrammetry are two techniques that enable mapping of micro-scale features, but the first technique is not suitable because of the poor quality of the backscattered laser signal on wet surfaces and the need to set up several measuring stations on a complex, unstable substrate. Thus, we set up an experiment to assess the feasibility and the accuracy of SfM in such a context. We took the opportunity of the installation of a pontoon dedicated to the study of bio-geochemical processes within benthic mesocosms installed on a mud bank inhabited by pioneer mangroves trees to develop an adapted photogrammetry protocol based on a full-frame remotely triggered camera sensor mounted on a pole. The incident light on the surface was also controlled with a light-diffusing device. We obtained sub-millimetric resolution 3D-topography and visible imagery. Surveys were carried out every 2 hours at low tide to detect surface changes due to water content variation as well as bioturbation mainly caused by crabs digging galleries and feeding on sediment surface. Both the qualitative and quantitative results seem very promising and lead us to expect new insights into heterogeneous surface processes on a

  19. cDNA cloning and chromosomal mapping of the mouse type VII collagen gene (Col7a1): Evidence for rapid evolutionary divergence of the gene

    Energy Technology Data Exchange (ETDEWEB)

    Li, Kehua; Christiano, A.M.; Chu, Mon Li; Uitto, J. (Jefferson Medical College, Philadelphia, PA (United States) Thomas Jefferson Univ., Philadelphia, PA (United States)); Copeland, N.G.; Gilbert, D.J. (NCI-Federick Cancer Research and Development Center, Federick, MD (United States))

    1993-06-01

    Type VII collagen is the major component of anchoring fibrils, critical attachment structures at the dermal-epidermal basement membrane zone. Genetic linkage analyses with recently cloned human type VII collagen cDNAs have indicated that the corresponding gene, COL7A1, is the candidate gene in the dystrophic forms of epidermolysis bullosa. To gain insight into the evolutionary conservation of COL7A1, in this study the authors have isolated mouse type VII collagen cDNAs by screening a mouse epidermal keratinocyte cDNA library with a human COL7A1 cDNA. Two overlapping mouse cDNAs were isolated, and Northern hybridization of mouse epidermal keratinocyte RNA with one of them revealed the presence of a mRNA transcript of [approximately]9.5 kb, the approximate size of the human COL7A1 mRNA. Nucleotide sequencing of the mouse cDNAs revealed a 2760-bp open reading frame that encodes the 5[prime] half of the collagenous domain and a segment of the NC-1, the noncollagenous amino-terminal domain of type VII collagen. Comparison of the mouse amino acid sequences with the corresponding human sequences deduced from cDNAs revealed 82.5% identity. The evolutionary divergence of the gene was relatively rapid in comparison to other collagen genes. Despite the high degree of sequence variation, several sequences, including the size and the position of noncollagenous imperfections and interruptions within the Gly-X-Y repeat sequence, were precisely conserved. Finally, the mouse Col7a1 gene was located by interspecific backcross mapping to mouse Chromosome 9, a region that corresponds to human chromosome 3p21, the position of human COL7Al. This assignment confirms and extends the relationship between the mouse and the human chromosomes in this region of the genome. 33 refs., 5 figs., 1 tab.

  20. High-level rapid production of full-size monoclonal antibodies in plants by a single-vector DNA replicon system.

    Science.gov (United States)

    Huang, Zhong; Phoolcharoen, Waranyoo; Lai, Huafang; Piensook, Khanrat; Cardineau, Guy; Zeitlin, Larry; Whaley, Kevin J; Arntzen, Charles J; Mason, Hugh S; Chen, Qiang

    2010-05-01

    Plant viral vectors have great potential in rapid production of important pharmaceutical proteins. However, high-yield production of hetero-oligomeric proteins that require the expression and assembly of two or more protein subunits often suffers problems due to the "competing" nature of viral vectors derived from the same virus. Previously we reported that a bean yellow dwarf virus (BeYDV)-derived, three-component DNA replicon system allows rapid production of single recombinant proteins in plants (Huang et al., 2009. Biotechnol Bioeng 103: 706-714). In this article, we report further development of this expression system for its application in high-yield production of oligomeric protein complexes including monoclonal antibodies (mAbs) in plants. We showed that the BeYDV replicon system permits simultaneous efficient replication of two DNA replicons and thus, high-level accumulation of two recombinant proteins in the same plant cell. We also demonstrated that a single vector that contains multiple replicon cassettes was as efficient as the three-component system in driving the expression of two distinct proteins. Using either the non-competing, three-vector system or the multi-replicon single vector, we produced both the heavy and light chain subunits of a protective IgG mAb 6D8 against Ebola virus GP1 (Wilson et al., 2000. Science 287: 1664-1666) at 0.5 mg of mAb per gram leaf fresh weight within 4 days post-infiltration of Nicotiana benthamiana leaves. We further demonstrated that full-size tetrameric IgG complex containing two heavy and two light chains was efficiently assembled and readily purified, and retained its functionality in specific binding to inactivated Ebola virus. Thus, our single-vector replicon system provides high-yield production capacity for hetero-oligomeric proteins, yet eliminates the difficult task of identifying non-competing virus and the need for co-infection of multiple expression modules. The multi-replicon vector represents a

  1. A rapid method for the detection of foodborne pathogens by extraction of a trace amount of DNA from raw milk based on label-free amino-modified silica-coated magnetic nanoparticles and polymerase chain reaction

    Science.gov (United States)

    A method based on amino-modified silica-coated magnetic nanoparticles (ASMNPs) and polymerase chain reaction (PCR) was developed to rapidly and sensitively detect foodborne pathogens in raw milk. After optimizing parameters such as pH, temperature, and time, a trace amount of genomic DNA of pathogen...

  2. Development of a Rapid Point-of-Use DNA Test for the Screening of Genuity® Roundup Ready 2 Yield® Soybean in Seed Samples

    Directory of Open Access Journals (Sweden)

    Dilip Chandu

    2016-01-01

    Full Text Available Testing for the presence of genetically modified material in seed samples is of critical importance for all stakeholders in the agricultural industry, including growers, seed manufacturers, and regulatory bodies. While rapid antibody-based testing for the transgenic protein has fulfilled this need in the past, the introduction of new variants of a given transgene demands new diagnostic regimen that allows distinguishing different traits at the nucleic acid level. Although such molecular tests can be performed by PCR in the laboratory, their requirement for expensive equipment and sophisticated operation have prevented its uptake in point-of-use applications. A recently developed isothermal DNA amplification technique, recombinase polymerase amplification (RPA, combines simple sample preparation and amplification work-flow procedures with the use of minimal detection equipment in real time. Here, we report the development of a highly sensitive and specific RPA-based detection system for Genuity Roundup Ready 2 Yield (RR2Y material in soybean (Glycine max seed samples and present the results of studies applying the method in both laboratory and field-type settings.

  3. Genome-wide DNA methylation alterations of Alternanthera philoxeroides in natural and manipulated habitats: implications for epigenetic regulation of rapid responses to environmental fluctuation and phenotypic variation.

    Science.gov (United States)

    Gao, Lexuan; Geng, Yupeng; Li, Bo; Chen, Jiakuan; Yang, Ji

    2010-11-01

    Alternanthera philoxeroides (alligator weed) is an invasive weed that can colonize both aquatic and terrestrial habitats. Individuals growing in different habitats exhibit extensive phenotypic variation but little genetic differentiation in its introduced range. The mechanisms underpinning the wide range of phenotypic variation and rapid adaptation to novel and changing environments remain uncharacterized. In this study, we examined the epigenetic variation and its correlation with phenotypic variation in plants exposed to natural and manipulated environmental variability. Genome-wide methylation profiling using methylation-sensitive amplified fragment length polymorphism (MSAP) revealed considerable DNA methylation polymorphisms within and between natural populations. Plants of different source populations not only underwent significant morphological changes in common garden environments, but also underwent a genome-wide epigenetic reprogramming in response to different treatments. Methylation alterations associated with response to different water availability were detected in 78.2% (169/216) of common garden induced polymorphic sites, demonstrating the environmental sensitivity and flexibility of the epigenetic regulatory system. These data provide evidence of the correlation between epigenetic reprogramming and the reversible phenotypic response of alligator weed to particular environmental factors. © 2010 Blackwell Publishing Ltd.

  4. A simple and rapid PCR-based method to isolate complete small macronuclear minichromosomes from hypotrich ciliates: 5S rDNA and S26 ribosomal protein gene of Oxytricha (Sterkiella) nova.

    Science.gov (United States)

    Callejas, Sergio; Gutiérrez, Juan Carlos

    2002-06-01

    Hypotrich ciliates present a macronuclear genome consisting of gene-sized instead of chromosome-sized DNA molecules. Exploiting this unique eukaryotic genome feature, we introduce, for the first time in ciliates, a rapid and easy PCR method using telomeric primers to isolate small complete macronuclear DNA molecules or minichromosomes. Two presumably abundant macronuclear DNA molecules, containing ribosomal genes, were amplified from the Oxytricha (Sterkiella) nova complete genome after using this method, and then were cloned and sequenced. The 5S rDNA sequence of O. (S.) nova is the third one reported among hypotrich ciliates; its primary and secondary structure is compared with other eukaryotic 5S rRNAs. The ribosomal protein S26 gene is the first one reported among ciliates. This "End-End-PCR" method might be useful to obtain similar gene-sized macronuclear molecules from other hypotrich ciliates, and, therefore, to increase our knowledge on ribosomal genes in these eukaryotic microorganisms.

  5. Natural selection promotes antigenic evolvability

    NARCIS (Netherlands)

    Graves, C.J.; Ros, V.I.D.; Stevenson, B.; Sniegowski, P.D.; Brisson, D.

    2013-01-01

    The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide

  6. Disgust: Evolved function and structure

    NARCIS (Netherlands)

    Tybur, J.M.; Lieberman, D.; Kurzban, R.; DeScioli, P.

    2013-01-01

    Interest in and research on disgust has surged over the past few decades. The field, however, still lacks a coherent theoretical framework for understanding the evolved function or functions of disgust. Here we present such a framework, emphasizing 2 levels of analysis: that of evolved function and

  7. A selective and label-free strategy for rapid screening of telomere-binding Ligands via fluorescence regulation of DNA/silver nanocluster

    National Research Council Canada - National Science Library

    Rui Cheng; Jing Xu; Xiafei Zhang; Zhilu Shi; Qi Zhang; Yan Jin

    2017-01-01

    Herein, the conformational switch of G-rich oligonucleotide (GDNA) demonstrated the obvious functional switch of GDNA which was found to significantly affect the fluorescence of the in-situ synthesized DNA/silver nanocluster (DNA-AgNC...

  8. Evolving virtual creatures and catapults.

    Science.gov (United States)

    Chaumont, Nicolas; Egli, Richard; Adami, Christoph

    2007-01-01

    We present a system that can evolve the morphology and the controller of virtual walking and block-throwing creatures (catapults) using a genetic algorithm. The system is based on Sims' work, implemented as a flexible platform with an off-the-shelf dynamics engine. Experiments aimed at evolving Sims-type walkers resulted in the emergence of various realistic gaits while using fairly simple objective functions. Due to the flexibility of the system, drastically different morphologies and functions evolved with only minor modifications to the system and objective function. For example, various throwing techniques evolved when selecting for catapults that propel a block as far as possible. Among the strategies and morphologies evolved, we find the drop-kick strategy, as well as the systematic invention of the principle behind the wheel, when allowing mutations to the projectile.

  9. Emerging Zika Virus Infection: A Rapidly Evolving Situation.

    Science.gov (United States)

    Bordi, Licia; Avsic-Zupanc, Tatjana; Lalle, Eleonora; Vairo, Francesco; Capobianchi, Maria Rosaria; da Costa Vasconcelos, Pedro Fernando

    2017-01-01

    Zika virus is a mosquito-borne flavivirus, firstly identified in Uganda and responsible for sporadic human cases in Africa and Asia until recently, when large outbreak occurred in Pacific Ocean and the Americas. Since the main vectors during its spread outside of Africa have been Ae. albopictus and Ae. aegypti mosquitoes, which are widely distributed all over the world, there is urgent need for a coordinated response for prevention and spread of ZIKV epidemics.Despite clinical manifestation of Zika virus infection are usually mild and self limiting, there are reports suggesting, during the recent epidemic, an association of ZIKV infection with severe consequences, including fetal/newborn microcephaly, due to vertical in utero transmission, autoimmune-neurological presentations including cranial nerve dysfunction, and Guillain-Barré Syndrome in adults. The primary mode of transmission of Zika virus between humans is through the bite of an infected female mosquito of the Aedes genus, but also sexual and blood transfusion transmission may occur. Moreover, a case of non-sexual spread from one person to another has been described, indicating that we still have more to learn about Zika transmission.Biological basis for pathogenetic effects are under investigation. Laboratory diagnosis is challenging since, so far, there are no "gold standard" diagnostic tools, and the low and short viremia in the acute phase, and together with the high cross-reactivity among the members of flavivirus genus are the most challenging aspects to be overcome.

  10. A Rapidly Evolving Active Region NOAA 8032 observed on April ...

    Indian Academy of Sciences (India)

    tribpo

    1997-04-15

    Apr 15, 1997 ... The GOES X-ray data showed a number of sub-flares and two C-class flares during the 8-9 hours of its evolution. ... (1991), where they observed X-class flares near the sites of. EFR. Wang & Shi (1993) suggested that ... region using the USΟ video magnetograph (Mathew et al. 1998). The active region. 233 ...

  11. The Rapidly Evolving Concept of Whole Heart Engineering

    Directory of Open Access Journals (Sweden)

    Laura Iop

    2017-01-01

    Full Text Available Whole heart engineering represents an incredible journey with as final destination the challenging aim to solve end-stage cardiac failure with a biocompatible and living organ equivalent. Its evolution started in 2008 with rodent organs and is nowadays moving closer to clinical application thanks to scaling-up strategies to human hearts. This review will offer a comprehensive examination on the important stages to be reached for the bioengineering of the whole heart, by describing the approaches of organ decellularization, repopulation, and maturation so far applied and the novel technologies of potential interest. In addition, it will carefully address important demands that still need to be satisfied in order to move to a real clinical translation of the whole bioengineering heart concept.

  12. "Reinventing Life": Introductory Biology for a Rapidly Evolving World

    Science.gov (United States)

    Coker, Jeffrey Scott

    2009-01-01

    Evolutionary concepts are essential for a scientific understanding of most issues surrounding modern medicine, agriculture, biotechnology, and the environment. If the mantra for biology education in the 20th century was, "Nothing in biology makes sense except in the light of evolution," the mantra for the 21st century must be, "Nothing in biology…

  13. Rapid radiation in spiny lobsters (Palinurus spp as revealed by classic and ABC methods using mtDNA and microsatellite data

    Directory of Open Access Journals (Sweden)

    Macpherson Enrique

    2009-11-01

    Full Text Available Abstract Background Molecular tools may help to uncover closely related and still diverging species from a wide variety of taxa and provide insight into the mechanisms, pace and geography of marine speciation. There is a certain controversy on the phylogeography and speciation modes of species-groups with an Eastern Atlantic-Western Indian Ocean distribution, with previous studies suggesting that older events (Miocene and/or more recent (Pleistocene oceanographic processes could have influenced the phylogeny of marine taxa. The spiny lobster genus Palinurus allows for testing among speciation hypotheses, since it has a particular distribution with two groups of three species each in the Northeastern Atlantic (P. elephas, P. mauritanicus and P. charlestoni and Southeastern Atlantic and Southwestern Indian Oceans (P. gilchristi, P. delagoae and P. barbarae. In the present study, we obtain a more complete understanding of the phylogenetic relationships among these species through a combined dataset with both nuclear and mitochondrial markers, by testing alternative hypotheses on both the mutation rate and tree topology under the recently developed approximate Bayesian computation (ABC methods. Results Our analyses support a North-to-South speciation pattern in Palinurus with all the South-African species forming a monophyletic clade nested within the Northern Hemisphere species. Coalescent-based ABC methods allowed us to reject the previously proposed hypothesis of a Middle Miocene speciation event related with the closure of the Tethyan Seaway. Instead, divergence times obtained for Palinurus species using the combined mtDNA-microsatellite dataset and standard mutation rates for mtDNA agree with known glaciation-related processes occurring during the last 2 my. Conclusion The Palinurus speciation pattern is a typical example of a series of rapid speciation events occurring within a group, with very short branches separating different species. Our

  14. The Evolving Diagnostic and Genetic Landscapes of Autism Spectrum Disorder.

    Science.gov (United States)

    Ziats, Mark N; Rennert, Owen M

    2016-01-01

    The autism spectrum disorders (ASD) are a heterogeneous set of neurodevelopmental syndromes defined by impairments in verbal and non-verbal communication, restricted social interaction, and the presence of stereotyped patterns of behavior. The prevalence of ASD is rising, and the diagnostic criteria and clinical perspectives on the disorder continue to evolve in parallel. Although the majority of individuals with ASD will not have an identifiable genetic cause, almost 25% of cases have identifiable causative DNA variants. The rapidly improving ability to identify genetic mutations because of advances in next generation sequencing, coupled with previous epidemiological studies demonstrating high heritability of ASD, have led to many recent attempts to identify causative genetic mutations underlying the ASD phenotype. However, although hundreds of mutations have been identified to date, they are either rare variants affecting only a handful of ASD patients, or are common variants in the general population conferring only a small risk for ASD. Furthermore, the genes implicated thus far are heterogeneous in their structure and function, hampering attempts to understand shared molecular mechanisms among all ASD patients; an understanding that is crucial for the development of targeted diagnostics and therapies. However, new work is beginning to suggest that the heterogeneous set of genes implicated in ASD may ultimately converge on a few common pathways. In this review, we discuss the parallel evolution of our diagnostic and genetic understanding of autism spectrum disorders, and highlight recent attempts to infer common biology underlying this complicated syndrome.

  15. The evolving diagnostic and genetic landscapes of autism spectrum disorder

    Directory of Open Access Journals (Sweden)

    Mark Nicholas Ziats

    2016-04-01

    Full Text Available The autism spectrum disorders (ASD are a heterogeneous set of neurodevelopmental syndromes defined by impairments in verbal and non-verbal communication, restricted social interaction, and the presence of stereotyped patterns of behavior. The prevalence of ASD is rising, and the diagnostic criteria and clinical perspectives on the disorder continue to evolve in parallel. Although the majority of individuals with ASD will not have an identifiable genetic cause, almost 25% of cases have identifiable causative DNA variants. The rapidly improving ability to identify genetic mutations because of advances in next generation sequencing, coupled with previous epidemiological studies demonstrating high heritability of ASD, have led to many recent attempts to identify causative genetic mutations underlying the ASD phenotype. However, although hundreds of mutations have been identified to date, they are either rare variants affecting only a handful of ASD patients, or are common variants in the general population conferring only a small risk for ASD. Furthermore, the genes implicated thus far are heterogeneous in their structure and function, hampering attempts to understand shared molecular mechanisms among all ASD patients; an understanding that is crucial for the development of targeted diagnostics and therapies. However, new work is beginning to suggest that the heterogeneous set of genes implicated in ASD may ultimately converge on a few common pathways. In this review, we discuss the parallel evolution of our diagnostic and genetic understanding of autism spectrum disorders, and highlight recent attempts to infer common biology underlying this complicated syndrome.

  16. A selective and label-free strategy for rapid screening of telomere-binding Ligands via fluorescence regulation of DNA/silver nanocluster

    Science.gov (United States)

    Cheng, Rui; Xu, Jing; Zhang, Xiafei; Shi, Zhilu; Zhang, Qi; Jin, Yan

    2017-03-01

    Herein, the conformational switch of G-rich oligonucleotide (GDNA) demonstrated the obvious functional switch of GDNA which was found to significantly affect the fluorescence of the in-situ synthesized DNA/silver nanocluster (DNA-AgNC) in homogeneous solution. We envisioned that the allosteric interaction between GDNA and DNA-AgNC would be possible to be used for screening telomere-binding ligands. A unimolecular probe (12C5TG) is ingeniously designed consisting of three contiguous DNA elements: G-rich telomeric DNA (GDNA) as molecular recognition sequence, T-rich DNA as linker and C-rich DNA as template of DNA-AgNC. The quantum yield and stability of 12C5TG-AgNC is greatly improved because the nearby deoxyguanosines tended to protect DNA/AgNC against oxidation. However, in the presence of ligands, the formation of G-quadruplex obviously quenched the fluorescence of DNA-AgNC. By taking full advantage of intramolecular allosteric effect, telomere-binding ligands were selectively and label-free screened by using deoxyguanines and G-quadruplex as natural fluorescence enhancer and quencher of DNA-AgNC respectively. Therefore, the functional switching of G-rich structure offers a cost-effective, facile and reliable way to screen drugs, which holds a great potential in bioanalysis as well.

  17. Forensic utilization of familial searches in DNA databases.

    Science.gov (United States)

    Gershaw, Cassandra J; Schweighardt, Andrew J; Rourke, Linda C; Wallace, Margaret M

    2011-01-01

    DNA evidence is widely recognized as an invaluable tool in the process of investigation and identification, as well as one of the most sought after types of evidence for presentation to a jury. In the United States, the development of state and federal DNA databases has greatly impacted the forensic community by creating an efficient, searchable system that can be used to eliminate or include suspects in an investigation based on matching DNA profiles - the profile already in the database to the profile of the unknown sample in evidence. Recent changes in legislation have begun to allow for the possibility to expand the parameters of DNA database searches, taking into account the possibility of familial searches. This article discusses prospective positive outcomes of utilizing familial DNA searches and acknowledges potential negative outcomes, thereby presenting both sides of this very complicated, rapidly evolving situation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  18. When did oxygenic photosynthesis evolve?

    National Research Council Canada - National Science Library

    Roger Buick

    2008-01-01

    ...2.4 Ga ago, but when the photosynthetic oxygen production began is debatable. However, geological and geochemical evidence from older sedimentary rocks indicates that oxygenic photosynthesis evolved well before this oxygenation event...

  19. Marshal: Maintaining Evolving Models Project

    Data.gov (United States)

    National Aeronautics and Space Administration — SIFT proposes to design and develop the Marshal system, a mixed-initiative tool for maintaining task models over the course of evolving missions. Marshal-enabled...

  20. Genetic structure and evolved malaria resistance in Hawaiian honeycreepers

    Science.gov (United States)

    Foster, J.T.; Woodworth, B.L.; Eggert, L.E.; Hart, P.J.; Palmer, D.; Duffy, D.C.; Fleischer, R.C.

    2007-01-01

    Infectious diseases now threaten wildlife populations worldwide but population recovery following local extinction has rarely been observed. In such a case, do resistant individuals recolonize from a central remnant population, or do they spread from small, perhaps overlooked, populations of resistant individuals? Introduced avian malaria (Plasmodium relictum) has devastated low-elevation populations of native birds in Hawaii, but at least one species (Hawaii amakihi, Hemignathus virens) that was greatly reduced at elevations below about 1000 m tolerates malaria and has initiated a remarkable and rapid recovery. We assessed mitochondrial and nuclear DNA markers from amakihi and two other Hawaiian honeycreepers, apapane (Himatione sanguinea) and iiwi (Vestiaria coccinea), at nine primary study sites from 2001 to 2003 to determine the source of re-establishing birds. In addition, we obtained sequences from tissue from amakihi museum study skins (1898 and 1948-49) to assess temporal changes in allele distributions. We found that amakihi in lowland areas are, and have historically been, differentiated from birds at high elevations and had unique alleles retained through time; that is, their genetic signature was not a subset of the genetic variation at higher elevations. We suggest that high disease pressure rapidly selected for resistance to malaria at low elevation, leaving small pockets of resistant birds, and this resistance spread outward from the scattered remnant populations. Low-elevation amakihi are currently isolated from higher elevations (> 1000 m) where disease emergence and transmission rates appear to vary seasonally and annually. In contrast to results from amakihi, no genetic differentiation between elevations was found in apapane and iiwi, indicating that slight variation in genetic or life-history attributes can determine disease resistance and population recovery. Determining the conditions that allow for the development of resistance to disease is

  1. Whole-genome sequencing of a laboratory-evolved yeast strain

    Directory of Open Access Journals (Sweden)

    Dunham Maitreya J

    2010-02-01

    Full Text Available Abstract Background Experimental evolution of microbial populations provides a unique opportunity to study evolutionary adaptation in response to controlled selective pressures. However, until recently it has been difficult to identify the precise genetic changes underlying adaptation at a genome-wide scale. New DNA sequencing technologies now allow the genome of parental and evolved strains of microorganisms to be rapidly determined. Results We sequenced >93.5% of the genome of a laboratory-evolved strain of the yeast Saccharomyces cerevisiae and its ancestor at >28× depth. Both single nucleotide polymorphisms and copy number amplifications were found, with specific gains over array-based methodologies previously used to analyze these genomes. Applying a segmentation algorithm to quantify structural changes, we determined the approximate genomic boundaries of a 5× gene amplification. These boundaries guided the recovery of breakpoint sequences, which provide insights into the nature of a complex genomic rearrangement. Conclusions This study suggests that whole-genome sequencing can provide a rapid approach to uncover the genetic basis of evolutionary adaptations, with further applications in the study of laboratory selections and mutagenesis screens. In addition, we show how single-end, short read sequencing data can provide detailed information about structural rearrangements, and generate predictions about the genomic features and processes that underlie genome plasticity.

  2. Dietary restriction but not angiotensin II type 1 receptor blockade improves DNA damage-related vasodilator dysfunction in rapidly aging Ercc1Δ/- mice.

