WorldWideScience

Sample records for rapidly evolving dna

  1. Spatiotemporal reconstruction of the Aquilegia rapid radiation through next-generation sequencing of rapidly evolving cpDNA regions.

    Science.gov (United States)

    Fior, Simone; Li, Mingai; Oxelman, Bengt; Viola, Roberto; Hodges, Scott A; Ometto, Lino; Varotto, Claudio

    2013-04-01

    Aquilegia is a well-known model system in the field of evolutionary biology, but obtaining a resolved and well-supported phylogenetic reconstruction for the genus has been hindered by its recent and rapid diversification. Here, we applied 454 next-generation sequencing to PCR amplicons of 21 of the most rapidly evolving regions of the plastome to generate c. 24 kb of sequences from each of 84 individuals from throughout the genus. The resulting phylogeny has well-supported resolution of the main lineages of the genus, although recent diversification such as in the European taxa remains unresolved. By producing a chronogram of the whole Ranunculaceae family based on published data, we inferred calibration points for dating the Aquilegia radiation. The genus originated in the upper Miocene c. 6.9 million yr ago (Ma) in Eastern Asia, and diversification occurred c. 4.8 Ma with the split of two main clades, one colonizing North America, and the other Western Eurasia through the mountains of Central Asia. This was followed by a back-to-Asia migration, originating from the European stock using a North Asian route. These results provide the first backbone phylogeny and spatiotemporal reconstruction of the Aquilegia radiation, and constitute a robust framework to address the adaptative nature of speciation within the group. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  2. Satellite DNA: An Evolving Topic.

    Science.gov (United States)

    Garrido-Ramos, Manuel A

    2017-09-18

    Satellite DNA represents one of the most fascinating parts of the repetitive fraction of the eukaryotic genome. Since the discovery of highly repetitive tandem DNA in the 1960s, a lot of literature has extensively covered various topics related to the structure, organization, function, and evolution of such sequences. Today, with the advent of genomic tools, the study of satellite DNA has regained a great interest. Thus, Next-Generation Sequencing (NGS), together with high-throughput in silico analysis of the information contained in NGS reads, has revolutionized the analysis of the repetitive fraction of the eukaryotic genomes. The whole of the historical and current approaches to the topic gives us a broad view of the function and evolution of satellite DNA and its role in chromosomal evolution. Currently, we have extensive information on the molecular, chromosomal, biological, and population factors that affect the evolutionary fate of satellite DNA, knowledge that gives rise to a series of hypotheses that get on well with each other about the origin, spreading, and evolution of satellite DNA. In this paper, I review these hypotheses from a methodological, conceptual, and historical perspective and frame them in the context of chromosomal organization and evolution.

  3. Towards resolving Lamiales relationships: insights from rapidly evolving chloroplast sequences

    Directory of Open Access Journals (Sweden)

    Heubl Günther

    2010-11-01

    Full Text Available Abstract Background In the large angiosperm order Lamiales, a diverse array of highly specialized life strategies such as carnivory, parasitism, epiphytism, and desiccation tolerance occur, and some lineages possess drastically accelerated DNA substitutional rates or miniaturized genomes. However, understanding the evolution of these phenomena in the order, and clarifying borders of and relationships among lamialean families, has been hindered by largely unresolved trees in the past. Results Our analysis of the rapidly evolving trnK/matK, trnL-F and rps16 chloroplast regions enabled us to infer more precise phylogenetic hypotheses for the Lamiales. Relationships among the nine first-branching families in the Lamiales tree are now resolved with very strong support. Subsequent to Plocospermataceae, a clade consisting of Carlemanniaceae plus Oleaceae branches, followed by Tetrachondraceae and a newly inferred clade composed of Gesneriaceae plus Calceolariaceae, which is also supported by morphological characters. Plantaginaceae (incl. Gratioleae and Scrophulariaceae are well separated in the backbone grade; Lamiaceae and Verbenaceae appear in distant clades, while the recently described Linderniaceae are confirmed to be monophyletic and in an isolated position. Conclusions Confidence about deep nodes of the Lamiales tree is an important step towards understanding the evolutionary diversification of a major clade of flowering plants. The degree of resolution obtained here now provides a first opportunity to discuss the evolution of morphological and biochemical traits in Lamiales. The multiple independent evolution of the carnivorous syndrome, once in Lentibulariaceae and a second time in Byblidaceae, is strongly supported by all analyses and topological tests. The evolution of selected morphological characters such as flower symmetry is discussed. The addition of further sequence data from introns and spacers holds promise to eventually obtain a

  4. Towards resolving Lamiales relationships: insights from rapidly evolving chloroplast sequences

    Science.gov (United States)

    2010-01-01

    Background In the large angiosperm order Lamiales, a diverse array of highly specialized life strategies such as carnivory, parasitism, epiphytism, and desiccation tolerance occur, and some lineages possess drastically accelerated DNA substitutional rates or miniaturized genomes. However, understanding the evolution of these phenomena in the order, and clarifying borders of and relationships among lamialean families, has been hindered by largely unresolved trees in the past. Results Our analysis of the rapidly evolving trnK/matK, trnL-F and rps16 chloroplast regions enabled us to infer more precise phylogenetic hypotheses for the Lamiales. Relationships among the nine first-branching families in the Lamiales tree are now resolved with very strong support. Subsequent to Plocospermataceae, a clade consisting of Carlemanniaceae plus Oleaceae branches, followed by Tetrachondraceae and a newly inferred clade composed of Gesneriaceae plus Calceolariaceae, which is also supported by morphological characters. Plantaginaceae (incl. Gratioleae) and Scrophulariaceae are well separated in the backbone grade; Lamiaceae and Verbenaceae appear in distant clades, while the recently described Linderniaceae are confirmed to be monophyletic and in an isolated position. Conclusions Confidence about deep nodes of the Lamiales tree is an important step towards understanding the evolutionary diversification of a major clade of flowering plants. The degree of resolution obtained here now provides a first opportunity to discuss the evolution of morphological and biochemical traits in Lamiales. The multiple independent evolution of the carnivorous syndrome, once in Lentibulariaceae and a second time in Byblidaceae, is strongly supported by all analyses and topological tests. The evolution of selected morphological characters such as flower symmetry is discussed. The addition of further sequence data from introns and spacers holds promise to eventually obtain a fully resolved plastid tree of

  5. Delineating slowly and rapidly evolving fractions of the Drosophila genome.

    Science.gov (United States)

    Keith, Jonathan M; Adams, Peter; Stephen, Stuart; Mattick, John S

    2008-05-01

    Evolutionary conservation is an important indicator of function and a major component of bioinformatic methods to identify non-protein-coding genes. We present a new Bayesian method for segmenting pairwise alignments of eukaryotic genomes while simultaneously classifying segments into slowly and rapidly evolving fractions. We also describe an information criterion similar to the Akaike Information Criterion (AIC) for determining the number of classes. Working with pairwise alignments enables detection of differences in conservation patterns among closely related species. We analyzed three whole-genome and three partial-genome pairwise alignments among eight Drosophila species. Three distinct classes of conservation level were detected. Sequences comprising the most slowly evolving component were consistent across a range of species pairs, and constituted approximately 62-66% of the D. melanogaster genome. Almost all (>90%) of the aligned protein-coding sequence is in this fraction, suggesting much of it (comprising the majority of the Drosophila genome, including approximately 56% of non-protein-coding sequences) is functional. The size and content of the most rapidly evolving component was species dependent, and varied from 1.6% to 4.8%. This fraction is also enriched for protein-coding sequence (while containing significant amounts of non-protein-coding sequence), suggesting it is under positive selection. We also classified segments according to conservation and GC content simultaneously. This analysis identified numerous sub-classes of those identified on the basis of conservation alone, but was nevertheless consistent with that classification. Software, data, and results available at www.maths.qut.edu.au/-keithj/. Genomic segments comprising the conservation classes available in BED format.

  6. Rapidly Evolving Transients in the Dark Energy Survey

    Energy Technology Data Exchange (ETDEWEB)

    Pursiainen, M.; et al.

    2018-03-13

    We present the results of a search for rapidly evolving transients in the Dark Energy Survey Supernova Programme. These events are characterized by fast light curve evolution (rise to peak in $\\lesssim 10$ d and exponential decline in $\\lesssim30$ d after peak). We discovered 72 events, including 37 transients with a spectroscopic redshift from host galaxy spectral features. The 37 events increase the total number of rapid optical transients by more than factor of two. They are found at a wide range of redshifts ($0.05M_\\mathrm{g}>-22.25$). The multiband photometry is well fit by a blackbody up to few weeks after peak. The events appear to be hot ($T\\approx10000-30000$ K) and large ($R\\approx 10^{14}-2\\cdot10^{15}$ cm) at peak, and generally expand and cool in time, though some events show evidence for a receding photosphere with roughly constant temperature. Spectra taken around peak are dominated by a blue featureless continuum consistent with hot, optically thick ejecta. We compare our events with a previously suggested physical scenario involving shock breakout in an optically thick wind surrounding a core-collapse supernova (CCSNe), we conclude that current models for such a scenario might need an additional power source to describe the exponential decline. We find these transients tend to favor star-forming host galaxies, which could be consistent with a core-collapse origin. However, more detailed modeling of the light curves is necessary to determine their physical origin.

  7. Intrinsic immunogenicity of rapidly-degradable polymers evolves during degradation.

    Science.gov (United States)

    Andorko, James I; Hess, Krystina L; Pineault, Kevin G; Jewell, Christopher M

    2016-03-01

    Recent studies reveal many biomaterial vaccine carriers are able to activate immunostimulatory pathways, even in the absence of other immune signals. How the changing properties of polymers during biodegradation impact this intrinsic immunogenicity is not well studied, yet this information could contribute to rational design of degradable vaccine carriers that help direct immune response. We use degradable poly(beta-amino esters) (PBAEs) to explore intrinsic immunogenicity as a function of the degree of polymer degradation and polymer form (e.g., soluble, particles). PBAE particles condensed by electrostatic interaction to mimic a common vaccine approach strongly activate dendritic cells, drive antigen presentation, and enhance T cell proliferation in the presence of antigen. Polymer molecular weight strongly influences these effects, with maximum stimulation at short degradation times--corresponding to high molecular weight--and waning levels as degradation continues. In contrast, free polymer is immunologically inert. In mice, PBAE particles increase the numbers and activation state of cells in lymph nodes. Mechanistic studies reveal that this evolving immunogenicity occurs as the physicochemical properties and concentration of particles change during polymer degradation. This work confirms the immunological profile of degradable, synthetic polymers can evolve over time and creates an opportunity to leverage this feature in new vaccines. Degradable polymers are increasingly important in vaccination, but how the inherent immunogenicity of polymers changes during degradation is poorly understood. Using common rapidly-degradable vaccine carriers, we show that the activation of immune cells--even in the absence of other adjuvants--depends on polymer form (e.g., free, particulate) and the extent of degradation. These changing characteristics alter the physicochemical properties (e.g., charge, size, molecular weight) of polymer particles, driving changes in

  8. Sex as a strategy against rapidly evolving parasites.

    Science.gov (United States)

    Auld, Stuart K J R; Tinkler, Shona K; Tinsley, Matthew C

    2016-12-28

    Why is sex ubiquitous when asexual reproduction is much less costly? Sex disrupts coadapted gene complexes; it also causes costs associated with mate finding and the production of males who do not themselves bear offspring. Theory predicts parasites select for host sex, because genetically variable offspring can escape infection from parasites adapted to infect the previous generations. We examine this using a facultative sexual crustacean, Daphnia magna, and its sterilizing bacterial parasite, Pasteuria ramosa We obtained sexually and asexually produced offspring from wild-caught hosts and exposed them to contemporary parasites or parasites isolated from the same population one year later. We found rapid parasite adaptation to replicate within asexual but not sexual offspring. Moreover, sexually produced offspring were twice as resistant to infection as asexuals when exposed to parasites that had coevolved alongside their parents (i.e. the year two parasite). This fulfils the requirement that the benefits of sex must be both large and rapid for sex to be favoured by selection. © 2016 The Author(s).

  9. A rapidly evolving secretome builds and patterns a sea shell

    Directory of Open Access Journals (Sweden)

    Green Kathryn

    2006-11-01

    Full Text Available Abstract Background Instructions to fabricate mineralized structures with distinct nanoscale architectures, such as seashells and coral and vertebrate skeletons, are encoded in the genomes of a wide variety of animals. In mollusks, the mantle is responsible for the extracellular production of the shell, directing the ordered biomineralization of CaCO3 and the deposition of architectural and color patterns. The evolutionary origins of the ability to synthesize calcified structures across various metazoan taxa remain obscure, with only a small number of protein families identified from molluskan shells. The recent sequencing of a wide range of metazoan genomes coupled with the analysis of gene expression in non-model animals has allowed us to investigate the evolution and process of biomineralization in gastropod mollusks. Results Here we show that over 25% of the genes expressed in the mantle of the vetigastropod Haliotis asinina encode secreted proteins, indicating that hundreds of proteins are likely to be contributing to shell fabrication and patterning. Almost 85% of the secretome encodes novel proteins; remarkably, only 19% of these have identifiable homologues in the full genome of the patellogastropod Lottia scutum. The spatial expression profiles of mantle genes that belong to the secretome is restricted to discrete mantle zones, with each zone responsible for the fabrication of one of the structural layers of the shell. Patterned expression of a subset of genes along the length of the mantle is indicative of roles in shell ornamentation. For example, Has-sometsuke maps precisely to pigmentation patterns in the shell, providing the first case of a gene product to be involved in molluskan shell pigmentation. We also describe the expression of two novel genes involved in nacre (mother of pearl deposition. Conclusion The unexpected complexity and evolvability of this secretome and the modular design of the molluskan mantle enables

  10. EVOLVE

    CERN Document Server

    Deutz, André; Schütze, Oliver; Legrand, Pierrick; Tantar, Emilia; Tantar, Alexandru-Adrian

    2017-01-01

    This book comprises nine selected works on numerical and computational methods for solving multiobjective optimization, game theory, and machine learning problems. It provides extended versions of selected papers from various fields of science such as computer science, mathematics and engineering that were presented at EVOLVE 2013 held in July 2013 at Leiden University in the Netherlands. The internationally peer-reviewed papers include original work on important topics in both theory and applications, such as the role of diversity in optimization, statistical approaches to combinatorial optimization, computational game theory, and cell mapping techniques for numerical landscape exploration. Applications focus on aspects including robustness, handling multiple objectives, and complex search spaces in engineering design and computational biology.

  11. DNA motif alignment by evolving a population of Markov chains.

    Science.gov (United States)

    Bi, Chengpeng

    2009-01-30

    Deciphering cis-regulatory elements or de novo motif-finding in genomes still remains elusive although much algorithmic effort has been expended. The Markov chain Monte Carlo (MCMC) method such as Gibbs motif samplers has been widely employed to solve the de novo motif-finding problem through sequence local alignment. Nonetheless, the MCMC-based motif samplers still suffer from local maxima like EM. Therefore, as a prerequisite for finding good local alignments, these motif algorithms are often independently run a multitude of times, but without information exchange between different chains. Hence it would be worth a new algorithm design enabling such information exchange. This paper presents a novel motif-finding algorithm by evolving a population of Markov chains with information exchange (PMC), each of which is initialized as a random alignment and run by the Metropolis-Hastings sampler (MHS). It is progressively updated through a series of local alignments stochastically sampled. Explicitly, the PMC motif algorithm performs stochastic sampling as specified by a population-based proposal distribution rather than individual ones, and adaptively evolves the population as a whole towards a global maximum. The alignment information exchange is accomplished by taking advantage of the pooled motif site distributions. A distinct method for running multiple independent Markov chains (IMC) without information exchange, or dubbed as the IMC motif algorithm, is also devised to compare with its PMC counterpart. Experimental studies demonstrate that the performance could be improved if pooled information were used to run a population of motif samplers. The new PMC algorithm was able to improve the convergence and outperformed other popular algorithms tested using simulated and biological motif sequences.

  12. The rapidly evolving centromere-specific histone has stringent functional requirements in Arabidopsis thaliana.

    Science.gov (United States)

    Ravi, Maruthachalam; Kwong, Pak N; Menorca, Ron M G; Valencia, Joel T; Ramahi, Joseph S; Stewart, Jodi L; Tran, Robert K; Sundaresan, Venkatesan; Comai, Luca; Chan, Simon W-L

    2010-10-01

    Centromeres control chromosome inheritance in eukaryotes, yet their DNA structure and primary sequence are hypervariable. Most animals and plants have megabases of tandem repeats at their centromeres, unlike yeast with unique centromere sequences. Centromere function requires the centromere-specific histone CENH3 (CENP-A in human), which replaces histone H3 in centromeric nucleosomes. CENH3 evolves rapidly, particularly in its N-terminal tail domain. A portion of the CENH3 histone-fold domain, the CENP-A targeting domain (CATD), has been previously shown to confer kinetochore localization and centromere function when swapped into human H3. Furthermore, CENP-A in human cells can be functionally replaced by CENH3 from distantly related organisms including Saccharomyces cerevisiae. We have used cenh3-1 (a null mutant in Arabidopsis thaliana) to replace endogenous CENH3 with GFP-tagged variants. A H3.3 tail domain-CENH3 histone-fold domain chimera rescued viability of cenh3-1, but CENH3's lacking a tail domain were nonfunctional. In contrast to human results, H3 containing the A. thaliana CATD cannot complement cenh3-1. GFP-CENH3 from the sister species A. arenosa functionally replaces A. thaliana CENH3. GFP-CENH3 from the close relative Brassica rapa was targeted to centromeres, but did not complement cenh3-1, indicating that kinetochore localization and centromere function can be uncoupled. We conclude that CENH3 function in A. thaliana, an organism with large tandem repeat centromeres, has stringent requirements for functional complementation in mitosis.

  13. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E.; Korgsdam, A.-M.; Jørgensen, H.F.

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  14. A fibre based triature interferometer for measuring rapidly evolving, ablatively driven plasma densities

    Science.gov (United States)

    Macdonald, J.; Bland, S. N.; Threadgold, J.

    2015-08-01

    We report on the first use of a fibre interferometer incorporating triature analysis for measuring rapidly evolving plasma densities of ne ˜ 1013/cm3 and above, such as those produced by simple coaxial plasma guns. The resultant system is extremely portable, easy to field in experiments, relatively cheap to produce, and—with the exception of a small open area in which the plasma is sampled—safe in operation as all laser light is enclosed.

  15. DNA sequence evolution in fast evolving mitochondrial DNA nad1 exons in Geraniaceae and Plantaginaceae

    NARCIS (Netherlands)

    Bakker, F.T.; Breman, F.; Merckx, V.

    2006-01-01

    Previously, nucleotide substitution rates in mitochondrial DNA of Geraniaceae and Plantaginaceae have been shown to be exceptionally high compared with other angiosperm mtDNA lineages. It has also been shown that mtDNA introns were lost in Geraniaceae and Plantaginaceae. In this study we compile 127

  16. Snake venoms are integrated systems, but abundant venom proteins evolve more rapidly.

    Science.gov (United States)

    Aird, Steven D; Aggarwal, Shikha; Villar-Briones, Alejandro; Tin, Mandy Man-Ying; Terada, Kouki; Mikheyev, Alexander S

    2015-08-28

    While many studies have shown that extracellular proteins evolve rapidly, how selection acts on them remains poorly understood. We used snake venoms to understand the interaction between ecology, expression level, and evolutionary rate in secreted protein systems. Venomous snakes employ well-integrated systems of proteins and organic constituents to immobilize prey. Venoms are generally optimized to subdue preferred prey more effectively than non-prey, and many venom protein families manifest positive selection and rapid gene family diversification. Although previous studies have illuminated how individual venom protein families evolve, how selection acts on venoms as integrated systems, is unknown. Using next-generation transcriptome sequencing and mass spectrometry, we examined microevolution in two pitvipers, allopatrically separated for at least 1.6 million years, and their hybrids. Transcriptomes of parental species had generally similar compositions in regard to protein families, but for a given protein family, the homologs present and concentrations thereof sometimes differed dramatically. For instance, a phospholipase A2 transcript comprising 73.4 % of the Protobothrops elegans transcriptome, was barely present in the P. flavoviridis transcriptome (king cobra genome, suggesting that rapid evolution of abundant proteins may be generally true for snake venoms. Looking more broadly at Protobothrops, we show that rapid evolution of the most abundant components is due to positive selection, suggesting an interplay between abundance and adaptation. Given log-scale differences in toxin abundance, which are likely correlated with biosynthetic costs, we hypothesize that as a result of natural selection, snakes optimize return on energetic investment by producing more of venom proteins that increase their fitness. Natural selection then acts on the additive genetic variance of these components, in proportion to their contributions to overall fitness. Adaptive

  17. De novo ORFs in Drosophila are important to organismal fitness and evolved rapidly from previously non-coding sequences.

    Directory of Open Access Journals (Sweden)

    Josephine A Reinhardt

    Full Text Available How non-coding DNA gives rise to new protein-coding genes (de novo genes is not well understood. Recent work has revealed the origins and functions of a few de novo genes, but common principles governing the evolution or biological roles of these genes are unknown. To better define these principles, we performed a parallel analysis of the evolution and function of six putatively protein-coding de novo genes described in Drosophila melanogaster. Reconstruction of the transcriptional history of de novo genes shows that two de novo genes emerged from novel long non-coding RNAs that arose at least 5 MY prior to evolution of an open reading frame. In contrast, four other de novo genes evolved a translated open reading frame and transcription within the same evolutionary interval suggesting that nascent open reading frames (proto-ORFs, while not required, can contribute to the emergence of a new de novo gene. However, none of the genes arose from proto-ORFs that existed long before expression evolved. Sequence and structural evolution of de novo genes was rapid compared to nearby genes and the structural complexity of de novo genes steadily increases over evolutionary time. Despite the fact that these genes are transcribed at a higher level in males than females, and are most strongly expressed in testes, RNAi experiments show that most of these genes are essential in both sexes during metamorphosis. This lethality suggests that protein coding de novo genes in Drosophila quickly become functionally important.

  18. Cancer immunotherapy: Opportunities and challenges in the rapidly evolving clinical landscape.

    Science.gov (United States)

    Emens, Leisha A; Ascierto, Paolo A; Darcy, Phillip K; Demaria, Sandra; Eggermont, Alexander M M; Redmond, William L; Seliger, Barbara; Marincola, Francesco M

    2017-08-01

    Cancer immunotherapy is now established as a powerful way to treat cancer. The recent clinical success of immune checkpoint blockade (antagonists of CTLA-4, PD-1 and PD-L1) highlights both the universal power of treating the immune system across tumour types and the unique features of cancer immunotherapy. Immune-related adverse events, atypical clinical response patterns, durable responses, and clear overall survival benefit distinguish cancer immunotherapy from cytotoxic cancer therapy. Combination immunotherapies that transform non-responders to responders are under rapid development. Current challenges facing the field include incorporating immunotherapy into adjuvant and neoadjuvant cancer therapy, refining dose, schedule and duration of treatment and developing novel surrogate endpoints that accurately capture overall survival benefit early in treatment. As the field rapidly evolves, we must prioritise the development of biomarkers to guide the use of immunotherapies in the most appropriate patients. Immunotherapy is already transforming cancer from a death sentence to a chronic disease for some patients. By making smart, evidence-based decisions in developing next generation immunotherapies, cancer should become an imminently treatable, curable and even preventable disease. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Rapid divergence and convergence of life-history in experimentally evolved Drosophila melanogaster.

    Science.gov (United States)

    Burke, Molly K; Barter, Thomas T; Cabral, Larry G; Kezos, James N; Phillips, Mark A; Rutledge, Grant A; Phung, Kevin H; Chen, Richard H; Nguyen, Huy D; Mueller, Laurence D; Rose, Michael R

    2016-09-01

    Laboratory selection experiments are alluring in their simplicity, power, and ability to inform us about how evolution works. A longstanding challenge facing evolution experiments with metazoans is that significant generational turnover takes a long time. In this work, we present data from a unique system of experimentally evolved laboratory populations of Drosophila melanogaster that have experienced three distinct life-history selection regimes. The goal of our study was to determine how quickly populations of a certain selection regime diverge phenotypically from their ancestors, and how quickly they converge with independently derived populations that share a selection regime. Our results indicate that phenotypic divergence from an ancestral population occurs rapidly, within dozens of generations, regardless of that population's evolutionary history. Similarly, populations sharing a selection treatment converge on common phenotypes in this same time frame, regardless of selection pressures those populations may have experienced in the past. These patterns of convergence and divergence emerged much faster than expected, suggesting that intermediate evolutionary history has transient effects in this system. The results we draw from this system are applicable to other experimental evolution projects, and suggest that many relevant questions can be sufficiently tested on shorter timescales than previously thought. © 2016 The Author(s). Evolution © 2016 The Society for the Study of Evolution.

  20. Evolved Cas9 variants with broad PAM compatibility and high DNA specificity.

    Science.gov (United States)

    Hu, Johnny H; Miller, Shannon M; Geurts, Maarten H; Tang, Weixin; Chen, Liwei; Sun, Ning; Zeina, Christina M; Gao, Xue; Rees, Holly A; Lin, Zhi; Liu, David R

    2018-04-05

    A key limitation of the use of the CRISPR-Cas9 system for genome editing and other applications is the requirement that a protospacer adjacent motif (PAM) be present at the target site. For the most commonly used Cas9 from Streptococcus pyogenes (SpCas9), the required PAM sequence is NGG. No natural or engineered Cas9 variants that have been shown to function efficiently in mammalian cells offer a PAM less restrictive than NGG. Here we use phage-assisted continuous evolution to evolve an expanded PAM SpCas9 variant (xCas9) that can recognize a broad range of PAM sequences including NG, GAA and GAT. The PAM compatibility of xCas9 is the broadest reported, to our knowledge, among Cas9 proteins that are active in mammalian cells, and supports applications in human cells including targeted transcriptional activation, nuclease-mediated gene disruption, and cytidine and adenine base editing. Notably, despite its broadened PAM compatibility, xCas9 has much greater DNA specificity than SpCas9, with substantially lower genome-wide off-target activity at all NGG target sites tested, as well as minimal off-target activity when targeting genomic sites with non-NGG PAMs. These findings expand the DNA targeting scope of CRISPR systems and establish that there is no necessary trade-off between Cas9 editing efficiency, PAM compatibility and DNA specificity.

  1. Biobanks in the United States: how to identify an undefined and rapidly evolving population.

    Science.gov (United States)

    Boyer, Gregory J; Whipple, Warren; Cadigan, R Jean; Henderson, Gail E

    2012-12-01

    As part of a larger organizational study, we sought to survey biobanks in the United States. However, we encountered two problems with this population. First, no common definition of biobanks exists. Second, no census is available of these facilities from which to sample in order to implement a survey. In light of these problems, we employed a multifaceted approach using electronic searches of PubMed, RePORTER, and Google. In addition, we systematically searched for biobanks housed within universities that have NIH-designated Clinical and Translational Science Awards (CTSA). We expanded this part of the search by looking for biobanks among all members of the American Association of Medical Colleges (AAMC). Finally, we added banks to our database found previously by other researchers and banks found via correspondence with our colleagues. Our search strategy produced a database of 624 biobanks for which we were able to confirm contact information in order to conduct our online survey. Another 140 biobanks were identified but did not respond to our requests to confirm their existence or contact information. In order to maximize both the uniqueness of banks found and the greatest return on effort for each search, we suggest targeting resources that are already organized. In our work, these included the CTSA, AAMC, and part of the Google searches. We contend that our search provides a model for analysis of new fields of research and/or rapidly evolving industries. Furthermore, our approach demonstrates that with the appropriate tools it is possible to develop a systematic and comprehensive database to investigate undefined populations.

  2. Analysis of expression in the Anopheles gambiae developing testes reveals rapidly evolving lineage-specific genes in mosquitoes

    Directory of Open Access Journals (Sweden)

    Krzywinski Jaroslaw

    2009-07-01

    Full Text Available Abstract Background Male mosquitoes do not feed on blood and are not involved in delivery of pathogens to humans. Consequently, they are seldom the subjects of research, which results in a very poor understanding of their biology. To gain insights into male developmental processes we sought to identify genes transcribed exclusively in the reproductive tissues of male Anopheles gambiae pupae. Results Using a cDNA subtraction strategy, five male-specifically or highly male-biased expressed genes were isolated, four of which remain unannotated in the An. gambiae genome. Spatial and temporal expression patterns suggest that each of these genes is involved in the mid-late stages of spermatogenesis. Their sequences are rapidly evolving; however, two genes possess clear homologs in a wide range of taxa and one of these probably acts in a sperm motility control mechanism conserved in many organisms, including humans. The other three genes have no match to sequences from non-mosquito taxa, thus can be regarded as orphans. RNA in situ hybridization demonstrated that one of the orphans is transcribed in spermatids, which suggests its involvement in sperm maturation. Two other orphans have unknown functions. Expression analysis of orthologs of all five genes indicated that male-biased transcription was not conserved in the majority of cases in Aedes and Culex. Conclusion Discovery of testis-expressed orphan genes in mosquitoes opens new prospects for the development of innovative control methods. The orphan encoded proteins may represent unique targets of selective anti-mosquito sterilizing agents that will not affect non-target organisms.

  3. Analysis of expression in the Anopheles gambiae developing testes reveals rapidly evolving lineage-specific genes in mosquitoes.

    Science.gov (United States)

    Krzywinska, Elzbieta; Krzywinski, Jaroslaw

    2009-07-06

    Male mosquitoes do not feed on blood and are not involved in delivery of pathogens to humans. Consequently, they are seldom the subjects of research, which results in a very poor understanding of their biology. To gain insights into male developmental processes we sought to identify genes transcribed exclusively in the reproductive tissues of male Anopheles gambiae pupae. Using a cDNA subtraction strategy, five male-specifically or highly male-biased expressed genes were isolated, four of which remain unannotated in the An. gambiae genome. Spatial and temporal expression patterns suggest that each of these genes is involved in the mid-late stages of spermatogenesis. Their sequences are rapidly evolving; however, two genes possess clear homologs in a wide range of taxa and one of these probably acts in a sperm motility control mechanism conserved in many organisms, including humans. The other three genes have no match to sequences from non-mosquito taxa, thus can be regarded as orphans. RNA in situ hybridization demonstrated that one of the orphans is transcribed in spermatids, which suggests its involvement in sperm maturation. Two other orphans have unknown functions. Expression analysis of orthologs of all five genes indicated that male-biased transcription was not conserved in the majority of cases in Aedes and Culex. Discovery of testis-expressed orphan genes in mosquitoes opens new prospects for the development of innovative control methods. The orphan encoded proteins may represent unique targets of selective anti-mosquito sterilizing agents that will not affect non-target organisms.

  4. Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

    Science.gov (United States)

    Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

    2016-01-01

    Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample

  5. Genome-Wide Analysis in Three Fusarium Pathogens Identifies Rapidly Evolving Chromosomes and Genes Associated with Pathogenicity

    Science.gov (United States)

    Sperschneider, Jana; Gardiner, Donald M.; Thatcher, Louise F.; Lyons, Rebecca; Singh, Karam B.; Manners, John M.; Taylor, Jennifer M.

    2015-01-01

    Pathogens and hosts are in an ongoing arms race and genes involved in host–pathogen interactions are likely to undergo diversifying selection. Fusarium plant pathogens have evolved diverse infection strategies, but how they interact with their hosts in the biotrophic infection stage remains puzzling. To address this, we analyzed the genomes of three Fusarium plant pathogens for genes that are under diversifying selection. We found a two-speed genome structure both on the chromosome and gene group level. Diversifying selection acts strongly on the dispensable chromosomes in Fusarium oxysporum f. sp. lycopersici and on distinct core chromosome regions in Fusarium graminearum, all of which have associations with virulence. Members of two gene groups evolve rapidly, namely those that encode proteins with an N-terminal [SG]-P-C-[KR]-P sequence motif and proteins that are conserved predominantly in pathogens. Specifically, 29 F. graminearum genes are rapidly evolving, in planta induced and encode secreted proteins, strongly pointing toward effector function. In summary, diversifying selection in Fusarium is strongly reflected as genomic footprints and can be used to predict a small gene set likely to be involved in host–pathogen interactions for experimental verification. PMID:25994930

  6. Towards rapid prototyped convective microfluidic DNA amplification platform

    Science.gov (United States)

    Ajit, Smrithi; Praveen, Hemanth Mithun; Puneeth, S. B.; Dave, Abhishek; Sesham, Bharat; Mohan, K. N.; Goel, Sanket

    2017-02-01

    Today, Polymerase Chain Reaction (PCR) based DNA amplification plays an indispensable role in the field of biomedical research. Its inherent ability to exponentially amplify sample DNA has proven useful for the identification of virulent pathogens like those causing Multiple Drug-Resistant Tuberculosis (MDR-TB). The intervention of Microfluidics technology has revolutionized the concept of PCR from being a laborious and time consuming process into one that is faster, easily portable and capable of being multifunctional. The Microfluidics based PCR outweighs its traditional counterpart in terms of flexibility of varying reaction rate, operation simplicity, need of a fraction of volume and capability of being integrated with other functional elements. The scope of the present work involves the development of a real-time continuous flow microfluidic device, fabricated by 3D printing-governed rapid prototyping method, eventually leading to an automated and robust platform to process multiple DNA samples for detection of MDRTB-associated mutations. The thermal gradient characteristic to the PCR process is produced using peltier units appropriate to the microfluidic environment fully monitored and controlled by a low cost controller driven by a Data Acquisition System. The process efficiency achieved in the microfluidic environment in terms of output per cycle is expected to be on par with the traditional PCR and capable of earning the additional advantages of being faster and minimizing the handling.

  7. Sensationalistic journalism and tales of snakebite: are rattlesnakes rapidly evolving more toxic venom?

    Science.gov (United States)

    Hayes, William K; Mackessy, Stephen P

    2010-03-01

    Recent reports in the lay press have suggested that bites by rattlesnakes in the last several years have been more severe than those in the past. The explanation, often citing physicians, is that rattlesnakes are evolving more toxic venom, perhaps in response to anthropogenic causes. We suggest that other explanations are more parsimonious, including factors dependent on the snake and factors associated with the bite victim's response to envenomation. Although bites could become more severe from an increased proportion of bites from larger or more provoked snakes (ie, more venom injected), the venom itself evolves much too slowly to explain the severe symptoms occasionally seen. Increased snakebite severity could also result from a number of demographic changes in the victim profile, including age and body size, behavior toward the snake (provocation), anatomical site of bite, clothing, and general health including asthma prevalence and sensitivity to foreign antigens. Clinical management of bites also changes perpetually, rendering comparisons of snakebite severity over time tenuous. Clearly, careful study taking into consideration many factors will be essential to document temporal changes in snakebite severity or venom toxicity. Presently, no published evidence for these changes exists. The sensationalistic coverage of these atypical bites and accompanying speculation is highly misleading and can produce many detrimental results, such as inappropriate fear of the outdoors and snakes, and distraction from proven snakebite management needs, including a consistent supply of antivenom, adequate health care, and training. We urge healthcare providers to avoid propagating misinformation about snakes and snakebites. Copyright (c) 2010 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  8. The thermal dependency of locomotor performance evolves rapidly within an invasive species.

    Science.gov (United States)

    Kosmala, Georgia K; Brown, Gregory P; Christian, Keith A; Hudson, Cameron M; Shine, Richard

    2018-05-01

    Biological invasions can stimulate rapid shifts in organismal performance, via both plasticity and adaptation. We can distinguish between these two proximate mechanisms by rearing offspring from populations under identical conditions and measuring their locomotor abilities in standardized trials. We collected adult cane toads ( Rhinella marina ) from invasive populations that inhabit regions of Australia with different climatic conditions. We bred those toads and raised their offspring under common-garden conditions before testing their locomotor performance. At high (but not low) temperatures, offspring of individuals from a hotter location (northwestern Australia) outperformed offspring of conspecifics from a cooler location (northeastern Australia). This disparity indicates that, within less than 100 years, thermal performance in cane toads has adapted to the novel abiotic challenges that cane toads have encountered during their invasion of tropical Australia.

  9. Co-regulation of a large and rapidly evolving repertoire of odorant receptor genes

    Directory of Open Access Journals (Sweden)

    Lane Robert P

    2007-09-01

    Full Text Available Abstract The olfactory system meets niche- and species-specific demands by an accelerated evolution of its odorant receptor repertoires. In this review, we describe evolutionary processes that have shaped olfactory and vomeronasal receptor gene families in vertebrate genomes. We emphasize three important periods in the evolution of the olfactory system evident by comparative genomics: the adaptation to land in amphibian ancestors, the decline of olfaction in primates, and the delineation of putative pheromone receptors concurrent with rodent speciation. The rapid evolution of odorant receptor genes, the sheer size of the repertoire, as well as their wide distribution in the genome, presents a developmental challenge: how are these ever-changing odorant receptor repertoires coordinated within the olfactory system? A central organizing principle in olfaction is the specialization of sensory neurons resulting from each sensory neuron expressing only ~one odorant receptor allele. In this review, we also discuss this mutually exclusive expression of odorant receptor genes. We have considered several models to account for co-regulation of odorant receptor repertoires, as well as discussed a new hypothesis that invokes important epigenetic properties of the system.

  10. Consumer Health Informatics: Past, Present, and Future of a Rapidly Evolving Domain.

    Science.gov (United States)

    Demiris, G

    2016-05-20

    Consumer Health Informatics (CHI) is a rapidly growing domain within the field of biomedical and health informatics. The objective of this paper is to reflect on the past twenty five years and showcase informatics concepts and applications that led to new models of care and patient empowerment, and to predict future trends and challenges for the next 25 years. We discuss concepts and systems based on a review and analysis of published literature in the consumer health informatics domain in the last 25 years. The field was introduced with the vision that one day patients will be in charge of their own health care using informatics tools and systems. Scientific literature in the field originally focused on ways to assess the quality and validity of available printed health information, only to grow significantly to cover diverse areas such as online communities, social media, and shared decision-making. Concepts such as home telehealth, mHealth, and the quantified-self movement, tools to address transparency of health care organizations, and personal health records and portals provided significant milestones in the field. Consumers are able to actively participate in the decision-making process and to engage in health care processes and decisions. However, challenges such as health literacy and the digital divide have hindered us from maximizing the potential of CHI tools with a significant portion of underserved populations unable to access and utilize them. At the same time, at a global scale consumer tools can increase access to care for underserved populations in developing countries. The field continues to grow and emerging movements such as precision medicine and the sharing economy will introduce new opportunities and challenges.

  11. Rapidly evolving marmoset MSMB genes are differently expressed in the male genital tract

    Directory of Open Access Journals (Sweden)

    Ceder Yvonne

    2009-09-01

    Full Text Available Abstract Background Beta-microseminoprotein, an abundant component in prostatic fluid, is encoded by the potential tumor suppressor gene MSMB. Some New World monkeys carry several copies of this gene, in contrast to most mammals, including humans, which have one only. Here we have investigated the background for the species difference by analyzing the chromosomal organization and expression of MSMB in the common marmoset (Callithrix jacchus. Methods Genes were identified in the Callithrix jacchus genome database using bioinformatics and transcripts were analyzed by RT-PCR and quantified by real time PCR in the presence of SYBR green. Results The common marmoset has five MSMB: one processed pseudogene and four functional genes. The latter encompass homologous genomic regions of 32-35 kb, containing the genes of 12-14 kb and conserved upstream and downstream regions of 14-19 kb and 3-4 kb. One gene, MSMB1, occupies the same position on the chromosome as the single human gene. On the same chromosome, but several Mb away, is another MSMB locus situated with MSMB2, MSMB3 and MSMB4 arranged in tandem. Measurements of transcripts demonstrated that all functional genes are expressed in the male genital tract, generating very high transcript levels in the prostate. The transcript levels in seminal vesicles and testis are two and four orders of magnitude lower. A single gene, MSMB3, accounts for more than 90% of MSMB transcripts in both the prostate and the seminal vesicles, whereas in the testis around half of the transcripts originate from MSMB2. These genes display rapid evolution with a skewed distribution of mutated nucleotides; in MSMB2 they affect nucleotides encoding the N-terminal Greek key domain, whereas in MSMB3 it is the C-terminal MSMB-unique domain that is affected. Conclusion Callitrichide monkeys have four functional MSMB that are all expressed in the male genital tract, but the product from one gene, MSMB3, will predominate in seminal

  12. Linking rapid magma reservoir assembly and eruption trigger mechanisms at evolved Yellowstone-type supervolcanoes

    Science.gov (United States)

    Wotzlaw, J.F.; Bindeman, I.N.; Watts, Kathryn E.; Schmitt, A.K.; Caricchi, L.; Schaltegger, U.

    2014-01-01

    The geological record contains evidence of volcanic eruptions that were as much as two orders of magnitude larger than the most voluminous eruption experienced by modern civilizations, the A.D. 1815 Tambora (Indonesia) eruption. Perhaps nowhere on Earth are deposits of such supereruptions more prominent than in the Snake River Plain–Yellowstone Plateau (SRP-YP) volcanic province (northwest United States). While magmatic activity at Yellowstone is still ongoing, the Heise volcanic field in eastern Idaho represents the youngest complete caldera cycle in the SRP-YP, and thus is particularly instructive for current and future volcanic activity at Yellowstone. The Heise caldera cycle culminated 4.5 Ma ago in the eruption of the ∼1800 km3 Kilgore Tuff. Accessory zircons in the Kilgore Tuff display significant intercrystalline and intracrystalline oxygen isotopic heterogeneity, and the vast majority are 18O depleted. This suggests that zircons crystallized from isotopically distinct magma batches that were generated by remelting of subcaldera silicic rocks previously altered by low-δ18O meteoric-hydrothermal fluids. Prior to eruption these magma batches were assembled and homogenized into a single voluminous reservoir. U-Pb geochronology of isotopically diverse zircons using chemical abrasion–isotope dilution–thermal ionization mass spectrometry yielded indistinguishable crystallization ages with a weighted mean 206Pb/238U date of 4.4876 ± 0.0023 Ma (MSWD = 1.5; n = 24). These zircon crystallization ages are also indistinguishable from the sanidine 40Ar/39Ar dates, and thus zircons crystallized close to eruption. This requires that shallow crustal melting, assembly of isolated batches into a supervolcanic magma reservoir, homogenization, and eruption occurred extremely rapidly, within the resolution of our geochronology (103–104 yr). The crystal-scale image of the reservoir configuration, with several isolated magma batches, is very similar to the

  13. Patient with rapidly evolving neurological disease with neuropathological lesions of Creutzfeldt-Jakob disease, Lewy body dementia, chronic subcortical vascular encephalopathy and meningothelial meningioma.

    Science.gov (United States)

    Vita, Maria Gabriella; Tiple, Dorina; Bizzarro, Alessandra; Ladogana, Anna; Colaizzo, Elisa; Capellari, Sabina; Rossi, Marcello; Parchi, Piero; Masullo, Carlo; Pocchiari, Maurizio

    2017-04-01

    We report a case of rapidly evolving neurological disease in a patient with neuropathological lesions of Creutzfeldt-Jakob disease (CJD), Lewy body dementia (LBD), chronic subcortical vascular encephalopathy and meningothelial meningioma. The coexistence of severe multiple pathologies in a single patient strengthens the need to perform accurate clinical differential diagnoses in rapidly progressive dementias. © 2016 Japanese Society of Neuropathology.

  14. Rapid transfer of DNA from agarose gels to nylon membranes.

    OpenAIRE

    Reed, K C; Mann, D A

    1985-01-01

    The unique properties of nylon membranes allow for dramatic improvement in the capillary transfer of DNA restriction fragments from agarose gels (Southern blotting). By using 0.4 M NaOH as the transfer solvent following a short pre-treatment of the gel in acid, DNA is depurinated during transfer. Fragments of all sizes are eluted and retained quantitatively by the membrane; furthermore, the alkaline solvent induces covalent fixation of DNA to the membrane. The saving in time and materials aff...

  15. Rapid and inexpensive method for isolating plasmid DNA

    International Nuclear Information System (INIS)

    Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

    1997-01-01

    A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

  16. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  17. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    Total DNA of Chokanan mango (Mangifera indica L.) was extracted from the leaf for the construction of total genomic library. However, the quality of the extracted DNA was often compromised by the presence of secondary metabolites, thus interfering with the analytical applications. Improvement on the quality of the ...

  18. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  19. Rapidly evolving zona pellucida domain proteins are a major component of the vitelline envelope of abalone eggs

    Science.gov (United States)

    Aagaard, Jan E.; Yi, Xianhua; MacCoss, Michael J.; Swanson, Willie J.

    2006-01-01

    Proteins harboring a zona pellucida (ZP) domain are prominent components of vertebrate egg coats. Although less well characterized, the egg coat of the non-vertebrate marine gastropod abalone (Haliotis spp.) is also known to contain a ZP domain protein, raising the possibility of a common molecular basis of metazoan egg coat structures. Egg coat proteins from vertebrate as well as non-vertebrate taxa have been shown to evolve under positive selection. Studied most extensively in the abalone system, coevolution between adaptively diverging egg coat and sperm proteins may contribute to the rapid development of reproductive isolation. Thus, identifying the pattern of evolution among egg coat proteins is important in understanding the role these genes may play in the speciation process. The purpose of the present study is to characterize the constituent proteins of the egg coat [vitelline envelope (VE)] of abalone eggs and to provide preliminary evidence regarding how selection has acted on VE proteins during abalone evolution. A proteomic approach is used to match tandem mass spectra of peptides from purified VE proteins with abalone ovary EST sequences, identifying 9 of 10 ZP domain proteins as components of the VE. Maximum likelihood models of codon evolution suggest positive selection has acted among a subset of amino acids for 6 of these genes. This work provides further evidence of the prominence of ZP proteins as constituents of the egg coat, as well as the prominent role of positive selection in diversification of these reproductive proteins. PMID:17085584

  20. Capillary gel electrophoresis for rapid, high resolution DNA sequencing.

    OpenAIRE

    Swerdlow, H; Gesteland, R

    1990-01-01

    Capillary gel electrophoresis has been demonstrated for the separation and detection of DNA sequencing samples. Enzymatic dideoxy nucleotide chain termination was employed, using fluorescently tagged oligonucleotide primers and laser based on-column detection (limit of detection is 6,000 molecules per peak). Capillary gel separations were shown to be three times faster, with better resolution (2.4 x), and higher separation efficiency (5.4 x) than a conventional automated slab gel DNA sequenci...

  1. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  2. A rapid mini-prep DNA extraction method in rice (Oryza sativa)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-01-19

    Jan 19, 2009 ... homogenizer with a plastic tip is incomplete, since the leaves of these plants .... mortar and pestle with liquid nitrogen and transferred to a tube. ... rapid DNA extraction protocols for gymnosperms for application in population ...

  3. Rapid isolation of high molecular weight DNA from single dried ...

    African Journals Online (AJOL)

    ANAND

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri. Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  4. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    gels, containing 7% glycerol, and 1×TBE buffer. The gels were run under 200 .... Inc. Germany, GeneaidTM DNA Isolation Kit, Geneaid. Biotech., New Taipei City, .... C. L. and Arsenos G. 2015 Comparison of eleven methods for genomic DNA ...

  5. An optimized rapid bisulfite conversion method with high recovery of cell-free DNA.

    Science.gov (United States)

    Yi, Shaohua; Long, Fei; Cheng, Juanbo; Huang, Daixin

    2017-12-19

    Methylation analysis of cell-free DNA is a encouraging tool for tumor diagnosis, monitoring and prognosis. Sensitivity of methylation analysis is a very important matter due to the tiny amounts of cell-free DNA available in plasma. Most current methods of DNA methylation analysis are based on the difference of bisulfite-mediated deamination of cytosine between cytosine and 5-methylcytosine. However, the recovery of bisulfite-converted DNA based on current methods is very poor for the methylation analysis of cell-free DNA. We optimized a rapid method for the crucial steps of bisulfite conversion with high recovery of cell-free DNA. A rapid deamination step and alkaline desulfonation was combined with the purification of DNA on a silica column. The conversion efficiency and recovery of bisulfite-treated DNA was investigated by the droplet digital PCR. The optimization of the reaction results in complete cytosine conversion in 30 min at 70 °C and about 65% of recovery of bisulfite-treated cell-free DNA, which is higher than current methods. The method allows high recovery from low levels of bisulfite-treated cell-free DNA, enhancing the analysis sensitivity of methylation detection from cell-free DNA.

  6. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  7. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

    Science.gov (United States)

    Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

    2014-12-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

  8. Rapid DNA sequencing by horizontal ultrathin gel electrophoresis.

    OpenAIRE

    Brumley, R L; Smith, L M

    1991-01-01

    A horizontal polyacrylamide gel electrophoresis apparatus has been developed that decreases the time required to separate the DNA fragments produced in enzymatic sequencing reactions. The configuration of this apparatus and the use of circulating coolant directly under the glass plates result in heat exchange that is approximately nine times more efficient than passive thermal transfer methods commonly used. Bubble-free gels as thin as 25 microns can be routinely cast on this device. The appl...

  9. Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform

    Directory of Open Access Journals (Sweden)

    Shan Wei

    2018-05-01

    Full Text Available Real-time sequencing of short DNA reads has a wide variety of clinical and research applications including screening for mutations, target sequences and aneuploidy. We recently demonstrated that MinION, a nanopore-based DNA sequencing device the size of a USB drive, could be used for short-read DNA sequencing. In this study, an ultra-rapid multiplex library preparation and sequencing method for the MinION is presented and applied to accurately test normal diploid and aneuploidy samples’ genomic DNA in under three hours, including library preparation and sequencing. This novel method shows great promise as a clinical diagnostic test for applications requiring rapid short-read DNA sequencing.

  10. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  11. A pneumatic device for rapid loading of DNA sequencing gels.

    Science.gov (United States)

    Panussis, D A; Cook, M W; Rifkin, L L; Snider, J E; Strong, J T; McGrane, R M; Wilson, R K; Mardis, E R

    1998-05-01

    This work describes the design and construction of a device that facilitates the loading of DNA samples onto polyacrylamide gels for detection in the Perkin Elmer/Applied Biosystems (PE/ABI) 373 and 377 DNA sequencing instruments. The device is mounted onto the existing gel cassettes and makes the process of loading high-density gels less cumbersome while the associated time and errors are reduced. The principle of operation includes the simultaneous transfer of the entire batch of samples, in which a spring-loaded air cylinder generates positive pressure and flexible silica capillaries transfer the samples. A retractable capillary array carrier allows the delivery ends of the capillaries to be held up clear of the gel during loader attachment on the gel plates, while enabling their insertion in the gel wells once the device is securely mounted. Gel-loading devices capable of simultaneously transferring 72 samples onto the PE/ABI 373 and 377 are currently being used in our production sequencing groups while a 96-sample transfer prototype undergoes testing.

  12. DNA Probe Pooling for Rapid Delineation of Chromosomal Breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Kwan, Johnson; Baumgartner, Adolf; Weier, Jingly F.; Wang, Mei; Escudero, Tomas; Munne' , Santiago; Zitzelsberger, Horst F.; Weier, Heinz-Ulrich

    2009-01-30

    Structural chromosome aberrations are hallmarks of many human genetic diseases. The precise mapping of translocation breakpoints in tumors is important for identification of genes with altered levels of expression, prediction of tumor progression, therapy response, or length of disease-free survival as well as the preparation of probes for detection of tumor cells in peripheral blood. Similarly, in vitro fertilization (IVF) and preimplantation genetic diagnosis (PGD) for carriers of balanced, reciprocal translocations benefit from accurate breakpoint maps in the preparation of patient-specific DNA probes followed by a selection of normal or balanced oocytes or embryos. We expedited the process of breakpoint mapping and preparation of case-specific probes by utilizing physically mapped bacterial artificial chromosome (BAC) clones. Historically, breakpoint mapping is based on the definition of the smallest interval between proximal and distal probes. Thus, many of the DNA probes prepared for multi-clone and multi-color mapping experiments do not generate additional information. Our pooling protocol described here with examples from thyroid cancer research and PGD accelerates the delineation of translocation breakpoints without sacrificing resolution. The turnaround time from clone selection to mapping results using tumor or IVF patient samples can be as short as three to four days.

  13. Facile preparation of a DNA sensor for rapid herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Tam, Phuong Dinh, E-mail: tampd-hast@mail.hut.edu.vn [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Tuan, Mai Anh, E-mail: tuanma-itims@mail.hut.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam); Huy, Tran Quang [National Institute of Hygiene and Epidemiology (NIHE), 01 Yersin, Hai Ba Trung District, Hanoi (Viet Nam); Le, Anh-Tuan [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Hieu, Nguyen Van, E-mail: hieu@itims.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam)

    2010-10-12

    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  14. Facile preparation of a DNA sensor for rapid herpes virus detection

    International Nuclear Information System (INIS)

    Tam, Phuong Dinh; Tuan, Mai Anh; Huy, Tran Quang; Le, Anh-Tuan; Hieu, Nguyen Van

    2010-01-01

    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  15. A Rapid and Cost-Effective Method for DNA Extraction from Archival Herbarium Specimens.

    Science.gov (United States)

    Krinitsina, A A; Sizova, T V; Zaika, M A; Speranskaya, A S; Sukhorukov, A P

    2015-11-01

    Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.

  16. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  17. Photoelectrochemical Sensors for the Rapid Detection of DNA Damage Induced by Some Nanoparticles

    Directory of Open Access Journals (Sweden)

    M. Jamaluddin Ahmed

    2010-06-01

    Full Text Available Photoelectrochemcal sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy2 (dppz2+ [bpy=2, 2′ -bipyridine, dppz=dipyrido( 3, 2-a: 2′ 3′-c phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy2 (dppz2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time – dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polysterene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals.

  18. Photoelectrochemical sensors for the rapid detection of DNA damage Induced by some nanoparticles

    International Nuclear Information System (INIS)

    Ahmed, M.J.; Zhang, B.T.; Guo, L.H.

    2010-01-01

    Photoelectrochemical sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy)2 (dppz)2+ [bpy=2, 2' -bipyridine, dppz=dipyrido (3, 2-a: 2' 3'-c) phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy)2 (dppz)2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine) was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time . dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polystyrene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals. (author)

  19. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.

    Science.gov (United States)

    Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B

    2017-01-01

    Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.

  20. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  1. Rapid detection and purification of sequence specific DNA binding proteins using magnetic separation

    Directory of Open Access Journals (Sweden)

    TIJANA SAVIC

    2006-02-01

    Full Text Available In this paper, a method for the rapid identification and purification of sequence specific DNA binding proteins based on magnetic separation is presented. This method was applied to confirm the binding of the human recombinant USF1 protein to its putative binding site (E-box within the human SOX3 protomer. It has been shown that biotinylated DNA attached to streptavidin magnetic particles specifically binds the USF1 protein in the presence of competitor DNA. It has also been demonstrated that the protein could be successfully eluted from the beads, in high yield and with restored DNA binding activity. The advantage of these procedures is that they could be applied for the identification and purification of any high-affinity sequence-specific DNA binding protein with only minor modifications.

  2. Rapid detection of cancer related DNA nanoparticulate biomarkers and nanoparticles in whole blood

    Science.gov (United States)

    Heller, Michael J.; Krishnan, Raj; Sonnenberg, Avery

    2010-08-01

    The ability to rapidly detect cell free circulating (cfc) DNA, cfc-RNA, exosomes and other nanoparticulate disease biomarkers as well as drug delivery nanoparticles directly in blood is a major challenge for nanomedicine. We now show that microarray and new high voltage dielectrophoretic (DEP) devices can be used to rapidly isolate and detect cfc-DNA nanoparticulates and nanoparticles directly from whole blood and other high conductance samples (plasma, serum, urine, etc.). At DEP frequencies of 5kHz-10kHz both fluorescent-stained high molecular weight (hmw) DNA, cfc-DNA and fluorescent nanoparticles separate from the blood and become highly concentrated at specific DEP highfield regions over the microelectrodes, while blood cells move to the DEP low field-regions. The blood cells can then be removed by a simple fluidic wash while the DNA and nanoparticles remain highly concentrated. The hmw-DNA could be detected at a level of <260ng/ml and the nanoparticles at <9.5 x 109 particles/ml, detection levels that are well within the range for viable clinical diagnostics and drug nanoparticle monitoring. Disease specific cfc-DNA materials could also be detected directly in blood from patients with Chronic Lymphocytic Leukemia (CLL) and confirmed by PCR genotyping analysis.

  3. Rapid and efficient method to extract metagenomic DNA from estuarine sediments.

    Science.gov (United States)

    Shamim, Kashif; Sharma, Jaya; Dubey, Santosh Kumar

    2017-07-01

    Metagenomic DNA from sediments of selective estuaries of Goa, India was extracted using a simple, fast, efficient and environment friendly method. The recovery of pure metagenomic DNA from our method was significantly high as compared to other well-known methods since the concentration of recovered metagenomic DNA ranged from 1185.1 to 4579.7 µg/g of sediment. The purity of metagenomic DNA was also considerably high as the ratio of absorbance at 260 and 280 nm ranged from 1.88 to 1.94. Therefore, the recovered metagenomic DNA was directly used to perform various molecular biology experiments viz. restriction digestion, PCR amplification, cloning and metagenomic library construction. This clearly proved that our protocol for metagenomic DNA extraction using silica gel efficiently removed the contaminants and prevented shearing of the metagenomic DNA. Thus, this modified method can be used to recover pure metagenomic DNA from various estuarine sediments in a rapid, efficient and eco-friendly manner.

  4. Rapid DNA multi-analyte immunoassay on a magneto-resistance biosensor

    NARCIS (Netherlands)

    Koets, M.; Wijk, van der T.; Eemeren, van J.T.W.M.; Amerongen, van A.; Prins, M.W.J.

    2009-01-01

    We present the rapid and sensitive detection of amplified DNA on a giant magneto-resistance sensor using superparamagnetic particles as a detection label. The one-step assay is performed on an integrated and miniaturized detection platform suitable for application into point-of-care devices. A

  5. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  6. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  7. RBE comparison between rapid electrons of 20 MeV and 45 MeV with survival rate, DNA synthesis, DNA reparation and nucleoid sedimentation

    International Nuclear Information System (INIS)

    Alth, G.; Weniger, P.; Turtzer, K.; Klein, W.; Kocsis, F.; Krankenhaus der Stadt Wien-Lainz; Oesterreichisches Forschungszentrum Seibersdorf G.m.b.H. Inst. fuer Biologie)

    1982-01-01

    In order to find out possible differences of the biologic efficacy of rapid electrons of different energies, the authors examined the influence of rapid electrons of 20 MeV and 45 MeV upon the survival rate of Hela cells S3, their cell growth, DNA synthesis, DNA reparation, and sedimentation of nucleoids. The results show a difference only for the nucleoid sedimentation, i.e. there are more fractured DNA cords after 45 MeV irradiation. No significant differences could be demonstrated for the parameters of the survival curve, DNA synthesis and DNA reparation. Four double tests were carried out corresponding to the indicated types of examination. (orig.) [de

  8. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples.

    Science.gov (United States)

    Guha, Pokhraj; Das, Avishek; Dutta, Somit; Chaudhuri, Tapas Kumar

    2018-01-01

    Different methods available for extraction of human genomic DNA suffer from one or more drawbacks including low yield, compromised quality, cost, time consumption, use of toxic organic solvents, and many more. Herein, we aimed to develop a method to extract DNA from 500 μL of fresh or frozen human blood. Five hundred microliters of fresh and frozen human blood samples were used for standardization of the extraction procedure. Absorbance at 260 and 280 nm, respectively, (A 260 /A 280 ) were estimated to check the quality and quantity of the extracted DNA sample. Qualitative assessment of the extracted DNA was checked by Polymerase Chain reaction and double digestion of the DNA sample. Our protocol resulted in average yield of 22±2.97 μg and 20.5±3.97 μg from 500 μL of fresh and frozen blood, respectively, which were comparable to many reference protocols and kits. Besides yielding bulk amount of DNA, our protocol is rapid, economical, and avoids toxic organic solvents such as Phenol. Due to unaffected quality, the DNA is suitable for downstream applications. The protocol may also be useful for pursuing basic molecular researches in laboratories having limited funds. © 2017 Wiley Periodicals, Inc.

  9. Rapid Sequential in Situ Multiplexing with DNA Exchange Imaging in Neuronal Cells and Tissues.

    Science.gov (United States)

    Wang, Yu; Woehrstein, Johannes B; Donoghue, Noah; Dai, Mingjie; Avendaño, Maier S; Schackmann, Ron C J; Zoeller, Jason J; Wang, Shan Shan H; Tillberg, Paul W; Park, Demian; Lapan, Sylvain W; Boyden, Edward S; Brugge, Joan S; Kaeser, Pascal S; Church, George M; Agasti, Sarit S; Jungmann, Ralf; Yin, Peng

    2017-10-11

    To decipher the molecular mechanisms of biological function, it is critical to map the molecular composition of individual cells or even more importantly tissue samples in the context of their biological environment in situ. Immunofluorescence (IF) provides specific labeling for molecular profiling. However, conventional IF methods have finite multiplexing capabilities due to spectral overlap of the fluorophores. Various sequential imaging methods have been developed to circumvent this spectral limit but are not widely adopted due to the common limitation of requiring multirounds of slow (typically over 2 h at room temperature to overnight at 4 °C in practice) immunostaining. We present here a practical and robust method, which we call DNA Exchange Imaging (DEI), for rapid in situ spectrally unlimited multiplexing. This technique overcomes speed restrictions by allowing for single-round immunostaining with DNA-barcoded antibodies, followed by rapid (less than 10 min) buffer exchange of fluorophore-bearing DNA imager strands. The programmability of DEI allows us to apply it to diverse microscopy platforms (with Exchange Confocal, Exchange-SIM, Exchange-STED, and Exchange-PAINT demonstrated here) at multiple desired resolution scales (from ∼300 nm down to sub-20 nm). We optimized and validated the use of DEI in complex biological samples, including primary neuron cultures and tissue sections. These results collectively suggest DNA exchange as a versatile, practical platform for rapid, highly multiplexed in situ imaging, potentially enabling new applications ranging from basic science, to drug discovery, and to clinical pathology.

  10. The DNA 'comet assay' as a rapid screening technique to control irradiated food

    International Nuclear Information System (INIS)

    Cerda, H.; Delincee, H.; Haine, H.; Rupp, H.

    1997-01-01

    The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded

  11. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    Science.gov (United States)

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

    2018-02-15

    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  12. HIV-TRACE (Transmission Cluster Engine): a tool for large scale molecular epidemiology of HIV-1 and other rapidly evolving pathogens.