    NARCIS (Netherlands)

    Wu, Haiyan; van Thiel, Bibi S; Bautista-Niño, Paula K; Reiling, Erwin; Durik, Matej; Leijten, Frank P J; Ridwan, Yanto; Brandt, Renata M C; van Steeg, Harry; Dollé, Martijn E T; Vermeij, Wilbert P; Hoeijmakers, Jan H J; Essers, Jeroen; van der Pluijm, Ingrid; Danser, A H Jan; Roks, Anton J M

    2017-01-01

    DNA damage is an important contributor to endothelial dysfunction and age-related vascular disease. Recently, we demonstrated in a DNA repair-deficient, prematurely aging mouse model (Ercc1Δ/- mice) that dietary restriction (DR) strongly increases life- and health span, including ameliorating

  3. Direct immobilization of DNA probes on non-modified plastics by UV irradiation and integration in microfluidic devices for rapid bioassay

    DEFF Research Database (Denmark)

    Yi, Sun; Perch-Nielsen, Ivan R.; Dufva, Martin

    2012-01-01

    that simple UV irradiation can be used to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on many different types of plastics without any surface modification. On average, five- and fourfold improvement in immobilization and hybridization efficiency have been achieved compared to surface...... and parallel identification of Avian Influenza Virus by DNA hybridization. The one-step, cost-effective DNA-linking method on non-modified polymers significantly simplifies microarray fabrication procedures and permits great flexibility to plastic material selection, thus making it convenient to integrate...... microarrays into plastic microfluidic systems....

  4. The Evolving Status of Photojournalism Education. ERIC Digest.

    Science.gov (United States)

    Cookman, Claude

    Noting that new technologies are resulting in extensive changes in the field of photojournalism, both as it is practiced and taught, this Digest reviews this rapidly evolving field of education and professional practice. It discusses what digital photography is; the history of digital photography; how digital photography has changed…

  5. Clinical utility of circulating DNA analysis for rapid detection of actionable mutations to select metastatic colorectal patients for anti-EGFR treatment.

    Science.gov (United States)

    Thierry, A R; El Messaoudi, S; Mollevi, C; Raoul, J L; Guimbaud, R; Pezet, D; Artru, P; Assenat, E; Borg, C; Mathonnet, M; De La Fouchardière, C; Bouché, O; Gavoille, C; Fiess, C; Auzemery, B; Meddeb, R; Lopez-Crapez, E; Sanchez, C; Pastor, B; Ychou, M

    2017-09-01

    While tumor-tissue remains the 'gold standard' for genetic analysis in cancer patients, it is challenged with the advent of circulating cell-free tumor DNA (ctDNA) analysis from blood samples. Here, we broaden our previous study on the clinical validation of plasma DNA in metastatic colorectal cancer patients, by evaluating its clinical utility under standard management care. Concordance and data turnaround-time of ctDNA when compared with tumor-tissue analysis were studied in a real-time blinded prospective multicenter clinical study (n = 140 metastatic colorectal patients). Results are presented according to STARD criteria and were discussed in regard with clinical outcomes of patients. Much more mutations were found by ctDNA analysis: 59%, 11.8% and 14.4% of the patients were found KRAS, NRAS and BRAF mutant by ctDNA analysis instead of 44%, 8.8% and 7.2% by tumor-tissue analysis. Median tumor-tissue data turnaround-time was 16 days while 2 days for ctDNA analysis. Discordant samples analysis revealed that use of biopsy, long delay between tumor-tissue and blood collection and resection of the tumor at time of blood draw, tumor site, or type of tissue analyzed seem to affect concordance. Altogether, the clinical data with respect to the anti-epidermal growth factor receptor response (RAS status) and the prognosis (BRAF status) of those discordant patients do not appear contradictory to the mutational status as determined by plasma analysis. Lastly, we present the first distribution profile of the RAS and BRAF hotspot mutations as determined by ctDNA analysis (n = 119), revealing a high proportion of patients with multiple mutations (45% of the population and up to 5 mutations) and only 24% of WT scored patients for both genes. Mutation profile as determined from ctDNA analysis with using various detection thresholds highlights the importance of the test sensitivity. Our study showed that ctDNA could replace tumor-tissue analysis, and also clinical

  6. One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

    Science.gov (United States)

    Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

    2013-01-02

    Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

  7. Rapid decrease of circulating tumor DNA predicted the treatment effect of nivolumab in a lung cancer patient within only 5 days

    Directory of Open Access Journals (Sweden)

    Yuki Iijima

    2017-01-01

    Full Text Available A 77-year-old Japanese man presented to our hospital with a 1-month history of low back pain and was diagnosed as having stage IV EGFR mutation-positive lung adenocarcinoma. After treatment with EGFR tyrosine kinase inhibitor and cytotoxic chemotherapy, nivolumab was started as fourth-line therapy. Remarkable regression of the primary tumor was observed, suggesting high anti-tumor activity of nivolumab. We retrospectively investigated the change in circulating tumor DNA (ctDNA variant allele fractions in serial plasma samples before and after the nivolumab therapy. Targeted sequencing analysis showed tumor-derived TP53R249S and EGFRL858R mutations detectable in plasma, and the timing of decrease was only 5 days, much earlier than the appearance of radiological changes. Overall, these results suggest that ctDNA might reflect tumor burden and might be a surrogate marker of the therapeutic efficacy of immune checkpoint therapy.

  8. The Evolving Resource Metadata Infrastructure

    Science.gov (United States)

    Biemesderfer, Chris

    The search and discovery mechanisms that will facilitate and simplify systematic research on the Internet depend on systematic classifications of resources, as well as on standardized access to such metadata. The principles and technologies that will make this possible are evolving in the work of the Internet Engineering Task Force and the digital library initiatives, among others. The desired outcome is a set of standards, tools, and practices that permits both cataloging and retrieval to be comprehensive and efficient.

  9. Methylation of DNA in cancer.

    Science.gov (United States)

    Watanabe, Yoshihisa; Maekawa, Masato

    2010-01-01

    Epigenetic mechanisms are essential for normal development and maintenance of tissue-specific gene expression patterns in mammals. Disruption of epigenetic processes can lead to altered gene function and malignant cellular transformation. Global changes in the epigenetic landscape are a hallmark of cancer. Methylation of cytosine bases in DNA provides a layer of epigenetic control in many eukaryotes that has important implications for normal biology and disease. DNA methylation is a crucial epigenetic modification of the genome that is involved in regulating many cellular processes. These include embryonic development, transcription, chromatin structure, X-chromosome inactivation, genomic imprinting, and chromosome stability. Consistent with these important roles, a growing number of human diseases including cancer have been found to be associated with aberrant DNA methylation. Recent advancements in the rapidly evolving field of cancer epigenetics have described extensive reprogramming of every component of the epigenetic machinery in cancer, such as DNA demethylation. Hypomethylation of the genome largely affects the intergenic and intronic regions of the DNA, particularly repeat sequences and transposable elements, and it is believed to result in chromosomal instability and increased mutation events. Therefore, we propose that R/G-chromosome band boundaries, which correspond with the early/late-switch regions of replication timing and a transition in relative GC content, correspond to "unstable" genomic regions in which concentrated occurrences of repetitive sequences and transposable elements including LINE and Alu elements are hypomethylated during tumorigenesis. In this review, we discuss the current understanding of alterations in DNA methylation composing the epigenetic landscape that occurs in cancer compared with normal cells, the roles of these changes in cancer initiation and progression, and the potential use of this knowledge in designing more

  10. Application of subtracted gDNA microarray-assisted Bulked Segregant Analysis for rapid discovery of molecular markers associated with day-neutrality in strawberry (Fragaria x ananassa)

    Science.gov (United States)

    Gor, Mian Chee; Mantri, Nitin; Pang, Edwin

    2016-01-01

    A Fragaria Discovery Panel (FDP; strawberry-specific SDA) containing 287 features was constructed by subtracting the pooled gDNA of nine non-angiosperm species from the pooled gDNA of five strawberry genotypes. This FDP was used for Bulk Segregant Analysis (BSA) to enable identification of molecular markers associated with day-neutrality. Analysis of hybridisation patterns of a short day (SD) DNA bulk and three day-neutral (DN) DNA bulks varying in flowering strength allowed identification of a novel feature, FaP2E11, closely linked to CYTOKININ OXIDASE 1 (CKX1) gene possibly involved in promoting flowering under non-inductive condition. The signal intensities of FaP2E11 feature obtained from the strong DN bulk (DN1) is three fold higher than the short day bulk (SD), indicating that the putative marker may linked to a CKX1 variant allele with lower enzyme activity. We propose a model for flowering regulation based on the hypothesis that flowering strength may be regulated by the copy number of FaP2E11-linked CKX1 alleles. This study demonstrates the feasibility of the SDA-based BSA approach for the identification of molecular markers associated with day-neutrality in strawberry. This innovative strategy is an efficient and cost-effective approach for molecular marker discovery. PMID:27586242

  11. A Simple Oligonucleotide Biochip Capable of Rapidly Detecting Known Mitochondrial DNA Mutations in Chinese Patients with Leber’S Hereditary Optic Neuropathy (LHON)

    Science.gov (United States)

    Du, Wei-Dong; Chen, Gang; Cao, Hui-Min; Jin, Qing-Hui; Liao, Rong-Feng; He, Xiang-Cheng; Chen, Da-Ben; Huang, Shu-Ren; Zhao, Hui; Lv, Yong-Mei; Tang, Hua-Yang; Tang, Xian-Fa; Wang, Yong-Qing; Sun, Song; Zhao, Jian-Long; Zhang, Xue-Jun

    2011-01-01

    Leber's hereditary optic neuropathy (LHON) is a maternally transmitted disease. Clinically, no efficient assay protocols have been available. In this study, we aimed to develop an oligonucleotide biochip specialized for detection of known base substitution mutations in mitochondrial DNA causing LHON and to investigate frequencies of LHON relevant variants in Anhui region of China. Thirty-two pairs of oligonucleotide probes matched with the mutations potentially linked to LHON were covalently immobilized. Cy5-lablled targets were amplified from blood DNA samples by a multiplex PCR method. Two kinds of primary mutations 11778 G > A and 14484 T > C from six confirmed LHON patients were interrogated to validate this biochip format. Further, fourteen Chinese LHON pedigrees and twenty-five unrelated healthy individuals were investigated by the LHON biochip, direct sequencing and pyrosequencing, respectively. The biochip was found to be able efficiently to discriminate homoplasmic and heteroplasmic mtDNA mutations in LHON. Biochip analysis revealed that twelve of eighteen LHON symptomatic cases from the 14 Chinese pedigree harbored the mutations either 11778G > A, 14484T > C or 3460G > A, respectively, accounting for 66.7%. The mutation 11778G > A in these patients was homoplasmic and prevalent (55.5%, 10 of 18 cases). The mutations 3460G > A and 3394T > C were found to co-exist in one LHON case. The mutation 13708G > A appeared in one LHON pedigree. Smaller amount of sampling and reaction volume, easier target preparation, fast and high-throughput were the main advantages of the biochip over direct DNA sequencing and pyrosequencing. Our findings suggested that primary mutations of 11778G > A, 14484T > C or 3460G > A are main variants of mtDNA gene leading to LHON in China. The biochip would easily be implemented in clinical diagnosis. PMID:21694444

  12. A simple oligonucleotide biochip capable of rapidly detecting known mitochondrial DNA mutations in Chinese patients with Leber's hereditary optic neuropathy (LHON).

    Science.gov (United States)

    Du, Wei-Dong; Chen, Gang; Cao, Hui-Min; Jin, Qing-Hui; Liao, Rong-Feng; He, Xiang-Cheng; Chen, Da-Ben; Huang, Shu-Ren; Zhao, Hui; Lv, Yong-Mei; Tang, Hua-Yang; Tang, Xian-Fa; Wang, Yong-Qing; Sun, Song; Zhao, Jian-Long; Zhang, Xue-Jun

    2011-01-01

    Leber's hereditary optic neuropathy (LHON) is a maternally transmitted disease. Clinically, no efficient assay protocols have been available. In this study, we aimed to develop an oligonucleotide biochip specialized for detection of known base substitution mutations in mitochondrial DNA causing LHON and to investigate frequencies of LHON relevant variants in Anhui region of China. Thirty-two pairs of oligonucleotide probes matched with the mutations potentially linked to LHON were covalently immobilized. Cy5-lablled targets were amplified from blood DNA samples by a multiplex PCR method. Two kinds of primary mutations 11778 G > A and 14484 T > C from six confirmed LHON patients were interrogated to validate this biochip format. Further, fourteen Chinese LHON pedigrees and twenty-five unrelated healthy individuals were investigated by the LHON biochip, direct sequencing and pyrosequencing, respectively. The biochip was found to be able efficiently to discriminate homoplasmic and heteroplasmic mtDNA mutations in LHON. Biochip analysis revealed that twelve of eighteen LHON symptomatic cases from the 14 Chinese pedigree harbored the mutations either 11778G > A, 14484T > C or 3460G A, respectively, accounting for 66.7%. The mutation 11778G > A in these patients was homoplasmic and prevalent (55.5%, 10 of 18 cases). The mutations 3460G > A and 3394T > C were found to co-exist in one LHON case. The mutation 13708G > A appeared in one LHON pedigree. Smaller amount of sampling and reaction volume, easier target preparation, fast and high-throughput were the main advantages of the biochip over direct DNA sequencing and pyrosequencing. Our findings suggested that primary mutations of 11778G > A, 14484T > C or 3460G > A are main variants of mtDNA gene leading to LHON in China. The biochip would easily be implemented in clinical diagnosis.

  13. A Simple Oligonucleotide Biochip Capable of Rapidly Detecting Known Mitochondrial DNA Mutations in Chinese Patients with Leber’S Hereditary Optic Neuropathy (LHON

    Directory of Open Access Journals (Sweden)

    Wei-Dong Du

    2011-01-01

    Full Text Available Leber's hereditary optic neuropathy (LHON is a maternally transmitted disease. Clinically, no efficient assay protocols have been available. In this study, we aimed to develop an oligonucleotide biochip specialized for detection of known base substitution mutations in mitochondrial DNA causing LHON and to investigate frequencies of LHON relevant variants in Anhui region of China. Thirty-two pairs of oligonucleotide probes matched with the mutations potentially linked to LHON were covalently immobilized. Cy5-lablled targets were amplified from blood DNA samples by a multiplex PCR method. Two kinds of primary mutations 11778 G > A and 14484 T > C from six confirmed LHON patients were interrogated to validate this biochip format. Further, fourteen Chinese LHON pedigrees and twenty-five unrelated healthy individuals were investigated by the LHON biochip, direct sequencing and pyrosequencing, respectively. The biochip was found to be able efficiently to discriminate homoplasmic and heteroplasmic mtDNA mutations in LHON. Biochip analysis revealed that twelve of eighteen LHON symptomatic cases from the 14 Chinese pedigree harbored the mutations either 11778G > A, 14484T > C or 3460G > A, respectively, accounting for 66.7%. The mutation 11778G > A in these patients was homoplasmic and prevalent (55.5%, 10 of 18 cases. The mutations 3460G > A and 3394T > C were found to co-exist in one LHON case. The mutation 13708G > A appeared in one LHON pedigree. Smaller amount of sampling and reaction volume, easier target preparation, fast and high-throughput were the main advantages of the biochip over direct DNA sequencing and pyrosequencing. Our findings suggested that primary mutations of 11778G > A, 14484T > C or 3460G > A are main variants of mtDNA gene leading to LHON in China. The biochip would easily be implemented in clinical diagnosis.

  14. Rapid and Simultaneous Detection of Mycobacterium tuberculosis Complex and Beijing/W Genotype in Sputum by an Optimized DNA Extraction Protocol and a Novel Multiplex Real-Time PCR ▿

    Science.gov (United States)

    Leung, Eric T. Y.; Zheng, L.; Wong, Rity Y. K.; Chan, Edward W. C.; Au, T. K.; Chan, Raphael C. Y.; Lui, Grace; Lee, Nelson; Ip, Margaret

    2011-01-01

    Rapid diagnosis and genotyping of Mycobacterium tuberculosis by molecular methods are often limited by the amount and purity of DNA extracted from body fluids. In this study, we evaluated 12 DNA extraction methods and developed a highly sensitive protocol for mycobacterial DNA extraction directly from sputa using surface-coated magnetic particles. We have also developed a novel multiplex real-time PCR for simultaneous identification of M. tuberculosis complex and the Beijing/W genotype (a hypervirulent sublineage of M. tuberculosis) by using multiple fluorogenic probes targeting both the M. tuberculosis IS6110 and the Rv0927c-pstS3 intergenic region. With reference strains and clinical isolates, our real-time PCR accurately identified 20 non-Beijing/W and 20 Beijing/W M. tuberculosis strains from 17 different species of nontuberculosis Mycobacterium (NTM). Further assessment of our DNA extraction protocol and real-time PCR with 335 nonduplicate sputum specimens correctly identified all 74 M. tuberculosis culture-positive specimens. In addition, 15 culture-negative specimens from patients with confirmed tuberculosis were also identified. No cross-reactivity was detected with NTM specimens (n = 31). The detection limit of the assay is 10 M. tuberculosis bacilli, as determined by endpoint dilution analysis. In conclusion, an optimized DNA extraction protocol coupled with a novel multiprobe multiplex real-time PCR for the direct detection of M. tuberculosis, including Beijing/W M. tuberculosis, was found to confer high sensitivity and specificity. The combined procedure has the potential to compensate for the drawbacks of conventional mycobacterial culture in routine clinical laboratory setting, such as the lengthy incubation period and the limitation to viable organisms. PMID:21593264

  15. The evolvability of programmable hardware

    Science.gov (United States)

    Raman, Karthik; Wagner, Andreas

    2011-01-01

    In biological systems, individual phenotypes are typically adopted by multiple genotypes. Examples include protein structure phenotypes, where each structure can be adopted by a myriad individual amino acid sequence genotypes. These genotypes form vast connected ‘neutral networks’ in genotype space. The size of such neutral networks endows biological systems not only with robustness to genetic change, but also with the ability to evolve a vast number of novel phenotypes that occur near any one neutral network. Whether technological systems can be designed to have similar properties is poorly understood. Here we ask this question for a class of programmable electronic circuits that compute digital logic functions. The functional flexibility of such circuits is important in many applications, including applications of evolutionary principles to circuit design. The functions they compute are at the heart of all digital computation. We explore a vast space of 1045 logic circuits (‘genotypes’) and 1019 logic functions (‘phenotypes’). We demonstrate that circuits that compute the same logic function are connected in large neutral networks that span circuit space. Their robustness or fault-tolerance varies very widely. The vicinity of each neutral network contains circuits with a broad range of novel functions. Two circuits computing different functions can usually be converted into one another via few changes in their architecture. These observations show that properties important for the evolvability of biological systems exist in a commercially important class of electronic circuitry. They also point to generic ways to generate fault-tolerant, adaptable and evolvable electronic circuitry. PMID:20534598

  16. The 'E' factor -- evolving endodontics.

    Science.gov (United States)

    Hunter, M J

    2013-03-01

    Endodontics is a constantly developing field, with new instruments, preparation techniques and sealants competing with trusted and traditional approaches to tooth restoration. Thus general dental practitioners must question and understand the significance of these developments before adopting new practices. In view of this, the aim of this article, and the associated presentation at the 2013 British Dental Conference & Exhibition, is to provide an overview of endodontic methods and constantly evolving best practice. The presentation will review current preparation techniques, comparing rotary versus reciprocation, and question current trends in restoration of the endodontically treated tooth.

  17. Rapid, sensitive, and selective fluorescent DNA detection using iron-based metal-organic framework nanorods: Synergies of the metal center and organic linker.

    Science.gov (United States)

    Tian, Jingqi; Liu, Qian; Shi, Jinle; Hu, Jianming; Asiri, Abdullah M; Sun, Xuping; He, Yuquan

    2015-09-15

    Considerable recent attention has been paid to homogeneous fluorescent DNA detection with the use of nanostructures as a universal "quencher", but it still remains a great challenge to develop such nanosensor with the benefits of low cost, high speed, sensitivity, and selectivity. In this work, we report the use of iron-based metal-organic framework nanorods as a high-efficient sensing platform for fluorescent DNA detection. It only takes about 4 min to complete the whole "mix-and-detect" process with a low detection limit of 10 pM and a strong discrimination of single point mutation. Control experiments reveal the remarkable sensing behavior is a consequence of the synergies of the metal center and organic linker. This work elucidates how composition control of nanostructures can significantly impact their sensing properties, enabling new opportunities for the rational design of functional materials for analytical applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene

    DEFF Research Database (Denmark)

    Candiloro, Ida Lm; Mikeska, Thomas; Hokland, Peter

    2008-01-01

    MS-HRM) that involves the amplification of single templates after limiting dilution to quantify and to determine the degree of methylation. We used this approach to study methylation of the CDKN2B (p15) cell cycle progression inhibitor gene which is inactivated by DNA methylation in haematological malignancies...... and other heterogeneously methylated genes. It eliminates both PCR and cloning bias towards either methylated or unmethylated DNA. Potentially complex information is simplified into a digital output, allowing counting of methylated and unmethylated alleles and providing an overall picture of methylation...... at the given locus. Downstream sequencing is minimised as dMS-HRM acts as a screen to select only methylated clones for further analysis....

  19. Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

    Science.gov (United States)

    Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

    2015-12-01

    Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

  20. Multiplex PCR provides a low-cost alternative to DNA probe methods for rapid identification of Mycobacterium avium and Mycobacterium intracellulare.

    OpenAIRE

    Cousins, D; Francis, B; Dawson, D

    1996-01-01

    A multiplex PCR designed to differentiate Mycobacterium tuberculosis complex organisms from M. avium and M. intracellulare was used to test 105 isolates identified by DNA probe methods as M. avium, M. intracellulare, or M. avium complex type X. The multiple PCR correctly identified 33 of 34 isolates identified by commercial probe methods as M. avium and all 51 isolates identified as M. intracellulare. The 20 isolates identified as M. avium complex type X by probe were identified as Mycobacter...

  1. Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

    Directory of Open Access Journals (Sweden)

    Decai Tuo

    2015-12-01

    Full Text Available Papaya leaf distortion mosaic virus (PLDMV is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV. The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA, was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

  2. Rapid assessment of repair of ultraviolet DNA damage with a modified host-cell reactivation assay using a luciferase reporter gene and correlation with polymorphisms of DNA repair genes in normal human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Qiao Yawei; Spitz, Margaret R.; Guo Zhaozheng; Hadeyati, Mohammad; Grossman, Lawrence; Kraemer, Kenneth H.; Wei Qingyi

    2002-11-30

    As DNA repair plays an important role in genetic susceptibility to cancer, assessment of the DNA repair phenotype is critical for molecular epidemiological studies of cancer. In this report, we compared use of the luciferase (luc) reporter gene in a host-cell reactivation (HCR) (LUC) assay of repair of ultraviolet (UV) damage to DNA to use of the chloramphenicol (cat) gene-based HCR (CAT) assay we used previously for case-control studies. We performed both the assays on cryopreserved lymphocytes from 102 healthy non-Hispanic white subjects. There was a close correlation between DNA repair capacity (DRC) as measured by the LUC and CAT assays. Although these two assays had similar variation, the LUC assay was faster and more sensitive. We also analyzed the relationship between DRC and the subjects' previously determined genotypes for four polymorphisms of two nucleotide-excision repair (NER) genes (in intron 9 of xeroderma pigmentosum (XP) C and exons 6, 10 and 23 of XPD) and one polymorphism of a base-excision repair gene in exon 10 of X-ray complementing group 1 (XRCC1). The DRC was significantly lower in subjects homozygous for one or more polymorphisms of the two NER genes than in subjects with other genotypes (P=0.010). In contrast, the polymorphic XRCC1 allele had no significant effect on DRC. These results suggest that the post-UV LUC assay measures NER phenotype and that polymorphisms of XPC and XPD genes modulate DRC. For population studies of the DNA repair phenotype, many samples need to be evaluated, and so the LUC assay has several advantages over the CAT assay: the LUC assay was more sensitive, had less variation, was not radioactive, was easier to perform, and required fewer cryopreserved cells. These features make the LUC-based HCR assay suitable for molecular epidemiological studies.

  3. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  4. No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation

    Directory of Open Access Journals (Sweden)

    Hellberg Michael E

    2006-03-01

    Full Text Available Abstract Background The mitochondrial DNA (mtDNA of most animals evolves more rapidly than nuclear DNA, and often shows higher levels of intraspecific polymorphism and population subdivision. The mtDNA of anthozoans (corals, sea fans, and their kin, by contrast, appears to evolve slowly. Slow mtDNA evolution has been reported for several anthozoans, however this slow pace has been difficult to put in phylogenetic context without parallel surveys of nuclear variation or calibrated rates of synonymous substitution that could permit quantitative rate comparisons across taxa. Here, I survey variation in the coding region of a mitochondrial gene from a coral species (Balanophyllia elegans known to possess high levels of nuclear gene variation, and estimate synonymous rates of mtDNA substitution by comparison to another coral (Tubastrea coccinea. Results The mtDNA surveyed (630 bp of cytochrome oxidase subunit I was invariant among individuals sampled from 18 populations spanning 3000 km of the range of B. elegans, despite high levels of variation and population subdivision for allozymes over these same populations. The synonymous substitution rate between B. elegans and T. coccinea (0.05%/site/106 years is similar to that in most plants, but 50–100 times lower than rates typical for most animals. In addition, while substitutions to mtDNA in most animals exhibit a strong bias toward transitions, mtDNA from these corals does not. Conclusion Slow rates of mitochondrial nucleotide substitution result in low levels of intraspecific mtDNA variation in corals, even when nuclear loci vary. Slow mtDNA evolution appears to be the basal condition among eukaryotes. mtDNA substitution rates switch from slow to fast abruptly and unidirectionally. This switch may stem from the loss of just one or a few mitochondrion-specific DNA repair or replication genes.