    Science.gov (United States)

    Kosakovsky Pond, Sergei L; Weaver, Steven; Leigh Brown, Andrew J; Wertheim, Joel O

    2018-01-31

    In modern applications of molecular epidemiology, genetic sequence data are routinely used to identify clusters of transmission in rapidly evolving pathogens, most notably HIV-1. Traditional 'shoeleather' epidemiology infers transmission clusters by tracing chains of partners sharing epidemiological connections (e.g., sexual contact). Here, we present a computational tool for identifying a molecular transmission analog of such clusters: HIV-TRACE (TRAnsmission Cluster Engine). HIV-TRACE implements an approach inspired by traditional epidemiology, by identifying chains of partners whose viral genetic relatedness imply direct or indirect epidemiological connections. Molecular transmission clusters are constructed using codon-aware pairwise alignment to a reference sequence followed by pairwise genetic distance estimation among all sequences. This approach is computationally tractable and is capable of identifying HIV-1 transmission clusters in large surveillance databases comprising tens or hundreds of thousands of sequences in near real time, i.e., on the order of minutes to hours. HIV-TRACE is available at www.hivtrace.org and from github.com/veg/hivtrace, along with the accompanying result visualization module from github.com/veg/hivtrace-viz. Importantly, the approach underlying HIV-TRACE is not limited to the study of HIV-1 and can be applied to study outbreaks and epidemics of other rapidly evolving pathogens. © The Author 2018. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. A rapid and quantitative method to determine the tritium content in DNA from small tissue sampes

    International Nuclear Information System (INIS)

    Kasche, V.; Zoellner, R.

    1979-01-01

    A rapid and quantitative two-step procedure to isolate double-strand DNA from small (10-100 mg) animal tissue samples is presented. The method is developed for investigations to evaluate the relative importance of organically bound tritium for the dose factors used to calculate dose commitments due to this nuclide. In the first step the proteins in the homogenized sample are hydrolysed, at a high pH (9.0) and ionic strength (1.5) to dissociate protein from DNA, using immobilized Proteinase K as a proteolytic enzyme. The DNA is then absorbed to hydroxylapatite and separated from impurities by step-wise elution with buffers of increasing ionic strength. More than 90% of the DNA in the samples could be isolated in double-strand form by this procedure. The method has been applied to determine pool-sizes and biological half-life times of tritium in DNA from various animal (mouse) tissues. It has also been shown to be suitable in other radiobiological studies where effects on DNA are investigated. (author)

  14. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  15. Rapid turnover of 2-LTR HIV-1 DNA during early stage of highly active antiretroviral therapy.

    Directory of Open Access Journals (Sweden)

    Weijun Zhu

    Full Text Available BACKGROUND: Despite prolonged treatment with highly active antiretroviral therapy (HAART, the infectious HIV-1 continues to replicate and resides latently in the resting memory CD4+ T lymphocytes, which blocks the eradication of HIV-1. The viral persistence of HIV-1 is mainly caused by its proviral DNA being either linear nonintegrated, circular nonintegrated, or integrated. Previous reports have largely focused on the dynamics of HIV-1 DNA from the samples collected with relatively long time intervals during the process of disease and HAART treatment, which may have missed the intricate changes during the intervals in early treatment. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we investigated the dynamics of HIV-1 DNA in patients during the early phase of HARRT treatment. Using optimized real time PCR, we observed significant changes in 2-LTR during the first 12-week of treatment, while total and integrated HIV-1 DNA remained stable. The doubling time and half-life of 2-LTR were not correlated with the baseline and the rate of changes in plasma viral load and various CD4+ T-cell populations. Longitudinal analyses on 2-LTR sequences and plasma lipopolysaccharide (LPS levels did not reveal any significant changes in the same treatment period. CONCLUSIONS/SIGNIFICANCE: Our study revealed the rapid changes in 2-LTR concentration in a relatively large number of patients during the early HAART treatment. The rapid changes indicate the rapid infusion and clearance of cells bearing 2-LTR in the peripheral blood. Those changes are not expected to be caused by the blocking of viral integration, as our study did not include the integrase inhibitor raltegravir. Our study helps better understand the dynamics of HIV-DNA and its potential role as a biomarker for the diseases and for the treatment efficacy of HAART.

  16. The apolipoprotein L family of programmed cell death and immunity genes rapidly evolved in primates at discrete sites of host-pathogen interactions.

    Science.gov (United States)

    Smith, Eric E; Malik, Harmit S

    2009-05-01

    Apolipoprotein L1 (APOL1) is a human protein that confers immunity to Trypanosoma brucei infections but can be countered by a trypanosome-encoded antagonist SRA. APOL1 belongs to a family of programmed cell death genes whose proteins can initiate host apoptosis or autophagic death. We report here that all six members of the APOL gene family (APOL1-6) present in humans have rapidly evolved in simian primates. APOL6, furthermore, shows evidence of an adaptive sweep during recent human evolution. In each APOL gene tested, we found rapidly evolving codons in or adjacent to the SRA-interacting protein domain (SID), which is the domain of APOL1 that interacts with SRA. In APOL6, we also found a rapidly changing 13-amino-acid cluster in the membrane-addressing domain (MAD), which putatively functions as a pH sensor and regulator of cell death. We predict that APOL genes are antagonized by pathogens by at least two distinct mechanisms: SID antagonists, which include SRA, that interact with the SID of various APOL proteins, and MAD antagonists that interact with the MAD hinge base of APOL6. These antagonists either block or prematurely cause APOL-mediated programmed cell death of host cells to benefit the infecting pathogen. These putative interactions must occur inside host cells, in contrast to secreted APOL1 that trafficks to the trypanosome lysosome. Hence, the dynamic APOL gene family appears to be an important link between programmed cell death of host cells and immunity to pathogens.

  17. Essential Function of Dicer in Resolving DNA Damage in the Rapidly Dividing Cells of the Developing and Malignant Cerebellum

    Directory of Open Access Journals (Sweden)

    Vijay Swahari

    2016-01-01

    Full Text Available Maintenance of genomic integrity is critical during neurodevelopment, particularly in rapidly dividing cerebellar granule neuronal precursors that experience constitutive replication-associated DNA damage. As Dicer was recently recognized to have an unexpected function in the DNA damage response, we examined whether Dicer was important for preserving genomic integrity in the developing brain. We report that deletion of Dicer in the developing mouse cerebellum resulted in the accumulation of DNA damage leading to cerebellar progenitor degeneration, which was rescued with p53 deficiency; deletion of DGCR8 also resulted in similar DNA damage and cerebellar degeneration. Dicer deficiency also resulted in DNA damage and death in other rapidly dividing cells including embryonic stem cells and the malignant cerebellar progenitors in a mouse model of medulloblastoma. Together, these results identify an essential function of Dicer in resolving the spontaneous DNA damage that occurs during the rapid proliferation of developmental progenitors and malignant cells.

  18. Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

    Science.gov (United States)

    Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

    2017-08-12

    Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

  19. Rapid detection of DNA-interstrand and DNA-protein cross-links in mammalian cells by gravity-flow alkaline elution

    International Nuclear Information System (INIS)

    Hincks, J.R.; Coulombe, R.A. Jr.

    1989-01-01

    Alkaline elution is a sensitive and commonly used technique to detect cellular DNA damage in the form of DNA strand breaks and DNA cross-links. Conventional alkaline elution procedures have extensive equipment requirements and are tedious to perform. Our laboratory recently presented a rapid, simplified, and sensitive modification of the alkaline elution technique to detect carcinogen-induced DNA strand breaks. In the present study, we have further modified this technique to enable the rapid characterization of chemically induced DNA-interstrand and DNA-protein associated cross-links in cultured epithelial cells. Cells were exposed to three known DNA cross-linking agents, nitrogen mustard (HN 2 ), mitomycin C (MMC), or ultraviolet irradiation (UV). One hour exposures of HN 2 at 0.25, 1.0, and 4.0 microM or of MMC at 20, 40, and 60 microM produced a dose-dependent induction of total DNA cross-links by these agents. Digestion with proteinase K revealed that HN 2 and MMC induced both DNA-protein cross-links and DNA-interstrand cross-links. Ultraviolet irradiation induced both DNA cross-links and DNA strand breaks, the latter of which were either protein and nonprotein associated. The results demonstrate that gravity-flow alkaline elution is a sensitive and accurate method to characterize the molecular events of DNA cross-linking. Using this procedure, elution of DNA from treated cells is completed in 1 hr, and only three fractions per sample are analyzed. This method may be useful as a rapid screening assay for genotoxicity and/or as an adjunct to other predictive assays for potential mutagenic or carcinogenic agents

  20. Rapid on-site detection of Acidovorax avenae subsp. citrulli by gold-labeled DNA strip sensor.

    Science.gov (United States)

    Zhao, Wenjun; Lu, Jie; Ma, Wenwei; Xu, Chuanlai; Kuang, Hua; Zhu, Shuifang

    2011-06-15

    Acidovorax avenae subsp. citrulli (AAC) is one of the most harmful diseases in cucurbit production. A rapid and sensitive DNA strip sensor was constructed based on gold nanoparticle-labeled oligonucleotide probes for the detection of AAC. Both the qualitative and semi-quantitative detections of target DNA were successfully achieved using the developed DNA strip sensor. The qualitative limit of detection (LOD) of the strip sensor was determined as 4 nM. The LOD for the semi-quantitative detection was calculated to be 0.48 nM in the range of 0-10 nM. The genomic DNA was detected directly using the DNA strip sensor without any further treatment. This DNA strip sensor is a potentially useful tool for rapid on-site DNA screening. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

    Science.gov (United States)

    Hebert, Paul D N; Dewaard, Jeremy R; Zakharov, Evgeny V; Prosser, Sean W J; Sones, Jayme E; McKeown, Jaclyn T A; Mantle, Beth; La Salle, John

    2013-01-01

    DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera) species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp) were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  2. Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

    Science.gov (United States)

    Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  3. Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

    Directory of Open Access Journals (Sweden)

    Lingyang Tian

    2014-01-01

    Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  4. Rapid Detection of Cell-Free Mycobacterium tuberculosis DNA in Tuberculous Pleural Effusion.

    Science.gov (United States)

    Che, Nanying; Yang, Xinting; Liu, Zichen; Li, Kun; Chen, Xiaoyou

    2017-05-01

    Tuberculous pleurisy is one of the most common types of extrapulmonary tuberculosis, but its diagnosis remains difficult. In this study, we report for the first time on the detection of cell-free Mycobacterium tuberculosis DNA in pleural effusion and an evaluation of a newly developed molecular assay for the detection of cell-free Mycobacterium tuberculosis DNA. A total of 78 patients with pleural effusion, 60 patients with tuberculous pleurisy, and 18 patients with alternative diseases were included in this study. Mycobacterial culture, the Xpert MTB/RIF assay, the adenosine deaminase assay, the T-SPOT.TB assay, and the cell-free Mycobacterium tuberculosis DNA assay were performed on all the pleural effusion samples. The cell-free Mycobacterium tuberculosis DNA assay and adenosine deaminase assay showed significantly higher sensitivities of 75.0% and 68.3%, respectively, than mycobacterial culture and the Xpert MTB/RIF assay, which had sensitivities of 26.7% and 20.0%, respectively ( P pleural effusion showed the highest sensitivity of 95.0% but the lowest specificity of 38.9%. The cell-free Mycobacterium tuberculosis DNA assay detected as few as 1.25 copies of IS 6110 per ml of pleural effusion and showed good accordance of the results between repeated tests ( r = 0.978, P = 2.84 × 10 -10 ). These data suggest that the cell-free Mycobacterium tuberculosis DNA assay is a rapid and accurate molecular test which provides direct evidence of Mycobacterium tuberculosis etiology. Copyright © 2017 American Society for Microbiology.

  5. A rapid and economic in-house DNA purification method using glass syringe filters.

    Directory of Open Access Journals (Sweden)

    Yun-Cheol Kim

    Full Text Available BACKGROUND: Purity, yield, speed and cost are important considerations in plasmid purification, but it is difficult to achieve all of these at the same time. Currently, there are many protocols and kits for DNA purification, however none maximize all four considerations. METHODOLOGY/PRINCIPAL FINDINGS: We now describe a fast, efficient and economic in-house protocol for plasmid preparation using glass syringe filters. Plasmid yield and quality as determined by enzyme digestion and transfection efficiency were equivalent to the expensive commercial kits. Importantly, the time required for purification was much less than that required using a commercial kit. CONCLUSIONS/SIGNIFICANCE: This method provides DNA yield and quality similar to that obtained with commercial kits, but is more rapid and less costly.

  6. Rapid DNA vaccination against Burkholderia pseudomallei flagellin by tattoo or intranasal application.

    Science.gov (United States)

    Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D

    2017-11-17

    Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.

  7. Rapid detection of fungal keratitis with DNA-stabilizing FTA filter paper.

    Science.gov (United States)

    Menassa, Nardine; Bosshard, Philipp P; Kaufmann, Claude; Grimm, Christian; Auffarth, Gerd U; Thiel, Michael A

    2010-04-01

    Purpose. Polymerase chain reaction (PCR) is increasingly important for the rapid detection of fungal keratitis. However, techniques of specimen collection and DNA extraction before PCR may interfere with test sensitivity. The purpose of this study was to investigate the use of DNA-stabilizing FTA filter paper (Indicating FTA filter paper; Whatman International, Ltd., Maidstone, UK) for specimen collection without DNA extraction in a single-step, nonnested PCR for fungal keratitis. Methods. Specimens were collected from ocular surfaces with FTA filter discs, which automatically lyse collected cells and stabilize nucleic acids. Filter discs were directly used in single-step PCR reactions to detect fungal DNA. Test sensitivity was evaluated with serial dilutions of Candida albicans, Fusarium oxysporum, and Aspergillus fumigatus cultures. Test specificity was analyzed by comparing 196 and 155 healthy individuals from Switzerland and Egypt, respectively, with 15 patients with a diagnosis of microbial keratitis. Results. PCR with filter discs detected 3 C. albicans, 25 F. oxysporum, and 125 A. fumigatus organisms. In healthy volunteers, fungal PCR was positive in 1.0% and 8.4% of eyes from Switzerland and Egypt, respectively. Fungal PCR remained negative in 10 cases of culture-proven bacterial keratitis, became positive in 4 cases of fungal keratitis, but missed 1 case of culture-proven A. fumigatus keratitis. Conclusions. FTA filter paper for specimen collection together with direct PCR is a promising method of detecting fungal keratitis. The analytical sensitivity is high without the need for a semi-nested or nested second PCR, the clinical specificity is 91.7% to 99.0%, and the method is rapid and inexpensive.

  8. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

  9. Rapid Extraction of Genomic DNA from Medically Important Yeasts and Filamentous Fungi by High-Speed Cell Disruption

    OpenAIRE

    Müller, Frank-Michael C.; Werner, Katherine E.; Kasai, Miki; Francesconi, Andrea; Chanock, Stephen J.; Walsh, Thomas J.

    1998-01-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolatio...

  10. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    Science.gov (United States)

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  11. Target-Specific Assay for Rapid and Quantitative Detection of Mycobacterium chimaera DNA.

    Science.gov (United States)

    Zozaya-Valdés, Enrique; Porter, Jessica L; Coventry, John; Fyfe, Janet A M; Carter, Glen P; Gonçalves da Silva, Anders; Schultz, Mark B; Seemann, Torsten; Johnson, Paul D R; Stewardson, Andrew J; Bastian, Ivan; Roberts, Sally A; Howden, Benjamin P; Williamson, Deborah A; Stinear, Timothy P

    2017-06-01

    Mycobacterium chimaera is an opportunistic environmental mycobacterium belonging to the Mycobacterium avium - M. intracellulare complex. Although most commonly associated with pulmonary disease, there has been growing awareness of invasive M. chimaera infections following cardiac surgery. Investigations suggest worldwide spread of a specific M. chimaera clone, associated with contaminated hospital heater-cooler units used during the surgery. Given the global dissemination of this clone, its potential to cause invasive disease, and the laboriousness of current culture-based diagnostic methods, there is a pressing need to develop rapid and accurate diagnostic assays specific for M. chimaera Here, we assessed 354 mycobacterial genome sequences and confirmed that M. chimaera is a phylogenetically coherent group. In silico comparisons indicated six DNA regions present only in M. chimaera We targeted one of these regions and developed a TaqMan quantitative PCR (qPCR) assay for M. chimaera with a detection limit of 100 CFU/ml in whole blood spiked with bacteria. In vitro screening against DNA extracted from 40 other mycobacterial species and 22 bacterial species from 21 diverse genera confirmed the in silico -predicted specificity for M. chimaera Screening 33 water samples from heater-cooler units with this assay highlighted the increased sensitivity of PCR compared to culture, with 15 of 23 culture-negative samples positive by M. chimaera qPCR. We have thus developed a robust molecular assay that can be readily and rapidly deployed to screen clinical and environmental specimens for M. chimaera . Copyright © 2017 American Society for Microbiology.

  12. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    Science.gov (United States)

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  13. DNA Barcoding Evaluation and Its Taxonomic Implications in the Recently Evolved Genus Oberonia Lindl. (Orchidaceae in China

    Directory of Open Access Journals (Sweden)

    Yuling Li

    2016-12-01

    Full Text Available The orchid genus Oberonia Lindl., is a taxonomically complex genus characterized by recent species radiations and many closely related species. All Oberonia species are under conservation as listed in the CITES and the IUCN Red List Categories and Criteria. Given its difficulties in taxonomy and conservation status, Oberonia is an excellent model for developing DNA barcodes. Three analytical methods and five DNA barcoding regions (rbcL, matK, trnH-psbA, ITS and ITS2 were evaluated on 127 individuals representing 40 species and 1 variety of Oberonia from China. All the three plastid candidates tested (rbcL, matK and trnH-psbA have a lower discriminatory power than the nuclear regions (ITS and ITS2, and ITS had the highest resolution rate (82.14%. Two to four combinations of these gene sets were not better than the ITS alone, but when considering modes of inheritance, rbcL+ITS and matK+ITS were the best barcodes for identifying Oberonia species. Furthermore, the present barcoding system has many new insights in the current Oberonia taxonomy, such as correcting species identification, resolving taxonomic uncertainties, and the underlying presence of new or cryptic species in a genus with a complex speciation history.

  14. Structures of an Apo and a Binary Complex of an Evolved Archeal B Family DNA Polymerase Capable of Synthesising Highly Cy-Dye Labelled DNA

    Science.gov (United States)

    Wynne, Samantha A.; Pinheiro, Vitor B.; Holliger, Philipp; Leslie, Andrew G. W.

    2013-01-01

    Thermophilic DNA polymerases of the polB family are of great importance in biotechnological applications including high-fidelity PCR. Of particular interest is the relative promiscuity of engineered versions of the exo- form of polymerases from the Thermo- and Pyrococcales families towards non-canonical substrates, which enables key advances in Next-generation sequencing. Despite this there is a paucity of structural information to guide further engineering of this group of polymerases. Here we report two structures, of the apo form and of a binary complex of a previously described variant (E10) of Pyrococcus furiosus (Pfu) polymerase with an ability to fully replace dCTP with Cyanine dye-labeled dCTP (Cy3-dCTP or Cy5-dCTP) in PCR and synthesise highly fluorescent “CyDNA” densely decorated with cyanine dye heterocycles. The apo form of Pfu-E10 closely matches reported apo form structures of wild-type Pfu. In contrast, the binary complex (in the replicative state with a duplex DNA oligonucleotide) reveals a closing movement of the thumb domain, increasing the contact surface with the nascent DNA duplex strand. Modelling based on the binary complex suggests how bulky fluorophores may be accommodated during processive synthesis and has aided the identification of residues important for the synthesis of unnatural nucleic acid polymers. PMID:23940661

  15. Targeted disruption in mice of a neural stem cell-maintaining, KRAB-Zn finger-encoding gene that has rapidly evolved in the human lineage.

    Directory of Open Access Journals (Sweden)

    Huan-Chieh Chien

    Full Text Available Understanding the genetic basis of the physical and behavioral traits that separate humans from other primates is a challenging but intriguing topic. The adaptive functions of the expansion and/or reduction in human brain size have long been explored. From a brain transcriptome project we have identified a KRAB-Zn finger protein-encoding gene (M003-A06 that has rapidly evolved since the human-chimpanzee separation. Quantitative RT-PCR analysis of different human tissues indicates that M003-A06 expression is enriched in the human fetal brain in addition to the fetal heart. Furthermore, analysis with use of immunofluorescence staining, neurosphere culturing and Western blotting indicates that the mouse ortholog of M003-A06, Zfp568, is expressed mainly in the embryonic stem (ES cells and fetal as well as adult neural stem cells (NSCs. Conditional gene knockout experiments in mice demonstrates that Zfp568 is both an NSC maintaining- and a brain size-regulating gene. Significantly, molecular genetic analyses show that human M003-A06 consists of 2 equilibrated allelic types, H and C, one of which (H is human-specific. Combined contemporary genotyping and database mining have revealed interesting genetic associations between the different genotypes of M003-A06 and the human head sizes. We propose that M003-A06 is likely one of the genes contributing to the uniqueness of the human brain in comparison to other higher primates.

  16. DNA comet assay as a rapid detection method of irradiated bovine meat by electron beam

    International Nuclear Information System (INIS)

    Marin-Huachaca, Nelida Simona; Villavicencio, Anna Lucia C.H.

    2001-01-01

    Full text: Introduction: The presence in food of pathogenic microorganisms, such as Salmonella species, Escherichia coli 0157:H7, Listeria Monocytogenes or Yersinia enterolitica, is a problem of growing concern to public health authorities all over the world. Thus, irradiation of certain prepackaged meat products such as ground beef, minced meat, and hamburgers may help in controlling meatborne pathogens and parasites. Pathogenic microorganisms and parasites in meat products, which are commonly consumed raw, are of particular importance, Up to now, only electron-beam accelerators and gamma-ray cells have been used for commercial applications. At the international conference on 'The Acceptance, Control of, and Trade in Irradiated Food', it was recommended that governments should encourage research into detection methods (Anon, 1989), Already five international standards are available to food control agencies. A number of physical, chemical, and biological techniques of detection of irradiated foods have been discussed in the literature. A rapid and inexpensive screening test employing DNA Comet Assay to identify radiation treatment of food has been described by Cerda et al. (1997). This method is restricted to foods that have not been subjected to heat or other treatments, which also induce DNA fragmentation. Advantages are its simplicity, low cost and speed of measurement. This method was proposed to the European Committee for Standardization (CEN) as a screening protocol (presumptive) and not as a proof (definitive). The DNA comet assay have been yielded good results with chicken, pork, fish meat, exotic meat, hamburgers, fruits and cereals. In this work we studied a DNA fragmentation of bovine meat irradiated by electron beam. Experimental: Bovine meat was purchased in local shops in Sao Paulo. Irradiation was performed with electron beam of accelerator facility of Radiation Dynamics Inc., USA (E=1,5 MeV, l=25 mA). The irradiation doses were 3,5; 4,5, 5,5, and 7

  17. A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

    Science.gov (United States)

    Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

    2008-11-01

    A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

  18. DNA immunoprecipitation semiconductor sequencing (DIP-SC-seq) as a rapid method to generate genome wide epigenetic signatures

    OpenAIRE

    Thomson, John P.; Fawkes, Angie; Ottaviano, Raffaele; Hunter, Jennifer M.; Shukla, Ruchi; Mjoseng, Heidi K.; Clark, Richard; Coutts, Audrey; Murphy, Lee; Meehan, Richard R.

    2015-01-01

    Modification of DNA resulting in 5-methylcytosine (5 mC) or 5-hydroxymethylcytosine (5hmC) has been shown to influence the local chromatin environment and affect transcription. Although recent advances in next generation sequencing technology allow researchers to map epigenetic modifications across the genome, such experiments are often time-consuming and cost prohibitive. Here we present a rapid and cost effective method of generating genome wide DNA modification maps utilising commercially ...

  19. A discrete event simulation to model the cost-utility of fingolimod and natalizumab in rapidly evolving severe relapsing-remitting multiple sclerosis in the UK.

    Science.gov (United States)

    Montgomery, Stephen M; Maruszczak, Maciej J; Slater, David; Kusel, Jeanette; Nicholas, Richard; Adlard, Nicholas

    2017-05-01

    Two disease-modifying therapies are licensed in the EU for use in rapidly-evolving severe (RES) relapsing-remitting multiple sclerosis (RRMS), fingolimod and natalizumab. Here a discrete event simulation (DES) model to analyze the cost-effectiveness of natalizumab and fingolimod in the RES population, from the perspective of the National Health Service (NHS) in the UK, is reported. A DES model was developed to track individual RES patients, based on Expanded Disability Status Scale scores. Individual patient characteristics were taken from the RES sub-groups of the pivotal trials for fingolimod. Utility data were in line with previous models. Published costs were inflated to NHS cost year 2015. Owing to the confidential patient access scheme (PAS) discount applied to fingolimod in the UK, a range of discount levels were applied to the fingolimod list price, to capture the likelihood of natalizumab being cost-effective in a real-world setting. At the lower National Institute of Health and Care Excellence (NICE) threshold of £20,000/quality-adjusted life year (QALY), fingolimod only required a discount greater than 0.8% of list price to be cost-effective. At the upper threshold of £30,000/QALY employed by the NICE, fingolimod was cost-effective if the confidential discount is greater than 2.5%. Sensitivity analyses conducted using fingolimod list-price showed the model to be most sensitive to changes in the cost of each drug, particularly fingolimod. The DES model shows that only a modest discount to the UK fingolimod list-price is required to make fingolimod a more cost-effective option than natalizumab in RES RRMS.

  20. Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

    Science.gov (United States)

    Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

    2018-02-01

    The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

  1. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  2. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  3. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  4. Rapid extraction of genomic DNA from medically important yeasts and filamentous fungi by high-speed cell disruption.

    Science.gov (United States)

    Müller, F M; Werner, K E; Kasai, M; Francesconi, A; Chanock, S J; Walsh, T J

    1998-06-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolation of DNA from three medically important yeasts (Candida albicans, Cryptococcus neoformans, and Trichosporon beigelii) and two filamentous fungi (Aspergillus fumigatus and Fusarium solani). Additional extractions by HSCD were performed on Saccharomyces cerevisiae, Pseudallescheria boydii, and Rhizopus arrhizus. Two different inocula (10(8) and 10(7) CFU) were compared for optimization of obtained yields. The entire extraction procedure was performed on as many as 12 samples within 1 h compared to 6 h for PC extraction. In comparison to the PC procedure, HSCD DNA extraction demonstrated significantly greater yields for 10(8) CFU of C. albicans, T. beigelii, A. fumigatus, and F. solani (P extraction and PC extraction. For 10(7) CFU of T. beigelii, PC extraction resulted in a greater yield than did HSCD (P fungi than for yeasts by the HSCD extraction procedure (P extraction procedure, differences were not significant. For all eight organisms, the rapid extraction procedure resulted in good yield, integrity, and quality of DNA as demonstrated by restriction fragment length polymorphism, PCR, and random amplified polymorphic DNA. We conclude that mechanical disruption of fungal cells by HSCD is a safe, rapid, and efficient procedure for extracting genomic DNA from medically important yeasts and especially from filamentous fungi.

  5. DNA microarray unravels rapid changes in transcriptome of MK-801 treated rat brain

    Science.gov (United States)

    Kobayashi, Yuka; Kulikova, Sofya P; Shibato, Junko; Rakwal, Randeep; Satoh, Hiroyuki; Pinault, Didier; Masuo, Yoshinori

    2015-01-01

    AIM: To investigate the impact of MK-801 on gene expression patterns genome wide in rat brain regions. METHODS: Rats were treated with an intraperitoneal injection of MK-801 [0.08 (low-dose) and 0.16 (high-dose) mg/kg] or NaCl (vehicle control). In a first series of experiment, the frontoparietal electrocorticogram was recorded 15 min before and 60 min after injection. In a second series of experiments, the whole brain of each animal was rapidly removed at 40 min post-injection, and different regions were separated: amygdala, cerebral cortex, hippocampus, hypothalamus, midbrain and ventral striatum on ice followed by DNA microarray (4 × 44 K whole rat genome chip) analysis. RESULTS: Spectral analysis revealed that a single systemic injection of MK-801 significantly and selectively augmented the power of baseline gamma frequency (30-80 Hz) oscillations in the frontoparietal electroencephalogram. DNA microarray analysis showed the largest number (up- and down- regulations) of gene expressions in the cerebral cortex (378), midbrain (376), hippocampus (375), ventral striatum (353), amygdala (301), and hypothalamus (201) under low-dose (0.08 mg/kg) of MK-801. Under high-dose (0.16 mg/kg), ventral striatum (811) showed the largest number of gene expression changes. Gene expression changes were functionally categorized to reveal expression of genes and function varies with each brain region. CONCLUSION: Acute MK-801 treatment increases synchrony of baseline gamma oscillations, and causes very early changes in gene expressions in six individual rat brain regions, a first report. PMID:26629322

  6. Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

    Science.gov (United States)

    Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

    2018-04-01

    ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

  7. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  8. Facile and rapid DNA extraction and purification from food matrices using IFAST (immiscible filtration assisted by surface tension).

    Science.gov (United States)

    Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J

    2012-09-07

    Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.

  9. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun

    2014-11-24

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  10. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun; Lee, Kunwoo; Murthy, Niren; Pisano, Albert P

    2014-01-01

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  11. Minimal methylation classifier (MIMIC): A novel method for derivation and rapid diagnostic detection of disease-associated DNA methylation signatures.

    Science.gov (United States)

    Schwalbe, E C; Hicks, D; Rafiee, G; Bashton, M; Gohlke, H; Enshaei, A; Potluri, S; Matthiesen, J; Mather, M; Taleongpong, P; Chaston, R; Silmon, A; Curtis, A; Lindsey, J C; Crosier, S; Smith, A J; Goschzik, T; Doz, F; Rutkowski, S; Lannering, B; Pietsch, T; Bailey, S; Williamson, D; Clifford, S C

    2017-10-18

    Rapid and reliable detection of disease-associated DNA methylation patterns has major potential to advance molecular diagnostics and underpin research investigations. We describe the development and validation of minimal methylation classifier (MIMIC), combining CpG signature design from genome-wide datasets, multiplex-PCR and detection by single-base extension and MALDI-TOF mass spectrometry, in a novel method to assess multi-locus DNA methylation profiles within routine clinically-applicable assays. We illustrate the application of MIMIC to successfully identify the methylation-dependent diagnostic molecular subgroups of medulloblastoma (the most common malignant childhood brain tumour), using scant/low-quality samples remaining from the most recently completed pan-European medulloblastoma clinical trial, refractory to analysis by conventional genome-wide DNA methylation analysis. Using this approach, we identify critical DNA methylation patterns from previously inaccessible cohorts, and reveal novel survival differences between the medulloblastoma disease subgroups with significant potential for clinical exploitation.

  12. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... Available online at http://www.academicjournals.org/AJB ... α-casein, produces PCR ready DNA at a fraction of the cost of commercial DNA extraction kits. Key words: DNA .... This experiment was performed to evaluate the efficiency of the ..... Zoetendal EG, Ben-Amor K, Akkermans AD, Abee T, De Vos WM.

  13. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Science.gov (United States)

    Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

  14. Rectangular coordination polymer nanoplates: large-scale, rapid synthesis and their application as a fluorescent sensing platform for DNA detection.

    Directory of Open Access Journals (Sweden)

    Yingwei Zhang

    Full Text Available In this paper, we report on the large-scale, rapid synthesis of uniform rectangular coordination polymer nanoplates (RCPNs assembled from Cu(II and 4,4'-bipyridine for the first time. We further demonstrate that such RCPNs can be used as a very effective fluorescent sensing platform for multiple DNA detection with a detection limit as low as 30 pM and a high selectivity down to single-base mismatch. The DNA detection is accomplished by the following two steps: (1 RCPN binds dye-labeled single-stranded DNA (ssDNA probe, which brings dye and RCPN into close proximity, leading to fluorescence quenching; (2 Specific hybridization of the probe with its target generates a double-stranded DNA (dsDNA which detaches from RCPN, leading to fluorescence recovery. It suggests that this sensing system can well discriminate complementary and mismatched DNA sequences. The exact mechanism of fluorescence quenching involved is elucidated experimentally and its use in a human blood serum system is also demonstrated successfully.

  15. Rapid purification of circular DNA by triplex-mediated affinity capture

    Science.gov (United States)

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  16. Combination of methylated-DNA precipitation and methylation-sensitive restriction enzymes (COMPARE-MS) for the rapid, sensitive and quantitative detection of DNA methylation.

    Science.gov (United States)

    Yegnasubramanian, Srinivasan; Lin, Xiaohui; Haffner, Michael C; DeMarzo, Angelo M; Nelson, William G

    2006-02-09

    Hypermethylation of CpG island (CGI) sequences is a nearly universal somatic genome alteration in cancer. Rapid and sensitive detection of DNA hypermethylation would aid in cancer diagnosis and risk stratification. We present a novel technique, called COMPARE-MS, that can rapidly and quantitatively detect CGI hypermethylation with high sensitivity and specificity in hundreds of samples simultaneously. To quantitate CGI hypermethylation, COMPARE-MS uses real-time PCR of DNA that was first digested by methylation-sensitive restriction enzymes and then precipitated by methyl-binding domain polypeptides immobilized on a magnetic solid matrix. We show that COMPARE-MS could detect five genome equivalents of methylated CGIs in a 1000- to 10,000-fold excess of unmethylated DNA. COMPARE-MS was used to rapidly quantitate hypermethylation at multiple CGIs in >155 prostate tissues, including benign and malignant prostate specimens, and prostate cell lines. This analysis showed that GSTP1, MDR1 and PTGS2 CGI hypermethylation as determined by COMPARE-MS could differentiate between malignant and benign prostate with sensitivities >95% and specificities approaching 100%. This novel technology could significantly improve our ability to detect CGI hypermethylation.

  17. Using rapid diagnostic tests as source of malaria parasite DNA for molecular analyses in the era of declining malaria prevalence

    DEFF Research Database (Denmark)

    Ishengoma, Deus S; Lwitiho, Sudi; Madebe, Rashid A

    2011-01-01

    was conducted to examine if sufficient DNA could be successfully extracted from malaria rapid diagnostic tests (RDTs), used and collected as part of routine case management services in health facilities, and thus forming the basis for molecular analyses, surveillance and quality control (QC) testing of RDTs....... continued molecular surveillance of malaria parasites is important to early identify emerging anti-malarial drug resistance, it is becoming increasingly difficult to obtain parasite samples from ongoing studies, such as routine drug efficacy trials. To explore other sources of parasite DNA, this study...

  18. SeqAnt: A web service to rapidly identify and annotate DNA sequence variations

    Directory of Open Access Journals (Sweden)

    Patel Viren

    2010-09-01

    Full Text Available Abstract Background The enormous throughput and low cost of second-generation sequencing platforms now allow research and clinical geneticists to routinely perform single experiments that identify tens of thousands to millions of variant sites. Existing methods to annotate variant sites using information from publicly available databases via web browsers are too slow to be useful for the large sequencing datasets being routinely generated by geneticists. Because sequence annotation of variant sites is required before functional characterization can proceed, the lack of a high-throughput pipeline to efficiently annotate variant sites can act as a significant bottleneck in genetics research. Results SeqAnt (Sequence Annotator is an open source web service and software package that rapidly annotates DNA sequence variants and identifies recessive or compound heterozygous loci in human, mouse, fly, and worm genome sequencing experiments. Variants are characterized with respect to their functional type, frequency, and evolutionary conservation. Annotated variants can be viewed on a web browser, downloaded in a tab-delimited text file, or directly uploaded in a BED format to the UCSC genome browser. To demonstrate the speed of SeqAnt, we annotated a series of publicly available datasets that ranged in size from 37 to 3,439,107 variant sites. The total time to completely annotate these data completely ranged from 0.17 seconds to 28 minutes 49.8 seconds. Conclusion SeqAnt is an open source web service and software package that overcomes a critical bottleneck facing research and clinical geneticists using second-generation sequencing platforms. SeqAnt will prove especially useful for those investigators who lack dedicated bioinformatics personnel or infrastructure in their laboratories.

  19. Oxidants and not alkylating agents induce rapid mtDNA loss and mitochondrial dysfunction

    Science.gov (United States)

    Furda, Amy M.; Marrangoni, Adele M.; Lokshin, Anna; Van Houten, Bennett

    2013-01-01

    Mitochondrial DNA (mtDNA) is essential for proper mitochondrial function and encodes 22 tRNAs, 2 rRNAs and 13 polypeptides that make up subunits of complex I, III, IV, in the electron transport chain and complex V, the ATP synthase. Although mitochondrial dysfunction has been implicated in processes such as premature aging, neurodegeneration, and cancer, it has not been shown whether persistent mtDNA damage causes a loss of oxidative phosphorylation. We addressed this question by treating mouse embryonic fibroblasts with either hydrogen peroxide (H2O2) or the alkylating agent methyl methanesulfonate (MMS) and measuring several endpoints, including mtDNA damage and repair rates using QPCR, levels of mitochondrial- and nuclear-encoded proteins using antibody analysis, and a pharmacologic profile of mitochondria using the Seahorse Extracellular Flux Analyzer. We show that a 60 min treatment with H2O2 causes persistent mtDNA lesions, mtDNA loss, decreased levels of a nuclear-encoded mitochondrial subunit, a loss of ATP-linked oxidative phosphorylation and a loss of total reserve capacity. Conversely, a 60 min treatment with 2 mM MMS causes persistent mtDNA lesions but no mtDNA loss, no decrease in levels of a nuclear-encoded mitochondrial subunit, and no mitochondrial dysfunction. These results suggest that persistent mtDNA damage is not sufficient to cause mitochondrial dysfunction. PMID:22766155

  20. A Fluorescent Tile DNA Diagnocode System for In Situ Rapid and Selective Diagnosis of Cytosolic RNA Cancer Markers

    Science.gov (United States)

    Park, Kyung Soo; Shin, Seung Won; Jang, Min Su; Shin, Woojung; Yang, Kisuk; Min, Junhong; Cho, Seung-Woo; Oh, Byung-Keun; Bae, Jong Wook; Jung, Sunghwan; Choi, Jeong-Woo; Um, Soong Ho

    2015-01-01

    Accurate cancer diagnosis often requires extraction and purification of genetic materials from cells, and sophisticated instrumentations that follow. Otherwise in order to directly treat the diagnostic materials to cells, multiple steps to optimize dose concentration and treatment time are necessary due to diversity in cellular behaviors. These processes may offer high precision but hinder fast analysis of cancer, especially in clinical situations that need rapid detection and characterization of cancer. Here we present a novel fluorescent tile DNA nanostructure delivered to cancer cytosol by employing nanoparticle technology. Its structural anisotropicity offers easy manipulation for multifunctionalities, enabling the novel DNA nanostructure to detect intracellular cancer RNA markers with high specificity within 30 minutes post treatment, while the nanoparticle property bypasses the requirement of treatment optimization, effectively reducing the complexity of applying the system for cancer diagnosis. Altogether, the system offers a precise and rapid detection of cancer, suggesting the future use in the clinical fields. PMID:26678430

  1. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

    1989-01-01

    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  2. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  3. Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors

    DEFF Research Database (Denmark)

    Fu, Yanming; Zeng, Dongdong; Chao, Jie

    2013-01-01

    nm resolution and at the single-molecule level. We attach a pair of enzymes (horseradish peroxidase and glucose oxidase) at the inner side of DNA nanotubes and observe high coupling efficiency of enzyme cascade within this confined nanospace. Hence, DNA nanostructures with such unprecedented...

  4. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  5. Preservation and rapid purification of DNA from decomposing human tissue samples.

    Science.gov (United States)

    Sorensen, Amy; Rahman, Elizabeth; Canela, Cassandra; Gangitano, David; Hughes-Stamm, Sheree

    2016-11-01

    One of the key features to be considered in a mass disaster is victim identification. However, the recovery and identification of human remains are sometimes complicated by harsh environmental conditions, limited facilities, loss of electricity and lack of refrigeration. If human remains cannot be collected, stored, or identified immediately, bodies decompose and DNA degrades making genotyping more difficult and ultimately decreasing DNA profiling success. In order to prevent further DNA damage and degradation after collection, tissue preservatives may be used. The goal of this study was to evaluate three customized (modified TENT, DESS, LST) and two commercial DNA preservatives (RNAlater and DNAgard ® ) on fresh and decomposed human skin and muscle samples stored in hot (35°C) and humid (60-70% relative humidity) conditions for up to three months. Skin and muscle samples were harvested from the thigh of three human cadavers placed outdoors for up to two weeks. In addition, the possibility of purifying DNA directly from the preservative solutions ("free DNA") was investigated in order to eliminate lengthy tissue digestion processes and increase throughput. The efficiency of each preservative was evaluated based on the quantity of DNA recovered from both the "free DNA" in solution and the tissue sample itself in conjunction with the quality and completeness of downstream STR profiles. As expected, DNA quantity and STR success decreased with time of decomposition. However, a marked decrease in DNA quantity and STR quality was observed in all samples after the bodies entered the bloat stage (approximately six days of decomposition in this study). Similar amounts of DNA were retrieved from skin and muscle samples over time, but slightly more complete STR profiles were obtained from muscle tissue. Although higher amounts of DNA were recovered from tissue samples than from the surrounding preservative, the average number of reportable alleles from the "free DNA" was

  6. Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

    Science.gov (United States)

    Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

    2005-01-01

    A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

  7. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  8. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  9. An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens.

    Science.gov (United States)

    Riahi, M; Zarre, S; Maassoumi, A A; Attar, F; Kazempour Osaloo, S

    2010-07-13

    Three DNA extraction protocols were compared for their ability to yield DNA from the leaves of herbarium specimens of nine species from nine genera of the Papilionoideae. We tested two protocols that use classic procedures for lysis and purification with cetyl trimethylammonium bromide (CTAB); a third protocol used a Nucleospin Plant kit. DNA obtained from all three procedures was quantified and tested by PCR. Test results indicated the superiority of one of the CTAB protocols. We made some modifications, developing a protocol that produced high-quality DNA from all nine species. The modification involved the use of a lower EDTA concentration (20 mM instead of 50 mM) and a higher beta-mercaptoethanol concentration (1% instead of 0.4%) in the extraction buffer. The modified protocol avoids the necessity for a second DNA precipitation step. This new CTAB protocol includes the use of 1.4 M NaCl, 20 mM EDTA and 1% beta-mercaptoethanol in the extraction; DNA precipitation time is reduced. A reduction in contaminating metabolites (such as PCR inhibitors) in the sample mixtures and lower costs for reagents are characteristics of this modified protocol; the cost of analysis per sample was lowered, compared to previous options. The quality of DNA was suitable for PCR amplification. This is a practical alternative to more difficult, time-consuming and expensive protocols.

  10. Maintaining evolvability.

    Science.gov (United States)

    Crow, James F

    2008-12-01

    Although molecular methods, such as QTL mapping, have revealed a number of loci with large effects, it is still likely that the bulk of quantitative variability is due to multiple factors, each with small effect. Typically, these have a large additive component. Conventional wisdom argues that selection, natural or artificial, uses up additive variance and thus depletes its supply. Over time, the variance should be reduced, and at equilibrium be near zero. This is especially expected for fitness and traits highly correlated with it. Yet, populations typically have a great deal of additive variance, and do not seem to run out of genetic variability even after many generations of directional selection. Long-term selection experiments show that populations continue to retain seemingly undiminished additive variance despite large changes in the mean value. I propose that there are several reasons for this. (i) The environment is continually changing so that what was formerly most fit no longer is. (ii) There is an input of genetic variance from mutation, and sometimes from migration. (iii) As intermediate-frequency alleles increase in frequency towards one, producing less variance (as p --> 1, p(1 - p) --> 0), others that were originally near zero become more common and increase the variance. Thus, a roughly constant variance is maintained. (iv) There is always selection for fitness and for characters closely related to it. To the extent that the trait is heritable, later generations inherit a disproportionate number of genes acting additively on the trait, thus increasing genetic variance. For these reasons a selected population retains its ability to evolve. Of course, genes with large effect are also important. Conspicuous examples are the small number of loci that changed teosinte to maize, and major phylogenetic changes in the animal kingdom. The relative importance of these along with duplications, chromosome rearrangements, horizontal transmission and polyploidy

  11. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  12. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

    Science.gov (United States)

    Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

    2006-05-01

    A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

  13. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  14. Rapid molecular detection of invasive species in ballast and harbor water by integrating environmental DNA and light transmission spectroscopy.

    Science.gov (United States)

    Egan, Scott P; Grey, Erin; Olds, Brett; Feder, Jeffery L; Ruggiero, Steven T; Tanner, Carol E; Lodge, David M

    2015-04-07

    Invasive species introduced via the ballast water of commercial ships cause enormous environmental and economic damage worldwide. Accurate monitoring for these often microscopic and morphologically indistinguishable species is challenging but critical for mitigating damages. We apply eDNA sampling, which involves the filtering and subsequent DNA extraction of microscopic bits of tissue suspended in water, to ballast and harbor water sampled during a commercial ship's 1400 km voyage through the North American Great Lakes. Using a lab-based gel electrophoresis assay and a rapid, field-ready light transmission spectroscopy (LTS) assay, we test for the presence of two invasive species: quagga (Dreissena bugensis) and zebra (D. polymorpha) mussels. Furthermore, we spiked a set of uninfested ballast and harbor samples with zebra mussel tissue to further test each assay's detection capabilities. In unmanipulated samples, zebra mussel was not detected, while quagga mussel was detected in all samples at a rate of 85% for the gel assay and 100% for the LTS assay. In the spiked experimental samples, both assays detected zebra mussel in 94% of spiked samples and 0% of negative controls. Overall, these results demonstrate that eDNA sampling is effective for monitoring ballast-mediated invasions and that LTS has the potential for rapid, field-based detection.

  15. Rapid Diminution in the Level and Activity of DNA-Dependent Protein Kinase in Cancer Cells by a Reactive Nitro-Benzoxadiazole Compound

    Directory of Open Access Journals (Sweden)

    Viviane A. O. Silva

    2016-05-01

    Full Text Available The expression and activity of DNA-dependent protein kinase (DNA-PK is related to DNA repair status in the response of cells to exogenous and endogenous factors. Recent studies indicate that Epidermal Growth Factor Receptor (EGFR is involved in modulating DNA-PK. It has been shown that a compound 4-nitro-7-[(1-oxidopyridin-2-ylsulfanyl]-2,1,3-benzoxadiazole (NSC, bearing a nitro-benzoxadiazole (NBD scaffold, enhances tyrosine phosphorylation of EGFR and triggers downstream signaling pathways. Here, we studied the behavior of DNA-PK and other DNA repair proteins in prostate cancer cells exposed to compound NSC. We showed that both the expression and activity of DNA-PKcs (catalytic subunit of DNA-PK rapidly decreased upon exposure of cells to the compound. The decline in DNA-PKcs was associated with enhanced protein ubiquitination, indicating the activation of cellular proteasome. However, pretreatment of cells with thioglycerol abolished the action of compound NSC and restored the level of DNA-PKcs. Moreover, the decreased level of DNA-PKcs was associated with the production of intracellular hydrogen peroxide by stable dimeric forms of Cu/Zn SOD1 induced by NSC. Our findings indicate that reactive oxygen species and electrophilic intermediates, generated and accumulated during the redox transformation of NBD compounds, are primarily responsible for the rapid modulation of DNA-PKcs functions in cancer cells.

  16. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    Science.gov (United States)

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-08-06

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

  17. A rapid and inexpensive method for isolation of total DNA from Trichoderma spp (Hypocreaceae).

    Science.gov (United States)

    Vazquez-Angulo, J C; Mendez-Trujillo, V; González-Mendoza, D; Morales-Trejo, A; Grimaldo-Juarez, O; Cervantes-Díaz, L

    2012-05-15

    Extraction of high-quality genomic DNA for PCR amplification from filamentous fungi is difficult because of the complex cell wall and the high concentrations of polysaccharides and other secondary metabolites that bind to or co-precipitate with nucleic acids. We developed a modified sodium dodecyl sulfate/phenol protocol, without maceration in liquid nitrogen and without a final ethanol precipitation step. The A(260/280) absorbance ratios of isolated DNA were approximately 1.7-1.9, demonstrating that the DNA fraction is pure and can be used for analysis. Additionally, the A(260/230) values were higher than 1.6, demonstrating negligible contamination by polysaccharides. The DNA isolated by this protocol is of sufficient quality for molecular applications; this technique could be applied to other organisms that have similar substances that hinder DNA extraction. The main advantages of the method are that the mycelium is directly recovered from culture medium and it does not require the use of expensive and specialized equipment.

  18. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  19. Measurement of cell proliferation in microculture using Hoechst 33342 for the rapid semiautomated microfluorimetric determination of chromatin DNA.

    Science.gov (United States)

    Richards, W L; Song, M K; Krutzsch, H; Evarts, R P; Marsden, E; Thorgeirsson, S S

    1985-07-01

    We report the development and characterization of a semiautomated method for measurement of cell proliferation in microculture using Hoechst 33342, a non-toxic specific vital stain for DNA. In this assay, fluorescence resulting from interaction of cell chromatin DNA with Hoechst 33342 dye was measured by an instrument that automatically reads the fluorescence of each well of a 96-well microtiter plate within 1 min. Each cell line examined was shown to require different Hoechst 33342 concentrations and time of incubation with the dye to attain optimum fluorescence in the assay. In all cell lines, cell chromatin-enhanced Hoechst 33342 fluorescence was shown to be a linear function of the number of cells or cell nuclei per well when optimum assay conditions were employed. Because of this linear relation, equivalent cell doubling times were calculated from growth curves based on changes in cell counts or changes in Hoechst/DNA fluorescence and the fluorimetric assay was shown to be useful for the direct assay of the influence of growth factors on cell proliferation. The fluorimetric assay also provided a means for normalizing the incorporation of tritiated thymidine ( [3H] TdR) into DNA; normalized values of DPM per fluorescence unit closely paralleled values of percent 3H-labelled nuclei when DNA synthesis was studied as a function of the concentration of rat serum in the medium. In summary, the chromatin-enhanced Hoechst 33342 fluorimetric assay provides a rapid, simple, and reproducible means for estimating cell proliferation by direct measurement of changes in cell fluorescence or by measurement of changes in the normalized incorporation of thymidine into DNA.

  20. Rapid DNA Synthesis During Early Drosophila Embryogenesis Is Sensitive to Maternal Humpty Dumpty Protein Function.

    Science.gov (United States)

    Lesly, Shera; Bandura, Jennifer L; Calvi, Brian R

    2017-11-01

    Problems with DNA replication cause cancer and developmental malformations. It is not fully understood how DNA replication is coordinated with development and perturbed in disease. We had previously identified the Drosophila gene humpty dumpty ( hd ), and showed that null alleles cause incomplete DNA replication, tissue undergrowth, and lethality. Animals homozygous for the missense allele, hd 272-9 , were viable, but adult females had impaired amplification of eggshell protein genes in the ovary, resulting in the maternal effects of thin eggshells and embryonic lethality. Here, we show that expression of an hd transgene in somatic cells of the ovary rescues amplification and eggshell synthesis but not embryo viability. The germline of these mothers remain mutant for the hd 272-9 allele, resulting in reduced maternal Hd protein and embryonic arrest during mitosis of the first few S/M nuclear cleavage cycles with chromosome instability and chromosome bridges. Epistasis analysis of hd with the rereplication mutation plutonium indicates that the chromosome bridges of hd embryos are the result of a failed attempt to segregate incompletely replicated sister chromatids. This study reveals that maternally encoded Humpty dumpty protein is essential for DNA replication and genome integrity during the little-understood embryonic S/M cycles. Moreover, the two hd 272-9 maternal-effect phenotypes suggest that ovarian gene amplification and embryonic cleavage are two time periods in development that are particularly sensitive to mild deficits in DNA replication function. This last observation has broader relevance for interpreting why mild mutations in the human ortholog of humpty dumpty and other DNA replication genes cause tissue-specific malformations of microcephalic dwarfisms. Copyright © 2017 by the Genetics Society of America.

  1. Rapid assessment of non-indigenous species in the era of the eDNA barcoding: A Mediterranean case study

    Science.gov (United States)

    Ardura, Alba; Planes, Serge

    2017-03-01

    With only a narrow opening through the Gibraltar and Suez Canals, the Mediterranean Sea is one of the largest semi-enclosed seas. The marine flora and fauna are some of the richest in the world, relative to its size, particularly in the coastal habitats, which are also characterized by numerous endemic species although the introduction of non-indigenous species threatens its rich and unique biodiversity. Following the opening of the Suez Canal, and in combination with shipping and aquaculture activities, non-indigenous species (NIS) introduction has had measurable impacts on the Mediterranean. Lagoon ecosystems along the French coastline, with approx. 100 NIS identified, are considered hot-spot areas for these species. Rapid assessment sampling for sessile benthic species together with DNA barcoding is a rapid, easy and cheap method to detect non-indigenous species. Two nearby and different ecosystems were sampled for invertebrate species: Saint-Nazaire lagoon, a Special Protection Area within the Natura 2000 Network and Canet port, a marina in a small village. The DNA barcoding tool for species identification was used for confirming the taxonomy. This showed that, despite the Saint-Nazaire Lagoon classification within the Natura 2000 network, it is already contaminated with a single NIS that was found in high densities and is clearly beginning to dominate the system. It is proposed that a rapid assessment of the sampled environment and the DNA barcode approach are efficient and can provide sufficient information on the new target species to be used in conservation planning and ongoing management efforts.

  2. Variability among the Most Rapidly Evolving Plastid Genomic Regions is Lineage-Specific: Implications of Pairwise Genome Comparisons in Pyrus (Rosaceae) and Other Angiosperms for Marker Choice

    Science.gov (United States)

    Ter-Voskanyan, Hasmik; Allgaier, Martin; Borsch, Thomas

    2014-01-01

    Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae)—a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC–trnV, trnR–atpA, ndhF–rpl32, psbM–trnD, and trnQ–rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters). Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid), Olea (asterids) and Cymbidium (monocots) showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF–rpl32 and trnK–rps16) were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations

  3. Variability among the most rapidly evolving plastid genomic regions is lineage-specific: implications of pairwise genome comparisons in Pyrus (Rosaceae and other angiosperms for marker choice.

    Directory of Open Access Journals (Sweden)

    Nadja Korotkova

    Full Text Available Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae-a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC-trnV, trnR-atpA, ndhF-rpl32, psbM-trnD, and trnQ-rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters. Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid, Olea (asterids and Cymbidium (monocots showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF-rpl32 and trnK-rps16 were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations. Sequencing

  4. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection

    NARCIS (Netherlands)

    Wagemakers, A.; Mason, L. M. K.; Oei, A.; de Wever, B.; van der Poll, T.; Bins, A. D.; Hovius, J. W. R.

    2014-01-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method

  5. Rapid DNA extraction from dried blood spots on filter paper: potential applications in biobanking.

    Science.gov (United States)

    Choi, Eun-Hye; Lee, Sang Kwang; Ihm, Chunhwa; Sohn, Young-Hak

    2014-12-01

    Dried blood spot (DBS) technology is a microsampling alternative to traditional plasma or serum sampling for pharmaco- or toxicokinetic evaluation. DBS technology has been applied to diagnostic screening in drug discovery, nonclinical, and clinical settings. We have developed an improved elution protocol involving boiling of blood spots dried on Whatman filter paper. The purpose of this study was to compare the quality, purity, and quantity of DNA isolated from frozen blood samples and DBSs. We optimized a method for extraction and estimation of DNA from blood spots dried on filter paper (3-mm FTA card). A single DBS containing 40 μL blood was used. DNA was efficiently extracted in phosphate-buffered saline (PBS) or Tris-EDTA (TE) buffer by incubation at 37°C overnight. DNA was stable in DBSs that were stored at room temperature or frozen. The housekeeping genes GAPDH and beta-actin were used as positive standards for polymerase chain reaction (PCR) validation of general diagnostic screening. Our simple and convenient DBS storage and extraction methods are suitable for diagnostic screening by using very small volumes of blood collected on filter paper, and can be used in biobanks for blood sample storage.

  6. The use of DNA markers for rapid improvement of crops in Africa ...

    African Journals Online (AJOL)

    Genetic engineering and biotechnology are providing new tools for genetic improvement of food crops. Molecular DNA markers are some of these tools which can be used in various fields of plant breeding and germplasm management. For example, molecular markers have been used to confirm the identity of hybrids in ...

  7. A Novel Method for Rapid Hybridization of DNA to a Solid Support

    Science.gov (United States)

    Pettersson, Erik; Ahmadian, Afshin; Ståhl, Patrik L.

    2013-01-01

    Here we present a novel approach entitled Magnetic Forced Hybridization (MFH) that provides the means for efficient and direct hybridization of target nucleic acids to complementary probes immobilized on a glass surface in less than 15 seconds at ambient temperature. In addition, detection is carried out instantly since the beads become visible on the surface. The concept of MFH was tested for quality control of array manufacturing, and was combined with a multiplex competitive hybridization (MUCH) approach for typing of Human Papilloma Virus (HPV). Magnetic Forced Hybridization of bead-DNA constructs to a surface achieves a significant reduction in diagnostic testing time. In addition, readout of results by visual inspection of the unassisted eye eliminates the need for additional expensive instrumentation. The method uses the same set of beads throughout the whole process of manipulating and washing DNA constructs prior to detection, as in the actual detection step itself. PMID:23950946

  8. Rapid Identification of Seven Waterborne Exophiala Species by RCA DNA Padlock Probes.

    Science.gov (United States)

    Najafzadeh, M J; Vicente, V A; Feng, Peiying; Naseri, A; Sun, Jiufeng; Rezaei-Matehkolaei, A; de Hoog, G S

    2018-03-05

    The black yeast genus Exophiala includes numerous potential opportunistic species that potentially cause systematic and disseminated infections in immunocompetent individuals. Species causing systemic disease have ability to grow at 37-40 °C, while others consistently lack thermotolerance and are involved in diseases of cold-blooded, waterborne vertebrates and occasionally invertebrates. We explain a fast and sensitive assay for recognition and identification of waterborne Exophiala species without sequencing. The ITS rDNA region of seven Exophiala species (E. equina, E. salmonis, E. opportunistica, E. pisciphila, E. aquamarina, E. angulospora and E. castellanii) along with the close relative Veronaea botryosa was sequenced and aligned for the design of specific padlock probes for the detection of characteristic single-nucleotide polymorphisms. The assay demonstrated to successfully amplify DNA of target fungi, allowing detection at the species level. Amplification products were visualized on 1% agarose gels to confirm specificity of probe-template binding. Amounts of reagents were reduced to prevent the generation of false positive results. The simplicity, tenderness, robustness and low expenses provide padlock probe assay (RCA) a definite place as a very practical method among isothermal approaches for DNA diagnostics.

  9. DNA Sequence-Mediated, Evolutionarily Rapid Redistribution of Meiotic Recombination Hotspots

    Science.gov (United States)

    Wahls, Wayne P.; Davidson, Mari K.

    2011-01-01

    Hotspots regulate the position and frequency of Spo11 (Rec12)-initiated meiotic recombination, but paradoxically they are suicidal and are somehow resurrected elsewhere in the genome. After the DNA sequence-dependent activation of hotspots was discovered in fission yeast, nearly two decades elapsed before the key realizations that (A) DNA site-dependent regulation is broadly conserved and (B) individual eukaryotes have multiple different DNA sequence motifs that activate hotspots. From our perspective, such findings provide a conceptually straightforward solution to the hotspot paradox and can explain other, seemingly complex features of meiotic recombination. We describe how a small number of single-base-pair substitutions can generate hotspots de novo and dramatically alter their distribution in the genome. This model also shows how equilibrium rate kinetics could maintain the presence of hotspots over evolutionary timescales, without strong selective pressures invoked previously, and explains why hotspots localize preferentially to intergenic regions and introns. The model is robust enough to account for all hotspots of humans and chimpanzees repositioned since their divergence from the latest common ancestor. PMID:22084420

  10. Comparative sequence analysis of Solanum and Arabidopsis in a hot spot for pathogen resistance on potato chromosome V reveals a patchwork of conserved and rapidly evolving genome segments

    Directory of Open Access Journals (Sweden)

    Bruggmann Rémy

    2007-05-01

    Full Text Available Abstract Background Quantitative phenotypic variation of agronomic characters in crop plants is controlled by environmental and genetic factors (quantitative trait loci = QTL. To understand the molecular basis of such QTL, the identification of the underlying genes is of primary interest and DNA sequence analysis of the genomic regions harboring QTL is a prerequisite for that. QTL mapping in potato (Solanum tuberosum has identified a region on chromosome V tagged by DNA markers GP21 and GP179, which contains a number of important QTL, among others QTL for resistance to late blight caused by the oomycete Phytophthora infestans and to root cyst nematodes. Results To obtain genomic sequence for the targeted region on chromosome V, two local BAC (bacterial artificial chromosome contigs were constructed and sequenced, which corresponded to parts of the homologous chromosomes of the diploid, heterozygous genotype P6/210. Two contiguous sequences of 417,445 and 202,781 base pairs were assembled and annotated. Gene-by-gene co-linearity was disrupted by non-allelic insertions of retrotransposon elements, stretches of diverged intergenic sequences, differences in gene content and gene order. The latter was caused by inversion of a 70 kbp genomic fragment. These features were also found in comparison to orthologous sequence contigs from three homeologous chromosomes of Solanum demissum, a wild tuber bearing species. Functional annotation of the sequence identified 48 putative open reading frames (ORF in one contig and 22 in the other, with an average of one ORF every 9 kbp. Ten ORFs were classified as resistance-gene-like, 11 as F-box-containing genes, 13 as transposable elements and three as transcription factors. Comparing potato to Arabidopsis thaliana annotated proteins revealed five micro-syntenic blocks of three to seven ORFs with A. thaliana chromosomes 1, 3 and 5. Conclusion Comparative sequence analysis revealed highly conserved collinear regions

  11. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  12. A novel GMO biosensor for rapid ultrasensitive and simultaneous detection of multiple DNA components in GMO products.

    Science.gov (United States)

    Huang, Lin; Zheng, Lei; Chen, Yinji; Xue, Feng; Cheng, Lin; Adeloju, Samuel B; Chen, Wei

    2015-04-15

    Since the introduction of genetically modified organisms (GMOs), there has been on-going and continuous concern and debates on the commercialization of products derived from GMOs. There is an urgent need for development of highly efficient analytical methods for rapid and high throughput screening of GMOs components, as required for appropriate labeling of GMO-derived foods, as well as for on-site inspection and import/export quarantine. In this study, we describe, for the first time, a multi-labeling based electrochemical biosensor for simultaneous detection of multiple DNA components of GMO products on the same sensing interface. Two-round signal amplification was applied by using both an exonuclease enzyme catalytic reaction and gold nanoparticle-based bio-barcode related strategies, respectively. Simultaneous multiple detections of different DNA components of GMOs were successfully achieved with satisfied sensitivity using this electrochemical biosensor. Furthermore, the robustness and effectiveness of the proposed approach was successfully demonstrated by application to various GMO products, including locally obtained and confirmed commercial GMO seeds and transgenetic plants. The proposed electrochemical biosensor demonstrated unique merits that promise to gain more interest in its use for rapid and on-site simultaneous multiple screening of different components of GMO products. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Rapid and sensitive method to identify Mycobacterium avium subsp. paratuberculosis in cow's milk by DNA methylase genotyping.

    Science.gov (United States)

    Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José; Lopez, Osvaldo Jorge

    2013-03-01

    Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time.

  14. Rapid and annealing-free self-assembly of DNA building blocks for 3D hydrogel chaperoned by cationic comb-type copolymers.