  5. Development of novel vaccines using DNA shuffling and screening strategies.

    Science.gov (United States)

    Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha

    2004-02-01

    DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.

  6. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  7. Rapid isolation of microsatellite DNAs and identification of polymorphic mitochondrial DNA regions in the fish rotan (Perccottus glenii) invading European Russia

    Science.gov (United States)

    King, Timothy L.; Eackles, Michael S.; Reshetnikov, Andrey N.

    2015-01-01

    Human-mediated translocations and subsequent large-scale colonization by the invasive fish rotan (Perccottus glenii Dybowski, 1877; Perciformes, Odontobutidae), also known as Amur or Chinese sleeper, has resulted in dramatic transformations of small lentic ecosystems. However, no detailed genetic information exists on population structure, levels of effective movement, or relatedness among geographic populations of P. glenii within the European part of the range. We used massively parallel genomic DNA shotgun sequencing on the semiconductor-based Ion Torrent Personal Genome Machine (PGM) sequencing platform to identify nuclear microsatellite and mitochondrial DNA sequences in P. glenii from European Russia. Here we describe the characterization of nine nuclear microsatellite loci, ascertain levels of allelic diversity, heterozygosity, and demographic status of P. glenii collected from Ilev, Russia, one of several initial introduction points in European Russia. In addition, we mapped sequence reads to the complete P. glenii mitochondrial DNA sequence to identify polymorphic regions. Nuclear microsatellite markers developed for P. glenii yielded sufficient genetic diversity to: (1) produce unique multilocus genotypes; (2) elucidate structure among geographic populations; and (3) provide unique perspectives for analysis of population sizes and historical demographics. Among 4.9 million filtered P. glenii Ion Torrent PGM sequence reads, 11,304 mapped to the mitochondrial genome (NC_020350). This resulted in 100 % coverage of this genome to a mean coverage depth of 102X. A total of 130 variable sites were observed between the publicly available genome from China and the studied composite mitochondrial genome. Among these, 82 were diagnostic and monomorphic between the mitochondrial genomes and distributed among 15 genome regions. The polymorphic sites (N = 48) were distributed among 11 mitochondrial genome regions. Our results also indicate that sequence reads generated

  8. Primordial evolvability: Impasses and challenges.

    Science.gov (United States)

    Vasas, Vera; Fernando, Chrisantha; Szilágyi, András; Zachár, István; Santos, Mauro; Szathmáry, Eörs

    2015-09-21

    While it is generally agreed that some kind of replicating non-living compounds were the precursors of life, there is much debate over their possible chemical nature. Metabolism-first approaches propose that mutually catalytic sets of simple organic molecules could be capable of self-replication and rudimentary chemical evolution. In particular, the graded autocatalysis replication domain (GARD) model, depicting assemblies of amphiphilic molecules, has received considerable interest. The system propagates compositional information across generations and is suggested to be a target of natural selection. However, evolutionary simulations indicate that the system lacks selectability (i.e. selection has negligible effect on the equilibrium concentrations). We elaborate on the lessons learnt from the example of the GARD model and, more widely, on the issue of evolvability, and discuss the implications for similar metabolism-first scenarios. We found that simple incorporation-type chemistry based on non-covalent bonds, as assumed in GARD, is unlikely to result in alternative autocatalytic cycles when catalytic interactions are randomly distributed. An even more serious problem stems from the lognormal distribution of catalytic factors, causing inherent kinetic instability of such loops, due to the dominance of efficiently catalyzed components that fail to return catalytic aid. Accordingly, the dynamics of the GARD model is dominated by strongly catalytic, but not auto-catalytic, molecules. Without effective autocatalysis, stable hereditary propagation is not possible. Many repetitions and different scaling of the model come to no rescue. Despite all attempts to show the contrary, the GARD model is not evolvable, in contrast to reflexively autocatalytic networks, complemented by rare uncatalyzed reactions and compartmentation. The latter networks, resting on the creation and breakage of chemical bonds, can generate novel ('mutant') autocatalytic loops from a given set of

  9. Peripartum hysterectomy: an evolving picture.

    LENUS (Irish Health Repository)

    Turner, Michael J

    2012-02-01

    Peripartum hysterectomy (PH) is one of the obstetric catastrophes. Evidence is emerging that the role of PH in modern obstetrics is evolving. Improving management of postpartum hemorrhage and newer surgical techniques should decrease PH for uterine atony. Rising levels of repeat elective cesarean deliveries should decrease PH following uterine scar rupture in labor. Increasing cesarean rates, however, have led to an increase in the number of PHs for morbidly adherent placenta. In the case of uterine atony or rupture where PH is required, a subtotal PH is often sufficient. In the case of pathological placental localization involving the cervix, however, a total hysterectomy is required. Furthermore, the involvement of other pelvic structures may prospectively make the diagnosis difficult and the surgery challenging. If resources permit, PH for pathological placental localization merits a multidisciplinary approach. Despite advances in clinical practice, it is likely that peripartum hysterectomy will be more challenging for obstetricians in the future.

  10. ex vivo DNA assembly

    Directory of Open Access Journals (Sweden)

    Adam B Fisher

    2013-10-01

    Full Text Available Even with decreasing DNA synthesis costs there remains a need for inexpensive, rapid and reliable methods for assembling synthetic DNA into larger constructs or combinatorial libraries. Advances in cloning techniques have resulted in powerful in vitro and in vivo assembly of DNA. However, monetary and time costs have limited these approaches. Here, we report an ex vivo DNA assembly method that uses cellular lysates derived from a commonly used laboratory strain of Escherichia coli for joining double-stranded DNA with short end homologies embedded within inexpensive primers. This method concurrently shortens the time and decreases costs associated with current DNA assembly methods.

  11. Extreme evolved solar systems (EESS)

    Science.gov (United States)

    Gaensicke, Boris

    2017-08-01

    In just 20 years, we went from not knowing if the solar system is a fluke of Nature to realising that it is totally normal for stars to have planets. More remarkably, it is now clear that planet formation is a robust process, as rich multi-planet systems are found around stars more massive and less massive than the Sun. More recently, planetary systems have been identified in increasingly complex architectures, including circumbinary planets, wide binaries with planets orbiting one or both stellar components, and planets in triple stellar systems.We have also learned that many planetary systems will survive the evolution of their host stars into the white dwarf phase. Small bodies are scattered by unseen planets into the gravitational field of the white dwarfs, tidally disrupt, form dust discs, and eventually accrete onto the white dwarf, where they can be spectroscopically detected. HST/COS has played a critical role in the study these evolved planetary systems, demonstrating that overall the bulk composition of the debris is rocky and resembles in composition the inner the solar system, including evidence for water-rich planetesimals. Past observations of planetary systems at white dwarfs have focused on single stars with main-sequence progenitors of 1.5 to 2.5Msun. Here we propose to take the study of evolved planetary systems into the extremes of parameter ranges to answer questions such as: * How efficient is planet formation around 4-10Msun stars? * What are the metallicities of the progenitors of debris-accreting white dwarfs?* What is the fate of circumbinary planets?* Can star-planet interactions generate magnetic fields in the white dwarf host?

  12. Application of a Novel and Automated Branched DNA in Situ Hybridization Method for the Rapid and Sensitive Localization of mRNA Molecules in Plant Tissues

    Directory of Open Access Journals (Sweden)

    Andrew J. Bowling

    2014-04-01

    Full Text Available Premise of the study: A novel branched DNA detection technology, RNAscope in situ hybridization (ISH, originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. Methods and Results: Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC and phosphoenolpyruvate carboxykinase (PEPCK. Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. Conclusions: RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.

  13. Application of a novel and automated branched DNA in situ hybridization method for the rapid and sensitive localization of mRNA molecules in plant tissues.

    Science.gov (United States)

    Bowling, Andrew J; Pence, Heather E; Church, Jeffrey B

    2014-04-01

    A novel branched DNA detection technology, RNAscope in situ hybridization (ISH), originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. • Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE) and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC) and phosphoenolpyruvate carboxykinase (PEPCK). Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. • RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.

  14. The comet assay as a rapid test in biomonitoring occupational exposure to DNA-damaging agents and effect of confounding factors

    DEFF Research Database (Denmark)

    Møller, P; Knudsen, Lisbeth E.; Loft, S

    2000-01-01

    Within the last decade, the comet assay has been used with increasing popularity to investigate the level of DNA damage in terms of strand breaks and alkaline labile sites in biomonitoring studies. The assay is easily performed on WBCs and has been included in a wide range of biomonitoring studies...... appeared to have less power than the positive studies. Also, there were poor dose-response relationships in many of the biomonitoring studies. Many factors have been reported to produce effects by the comet assay, e.g., age, air pollution exposure, diet, exercise, gender, infection, residential radon...... exposure, smoking, and season. Until now, the use of the comet assay has been hampered by the uncertainty of the influence of confounding factors. We argue that none of the confounding factors are unequivocally positive in the majority of the studies. We recommend that age, gender, and smoking status...

  15. Sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2, and 28S rDNA) of Demodex and phylogenetic analysis of Acari based on 18S and 28S rDNA.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping; Hu, Li; Xu, Yang; Wang, Zheng-Hang; Liu, Wen-Yan

    2012-11-01

    Due to the difficulty of DNA extraction for Demodex, few studies dealt with the identification and the phyletic evolution of Demodex at molecular level. In this study, we amplified, sequenced, and analyzed a complete (Demodex folliculorum) and an almost complete (D12 missing) (Demodex brevis) ribosomal DNA (rDNA) sequence and also analyzed the primary sequences of divergent domains in small-subunit ribosomal RNA (rRNA) of 51 species and in large-subunit rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea, and Ixodoidea). The results revealed that 18S rDNA sequence was relatively conserved in rDNA-coding regions and was not evolving as rapidly as 28S rDNA sequence. The evolutionary rates of transcribed spacer regions were much higher than those of the coding regions. The maximum parsimony trees of 18S and 28S rDNA appeared to be almost identical, consistent with their morphological classification. Based on the fact that the resolution capability of sequence length and the divergence of the 13 segments (D1-D6, D7a, D7b, and D8-D12) of 28S rDNA were stronger than that of the nine variable regions (V1-V9) of 18S rDNA, we were able to identify Demodex (Cheyletoidea) by the indels occurring in D2, D6, and D8.

  16. Orbital Decay in Binaries with Evolved Stars

    Science.gov (United States)

    Sun, Meng; Arras, Phil; Weinberg, Nevin N.; Troup, Nicholas; Majewski, Steven R.

    2018-01-01

    Two mechanisms are often invoked to explain tidal friction in binary systems. The ``dynamical tide” is the resonant excitation of internal gravity waves by the tide, and their subsequent damping by nonlinear fluid processes or thermal diffusion. The ``equilibrium tide” refers to non-resonant excitation of fluid motion in the star’s convection zone, with damping by interaction with the turbulent eddies. There have been numerous studies of these processes in main sequence stars, but less so on the subgiant and red giant branches. Motivated by the newly discovered close binary systems in the Apache Point Observatory Galactic Evolution Experiment (APOGEE-1), we have performed calculations of both the dynamical and equilibrium tide processes for stars over a range of mass as the star’s cease core hydrogen burning and evolve to shell burning. Even for stars which had a radiative core on the main sequence, the dynamical tide may have very large amplitude in the newly radiative core in post-main sequence, giving rise to wave breaking. The resulting large dynamical tide dissipation rate is compared to the equilibrium tide, and the range of secondary masses and orbital periods over which rapid orbital decay may occur will be discussed, as well as applications to close APOGEE binaries.

  17. CERN internal communication is evolving

    CERN Multimedia

    2016-01-01

    CERN news will now be regularly updated on the CERN People page (see here).      Dear readers, All over the world, communication is becoming increasingly instantaneous, with news published in real time on websites and social networks. In order to keep pace with these changes, CERN's internal communication is evolving too. From now on, you will be informed of what’s happening at CERN more often via the “CERN people” page, which will frequently be updated with news. The Bulletin is following this trend too: twice a month, we will compile the most important articles published on the CERN site, with a brand-new layout. You will receive an e-mail every two weeks as soon as this new form of the Bulletin is available. If you have interesting news or stories to share, tell us about them through the form at: https://communications.web.cern.ch/got-story-cern-website​. You can also find out about news from CERN in real time...

  18. A streamlined collecting and preparation protocol for DNA barcoding of Lepidoptera as part of large-scale rapid biodiversity assessment projects, exemplified by the Indonesian Biodiversity Discovery and Information System (IndoBioSys).

    Science.gov (United States)

    Schmidt, Olga; Hausmann, Axel; Cancian de Araujo, Bruno; Sutrisno, Hari; Peggie, Djunijanti; Schmidt, Stefan

    2017-01-01

    Here we present a general collecting and preparation protocol for DNA barcoding of Lepidoptera as part of large-scale rapid biodiversity assessment projects, and a comparison with alternative preserving and vouchering methods. About 98% of the sequenced specimens processed using the present collecting and preparation protocol yielded sequences with more than 500 base pairs. The study is based on the first outcomes of the Indonesian Biodiversity Discovery and Information System (IndoBioSys). IndoBioSys is a German-Indonesian research project that is conducted by the Museum für Naturkunde in Berlin and the Zoologische Staatssammlung München, in close cooperation with the Research Center for Biology - Indonesian Institute of Sciences (RCB-LIPI, Bogor).

  19. Evidence for genetic association between East Asian and western North American Crataegus L. (Rosaceae) and rapid divergence of the eastern North American lineages based on multiple DNA sequences.

    Science.gov (United States)

    Lo, Eugenia Y Y; Stefanović, Sasa; Christensen, Knud Ib; Dickinson, Timothy A

    2009-05-01

    Phylogeographic relationships were constructed for 72 Old and New World Crataegus species using combinations of four chloroplast and up to five nuclear regions. Maximum parsimony, maximum likelihood, and Bayesian results yield consistent relationships among major lineages. The close associations of the East Asian and western North American species point toward ancient trans-Beringian migrations. Relationships among eastern North American species are poorly resolved and few groups are identified that are congruent with existing classifications. Scant variation and short internal branches among these species suggest rapid divergence associated with polyploidy and hybridization. Incongruence between the chloroplast and nuclear data, and morphology suggest hybrid origins of three species from an extinct European lineage (the male parent) and three different North American female parents. Europe and eastern North America are suggested as the most recent common areas for Crataegus; at least four dispersal events are inferred to explain the present distribution of the genus.

  20. Mechanisms of Action of Escapin, a Bactericidal Agent in the Ink Secretion of the Sea Hare Aplysia californica: Rapid and Long-Lasting DNA Condensation and Involvement of the OxyR-Regulated Oxidative Stress Pathway

    Science.gov (United States)

    Ko, Ko-Chun; Tai, Phang C.

    2012-01-01

    The marine snail Aplysia californica produces escapin, an l-amino acid oxidase, in its defensive ink. Escapin uses l-lysine to produce diverse products called escapin intermediate products of l-lysine (EIP-K), including α-amino-ε-caproic acid, Δ1-piperidine-2-carboxylic acid, and Δ2-piperidine-2-carboxylic acid. EIP-K and H2O2 together, but neither alone, is a powerful bactericide. Here, we report bactericidal mechanisms of escapin products on Escherichia coli. We show that EIP-K and H2O2 together cause rapid and long-lasting DNA condensation: 2-min treatment causes significant DNA condensation and killing, and 10-min treatment causes maximal effect, lasting at least 70 h. We isolated two mutants resistant to EIP-K plus H2O2, both having a single missense mutation in the oxidation regulatory gene, oxyR. A complementation assay showed that the mutated gene, oxyR(A233V), renders resistance to EIP-K plus H2O2, and a gene dosage effect leads to reduction of resistance for strains carrying wild-type oxyR. Temperature stress with EIP-K does not produce the bactericidal effect, suggesting the effect is due to a specific response to oxidative stress. The null mutant for any single DNA-binding protein—Dps, H-NS, Hup, Him, or MukB—was not resistant to EIP-K plus H2O2, suggesting that no single DNA-binding protein is necessary to mediate this bactericidal effect, but allowing for the possibility that EIP-K plus H2O2 could function through a combination of DNA-binding proteins. The bactericidal effect of EIP-K plus H2O2 was eliminated by the ferrous ion chelator 1,10-phenanthroline, and it was reduced by the hydroxyl radical scavenger thiourea, suggesting hydroxyl radicals mediate the effects of EIP-K plus H2O2. PMID:22232273

  1. Evaluation of genetic diversity in Chinese kale (Brassica oleracea L. var. alboglabra Bailey) by using rapid amplified polymorphic DNA and sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Zhang, J; Zhang, L G

    2014-02-14

    Chinese kale is an original Chinese vegetable of the Cruciferae family. To select suitable parents for hybrid breeding, we thoroughly analyzed the genetic diversity of Chinese kale. Random amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) molecular markers were used to evaluate the genetic diversity across 21 Chinese kale accessions from AVRDC and Guangzhou in China. A total of 104 bands were detected by 11 RAPD primers, of which 66 (63.5%) were polymorphic, and 229 polymorphic bands (68.4%) were observed in 335 bands amplified by 17 SRAP primer combinations. The dendrogram showed the grouping of the 21 accessions into 4 main clusters based on RAPD data, and into 6 clusters based on SRAP and combined data (RAPD + SRAP). The clustering of accessions based on SRAP data was consistent with petal colors. The Mantel test indicated a poor fit for the RAPD and SRAP data (r = 0.16). These results have an important implication for Chinese kale germplasm characterization and improvement.

  2. Target-responsive DNA hydrogel mediated "stop-flow" microfluidic paper-based analytic device for rapid, portable and visual detection of multiple targets.

    Science.gov (United States)

    Wei, Xiaofeng; Tian, Tian; Jia, Shasha; Zhu, Zhi; Ma, Yanli; Sun, Jianjun; Lin, Zhenyu; Yang, Chaoyong James

    2015-04-21

    A versatile point-of-care assay platform was developed for simultaneous detection of multiple targets based on a microfluidic paper-based analytic device (μPAD) using a target-responsive hydrogel to mediate fluidic flow and signal readout. An aptamer-cross-linked hydrogel was used as a target-responsive flow regulator in the μPAD. In the absence of a target, the hydrogel is formed in the flow channel, stopping the flow in the μPAD and preventing the colored indicator from traveling to the final observation spot, thus yielding a "signal off" readout. In contrast, in the presence of a target, no hydrogel is formed because of the preferential interaction of target and aptamer. This allows free fluidic flow in the μPAD, carrying the indicator to the observation spot and producing a "signal on" readout. The device is inexpensive to fabricate, easy to use, and disposable after detection. Testing results can be obtained within 6 min by the naked eye via a simple loading operation without the need for any auxiliary equipment. Multiple targets, including cocaine, adenosine, and Pb(2+), can be detected simultaneously, even in complex biological matrices such as urine. The reported method offers simple, low cost, rapid, user-friendly, point-of-care testing, which will be useful in many applications.

  3. Evolving fuzzy rules for relaxed-criteria negotiation.

    Science.gov (United States)

    Sim, Kwang Mong

    2008-12-01

    In the literature on automated negotiation, very few negotiation agents are designed with the flexibility to slightly relax their negotiation criteria to reach a consensus more rapidly and with more certainty. Furthermore, these relaxed-criteria negotiation agents were not equipped with the ability to enhance their performance by learning and evolving their relaxed-criteria negotiation rules. The impetus of this work is designing market-driven negotiation agents (MDAs) that not only have the flexibility of relaxing bargaining criteria using fuzzy rules, but can also evolve their structures by learning new relaxed-criteria fuzzy rules to improve their negotiation outcomes as they participate in negotiations in more e-markets. To this end, an evolutionary algorithm for adapting and evolving relaxed-criteria fuzzy rules was developed. Implementing the idea in a testbed, two kinds of experiments for evaluating and comparing EvEMDAs (MDAs with relaxed-criteria rules that are evolved using the evolutionary algorithm) and EMDAs (MDAs with relaxed-criteria rules that are manually constructed) were carried out through stochastic simulations. Empirical results show that: 1) EvEMDAs generally outperformed EMDAs in different types of e-markets and 2) the negotiation outcomes of EvEMDAs generally improved as they negotiated in more e-markets.

  4. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  5. DNA as a Phosphate Storage Polymer and the Alternative Advantages of Polyploidy for Growth or Survival

    Science.gov (United States)

    Zerulla, Karolin; Chimileski, Scott; Näther, Daniela; Gophna, Uri; Papke, R. Thane; Soppa, Jörg

    2014-01-01

    Haloferax volcanii uses extracellular DNA as a source for carbon, nitrogen, and phosphorous. However, it can also grow to a limited extend in the absence of added phosphorous, indicating that it contains an intracellular phosphate storage molecule. As Hfx. volcanii is polyploid, it was investigated whether DNA might be used as storage polymer, in addition to its role as genetic material. It could be verified that during phosphate starvation cells multiply by distributing as well as by degrading their chromosomes. In contrast, the number of ribosomes stayed constant, revealing that ribosomes are distributed to descendant cells, but not degraded. These results suggest that the phosphate of phosphate-containing biomolecules (other than DNA and RNA) originates from that stored in DNA, not in rRNA. Adding phosphate to chromosome depleted cells rapidly restores polyploidy. Quantification of desiccation survival of cells with different ploidy levels showed that under phosphate starvation Hfx. volcanii diminishes genetic advantages of polyploidy in favor of cell multiplication. The consequences of the usage of genomic DNA as phosphate storage polymer are discussed as well as the hypothesis that DNA might have initially evolved in evolution as a storage polymer, and the various genetic benefits evolved later. PMID:24733558

  6. Evolving Deep Networks Using HPC

    Energy Technology Data Exchange (ETDEWEB)

    Young, Steven R. [ORNL, Oak Ridge; Rose, Derek C. [ORNL, Oak Ridge; Johnston, Travis [ORNL, Oak Ridge; Heller, William T. [ORNL, Oak Ridge; Karnowski, thomas P. [ORNL, Oak Ridge; Potok, Thomas E. [ORNL, Oak Ridge; Patton, Robert M. [ORNL, Oak Ridge; Perdue, Gabriel [Fermilab; Miller, Jonathan [Santa Maria U., Valparaiso

    2017-01-01

    While a large number of deep learning networks have been studied and published that produce outstanding results on natural image datasets, these datasets only make up a fraction of those to which deep learning can be applied. These datasets include text data, audio data, and arrays of sensors that have very different characteristics than natural images. As these “best” networks for natural images have been largely discovered through experimentation and cannot be proven optimal on some theoretical basis, there is no reason to believe that they are the optimal network for these drastically different datasets. Hyperparameter search is thus often a very important process when applying deep learning to a new problem. In this work we present an evolutionary approach to searching the possible space of network hyperparameters and construction that can scale to 18, 000 nodes. This approach is applied to datasets of varying types and characteristics where we demonstrate the ability to rapidly find best hyperparameters in order to enable practitioners to quickly iterate between idea and result.

  7. At the forefront: evidence of the applicability of using environmental DNA to quantify the abundance of fish populations in natural lentic waters with additional sampling considerations

    Science.gov (United States)

    Klobucar, Stephen L.; Rodgers, Torrey W.; Budy, Phaedra

    2017-01-01

    Environmental DNA (eDNA) sampling has proven to be a valuable tool for detecting species in aquatic ecosystems. Within this rapidly evolving field, a promising application is the ability to obtain quantitative estimates of relative species abundance based on eDNA concentration rather than traditionally labor-intensive methods. We investigated the relationship between eDNA concentration and Arctic char (Salvelinus alpinus) abundance in five well-studied natural lakes; additionally, we examined the effects of different temporal (e.g., season) and spatial (e.g., depth) scales on eDNA concentration. Concentrations of eDNA were linearly correlated with char population estimates ( = 0.78) and exponentially correlated with char densities ( = 0.96 by area; 0.82 by volume). Across lakes, eDNA concentrations were greater and more homogeneous in the water column during mixis; however, when stratified, eDNA concentrations were greater in the hypolimnion. Overall, our findings demonstrate that eDNA techniques can produce effective estimates of relative fish abundance in natural lakes. These findings can guide future studies to improve and expand eDNA methods while informing research and management using rapid and minimally invasive sampling.

  8. NASA's Space Launch System: An Evolving Capability for Exploration An Evolving Capability for Exploration

    Science.gov (United States)

    Creech, Stephen D.; Crumbly, Christopher M.; Robinson, Kimerly F.

    2016-01-01

    A foundational capability for international human deep-space exploration, NASA's Space Launch System (SLS) vehicle represents a new spaceflight infrastructure asset, creating opportunities for mission profiles and space systems that cannot currently be executed. While the primary purpose of SLS, which is making rapid progress towards initial launch readiness in two years, will be to support NASA's Journey to Mars, discussions are already well underway regarding other potential utilization of the vehicle's unique capabilities. In its initial Block 1 configuration, capable of launching 70 metric tons (t) to low Earth orbit (LEO), SLS is capable of propelling the Orion crew vehicle to cislunar space, while also delivering small CubeSat-class spacecraft to deep-space destinations. With the addition of a more powerful upper stage, the Block 1B configuration of SLS will be able to deliver 105 t to LEO and enable more ambitious human missions into the proving ground of space. This configuration offers opportunities for launching co-manifested payloads with the Orion crew vehicle, and a class of secondary payloads, larger than today's CubeSats. Further upgrades to the vehicle, including advanced boosters, will evolve its performance to 130 t in its Block 2 configuration. Both Block 1B and Block 2 also offer the capability to carry 8.4- or 10-m payload fairings, larger than any contemporary launch vehicle. With unmatched mass-lift capability, payload volume, and C3, SLS not only enables spacecraft or mission designs currently impossible with contemporary EELVs, it also offers enhancing benefits, such as reduced risk, operational costs and/or complexity, shorter transit time to destination or launching large systems either monolithically or in fewer components. This paper will discuss both the performance and capabilities of Space Launch System as it evolves, and the current state of SLS utilization planning.