    Science.gov (United States)

    Zhang, Zheng; Wu, Yuyang; Yu, Feng; Niu, Chaoqun; Du, Zhi; Chen, Yong; Du, Jie

    2017-10-01

    The construction and self-assembly of DNA building blocks are the foundation of bottom-up development of three-dimensional DNA nanostructures or hydrogels. However, most self-assembly from DNA components is impeded by the mishybridized intermediates or the thermodynamic instability. To enable rapid production of complicated DNA objects with high yields no need for annealing process, herein different DNA building blocks (Y-shaped, L- and L'-shaped units) were assembled in presence of a cationic comb-type copolymer, poly (L-lysine)-graft-dextran (PLL-g-Dex), under physiological conditions. The results demonstrated that PLL-g-Dex not only significantly promoted the self-assembly of DNA blocks with high efficiency, but also stabilized the assembled multi-level structures especially for promoting the complicated 3D DNA hydrogel formation. This study develops a novel strategy for rapid and high-yield production of DNA hydrogel even derived from instable building blocks at relatively low DNA concentrations, which would endow DNA nanotechnology for more practical applications.

  15. DNA-based genetic markers for Rapid Cycling Brassica rapa (Fast Plants type designed for the teaching laboratory.

    Directory of Open Access Journals (Sweden)

    Eryn E. Slankster

    2012-06-01

    Full Text Available We have developed DNA-based genetic markers for rapid-cycling Brassica rapa (RCBr, also known as Fast Plants. Although markers for Brassica rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP based markers and 14 variable number tandem repeat (VNTR-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a nongenic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology.

  16. Real-time DNA barcoding in a rainforest using nanopore sequencing: opportunities for rapid biodiversity assessments and local capacity building.

    Science.gov (United States)

    Pomerantz, Aaron; Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan

    2018-04-01

    Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism.

  17. Rapid, sensitive and cost effective method for isolation of viral DNA from feacal samples of dogs

    Directory of Open Access Journals (Sweden)

    Savi.

    2010-06-01

    Full Text Available A simple method for viral DNA extraction using chelex resin was developed. The method used was eco-friendly and cost effective compared to other methods such as phenol chloroform method which use health hazardous organic reagents. Further, a polymerase chain reaction (PCR based detection of canine parvovirus (CPV using primers from conserved region of VP2 gene was developed. To increase the sensitivity and specificity of reaction, nested PCR was designed. PCR reaction was optimized to amplify 747bp product of VP2 gene. The assay can be completed in few hours and doesn’t need hazardous chemicals. Thus, the sample preparation using chelating resin along with nested PCR seems to be a sensitive, specific and practical method for the detection of CPV in diarrhoeal feacal samples. [Vet. World 2010; 3(3.000: 105-106

  18. Development of bufferless gel electrophoresis chip for easy preparation and rapid DNA separation.

    Science.gov (United States)

    Oleksandrov, Sergiy; Aman, Abdurazak; Lim, Wanyoung; Kim, Younghee; Bae, Nam Ho; Lee, Kyoung G; Lee, Seok Jae; Park, Sungsu

    2018-02-01

    This work presents a handy, fast, and compact bufferless gel electrophoresis chip (BGEC), which consists of precast agarose gel confined in a disposable plastic body with electrodes. It does not require large volumes of buffer to fill reservoirs, or the process of immersing the gel in the buffer. It withstands voltages up to 28.4 V/cm, thereby allowing DNA separation within 10 min with a similar separation capability to the standard gel electrophoresis. The results suggest that our BGEC is highly suitable for in situ gel electrophoresis in forensic, epidemiological settings and crime scenes where standard gel electrophoresis equipment cannot be brought in while quick results are needed. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  20. Rapid DNA haplotyping using a multiplex heteroduplex approach: Application to Duchenne muscula dystrophy carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Wenger, G.D.; Moore, J. [Ohio State Univ., Columbus, OH (United States)] [and others

    1994-09-01

    A new strategy has been developed for rapid haplotype analysis. It is based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. The method is simple, rapid, does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using 12 commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. As a result of expanding the number of detectable polymorphisms throughout the dystrophin gene, we show how the method can easily be combined with dinucleotide analysis to improve the accuracy of carrier detection in the nondeletion cases. The technique is also shown to be used as an effective screen for improving carrier detection in several families with deletions. The finding of heterozygosity within the deletion identifies the at-risk female as a noncarrier. Using this method, we have identified and incorporated 3 new dystrophin polymorphisms (one of which in exon 16 is unique to African Americans). The method may be used other genetic diseases when mutations are unknown, or there are few dinucleotide markers in the gene proximity, or for the identification of haplotype backgrounds of mutant alleles.

  1. The development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of abalone herpesvirus DNA.

    Science.gov (United States)

    Chen, M H; Kuo, S T; Renault, T; Chang, P H

    2014-02-01

    A loop-mediated isothermal amplification (LAMP) assay was developed for the detection of abalone herpesvirus DNA. Two pairs of primers were designed, based on the sequence of the DNA polymerase gene of abalone herpesvirus. The reaction temperature and time were optimized to 63°C and 60min, respectively. LAMP amplicons were analyzed by 2% agarose gel electrophoresis or by visual inspection of a colour change emitted by fluorescent dye. The method developed was specific for the detection of abalone herpesvirus, without cross-reactions with other tested herpesviruses including ostreid herpesvirus 1 (OsHV-1), European eel herpesvirus, koi herpesvirus (KHV) and an avian herpesvirus. The LAMP assay was 100 folds more sensitive than a conventional PCR and 10 folds less sensitive than a SYBR Green PCR. These results indicate that the developed LAMP assay is a simple, rapid, sensitive, specific and reliable technique for the detection of abalone herpesvirus. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Unique mitochondrial DNA lineages in Irish stickleback populations: cryptic refugium or rapid recolonization?

    Science.gov (United States)

    Ravinet, Mark; Harrod, Chris; Eizaguirre, Christophe; Prodöhl, Paulo A

    2014-06-01

    Repeated recolonization of freshwater environments following Pleistocene glaciations has played a major role in the evolution and adaptation of anadromous taxa. Located at the western fringe of Europe, Ireland and Britain were likely recolonized rapidly by anadromous fishes from the North Atlantic following the last glacial maximum (LGM). While the presence of unique mitochondrial haplotypes in Ireland suggests that a cryptic northern refugium may have played a role in recolonization, no explicit test of this hypothesis has been conducted. The three-spined stickleback is native and ubiquitous to aquatic ecosystems throughout Ireland, making it an excellent model species with which to examine the biogeographical history of anadromous fishes in the region. We used mitochondrial and microsatellite markers to examine the presence of divergent evolutionary lineages and to assess broad-scale patterns of geographical clustering among postglacially isolated populations. Our results confirm that Ireland is a region of secondary contact for divergent mitochondrial lineages and that endemic haplotypes occur in populations in Central and Southern Ireland. To test whether a putative Irish lineage arose from a cryptic Irish refugium, we used approximate Bayesian computation (ABC). However, we found no support for this hypothesis. Instead, the Irish lineage likely diverged from the European lineage as a result of postglacial isolation of freshwater populations by rising sea levels. These findings emphasize the need to rigorously test biogeographical hypothesis and contribute further evidence that postglacial processes may have shaped genetic diversity in temperate fauna.

  3. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    OpenAIRE

    Farkhondeh Saba; Moslem Papizadeh; Javad Khansha; Mahshid Sedghi; Mehrnoosh Rasooli; Mohammad Ali Amoozegar; Mohammad Reza Soudi; Seyed Abolhassan Shahzadeh Fazeli

    2016-01-01

    Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR). Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Me...

  4. Rapid one-step selection method for generating nucleic acid aptamers: development of a DNA aptamer against α-bungarotoxin.

    Directory of Open Access Journals (Sweden)

    Lasse H Lauridsen

    Full Text Available BACKGROUND: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen®, an inhibitor of vascular endothelial growth factor (VEGF for the treatment of age related macular degeneration (AMD. Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly in one-step, technique is required for developing aptamers in limited time period. PRINCIPAL FINDINGS: Herein, we present a simple one-step selection of DNA aptamers against α-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed by PCR enrichment of the selected aptamers. One round of selection successfully identified a DNA aptamer sequence with a binding affinity of 7.58 µM. CONCLUSION: We have demonstrated a one-step method for rapid production of nucleic acid aptamers. Although the reported binding affinity is in the low micromolar range, we believe that this could be further improved by using larger targets, increasing the stringency of selection and also by combining a capillary electrophoresis separation prior to the one-step selection. Furthermore, the method presented here is a user-friendly, cheap and an easy way of deriving an aptamer unlike the time consuming conventional SELEX-based approach. The most important application of this method is that chemically-modified nucleic acid libraries can also be used for aptamer selection as it requires only one enzymatic step. This method could equally be suitable for developing RNA aptamers.

  5. Feedback-regulated poly(ADP-ribosyl)ation by PARP-1 is required for rapid response to DNA damage in living cells

    Science.gov (United States)

    Mortusewicz, Oliver; Amé, Jean-Christophe; Leonhardt, Heinrich

    2007-01-01

    Genome integrity is constantly threatened by DNA lesions arising from numerous exogenous and endogenous sources. Survival depends on immediate recognition of these lesions and rapid recruitment of repair factors. Using laser microirradiation and live cell microscopy we found that the DNA-damage dependent poly(ADP-ribose) polymerases (PARP) PARP-1 and PARP-2 are recruited to DNA damage sites, however, with different kinetics and roles. With specific PARP inhibitors and mutations, we could show that the initial recruitment of PARP-1 is mediated by the DNA-binding domain. PARP-1 activation and localized poly(ADP-ribose) synthesis then generates binding sites for a second wave of PARP-1 recruitment and for the rapid accumulation of the loading platform XRCC1 at repair sites. Further PARP-1 poly(ADP-ribosyl)ation eventually initiates the release of PARP-1. We conclude that feedback regulated recruitment of PARP-1 and concomitant local poly(ADP-ribosyl)ation at DNA lesions amplifies a signal for rapid recruitment of repair factors enabling efficient restoration of genome integrity. PMID:17982172

  6. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    Science.gov (United States)

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  7. Microfluidic method for rapid turbidimetric detection of the DNA of Mycobacterium tuberculosis using loop-mediated isothermal amplification in capillary tubes

    International Nuclear Information System (INIS)

    Rafati, Adele; Gill, Pooria

    2015-01-01

    We describe a microfluidic method for rapid isothermal turbidimetric detection of the DNA of Mycobacterium tuberculosis. Loop-mediated isothermal amplification is accomplished in capillary tubes for amplifying DNA in less than 15 min, and sensitivity and specificity were compared to conventional loop-mediated isothermal amplification (LAMP). The method can detect as little as 1 pg mL −1 DNA in a sample. Results obtained with clinical specimens indicated 90 % sensitivity and 95 % specificity for microfluidic LAMP in comparison to culture methods. No interference occurred due to the presence of nonspecific DNAs. The findings demonstrate the power of the new microfluidic LAMP test for rapid molecular detection of microorganisms even when using bare eyes. (author)

  8. Evolvable synthetic neural system

    Science.gov (United States)

    Curtis, Steven A. (Inventor)

    2009-01-01

    An evolvable synthetic neural system includes an evolvable neural interface operably coupled to at least one neural basis function. Each neural basis function includes an evolvable neural interface operably coupled to a heuristic neural system to perform high-level functions and an autonomic neural system to perform low-level functions. In some embodiments, the evolvable synthetic neural system is operably coupled to one or more evolvable synthetic neural systems in a hierarchy.

  9. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Papa Mze Nasserdine

    2016-01-01

    Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

  10. Rapid method for detecting base damage in DNA of mammalian cells: assay of U. V. -induced pyrimidine dimers in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Bryant, P E [Hammersmith Hospital, London (UK). M.R.C. Cyclotron Unit; Jansson, G; Ahnstroem, G

    1978-11-01

    Simple and rapid techniques are described for the detection of pyrimidine dimers in DNA. Human cells derived from embryonic lung tissue were UV-irradiated and subjected to either an osmotic shock procedure or detergent lysis, then treated with UV-endonuclease from Micrococcus luteus and the DNA partially denatured by treatment with weak alkali. Brief sonication reduced the molecular weight of the DNA, and the single- and double-stranded DNA could then be separated by hydroxylapatite chromatography. Approximately 40% of the expected number of pyrimidine dimers were detected by the enzyme treatment technique. The mean value of numbers of strand breaks per 10/sup 9/ dalton per J/m/sup 2/ was approximately 50% of the expected value. The method has advantages of speed and reproducibility and a large reduction in the quantities of materials used, particularly at the scintillation-counting stage.

  11. Loop-mediated isothermal amplification (LAMP) assay-A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena).

    Science.gov (United States)

    Heers, Teresa; van Neer, Abbo; Becker, André; Grilo, Miguel Luca; Siebert, Ursula; Abdulmawjood, Amir

    2017-01-01

    Carcasses of wild animals are often visited by different scavengers. However, determining which scavenger caused certain types of bite marks is particularly difficult and knowledge thereof is lacking. Therefore, a loop-mediated isothermal amplification (LAMP) assay (target sequence cytochrome b) was developed to detect red fox DNA in carcasses of harbour porpoises. The MSwab™ method for direct testing without prior DNA isolation was validated. As a detection device, the portable real-time fluorometer Genie® II was used, which yields rapid results and can be used in field studies without huge laboratory equipment. In addition to in vitro evaluation and validation, a stranded and scavenged harbour porpoise carcass was successfully examined for red fox DNA residues. The developed LAMP method is a valuable diagnostic tool for confirming presumable red fox bite wounds in harbour porpoises without further DNA isolation steps.

  12. Potassium hydroxide-ethylene diamine tetraacetic acid method for the rapid preparation of small-scale PCR template DNA from actinobacteria.

    Science.gov (United States)

    Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli

    2014-01-01

    Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.

  13. Simple design for DNA nanotubes from a minimal set of unmodified strands: rapid, room-temperature assembly and readily tunable structure.

    Science.gov (United States)

    Hamblin, Graham D; Hariri, Amani A; Carneiro, Karina M M; Lau, Kai L; Cosa, Gonzalo; Sleiman, Hanadi F

    2013-04-23

    DNA nanotubes have great potential as nanoscale scaffolds for the organization of materials and the templation of nanowires and as drug delivery vehicles. Current methods for making DNA nanotubes either rely on a tile-based step-growth polymerization mechanism or use a large number of component strands and long annealing times. Step-growth polymerization gives little control over length, is sensitive to stoichiometry, and is slow to generate long products. Here, we present a design strategy for DNA nanotubes that uses an alternative, more controlled growth mechanism, while using just five unmodified component strands and a long enzymatically produced backbone. These tubes form rapidly at room temperature and have numerous, orthogonal sites available for the programmable incorporation of arrays of cargo along their length. As a proof-of-concept, cyanine dyes were organized into two distinct patterns by inclusion into these DNA nanotubes.

  14. Natural selection promotes antigenic evolvability.

    Science.gov (United States)

    Graves, Christopher J; Ros, Vera I D; Stevenson, Brian; Sniegowski, Paul D; Brisson, Dustin

    2013-01-01

    The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios) and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish chronic infections.

  15. Natural selection promotes antigenic evolvability.

    Directory of Open Access Journals (Sweden)

    Christopher J Graves

    Full Text Available The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish

  16. DNA-based identification of invasive alien species in relation to Canadian federal policy and law, and the basis of rapid-response management.

    Science.gov (United States)

    Thomas, Vernon G; Hanner, Robert H; Borisenko, Alex V

    2016-11-01

    Managing invasive alien species in Canada requires reliable taxonomic identification as the basis of rapid-response management. This can be challenging, especially when organisms are small and lack morphological diagnostic features. DNA-based techniques, such as DNA barcoding, offer a reliable, rapid, and inexpensive toolkit for taxonomic identification of individual or bulk samples, forensic remains, and even environmental DNA. Well suited for this requirement, they could be more broadly deployed and incorporated into the operating policy and practices of Canadian federal departments and should be authorized under these agencies' articles of law. These include Fisheries and Oceans Canada, Canadian Food Inspection Agency, Transport Canada, Environment Canada, Parks Canada, and Health Canada. These efforts should be harmonized with the appropriate provisions of provincial jurisdictions, for example, the Ontario Invasive Species Act. This approach necessitates that a network of accredited, certified laboratories exists, and that updated DNA reference libraries are readily accessible. Harmonizing this approach is vital among Canadian federal agencies, and between the federal and provincial levels of government. Canadian policy and law must also be harmonized with that of the USA when detecting, and responding to, invasive species in contiguous lands and waters. Creating capacity in legislation for use of DNA-based identifications brings the authority to fund, train, deploy, and certify staff, and to refine further developments in this molecular technology.

  17. Molecular-based rapid inventories of sympatric diversity: a comparison of DNA barcode clustering methods applied to geography-based vs clade-based sampling of amphibians.

    Science.gov (United States)

    Paz, Andrea; Crawford, Andrew J

    2012-11-01

    Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.

  18. Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

    Science.gov (United States)

    Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

    2016-11-01

    Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  19. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  20. Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques.

    Science.gov (United States)

    Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian

    2010-03-01

    The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays.

  1. Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

    Science.gov (United States)

    Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

    2018-04-04

    In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Directory of Open Access Journals (Sweden)

    Koji Hashimoto

    2016-05-01

    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond

  3. A simple and rapid micromethod for genomic DNA extraction from jugal epithelial cells. Application to human lymphocyte antigen typing in one large family of atopic/asthmatic probands.

    Science.gov (United States)

    Aron, Y; Swierczewski, E; Lockhart, A

    1994-10-01

    We describe a rapid and reliable micromethod for DNA isolation from buccal epithelial cells from the interior mouth mucosa. This convenient, noninvasive method could be applied to genetic typing in a small number of cells (about 2000 cells per cheek). We have shown that DNA released by this method is suitable for further amplification by polymerase chain reaction (PCR). Using this protocol, coupled with the PCR-RFLP (restriction fragment length polymorphism) method, we analyzed the allelic sequence diversity of the human lymphocyte antigen (HLA) class II genes in an extended family of 33 persons containing 14 asthmatic or atopic members. Six of eight DQA1 alleles, and 11 DQB1, 20 DPB1, and 10 DR haplotypes could be identified in a single DNA sample. Our results suggest that the DR53 group haplotype is frequently associated with allergic asthma and atopy. The micromethod described here may be useful in genetic epidemiology, especially in family studies involving small children.

  4. New LightCycler PCR for Rapid and Sensitive Quantification of Parvovirus B19 DNA Guides Therapeutic Decision-Making in Relapsing Infections

    Science.gov (United States)

    Harder, Timm C.; Hufnagel, Markus; Zahn, Katrin; Beutel, Karin; Schmitt, Heinz-Josef; Ullmann, Uwe; Rautenberg, Peter

    2001-01-01

    Detection of parvovirus B19 DNA offers diagnostic advantages over serology, particularly in persistent infections of immunocompromised patients. A rapid, novel method of B19 DNA detection and quantification is introduced. This method, a quantitative PCR assay, is based on real-time glass capillary thermocycling (LightCycler [LC]) and fluorescence resonance energy transfer (FRET). The PCR assay allowed quantification over a dynamic range of over 7 logs and could quantify as little as 250 B19 genome equivalents (geq) per ml as calculated for plasmid DNA (i.e., theoretically ≥5 geq per assay). Interrater agreement analysis demonstrated equivalence of LC-FRET PCR and conventional nested PCR in the diagnosis of an active B19 infection (kappa coefficient = 0.83). The benefit of the new method was demonstrated in an immunocompromised child with a relapsing infection, who required an attenuation of the immunosuppressive therapy in addition to repeated doses of immunoglobulin to eliminate the virus. PMID:11724854

  5. Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing

    OpenAIRE

    Wang, Huiping; Kong, Fanrong; Sorrell, Tania C; Wang, Bin; McNicholas, Paul; Pantarat, Namfon; Ellis, David; Xiao, Meng; Widmer, Fred; Chen, Sharon CA

    2009-01-01

    Abstract Background Amino acid substitutions in the target enzyme Erg11p of azole antifungals contribute to clinically-relevant azole resistance in Candida albicans. A simple molecular method for rapid detection of ERG11 gene mutations would be an advantage as a screening tool to identify potentially-resistant strains and to track their movement. To complement DNA sequencing, we developed a padlock probe and rolling circle amplification (RCA)-based method to detect a series of mutations in th...

  6. Determination of alkylation of bacterial DNA as a rapid test for toxicological evaluation of alkylating xenobiotic agents

    Energy Technology Data Exchange (ETDEWEB)

    Botzenhart, K.; Waldner-Sander, S.; Schweinsberg, F.

    1986-05-01

    Alkylated purine bases from hydrolized DNA can be separated by HPLC and quantified with a fluorescence detector. We applied this method to bacterial DNA. 7-methylguanine was detected after treatment of Serratia marcescens with iodoacetamide, dimethyl sulfate and with polluted air.

  7. A DNA Barcode-Based RPA Assay (BAR-RPA) for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao).

    Science.gov (United States)

    Tian, Enwei; Liu, Qianqian; Ye, Haoting; Li, Fang; Chao, Zhi

    2017-12-18

    Background: Wuzhimaotao (the dry root of Ficus hirta ) is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans , which contains gelsemine that is extremely neurotoxic) and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA) with species-specific primers targeting the internal transcribed spacer (ITS) region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species-specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min) of the ITS region under a constant and mild temperature range of 37-42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

  8. A DNA Barcode-Based RPA Assay (BAR-RPA for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao

    Directory of Open Access Journals (Sweden)

    Enwei Tian

    2017-12-01

    Full Text Available Background: Wuzhimaotao (the dry root of Ficus hirta is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans, which contains gelsemine that is extremely neurotoxic and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA with species–specific primers targeting the internal transcribed spacer (ITS region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species–specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min of the ITS region under a constant and mild temperature range of 37–42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

  9. Lung Basal Stem Cells Rapidly Repair DNA Damage Using the Error-Prone Nonhomologous End-Joining Pathway

    Science.gov (United States)

    Weeden, Clare E.; Chen, Yunshun; Ma, Stephen B.; Hu, Yifang; Ramm, Georg; Sutherland, Kate D.; Smyth, Gordon K.

    2017-01-01

    Lung squamous cell carcinoma (SqCC), the second most common subtype of lung cancer, is strongly associated with tobacco smoking and exhibits genomic instability. The cellular origins and molecular processes that contribute to SqCC formation are largely unexplored. Here we show that human basal stem cells (BSCs) isolated from heavy smokers proliferate extensively, whereas their alveolar progenitor cell counterparts have limited colony-forming capacity. We demonstrate that this difference arises in part because of the ability of BSCs to repair their DNA more efficiently than alveolar cells following ionizing radiation or chemical-induced DNA damage. Analysis of mice harbouring a mutation in the DNA-dependent protein kinase catalytic subunit (DNA-PKcs), a key enzyme in DNA damage repair by nonhomologous end joining (NHEJ), indicated that BSCs preferentially repair their DNA by this error-prone process. Interestingly, polyploidy, a phenomenon associated with genetically unstable cells, was only observed in the human BSC subset. Expression signature analysis indicated that BSCs are the likely cells of origin of human SqCC and that high levels of NHEJ genes in SqCC are correlated with increasing genomic instability. Hence, our results favour a model in which heavy smoking promotes proliferation of BSCs, and their predilection for error-prone NHEJ could lead to the high mutagenic burden that culminates in SqCC. Targeting DNA repair processes may therefore have a role in the prevention and therapy of SqCC. PMID:28125611

  10. Rapid point-of-care testing for epidermal growth factor receptor gene mutations in patients with lung cancer using cell-free DNA from cytology specimen supernatants.

    Science.gov (United States)

    Asaka, Shiho; Yoshizawa, Akihiko; Saito, Kazusa; Kobayashi, Yukihiro; Yamamoto, Hiroshi; Negishi, Tatsuya; Nakata, Rie; Matsuda, Kazuyuki; Yamaguchi, Akemi; Honda, Takayuki

    2018-06-01

    Epidermal growth factor receptor (EGFR) mutations are associated with responses to EGFR tyrosine kinase inhibitors (EGFR-TKIs) in non-small-cell lung cancer (NSCLC). Our previous study revealed a rapid point-of-care system for detecting EGFR mutations. This system analyzes cell pellets from cytology specimens using droplet-polymerase chain reaction (d-PCR), and has a reaction time of 10 min. The present study aimed to validate the performance of the EGFR d-PCR assay using cell-free DNA (cfDNA) from supernatants obtained from cytology specimens. Assay results from cfDNA supernatant analyses were compared with those from cell pellets for 90 patients who were clinically diagnosed with, or suspected of having, lung cancer (80 bronchial lavage fluid samples, nine pleural effusion samples and one spinal fluid sample). EGFR mutations were identified in 12 and 15 cases using cfDNA supernatants and cell pellets, respectively. The concordance rates between cfDNA-supernatant and cell‑pellet assay results were 96.7% [kappa coefficient (K)=0.87], 98.9% (K=0.94), 98.9% (K=0.79) and 98.9% (K=0.79) for total EGFR mutations, L858R, E746_A750del and T790M, respectively. All 15 patients with EGFR mutation-positive results, as determined by EGFR d-PCR assay using cfDNA supernatants or cell pellets, also displayed positive results by conventional EGFR assays using tumor tissue or cytology specimens. Notably, EGFR mutations were even detected in five cfDNA supernatants for which the cytological diagnoses of the corresponding cell pellets were 'suspicious for malignancy', 'atypical' or 'negative for malignancy.' In conclusion, this rapid point-of-care system may be considered a promising novel screening method that may enable patients with NSCLC to receive EGFR-TKI therapy more rapidly, whilst also reserving cell pellets for additional morphological and molecular analyses.

  11. Lactobacilli evolve by cumulative DNA degeneration

    OpenAIRE

    Bringel , Françoise; Hubert , Jean-Claude

    2004-01-01

    International audience; Lactic acid bacteria require rich media since, due to mutations in their biosynthetic genes, they are unable to synthesise numerous amino acids and nucleobases. The extent of genetic lesions was investigated in two biosynthetic pathways for 150 Lactobacillus plantarum isolates from various origins. Arginine biosynthesis and pyrimidine biosynthesis share a common intermediate, carbamoyl phosphate (CP). No pyrimidine auxotrophs were detected and only 7 L. plantarum strai...

  12. Boom-Bust Turnovers of Megabase-Sized Centromeric DNA in Solanum Species: Rapid Evolution of DNA Sequences Associated with Centromeres

    Czech Academy of Sciences Publication Activity Database

    Zhang, H.Q.; Koblížková, Andrea; Wang, K.; Gong, Z.Y.; Oliveira, L.; Torres, G.A.; Wu, Y.; Zhang, W.; Novák, Petr; Buell, C.R.; Macas, Jiří; Jiang, J.

    2014-01-01

    Roč. 26, č. 4 (2014), s. 1436-1447 ISSN 1040-4651 Institutional support: RVO:60077344 Keywords : Alpha-satellite DNA * repetitive sequences * rice centromeres Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.338, year: 2014

  13. Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms.

    Science.gov (United States)

    Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc

    2010-07-01

    We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.

  14. Inhibition of exportin-1 function results in rapid cell cycle-associated DNA damage in cancer cells.

    Science.gov (United States)

    Burke, Russell T; Marcus, Joshua M; Orth, James D

    2017-06-13

    Selective inhibitors of nuclear export (SINE) are small molecules in development as anti-cancer agents. The first-in-class SINE, selinexor, is in clinical trials for blood and solid cancers. Selinexor forms a covalent bond with exportin-1 at cysteine-528, and blocks its ability to export cargos. Previous work has shown strong cell cycle effects and drug-induced cell death across many different cancer-derived cell lines. Here, we report strong cell cycle-associated DNA double-stranded break formation upon the treatment of cancer cells with SINE. In multiple cell models, selinexor treatment results in the formation of clustered DNA damage foci in 30-40% of cells within 8 hours that is dependent upon cysteine-528. DNA damage strongly correlates with G1/S-phase and decreased DNA replication. Live cell microscopy reveals an association between DNA damage and cell fate. Cells that form damage in G1-phase more often die or arrest, while those damaged in S/G2-phase frequently progress to cell division. Up to half of all treated cells form damage foci, and most cells that die after being damaged, were damaged in G1-phase. By comparison, non-transformed cell lines show strong cell cycle effects but little DNA damage and less death than cancer cells. Significant drug combination effects occur when selinexor is paired with different classes of agents that either cause DNA damage or that diminish DNA damage repair. These data present a novel effect of exportin-1 inhibition and provide a strong rationale for multiple combination treatments of selinexor with agents that are currently in use for the treatment of different solid cancers.

  15. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  16. Novel Polymerase Spiral Reaction (PSR) for rapid visual detection of Bovine Herpesvirus 1 genomic DNA from aborted bovine fetus and semen.

    Science.gov (United States)

    Malla, Javed Ahmed; Chakravarti, Soumendu; Gupta, Vikas; Chander, Vishal; Sharma, Gaurav Kumar; Qureshi, Salauddin; Mishra, Adhiraj; Gupta, Vivek Kumar; Nandi, Sukdeb

    2018-02-20

    Bovine herpesvirus-1 (BHV-1) is a major viral pathogen affecting bovines leading to various clinical manifestations and causes significant economic impediment in modern livestock production system. Rapid, accurate and sensitive detection of BHV-1 infection at frozen semen stations or at dairy herds remains a priority for control of BHV-1 spread to susceptible population. Polymerase Spiral Reaction (PSR), a novel addition in the gamut of isothermal techniques, has been successfully implemented in initial optimization for detection of BHV-1 genomic DNA and further validated in clinical samples. The developed PSR assay has been validated for detection of BHV-1 from bovine semen (n=99), a major source of transmission of BHV-1 from breeding bulls to susceptible dams in artificial insemination programs. The technique has also been used for screening of BHV-1 DNA from suspected aborted fetal tissues (n=25). The developed PSR technique is 100 fold more sensitive than conventional PCR and comparable to real-time PCR. The PSR technique has been successful in detecting 13 samples positive for BHV-1 DNA in bovine semen, 4 samples more than conventional PCR. The aborted fetal tissues were negative for presence of BHV-1 DNA. The presence of BHV-1 in bovine semen samples raises a pertinent concern for extensively screening of semen from breeding bulls before been used for artificial insemination process. PSR has all the attributes for becoming a method of choice for rapid, accurate and sensitive detection of BHV-1 DNA at frozen semen stations or at dairy herds in resource constrained settings. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

    Science.gov (United States)

    Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

    2018-05-05

    The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. A simple and rapid method for isolation of high quality genomic DNA from fruit trees and conifers using PVP.

    Science.gov (United States)

    Kim, C S; Lee, C H; Shin, J S; Chung, Y S; Hyung, N I

    1997-03-01

    Because DNA degradation is mediated by secondary plant products such as phenolic terpenoids, the isolation of high quality DNA from plants containing a high content of polyphenolics has been a difficult problem. We demonstrate an easy extraction process by modifying several existing ones. Using this process we have found it possible to isolate DNAs from four fruit trees, grape (Vitis spp.), apple (Malus spp.), pear (Pyrus spp.) and persimmon (Diospyros spp.) and four species of conifer, Pinus densiflora, Pinus koraiensis,Taxus cuspidata and Juniperus chinensis within a few hours. Compared with the existing method, we have isolated high quality intact DNAs (260/280 = 1.8-2.0) routinely yielding 250-500 ng/microl (total 7.5-15 microg DNA from four to five tissue discs).

  19. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2017-01-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  20. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2016-09-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  1. A differential mobility spectrometry/mass spectrometry platform for the rapid detection and quantitation of DNA adduct dG-ABP.

    Science.gov (United States)

    Kafle, Amol; Klaene, Joshua; Hall, Adam B; Glick, James; Coy, Stephen L; Vouros, Paul

    2013-07-15

    There is continued interest in exploring new analytical technologies for the detection and quantitation of DNA adducts, biomarkers which provide direct evidence of exposure and genetic damage in cells. With the goal of reducing clean-up steps and improving sample throughput, a Differential Mobility Spectrometry/Mass Spectrometry (DMS/MS) platform has been introduced for adduct analysis. A DMS/MS platform has been utilized for the analysis of dG-ABP, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl (4-ABP). After optimization of the DMS parameters, each sample was analyzed in just 30 s following a simple protein precipitation step of the digested DNA. A detection limit of one modification in 10^6 nucleosides has been achieved using only 2 µg of DNA. A brief comparison (quantitative and qualitative) with liquid chromatography/mass spectrometry is also presented highlighting the advantages of using the DMS/MS method as a high-throughput platform. The data presented demonstrate the successful application of a DMS/MS/MS platform for the rapid quantitation of DNA adducts using, as a model analyte, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl. Copyright © 2013 John Wiley & Sons, Ltd.

  2. Internal validation of the DNAscan/ANDE™ Rapid DNA Analysis™ platform and its associated PowerPlex® 16 high content DNA biochip cassette for use as an expert system with reference buccal swabs.

    Science.gov (United States)

    Moreno, Lilliana I; Brown, Alice L; Callaghan, Thomas F

    2017-07-01

    Rapid DNA platforms are fully integrated systems capable of producing and analyzing short tandem repeat (STR) profiles from reference sample buccal swabs in less than two hours. The technology requires minimal user interaction and experience making it possible for high quality profiles to be generated outside an accredited laboratory. The automated production of point of collection reference STR profiles could eliminate the time delay for shipment and analysis of arrestee samples at centralized laboratories. Furthermore, point of collection analysis would allow searching against profiles from unsolved crimes during the normal booking process once the infrastructure to immediately search the Combined DNA Index System (CODIS) database from the booking station is established. The DNAscan/ANDE™ Rapid DNA Analysis™ System developed by Network Biosystems was evaluated for robustness and reliability in the production of high quality reference STR profiles for database enrollment and searching applications. A total of 193 reference samples were assessed for concordance of the CODIS 13 loci. Studies to evaluate contamination, reproducibility, precision, stutter, peak height ratio, noise and sensitivity were also performed. The system proved to be robust, consistent and dependable. Results indicated an overall success rate of 75% for the 13 CODIS core loci and more importantly no incorrect calls were identified. The DNAscan/ANDE™ could be confidently used without human interaction in both laboratory and non-laboratory settings to generate reference profiles. Published by Elsevier B.V.

  3. Rapid discrimination of Isaria javanica and Isaria poprawskii from Isaria spp. using high resolution DNA melting assays

    Science.gov (United States)

    The current study evaluates the potential of using high resolution DNA melting assays to discriminate species in the genus, Isaria. The study utilizes a previously identified 103 base pair PCR amplicon, which was reported to be selective for Isaria fumosorosea. Our study finds the amplicon selective...

  4. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.

    2011-01-01

    for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were...

  5. Evaluation of a transposase protocol for rapid generation of shotgun high-throughput sequencing libraries from nanogram quantities of DNA.

    Science.gov (United States)

    Marine, Rachel; Polson, Shawn W; Ravel, Jacques; Hatfull, Graham; Russell, Daniel; Sullivan, Matthew; Syed, Fraz; Dumas, Michael; Wommack, K Eric

    2011-11-01

    Construction of DNA fragment libraries for next-generation sequencing can prove challenging, especially for samples with low DNA yield. Protocols devised to circumvent the problems associated with low starting quantities of DNA can result in amplification biases that skew the distribution of genomes in metagenomic data. Moreover, sample throughput can be slow, as current library construction techniques are time-consuming. This study evaluated Nextera, a new transposon-based method that is designed for quick production of DNA fragment libraries from a small quantity of DNA. The sequence read distribution across nine phage genomes in a mock viral assemblage met predictions for six of the least-abundant phages; however, the rank order of the most abundant phages differed slightly from predictions. De novo genome assemblies from Nextera libraries provided long contigs spanning over half of the phage genome; in four cases where full-length genome sequences were available for comparison, consensus sequences were found to match over 99% of the genome with near-perfect identity. Analysis of areas of low and high sequence coverage within phage genomes indicated that GC content may influence coverage of sequences from Nextera libraries. Comparisons of phage genomes prepared using both Nextera and a standard 454 FLX Titanium library preparation protocol suggested that the coverage biases according to GC content observed within the Nextera libraries were largely attributable to bias in the Nextera protocol rather than to the 454 sequencing technology. Nevertheless, given suitable sequence coverage, the Nextera protocol produced high-quality data for genomic studies. For metagenomics analyses, effects of GC amplification bias would need to be considered; however, the library preparation standardization that Nextera provides should benefit comparative metagenomic analyses.

  6. Ranking in evolving complex networks

    Science.gov (United States)

    Liao, Hao; Mariani, Manuel Sebastian; Medo, Matúš; Zhang, Yi-Cheng; Zhou, Ming-Yang

    2017-05-01

    Complex networks have emerged as a simple yet powerful framework to represent and analyze a wide range of complex systems. The problem of ranking the nodes and the edges in complex networks is critical for a broad range of real-world problems because it affects how we access online information and products, how success and talent are evaluated in human activities, and how scarce resources are allocated by companies and policymakers, among others. This calls for a deep understanding of how existing ranking algorithms perform, and which are their possible biases that may impair their effectiveness. Many popular ranking algorithms (such as Google's PageRank) are static in nature and, as a consequence, they exhibit important shortcomings when applied to real networks that rapidly evolve in time. At the same time, recent advances in the understanding and modeling of evolving networks have enabled the development of a wide and diverse range of ranking algorithms that take the temporal dimension into account. The aim of this review is to survey the existing ranking algorithms, both static and time-aware, and their applications to evolving networks. We emphasize both the impact of network evolution on well-established static algorithms and the benefits from including the temporal dimension for tasks such as prediction of network traffic, prediction of future links, and identification of significant nodes.

  7. Potential of cross-priming amplification and DNA-based lateral-flow strip biosensor for rapid on-site GMO screening.

    Science.gov (United States)

    Huang, Xin; Zhai, Congcong; You, Qimin; Chen, Hongjun

    2014-07-01

    The requirement to monitor the presence of genetically modified organisms (GMO) in a variety of marked products has generated an increasing demand for reliable, rapid, and time and cost-effective analytical methods. Here we report an on-site method for rapid detection of cauliflower mosaic virus promoter (CaMV 35S), a common element present in most GMO, using cross-priming amplification (CPA) technology. Detection was achieved using a DNA-based contamination-proof strip biosensor. The limit of detection was 30 copies for the pBI121 plasmid containing the CaMV 35S gene. The certified reference sample of GM maize line MON810 was detectable even at the low relative mass concentration of 0.05%. The developed CPA method had high specificity for the CaMV 35S gene, as compared with other GM lines not containing this gene and non-GM products. The method was further validated using nine real-world samples, and the results were confirmed by real-time PCR analysis. Because of its simplicity, rapidity, and high sensitivity, this method of detecting the CaMV 35S gene has great commercial prospects for rapid GMO screening of high-consumption food and agriculture products.

  8. Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor.

    Science.gov (United States)

    Yu, Xiaofan; Chen, Fang; Wang, Ronghui; Li, Yanbin

    2018-01-20

    The rapid detection of foodborne pathogens is critical to ensure food safety. The objective of this study is to select aptamers specifically bound to Escherichia coli O157:H7 using the whole-bacterium SELEX (Systematic Evolution of Ligands by Exponential Enrichment) and apply the selected aptamer to a QCM (quartz crystal microbalance) sensor for rapid and sensitive detection of target bacteria. A total of 19 rounds of selection against live E. coli O157:H7 and 6 rounds of counter selection against a mixture of Staphylococcus aureus, Listeria monocytogenes, and Salmonella Typhimurium, were performed. The aptamer pool from the last round was cloned and sequenced. One sequence S1 that appeared 16 times was characterized and a dissociation constant (K d ) of 10.30nM was obtained. Subsequently, a QCM aptasensor was developed for the rapid detection of E. coli O157:H7. The limit of detection (LOD) and the detection time of the aptasensor was determined to be 1.46×10 3 CFU/ml and 50min, respectively. This study demonstrated that the ssDNA aptamer selected by the whole-bacterium SELEX possessed higher sensitivity than previous work and the potential use of the constructed QCM aptasensor in rapid screening of foodborne pathogens. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Independent, rapid and targeted loss of highly repetitive DNA in natural and synthetic allopolyploids of Nicotiana tabacum

    Czech Academy of Sciences Publication Activity Database

    Renny-Byfield, S.; Kovařík, Aleš; Chester, M.; Nichols, R.A.; Macas, Jiří; Novák, Petr; Leitch, A.R.

    2012-01-01

    Roč. 7, č. 5 (2012), e36963 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GAP501/10/0208; GA MŠk OC10037 Institutional research plan: CEZ:AV0Z50040702; CEZ:AV0Z50510513 Keywords : chromosome evolution * repetitive DNA * allopolyploid Subject RIV: BO - Biophysics; EB - Genetics ; Molecular Biology (BC-A) Impact factor: 3.730, year: 2012

  10. Rapid, large-scale purification and characterization of Ada protein (O sup 6 methylguanine-DNA methyltransferase) of E. coli

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharyya, D.; Tano, K.; Bunick, G.J.; Uberbacher, E.C.; Mitra, S. (Oak Ridge National Laboratory, TN (USA)); Behnke, W.D. (Univ. of Cincinnati College of Medicine, OH (USA))

    1988-07-25

    The E. coli Ada protein (O{sup 6}-methylguanine-DNA methyltransferase) has been purified using a high-level expression vector with a yield of about 3 mg per liter of E. coli culture. The 39-kDa protein has an extinction coefficient (E{sup 280nm}{sub 1%}) of 5.3. Its isoelectric point of 7.1 is lower than that predicted from the amino acid content. The homogeneous Ada protein is fully active as a methyl acceptor from O{sup 6}-methylguanine in DNA. Its reaction with O{sup 6}-methylguanine in a synthetic DNA has a second-order rate constant of 1.1 {times} 10{sup 9} M{sup {minus}1} min{sup {minus}1} at 0{degree}C. Both the native form and the protein methylated at Cys-69 are monomeric. The CD spectrum suggests a low {alpha}-helical content and the radius of gyration of 23 {angstrom} indicates a compact, globular shape. The middle region of the protein is sensitive to a variety of proteases, including an endogenous activity in E. coli, suggesting that the protein is composed of N-terminal and C-terminal domains connected by a hinge region. E. coli B has a higher level of this protease than does K12.

  11. Mitochondrial DNA signature for range-wide populations of Bicyclus anynana suggests a rapid expansion from recent refugia.

    Directory of Open Access Journals (Sweden)

    Maaike A de Jong

    Full Text Available This study investigates the genetic diversity, population structure and demographic history of the afrotropical butterfly Bicyclus anynana using mitochondrial DNA (mtDNA. Samples from six wild populations covering most of the species range from Uganda to South Africa were compared for the cytochrome c oxidase subunit gene (COI. Molecular diversity indices show overall high mtDNA diversity for the populations, but low nucleotide divergence between haplotypes. Our results indicate relatively little geographic population structure among the southern populations, especially given the extensive distributional range and an expectation of limited gene flow between populations. We implemented neutrality tests to assess signatures of recent historical demographic events. Tajima's D test and Fu's F(S test both suggested recent population growth for the populations. The results were only significant for the southernmost populations when applying Tajima's D, but Fu's F(S indicated significant deviations from neutrality for all populations except the one closest to the equator. Based on our own findings and those from pollen and vegetation studies, we hypothesize that the species range of B. anynana was reduced to equatorial refugia during the last glacial period, and that the species expanded southwards during the past 10.000 years. These results provide crucial background information for studies of phenotypic and molecular adaptation in wild populations of B. anynana.

  12. 3' RNA ligase mediated rapid amplification of cDNA ends for validating viroid induced cleavage at the 3' extremity of the host mRNA.

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Bru, Pierrick; Perreault, Jean-Pierre

    2017-12-01

    5' RNA ligase-mediated rapid amplification of cDNA ends (5' RLM-RACE) is a widely-accepted method for the validation of direct cleavage of a target gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). However, this method cannot be used if cleavage takes place in the 3' extremity of the target RNA, as this gives insufficient sequence length to design nested PCR primers for 5' RLM RACE. To overcome this hurdle, we have developed 3' RNA ligase-mediated rapid amplification of cDNA ends (3' RLM RACE). In this method, an oligonucleotide adapter having 5' adenylated and 3' blocked is ligated to the 3' end of the cleaved RNA followed by PCR amplification using gene specific primers. In other words, in 3' RLM RACE, 3' end is mapped using 5' fragment instead of small 3' fragment. The method developed here was verified by examining the bioinformatics predicted and parallel analysis of RNA ends (PARE) proved cleavage sites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid infected tomato plants. The 3' RLM RACE developed in this study has the potential to validate the miRNA and vd-sRNA mediated cleavage of mRNAs at its 3' untranslated region (3' UTR). Copyright © 2017 Elsevier B.V. All rights reserved.

  13. DPS - a rapid method for genome sequencing of DNA-containing bacteriophages directly from a single plaque

    DEFF Research Database (Denmark)

    Kot, Witold Piotr; Vogensen, Finn Kvist; Sørensen, Søren Johannes

    2014-01-01

    Bacteriophages (phages) coexist with bacteria in all environments and influence microbial diversity, evolution and industrial production processes. As a result of this major impact of phages on microbes, tools that allow rapid characterization of phages are needed. Today, one of the most powerful...

  14. An easy, rapid, and cost-effective method for DNA extraction from various lichen taxa and specimens suitable for analysis of fungal and algal strains.

    Science.gov (United States)

    Park, Sook-Young; Jang, Seol-Hwa; Oh, Soon-Ok; Kim, Jung A; Hur, Jae-Seoun

    2014-12-01

    Lichen studies, including biodiversity, phylogenetic relationships, and conservation concerns require definitive species identification, however many lichens can be challenging to identify at the species level. Molecular techniques have shown efficacy in discriminating among lichen taxa, however, obtaining genomic DNA from herbarium and fresh lichen thalli by conventional methods has been difficult, because lichens contain high proteins, polysaccharides, and other complex compounds in their cell walls. Here we report a rapid, easy, and inexpensive protocol for extracting PCR-quality DNA from various lichen species. This method involves the following two steps: first, cell breakage using a beadbeater; and second, extraction, isolation, and precipitation of genomic DNA. The procedure requires approximately 10 mg of lichen thalli and can be completed within 20 min. The obtained DNAs were of sufficient quality and quantity to amplify the internal transcribed spacer region from the fungal and algal lichen components, as well as to sequence the amplified products. In addition, 26 different lichen taxa were tested, resulting in successful PCR products. The results of this study validated the experimental protocols, and clearly demonstrated the efficacy and value of our KCl extraction method applied in the fungal and algal samples.

  15. Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Ellis David

    2009-08-01

    Full Text Available Abstract Background Amino acid substitutions in the target enzyme Erg11p of azole antifungals contribute to clinically-relevant azole resistance in Candida albicans. A simple molecular method for rapid detection of ERG11 gene mutations would be an advantage as a screening tool to identify potentially-resistant strains and to track their movement. To complement DNA sequencing, we developed a padlock probe and rolling circle amplification (RCA-based method to detect a series of mutations in the C. albicans ERG11 gene using "reference" azole-resistant isolates with known mutations. The method was then used to estimate the frequency of ERG11 mutations and their type in 25 Australian clinical C. albicans isolates with reduced susceptibility to fluconazole and in 23 fluconazole-susceptible isolates. RCA results were compared DNA sequencing. Results The RCA assay correctly identified all ERG11 mutations in eight "reference" C. albicans isolates. When applied to 48 test strains, the RCA method showed 100% agreement with DNA sequencing where an ERG11 mutation-specific probe was used. Of 20 different missense mutations detected by sequencing in 24 of 25 (96% isolates with reduced fluconazole susceptibility, 16 were detected by RCA. Five missense mutations were detected by both methods in 18 of 23 (78% fluconazole-susceptible strains. DNA sequencing revealed that mutations in non-susceptible isolates were all due to homozygous nucleotide changes. With the exception of the mutations leading to amino acid substitution E266D, those in fluconazole-susceptible strains were heterozygous. Amino acid substitutions common to both sets of isolates were D116E, E266D, K128T, V437I and V488I. Substitutions unique to isolates with reduced fluconazole susceptibility were G464 S (n = 4 isolates, G448E (n = 3, G307S (n = 3, K143R (n = 3 and Y123H, S405F and R467K (each n = 1. DNA sequencing revealed a novel substitution, G450V, in one isolate. Conclusion The sensitive RCA

  16. Open microfluidic gel electrophoresis: Rapid and low cost separation and analysis of DNA at the nanoliter scale.

    Science.gov (United States)

    Gutzweiler, Ludwig; Gleichmann, Tobias; Tanguy, Laurent; Koltay, Peter; Zengerle, Roland; Riegger, Lutz

    2017-07-01

    Gel electrophoresis is one of the most applied and standardized tools for separation and analysis of macromolecules and their fragments in academic research and in industry. In this work we present a novel approach for conducting on-demand electrophoretic separations of DNA molecules in open microfluidic (OM) systems on planar polymer substrates. The approach combines advantages of slab gel, capillary- and chip-based methods offering low consumable costs (<0.1$) circumventing cost-intensive microfluidic chip fabrication, short process times (5 min per analysis) and high sensitivity (4 ng/μL dsDNA) combined with reasonable resolution (17 bases). The open microfluidic separation system comprises two opposing reservoirs of 2-4 μL in volume, a semi-contact written gel line acting as separation channel interconnecting the reservoirs and sample injected into the line via non-contact droplet dispensing and thus enabling the precise control of the injection plug and sample concentration. Evaporation is prevented by covering aqueous structures with PCR-grade mineral oil while maintaining surface temperature at 15°C. The liquid gel line exhibits a semi-circular cross section of adaptable width (∼200-600 μm) and height (∼30-80 μm) as well as a typical length of 15-55 mm. Layout of such liquid structures is adaptable on-demand not requiring time consuming and repetitive fabrication steps. The approach was successfully demonstrated by the separation of a standard label-free DNA ladder (100-1000 bp) at 100 V/cm via in-line staining and laser induced fluorescent end-point detection using an automated prototype. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Optofluidics-based DNA structure-competitive aptasensor for rapid on-site detection of lead(II) in an aquatic environment.

    Science.gov (United States)

    Long, Feng; Zhu, Anna; Wang, Hongchen

    2014-11-07

    Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Rapid One-Step Selection Method for Generating Nucleic Acid Aptamers: Development of a DNA Aptamer against alpha-Bungarotoxin

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Shamaileh, Hadi A.; Edwards, Stacey L.

    2012-01-01

    Background: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen (R), an inhibitor of vascular endothelial growth factor (VEGF......) for the treatment of age related macular degeneration (AMD). Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly...... in one-step, technique is required for developing aptamers in limited time period. Principal Findings: Herein, we present a simple one-step selection of DNA aptamers against alpha-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed...

  19. Mentoring: An Evolving Relationship.

    Science.gov (United States)

    Block, Michelle; Florczak, Kristine L

    2017-04-01

    The column concerns itself with mentoring as an evolving relationship between mentor and mentee. The collegiate mentoring model, the transformational transcendence model, and the humanbecoming mentoring model are considered in light of a dialogue with mentors at a Midwest university and conclusions are drawn.

  20. Methods Evolved by Observation

    Science.gov (United States)

    Montessori, Maria

    2016-01-01

    Montessori's idea of the child's nature and the teacher's perceptiveness begins with amazing simplicity, and when she speaks of "methods evolved," she is unveiling a methodological system for observation. She begins with the early childhood explosion into writing, which is a familiar child phenomenon that Montessori has written about…

  1. Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

    Science.gov (United States)

    Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

    2015-01-01

    Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and

  2. EVOLVE 2014 International Conference

    CERN Document Server

    Tantar, Emilia; Sun, Jian-Qiao; Zhang, Wei; Ding, Qian; Schütze, Oliver; Emmerich, Michael; Legrand, Pierrick; Moral, Pierre; Coello, Carlos

    2014-01-01

    This volume encloses research articles that were presented at the EVOLVE 2014 International Conference in Beijing, China, July 1–4, 2014.The book gathers contributions that emerged from the conference tracks, ranging from probability to set oriented numerics and evolutionary computation; all complemented by the bridging purpose of the conference, e.g. Complex Networks and Landscape Analysis, or by the more application oriented perspective. The novelty of the volume, when considering the EVOLVE series, comes from targeting also the practitioner’s view. This is supported by the Machine Learning Applied to Networks and Practical Aspects of Evolutionary Algorithms tracks, providing surveys on new application areas, as in the networking area and useful insights in the development of evolutionary techniques, from a practitioner’s perspective. Complementary to these directions, the conference tracks supporting the volume, follow on the individual advancements of the subareas constituting the scope of the confe...

  3. Evolving Procurement Organizations

    DEFF Research Database (Denmark)

    Bals, Lydia; Laine, Jari; Mugurusi, Godfrey

    Procurement has to find further levers and advance its contribution to corporate goals continuously. This places pressure on its organization in order to facilitate its performance. Therefore, procurement organizations constantly have to evolve in order to match these demands. A conceptual model...... and external contingency factors and having a more detailed look at the structural dimensions chosen, beyond the well-known characteristics of centralization, formalization, participation, specialization, standardization and size. From a theoretical perspective, it opens up insights that can be leveraged...

  4. Symbiotic Composition and Evolvability

    OpenAIRE

    Watson, Richard A.; Pollack, Jordan B.

    2001-01-01

    Several of the Major Transitions in natural evolution, such as the symbiogenic origin of eukaryotes from prokaryotes, share the feature that existing entities became the components of composite entities at a higher level of organisation. This composition of pre-adapted extant entities into a new whole is a fundamentally different source of variation from the gradual accumulation of small random variations, and it has some interesting consequences for issues of evolvability. In this paper we p...

  5. Evolvable Neural Software System

    Science.gov (United States)

    Curtis, Steven A.

    2009-01-01

    The Evolvable Neural Software System (ENSS) is composed of sets of Neural Basis Functions (NBFs), which can be totally autonomously created and removed according to the changing needs and requirements of the software system. The resulting structure is both hierarchical and self-similar in that a given set of NBFs may have a ruler NBF, which in turn communicates with other sets of NBFs. These sets of NBFs may function as nodes to a ruler node, which are also NBF constructs. In this manner, the synthetic neural system can exhibit the complexity, three-dimensional connectivity, and adaptability of biological neural systems. An added advantage of ENSS over a natural neural system is its ability to modify its core genetic code in response to environmental changes as reflected in needs and requirements. The neural system is fully adaptive and evolvable and is trainable before release. It continues to rewire itself while on the job. The NBF is a unique, bilevel intelligence neural system composed of a higher-level heuristic neural system (HNS) and a lower-level, autonomic neural system (ANS). Taken together, the HNS and the ANS give each NBF the complete capabilities of a biological neural system to match sensory inputs to actions. Another feature of the NBF is the Evolvable Neural Interface (ENI), which links the HNS and ANS. The ENI solves the interface problem between these two systems by actively adapting and evolving from a primitive initial state (a Neural Thread) to a complicated, operational ENI and successfully adapting to a training sequence of sensory input. This simulates the adaptation of a biological neural system in a developmental phase. Within the greater multi-NBF and multi-node ENSS, self-similar ENI s provide the basis for inter-NBF and inter-node connectivity.

  6. [Application of DNA-based electrochemical biosensor in rapid detection of Escherichia coli exist in licorice decoction].

    Science.gov (United States)

    Zhao, Yu-Wen; Wang, Hai-Xia; Bie, Song-Tao; Shao, Qian; Wang, Chun-Hua; Wang, Dong-Heng; Li, Zheng

    2018-03-01

    A new method for detection of Escherichia coli exist in licorice decoction was developed by using DNA-based electrochemical biosensor. The thiolated capture probe was immobilized on a gold electrode at first. Then the aptamer for Escherichia coli was combined with the capture probe by hybridization. Due to the stronger interaction between the aptamer and the E. coli, the aptamer can dissociate from the capture probe in the presence of E. coli in licorice decoction. The biotinylated detection probe was hybridized with the single-strand capture probe. As a result, the electrochemical response to Escherichia coli can be measured by using differential pulse voltammetric in the presence of α-naphthyl phosphate. The plot of peak current vs. the logarithm of concentration in the range from 2.7×10² to 2.7×10⁸ CFU·mL⁻¹ displayed a linear relationship with a detection limit of 50 CFU·mL⁻¹. The relative standard deviation of 3 successive scans was 2.5%,2.1%,4.6% for 2×10²,2×10⁴,2×106:⁶ CFU·mL⁻¹ E. coli, respectively. The proposed procedure showed better specificity to E. coli in comparison to Pseudomonas aeruginosa, Staphylococcus aureus and Bacillus subtilis. In the detection of the real extractum glycyrrhizae, the results between the proposed strategy and the GB assay showed high degree of agreement, demonstrating the designed biosensor could be utilized as a powerful tool for microbial examination for traditional Chinese medicine. Copyright© by the Chinese Pharmaceutical Association.

  7. Evolved H II regions

    International Nuclear Information System (INIS)

    Churchwell, E.

    1975-01-01

    A probable evolutionary sequence of H II regions based on six distinct types of observed objects is suggested. Two examples which may deviate from this idealized sequence, are discussed. Even though a size-mean density relation of H II regions can be used as a rough indication of whether a nebula is very young or evolved, it is argued that such a relation is not likely to be useful for the quantitative assignment of ages to H II regions. Evolved H II regions appear to fit into one of four structural types: rings, core-halos, smooth structures, and irregular or filamentary structures. Examples of each type are given with their derived physical parameters. The energy balance in these nebulae is considered. The mass of ionized gas in evolved H II regions is in general too large to trace the nebula back to single compact H II regions. Finally, the morphological type of the Galaxy is considered from its H II region content. 2 tables, 2 figs., 29 refs

  8. Rapid Recruitment of BRCA1 to DNA Double-Strand Breaks Is Dependent on Its Association with Ku80▿ †

    Science.gov (United States)

    Wei, Leizhen; Lan, Li; Hong, Zehui; Yasui, Akira; Ishioka, Chikashi; Chiba, Natsuko

    2008-01-01

    BRCA1 is the first susceptibility gene to be linked to breast and ovarian cancers. Although mounting evidence has indicated that BRCA1 participates in DNA double-strand break (DSB) repair pathways, its precise mechanism is still unclear. Here, we analyzed the in situ response of BRCA1 at DSBs produced by laser microirradiation. The amino (N)- and carboxyl (C)-terminal fragments of BRCA1 accumulated independently at DSBs with distinct kinetics. The N-terminal BRCA1 fragment accumulated immediately after laser irradiation at DSBs and dissociated rapidly. In contrast, the C-terminal fragment of BRCA1 accumulated more slowly at DSBs but remained at the sites. Interestingly, rapid accumulation of the BRCA1 N terminus, but not the C terminus, at DSBs depended on Ku80, which functions in the nonhomologous end-joining (NHEJ) pathway, independently of BARD1, which binds to the N terminus of BRCA1. Two small regions in the N terminus of BRCA1 independently accumulated at DSBs and interacted with Ku80. Missense mutations found within the N terminus of BRCA1 in cancers significantly changed the kinetics of its accumulation at DSBs. A P142H mutant failed to associate with Ku80 and restore resistance to irradiation in BRCA1-deficient cells. These might provide a molecular basis of the involvement of BRCA1 in the NHEJ pathway of the DSB repair process. PMID:18936166

  9. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Science.gov (United States)

    Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

    2016-01-01

    Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.

  10. Rapid MCNP simulation of DNA double strand break (DSB) relative biological effectiveness (RBE) for photons, neutrons, and light ions.

    Science.gov (United States)

    Stewart, Robert D; Streitmatter, Seth W; Argento, David C; Kirkby, Charles; Goorley, John T; Moffitt, Greg; Jevremovic, Tatjana; Sandison, George A

    2015-11-07

    To account for particle interactions in the extracellular (physical) environment, information from the cell-level Monte Carlo damage simulation (MCDS) for DNA double strand break (DSB) induction has been integrated into the general purpose Monte Carlo N-particle (MCNP) radiation transport code system. The effort to integrate these models is motivated by the need for a computationally efficient model to accurately predict particle relative biological effectiveness (RBE) in cell cultures and in vivo. To illustrate the approach and highlight the impact of the larger scale physical environment (e.g. establishing charged particle equilibrium), we examined the RBE for DSB induction (RBEDSB) of x-rays, (137)Cs γ-rays, neutrons and light ions relative to γ-rays from (60)Co in monolayer cell cultures at various depths in water. Under normoxic conditions, we found that (137)Cs γ-rays are about 1.7% more effective at creating DSB than γ-rays from (60)Co (RBEDSB  =  1.017) whereas 60-250 kV x-rays are 1.1 to 1.25 times more efficient at creating DSB than (60)Co. Under anoxic conditions, kV x-rays may have an RBEDSB up to 1.51 times as large as (60)Co γ-rays. Fission neutrons passing through monolayer cell cultures have an RBEDSB that ranges from 2.6 to 3.0 in normoxic cells, but may be as large as 9.93 for anoxic cells. For proton pencil beams, Monte Carlo simulations suggest an RBEDSB of about 1.2 at the tip of the Bragg peak and up to 1.6 a few mm beyond the Bragg peak. Bragg peak RBEDSB increases with decreasing oxygen concentration, which may create opportunities to apply proton dose painting to help address tumor hypoxia. Modeling of the particle RBE for DSB induction across multiple physical and biological scales has the potential to aid in the interpretation of laboratory experiments and provide useful information to advance the safety and effectiveness of hadron therapy in the treatment of cancer.

  11. Rapid divergence of histones in Hydrozoa (Cnidaria) and evolution of a novel histone involved in DNA damage response in hydra.

    Science.gov (United States)

    Reddy, Puli Chandramouli; Ubhe, Suyog; Sirwani, Neha; Lohokare, Rasika; Galande, Sanjeev

    2017-08-01

    Histones are fundamental components of chromatin in all eukaryotes. Hydra, an emerging model system belonging to the basal metazoan phylum Cnidaria, provides an ideal platform to understand the evolution of core histone components at the base of eumetazoan phyla. Hydra exhibits peculiar properties such as tremendous regenerative capacity, lack of organismal senescence and rarity of malignancy. In light of the role of histone modifications and histone variants in these processes it is important to understand the nature of histones themselves and their variants in hydra. Here, we report identification of the complete repertoire of histone-coding genes in the Hydra magnipapillata genome. Hydra histones were classified based on their copy numbers, gene structure and other characteristic features. Genomic organization of canonical histone genes revealed the presence of H2A-H2B and H3-H4 paired clusters in high frequency and also a cluster with all core histones along with H1. Phylogenetic analysis of identified members of H2A and H2B histones suggested rapid expansion of these groups in Hydrozoa resulting in the appearance of unique subtypes. Amino acid sequence level comparisons of H2A and H2B forms with bilaterian counterparts suggest the possibility of a highly mobile nature of nucleosomes in hydra. Absolute quantitation of transcripts confirmed the high copy number of histones and supported the canonical nature of H2A. Furthermore, functional characterization of H2A.X.1 and a unique variant H2A.X.2 in the gastric region suggest their role in the maintenance of genome integrity and differentiation processes. These findings provide insights into the evolution of histones and their variants in hydra. Copyright © 2017 Elsevier GmbH. All rights reserved.

  12. Rapid response to an emerging infectious disease - Lessons learned from development of a synthetic DNA vaccine targeting Zika virus.