  9. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Science.gov (United States)

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

  10. Uptake of DNA by cancer cells without a transfection reagent.

    Science.gov (United States)

    Kong, Yanping; Zhang, Xianbo; Zhao, Yongliang; Xue, Yanfang; Zhang, Ye

    2017-01-21

    Cancer cells exhibit elevated levels of glucose uptake and may obtain pre-formed, diet-derived fatty acids from the bloodstream to boost their rapid growth; they may also use nucleic acid from their microenvironment. The study of processing nucleic acid by cancer cells will help improve the understanding of the metabolism of cancer. DNA is commonly packaged into a viral or lipid particle to be transferred into cells; this process is called transfection in laboratory. Cancer cells are known for having gene mutations and the evolving ability of endocytosis. Their uptake of DNAs might be different from normal cells; they may take in DNAs directly from the environment. In this report, we studied the uptake of DNAs in cancer cells without a transfection reagent. A group of DNA fragments were prepared with PCR and labeled with isotope phosphorous-32 to test their uptake by Huh 7 (liver cancer) and THLE3 (normal liver cells) after incubation overnight by counting radioactivity of the cells' genomic DNA. Multiple cell lines including breast cancer and lung cancer were tested with the same method. DNA molecules were also labeled with fluorescence to test the location in the cells using a kit of "label it fluorescence in situ hybridization (FISH)" from Mirus (USA). The data demonstrated that hepatocellular carcinoma cells possess the ability to take in large DNA fragments directly without a transfection reagent whereas normal liver cells cannot. Huh7 and MDA-MB231 cells displayed a significantly higher Rhodamine density in the cytoplasmic phagosomes and this suggests that the mechanism of uptake of large DNA by cancer cells is likely endocytosis. The efficacy of uptake is related to the DNA's size. Some cell lines of lung cancer and breast cancer also showed similar uptake of DNA. In the present study, we have revealed the evidence that some cancer cells, but not nontumorigenic cells, can take DNA fragments directly from the environment without the aid of the transfecting

  11. WSC-07: Evolving the Web Services Challenge

    NARCIS (Netherlands)

    Blake, M. Brian; Cheung, William K.W.; Jaeger, Michael C.; Wombacher, Andreas

    Service-oriented architecture (SOA) is an evolving architectural paradigm where businesses can expose their capabilities as modular, network-accessible software services. By decomposing capabilities into modular services, organizations can share their offerings at multiple levels of granularity

  12. Satcom access in the evolved packet core

    NARCIS (Netherlands)

    Cano, M.D.; Norp, A.H.J.; Popova, M.P.

    2012-01-01

    Satellite communications (Satcom) networks are increasingly integrating with terrestrial communications networks, namely Next Generation Networks (NGN). In the area of NGN the Evolved Packet Core (EPC) is a new network architecture that can support multiple access technologies. When Satcom is

  13. Acquisition: Acquisition of the Evolved SEASPARROW Missile

    National Research Council Canada - National Science Library

    2002-01-01

    .... The Evolved SEASPARROW Missile, a Navy Acquisition Category II program, is an improved version of the RIM-7P SEASPARROW missile that will intercept high-speed maneuvering, anti-ship cruise missiles...

  14. Biomimetic molecular design tools that learn, evolve, and adapt.

    Science.gov (United States)

    Winkler, David A

    2017-01-01

    A dominant hallmark of living systems is their ability to adapt to changes in the environment by learning and evolving. Nature does this so superbly that intensive research efforts are now attempting to mimic biological processes. Initially this biomimicry involved developing synthetic methods to generate complex bioactive natural products. Recent work is attempting to understand how molecular machines operate so their principles can be copied, and learning how to employ biomimetic evolution and learning methods to solve complex problems in science, medicine and engineering. Automation, robotics, artificial intelligence, and evolutionary algorithms are now converging to generate what might broadly be called in silico-based adaptive evolution of materials. These methods are being applied to organic chemistry to systematize reactions, create synthesis robots to carry out unit operations, and to devise closed loop flow self-optimizing chemical synthesis systems. Most scientific innovations and technologies pass through the well-known "S curve", with slow beginning, an almost exponential growth in capability, and a stable applications period. Adaptive, evolving, machine learning-based molecular design and optimization methods are approaching the period of very rapid growth and their impact is already being described as potentially disruptive. This paper describes new developments in biomimetic adaptive, evolving, learning computational molecular design methods and their potential impacts in chemistry, engineering, and medicine.

  15. Biomimetic molecular design tools that learn, evolve, and adapt

    Directory of Open Access Journals (Sweden)

    David A Winkler

    2017-06-01

    Full Text Available A dominant hallmark of living systems is their ability to adapt to changes in the environment by learning and evolving. Nature does this so superbly that intensive research efforts are now attempting to mimic biological processes. Initially this biomimicry involved developing synthetic methods to generate complex bioactive natural products. Recent work is attempting to understand how molecular machines operate so their principles can be copied, and learning how to employ biomimetic evolution and learning methods to solve complex problems in science, medicine and engineering. Automation, robotics, artificial intelligence, and evolutionary algorithms are now converging to generate what might broadly be called in silico-based adaptive evolution of materials. These methods are being applied to organic chemistry to systematize reactions, create synthesis robots to carry out unit operations, and to devise closed loop flow self-optimizing chemical synthesis systems. Most scientific innovations and technologies pass through the well-known “S curve”, with slow beginning, an almost exponential growth in capability, and a stable applications period. Adaptive, evolving, machine learning-based molecular design and optimization methods are approaching the period of very rapid growth and their impact is already being described as potentially disruptive. This paper describes new developments in biomimetic adaptive, evolving, learning computational molecular design methods and their potential impacts in chemistry, engineering, and medicine.

  16. Higher rates of sex evolve in spatially heterogeneous environments.

    Science.gov (United States)

    Becks, Lutz; Agrawal, Aneil F

    2010-11-04

    The evolution and maintenance of sexual reproduction has puzzled biologists for decades. Although this field is rich in hypotheses, experimental evidence is scarce. Some important experiments have demonstrated differences in evolutionary rates between sexual and asexual populations; other experiments have documented evolutionary changes in phenomena related to genetic mixing, such as recombination and selfing. However, direct experiments of the evolution of sex within populations are extremely rare (but see ref. 12). Here we use the rotifer, Brachionus calyciflorus, which is capable of both sexual and asexual reproduction, to test recent theory predicting that there is more opportunity for sex to evolve in spatially heterogeneous environments. Replicated experimental populations of rotifers were maintained in homogeneous environments, composed of either high- or low-quality food habitats, or in heterogeneous environments that consisted of a mix of the two habitats. For populations maintained in either type of homogeneous environment, the rate of sex evolves rapidly towards zero. In contrast, higher rates of sex evolve in populations experiencing spatially heterogeneous environments. The data indicate that the higher level of sex observed under heterogeneity is not due to sex being less costly or selection against sex being less efficient; rather sex is sufficiently advantageous in heterogeneous environments to overwhelm its inherent costs. Counter to some alternative theories for the evolution of sex, there is no evidence that genetic drift plays any part in the evolution of sex in these populations.

  17. Biomimetic molecular design tools that learn, evolve, and adapt

    Science.gov (United States)

    2017-01-01

    A dominant hallmark of living systems is their ability to adapt to changes in the environment by learning and evolving. Nature does this so superbly that intensive research efforts are now attempting to mimic biological processes. Initially this biomimicry involved developing synthetic methods to generate complex bioactive natural products. Recent work is attempting to understand how molecular machines operate so their principles can be copied, and learning how to employ biomimetic evolution and learning methods to solve complex problems in science, medicine and engineering. Automation, robotics, artificial intelligence, and evolutionary algorithms are now converging to generate what might broadly be called in silico-based adaptive evolution of materials. These methods are being applied to organic chemistry to systematize reactions, create synthesis robots to carry out unit operations, and to devise closed loop flow self-optimizing chemical synthesis systems. Most scientific innovations and technologies pass through the well-known “S curve”, with slow beginning, an almost exponential growth in capability, and a stable applications period. Adaptive, evolving, machine learning-based molecular design and optimization methods are approaching the period of very rapid growth and their impact is already being described as potentially disruptive. This paper describes new developments in biomimetic adaptive, evolving, learning computational molecular design methods and their potential impacts in chemistry, engineering, and medicine. PMID:28694872

  18. Cyberspace Operations: Influence Upon Evolving War Theory

    Science.gov (United States)

    2011-03-18

    St ra te gy R es ea rc h Pr oj ec t CYBERSPACE OPERATIONS: INFLUENCE UPON EVOLVING WAR THEORY BY COLONEL KRISTIN BAKER United States...DATES COVERED (From - To) 4. TITLE AND SUBTITLE Cyberspace Operations: Influence Upon Evolving War Theory 5a. CONTRACT NUMBER... Leadership 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING / MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S

  19. Evolving effective incremental SAT solvers with GP

    OpenAIRE

    Bader, Mohamed; Poli, R.

    2008-01-01

    Hyper-Heuristics could simply be defined as heuristics to choose other heuristics, and it is a way of combining existing heuristics to generate new ones. In a Hyper-Heuristic framework, the framework is used for evolving effective incremental (Inc*) solvers for SAT. We test the evolved heuristics (IncHH) against other known local search heuristics on a variety of benchmark SAT problems.

  20. Evolutionary defined role of the mitochondrial DNA in fertility, disease and ageing.

    Science.gov (United States)

    Otten, Auke B C; Smeets, Hubert J M

    2015-01-01

    The endosymbiosis of an alpha-proteobacterium and a eubacterium a billion years ago paved the way for multicellularity and enabled eukaryotes to flourish. The selective advantage for the host was the acquired ability to generate large amounts of intracellular hydrogen-dependent adenosine triphosphate. The price was increased reactive oxygen species (ROS) inside the eukaryotic cell, causing high mutation rates of the mitochondrial DNA (mtDNA). According to the Muller's ratchet theory, this accumulation of mutations in asexually transmitted mtDNA would ultimately lead to reduced reproductive fitness and eventually extinction. However, mitochondria have persisted over the course of evolution, initially due to a rapid, extreme evolutionary reduction of the mtDNA content. After the phylogenetic divergence of eukaryotes into animals, fungi and plants, differences in evolution of the mtDNA occurred with different adaptations for coping with the mutation burden within these clades. As a result, mitochondrial evolutionary mechanisms have had a profound effect on human adaptation, fertility, healthy reproduction, mtDNA disease manifestation and transmission and ageing. An understanding of these mechanisms might elucidate novel approaches for treatment and prevention of mtDNA disease. The scientific literature was investigated to determine how mtDNA evolved in animals, plants and fungi. Furthermore, the different mechanisms of mtDNA inheritance and of balancing Muller's ratchet in these species were summarized together with the consequences of these mechanisms for human health and reproduction. Animal, plant and fungal mtDNA have evolved differently. Animals have compact genomes, little recombination, a stable number of genes and a high mtDNA copy number, whereas plants have larger genomes with variable gene counts, a low mtDNA copy number and many recombination events. Fungal mtDNA is somewhere in between. In plants, the mtDNA mutation rate is kept low by effective ROS

  1. How Genes Evolve Molecular Techniques Give Us a Closer Look at ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 3; Issue 2. How Genes Evolve Molecular Techniques Give Us a Closer Look at Evolution at the DNA Level. Ravi Parkash. General Article Volume 3 Issue 2 February 1998 pp 28-34 ...

  2. Efficacy of environmental DNA to detect and quantify Brook Trout populations in headwater streams of the Adirondack Mountains, New York

    Science.gov (United States)

    Baldigo, Barry P.; Sporn, Lee Ann; George, Scott D.; Ball, Jacob

    2016-01-01

    Environmental DNA (eDNA) analysis is rapidly evolving as a tool for monitoring the distributions of aquatic species. Detection of species’ populations in streams may be challenging because the persistence time for intact DNA fragments is unknown and because eDNA is diluted and dispersed by dynamic hydrological processes. During 2015, the DNA of Brook Trout Salvelinus fontinalis was analyzed from water samples collected at 40 streams across the Adirondack region of upstate New York, where Brook Trout populations were recently quantified. Study objectives were to evaluate different sampling methods and the ability of eDNA to accurately predict the presence and abundance of resident Brook Trout populations. Results from three-pass electrofishing surveys indicated that Brook Trout were absent from 10 sites and were present in low (300 fish/0.1 ha) densities at 9, 11, and 10 sites, respectively. The eDNA results correctly predicted the presence and confirmed the absence of Brook Trout at 85.0–92.5% of the study sites; eDNA also explained 44% of the variability in Brook Trout population density and 24% of the variability in biomass. These findings indicate that eDNA surveys will enable researchers to effectively characterize the presence and abundance of Brook Trout and other species’ populations in headwater streams across the Adirondack region and elsewhere.

  3. Evolvability Search: Directly Selecting for Evolvability in order to Study and Produce It

    DEFF Research Database (Denmark)

    Mengistu, Henok; Lehman, Joel Anthony; Clune, Jeff

    2016-01-01

    One hallmark of natural organisms is their significant evolvability, i.e.,their increased potential for further evolution. However, reproducing such evolvability in artificial evolution remains a challenge, which both reduces the performance of evolutionary algorithms and inhibits the study...... of evolvable digital phenotypes. Although some types of selection in evolutionary computation indirectly encourage evolvability, one unexplored possibility is to directly select for evolvability. To do so, we estimate an individual's future potential for diversity by calculating the behavioral diversity of its...... immediate offspring, and select organisms with increased offspring variation. While the technique is computationally expensive, we hypothesized that direct selection would better encourage evolvability than indirect methods. Experiments in two evolutionary robotics domains confirm this hypothesis: in both...

  4. Increased humoral immunity by DNA vaccination using an alpha-tocopherol-based adjuvant

    DEFF Research Database (Denmark)

    Karlsson, Ingrid; Borggren, Marie; Nielsen, Jens

    2017-01-01

    DNA vaccines induce broad immunity, which involves both humoral and strong cellular immunity, and can be rapidly designed for novel or evolving pathogens such as influenza. However, the humoral immunogenicity in humans and higher animals has been suboptimal compared to that of traditional vaccine......). The animals received two intracutaneous immunizations spaced 3 weeks apart. When combined with Diluvac Forte® or the emulsion containing alpha-tocopherol, the DNA vaccine induced a more potent and balanced immunoglobulin G (IgG)1 and IgG2c response, and both IgG subclass responses were significantly enhanced...... constituent alpha-tocopherol plays an important role in this immunogenicity. This induction of a potent and balanced humoral response without impairment of cellular immunity constitutes an important advancement toward effective DNA vaccines....

  5. Evolved atmospheric entry corridor with safety factor

    Science.gov (United States)

    Liang, Zixuan; Ren, Zhang; Li, Qingdong

    2018-02-01

    Atmospheric entry corridors are established in previous research based on the equilibrium glide condition which assumes the flight-path angle to be zero. To get a better understanding of the highly constrained entry flight, an evolved entry corridor that considers the exact flight-path angle is developed in this study. Firstly, the conventional corridor in the altitude vs. velocity plane is extended into a three-dimensional one in the space of altitude, velocity, and flight-path angle. The three-dimensional corridor is generated by a series of constraint boxes. Then, based on a simple mapping method, an evolved two-dimensional entry corridor with safety factor is obtained. The safety factor is defined to describe the flexibility of the flight-path angle for a state within the corridor. Finally, the evolved entry corridor is simulated for the Space Shuttle and the Common Aero Vehicle (CAV) to demonstrate the effectiveness of the corridor generation approach. Compared with the conventional corridor, the evolved corridor is much wider and provides additional information. Therefore, the evolved corridor would benefit more to the entry trajectory design and analysis.

  6. Environmental noise, genetic diversity and the evolution of evolvability and robustness in model gene networks.

    Directory of Open Access Journals (Sweden)

    Christopher F Steiner

    Full Text Available The ability of organisms to adapt and persist in the face of environmental change is accepted as a fundamental feature of natural systems. More contentious is whether the capacity of organisms to adapt (or "evolvability" can itself evolve and the mechanisms underlying such responses. Using model gene networks, I provide evidence that evolvability emerges more readily when populations experience positively autocorrelated environmental noise (red noise compared to populations in stable or randomly varying (white noise environments. Evolvability was correlated with increasing genetic robustness to effects on network viability and decreasing robustness to effects on phenotypic expression; populations whose networks displayed greater viability robustness and lower phenotypic robustness produced more additive genetic variation and adapted more rapidly in novel environments. Patterns of selection for robustness varied antagonistically with epistatic effects of mutations on viability and phenotypic expression, suggesting that trade-offs between these properties may constrain their evolutionary responses. Evolution of evolvability and robustness was stronger in sexual populations compared to asexual populations indicating that enhanced genetic variation under fluctuating selection combined with recombination load is a primary driver of the emergence of evolvability. These results provide insight into the mechanisms potentially underlying rapid adaptation as well as the environmental conditions that drive the evolution of genetic interactions.

  7. Rapid HLA class I DNA typing using microtiter plate-reverse hybridization assay (MRHA) by simple thermoregulation: high-resolution subtyping of the HLA-A2 and -B40 antigen groups.

    Science.gov (United States)

    Moribe, T; Kaneshige, T; Inagawa, A; Nakatani, S; Hirai, H; Morita, F; Ito, Y; Inoko, H

    1999-06-01

    We have established a precise, rapid, simple and economical subtyping method for alleles encoding the HLA-A2 and -B40 antigens using microtiter plate-reverse hybridization assay (MRHA), which is based on the general principle of HLA oligotyping by reverse dot blot hybridization. Amino-modified sequence-specific oligonucleotide (SSO) probes were immobilized covalently onto a carboxylate-modified microtiter plate. In order to perform high-resolution subtyping of the HLA-A2 and -B40 antigen groups, the alpha1 and alpha2 domain regions were amplified using a pair of group-specific primers composed of an unlabeled sense primer and a biotinylated antisense primer. PCR-amplified products were hybridized with SSO probes in hybridization buffer containing formamide for 1 hour at 37 degrees C. After washing with 2 X SSC at room temperature, the bound PCR products were detected by alkaline phosphatase-conjugated streptavidine followed by color development. All of 8 HLA-B40 suballeles, all of 2 HLA-B47 suballeles (B40 group-specific primers used in this study allowed also B47 amplification) and 17 out of 21 HLA-A2 suballeles were discriminated. The remaining four HLA-A2 suballeles were determined by analysis after exon 4 amplification. HLA-DNA typing by this method was easily and exactly performed regardless of sample number. The greatest advantages of this technique are strong positive signals obtained, reproducibility and the ease of thermoregulation for hybridization and washing as compared to previously reported microtiter plate hybridization methods.

  8. Interactively Evolving Compositional Sound Synthesis Networks

    DEFF Research Database (Denmark)

    Jónsson, Björn Þór; Hoover, Amy K.; Risi, Sebastian

    2015-01-01

    While the success of electronic music often relies on the uniqueness and quality of selected timbres, many musicians struggle with complicated and expensive equipment and techniques to create their desired sounds. Instead, this paper presents a technique for producing novel timbres that are evolved......, CPPNs can theoretically compute any function and can build on those present in traditional synthesizers (e.g. square, sawtooth, triangle, and sine waves functions) to produce completely novel timbres. Evolved with NeuroEvolution of Augmenting Topologies (NEAT), the aim of this paper is to explore...... the space of potential sounds that can be generated through such compositional sound synthesis networks (CSSNs). To study the effect of evolution on subjective appreciation, participants in a listener study ranked evolved timbres by personal preference, resulting in preferences skewed toward the first...

  9. Quantifying evolvability in small biological networks

    Energy Technology Data Exchange (ETDEWEB)

    Nemenman, Ilya [Los Alamos National Laboratory; Mugler, Andrew [COLUMBIA UNIV; Ziv, Etay [COLUMBIA UNIV; Wiggins, Chris H [COLUMBIA UNIV

    2008-01-01

    The authors introduce a quantitative measure of the capacity of a small biological network to evolve. The measure is applied to a stochastic description of the experimental setup of Guet et al. (Science 2002, 296, pp. 1466), treating chemical inducers as functional inputs to biochemical networks and the expression of a reporter gene as the functional output. The authors take an information-theoretic approach, allowing the system to set parameters that optimise signal processing ability, thus enumerating each network's highest-fidelity functions. All networks studied are highly evolvable by the measure, meaning that change in function has little dependence on change in parameters. Moreover, each network's functions are connected by paths in the parameter space along which information is not significantly lowered, meaning a network may continuously change its functionality without completely losing it along the way. This property further underscores the evolvability of the networks.

  10. Evolution of evolvability in gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Anton Crombach

    Full Text Available Gene regulatory networks are perhaps the most important organizational level in the cell where signals from the cell state and the outside environment are integrated in terms of activation and inhibition of genes. For the last decade, the study of such networks has been fueled by large-scale experiments and renewed attention from the theoretical field. Different models have been proposed to, for instance, investigate expression dynamics, explain the network topology we observe in bacteria and yeast, and for the analysis of evolvability and robustness of such networks. Yet how these gene regulatory networks evolve and become evolvable remains an open question. An individual-oriented evolutionary model is used to shed light on this matter. Each individual has a genome from which its gene regulatory network is derived. Mutations, such as gene duplications and deletions, alter the genome, while the resulting network determines the gene expression pattern and hence fitness. With this protocol we let a population of individuals evolve under Darwinian selection in an environment that changes through time. Our work demonstrates that long-term evolution of complex gene regulatory networks in a changing environment can lead to a striking increase in the efficiency of generating beneficial mutations. We show that the population evolves towards genotype-phenotype mappings that allow for an orchestrated network-wide change in the gene expression pattern, requiring only a few specific gene indels. The genes involved are hubs of the networks, or directly influencing the hubs. Moreover, throughout the evolutionary trajectory the networks maintain their mutational robustness. In other words, evolution in an alternating environment leads to a network that is sensitive to a small class of beneficial mutations, while the majority of mutations remain neutral: an example of evolution of evolvability.

  11. How the first biopolymers could have evolved.

    Science.gov (United States)

    Abkevich, V I; Gutin, A M; Shakhnovich, E I

    1996-01-01

    In this work, we discuss a possible origin of the first biopolymers with stable unique structures. We suggest that at the prebiotic stage of evolution, long organic polymers had to be compact to avoid hydrolysis and had to be soluble and thus must not be exceedingly hydrophobic. We present an algorithm that generates such sequences for model proteins. The evolved sequences turn out to have a stable unique structure, into which they quickly fold. This result illustrates the idea that the unique three-dimensional native structures of first biopolymers could have evolved as a side effect of nonspecific physicochemical factors acting at the prebiotic stage of evolution. PMID:8570645

  12. Evolving Intelligent Systems Methodology and Applications

    CERN Document Server

    Angelov, Plamen; Kasabov, Nik

    2010-01-01

    From theory to techniques, the first all-in-one resource for EIS. There is a clear demand in advanced process industries, defense, and Internet and communication (VoIP) applications for intelligent yet adaptive/evolving systems. Evolving Intelligent Systems is the first self- contained volume that covers this newly established concept in its entirety, from a systematic methodology to case studies to industrial applications. Featuring chapters written by leading world experts, it addresses the progress, trends, and major achievements in this emerging research field, with a strong emphasis on th

  13. Preface: evolving rotifers, evolving science: Proceedings of the XIV International Rotifer Symposium

    Czech Academy of Sciences Publication Activity Database

    Devetter, Miloslav; Fontaneto, D.; Jersabek, Ch.D.; Welch, D.B.M.; May, L.; Walsh, E.J.

    2017-01-01

    Roč. 796, č. 1 (2017), s. 1-6 ISSN 0018-8158 Institutional support: RVO:60077344 Keywords : evolving rotifers * 14th International Rotifer Symposium * evolving science Subject RIV: EG - Zoology OBOR OECD: Zoology Impact factor: 2.056, year: 2016

  14. Thermal and Evolved-Gas Analyzer Illustration

    Science.gov (United States)

    2008-01-01

    This is a computer-aided drawing of the Thermal and Evolved-Gas Analyzer, or TEGA, on NASA's Phoenix Mars Lander. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  15. Apollo 16 Evolved Lithology Sodic Ferrogabbro

    Science.gov (United States)

    Zeigler, Ryan; Jolliff, B. L.; Korotev, R. L.

    2014-01-01

    Evolved lunar igneous lithologies, often referred to as the alkali suite, are a minor but important component of the lunar crust. These evolved samples are incompatible-element rich samples, and are, not surprisingly, most common in the Apollo sites in (or near) the incompatible-element rich region of the Moon known as the Procellarum KREEP Terrane (PKT). The most commonly occurring lithologies are granites (A12, A14, A15, A17), monzogabbro (A14, A15), alkali anorthosites (A12, A14), and KREEP basalts (A15, A17). The Feldspathic Highlands Terrane is not entirely devoid of evolved lithologies, and rare clasts of alkali gabbronorite and sodic ferrogabbro (SFG) have been identified in Apollo 16 station 11 breccias 67915 and 67016. Curiously, nearly all pristine evolved lithologies have been found as small clasts or soil particles, exceptions being KREEP basalts 15382/6 and granitic sample 12013 (which is itself a breccia). Here we reexamine the petrography and geochemistry of two SFG-like particles found in a survey of Apollo 16 2-4 mm particles from the Cayley Plains 62283,7-15 and 62243,10-3 (hereafter 7-15 and 10-3 respectively). We will compare these to previously reported SFG samples, including recent analyses on the type specimen of SFG from lunar breccia 67915.

  16. Rapid Prototyping

    Science.gov (United States)

    1999-01-01

    Javelin, a Lone Peak Engineering Inc. Company has introduced the SteamRoller(TM) System as a commercial product. The system was designed by Javelin during a Phase II NASA funded small commercial product. The purpose of the invention was to allow automated-feed of flexible ceramic tapes to the Laminated Object Manufacturing rapid prototyping equipment. The ceramic material that Javelin was working with during the Phase II project is silicon nitride. This engineered ceramic material is of interest for space-based component.

  17. Why, when, and how did yeast evolve alcoholic fermentation?

    Science.gov (United States)

    Dashko, Sofia; Zhou, Nerve; Compagno, Concetta; Piškur, Jure

    2014-09-01

    The origin of modern fruits brought to microbial communities an abundant source of rich food based on simple sugars. Yeasts, especially Saccharomyces cerevisiae, usually become the predominant group in these niches. One of the most prominent and unique features and likely a winning trait of these yeasts is their ability to rapidly convert sugars to ethanol at both anaerobic and aerobic conditions. Why, when, and how did yeasts remodel their carbon metabolism to be able to accumulate ethanol under aerobic conditions and at the expense of decreasing biomass production? We hereby review the recent data on the carbon metabolism in Saccharomycetaceae species and attempt to reconstruct the ancient environment, which could promote the evolution of alcoholic fermentation. We speculate that the first step toward the so-called fermentative lifestyle was the exploration of anaerobic niches resulting in an increased metabolic capacity to degrade sugar to ethanol. The strengthened glycolytic flow had in parallel a beneficial effect on the microbial competition outcome and later evolved as a "new" tool promoting the yeast competition ability under aerobic conditions. The basic aerobic alcoholic fermentation ability was subsequently "upgraded" in several lineages by evolving additional regulatory steps, such as glucose repression in the S. cerevisiae clade, to achieve a more precise metabolic control. © 2014 The Authors. FEMS Yeast Research published by John Wiley & Sons Ltd on behalf of Federation of European Microbiological Societies.

  18. IR Spectroscopy of Gasses Evolved During Roasting Coffee Beans

    Science.gov (United States)

    Clain, Alexander; Capaldi, Xavier; Amanuel, Samuel

    2014-03-01

    We measured the IR spectra of the gasses that evolve during roasting of coffee beans. The spectra recorded at different temperature revealed that the intensity of certain IR bands increase as the temperature increases. For instance, the intensity of the CO2 band increased by a factor of four and reached a plateau as the roasting temperature approached 200°C. The intensity further increased as the temperature increased above 200°C, however, in two steps. Similarly the intensity of the OH bands monotonically increased until 200°C and then increased further in two rapid steps above 200°C. The temperature ranges where IR intensities change in two steps coincides with the temperature ranges where typically commercial roasting is done and where the first and second ``cracks'' are heard during roasting.

  19. Forces shaping the fastest evolving regions in the human genome.

    Directory of Open Access Journals (Sweden)

    Katherine S Pollard

    2006-10-01

    Full Text Available Comparative genomics allow us to search the human genome for segments that were extensively changed in the last approximately 5 million years since divergence from our common ancestor with chimpanzee, but are highly conserved in other species and thus are likely to be functional. We found 202 genomic elements that are highly conserved in vertebrates but show evidence of significantly accelerated substitution rates in human. These are mostly in non-coding DNA, often near genes associated with transcription and DNA binding. Resequencing confirmed that the five most accelerated elements are dramatically changed in human but not in other primates, with seven times more substitutions in human than in chimp. The accelerated elements, and in particular the top five, show a strong bias for adenine and thymine to guanine and cytosine nucleotide changes and are disproportionately located in high recombination and high guanine and cytosine content environments near telomeres, suggesting either biased gene conversion or isochore selection. In addition, there is some evidence of directional selection in the regions containing the two most accelerated regions. A combination of evolutionary forces has contributed to accelerated evolution of the fastest evolving elements in the human genome.

  20. Sanger dideoxy sequencing of DNA.

    Science.gov (United States)

    Walker, Sarah E; Lorsch, Jon

    2013-01-01

    While the ease and reduced cost of automated DNA sequencing has largely obviated the need for manual dideoxy sequencing for routine purposes, specific applications require manual DNA sequencing. For instance, in studies of enzymes or proteins that bind or modify DNA, a DNA ladder is often used to map the site at which an enzyme is bound or a modification occurs. In these cases, the Sanger method for dideoxy sequencing provides a rapid and facile method for producing a labeled DNA ladder. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Expression of human A53T alpha-synuclein in the rat substantia nigra using a novel AAV1/2 vector produces a rapidly evolving pathology with protein aggregation, dystrophic neurite architecture and nigrostriatal degeneration with potential to model the pathology of Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Sun Xuan

    2010-10-01

    Full Text Available Abstract Background The pathological hallmarks of Parkinson's disease (PD include the presence of alpha-synuclein (α-syn rich Lewy bodies and neurites and the loss of dopaminergic (DA neurons of the substantia nigra (SN. Animal models of PD based on viral vector-mediated over-expression of α-syn have been developed and show evidence of DA toxicity to varying degrees depending on the type of virus used, its concentration, and the serotype of vector employed. To date these models have been variable, difficult to reproduce, and slow in their evolution to achieve a desired phenotype, hindering their use as a model for testing novel therapeutics. To address these issues we have taken a novel vector in this context, that can be prepared in high titer and which possesses an ability to produce neuronally-directed expression, with expression dynamics optimised to provide a rapid rise in gene product expression. Thus, in the current study, we have used a high titer chimeric AAV1/2 vector, to express human A53T α-syn, an empty vector control (EV, or green fluorescent protein (GFP, the latter to control for the possibility that high levels of protein in themselves might contribute to damage. Results We show that following a single 2 μl injection into the rat SN there is near complete coverage of the structure and expression of A53T α-syn or GFP appears throughout the striatum. Within 3 weeks of SN delivery of their respective vectors, aggregations of insoluble α-syn were observed in SN DA neurons. The numbers of DA neurons in the SN were significantly reduced by expression of A53T α-syn (52%, and to a lesser extent by GFP (24%, compared to EV controls (both P P Conclusions In the current implementation of the model, we recapitulate the primary pathological hallmarks of PD, although a proportion of the SN damage may relate to general protein overload and may not be specific for A53T α-syn. Future studies will thus be required to optimise the dose of

  2. Expression of human A53T alpha-synuclein in the rat substantia nigra using a novel AAV1/2 vector produces a rapidly evolving pathology with protein aggregation, dystrophic neurite architecture and nigrostriatal degeneration with potential to model the pathology of Parkinson's disease.

    Science.gov (United States)

    Koprich, James B; Johnston, Tom H; Reyes, M Gabriela; Sun, Xuan; Brotchie, Jonathan M

    2010-10-28

    The pathological hallmarks of Parkinson's disease (PD) include the presence of alpha-synuclein (α-syn) rich Lewy bodies and neurites and the loss of dopaminergic (DA) neurons of the substantia nigra (SN). Animal models of PD based on viral vector-mediated over-expression of α-syn have been developed and show evidence of DA toxicity to varying degrees depending on the type of virus used, its concentration, and the serotype of vector employed. To date these models have been variable, difficult to reproduce, and slow in their evolution to achieve a desired phenotype, hindering their use as a model for testing novel therapeutics. To address these issues we have taken a novel vector in this context, that can be prepared in high titer and which possesses an ability to produce neuronally-directed expression, with expression dynamics optimised to provide a rapid rise in gene product expression. Thus, in the current study, we have used a high titer chimeric AAV1/2 vector, to express human A53T α-syn, an empty vector control (EV), or green fluorescent protein (GFP), the latter to control for the possibility that high levels of protein in themselves might contribute to damage. We show that following a single 2 μl injection into the rat SN there is near complete coverage of the structure and expression of A53T α-syn or GFP appears throughout the striatum. Within 3 weeks of SN delivery of their respective vectors, aggregations of insoluble α-syn were observed in SN DA neurons. The numbers of DA neurons in the SN were significantly reduced by expression of A53T α-syn (52%), and to a lesser extent by GFP (24%), compared to EV controls (both P AAV1/2-A53T α-syn injection produced dystrophic neurites and a significant reduction in tyrosine hydroxylase levels (by 53%, P AAV1/2-GFP condition. In the current implementation of the model, we recapitulate the primary pathological hallmarks of PD, although a proportion of the SN damage may relate to general protein overload and

  3. Slow molecular evolution in 18S rDNA, rbcL and nad5 genes of mosses compared with higher plants.

    Science.gov (United States)

    Stenøien, H K

    2008-03-01

    The evolutionary potential of bryophytes (mosses, liverworts and hornworts) has been debated for decades. Fossil record and biogeographical distribution patterns suggest very slow morphological evolution and the retainment of several ancient traits since the split with vascular plants some 450 million years ago. Many have argued that bryophytes may evolve as rapidly as higher plants on the molecular level, but this hypothesis has not been tested so far. Here, it is shown that mosses have experienced significantly lower rates of molecular evolution than higher plants within 18S rDNA (nuclear), rbcL (chloroplast) and nad5 (mitochondrial) genes. Mosses are on an average evolving 2-3 times slower than ferns, gymnosperms and angiosperms; and also green algae seem to be evolving faster than nonvascular plants. These results support the observation of a general correlation between morphological and molecular evolutionary rates in plants and also show that mosses are 'evolutionary sphinxes' regarding both morphological and molecular evolutionary potential.

  4. Evolving wormhole geometries within nonlinear electrodynamics

    Energy Technology Data Exchange (ETDEWEB)

    Arellano, Aaron V B [Facultad de Ciencias, Universidad Autonoma del Estado de Mexico, El Cerrillo, Piedras Blancas, CP 50200, Toluca (Mexico); Lobo, Francisco S N [Centro de Astronomia e Astrofisica da Universidade de Lisboa, Campo Grande, Ed C8 1749-016 Lisbon (Portugal)

    2006-10-21

    In this work, we explore the possibility of evolving (2 + 1) and (3 + 1)-dimensional wormhole spacetimes, conformally related to the respective static geometries, within the context of nonlinear electrodynamics. For (3 + 1)-dimensional spacetime, it is found that the Einstein field equation imposes a contracting wormhole solution and the obedience of the weak energy condition. Nevertheless, in the presence of an electric field, the latter presents a singularity at the throat; however, for a pure magnetic field the solution is regular. For (2 + 1)-dimensional case, it is also found that the physical fields are singular at the throat. Thus, taking into account the principle of finiteness, which states that a satisfactory theory should avoid physical quantities becoming infinite, one may rule out evolving (3 + 1)-dimensional wormhole solutions, in the presence of an electric field, and (2 + 1)-dimensional case coupled to nonlinear electrodynamics.

  5. Continual Learning through Evolvable Neural Turing Machines

    DEFF Research Database (Denmark)

    Lüders, Benno; Schläger, Mikkel; Risi, Sebastian

    2016-01-01

    Continual learning, i.e. the ability to sequentially learn tasks without catastrophic forgetting of previously learned ones, is an important open challenge in machine learning. In this paper we take a step in this direction by showing that the recently proposed Evolving Neural Turing Machine (ENT......) approach is able to perform one-shot learning in a reinforcement learning task without catastrophic forgetting of previously stored associations.......Continual learning, i.e. the ability to sequentially learn tasks without catastrophic forgetting of previously learned ones, is an important open challenge in machine learning. In this paper we take a step in this direction by showing that the recently proposed Evolving Neural Turing Machine (ENTM...

  6. Designing Garments to Evolve Over Time

    DEFF Research Database (Denmark)

    Riisberg, Vibeke; Grose, Lynda

    2017-01-01

    This paper proposes a REDO of the current fashion paradigm by investigating how garments might be designed to evolve over time. The purpose is to discuss ways of expanding the traditional role of the designer to include temporal dimensions of creating, producing and using clothes and to suggest a...... to a REDO of design education, to further research and the future fashion and textile industry.......This paper proposes a REDO of the current fashion paradigm by investigating how garments might be designed to evolve over time. The purpose is to discuss ways of expanding the traditional role of the designer to include temporal dimensions of creating, producing and using clothes and to suggest...... a range of potential fashion futures that decouple from declining resources. In the first part literature on 'Past and Present' historical and current aspects of sustainability in fashion and textiles are presented. In the second part, three exploratory case studies are described: Two projects by students...

  7. Antibody therapeutics - the evolving patent landscape.

    Science.gov (United States)

    Petering, Jenny; McManamny, Patrick; Honeyman, Jane

    2011-09-01

    The antibody patent landscape has evolved dramatically over the past 30 years, particularly in areas of technology relating to antibody modification to reduce immunogenicity in humans or improve antibody function. In some cases antibody techniques that were developed in the 1980s are still the subject of patent protection in the United States or Canada. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. The evolving epidemiology of inflammatory bowel disease.

    LENUS (Irish Health Repository)

    Shanahan, Fergus

    2009-07-01

    Epidemiologic studies in inflammatory bowel disease (IBD) include assessments of disease burden and evolving patterns of disease presentation. Although it is hoped that sound epidemiologic studies provide aetiological clues, traditional risk factor-based epidemiology has provided limited insights into either Crohn\\'s disease or ulcerative colitis etiopathogenesis. In this update, we will summarize how the changing epidemiology of IBD associated with modernization can be reconciled with current concepts of disease mechanisms and will discuss studies of clinically significant comorbidity in IBD.

  9. Directional Communication in Evolved Multiagent Teams

    Science.gov (United States)

    2013-06-10

    networks. Artificial Life, 15(2):185– 212, 2009. [23] K. O. Stanley and R. Miikkulainen. Evolving neural networks through augmenting topologies ...paper. 2.2 Neuroevolution of Augmenting Topologies The HyperNEAT approach is itself an extension of the original NEAT (Neu- roevolution of Augmenting ...Gauci and K. O. Stanley. Autonomous evolution of topographic regu- larities in artificial neural networks. Neural Computation, 22(7):1860–1898, 2010

  10. The Evolving Leadership Path of Visual Analytics

    Energy Technology Data Exchange (ETDEWEB)

    Kluse, Michael; Peurrung, Anthony J.; Gracio, Deborah K.

    2012-01-02

    This is a requested book chapter for an internationally authored book on visual analytics and related fields, coordianted by a UK university and to be published by Springer in 2012. This chapter is an overview of the leadship strategies that PNNL's Jim Thomas and other stakeholders used to establish visual analytics as a field, and how those strategies may evolve in the future.

  11. Raeder paratrigeminal neuralgia evolving to hemicrania continua.

    Science.gov (United States)

    Porzukowiak, Tina Renae

    2015-04-01

    Raeder paratrigeminal neuralgia is most commonly characterized as deep, boring, nonpulsatile, severe, unilateral facial and head pain in the distribution of the V1 area combined with ipsilateral oculosympathetic palsy and autonomic symptoms. Raeder paratrigeminal neuralgia evolving into hemicrania continua, a rare primary, chronic headache syndrome characterized by unilateral pain and response to indomethacin, has rarely been documented. The purpose of this case report is to contribute to the medical literature a single case of Raeder paratrigeminal neuralgia presenting as multiple cranial nerve palsies that evolved into hemicrania continua that was successfully treated with onabotulinumtoxinA. A 52-year-old white woman presented to the emergency department with the complaint of severe, aching, constant eye pain radiating to the V1 area for 1 week with associated ptosis and photophobia of the left eye. Ocular examination revealed involvement of cranial nerves II, III, V, and VI. Additional symptoms included ipsilateral lacrimation, eyelid edema, and rhinorrhea. Extensive medical work-up showed normal results. Raeder paratrigeminal neuralgia was diagnosed with multiple cranial nerve involvement; the headache component became chronic with periodic exacerbations of autonomic symptoms evolving to a diagnosis of hemicrania continua. The patient was intolerant to traditional indomethacin treatment, and the headache was successfully treated with onabotulinumtoxinA injections. Recognition of ipsilateral signs such as miosis, ptosis, hydrosis, eyelid edema, hyperemia, rhinorrhea, or nasal congestion is useful in the differential diagnosis of painful ophthalmoplegia, particularly in the diagnosis of Raeder paratrigeminal neuralgia and hemicrania continua. This case study illustrates a rare presentation of Raeder paratrigeminal neuralgia evolving into hemicrania continua presenting as a painful ophthalmoplegia with multiple cranial nerve involvement. The example supports the

  12. Evolvability of Amyloidogenic Proteins in Human Brain

    Science.gov (United States)

    Hashimoto, Makoto; Ho, Gilbert; Sugama, Shuei; Takamatsu, Yoshiki; Shimizu, Yuka; Takenouchi, Takato; Waragai, Masaaki; Masliah, Eliezer

    2018-01-01

     Currently, the physiological roles of amyloidogenic proteins (APs) in human brain, such as amyloid-β and α-synuclein, are elusive. Given that many APs arose by gene duplication and have been resistant against the pressures of natural selection, APs may be associated with some functions that are advantageous for survival of offspring. Nonetheless, evolvability is the sole physiological quality of APs that has been characterized in microorganisms such as yeast. Since yeast and human brain may share similar strategies in coping with diverse range of critical environmental stresses, the objective of this paper was to discuss the potential role of evolvability of APs in aging-associated neurodegenerative disorders, including Alzheimer’s disease and Parkinson’s disease. Given the heterogeneity of APs in terms of structure and cytotoxicity, it is argued that APs might be involved in preconditioning against diverse stresses in human brain. It is further speculated that these stress-related APs, most likely protofibrillar forms, might be transmitted to offspring via the germline, conferring preconditioning against forthcoming stresses. Thus, APs might represent a vehicle for the inheritance of the acquired characteristics against environmental stresses. Curiously, such a characteristic of APs is reminiscent of Charles Darwin’s ‘gemmules’, imagined molecules of heritability described in his pangenesis theory. We propose that evolvability might be a physiological function of APs during the reproductive stage and neurodegenerative diseases could be a by-product effect manifested later in aging. Collectively, our evolvability hypothesis may play a complementary role in the pathophysiology of APs with the conventional amyloid cascade hypothesis. PMID:29439348

  13. High-order evolving surface finite element method for parabolic problems on evolving surfaces

    OpenAIRE

    Kovács, Balázs

    2016-01-01

    High-order spatial discretisations and full discretisations of parabolic partial differential equations on evolving surfaces are studied. We prove convergence of the high-order evolving surface finite element method, by showing high-order versions of geometric approximation errors and perturbation error estimates and by the careful error analysis of a modified Ritz map. Furthermore, convergence of full discretisations using backward difference formulae and implicit Runge-Kutta methods are als...

  14. DNA origami: the art of folding DNA.

    Science.gov (United States)

    Saccà, Barbara; Niemeyer, Christof M

    2012-01-02

    The advent of DNA origami technology greatly simplified the design and construction of nanometer-sized DNA objects. The self-assembly of a DNA-origami structure is a straightforward process in which a long single-stranded scaffold (often from the phage M13mp18) is folded into basically any desired shape with the help of a multitude of short helper strands. This approach enables the ready generation of objects with an addressable surface area of a few thousand nm(2) and with a single "pixel" resolution of about 6 nm. The process is rapid, puts low demands on experimental conditions, and delivers target products in high yields. These features make DNA origami the method of choice in structural DNA nanotechnology when two- and three-dimensional objects are desired. This Minireview summarizes recent advances in the design of DNA origami nanostructures, which open the door to numerous exciting applications. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Mechanism of DNA damage tolerance

    Science.gov (United States)

    Bi, Xin

    2015-01-01

    DNA damage may compromise genome integrity and lead to cell death. Cells have evolved a variety of processes to respond to DNA damage including damage repair and tolerance mechanisms, as well as damage checkpoints. The DNA damage tolerance (DDT) pathway promotes the bypass of single-stranded DNA lesions encountered by DNA polymerases during DNA replication. This prevents the stalling of DNA replication. Two mechanistically distinct DDT branches have been characterized. One is translesion synthesis (TLS) in which a replicative DNA polymerase is temporarily replaced by a specialized TLS polymerase that has the ability to replicate across DNA lesions. TLS is mechanistically simple and straightforward, but it is intrinsically error-prone. The other is the error-free template switching (TS) mechanism in which the stalled nascent strand switches from the damaged template to the undamaged newly synthesized sister strand for extension past the lesion. Error-free TS is a complex but preferable process for bypassing DNA lesions. However, our current understanding of this pathway is sketchy. An increasing number of factors are being found to participate or regulate this important mechanism, which is the focus of this editorial. PMID:26322163

  16. Evolvability Is an Evolved Ability: The Coding Concept as the Arch-Unit of Natural Selection.

    Science.gov (United States)

    Janković, Srdja; Ćirković, Milan M

    2016-03-01

    Physical processes that characterize living matter are qualitatively distinct in that they involve encoding and transfer of specific types of information. Such information plays an active part in the control of events that are ultimately linked to the capacity of the system to persist and multiply. This algorithmicity of life is a key prerequisite for its Darwinian evolution, driven by natural selection acting upon stochastically arising variations of the encoded information. The concept of evolvability attempts to define the total capacity of a system to evolve new encoded traits under appropriate conditions, i.e., the accessible section of total morphological space. Since this is dependent on previously evolved regulatory networks that govern information flow in the system, evolvability itself may be regarded as an evolved ability. The way information is physically written, read and modified in living cells (the "coding concept") has not changed substantially during the whole history of the Earth's biosphere. This biosphere, be it alone or one of many, is, accordingly, itself a product of natural selection, since the overall evolvability conferred by its coding concept (nucleic acids as information carriers with the "rulebook of meanings" provided by codons, as well as all the subsystems that regulate various conditional information-reading modes) certainly played a key role in enabling this biosphere to survive up to the present, through alterations of planetary conditions, including at least five catastrophic events linked to major mass extinctions. We submit that, whatever the actual prebiotic physical and chemical processes may have been on our home planet, or may, in principle, occur at some time and place in the Universe, a particular coding concept, with its respective potential to give rise to a biosphere, or class of biospheres, of a certain evolvability, may itself be regarded as a unit (indeed the arch-unit) of natural selection.

  17. Survivability is more fundamental than evolvability.

    Directory of Open Access Journals (Sweden)

    Michael E Palmer

    Full Text Available For a lineage to survive over long time periods, it must sometimes change. This has given rise to the term evolvability, meaning the tendency to produce adaptive variation. One lineage may be superior to another in terms of its current standing variation, or it may tend to produce more adaptive variation. However, evolutionary outcomes depend on more than standing variation and produced adaptive variation: deleterious variation also matters. Evolvability, as most commonly interpreted, is not predictive of evolutionary outcomes. Here, we define a predictive measure of the evolutionary success of a lineage that we call the k-survivability, defined as the probability that the lineage avoids extinction for k generations. We estimate the k-survivability using multiple experimental replicates. Because we measure evolutionary outcomes, the initial standing variation, the full spectrum of generated variation, and the heritability of that variation are all incorporated. Survivability also accounts for the decreased joint likelihood of extinction of sub-lineages when they 1 disperse in space, or 2 diversify in lifestyle. We illustrate measurement of survivability with in silico models, and suggest that it may also be measured in vivo using multiple longitudinal replicates. The k-survivability is a metric that enables the quantitative study of, for example, the evolution of 1 mutation rates, 2 dispersal mechanisms, 3 the genotype-phenotype map, and 4 sexual reproduction, in temporally and spatially fluctuating environments. Although these disparate phenomena evolve by well-understood microevolutionary rules, they are also subject to the macroevolutionary constraint of long-term survivability.

  18. Present weather and climate: evolving conditions

    Science.gov (United States)

    Hoerling, Martin P; Dettinger, Michael; Wolter, Klaus; Lukas, Jeff; Eischeid, Jon K.; Nemani, Rama; Liebmann, Brant; Kunkel, Kenneth E.

    2013-01-01

    This chapter assesses weather and climate variability and trends in the Southwest, using observed climate and paleoclimate records. It analyzes the last 100 years of climate variability in comparison to the last 1,000 years, and links the important features of evolving climate conditions to river flow variability in four of the region’s major drainage basins. The chapter closes with an assessment of the monitoring and scientific research needed to increase confidence in understanding when climate episodes, events, and phenomena are attributable to human-caused climate change.

  19. f( R) gravity solutions for evolving wormholes

    Science.gov (United States)

    Bhattacharya, Subhra; Chakraborty, Subenoy

    2017-08-01

    The scalar-tensor f( R) theory of gravity is considered in the framework of a simple inhomogeneous space-time model. In this research we use the reconstruction technique to look for possible evolving wormhole solutions within viable f( R) gravity formalism. These f( R) models are then constrained so that they are consistent with existing experimental data. Energy conditions related to the matter threading the wormhole are analyzed graphically and are in general found to obey the null energy conditions (NEC) in regions around the throat, while in the limit f(R)=R, NEC can be violated at large in regions around the throat.