    Science.gov (United States)

    Kudchodkar, Sagar B; Choi, Hyeree; Reuschel, Emma L; Esquivel, Rianne; Jin-Ah Kwon, Jackie; Jeong, Moonsup; Maslow, Joel N; Reed, Charles C; White, Scott; Kim, J Joseph; Kobinger, Gary P; Tebas, Pablo; Weiner, David B; Muthumani, Kar

    2018-03-17

    Vaccines are considered one of the greatest advances in modern medicine. The global burden of numerous infectious diseases has been significantly reduced, and in some cases, effectively eradicated through the deployment of specific vaccines. However, efforts to develop effective new vaccines against infectious pathogens such as influenza, Human immunodeficiency virus (HIV), dengue virus (DENV), chikungunya virus (CHIKV), Ebola virus, and Zika virus (ZIKV) have proven challenging. Zika virus is a mosquito-vectored flavivirus responsible for periodic outbreaks of disease in Africa, Southeast Asia, and the Pacific Islands dating back over 50 years. Over this period, ZIKV infections were subclinical in most infected individuals and resulted in mild cases of fever, arthralgia, and rash in others. Concerns about ZIKV changed over the past two years, however, as outbreaks in Brazil, Central American countries, and Caribbean islands revealed novel aspects of infection including vertical and sexual transmission modes. Cases have been reported showing dramatic neurological pathologies including microcephaly and other neurodevelopmental problems in babies born to ZIKV infected mothers, as well as an increased risk of Guillain-Barre syndrome in adults. These findings prompted the World Health Organization to declare ZIKV a public health emergency in 2016, which resulted in expanded efforts to develop ZIKV vaccines and immunotherapeutics. Several ZIKV vaccine candidates that are immunogenic and effective at blocking ZIKV infection in animal models have since been developed, with some of these now being evaluated in the clinic. Additional therapeutics under investigation include anti-ZIKV monoclonal antibodies (mAbs) that have been shown to neutralize infection in vitro as well as protect against morbidity in mouse models of ZIKV infection. In this review, we summarize the current understanding of ZIKV biology and describe our efforts to rapidly develop a vaccine against ZIKV

  13. MALDI-TOF MS performance compared to direct examination, culture, and 16S rDNA PCR for the rapid diagnosis of bone and joint infections.

    Science.gov (United States)

    Lallemand, E; Coiffier, G; Arvieux, C; Brillet, E; Guggenbuhl, P; Jolivet-Gougeon, A

    2016-05-01

    The rapid identification of bacterial species involved in bone and joint infections (BJI) is an important element to optimize the diagnosis and care of patients. The aim of this study was to evaluate the usefulness of matrix-assisted laser desorption ionization mass spectrometry (MALDI-TOF MS) for the rapid diagnosis of bone infections, directly on synovial fluid (SF) or on crushed osteoarticular samples (CS). From January to October 2013, we prospectively analyzed 111 osteoarticular samples (bone and joint samples, BJS) from 78 patients in care at the University Hospital of Rennes, France. The diagnosis procedure leading to the sample collection was linked to a suspicion of infection, inflammatory disease, arthritis, or for any bone or joint abnormalities. Standard bacteriological diagnosis and molecular biology analysis [16S rRNA polymerase chain reaction (PCR) and sequencing] were conducted. In addition, analysis by MALDI-TOF MS was performed directly on the osteoarticular samples, as soon as the amount allowed. Culture, which remains the gold standard for the diagnosis of BJI, has the highest sensitivity (85.9 %) and remains necessary to test antimicrobial susceptibility. The 16S rDNA PCR results were positive in the group with positive BJI (28.6 %) and negative in the group without infection. Direct examination remains insensitive (31.7 %) but more effective than MALDI-TOF MS directly on the sample (6.3 %). The specificity was 100 % in all cases, except for culture (74.5 %). Bacterial culture remains the gold standard, especially enrichment in blood bottles. Direct analysis of bone samples with MALDI-TOF MS is not useful, possibly due to the low inoculum of BJS.

  14. Evolving Procurement Organizations

    DEFF Research Database (Denmark)

    Bals, Lydia; Laiho, Aki; Laine, Jari

    Procurement has to find further levers and advance its contribution to corporate goals continuously. This places pressure on its organization in order to facilitate its performance. Therefore, Procurement organizations constantly have to evolve in order to match these demands. A conceptual model...... is presented and results of a first case study discussed. The findings highlight the importance of taking a contingency perspective on Procurement organization, understanding the internal and internal contingency factors. From a theoretical perspective, it opens up insights that can be furthermore leveraged...... in future studies in the fields of hybrid procurement organizations, global sourcing organizations as well as international procurement offices (IPOs). From a practical standpoint, an assessment of external and internal contingencies provides the opportunity to consciously match organization to its...

  15. Diffusion between evolving interfaces

    International Nuclear Information System (INIS)

    Juntunen, Janne; Merikoski, Juha

    2010-01-01

    Diffusion in an evolving environment is studied by continuous-time Monte Carlo simulations. Diffusion is modeled by continuous-time random walkers on a lattice, in a dynamic environment provided by bubbles between two one-dimensional interfaces driven symmetrically towards each other. For one-dimensional random walkers constrained by the interfaces, the bubble size distribution dominates diffusion. For two-dimensional random walkers, it is also controlled by the topography and dynamics of the interfaces. The results of the one-dimensional case are recovered in the limit where the interfaces are strongly driven. Even with simple hard-core repulsion between the interfaces and the particles, diffusion is found to depend strongly on the details of the dynamical rules of particles close to the interfaces.

  16. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting.

    Science.gov (United States)

    Rashed-Ul Islam, S M; Jahan, Munira; Tabassum, Shahina

    2015-01-01

    Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 10 3 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 10 3 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15.

  17. Genome-wide DNA methylation alterations of Alternanthera philoxeroides in natural and manipulated habitats: implications for epigenetic regulation of rapid responses to environmental fluctuation and phenotypic variation.

    Science.gov (United States)

    Gao, Lexuan; Geng, Yupeng; Li, Bo; Chen, Jiakuan; Yang, Ji

    2010-11-01

    Alternanthera philoxeroides (alligator weed) is an invasive weed that can colonize both aquatic and terrestrial habitats. Individuals growing in different habitats exhibit extensive phenotypic variation but little genetic differentiation in its introduced range. The mechanisms underpinning the wide range of phenotypic variation and rapid adaptation to novel and changing environments remain uncharacterized. In this study, we examined the epigenetic variation and its correlation with phenotypic variation in plants exposed to natural and manipulated environmental variability. Genome-wide methylation profiling using methylation-sensitive amplified fragment length polymorphism (MSAP) revealed considerable DNA methylation polymorphisms within and between natural populations. Plants of different source populations not only underwent significant morphological changes in common garden environments, but also underwent a genome-wide epigenetic reprogramming in response to different treatments. Methylation alterations associated with response to different water availability were detected in 78.2% (169/216) of common garden induced polymorphic sites, demonstrating the environmental sensitivity and flexibility of the epigenetic regulatory system. These data provide evidence of the correlation between epigenetic reprogramming and the reversible phenotypic response of alligator weed to particular environmental factors. © 2010 Blackwell Publishing Ltd.

  18. Rapid Convergence of Energy and Free Energy Profiles with Quantum Mechanical Size in Quantum Mechanical-Molecular Mechanical Simulations of Proton Transfer in DNA.

    Science.gov (United States)

    Das, Susanta; Nam, Kwangho; Major, Dan Thomas

    2018-03-13

    In recent years, a number of quantum mechanical-molecular mechanical (QM/MM) enzyme studies have investigated the dependence of reaction energetics on the size of the QM region using energy and free energy calculations. In this study, we revisit the question of QM region size dependence in QM/MM simulations within the context of energy and free energy calculations using a proton transfer in a DNA base pair as a test case. In the simulations, the QM region was treated with a dispersion-corrected AM1/d-PhoT Hamiltonian, which was developed to accurately describe phosphoryl and proton transfer reactions, in conjunction with an electrostatic embedding scheme using the particle-mesh Ewald summation method. With this rigorous QM/MM potential, we performed rather extensive QM/MM sampling, and found that the free energy reaction profiles converge rapidly with respect to the QM region size within ca. ±1 kcal/mol. This finding suggests that the strategy of QM/MM simulations with reasonably sized and selected QM regions, which has been employed for over four decades, is a valid approach for modeling complex biomolecular systems. We point to possible causes for the sensitivity of the energy and free energy calculations to the size of the QM region, and potential implications.

  19. Accurate and rapid modeling of iron-bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis.

    Science.gov (United States)

    Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P

    2000-05-01

    Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.

  20. Rapid classification of turmeric based on DNA fingerprint by near-infrared spectroscopy combined with moving window partial least squares-discrimination analysis

    International Nuclear Information System (INIS)

    Kasemsumran, Sumaporn; Suttiwijitpukdee, Nattaporn; Keeratinijakal, Vichein

    2017-01-01

    In this research, near-infrared (NIR) spectroscopy in combination with moving window partial least squares-discrimination analysis (MWPLS-DA) was utilized to discriminate the variety of turmeric based on DNA markers, which correlated to the quantity of curcuminoid. Curcuminoid was used as a marker compound in variety identification due to the most pharmacological properties of turmeric possessed from it. MWPLS-DA optimized informative NIR spectral regions for the fitting and prediction to {-1/1}-coded turmeric varieties, indicating variables in the development of latent variables in discrimination analysis. Consequently, MWPLS-DA benefited in the selection of combined informative NIR spectral regions of 1100 – 1260, 1300 – 1500 and 1880 – 2500 nm for classification modeling of turmeric variety with 148 calibration samples, and yielded the results better than that obtained from a partial least squares-discrimination analysis (PLS-DA) model built by using the whole NIR spectral region. An effective and rapid strategy of using NIR in combination with MWPLS-DA provided the best variety identification results of 100% in both specificity and total accuracy for 48 test samples. (author)

  1. Rapid genotyping with DNA micro-arrays for high-density linkage mapping and QTL mapping in common buckwheat (Fagopyrum esculentum Moench)

    Science.gov (United States)

    Yabe, Shiori; Hara, Takashi; Ueno, Mariko; Enoki, Hiroyuki; Kimura, Tatsuro; Nishimura, Satoru; Yasui, Yasuo; Ohsawa, Ryo; Iwata, Hiroyoshi

    2014-01-01

    For genetic studies and genomics-assisted breeding, particularly of minor crops, a genotyping system that does not require a priori genomic information is preferable. Here, we demonstrated the potential of a novel array-based genotyping system for the rapid construction of high-density linkage map and quantitative trait loci (QTL) mapping. By using the system, we successfully constructed an accurate, high-density linkage map for common buckwheat (Fagopyrum esculentum Moench); the map was composed of 756 loci and included 8,884 markers. The number of linkage groups converged to eight, which is the basic number of chromosomes in common buckwheat. The sizes of the linkage groups of the P1 and P2 maps were 773.8 and 800.4 cM, respectively. The average interval between adjacent loci was 2.13 cM. The linkage map constructed here will be useful for the analysis of other common buckwheat populations. We also performed QTL mapping for main stem length and detected four QTL. It took 37 days to process 178 samples from DNA extraction to genotyping, indicating the system enables genotyping of genome-wide markers for a few hundred buckwheat plants before the plants mature. The novel system will be useful for genomics-assisted breeding in minor crops without a priori genomic information. PMID:25914583

  2. Evaluation of powdery mildew-resistance of grape germplasm and rapid amplified polymorphic DNA markers associated with the resistant trait in Chinese wild Vitis.

    Science.gov (United States)

    Zhang, J; Zhang, Y; Yu, H; Wang, Y

    2014-05-09

    The resistance of wild Vitis germplasm, including Chinese and American wild Vitis and Vitis vinifera cultivars, to powdery mildew (Uncinula necator Burr.) was evaluated for two consecutive years under natural conditions. Most of the Chinese and North American species displayed a resistant phenotype, whereas all of the European species were highly susceptible. The Alachua and Conquistador accessions of Vitis rotundifolia species, which originated in North America, were immune to the disease, while Baihe-35-1, one of the accessions of Vitis pseudoreticulata, showed the strongest resistance among all Chinese accessions evaluated. Three rapid amplified polymorphic DNA (RAPD) markers, OPW02-1756, OPO11-964, and OPY13-661, were obtained after screening 520 random primers among various germplasm, and these markers were found to be associated with powdery mildew resistance in Baihe-35-1 and in some Chinese species, but not in any European species. Analysis of F₁ and F₂ progenies of a cross between resistant Baihe-35-1 and susceptible Carignane (V. vinifera) revealed that the three RAPD markers were linked to the powdery resistant trait in Baihe-35-1 plants. Potential applications of the identified RAPD markers for gene mapping, marker-assisted selection, and breeding were investigated in 168 F₂ progenies of the same cross. Characterization of the resistant phenotype of the selected F₂ seedlings for breeding a new disease-resistant grape cultivar is in progress.

  3. Why did heterospory evolve?

    Science.gov (United States)

    Petersen, Kurt B; Burd, Martin

    2017-08-01

    The primitive land plant life cycle featured the production of spores of unimodal size, a condition called homospory. The evolution of bimodal size distributions with small male spores and large female spores, known as heterospory, was an innovation that occurred repeatedly in the history of land plants. The importance of desiccation-resistant spores for colonization of the land is well known, but the adaptive value of heterospory has never been well established. It was an addition to a sexual life cycle that already involved male and female gametes. Its role as a precursor to the evolution of seeds has received much attention, but this is an evolutionary consequence of heterospory that cannot explain the transition from homospory to heterospory (and the lack of evolutionary reversal from heterospory to homospory). Enforced outcrossing of gametophytes has often been mentioned in connection to heterospory, but we review the shortcomings of this argument as an explanation of the selective advantage of heterospory. Few alternative arguments concerning the selective forces favouring heterospory have been proposed, a paucity of attention that is surprising given the importance of this innovation in land plant evolution. In this review we highlight two ideas that may lead us to a better understanding of why heterospory evolved. First, models of optimal resource allocation - an approach that has been used for decades in evolutionary ecology to help understand parental investment and other life-history patterns - suggest that an evolutionary increase in spore size could reach a threshold at which small spores yielding small, sperm-producing gametophytes would return greater fitness per unit of resource investment than would large spores and bisexual gametophytes. With the advent of such microspores, megaspores would evolve under frequency-dependent selection. This argument can account for the appearance of heterospory in the Devonian, when increasingly tall and complex

  4. Assessing SfM-Photogrammetry potential at micro-scale on a rapidly evolving mud-bank: case study on a mesocosm study within pioneer mangroves in French Guiana (South America)

    Science.gov (United States)

    Fleury, Jules; Brunier, Guillaume; Michaud, Emma; Anthony, Edward; Dussouillez, Philippe; Morvan, Sylvain

    2016-04-01

    Mud banks are the loci of rich bio-geo-chemical processes occuring rapidly at infra-tide frequency. Their surface topography is commonly affected by many of these processes, including bioturbation, water drainage or dessication. Quantifying surface morphology and changes on a mud bank at the micro-scale is a challenging task due to a number of issues. First, the water-saturated nature of the soil makes it difficult to measure High Resolution Topography (HRT) with classical methods. Second, setting up an instrumented experiment without disrupting the signal being studied is hardly achieved at micro-scale. Finally, the highly mobile nature of this environment enhancing strong spatio-temporal heterogeneity is hard to capture. Terrestrial Laser Scanning (TLS) and SfM (Surface from Motion)-Photogrammetry are two techniques that enable mapping of micro-scale features, but the first technique is not suitable because of the poor quality of the backscattered laser signal on wet surfaces and the need to set up several measuring stations on a complex, unstable substrate. Thus, we set up an experiment to assess the feasibility and the accuracy of SfM in such a context. We took the opportunity of the installation of a pontoon dedicated to the study of bio-geochemical processes within benthic mesocosms installed on a mud bank inhabited by pioneer mangroves trees to develop an adapted photogrammetry protocol based on a full-frame remotely triggered camera sensor mounted on a pole. The incident light on the surface was also controlled with a light-diffusing device. We obtained sub-millimetric resolution 3D-topography and visible imagery. Surveys were carried out every 2 hours at low tide to detect surface changes due to water content variation as well as bioturbation mainly caused by crabs digging galleries and feeding on sediment surface. Both the qualitative and quantitative results seem very promising and lead us to expect new insights into heterogeneous surface processes on a

  5. Evolving Capabilities for Virtual Globes

    Science.gov (United States)

    Glennon, A.

    2006-12-01

    Though thin-client spatial visualization software like Google Earth and NASA World Wind enjoy widespread popularity, a common criticism is their general lack of analytical functionality. This concern, however, is rapidly being addressed; standard and advanced geographic information system (GIS) capabilities are being developed for virtual globes--though not centralized into a single implementation or software package. The innovation is mostly originating from the user community. Three such capabilities relevant to the earth science, education, and emergency management communities are modeling dynamic spatial phenomena, real-time data collection and visualization, and multi-input collaborative databases. Modeling dynamic spatial phenomena has been facilitated through joining virtual globe geometry definitions--like KML--to relational databases. Real-time data collection uses short scripts to transform user-contributed data into a format usable by virtual globe software. Similarly, collaborative data collection for virtual globes has become possible by dynamically referencing online, multi-person spreadsheets. Examples of these functions include mapping flows within a karst watershed, real-time disaster assessment and visualization, and a collaborative geyser eruption spatial decision support system. Virtual globe applications will continue to evolve further analytical capabilities, more temporal data handling, and from nano to intergalactic scales. This progression opens education and research avenues in all scientific disciplines.

  6. Evolving a photosynthetic organelle

    Directory of Open Access Journals (Sweden)

    Nakayama Takuro

    2012-04-01

    Full Text Available Abstract The evolution of plastids from cyanobacteria is believed to represent a singularity in the history of life. The enigmatic amoeba Paulinella and its 'recently' acquired photosynthetic inclusions provide a fascinating system through which to gain fresh insight into how endosymbionts become organelles. The plastids, or chloroplasts, of algae and plants evolved from cyanobacteria by endosymbiosis. This landmark event conferred on eukaryotes the benefits of photosynthesis - the conversion of solar energy into chemical energy - and in so doing had a huge impact on the course of evolution and the climate of Earth 1. From the present state of plastids, however, it is difficult to trace the evolutionary steps involved in this momentous development, because all modern-day plastids have fully integrated into their hosts. Paulinella chromatophora is a unicellular eukaryote that bears photosynthetic entities called chromatophores that are derived from cyanobacteria and has thus received much attention as a possible example of an organism in the early stages of organellogenesis. Recent studies have unlocked the genomic secrets of its chromatophore 23 and provided concrete evidence that the Paulinella chromatophore is a bona fide photosynthetic organelle 4. The question is how Paulinella can help us to understand the process by which an endosymbiont is converted into an organelle.

  7. Fat: an evolving issue

    Directory of Open Access Journals (Sweden)

    John R. Speakman

    2012-09-01

    Work on obesity is evolving, and obesity is a consequence of our evolutionary history. In the space of 50 years, we have become an obese species. The reasons why can be addressed at a number of different levels. These include separating between whether the primary cause lies on the food intake or energy expenditure side of the energy balance equation, and determining how genetic and environmental effects contribute to weight variation between individuals. Opinion on whether increased food intake or decreased energy expenditure drives the obesity epidemic is still divided, but recent evidence favours the idea that food intake, rather than altered expenditure, is most important. There is more of a consensus that genetics explains most (probably around 65% of weight variation between individuals. Recent advances in genome-wide association studies have identified many polymorphisms that are linked to obesity, yet much of the genetic variance remains unexplained. Finding the causes of this unexplained variation will be an impetus of genetic and epigenetic research on obesity over the next decade. Many environmental factors – including gut microbiota, stress and endocrine disruptors – have been linked to the risk of developing obesity. A better understanding of gene-by-environment interactions will also be key to understanding obesity in the years to come.

  8. Evolving a photosynthetic organelle.

    Science.gov (United States)

    Nakayama, Takuro; Archibald, John M

    2012-04-24

    The evolution of plastids from cyanobacteria is believed to represent a singularity in the history of life. The enigmatic amoeba Paulinella and its 'recently' acquired photosynthetic inclusions provide a fascinating system through which to gain fresh insight into how endosymbionts become organelles.The plastids, or chloroplasts, of algae and plants evolved from cyanobacteria by endosymbiosis. This landmark event conferred on eukaryotes the benefits of photosynthesis--the conversion of solar energy into chemical energy--and in so doing had a huge impact on the course of evolution and the climate of Earth 1. From the present state of plastids, however, it is difficult to trace the evolutionary steps involved in this momentous development, because all modern-day plastids have fully integrated into their hosts. Paulinella chromatophora is a unicellular eukaryote that bears photosynthetic entities called chromatophores that are derived from cyanobacteria and has thus received much attention as a possible example of an organism in the early stages of organellogenesis. Recent studies have unlocked the genomic secrets of its chromatophore 23 and provided concrete evidence that the Paulinella chromatophore is a bona fide photosynthetic organelle 4. The question is how Paulinella can help us to understand the process by which an endosymbiont is converted into an organelle.

  9. Communicability across evolving networks.

    Science.gov (United States)

    Grindrod, Peter; Parsons, Mark C; Higham, Desmond J; Estrada, Ernesto

    2011-04-01

    Many natural and technological applications generate time-ordered sequences of networks, defined over a fixed set of nodes; for example, time-stamped information about "who phoned who" or "who came into contact with who" arise naturally in studies of communication and the spread of disease. Concepts and algorithms for static networks do not immediately carry through to this dynamic setting. For example, suppose A and B interact in the morning, and then B and C interact in the afternoon. Information, or disease, may then pass from A to C, but not vice versa. This subtlety is lost if we simply summarize using the daily aggregate network given by the chain A-B-C. However, using a natural definition of a walk on an evolving network, we show that classic centrality measures from the static setting can be extended in a computationally convenient manner. In particular, communicability indices can be computed to summarize the ability of each node to broadcast and receive information. The computations involve basic operations in linear algebra, and the asymmetry caused by time's arrow is captured naturally through the noncommutativity of matrix-matrix multiplication. Illustrative examples are given for both synthetic and real-world communication data sets. We also discuss the use of the new centrality measures for real-time monitoring and prediction.

  10. Evolving Concepts of Asthma

    Science.gov (United States)

    Ray, Anuradha; Wenzel, Sally E.

    2015-01-01

    Our understanding of asthma has evolved over time from a singular disease to a complex of various phenotypes, with varied natural histories, physiologies, and responses to treatment. Early therapies treated most patients with asthma similarly, with bronchodilators and corticosteroids, but these therapies had varying degrees of success. Similarly, despite initial studies that identified an underlying type 2 inflammation in the airways of patients with asthma, biologic therapies targeted toward these type 2 pathways were unsuccessful in all patients. These observations led to increased interest in phenotyping asthma. Clinical approaches, both biased and later unbiased/statistical approaches to large asthma patient cohorts, identified a variety of patient characteristics, but they also consistently identified the importance of age of onset of disease and the presence of eosinophils in determining clinically relevant phenotypes. These paralleled molecular approaches to phenotyping that developed an understanding that not all patients share a type 2 inflammatory pattern. Using biomarkers to select patients with type 2 inflammation, repeated trials of biologics directed toward type 2 cytokine pathways saw newfound success, confirming the importance of phenotyping in asthma. Further research is needed to clarify additional clinical and molecular phenotypes, validate predictive biomarkers, and identify new areas for possible interventions. PMID:26161792

  11. UKAEA'S evolving contract philosophy

    International Nuclear Information System (INIS)

    Nicol, R. D.

    2003-01-01

    The United Kingdom Atomic Energy Authority (UKAEA) has gone through fundamental change over the last ten years. At the heart of this change has been UKAEA's relationship with the contracting and supply market. This paper describes the way in which UKAEA actively developed the market to support the decommissioning programme, and how the approach to contracting has evolved as external pressures and demands have changed. UKAEA's pro-active approach to industry has greatly assisted the development of a healthy, competitive market for services supporting decommissioning in the UK. There have been difficult changes and many challenges along the way, and some retrenchment was necessary to meet regulatory requirements. Nevertheless, UKAEA has sustained a high level of competition - now measured in terms of competed spend as a proportion of competable spend - with annual out-turns consistently over 80%. The prime responsibility for market development will pass to the new Nuclear Decommissioning Authority (NDA) in 2005, as the owner, on behalf of the Government, of the UK's civil nuclear liabilities. The preparatory work for the NDA indicates that the principles established by UKAEA will be carried forward. (author)

  12. Rapid radiation in spiny lobsters (Palinurus spp) as revealed by classic and ABC methods using mtDNA and microsatellite data.

    Science.gov (United States)

    Palero, Ferran; Lopes, Joao; Abelló, Pere; Macpherson, Enrique; Pascual, Marta; Beaumont, Mark A

    2009-11-09

    Molecular tools may help to uncover closely related and still diverging species from a wide variety of taxa and provide insight into the mechanisms, pace and geography of marine speciation. There is a certain controversy on the phylogeography and speciation modes of species-groups with an Eastern Atlantic-Western Indian Ocean distribution, with previous studies suggesting that older events (Miocene) and/or more recent (Pleistocene) oceanographic processes could have influenced the phylogeny of marine taxa. The spiny lobster genus Palinurus allows for testing among speciation hypotheses, since it has a particular distribution with two groups of three species each in the Northeastern Atlantic (P. elephas, P. mauritanicus and P. charlestoni) and Southeastern Atlantic and Southwestern Indian Oceans (P. gilchristi, P. delagoae and P. barbarae). In the present study, we obtain a more complete understanding of the phylogenetic relationships among these species through a combined dataset with both nuclear and mitochondrial markers, by testing alternative hypotheses on both the mutation rate and tree topology under the recently developed approximate Bayesian computation (ABC) methods. Our analyses support a North-to-South speciation pattern in Palinurus with all the South-African species forming a monophyletic clade nested within the Northern Hemisphere species. Coalescent-based ABC methods allowed us to reject the previously proposed hypothesis of a Middle Miocene speciation event related with the closure of the Tethyan Seaway. Instead, divergence times obtained for Palinurus species using the combined mtDNA-microsatellite dataset and standard mutation rates for mtDNA agree with known glaciation-related processes occurring during the last 2 my. The Palinurus speciation pattern is a typical example of a series of rapid speciation events occurring within a group, with very short branches separating different species. Our results support the hypothesis that recent climate

  13. Forensic utilization of familial searches in DNA databases.

    Science.gov (United States)

    Gershaw, Cassandra J; Schweighardt, Andrew J; Rourke, Linda C; Wallace, Margaret M

    2011-01-01

    DNA evidence is widely recognized as an invaluable tool in the process of investigation and identification, as well as one of the most sought after types of evidence for presentation to a jury. In the United States, the development of state and federal DNA databases has greatly impacted the forensic community by creating an efficient, searchable system that can be used to eliminate or include suspects in an investigation based on matching DNA profiles - the profile already in the database to the profile of the unknown sample in evidence. Recent changes in legislation have begun to allow for the possibility to expand the parameters of DNA database searches, taking into account the possibility of familial searches. This article discusses prospective positive outcomes of utilizing familial DNA searches and acknowledges potential negative outcomes, thereby presenting both sides of this very complicated, rapidly evolving situation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  14. Disgust: Evolved function and structure

    NARCIS (Netherlands)

    Tybur, J.M.; Lieberman, D.; Kurzban, R.; DeScioli, P.

    2013-01-01

    Interest in and research on disgust has surged over the past few decades. The field, however, still lacks a coherent theoretical framework for understanding the evolved function or functions of disgust. Here we present such a framework, emphasizing 2 levels of analysis: that of evolved function and

  15. Natural selection promotes antigenic evolvability

    NARCIS (Netherlands)

    Graves, C.J.; Ros, V.I.D.; Stevenson, B.; Sniegowski, P.D.; Brisson, D.

    2013-01-01

    The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide

  16. "Reinventing Life": Introductory Biology for a Rapidly Evolving World

    Science.gov (United States)

    Coker, Jeffrey Scott

    2009-01-01

    Evolutionary concepts are essential for a scientific understanding of most issues surrounding modern medicine, agriculture, biotechnology, and the environment. If the mantra for biology education in the 20th century was, "Nothing in biology makes sense except in the light of evolution," the mantra for the 21st century must be, "Nothing in biology…

  17. Rapidly Evolving Distributed Systems by Bridging the Deployment Gap

    National Research Council Canada - National Science Library

    Wolf, Alexander

    2000-01-01

    .... The University of Colorado EDCS project has been successful in achieving its objective: producing innovative, useful, and interesting research results in the areas of software configuration and deployment...

  18. Rapidly Evolving Distributed Systems by Bridging the Deployment Gap

    National Research Council Canada - National Science Library

    Wolf, Alexander

    2001-01-01

    .... The University of Colorado EDCS project has been successful in achieving its objective; producing innovative, useful and interesting research results in the areas of software configuration and deployment...

  19. Emerging Zika Virus Infection: A Rapidly Evolving Situation.

    Science.gov (United States)

    Bordi, Licia; Avsic-Zupanc, Tatjana; Lalle, Eleonora; Vairo, Francesco; Capobianchi, Maria Rosaria; da Costa Vasconcelos, Pedro Fernando

    2017-01-01

    Zika virus is a mosquito-borne flavivirus, firstly identified in Uganda and responsible for sporadic human cases in Africa and Asia until recently, when large outbreak occurred in Pacific Ocean and the Americas. Since the main vectors during its spread outside of Africa have been Ae. albopictus and Ae. aegypti mosquitoes, which are widely distributed all over the world, there is urgent need for a coordinated response for prevention and spread of ZIKV epidemics.Despite clinical manifestation of Zika virus infection are usually mild and self limiting, there are reports suggesting, during the recent epidemic, an association of ZIKV infection with severe consequences, including fetal/newborn microcephaly, due to vertical in utero transmission, autoimmune-neurological presentations including cranial nerve dysfunction, and Guillain-Barré Syndrome in adults. The primary mode of transmission of Zika virus between humans is through the bite of an infected female mosquito of the Aedes genus, but also sexual and blood transfusion transmission may occur. Moreover, a case of non-sexual spread from one person to another has been described, indicating that we still have more to learn about Zika transmission.Biological basis for pathogenetic effects are under investigation. Laboratory diagnosis is challenging since, so far, there are no "gold standard" diagnostic tools, and the low and short viremia in the acute phase, and together with the high cross-reactivity among the members of flavivirus genus are the most challenging aspects to be overcome.