  20. Evolving Random Forest for Preference Learning

    DEFF Research Database (Denmark)

    Abou-Zleikha, Mohamed; Shaker, Noor

    2015-01-01

    This paper introduces a novel approach for pairwise preference learning through a combination of an evolutionary method and random forest. Grammatical evolution is used to describe the structure of the trees in the Random Forest (RF) and to handle the process of evolution. Evolved random forests ...... obtained for predicting pairwise self-reports of users for the three emotional states engagement, frustration and challenge show very promising results that are comparable and in some cases superior to those obtained from state-of-the-art methods....

  1. Netgram: Visualizing Communities in Evolving Networks.

    Directory of Open Access Journals (Sweden)

    Raghvendra Mall

    Full Text Available Real-world complex networks are dynamic in nature and change over time. The change is usually observed in the interactions within the network over time. Complex networks exhibit community like structures. A key feature of the dynamics of complex networks is the evolution of communities over time. Several methods have been proposed to detect and track the evolution of these groups over time. However, there is no generic tool which visualizes all the aspects of group evolution in dynamic networks including birth, death, splitting, merging, expansion, shrinkage and continuation of groups. In this paper, we propose Netgram: a tool for visualizing evolution of communities in time-evolving graphs. Netgram maintains evolution of communities over 2 consecutive time-stamps in tables which are used to create a query database using the sql outer-join operation. It uses a line-based visualization technique which adheres to certain design principles and aesthetic guidelines. Netgram uses a greedy solution to order the initial community information provided by the evolutionary clustering technique such that we have fewer line cross-overs in the visualization. This makes it easier to track the progress of individual communities in time evolving graphs. Netgram is a generic toolkit which can be used with any evolutionary community detection algorithm as illustrated in our experiments. We use Netgram for visualization of topic evolution in the NIPS conference over a period of 11 years and observe the emergence and merging of several disciplines in the field of information processing systems.

  2. Evolving MEMS Resonator Designs for Fabrication

    Science.gov (United States)

    Hornby, Gregory S.; Kraus, William F.; Lohn, Jason D.

    2008-01-01

    Because of their small size and high reliability, microelectromechanical (MEMS) devices have the potential to revolution many areas of engineering. As with conventionally-sized engineering design, there is likely to be a demand for the automated design of MEMS devices. This paper describes our current status as we progress toward our ultimate goal of using an evolutionary algorithm and a generative representation to produce designs of a MEMS device and successfully demonstrate its transfer to an actual chip. To produce designs that are likely to transfer to reality, we present two ways to modify evaluation of designs. The first is to add location noise, differences between the actual dimensions of the design and the design blueprint, which is a technique we have used for our work in evolving antennas and robots. The second method is to add prestress to model the warping that occurs during the extreme heat of fabrication. In future we expect to fabricate and test some MEMS resonators that are evolved in this way.

  3. Netgram: Visualizing Communities in Evolving Networks

    Science.gov (United States)

    Mall, Raghvendra; Langone, Rocco; Suykens, Johan A. K.

    2015-01-01

    Real-world complex networks are dynamic in nature and change over time. The change is usually observed in the interactions within the network over time. Complex networks exhibit community like structures. A key feature of the dynamics of complex networks is the evolution of communities over time. Several methods have been proposed to detect and track the evolution of these groups over time. However, there is no generic tool which visualizes all the aspects of group evolution in dynamic networks including birth, death, splitting, merging, expansion, shrinkage and continuation of groups. In this paper, we propose Netgram: a tool for visualizing evolution of communities in time-evolving graphs. Netgram maintains evolution of communities over 2 consecutive time-stamps in tables which are used to create a query database using the sql outer-join operation. It uses a line-based visualization technique which adheres to certain design principles and aesthetic guidelines. Netgram uses a greedy solution to order the initial community information provided by the evolutionary clustering technique such that we have fewer line cross-overs in the visualization. This makes it easier to track the progress of individual communities in time evolving graphs. Netgram is a generic toolkit which can be used with any evolutionary community detection algorithm as illustrated in our experiments. We use Netgram for visualization of topic evolution in the NIPS conference over a period of 11 years and observe the emergence and merging of several disciplines in the field of information processing systems. PMID:26356538

  4. BOOK REVIEW: OPENING SCIENCE, THE EVOLVING GUIDE ...

    Science.gov (United States)

    The way we get our funding, collaborate, do our research, and get the word out has evolved over hundreds of years but we can imagine a more open science world, largely facilitated by the internet. The movement towards this more open way of doing and presenting science is coming, and it is not taking hundreds of years. If you are interested in these trends, and would like to find out more about where this is all headed and what it means to you, consider downloding Opening Science, edited by Sönke Bartling and Sascha Friesike, subtitled The Evolving Guide on How the Internet is Changing Research, Collaboration, and Scholarly Publishing. In 26 chapters by various authors from a range of disciplines the book explores the developing world of open science, starting from the first scientific revolution and bringing us to the next scientific revolution, sometimes referred to as “Science 2.0”. Some of the articles deal with the impact of the changing landscape of how science is done, looking at the impact of open science on Academia, or journal publishing, or medical research. Many of the articles look at the uses, pitfalls, and impact of specific tools, like microblogging (think Twitter), social networking, and reference management. There is lots of discussion and definition of terms you might use or misuse like “altmetrics” and “impact factor”. Science will probably never be completely open, and Twitter will probably never replace the journal article,

  5. Rapid quantitative PCR assays for the simultaneous detection of herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and human herpesvirus 6 DNA in blood and other clinical specimens

    NARCIS (Netherlands)

    Engelmann, I.; Petzold, D. R.; Kosinska, A.; Hepkema, B. G.; Schulz, T. F.; Heim, A.

    Rapid diagnosis of human herpesvirus primary infections or reactivations is facilitated by quantitative PCRs. Quantitative PCR assays with a standard thermal cycling profile permitting simultaneous detection of herpes simplex virus (HSV), varicella zoster virus (VZV), cytomegalovirus (CMV),

  6. Visual DNA -- identification of DNA sequence variations by bead trapping.

    Science.gov (United States)

    Ståhl, Patrik L; Gantelius, Jesper; Natanaelsson, Christian; Ahmadian, Afshin; Andersson-Svahn, Helene; Lundeberg, Joakim

    2007-12-01

    In this paper we describe a method that uses the nearly covalent strength biotin-streptavidin interaction to attach a paramagnetic bead of micrometer size to a DNA molecule of nanometer size, scaling up the spatial size of a query DNA strand by a factor of 1000, making it visible to the human eye. The use of magnetic principles enables rapid binding and washing of detector beads, facilitating a readout of amplified DNA sequences in a few minutes. Here we exemplify the method on mitochondrial DNA variations using an array platform. Visual identification and documentation can be performed with an ordinary mobile phone equipped with a built-in camera.

  7. Evolutionary rates and patterns for human transcription factor binding sites derived from repetitive DNA

    Directory of Open Access Journals (Sweden)

    McDonald John F

    2008-05-01

    Full Text Available Abstract Background The majority of human non-protein-coding DNA is made up of repetitive sequences, mainly transposable elements (TEs. It is becoming increasingly apparent that many of these repetitive DNA sequence elements encode gene regulatory functions. This fact has important evolutionary implications, since repetitive DNA is the most dynamic part of the genome. We set out to assess the evolutionary rate and pattern of experimentally characterized human transcription factor binding sites (TFBS that are derived from repetitive versus non-repetitive DNA to test whether repeat-derived TFBS are in fact rapidly evolving. We also evaluated the position-specific patterns of variation among TFBS to look for signs of functional constraint on TFBS derived from repetitive and non-repetitive DNA. Results We found numerous experimentally characterized TFBS in the human genome, 7–10% of all mapped sites, which are derived from repetitive DNA sequences including simple sequence repeats (SSRs and TEs. TE-derived TFBS sequences are far less conserved between species than TFBS derived from SSRs and non-repetitive DNA. Despite their rapid evolution, several lines of evidence indicate that TE-derived TFBS are functionally constrained. First of all, ancient TE families, such as MIR and L2, are enriched for TFBS relative to younger families like Alu and L1. Secondly, functionally important positions in TE-derived TFBS, specifically those residues thought to physically interact with their cognate protein binding factors (TF, are more evolutionarily conserved than adjacent TFBS positions. Finally, TE-derived TFBS show position-specific patterns of sequence variation that are highly distinct from random patterns and similar to the variation seen for non-repeat derived sequences of the same TFBS. Conclusion The abundance of experimentally characterized human TFBS that are derived from repetitive DNA speaks to the substantial regulatory effects that this class of

  8. HIV Maintains an Evolving and Dispersed Population in Multiple Tissues during Suppressive Combined Antiretroviral Therapy in Individuals with Cancer.

    Science.gov (United States)

    Rose, Rebecca; Lamers, Susanna L; Nolan, David J; Maidji, Ekaterina; Faria, N R; Pybus, Oliver G; Dollar, James J; Maruniak, Samuel A; McAvoy, Andrew C; Salemi, Marco; Stoddart, Cheryl A; Singer, Elyse J; McGrath, Michael S

    2016-10-15

    While combined antiretroviral therapy (cART) can result in undetectable plasma viral loads, it does not eradicate HIV infection. Furthermore, HIV-infected individuals while on cART remain at an increased risk of developing serious comorbidities, such as cancer, neurological disease, and atherosclerosis, suggesting that during cART, tissue-based HIV may contribute to such pathologies. We obtained DNA and RNA env, nef, and pol sequences using single-genome sequencing from postmortem tissues of three HIV(+) cART-treated (cART(+)) individuals with undetectable viral load and metastatic cancer at death and performed time-scaled Bayesian evolutionary analyses. We used a sensitive in situ hybridization technique to visualize HIV gag-pol mRNA transcripts in cerebellum and lymph node tissues from one patient. Tissue-associated virus evolved at similar rates in cART(+) and cART-naive (cART(-)) patients. Phylogenetic trees were characterized by two distinct features: (i) branching patterns consistent with constant viral evolution and dispersal among tissues and (ii) very recently derived clades containing both DNA and RNA sequences from multiple tissues. Rapid expansion of virus near death corresponded to wide-spread metastasis. HIV RNA(+) cells clustered in cerebellum tissue but were dispersed in lymph node tissue, mirroring the evolutionary patterns observed for that patient. Activated, infiltrating macrophages were associated with HIV RNA. Our data provide evidence that tissues serve as a sanctuary for wild-type HIV during cART and suggest the importance of macrophages as an alternative reservoir and mechanism of virus spread. Combined antiretroviral therapy (cART) reduces plasma HIV to undetectable levels; however, removal of cART results in plasma HIV rebound, thus highlighting its inability to entirely rid the body of infection. Additionally, HIV-infected individuals on cART remain at high risk of serious diseases, which suggests a contribution from residual HIV. In

  9. NASA's Space Launch System: An Evolving Capability for Exploration

    Science.gov (United States)

    Creech, Stephen D.; Robinson, Kimberly F.

    2016-01-01

    A foundational capability for international human deep-space exploration, NASA's Space Launch System (SLS) vehicle represents a new spaceflight infrastructure asset, creating opportunities for mission profiles and space systems that cannot currently be executed. While the primary purpose of SLS, which is making rapid progress towards initial launch readiness in two years, will be to support NASA's Journey to Mars, discussions are already well underway regarding other potential utilization of the vehicle's unique capabilities. In its initial Block 1 configuration, capable of launching 70 metric tons (t) to low Earth orbit (LEO), SLS will propel the Orion crew vehicle to cislunar space, while also delivering small CubeSat-class spacecraft to deep-space destinations. With the addition of a more powerful upper stage, the Block 1B configuration of SLS will be able to deliver 105 t to LEO and enable more ambitious human missions into the proving ground of space. This configuration offers opportunities for launching co-manifested payloads with the Orion crew vehicle, and a class of secondary payloads, larger than today's CubeSats. Further upgrades to the vehicle, including advanced boosters, will evolve its performance to 130 t in its Block 2 configuration. Both Block 1B and Block 2 also offer the capability to carry 8.4- or 10-m payload fairings, larger than any contemporary launch vehicle. With unmatched mass-lift capability, payload volume, and C3, SLS not only enables spacecraft or mission designs currently impossible with contemporary EELVs, it also offers enhancing benefits, such as reduced risk, operational costs and/or complexity, shorter transit time to destination or launching large systems either monolithically or in fewer components. This paper will discuss both the performance and capabilities of Space Launch System as it evolves, and the current state of SLS utilization planning.

  10. The DNA Files

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-06-09

    The DNA Files is a radio documentary which disseminates genetics information over public radio. The documentaries explore subjects which include the following: How genetics affects society. How human life began and how it evolved. Could new prenatal genetic tests hold the key to disease prevention later in life? Would a national genetic data base sacrifice individual privacy? and Should genes that may lead to the cure for cancer be privately owned? This report serves as a project update for the second quarter of 1998. It includes the spring/summer 1998 newsletter, the winter 1998 newsletter, the program clock, and the latest flyer.

  11. Counseling and Family Therapy in India: Evolving Professions in a Rapidly Developing Nation

    Science.gov (United States)

    Carson, David K.; Jain, Sachin; Ramirez, Sylvia

    2009-01-01

    Outpatient counseling is a relatively new concept and form of clinical practice in India. This article provides an overview of the need for and current status of counseling and family therapy in India. Examples of training programs are presented, and future prospects for the counseling and family therapy professions are highlighted. The authors…

  12. The Information Technology Program Manager’s Dilemma: Rapidly Evolving Technology and Stagnant Processes

    Science.gov (United States)

    2010-08-01

    information technology systems. The current DoDI 5000.02 leaves IT project and program managers wondering how the current process applies to them, as the guidance is fairly rigid and does not allow for the flexibility required to appropriately manage IT programs. Until very recently, in comparison to the development of a traditional weapons system, IT programs seemed to have been viewed as a utility or service instead of a critical component to national security. Perhaps that is because data passing through cables cannot be observed with the naked senses and therefore an

  13. INDIAN BUSINESSMEN IN FRANCE: AN INITIAL EXAMINATION OF THEIR ACTIVITIES IN A RAPIDLY-EVOLVING CONTEXT

    Directory of Open Access Journals (Sweden)

    Vasoodeven Vuddamalay

    2010-12-01

    Full Text Available The aim of this article is to understand the implications of the recent economic and political evolution of Indian immigration in Europe, and specifically in France, their businesses and entrepreneurial groups, as well as their links with the countries of origin/welcoming countries and their transnational networks, using an historical and geoanthropological approach. The analysis also covers the essential links that the transnational entrepreneurs establish between France/Europe and the rest of the world, particularly with the emerging cities of Asia, the Middle East and, possibly, certain parts of Africa, such as South Africa, the Mascarene Islands and East Africa. To that end, the author begins by contextualising Indian business projects in France, before going on to examine the current situation of ethnic shops, the transnational companies of traditional trading communities and, to some extent, their Institute of Information Technology networks. The author also carries out a study of the “Mittal Case” as a new paradigm of research within the changing world economy, as the traditional North-South separation is undermined and the complexities of fields in research on trading and business groups is renewed. Finally, the author situates these debates within the growing world knowledge of the communities of Indian immigrants in France and their small ethnic businessmen and traders.

  14. Development of rapidly evolving intron markers to estimate multilocus species trees of rodents.

    Directory of Open Access Journals (Sweden)

    Ana Rodríguez-Prieto

    Full Text Available One of the major challenges in the analysis of closely related species, speciation and phylogeography is the identification of variable sequence markers that allow the determination of genealogical relationships in multiple genomic regions using coalescent and species tree approaches. Rodent species represent nearly half of the mammalian diversity, but so far no systematic study has been carried out to detect suitable informative markers for this group. Here, we used a bioinformatic pipeline to extract intron sequences from rodent genomes available in databases and applied a series of filters that allowed the identification of 208 introns that adequately fulfilled several criteria for these studies. The main required characteristics of the introns were that they had the maximum possible mutation rates, that they were part of single-copy genes, that they had an appropriate sequence length for amplification, and that they were flanked by exons with suitable regions for primer design. In addition, in order to determine the validity of this approach, we chose ten of these introns for primer design and tested them in a panel of eleven rodent species belonging to different representative families. We show that all these introns can be amplified in the majority of species and that, overall, 79% of the amplifications worked with minimum optimization of the annealing temperature. In addition, we confirmed for a pair of sister species the relatively high level of sequence divergence of these introns. Therefore, we provide here a set of adequate intron markers that can be applied to different species of Rodentia for their use in studies that require significant sequence variability.

  15. The rapidly evolving therapies for advanced melanoma--Towards immunotherapy, molecular targeted therapy, and beyond.

    Science.gov (United States)

    Zhu, Ziqiang; Liu, Wei; Gotlieb, Vladimir

    2016-03-01

    The incidence of melanoma in both males and females continues to rise during the past 40 years despite the stable or declining trends for most cancer types. Due to the tremendous advance in immunobiology and molecular biology, breakthroughs in both immunotherapies and molecular targeted therapies have recently revolutionized the standard of care for patients with advanced melanoma. In 2011, US Food and Drug Administration (FDA) approved ipilimumab, an anti-cytotoxic T-lymphocyte antigen-4 (CTLA-4) antibody for metastatic melanoma therapy. Since then, novel drugs including antibodies to programmed cell death 1 (PD-1) such as pembrolizumab and nivolumab (both approved in 2014), selective BRAF inhibitors such as vemurafenib (approved in 2011), dabrafenib (approved in 2013); and MEK inhibitor trametinib (approved in 2013), have greatly extended the potential of immunotherapy and molecular targeted therapy for advanced melanoma. All of which have been demonstrated a significant increase in overall survival rate, and long-term benefits in multiple large clinical trials. Several new agents and novel therapies are currently under phase III clinical trials with the hope of being approved in the near future. We already entered a golden era in oncology that are providing significant survival improvement. In the meantime, new challenges for clinicians also started to emerge. In this review, we presented the existing evidence for the newest treatments for advanced melanoma, including CTLA-4, PD-1/PD-L1 checkpoint inhibitors and BRAF, MEK inhibitors. We also discussed the strengths, limitations and challenges of using these novel therapies, and potential solutions as well as highlighted the areas requiring further research. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. Rapidly evolving circularly polarized emission during the 1994 outburst of GRO J1655-40

    NARCIS (Netherlands)

    Macquart, JP; Wu, K; Sault, RJ; Hannikainen, DC

    2002-01-01

    We report the detection of circular polarization during the 1994 outburst of the Galactic microquasar GRO J1655-40. The circular polarization is clearly detected at 1.4 and 2.4 GHz, but not at 4.8 and 8.4 GHz, where its magnitude never exceeds 5 mJy. Both the sign and magnitude of the circular

  17. Evolving Technology, Shifting Expectations: Cultivating Pedagogy for a Rapidly Changing GIS Landscape

    Science.gov (United States)

    Ricker, Britta; Thatcher, Jim

    2017-01-01

    As humans and natural processes continuously reshape the surface of the Earth, there is an unceasing need to document and analyze them through the use of Geographic Information Systems (GIS). The public is gaining more access to spatial technologies that were once only available to highly trained professionals. With technological evolution comes a…

  18. Transforming Research in Oceanography through Education, Ethnography and Rapidly Evolving Technologies: An NSF-INSPIRE project.

    Science.gov (United States)

    German, C. R.; Croff Bell, K. L.; Pallant, A.; Mirmalek, Z.; Jasanoff, S.; Rajan, K.

    2014-12-01

    This paper will discuss a new NSF-INSPIRE project that brings together research conducted in the fields of Ocean Sciences, Education & Human Resources and Computer and Information Science & Engineering. Specifically, our objective is to investigate new methods by which telepresence can be used to conduct cutting edge research and provide authentic educational experiences to undergraduate students, remotely. We choose to conduct this research in an Oceanographic context for two reasons: first with the move toward smaller research ships in the national Oceanographic research fleet, we anticipate that access to berth space at sea will continue to be at a premium. Any component of traditional oceanographic research that can be ported to shore without loss of effectiveness would be of immediate benefit to the Ocean Sciences. Equally, however, we argue that any improvements to work place and/or education practices that we can identify while delivering research and education from the bottom of the deep ocean should be readily mappable to any other scientific or engineering activities that seek to make use of telepresence in less extreme remote environments. Work on our TREET project, to-date, has included recruitment of 6 early career scientists keen to take advantage of the research opportunity provided, together with two senior science mentors with experience using Telepresence and a cohort of undergraduate students at three of the ECS partner Universities, spanning 4 time zones across the continental US. Following a 12-week synchronous on-line seminar series taught in Spring-Summer 2014, the entire team joined together at the Inner Space Center in Sept-Oct 2014 to participate, virtually, in a cruise of research and exploration to the Kick'Em Jenny underwater volcano and adjacent cold seep sites, conducted by the Ocean Exploration Trust's ROV Hercules aboard the Exploration Vessel Nautilus. Our presentation will include preliminary results from that cruise.

  19. An RNA gene expressed during cortical development evolved rapidly in humans

    DEFF Research Database (Denmark)

    Pollard, Katherine S; Salama, Sofie R; Lambert, Nelle

    2006-01-01

    of the human brain. We devised a ranking of regions in the human genome that show significant evolutionary acceleration. Here we report that the most dramatic of these 'human accelerated regions', HAR1, is part of a novel RNA gene (HAR1F) that is expressed specifically in Cajal-Retzius neurons...

  20. Evolving Digital Publishing Opportunities across Composition Studies

    Science.gov (United States)

    Hawishler, Gail E.; Selfe, Cynthia L.

    2014-01-01

    In this article, the authors report since the early 1980s, the profession has seen plenty of changes in the arena of digital scholarly publishing: during this time, while the specific challenges have seldom remained the same, the presence and the pressures of rapid technological change endure. In fact, as an editorial team that has, in part,…

  1. Evolving chromosomes and gene regulatory networks

    Indian Academy of Sciences (India)

    Aswin

    Many processes change genomes. Koonin and Wolf. 2008. Page 5 .. including horizontal gene transfer. Koonin and Wolf. 2008. Page 6. Horizontal gene transfer. Drastic modification of genetic material. Rapid exploration of ne niches and phenot pes. Page 7. Horizontal gene transfer regulates. New selective forces for gene ...

  2. Duplicated genes evolve independently in allopolyploid cotton.

    Science.gov (United States)

    Richard C. Cronn; Randall L. Small; Jonathan F. Wendel

    1999-01-01

    Of the many processes that generate gene duplications, polyploidy is unique in that entire genomes are duplicated. This process has been important in the evolution of many eukaryotic groups, and it occurs with high frequency in plants. Recent evidence suggests that polyploidization may be accompanied by rapid genomic changes, but the evolutionary fate of discrete loci...

  3. Evolving water science in the Anthropocene

    NARCIS (Netherlands)

    Savenije, H.H.G.; Hoekstra, A.Y.; Van der Zaag, P.

    2013-01-01

    This paper reviews the changing relation between man and water since the industrial revolution, the period that has been called the Anthropocene because of the unprecedented scale at which humans have altered the planet.We show how the rapidly changing reality urges us to continuously improve our

  4. Evolving water science in the Anthropocene

    NARCIS (Netherlands)

    Savenije, H.H.G.; Hoekstra, Arjen Ysbert; van der Zaag, P.

    2014-01-01

    This paper reviews the changing relation between human beings and water since the Industrial Revolution, a period that has been called the Anthropocene because of the unprecedented scale at which humans have altered the planet during this time. We show how the rapidly changing world urges us to

  5. Evolvability as a Quality Attribute of Software Architectures

    NARCIS (Netherlands)

    Ciraci, S.; van den Broek, P.M.; Duchien, Laurence; D'Hondt, Maja; Mens, Tom

    We review the definition of evolvability as it appears on the literature. In particular, the concept of software evolvability is compared with other system quality attributes, such as adaptability, maintainability and modifiability.

  6. Tracking correlated, simultaneously evolving target populations, II

    Science.gov (United States)

    Mahler, Ronald

    2017-05-01

    This paper is the sixth in a series aimed at weakening the independence assumptions that are typically presumed in multitarget tracking. Earlier papers investigated Bayes …lters that propagate the correlations between two evolving multitarget systems. Last year at this conference we attempted to derive PHD …lter-type approximations that account for both spatial correlation and cardinality correlation (i.e., correlation between the target numbers of the two systems). Unfortunately, this approach required heuristic models of both clutter and target appearance in order to incorporate both spatial and cardinality correlation. This paper describes a fully rigorous approach- provided, however, that spatial correlation between the two populations is ignored and only their cardinality correlations are taken into account. We derive the time-update and measurement-update equations for a CPHD …lter describing the evolution of such correlated multitarget populations.

  7. Resiliently evolving supply-demand networks.

    Science.gov (United States)

    Rubido, Nicolás; Grebogi, Celso; Baptista, Murilo S

    2014-01-01

    The ability to design a transport network such that commodities are brought from suppliers to consumers in a steady, optimal, and stable way is of great importance for distribution systems nowadays. In this work, by using the circuit laws of Kirchhoff and Ohm, we provide the exact capacities of the edges that an optimal supply-demand network should have to operate stably under perturbations, i.e., without overloading. The perturbations we consider are the evolution of the connecting topology, the decentralization of hub sources or sinks, and the intermittence of supplier and consumer characteristics. We analyze these conditions and the impact of our results, both on the current United Kingdom power-grid structure and on numerically generated evolving archetypal network topologies.

  8. A local-world evolving hypernetwork model

    Science.gov (United States)

    Yang, Guang-Yong; Liu, Jian-Guo

    2014-01-01

    Complex hypernetworks are ubiquitous in the real system. It is very important to investigate the evolution mechanisms. In this paper, we present a local-world evolving hypernetwork model by taking into account the hyperedge growth and local-world hyperedge preferential attachment mechanisms. At each time step, a newly added hyperedge encircles a new coming node and a number of nodes from a randomly selected local world. The number of the selected nodes from the local world obeys the uniform distribution and its mean value is m. The analytical and simulation results show that the hyperdegree approximately obeys the power-law form and the exponent of hyperdegree distribution is γ = 2 + 1/m. Furthermore, we numerically investigate the node degree, hyperedge degree, clustering coefficient, as well as the average distance, and find that the hypernetwork model shares the scale-free and small-world properties, which shed some light for deeply understanding the evolution mechanism of the real systems.

  9. The Evolving Theory of Evolutionary Radiations.

    Science.gov (United States)

    Simões, M; Breitkreuz, L; Alvarado, M; Baca, S; Cooper, J C; Heins, L; Herzog, K; Lieberman, B S

    2016-01-01

    Evolutionary radiations have intrigued biologists for more than 100 years, and our understanding of the patterns and processes associated with these radiations continues to grow and evolve. Recently it has been recognized that there are many different types of evolutionary radiation beyond the well-studied adaptive radiations. We focus here on multifarious types of evolutionary radiations, paying special attention to the abiotic factors that might trigger diversification in clades. We integrate concepts such as exaptation, species selection, coevolution, and the turnover-pulse hypothesis (TPH) into the theoretical framework of evolutionary radiations. We also discuss other phenomena that are related to, but distinct from, evolutionary radiations that have relevance for evolutionary biology. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Epidemic spreading on evolving signed networks

    CERN Document Server

    Saeedian, M; Jafari, G R; Kertesz, J

    2016-01-01

    Most studies of disease spreading consider the underlying social network as obtained without the contagion, though epidemic influences peoples willingness to contact others: A friendly contact may be turned to unfriendly to avoid infection. We study the susceptible-infected (SI) disease spreading model on signed networks, in which each edge is associated with a positive or negative sign representing the friendly or unfriendly relation between its end nodes. In a signed network, according to Heiders theory, edge signs evolve such that finally a state of structural balance is achieved, corresponding to no frustration in physics terms. However, the danger of infection affects the evolution of its edge signs. To describe the coupled problem of the sign evolution and disease spreading, we generalize the notion of structural balance by taking into account the state of the nodes. We introduce an energy function and carry out Monte-Carlo simulations on complete networks to test the energy landscape, where we find loc...

  11. Finch: A System for Evolving Java (Bytecode)

    Science.gov (United States)

    Orlov, Michael; Sipper, Moshe

    The established approach in genetic programming (GP) involves the definition of functions and terminals appropriate to the problem at hand, after which evolution of expressions using these definitions takes place. We have recently developed a system, dubbed FINCH (Fertile Darwinian Bytecode Harvester), to evolutionarily improve actual, extant software, which was not intentionally written for the purpose of serving as a GP representation in particular, nor for evolution in general. This is in contrast to existing work that uses restricted subsets of the Java bytecode instruction set as a representation language for individuals in genetic programming. The ability to evolve Java programs will hopefully lead to a valuable new tool in the software engineer's toolkit.

  12. Uncoupling of satellite DNA and centromeric function in the genus Equus.

    Directory of Open Access Journals (Sweden)

    Francesca M Piras

    2010-02-01

    Full Text Available In a previous study, we showed that centromere repositioning, that is the shift along the chromosome of the centromeric function without DNA sequence rearrangement, has occurred frequently during the evolution of the genus Equus. In this work, the analysis of the chromosomal distribution of satellite tandem repeats in Equus caballus, E. asinus, E. grevyi, and E. burchelli highlighted two atypical features: 1 several centromeres, including the previously described evolutionary new centromeres (ENCs, seem to be devoid of satellite DNA, and 2 satellite repeats are often present at non-centromeric termini, probably corresponding to relics of ancestral now inactive centromeres. Immuno-FISH experiments using satellite DNA and antibodies against the kinetochore protein CENP-A demonstrated that satellite-less primary constrictions are actually endowed with centromeric function. The phylogenetic reconstruction of centromere repositioning events demonstrates that the acquisition of satellite DNA occurs after the formation of the centromere during evolution and that centromeres can function over millions of years and many generations without detectable satellite DNA. The rapidly evolving Equus species gave us the opportunity to identify different intermediate steps along the full maturation of ENCs.

  13. Uncoupling of Satellite DNA and Centromeric Function in the Genus Equus

    Science.gov (United States)

    Magnani, Elisa; Bertoni, Livia; Attolini, Carmen; Khoriauli, Lela; Raimondi, Elena; Giulotto, Elena

    2010-01-01

    In a previous study, we showed that centromere repositioning, that is the shift along the chromosome of the centromeric function without DNA sequence rearrangement, has occurred frequently during the evolution of the genus Equus. In this work, the analysis of the chromosomal distribution of satellite tandem repeats in Equus caballus, E. asinus, E. grevyi, and E. burchelli highlighted two atypical features: 1) several centromeres, including the previously described evolutionary new centromeres (ENCs), seem to be devoid of satellite DNA, and 2) satellite repeats are often present at non-centromeric termini, probably corresponding to relics of ancestral now inactive centromeres. Immuno-FISH experiments using satellite DNA and antibodies against the kinetochore protein CENP-A demonstrated that satellite-less primary constrictions are actually endowed with centromeric function. The phylogenetic reconstruction of centromere repositioning events demonstrates that the acquisition of satellite DNA occurs after the formation of the centromere during evolution and that centromeres can function over millions of years and many generations without detectable satellite DNA. The rapidly evolving Equus species gave us the opportunity to identify different intermediate steps along the full maturation of ENCs. PMID:20169180

  14. Single-tube library preparation for degraded DNA

    DEFF Research Database (Denmark)

    Carøe, Christian; Gopalakrishnan, Shyam; Vinner, Lasse

    2017-01-01

    1.In recent years, massive parallel sequencing has revolutionized the study of degraded DNA, thus enabling the field of ancient DNA to evolve into that of paleogenomics. Despite these advances, the recovery and sequencing of degraded DNA remains challenging due to limitations in the manipulation ...... of single-tube library preparations, we anticipate these methods will be of considerable interest to the growing field of paleogenomics and other applications investigating degraded DNA....

  15. Mitochondrial DNA.

    Science.gov (United States)

    Wright, Russell G.; Bottino, Paul J.

    1986-01-01

    Provides background information for teachers on mitochondrial DNA, pointing out that it may have once been a free-living organism. Includes a ready-to-duplicate exercise titled "Using Microchondrial DNA to Measure Evolutionary Distance." (JN)

  16. A dnaN Plasmid Shuffle Strain for Rapid In Vivo Analysis of Mutant Escherichia coli β Clamps Provides Insight Into the Role of Clamp in umuDC-Mediated Cold Sensitivity

    Science.gov (United States)

    Babu, Vignesh M. P.; Sutton, Mark D.

    2014-01-01

    The E. coli umuDC gene products participate in two temporally distinct roles: UmuD2C acts in a DNA damage checkpoint control, while UmuD'2C, also known as DNA polymerase V (Pol V), catalyzes replication past DNA lesions via a process termed translesion DNA synthesis. These different roles of the umuDC gene products are managed in part by the dnaN-encoded β sliding clamp protein. Co-overexpression of the β clamp and Pol V severely blocked E. coli growth at 30°C. We previously used a genetic assay that was independent of the ability of β clamp to support E. coli viability to isolate 8 mutant clamp proteins (βQ61K, βS107L, βD150N, βG157S, βV170M, βE202K, βM204K and βP363S) that failed to block growth at 30°C when co-overexpressed with Pol V. It was unknown whether these mutant clamps were capable of supporting E. coli viability and normal umuDC functions in vivo. The goals of this study were to answer these questions. To this end, we developed a novel dnaN plasmid shuffle assay. Using this assay, βD150N and βP363S were unable to support E. coli viability. The remaining 6 mutant clamps, each of which supported viability, were indistinguishable from β+ with respect to umuDC functions in vivo. In light of these findings, we analyzed phenotypes of strains overexpressing either β clamp or Pol V alone. The strain overexpressing β+, but not those expressing mutant β clamps, displayed slowed growth irrespective of the incubation temperature. Moreover, growth of the Pol V-expressing strain was modestly slowed at 30°, but not 42°C. Taken together, these results suggest the mutant clamps were identified due to their inability to slow growth rather than an inability to interact with Pol V. They further suggest that cold sensitivity is due, at least in part, to the combination of their individual effects on growth at 30°C. PMID:24896652

  17. Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.

    Science.gov (United States)

    Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří

    2016-11-01

    Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.

  18. Human RAD52 Captures and Holds DNA Strands, Increases DNA Flexibility, and Prevents Melting of Duplex DNA: Implications for DNA Recombination

    Directory of Open Access Journals (Sweden)

    Ineke Brouwer

    2017-03-01

    Full Text Available Human RAD52 promotes annealing of complementary single-stranded DNA (ssDNA. In-depth knowledge of RAD52-DNA interaction is required to understand how its activity is integrated in DNA repair processes. Here, we visualize individual fluorescent RAD52 complexes interacting with single DNA molecules. The interaction with ssDNA is rapid, static, and tight, where ssDNA appears to wrap around RAD52 complexes that promote intra-molecular bridging. With double-stranded DNA (dsDNA, interaction is slower, weaker, and often diffusive. Interestingly, force spectroscopy experiments show that RAD52 alters the mechanics dsDNA by enhancing DNA flexibility and increasing DNA contour length, suggesting intercalation. RAD52 binding changes the nature of the overstretching transition of dsDNA and prevents DNA melting, which is advantageous for strand clamping during or after annealing. DNA-bound RAD52 is efficient at capturing ssDNA in trans. Together, these effects may help key steps in DNA repair, such as second-end capture during homologous recombination or strand annealing during RAD51-independent recombination reactions.

  19. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  20. The evolving energy budget of accretionary wedges

    Science.gov (United States)

    McBeck, Jessica; Cooke, Michele; Maillot, Bertrand; Souloumiac, Pauline

    2017-04-01

    The energy budget of evolving accretionary systems reveals how deformational processes partition energy as faults slip, topography uplifts, and layer-parallel shortening produces distributed off-fault deformation. The energy budget provides a quantitative framework for evaluating the energetic contribution or consumption of diverse deformation mechanisms. We investigate energy partitioning in evolving accretionary prisms by synthesizing data from physical sand accretion experiments and numerical accretion simulations. We incorporate incremental strain fields and cumulative force measurements from two suites of experiments to design numerical simulations that represent accretionary wedges with stronger and weaker detachment faults. One suite of the physical experiments includes a basal glass bead layer and the other does not. Two physical experiments within each suite implement different boundary conditions (stable base versus moving base configuration). Synthesizing observations from the differing base configurations reduces the influence of sidewall friction because the force vector produced by sidewall friction points in opposite directions depending on whether the base is fixed or moving. With the numerical simulations, we calculate the energy budget at two stages of accretion: at the maximum force preceding the development of the first thrust pair, and at the minimum force following the development of the pair. To identify the appropriate combination of material and fault properties to apply in the simulations, we systematically vary the Young's modulus and the fault static and dynamic friction coefficients in numerical accretion simulations, and identify the set of parameters that minimizes the misfit between the normal force measured on the physical backwall and the numerically simulated force. Following this derivation of the appropriate material and fault properties, we calculate the components of the work budget in the numerical simulations and in the

  1. Photochemical Acceleration of DNA Strand Displacement by Using Ultrafast DNA Photo-crosslinking.

    Science.gov (United States)

    Nakamura, Shigetaka; Hashimoto, Hirokazu; Kobayashi, Satoshi; Fujimoto, Kenzo

    2017-10-18

    DNA strand displacement is an essential reaction in genetic recombination, biological processes, and DNA nanotechnology. In particular, various DNA nanodevices enable complicated calculations. However, it takes time before the output is obtained, so acceleration of DNA strand displacement is required for a rapid-response DNA nanodevice. Herein, DNA strand displacement by using DNA photo-crosslinking to accelerate this displacement is evaluated. The DNA photo-crosslinking of 3-cyanovinylcarbazole ( CNV K) was accelerated at least 20 times, showing a faster DNA strand displacement. The rate of photo-crosslinking is a key factor and the rate of DNA strand displacement is accelerated through ultrafast photo-crosslinking. The rate of DNA strand displacement was regulated by photoirradiation energy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Evolving Nonthermal Electron Distributions in Simulations of Sgr A*

    Science.gov (United States)

    Chael, Andrew; Narayan, Ramesh

    2018-01-01

    The accretion flow around Sagittarius A* (Sgr A*), the black hole at the Galactic Center, produces strong variability from the radio to X-rays on timescales of minutes to hours. This rapid, powerful variability is thought to be powered by energetic particle acceleration by plasma processes like magnetic reconnection and shocks. These processes can accelerate particles into non-thermal distributions which do not quickly isothermal in the low densities found around hot accretion flows. Current state-of-the-art simulations of accretion flows around black holes assume either a single-temperature gas or, at best, a two-temperature gas with thermal ions and electrons. We present results from incorporating the self-consistent evolution of a non-thermal electron population in a GRRMHD simulation of Sgr A*. The electron distribution is evolved across space, time, and Lorentz factor in parallel with background thermal ion, electron, and radiation fluids. Energy injection into the non-thermal distribution is modeled with a sub-grid prescription based on results from particle-in-cell simulations of magnetic reconnection. The energy distribution of the non-thermal electrons shows strong variability, and the spectral shape traces the complex interplay between the local viscous heating rate, magnetic field strength, and fluid velocity. Results from these simulations will be used in interpreting forthcoming data from the Event Horizon Telescope that resolves Sgr A*'s sub-mm variability in both time and space.

  3. Meiosis evolves: adaptation to external and internal environments.

    Science.gov (United States)

    Bomblies, Kirsten; Higgins, James D; Yant, Levi

    2015-10-01

    306 I. 306 II. 307 III. 312 IV. 317 V. 318 319 References 319 SUMMARY: Meiosis is essential for the fertility of most eukaryotes and its structures and progression are conserved across kingdoms. Yet many of its core proteins show evidence of rapid or adaptive evolution. What drives the evolution of meiosis proteins? How can constrained meiotic processes be modified in response to challenges without compromising their essential functions? In surveying the literature, we found evidence of two especially potent challenges to meiotic chromosome segregation that probably necessitate adaptive evolutionary responses: whole-genome duplication and abiotic environment, especially temperature. Evolutionary solutions to both kinds of challenge are likely to involve modification of homologous recombination and synapsis, probably via adjustments of core structural components important in meiosis I. Synthesizing these findings with broader patterns of meiosis gene evolution suggests that the structural components of meiosis coevolve as adaptive modules that may change in primary sequence and function while maintaining three-dimensional structures and protein interactions. The often sharp divergence of these genes among species probably reflects periodic modification of entire multiprotein complexes driven by genomic or environmental changes. We suggest that the pressures that cause meiosis to evolve to maintain fertility may cause pleiotropic alterations of global crossover rates. We highlight several important areas for future research. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  4. No surviving evolved companions of the progenitor of SN 1006.

    Science.gov (United States)

    González Hernández, Jonay I; Ruiz-Lapuente, Pilar; Tabernero, Hugo M; Montes, David; Canal, Ramon; Méndez, Javier; Bedin, Luigi R

    2012-09-27

    Type Ia supernovae are thought to occur when a white dwarf made of carbon and oxygen accretes sufficient mass to trigger a thermonuclear explosion. The accretion could be slow, from an unevolved (main-sequence) or evolved (subgiant or giant) star (the single-degenerate channel), or rapid, as the primary star breaks up a smaller orbiting white dwarf (the double-degenerate channel). A companion star will survive the explosion only in the single-degenerate channel. Both channels might contribute to the production of type Ia supernovae, but the relative proportions of their contributions remain a fundamental puzzle in astronomy. Previous searches for remnant companions have revealed one possible case for SN 1572 (refs 8, 9), although that has been questioned. More recently, observations have restricted surviving companions to be small, main-sequence stars, ruling out giant companions but still allowing the single-degenerate channel. Here we report the results of a search for surviving companions of the progenitor of SN 1006 (ref. 14). None of the stars within 4 arc minutes of the apparent site of the explosion is associated with the supernova remnant, and we can firmly exclude all giant and subgiant stars from being companions of the progenitor. In combination with previous results, our findings indicate that fewer than 20 per cent of type Ia supernovae occur through the single-degenerate channel.

  5. On the Critical Role of Divergent Selection in Evolvability

    Directory of Open Access Journals (Sweden)

    Joel Lehman

    2016-08-01

    Full Text Available An ambitious goal in evolutionary robotics is to evolve increasingly complex robotic behaviors with minimal human design effort. Reaching this goal requires evolutionary algorithms that can unlock from genetic encodings their latent potential for evolvability. One issue clouding this goal is conceptual confusion about evolvability, which often obscures the aspects of evolvability that are important or desirable. The danger from such confusion is that it may establish unrealistic goals for evolvability that prove unproductive in practice. An important issue separate from conceptual confusion is the common misalignment between selection and evolvability in evolutionary robotics. While more expressive encodings can represent higher-level adaptations (e.g. sexual reproduction or developmental systems that increase long-term evolutionary potential (i.e. evolvability, realizing such potential requires gradients of fitness and evolvability to align. In other words, selection is often a critical factor limiting increasing evolvability. Thus, drawing from a series of recent papers, this article seeks to both (1 clarify and focus the ways in which the term evolvability is used within artificial evolution, and (2 argue for the importance of one type of selection, i.e. divergent selection, for enabling evolvability. The main argument is that there is a fundamental connection between divergent selection and evolvability (on both the individual and population level that does not hold for typical goal-oriented selection. The conclusion is that selection pressure plays a critical role in realizing the potential for evolvability, and that divergent selection in particular provides a principled mechanism for encouraging evolvability in artificial evolution.

  6. How does cognition evolve? Phylogenetic comparative psychology

    Science.gov (United States)

    Matthews, Luke J.; Hare, Brian A.; Nunn, Charles L.; Anderson, Rindy C.; Aureli, Filippo; Brannon, Elizabeth M.; Call, Josep; Drea, Christine M.; Emery, Nathan J.; Haun, Daniel B. M.; Herrmann, Esther; Jacobs, Lucia F.; Platt, Michael L.; Rosati, Alexandra G.; Sandel, Aaron A.; Schroepfer, Kara K.; Seed, Amanda M.; Tan, Jingzhi; van Schaik, Carel P.; Wobber, Victoria

    2014-01-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution. PMID:21927850

  7. Approximating centrality in evolving graphs: toward sublinearity

    Science.gov (United States)

    Priest, Benjamin W.; Cybenko, George

    2017-05-01

    The identification of important nodes is a ubiquitous problem in the analysis of social networks. Centrality indices (such as degree centrality, closeness centrality, betweenness centrality, PageRank, and others) are used across many domains to accomplish this task. However, the computation of such indices is expensive on large graphs. Moreover, evolving graphs are becoming increasingly important in many applications. It is therefore desirable to develop on-line algorithms that can approximate centrality measures using memory sublinear in the size of the graph. We discuss the challenges facing the semi-streaming computation of many centrality indices. In particular, we apply recent advances in the streaming and sketching literature to provide a preliminary streaming approximation algorithm for degree centrality utilizing CountSketch and a multi-pass semi-streaming approximation algorithm for closeness centrality leveraging a spanner obtained through iteratively sketching the vertex-edge adjacency matrix. We also discuss possible ways forward for approximating betweenness centrality, as well as spectral measures of centrality. We provide a preliminary result using sketched low-rank approximations to approximate the output of the HITS algorithm.

  8. How does cognition evolve? Phylogenetic comparative psychology.

    Science.gov (United States)

    MacLean, Evan L; Matthews, Luke J; Hare, Brian A; Nunn, Charles L; Anderson, Rindy C; Aureli, Filippo; Brannon, Elizabeth M; Call, Josep; Drea, Christine M; Emery, Nathan J; Haun, Daniel B M; Herrmann, Esther; Jacobs, Lucia F; Platt, Michael L; Rosati, Alexandra G; Sandel, Aaron A; Schroepfer, Kara K; Seed, Amanda M; Tan, Jingzhi; van Schaik, Carel P; Wobber, Victoria

    2012-03-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution.

  9. On the Discovery of Evolving Truth.

    Science.gov (United States)

    Li, Yaliang; Li, Qi; Gao, Jing; Su, Lu; Zhao, Bo; Fan, Wei; Han, Jiawei

    2015-08-01

    In the era of big data, information regarding the same objects can be collected from increasingly more sources. Unfortunately, there usually exist conflicts among the information coming from different sources. To tackle this challenge, truth discovery, i.e., to integrate multi-source noisy information by estimating the reliability of each source, has emerged as a hot topic. In many real world applications, however, the information may come sequentially, and as a consequence, the truth of objects as well as the reliability of sources may be dynamically evolving. Existing truth discovery methods, unfortunately, cannot handle such scenarios. To address this problem, we investigate the temporal relations among both object truths and source reliability, and propose an incremental truth discovery framework that can dynamically update object truths and source weights upon the arrival of new data. Theoretical analysis is provided to show that the proposed method is guaranteed to converge at a fast rate. The experiments on three real world applications and a set of synthetic data demonstrate the advantages of the proposed method over state-of-the-art truth discovery methods.

  10. Sexual regret: evidence for evolved sex differences.

    Science.gov (United States)

    Galperin, Andrew; Haselton, Martie G; Frederick, David A; Poore, Joshua; von Hippel, William; Buss, David M; Gonzaga, Gian C

    2013-10-01

    Regret and anticipated regret enhance decision quality by helping people avoid making and repeating mistakes. Some of people's most intense regrets concern sexual decisions. We hypothesized evolved sex differences in women's and men's experiences of sexual regret. Because of women's higher obligatory costs of reproduction throughout evolutionary history, we hypothesized that sexual actions, particularly those involving casual sex, would be regretted more intensely by women than by men. In contrast, because missed sexual opportunities historically carried higher reproductive fitness costs for men than for women, we hypothesized that poorly chosen sexual inactions would be regretted more by men than by women. Across three studies (Ns = 200, 395, and 24,230), we tested these hypotheses using free responses, written scenarios, detailed checklists, and Internet sampling to achieve participant diversity, including diversity in sexual orientation. Across all data sources, results supported predicted psychological sex differences and these differences were localized in casual sex contexts. These findings are consistent with the notion that the psychology of sexual regret was shaped by recurrent sex differences in selection pressures operating over deep time.

  11. Extracting evolving pathologies via spectral clustering.

    Science.gov (United States)

    Bernardis, Elena; Pohl, Kilian M; Davatzikos, Christos

    2013-01-01

    A bottleneck in the analysis of longitudinal MR scans with white matter brain lesions is the temporally consistent segmentation of the pathology. We identify pathologies in 3D+t(ime) within a spectral graph clustering framework. Our clustering approach simultaneously segments and tracks the evolving lesions by identifying characteristic image patterns at each time-point and voxel correspondences across time-points. For each 3D image, our method constructs a graph where weights between nodes capture the likeliness of two voxels belonging to the same region. Based on these weights, we then establish rough correspondences between graph nodes at different time-points along estimated pathology evolution directions. We combine the graphs by aligning the weights to a reference time-point, thus integrating temporal information across the 3D images, and formulate the 3D+t segmentation problem as a binary partitioning of this graph. The resulting segmentation is very robust to local intensity fluctuations and yields better results than segmentations generated for each time-point.

  12. Functional Topology of Evolving Urban Drainage Networks

    Science.gov (United States)

    Yang, Soohyun; Paik, Kyungrock; McGrath, Gavan S.; Urich, Christian; Krueger, Elisabeth; Kumar, Praveen; Rao, P. Suresh C.

    2017-11-01

    We investigated the scaling and topology of engineered urban drainage networks (UDNs) in two cities, and further examined UDN evolution over decades. UDN scaling was analyzed using two power law scaling characteristics widely employed for river networks: (1) Hack's law of length (L)-area (A) [L∝Ah] and (2) exceedance probability distribution of upstream contributing area (δ) [P>(A≥δ>)˜aδ-ɛ]. For the smallest UDNs ((A≥δ>) plots for river networks are abruptly truncated, those for UDNs display exponential tempering [P>(A≥δ>)=aδ-ɛexp⁡>(-cδ>)]. The tempering parameter c decreases as the UDNs grow, implying that the distribution evolves in time to resemble those for river networks. However, the power law exponent ɛ for large UDNs tends to be greater than the range reported for river networks. Differences in generative processes and engineering design constraints contribute to observed differences in the evolution of UDNs and river networks, including subnet heterogeneity and nonrandom branching.

  13. The Evolving Classification of Pulmonary Hypertension.

    Science.gov (United States)

    Foshat, Michelle; Boroumand, Nahal

    2017-05-01

    - An explosion of information on pulmonary hypertension has occurred during the past few decades. The perception of this disease has shifted from purely clinical to incorporate new knowledge of the underlying pathology. This transfer has occurred in light of advancements in pathophysiology, histology, and molecular medical diagnostics. - To update readers about the evolving understanding of the etiology and pathogenesis of pulmonary hypertension and to demonstrate how pathology has shaped the current classification. - Information presented at the 5 World Symposia on pulmonary hypertension held since 1973, with the last meeting occurring in 2013, was used in this review. - Pulmonary hypertension represents a heterogeneous group of disorders that are differentiated based on differences in clinical, hemodynamic, and histopathologic features. Early concepts of pulmonary hypertension were largely influenced by pharmacotherapy, hemodynamic function, and clinical presentation of the disease. The initial nomenclature for pulmonary hypertension segregated the clinical classifications from pathologic subtypes. Major restructuring of this disease classification occurred between the first and second symposia, which was the first to unite clinical and pathologic information in the categorization scheme. Additional changes were introduced in subsequent meetings, particularly between the third and fourth World Symposia meetings, when additional pathophysiologic information was gained. Discoveries in molecular diagnostics significantly progressed the understanding of idiopathic pulmonary arterial hypertension. Continued advancements in imaging modalities, mechanistic pathogenicity, and molecular biomarkers will enable physicians to define pulmonary hypertension phenotypes based on the pathobiology and allow for treatment customization.

  14. Evolving application of biomimetic nanostructured hydroxyapatite

    Directory of Open Access Journals (Sweden)

    Norberto Roveri

    2010-11-01

    Full Text Available Norberto Roveri, Michele IafiscoLaboratory of Environmental and Biological Structural Chemistry (LEBSC, Dipartimento di Chimica ‘G. Ciamician’, Alma Mater Studiorum, Università di Bologna, Bologna, ItalyAbstract: By mimicking Nature, we can design and synthesize inorganic smart materials that are reactive to biological tissues. These smart materials can be utilized to design innovative third-generation biomaterials, which are able to not only optimize their interaction with biological tissues and environment, but also mimic biogenic materials in their functionalities. The biomedical applications involve increasing the biomimetic levels from chemical composition, structural organization, morphology, mechanical behavior, nanostructure, and bulk and surface chemical–physical properties until the surface becomes bioreactive and stimulates cellular materials. The chemical–physical characteristics of biogenic hydroxyapatites from bone and tooth have been described, in order to point out the elective sides, which are important to reproduce the design of a new biomimetic synthetic hydroxyapatite. This review outlines the evolving applications of biomimetic synthetic calcium phosphates, details the main characteristics of bone and tooth, where the calcium phosphates are present, and discusses the chemical–physical characteristics of biomimetic calcium phosphates, methods of synthesizing them, and some of their biomedical applications.Keywords: hydroxyapatite, nanocrystals, biomimetism, biomaterials, drug delivery, remineralization

  15. Evolving application of biomimetic nanostructured hydroxyapatite.

    Science.gov (United States)

    Roveri, Norberto; Iafisco, Michele

    2010-11-09

    By mimicking Nature, we can design and synthesize inorganic smart materials that are reactive to biological tissues. These smart materials can be utilized to design innovative third-generation biomaterials, which are able to not only optimize their interaction with biological tissues and environment, but also mimic biogenic materials in their functionalities. The biomedical applications involve increasing the biomimetic levels from chemical composition, structural organization, morphology, mechanical behavior, nanostructure, and bulk and surface chemical-physical properties until the surface becomes bioreactive and stimulates cellular materials. The chemical-physical characteristics of biogenic hydroxyapatites from bone and tooth have been described, in order to point out the elective sides, which are important to reproduce the design of a new biomimetic synthetic hydroxyapatite. This review outlines the evolving applications of biomimetic synthetic calcium phosphates, details the main characteristics of bone and tooth, where the calcium phosphates are present, and discusses the chemical-physical characteristics of biomimetic calcium phosphates, methods of synthesizing them, and some of their biomedical applications.

  16. Epidemic spreading on evolving signed networks

    Science.gov (United States)

    Saeedian, M.; Azimi-Tafreshi, N.; Jafari, G. R.; Kertesz, J.

    2017-02-01

    Most studies of disease spreading consider the underlying social network as obtained without the contagion, though epidemic influences people's willingness to contact others: A "friendly" contact may be turned to "unfriendly" to avoid infection. We study the susceptible-infected disease-spreading model on signed networks, in which each edge is associated with a positive or negative sign representing the friendly or unfriendly relation between its end nodes. In a signed network, according to Heider's theory, edge signs evolve such that finally a state of structural balance is achieved, corresponding to no frustration in physics terms. However, the danger of infection affects the evolution of its edge signs. To describe the coupled problem of the sign evolution and disease spreading, we generalize the notion of structural balance by taking into account the state of the nodes. We introduce an energy function and carry out Monte Carlo simulations on complete networks to test the energy landscape, where we find local minima corresponding to the so-called jammed states. We study the effect of the ratio of initial friendly to unfriendly connections on the propagation of disease. The steady state can be balanced or a jammed state such that a coexistence occurs between susceptible and infected nodes in the system.

  17. UKAEA'S evolving contract philosophy

    Energy Technology Data Exchange (ETDEWEB)

    Nicol, R. D. [UK Atomic Energy Authority, UKAEA, Harwell, Oxfordshire (United Kingdom)

    2003-07-01

    The United Kingdom Atomic Energy Authority (UKAEA) has gone through fundamental change over the last ten years. At the heart of this change has been UKAEA's relationship with the contracting and supply market. This paper describes the way in which UKAEA actively developed the market to support the decommissioning programme, and how the approach to contracting has evolved as external pressures and demands have changed. UKAEA's pro-active approach to industry has greatly assisted the development of a healthy, competitive market for services supporting decommissioning in the UK. There have been difficult changes and many challenges along the way, and some retrenchment was necessary to meet regulatory requirements. Nevertheless, UKAEA has sustained a high level of competition - now measured in terms of competed spend as a proportion of competable spend - with annual out-turns consistently over 80%. The prime responsibility for market development will pass to the new Nuclear Decommissioning Authority (NDA) in 2005, as the owner, on behalf of the Government, of the UK's civil nuclear liabilities. The preparatory work for the NDA indicates that the principles established by UKAEA will be carried forward. (author)

  18. An evolving model of online bipartite networks

    Science.gov (United States)

    Zhang, Chu-Xu; Zhang, Zi-Ke; Liu, Chuang

    2013-12-01

    Understanding the structure and evolution of online bipartite networks is a significant task since they play a crucial role in various e-commerce services nowadays. Recently, various attempts have been tried to propose different models, resulting in either power-law or exponential degree distributions. However, many empirical results show that the user degree distribution actually follows a shifted power-law distribution, the so-called Mandelbrot’s law, which cannot be fully described by previous models. In this paper, we propose an evolving model, considering two different user behaviors: random and preferential attachment. Extensive empirical results on two real bipartite networks, Delicious and CiteULike, show that the theoretical model can well characterize the structure of real networks for both user and object degree distributions. In addition, we introduce a structural parameter p, to demonstrate that the hybrid user behavior leads to the shifted power-law degree distribution, and the region of power-law tail will increase with the increment of p. The proposed model might shed some lights in understanding the underlying laws governing the structure of real online bipartite networks.

  19. Rapid serial visual presentation design for cognition

    CERN Document Server

    Spence, Robert

    2013-01-01

    A powerful new image presentation technique has evolved over the last twenty years, and its value demonstrated through its support of many and varied common tasks. Conceptually, Rapid Serial Visual Presentation (RSVP) is basically simple, exemplified in the physical world by the rapid riffling of the pages of a book in order to locate a known image. Advances in computation and graphics processing allow RSVP to be applied flexibly and effectively to a huge variety of common tasks such as window shopping, video fast-forward and rewind, TV channel selection and product browsing. At its heart is a

  20. Implementation of rapid diagnostics with antimicrobial stewardship.

    Science.gov (United States)

    Minejima, Emi; Wong-Beringer, Annie

    2016-11-01

    Antimicrobial stewardship (ASP) is an intervention-based program to improve patient outcomes to infection while limiting spread of resistance and unintended consequences. Many rapid diagnostic tools are now FDA cleared for clinical use, with three evaluated across multiple settings: Matrix Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry, Verigene, and FilmArray. Areas covered: This review will focus on studies published that evaluated ASP intervention with rapid diagnostic implementation on outcomes of infection. A description of the key ASP personnel, rapid diagnostic notification methods, hours of notification, and scope of ASP intervention is summarized. Expert commentary: It is critical that ASPs continually re-evaluate and evolve with technological advances. Rapid diagnostic tools are powerful in their ability to identify organisms quickly. A trained clinician is needed to evaluate the results and interact with the providers to educate them on result interpretation and optimal antimicrobial selection to maximize treatment success.

  1. The future of forensic DNA analysis

    Science.gov (United States)

    Butler, John M.

    2015-01-01

    The author's thoughts and opinions on where the field of forensic DNA testing is headed for the next decade are provided in the context of where the field has come over the past 30 years. Similar to the Olympic motto of ‘faster, higher, stronger’, forensic DNA protocols can be expected to become more rapid and sensitive and provide stronger investigative potential. New short tandem repeat (STR) loci have expanded the core set of genetic markers used for human identification in Europe and the USA. Rapid DNA testing is on the verge of enabling new applications. Next-generation sequencing has the potential to provide greater depth of coverage for information on STR alleles. Familial DNA searching has expanded capabilities of DNA databases in parts of the world where it is allowed. Challenges and opportunities that will impact the future of forensic DNA are explored including the need for education and training to improve interpretation of complex DNA profiles. PMID:26101278

  2. Quantum mechanics in an evolving Hilbert space

    Science.gov (United States)

    Artacho, Emilio; O'Regan, David D.

    2017-03-01

    Many basis sets for electronic structure calculations evolve with varying external parameters, such as moving atoms in dynamic simulations, giving rise to extra derivative terms in the dynamical equations. Here we revisit these derivatives in the context of differential geometry, thereby obtaining a more transparent formalization, and a geometrical perspective for better understanding the resulting equations. The effect of the evolution of the basis set within the spanned Hilbert space separates explicitly from the effect of the turning of the space itself when moving in parameter space, as the tangent space turns when moving in a curved space. New insights are obtained using familiar concepts in that context such as the Riemann curvature. The differential geometry is not strictly that for curved spaces as in general relativity, a more adequate mathematical framework being provided by fiber bundles. The language used here, however, will be restricted to tensors and basic quantum mechanics. The local gauge implied by a smoothly varying basis set readily connects with Berry's formalism for geometric phases. Generalized expressions for the Berry connection and curvature are obtained for a parameter-dependent occupied Hilbert space spanned by nonorthogonal Wannier functions. The formalism is applicable to basis sets made of atomic-like orbitals and also more adaptative moving basis functions (such as in methods using Wannier functions as intermediate or support bases), but should also apply to other situations in which nonorthogonal functions or related projectors should arise. The formalism is applied to the time-dependent quantum evolution of electrons for moving atoms. The geometric insights provided here allow us to propose new finite-difference time integrators, and also better understand those already proposed.

  3. The evolving role of tiotropium in asthma

    Directory of Open Access Journals (Sweden)

    McIvor ER

    2017-08-01

    Full Text Available Emma R McIvor,1 R Andrew McIvor2 1Queen’s University, Belfast, UK; 2Department of Medicine, McMaster University, Firestone Institute for Respiratory Health, Hamilton, Ontario, Canada Abstract: Tiotropium is a long-acting muscarinic antagonist (LAMA that exerts its bronchodilatory effect by blocking endogenous acetylcholine receptors in the airways. Its safety and efficacy are well established for the treatment of COPD, and it is now being recognized for its role in improving lung function and control in asthma. This review discusses the evolving role of tiotropium delivered by the Respimat® in patients across the range of asthma severities and ages, and provides an overview of safety and efficacy data. Tiotropium is the only LAMA currently approved for the treatment of asthma, and evidence from a large-scale clinical trial program, including several Phase III studies in adults, has demonstrated that tiotropium improves lung function and asthma control, with a safety profile comparable with that of placebo. Clinical trials in adolescent patients (aged 12–17 years have also shown improvements in lung function and trends toward improved asthma control. Of note, the efficacy and safety profiles are consistent regardless of baseline characteristics and phenotype. Given the large and growing body of evidence, it is likely that as clinical experience with tiotropium increases, this treatment may possibly emerge as the key choice for add-on therapy to inhaled corticosteroids/long-acting β2-agonists, and in patients who do not tolerate long-acting bronchodilators or other medications, in the future. Keywords: tiotropium, anticholinergics, asthma, efficacy

  4. Emergent spacetime in stochastically evolving dimensions

    Energy Technology Data Exchange (ETDEWEB)

    Afshordi, Niayesh [Perimeter Institute for Theoretical Physics, 31 Caroline St. N., Waterloo, ON, N2L 2Y5 (Canada); Department of Physics and Astronomy, University of Waterloo, Waterloo, ON, N2L 3G1 (Canada); HEPCOS, Department of Physics, SUNY at Buffalo, Buffalo, NY 14260-1500 (United States); Stojkovic, Dejan, E-mail: ds77@buffalo.edu [Perimeter Institute for Theoretical Physics, 31 Caroline St. N., Waterloo, ON, N2L 2Y5 (Canada); HEPCOS, Department of Physics, SUNY at Buffalo, Buffalo, NY 14260-1500 (United States)

    2014-12-12

    Changing the dimensionality of the space–time at the smallest and largest distances has manifold theoretical advantages. If the space is lower dimensional in the high energy regime, then there are no ultraviolet divergencies in field theories, it is possible to quantize gravity, and the theory of matter plus gravity is free of divergencies or renormalizable. If the space is higher dimensional at cosmological scales, then some cosmological problems (including the cosmological constant problem) can be attacked from a completely new perspective. In this paper, we construct an explicit model of “evolving dimensions” in which the dimensions open up as the temperature of the universe drops. We adopt the string theory framework in which the dimensions are fields that live on the string worldsheet, and add temperature dependent mass terms for them. At the Big Bang, all the dimensions are very heavy and are not excited. As the universe cools down, dimensions open up one by one. Thus, the dimensionality of the space we live in depends on the energy or temperature that we are probing. In particular, we provide a kinematic Brandenberger–Vafa argument for how a discrete causal set, and eventually a continuum (3+1)-dim spacetime along with Einstein gravity emerges in the Infrared from the worldsheet action. The (3+1)-dim Planck mass and the string scale become directly related, without any compactification. Amongst other predictions, we argue that LHC might be blind to new physics even if it comes at the TeV scale. In contrast, cosmic ray experiments, especially those that can register the very beginning of the shower, and collisions with high multiplicity and density of particles, might be sensitive to the dimensional cross-over.

  5. Emergent spacetime in stochastically evolving dimensions

    Science.gov (United States)

    Afshordi, Niayesh; Stojkovic, Dejan

    2014-12-01

    Changing the dimensionality of the space-time at the smallest and largest distances has manifold theoretical advantages. If the space is lower dimensional in the high energy regime, then there are no ultraviolet divergencies in field theories, it is possible to quantize gravity, and the theory of matter plus gravity is free of divergencies or renormalizable. If the space is higher dimensional at cosmological scales, then some cosmological problems (including the cosmological constant problem) can be attacked from a completely new perspective. In this paper, we construct an explicit model of ;evolving dimensions; in which the dimensions open up as the temperature of the universe drops. We adopt the string theory framework in which the dimensions are fields that live on the string worldsheet, and add temperature dependent mass terms for them. At the Big Bang, all the dimensions are very heavy and are not excited. As the universe cools down, dimensions open up one by one. Thus, the dimensionality of the space we live in depends on the energy or temperature that we are probing. In particular, we provide a kinematic Brandenberger-Vafa argument for how a discrete causal set, and eventually a continuum (3 + 1)-dim spacetime along with Einstein gravity emerges in the Infrared from the worldsheet action. The (3 + 1)-dim Planck mass and the string scale become directly related, without any compactification. Amongst other predictions, we argue that LHC might be blind to new physics even if it comes at the TeV scale. In contrast, cosmic ray experiments, especially those that can register the very beginning of the shower, and collisions with high multiplicity and density of particles, might be sensitive to the dimensional cross-over.

  6. Emergent spacetime in stochastically evolving dimensions

    Directory of Open Access Journals (Sweden)

    Niayesh Afshordi

    2014-12-01

    Full Text Available Changing the dimensionality of the space–time at the smallest and largest distances has manifold theoretical advantages. If the space is lower dimensional in the high energy regime, then there are no ultraviolet divergencies in field theories, it is possible to quantize gravity, and the theory of matter plus gravity is free of divergencies or renormalizable. If the space is higher dimensional at cosmological scales, then some cosmological problems (including the cosmological constant problem can be attacked from a completely new perspective. In this paper, we construct an explicit model of “evolving dimensions” in which the dimensions open up as the temperature of the universe drops. We adopt the string theory framework in which the dimensions are fields that live on the string worldsheet, and add temperature dependent mass terms for them. At the Big Bang, all the dimensions are very heavy and are not excited. As the universe cools down, dimensions open up one by one. Thus, the dimensionality of the space we live in depends on the energy or temperature that we are probing. In particular, we provide a kinematic Brandenberger–Vafa argument for how a discrete causal set, and eventually a continuum (3+1-dim spacetime along with Einstein gravity emerges in the Infrared from the worldsheet action. The (3+1-dim Planck mass and the string scale become directly related, without any compactification. Amongst other predictions, we argue that LHC might be blind to new physics even if it comes at the TeV scale. In contrast, cosmic ray experiments, especially those that can register the very beginning of the shower, and collisions with high multiplicity and density of particles, might be sensitive to the dimensional cross-over.

  7. Evolvable Cryogenics (ECRYO) Pressure Transducer Calibration Test

    Science.gov (United States)

    Diaz, Carlos E., Jr.

    2015-01-01

    This paper provides a summary of the findings of recent activities conducted by Marshall Space Flight Center's (MSFC) In-Space Propulsion Branch and MSFC's Metrology and Calibration Lab to assess the performance of current "state of the art" pressure transducers for use in long duration storage and transfer of cryogenic propellants. A brief historical narrative in this paper describes the Evolvable Cryogenics program and the relevance of these activities to the program. This paper also provides a review of three separate test activities performed throughout this effort, including: (1) the calibration of several pressure transducer designs in a liquid nitrogen cryogenic environmental chamber, (2) the calibration of a pressure transducer in a liquid helium Dewar, and (3) the calibration of several pressure transducers at temperatures ranging from 20 to 70 degrees Kelvin (K) using a "cryostat" environmental chamber. These three separate test activities allowed for study of the sensors along a temperature range from 4 to 300 K. The combined data shows that both the slope and intercept of the sensor's calibration curve vary as a function of temperature. This homogeneous function is contrary to the linearly decreasing relationship assumed at the start of this investigation. Consequently, the data demonstrates the need for lookup tables to change the slope and intercept used by any data acquisition system. This ultimately would allow for more accurate pressure measurements at the desired temperature range. This paper concludes with a review of a request for information (RFI) survey conducted amongst different suppliers to determine the availability of current "state of the art" flight-qualified pressure transducers. The survey identifies requirements that are most difficult for the suppliers to meet, most notably the capability to validate the sensor's performance at temperatures below 70 K.

  8. Pancreatic Ductal Adenocarcinoma: Current and Evolving Therapies

    Directory of Open Access Journals (Sweden)

    Aleksandra Adamska

    2017-06-01

    Full Text Available Pancreatic ductal adenocarcinoma (PDAC, which constitutes 90% of pancreatic cancers, is the fourth leading cause of cancer-related deaths in the world. Due to the broad heterogeneity of genetic mutations and dense stromal environment, PDAC belongs to one of the most chemoresistant cancers. Most of the available treatments are palliative, with the objective of relieving disease-related symptoms and prolonging survival. Currently, available therapeutic options are surgery, radiation, chemotherapy, immunotherapy, and use of targeted drugs. However, thus far, therapies targeting cancer-associated molecular pathways have not given satisfactory results; this is due in part to the rapid upregulation of compensatory alternative pathways as well as dense desmoplastic reaction. In this review, we summarize currently available therapies and clinical trials, directed towards a plethora of pathways and components dysregulated during PDAC carcinogenesis. Emerging trends towards targeted therapies as the most promising approach will also be discussed.

  9. Orthogonally Evolved AI to Improve Difficulty Adjustment in Video Games

    DEFF Research Database (Denmark)

    Hintze, Arend; Olson, Randal; Lehman, Joel Anthony

    2016-01-01

    (i.e. agents subject to fewer generations of evolution) make for easier opponents, while highly-evolved agents are more challenging to overcome. In this publication we test a new approach for difficulty adjustment in games: orthogonally evolved AI, where the player receives support from collaborating...... opponents. Furthermore, human interaction can modulate (and be informed by) the performance and behavior of collaborating agents. In this way, orthogonally evolved AI both facilitates smoother difficulty adjustment and enables new game experiences....

  10. Making the bend: DNA tertiary structure and protein-DNA interactions.

    Science.gov (United States)

    Harteis, Sabrina; Schneider, Sabine

    2014-07-14

    DNA structure functions as an overlapping code to the DNA sequence. Rapid progress in understanding the role of DNA structure in gene regulation, DNA damage recognition and genome stability has been made. The three dimensional structure of both proteins and DNA plays a crucial role for their specific interaction, and proteins can recognise the chemical signature of DNA sequence ("base readout") as well as the intrinsic DNA structure ("shape recognition"). These recognition mechanisms do not exist in isolation but, depending on the individual interaction partners, are combined to various extents. Driving force for the interaction between protein and DNA remain the unique thermodynamics of each individual DNA-protein pair. In this review we focus on the structures and conformations adopted by DNA, both influenced by and influencing the specific interaction with the corresponding protein binding partner, as well as their underlying thermodynamics.

  11. Evolving R Coronae Borealis Stars with MESA

    Science.gov (United States)

    Clayton, Geoffrey C.; Lauer, Amber; Chatzopoulos, Emmanouil; Frank, Juhan

    2018-01-01

    being a WD. Solving the mystery of how the RCB stars evolve will lead to a better understanding of other important types of stellar merger events such as Type Ia SNe.

  12. The Evolving Definition of the Term "Gene".

    Science.gov (United States)

    Portin, Petter; Wilkins, Adam

    2017-04-01

    This paper presents a history of the changing meanings of the term "gene," over more than a century, and a discussion of why this word, so crucial to genetics, needs redefinition today. In this account, the first two phases of 20th century genetics are designated the "classical" and the "neoclassical" periods, and the current molecular-genetic era the "modern period." While the first two stages generated increasing clarity about the nature of the gene, the present period features complexity and confusion. Initially, the term "gene" was coined to denote an abstract "unit of inheritance," to which no specific material attributes were assigned. As the classical and neoclassical periods unfolded, the term became more concrete, first as a dimensionless point on a chromosome, then as a linear segment within a chromosome, and finally as a linear segment in the DNA molecule that encodes a polypeptide chain. This last definition, from the early 1960s, remains the one employed today, but developments since the 1970s have undermined its generality. Indeed, they raise questions about both the utility of the concept of a basic "unit of inheritance" and the long implicit belief that genes are autonomous agents. Here, we review findings that have made the classic molecular definition obsolete and propose a new one based on contemporary knowledge. Copyright © 2017 by the Genetics Society of America.

  13. Intraspecific diversity of sugar beet (Beta vulgaris) mitochondrial DNA.

    Science.gov (United States)

    Komarnitsky, I K; Samoylov, A M; Red'ko, V V; Peretyayko, V G; Gleba, Y Y

    1990-08-01

    Mitochondrial (mt) DNA, isolated from different sugar beet populations, was analyzed using BamHI and EcoRI restriction enzymes. It was shown that plants possessing the new mtDNA types are revealed among O-type fertilizers quite frequently. Among cytoplasmic male sterile (cms) plants, which evolved during cultivation of O-type fertilizers, plants with altered mt genome were found.

  14. Geminin: a major DNA replication safeguard in higher eukaryotes

    DEFF Research Database (Denmark)

    Melixetian, Marina; Helin, Kristian

    2004-01-01

    Eukaryotes have evolved multiple mechanisms to restrict DNA replication to once per cell cycle. These mechanisms prevent relicensing of origins of replication after initiation of DNA replication in S phase until the end of mitosis. Most of our knowledge of mechanisms controlling prereplication...

  15. The evolving genetic risk for sporadic ALS.

    Science.gov (United States)

    Gibson, Summer B; Downie, Jonathan M; Tsetsou, Spyridoula; Feusier, Julie E; Figueroa, Karla P; Bromberg, Mark B; Jorde, Lynn B; Pulst, Stefan M

    2017-07-18

    To estimate the genetic risk conferred by known amyotrophic lateral sclerosis (ALS)-associated genes to the pathogenesis of sporadic ALS (SALS) using variant allele frequencies combined with predicted variant pathogenicity. Whole exome sequencing and repeat expansion PCR of C9orf72 and ATXN2 were performed on 87 patients of European ancestry with SALS seen at the University of Utah. DNA variants that change the protein coding sequence of 31 ALS-associated genes were annotated to determine which were rare and deleterious as predicted by MetaSVM. The percentage of patients with SALS with a rare and deleterious variant or repeat expansion in an ALS-associated gene was calculated. An odds ratio analysis was performed comparing the burden of ALS-associated genes in patients with SALS vs 324 normal controls. Nineteen rare nonsynonymous variants in an ALS-associated gene, 2 of which were found in 2 different individuals, were identified in 21 patients with SALS. Further, 5 deleterious C9orf72 and 2 ATXN2 repeat expansions were identified. A total of 17.2% of patients with SALS had a rare and deleterious variant or repeat expansion in an ALS-associated gene. The genetic burden of ALS-associated genes in patients with SALS as predicted by MetaSVM was significantly higher than in normal controls. Previous analyses have identified SALS-predisposing variants only in terms of their rarity in normal control populations. By incorporating variant pathogenicity as well as variant frequency, we demonstrated that the genetic risk contributed by these genes for SALS is substantially lower than previous estimates. © 2017 American Academy of Neurology.

  16. Diverse CRISPRs evolving in human microbiomes.

    Directory of Open Access Journals (Sweden)

    Mina Rho

    Full Text Available CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats loci, together with cas (CRISPR-associated genes, form the CRISPR/Cas adaptive immune system, a primary defense strategy that eubacteria and archaea mobilize against foreign nucleic acids, incl