  20. Proliferating Cell Nuclear Antigen-dependent Rapid Recruitment of Cdt1 and CRL4Cdt2 at DNA-damaged Sites after UV Irradiation in HeLa Cells*

    Science.gov (United States)

    Ishii, Takashi; Shiomi, Yasushi; Takami, Toshihiro; Murakami, Yusuke; Ohnishi, Naho; Nishitani, Hideo

    2010-01-01

    The licensing factor Cdt1 is degraded by CRL4Cdt2 ubiquitin ligase dependent on proliferating cell nuclear antigen (PCNA) during S phase and when DNA damage is induced in G1 phase. Association of both Cdt2 and PCNA with chromatin was observed in S phase and after UV irradiation. Here we used a micropore UV irradiation assay to examine Cdt2 accumulation at cyclobutane pyrimidine dimer-containing DNA-damaged sites in the process of Cdt1 degradation in HeLa cells. Cdt2, present in the nucleus throughout the cell cycle, accumulated rapidly at damaged DNA sites during G1 phase. The recruitment of Cdt2 is dependent on prior PCNA chromatin binding because Cdt2 association was prevented when PCNA was silenced. Cdt1 was also recruited to damaged sites soon after UV irradiation through its PIP-box. As Cdt1 was degraded, the Cdt2 signal at damaged sites was reduced, but PCNA, cyclobutane pyrimidine dimer, and XPA (xeroderma pigmentosum, complementation group A) signals remained at the same levels. These findings suggest that Cdt1 degradation following UV irradiation occurs rapidly at damaged sites due to PCNA chromatin loading and the recruitment of Cdt1 and CRL4Cdt2, before DNA damage repair is completed. PMID:20929861

  1. The evolving diagnostic and genetic landscapes of autism spectrum disorder

    Directory of Open Access Journals (Sweden)

    Mark Nicholas Ziats

    2016-04-01

    Full Text Available The autism spectrum disorders (ASD are a heterogeneous set of neurodevelopmental syndromes defined by impairments in verbal and non-verbal communication, restricted social interaction, and the presence of stereotyped patterns of behavior. The prevalence of ASD is rising, and the diagnostic criteria and clinical perspectives on the disorder continue to evolve in parallel. Although the majority of individuals with ASD will not have an identifiable genetic cause, almost 25% of cases have identifiable causative DNA variants. The rapidly improving ability to identify genetic mutations because of advances in next generation sequencing, coupled with previous epidemiological studies demonstrating high heritability of ASD, have led to many recent attempts to identify causative genetic mutations underlying the ASD phenotype. However, although hundreds of mutations have been identified to date, they are either rare variants affecting only a handful of ASD patients, or are common variants in the general population conferring only a small risk for ASD. Furthermore, the genes implicated thus far are heterogeneous in their structure and function, hampering attempts to understand shared molecular mechanisms among all ASD patients; an understanding that is crucial for the development of targeted diagnostics and therapies. However, new work is beginning to suggest that the heterogeneous set of genes implicated in ASD may ultimately converge on a few common pathways. In this review, we discuss the parallel evolution of our diagnostic and genetic understanding of autism spectrum disorders, and highlight recent attempts to infer common biology underlying this complicated syndrome.

  2. The Evolving Diagnostic and Genetic Landscapes of Autism Spectrum Disorder.

    Science.gov (United States)

    Ziats, Mark N; Rennert, Owen M

    2016-01-01

    The autism spectrum disorders (ASD) are a heterogeneous set of neurodevelopmental syndromes defined by impairments in verbal and non-verbal communication, restricted social interaction, and the presence of stereotyped patterns of behavior. The prevalence of ASD is rising, and the diagnostic criteria and clinical perspectives on the disorder continue to evolve in parallel. Although the majority of individuals with ASD will not have an identifiable genetic cause, almost 25% of cases have identifiable causative DNA variants. The rapidly improving ability to identify genetic mutations because of advances in next generation sequencing, coupled with previous epidemiological studies demonstrating high heritability of ASD, have led to many recent attempts to identify causative genetic mutations underlying the ASD phenotype. However, although hundreds of mutations have been identified to date, they are either rare variants affecting only a handful of ASD patients, or are common variants in the general population conferring only a small risk for ASD. Furthermore, the genes implicated thus far are heterogeneous in their structure and function, hampering attempts to understand shared molecular mechanisms among all ASD patients; an understanding that is crucial for the development of targeted diagnostics and therapies. However, new work is beginning to suggest that the heterogeneous set of genes implicated in ASD may ultimately converge on a few common pathways. In this review, we discuss the parallel evolution of our diagnostic and genetic understanding of autism spectrum disorders, and highlight recent attempts to infer common biology underlying this complicated syndrome.

  3. Magnetic bead/capture DNA/glucose-loaded nanoliposomes for amplifying the glucometer signal in the rapid screening of hepatitis C virus RNA.

    Science.gov (United States)

    Tu, Haijian; Lin, Kun; Lun, Yongzhi; Yu, Liuming

    2018-06-01

    A digital detection strategy based on a portable personal glucometer (PGM) was developed for the simple, rapid, and sensitive detection of hepatitis C virus (HCV) RNA, involving the release of glucose-loaded nanoliposomes due to coupling-site-specific cleavage by the endonuclease BamHI. The glucose-loaded nanoliposomes were synthesized using a reversed-phase evaporation method and provided an amplified signal at the PGM in the presence of HCV RNA. Initially, a 21-mer oligonucleotide complementary to HCV RNA was covalently conjugated to a magnetic bead through the amino group at the 5' end of the oligonucleotide, and then bound to a glucose-loaded liposome by typical carbodiimide coupling at its 3' end. In the presence of the target HCV RNA, the target hybridized with the oligonucleotide to form double-stranded DNA. The symmetrical duplex sequence 5'-GGATCC-3' between guanines was then catalytically cleaved by BamHI, which detached the glucose-loaded liposome from the magnetic bead. Following magnetic separation of the bead, the detached glucose-loaded liposome was lysed using Triton X-100 to release the glucose molecules within it, which were then detected as an amplified signal at the digital PGM. Under optimal conditions, the PGM signal increased with increasing HCV RNA, and displayed a strongly linear dependence on the level of HCV RNA for concentrations ranging from 10 pM to 1.0 μM. The detection limit (LOD) of the system was 1.9 pM. Good reproducibility and favorable specificity were achieved in the analysis of the target HCV RNA. Human serum samples containing HCV RNA were analyzed using this strategy, and the developed sensing platform was observed to yield satisfactory results based on a comparison with the corresponding results from a Cobas ® Amplicor HCV Test Analyzer. Graphical abstract A digital detection strategy utilizing a personal glucometer was developed for the detection of hepatitis C virus RNA. The strategy involved the use of the

  4. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...... efficiency was not optimal (AE = 139.5 %). DNA extraction methods Easy-DNA Invitrogen, MiniMAG® and NucleoSpin® Tissue produced good real-time PCR reproducibility generating standard deviations from 0.3 to 0.8 between replicates....

  5. Genetic structure and evolved malaria resistance in Hawaiian honeycreepers

    Science.gov (United States)

    Foster, J.T.; Woodworth, B.L.; Eggert, L.E.; Hart, P.J.; Palmer, D.; Duffy, D.C.; Fleischer, R.C.

    2007-01-01

    Infectious diseases now threaten wildlife populations worldwide but population recovery following local extinction has rarely been observed. In such a case, do resistant individuals recolonize from a central remnant population, or do they spread from small, perhaps overlooked, populations of resistant individuals? Introduced avian malaria (Plasmodium relictum) has devastated low-elevation populations of native birds in Hawaii, but at least one species (Hawaii amakihi, Hemignathus virens) that was greatly reduced at elevations below about 1000 m tolerates malaria and has initiated a remarkable and rapid recovery. We assessed mitochondrial and nuclear DNA markers from amakihi and two other Hawaiian honeycreepers, apapane (Himatione sanguinea) and iiwi (Vestiaria coccinea), at nine primary study sites from 2001 to 2003 to determine the source of re-establishing birds. In addition, we obtained sequences from tissue from amakihi museum study skins (1898 and 1948-49) to assess temporal changes in allele distributions. We found that amakihi in lowland areas are, and have historically been, differentiated from birds at high elevations and had unique alleles retained through time; that is, their genetic signature was not a subset of the genetic variation at higher elevations. We suggest that high disease pressure rapidly selected for resistance to malaria at low elevation, leaving small pockets of resistant birds, and this resistance spread outward from the scattered remnant populations. Low-elevation amakihi are currently isolated from higher elevations (> 1000 m) where disease emergence and transmission rates appear to vary seasonally and annually. In contrast to results from amakihi, no genetic differentiation between elevations was found in apapane and iiwi, indicating that slight variation in genetic or life-history attributes can determine disease resistance and population recovery. Determining the conditions that allow for the development of resistance to disease is

  6. Whole-genome sequencing of a laboratory-evolved yeast strain

    Directory of Open Access Journals (Sweden)

    Dunham Maitreya J

    2010-02-01

    Full Text Available Abstract Background Experimental evolution of microbial populations provides a unique opportunity to study evolutionary adaptation in response to controlled selective pressures. However, until recently it has been difficult to identify the precise genetic changes underlying adaptation at a genome-wide scale. New DNA sequencing technologies now allow the genome of parental and evolved strains of microorganisms to be rapidly determined. Results We sequenced >93.5% of the genome of a laboratory-evolved strain of the yeast Saccharomyces cerevisiae and its ancestor at >28× depth. Both single nucleotide polymorphisms and copy number amplifications were found, with specific gains over array-based methodologies previously used to analyze these genomes. Applying a segmentation algorithm to quantify structural changes, we determined the approximate genomic boundaries of a 5× gene amplification. These boundaries guided the recovery of breakpoint sequences, which provide insights into the nature of a complex genomic rearrangement. Conclusions This study suggests that whole-genome sequencing can provide a rapid approach to uncover the genetic basis of evolutionary adaptations, with further applications in the study of laboratory selections and mutagenesis screens. In addition, we show how single-end, short read sequencing data can provide detailed information about structural rearrangements, and generate predictions about the genomic features and processes that underlie genome plasticity.

  7. Spacetimes containing slowly evolving horizons

    International Nuclear Information System (INIS)

    Kavanagh, William; Booth, Ivan

    2006-01-01

    Slowly evolving horizons are trapping horizons that are ''almost'' isolated horizons. This paper reviews their definition and discusses several spacetimes containing such structures. These include certain Vaidya and Tolman-Bondi solutions as well as (perturbatively) tidally distorted black holes. Taking into account the mass scales and orders of magnitude that arise in these calculations, we conjecture that slowly evolving horizons are the norm rather than the exception in astrophysical processes that involve stellar-scale black holes

  8. One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

    Science.gov (United States)

    Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

    2013-01-02

    Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

  9. Robustness to Faults Promotes Evolvability: Insights from Evolving Digital Circuits.

    Science.gov (United States)

    Milano, Nicola; Nolfi, Stefano

    2016-01-01

    We demonstrate how the need to cope with operational faults enables evolving circuits to find more fit solutions. The analysis of the results obtained in different experimental conditions indicates that, in absence of faults, evolution tends to select circuits that are small and have low phenotypic variability and evolvability. The need to face operation faults, instead, drives evolution toward the selection of larger circuits that are truly robust with respect to genetic variations and that have a greater level of phenotypic variability and evolvability. Overall our results indicate that the need to cope with operation faults leads to the selection of circuits that have a greater probability to generate better circuits as a result of genetic variation with respect to a control condition in which circuits are not subjected to faults.

  10. Rapid decrease of circulating tumor DNA predicted the treatment effect of nivolumab in a lung cancer patient within only 5 days

    Directory of Open Access Journals (Sweden)

    Yuki Iijima

    2017-01-01

    Full Text Available A 77-year-old Japanese man presented to our hospital with a 1-month history of low back pain and was diagnosed as having stage IV EGFR mutation-positive lung adenocarcinoma. After treatment with EGFR tyrosine kinase inhibitor and cytotoxic chemotherapy, nivolumab was started as fourth-line therapy. Remarkable regression of the primary tumor was observed, suggesting high anti-tumor activity of nivolumab. We retrospectively investigated the change in circulating tumor DNA (ctDNA variant allele fractions in serial plasma samples before and after the nivolumab therapy. Targeted sequencing analysis showed tumor-derived TP53R249S and EGFRL858R mutations detectable in plasma, and the timing of decrease was only 5 days, much earlier than the appearance of radiological changes. Overall, these results suggest that ctDNA might reflect tumor burden and might be a surrogate marker of the therapeutic efficacy of immune checkpoint therapy.

  11. A rapid assessment method to estimate the distribution of juvenile Chinook Salmon in tributary habitats using eDNA and occupancy estimation

    Science.gov (United States)

    Matter, A.; Falke, Jeffrey A.; López, J. Andres; Savereide, James W.

    2018-01-01

    Identification and protection of water bodies used by anadromous species are critical in light of increasing threats to fish populations, yet often challenging given budgetary and logistical limitations. Noninvasive, rapid‐assessment, sampling techniques may reduce costs and effort while increasing species detection efficiencies. We used an intrinsic potential (IP) habitat model to identify high‐quality rearing habitats for Chinook Salmon Oncorhynchus tshawytscha and select sites to sample throughout the Chena River basin, Alaska, for juvenile occupancy using an environmental DNA (eDNA) approach. Water samples were collected from 75 tributary sites in 2014 and 2015. The presence of Chinook Salmon DNA in water samples was assessed using a species‐specific quantitative PCR (qPCR) assay. The IP model predicted over 900 stream kilometers in the basin to support high‐quality (IP ≥ 0.75) rearing habitat. Occupancy estimation based on eDNA samples indicated that 80% and 56% of previously unsampled sites classified as high or low IP (IP Salmon DNA from three replicate water samples was high (p = 0.76) but varied with drainage area (km2). A power analysis indicated high power to detect proportional changes in occupancy based on parameter values estimated from eDNA occupancy models, although power curves were not symmetrical around zero, indicating greater power to detect positive than negative proportional changes in occupancy. Overall, the combination of IP habitat modeling and occupancy estimation provided a useful, rapid‐assessment method to predict and subsequently quantify the distribution of juvenile salmon in previously unsampled tributary habitats. Additionally, these methods are flexible and can be modified for application to other species and in other locations, which may contribute towards improved population monitoring and management.

  12. A neighbourhood evolving network model

    International Nuclear Information System (INIS)

    Cao, Y.J.; Wang, G.Z.; Jiang, Q.Y.; Han, Z.X.

    2006-01-01

    Many social, technological, biological and economical systems are best described by evolved network models. In this short Letter, we propose and study a new evolving network model. The model is based on the new concept of neighbourhood connectivity, which exists in many physical complex networks. The statistical properties and dynamics of the proposed model is analytically studied and compared with those of Barabasi-Albert scale-free model. Numerical simulations indicate that this network model yields a transition between power-law and exponential scaling, while the Barabasi-Albert scale-free model is only one of its special (limiting) cases. Particularly, this model can be used to enhance the evolving mechanism of complex networks in the real world, such as some social networks development

  13. Utility of DNA barcoding for rapid and accurate assessment of bat diversity in Malaysia in the absence of formally described species.

    Science.gov (United States)

    Wilson, J-J; Sing, K-W; Halim, M R A; Ramli, R; Hashim, R; Sofian-Azirun, M

    2014-02-19

    Bats are important flagship species for biodiversity research; however, diversity in Southeast Asia is considerably underestimated in the current checklists and field guides. Incorporation of DNA barcoding into surveys has revealed numerous species-level taxa overlooked by conventional methods. Inclusion of these taxa in inventories provides a more informative record of diversity, but is problematic as these species lack formal description. We investigated how frequently documented, but undescribed, bat taxa are encountered in Peninsular Malaysia. We discuss whether a barcode library provides a means of recognizing and recording these taxa across biodiversity inventories. Tissue was sampled from bats trapped at Pasir Raja, Dungun Terengganu, Peninsular Malaysia. The DNA was extracted and the COI barcode region amplified and sequenced. We identified 9 species-level taxa within our samples, based on analysis of the DNA barcodes. Six specimens matched to four previously documented taxa considered candidate species but currently lacking formal taxonomic status. This study confirms the high diversity of bats within Peninsular Malaysia (9 species in 13 samples) and demonstrates how DNA barcoding allows for inventory and documentation of known taxa lacking formal taxonomic status.

  14. Rapid response systems.

    Science.gov (United States)

    Lyons, Patrick G; Edelson, Dana P; Churpek, Matthew M

    2018-07-01

    Rapid response systems are commonly employed by hospitals to identify and respond to deteriorating patients outside of the intensive care unit. Controversy exists about the benefits of rapid response systems. We aimed to review the current state of the rapid response literature, including evolving aspects of afferent (risk detection) and efferent (intervention) arms, outcome measurement, process improvement, and implementation. Articles written in English and published in PubMed. Rapid response systems are heterogeneous, with important differences among afferent and efferent arms. Clinically meaningful outcomes may include unexpected mortality, in-hospital cardiac arrest, length of stay, cost, and processes of care at end of life. Both positive and negative interventional studies have been published, although the two largest randomized trials involving rapid response systems - the Medical Early Response and Intervention Trial (MERIT) and the Effect of a Pediatric Early Warning System on All-Cause Mortality in Hospitalized Pediatric Patients (EPOCH) trial - did not find a mortality benefit with these systems, albeit with important limitations. Advances in monitoring technologies, risk assessment strategies, and behavioral ergonomics may offer opportunities for improvement. Rapid responses may improve some meaningful outcomes, although these findings remain controversial. These systems may also improve care for patients at the end of life. Rapid response systems are expected to continue evolving with novel developments in monitoring technologies, risk prediction informatics, and work in human factors. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Rapid diagnosis of virulent Pasteurella multocida isolated from farm animals with clinical manifestation of pneumonia respiratory infection using 16S rDNA and KMT1 gene

    Directory of Open Access Journals (Sweden)

    Gamal Mohamedin Hassan

    2016-01-01

    Full Text Available Objective: To characterize intra-isolates variation between clinical isolates of Pasteurella multocida (P. multocida isolated from sheep, cattle and buffalo at molecular level to check the distribution of pneumonia and hemorrhagic septicemia in some regions of Fayoum, Egypt. Methods: These isolates were obtained from various locations in the Fayoum Governorate, Egypt and they were identified by amplifying 16S rDNA and KMT1 genes using their DNA as a template in PCR reaction. Results: The results demonstrated that the five selective isolates of P. multocida had similar size of PCR products that generated one band of 16S rDNA having 1 471 bp and KMT1 gene having 460 bp. The phylogenetic tree and similarity of the five selective isolates of P. multocida which were collected from GenBank database were calculated and analyzed for the nucleotide sequence of 16S rDNA and KMT1 genes. The sequencing result of 16S rRNA gene product (1 471 bp for the five selective isolates of P. multocida showed that the isolates of sheep (FUP2 shared 94.08%, 88.10% homology with the buffalo isolate (FUP8 and cattle isolate (FUP9 respectively, whereas, the buffalo isolate (FUP5 shared 98.18% and 94.40% homology with the cattle isolates (FUP12 and FUP9. Conclusions: The results indicated the relationships of P. multocida isolated from buffalo and cattle rather than the close relationships between P. multocida isolated from cattle and sheep. Diagnosis of P. multocida by 16S rDNA and KMT1 gene sequences was important to determine the antigen that is responsible for protective cover within the same group of animals and to help for the production of new vaccines for the control of microbial infection for domestic animals.

  16. 大豆种子DNA快速提取方法的改良及应用%Improvement and application of the rapid DNA extraction method from Soybean Seeds

    Institute of Scientific and Technical Information of China (English)

    朱振雷; 束永俊; 李勇; 柏锡; 才华; 纪巍; 朱延明

    2009-01-01

    High-quality DNA is an important base of molecular biology manipulation, such as gene cloning. There are lots of protein and fat in the soybean seeds, so the DNA extracted from them by using traditional methods is very difficult to achieve quality requirements of experiments. This study improved the SDS extraction buffer by adding NP-40 and Tween-20, and established a rapid DNA extraction method that is suitable for soybean seeds. The DNA extraction by the optimized SDS extraction method has high-quality, and the values of OD_(260)/OD_(280) ranged from 1.809 to 1.916, that means non-protein and RNA pollution. The DNA extraction method was validated by gene cloning and genotyping, and the results showed that it could be used for soybean gene cloning and molecular markers.%高质量的DNA是进行基因克隆等分子生物学试验的前提条件.因大豆种子中蛋白质和油脂含量丰富,利用传统方法提取DNA质量很难达到试验要求.研究在SDS提取液的基础上.通过添加表面活性剂NP-40和Tween-20,优化出一种适合于大豆种子DNA快速提取的方法.优化后的SDS方法提取的DNA质量较高.OD_(260)/OD_(280)在1.809~1.916之间,无蛋白质和RNA污染.对该方法提取的DNA进行了基因克隆和分子标记的试验验证,结果表明,它们能够用于大豆基因克隆、分子标记.

  17. No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation

    Directory of Open Access Journals (Sweden)

    Hellberg Michael E

    2006-03-01

    Full Text Available Abstract Background The mitochondrial DNA (mtDNA of most animals evolves more rapidly than nuclear DNA, and often shows higher levels of intraspecific polymorphism and population subdivision. The mtDNA of anthozoans (corals, sea fans, and their kin, by contrast, appears to evolve slowly. Slow mtDNA evolution has been reported for several anthozoans, however this slow pace has been difficult to put in phylogenetic context without parallel surveys of nuclear variation or calibrated rates of synonymous substitution that could permit quantitative rate comparisons across taxa. Here, I survey variation in the coding region of a mitochondrial gene from a coral species (Balanophyllia elegans known to possess high levels of nuclear gene variation, and estimate synonymous rates of mtDNA substitution by comparison to another coral (Tubastrea coccinea. Results The mtDNA surveyed (630 bp of cytochrome oxidase subunit I was invariant among individuals sampled from 18 populations spanning 3000 km of the range of B. elegans, despite high levels of variation and population subdivision for allozymes over these same populations. The synonymous substitution rate between B. elegans and T. coccinea (0.05%/site/106 years is similar to that in most plants, but 50–100 times lower than rates typical for most animals. In addition, while substitutions to mtDNA in most animals exhibit a strong bias toward transitions, mtDNA from these corals does not. Conclusion Slow rates of mitochondrial nucleotide substitution result in low levels of intraspecific mtDNA variation in corals, even when nuclear loci vary. Slow mtDNA evolution appears to be the basal condition among eukaryotes. mtDNA substitution rates switch from slow to fast abruptly and unidirectionally. This switch may stem from the loss of just one or a few mitochondrion-specific DNA repair or replication genes.

  18. Rapid assessment of repair of ultraviolet DNA damage with a modified host-cell reactivation assay using a luciferase reporter gene and correlation with polymorphisms of DNA repair genes in normal human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Qiao Yawei; Spitz, Margaret R.; Guo Zhaozheng; Hadeyati, Mohammad; Grossman, Lawrence; Kraemer, Kenneth H.; Wei Qingyi

    2002-11-30

    As DNA repair plays an important role in genetic susceptibility to cancer, assessment of the DNA repair phenotype is critical for molecular epidemiological studies of cancer. In this report, we compared use of the luciferase (luc) reporter gene in a host-cell reactivation (HCR) (LUC) assay of repair of ultraviolet (UV) damage to DNA to use of the chloramphenicol (cat) gene-based HCR (CAT) assay we used previously for case-control studies. We performed both the assays on cryopreserved lymphocytes from 102 healthy non-Hispanic white subjects. There was a close correlation between DNA repair capacity (DRC) as measured by the LUC and CAT assays. Although these two assays had similar variation, the LUC assay was faster and more sensitive. We also analyzed the relationship between DRC and the subjects' previously determined genotypes for four polymorphisms of two nucleotide-excision repair (NER) genes (in intron 9 of xeroderma pigmentosum (XP) C and exons 6, 10 and 23 of XPD) and one polymorphism of a base-excision repair gene in exon 10 of X-ray complementing group 1 (XRCC1). The DRC was significantly lower in subjects homozygous for one or more polymorphisms of the two NER genes than in subjects with other genotypes (P=0.010). In contrast, the polymorphic XRCC1 allele had no significant effect on DRC. These results suggest that the post-UV LUC assay measures NER phenotype and that polymorphisms of XPC and XPD genes modulate DRC. For population studies of the DNA repair phenotype, many samples need to be evaluated, and so the LUC assay has several advantages over the CAT assay: the LUC assay was more sensitive, had less variation, was not radioactive, was easier to perform, and required fewer cryopreserved cells. These features make the LUC-based HCR assay suitable for molecular epidemiological studies.

  19. Rapid, sensitive, and selective fluorescent DNA detection using iron-based metal-organic framework nanorods: Synergies of the metal center and organic linker.

    Science.gov (United States)

    Tian, Jingqi; Liu, Qian; Shi, Jinle; Hu, Jianming; Asiri, Abdullah M; Sun, Xuping; He, Yuquan

    2015-09-15

    Considerable recent attention has been paid to homogeneous fluorescent DNA detection with the use of nanostructures as a universal "quencher", but it still remains a great challenge to develop such nanosensor with the benefits of low cost, high speed, sensitivity, and selectivity. In this work, we report the use of iron-based metal-organic framework nanorods as a high-efficient sensing platform for fluorescent DNA detection. It only takes about 4 min to complete the whole "mix-and-detect" process with a low detection limit of 10 pM and a strong discrimination of single point mutation. Control experiments reveal the remarkable sensing behavior is a consequence of the synergies of the metal center and organic linker. This work elucidates how composition control of nanostructures can significantly impact their sensing properties, enabling new opportunities for the rational design of functional materials for analytical applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Direct immobilization of DNA probes on non-modified plastics by UV irradiation and integration in microfluidic devices for rapid bioassay

    DEFF Research Database (Denmark)

    Yi, Sun; Perch-Nielsen, Ivan R.; Dufva, Martin

    2012-01-01

    that simple UV irradiation can be used to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on many different types of plastics without any surface modification. On average, five- and fourfold improvement in immobilization and hybridization efficiency have been achieved compared to surface......DNA microarrays have become one of the most powerful tools in the field of genomics and medical diagnosis. Recently, there has been increased interest in combining microfluidics with microarrays since this approach offers advantages in terms of portability, reduced analysis time, low consumption...... of reagents, and increased system integration. Polymers are widely used for microfluidic systems, but fabrication of microarrays on such materials often requires complicated chemical surface modifications, which hinders the integration of microarrays into microfluidic systems. In this paper, we demonstrate...

  1. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  2. DNA damage and autophagy

    International Nuclear Information System (INIS)

    Rodriguez-Rocha, Humberto; Garcia-Garcia, Aracely; Panayiotidis, Mihalis I.; Franco, Rodrigo

    2011-01-01

    Both exogenous and endogenous agents are a threat to DNA integrity. Exogenous environmental agents such as ultraviolet (UV) and ionizing radiation, genotoxic chemicals and endogenous byproducts of metabolism including reactive oxygen species can cause alterations in DNA structure (DNA damage). Unrepaired DNA damage has been linked to a variety of human disorders including cancer and neurodegenerative disease. Thus, efficient mechanisms to detect DNA lesions, signal their presence and promote their repair have been evolved in cells. If DNA is effectively repaired, DNA damage response is inactivated and normal cell functioning resumes. In contrast, when DNA lesions cannot be removed, chronic DNA damage triggers specific cell responses such as cell death and senescence. Recently, DNA damage has been shown to induce autophagy, a cellular catabolic process that maintains a balance between synthesis, degradation, and recycling of cellular components. But the exact mechanisms by which DNA damage triggers autophagy are unclear. More importantly, the role of autophagy in the DNA damage response and cellular fate is unknown. In this review we analyze evidence that supports a role for autophagy as an integral part of the DNA damage response.

  3. Development of novel vaccines using DNA shuffling and screening strategies.

    Science.gov (United States)

    Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha

    2004-02-01

    DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.

  4. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  5. Forces shaping the fastest evolving regions in the human genome

    DEFF Research Database (Denmark)

    Pollard, Katherine S; Salama, Sofie R; King, Bryan

    2006-01-01

    Comparative genomics allow us to search the human genome for segments that were extensively changed in the last approximately 5 million years since divergence from our common ancestor with chimpanzee, but are highly conserved in other species and thus are likely to be functional. We found 202...... genomic elements that are highly conserved in vertebrates but show evidence of significantly accelerated substitution rates in human. These are mostly in non-coding DNA, often near genes associated with transcription and DNA binding. Resequencing confirmed that the five most accelerated elements...... contributed to accelerated evolution of the fastest evolving elements in the human genome....

  6. Rapid isolation of microsatellite DNAs and identification of polymorphic mitochondrial DNA regions in the fish rotan (Perccottus glenii) invading European Russia

    Science.gov (United States)

    King, Timothy L.; Eackles, Michael S.; Reshetnikov, Andrey N.

    2015-01-01

    Human-mediated translocations and subsequent large-scale colonization by the invasive fish rotan (Perccottus glenii Dybowski, 1877; Perciformes, Odontobutidae), also known as Amur or Chinese sleeper, has resulted in dramatic transformations of small lentic ecosystems. However, no detailed genetic information exists on population structure, levels of effective movement, or relatedness among geographic populations of P. glenii within the European part of the range. We used massively parallel genomic DNA shotgun sequencing on the semiconductor-based Ion Torrent Personal Genome Machine (PGM) sequencing platform to identify nuclear microsatellite and mitochondrial DNA sequences in P. glenii from European Russia. Here we describe the characterization of nine nuclear microsatellite loci, ascertain levels of allelic diversity, heterozygosity, and demographic status of P. glenii collected from Ilev, Russia, one of several initial introduction points in European Russia. In addition, we mapped sequence reads to the complete P. glenii mitochondrial DNA sequence to identify polymorphic regions. Nuclear microsatellite markers developed for P. glenii yielded sufficient genetic diversity to: (1) produce unique multilocus genotypes; (2) elucidate structure among geographic populations; and (3) provide unique perspectives for analysis of population sizes and historical demographics. Among 4.9 million filtered P. glenii Ion Torrent PGM sequence reads, 11,304 mapped to the mitochondrial genome (NC_020350). This resulted in 100 % coverage of this genome to a mean coverage depth of 102X. A total of 130 variable sites were observed between the publicly available genome from China and the studied composite mitochondrial genome. Among these, 82 were diagnostic and monomorphic between the mitochondrial genomes and distributed among 15 genome regions. The polymorphic sites (N = 48) were distributed among 11 mitochondrial genome regions. Our results also indicate that sequence reads generated

  7. Accurate and rapid modeling of iron–bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis

    OpenAIRE

    Harsch, Andreas; Marzilli, Lisa A.; Bunt, Richard C.; Stubbe, Joanne; Vouros, Paul

    2000-01-01

    Bleomycin B2 (BLM) in the presence of iron [Fe(II)] and O2 catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe–BLM was incorporated into each an...

  8. Evolving phenotypic networks in silico.

    Science.gov (United States)

    François, Paul

    2014-11-01

    Evolved gene networks are constrained by natural selection. Their structures and functions are consequently far from being random, as exemplified by the multiple instances of parallel/convergent evolution. One can thus ask if features of actual gene networks can be recovered from evolutionary first principles. I review a method for in silico evolution of small models of gene networks aiming at performing predefined biological functions. I summarize the current implementation of the algorithm, insisting on the construction of a proper "fitness" function. I illustrate the approach on three examples: biochemical adaptation, ligand discrimination and vertebrate segmentation (somitogenesis). While the structure of the evolved networks is variable, dynamics of our evolved networks are usually constrained and present many similar features to actual gene networks, including properties that were not explicitly selected for. In silico evolution can thus be used to predict biological behaviours without a detailed knowledge of the mapping between genotype and phenotype. Copyright © 2014 The Author. Published by Elsevier Ltd.. All rights reserved.

  9. Layer-by-Layer-Assembled AuNPs-Decorated First-Generation Poly(amidoamine) Dendrimer with Reduced Graphene Oxide Core as Highly Sensitive Biosensing Platform with Controllable 3D Nanoarchitecture for Rapid Voltammetric Analysis of Ultratrace DNA Hybridization.

    Science.gov (United States)

    Jayakumar, Kumarasamy; Camarada, María Belén; Dharuman, Venkataraman; Rajesh, Rajendiran; Venkatesan, Rengarajan; Ju, Huangxian; Maniraj, Mahalingam; Rai, Abhishek; Barman, Sudipta Roy; Wen, Yangping

    2018-06-12

    The structure and electrochemical properties of layer-by-layer-assembled gold nanoparticles (AuNPs)-decorated first-generation (G1) poly(amidoamine) dendrimer (PD) with reduced graphene oxide (rGO) core as a highly sensitive and label-free biosensing platform with a controllable three-dimensional (3D) nanoarchitecture for the rapid voltammetric analysis of DNA hybridization at ultratrace levels were characterized. Mercaptopropinoic acid (MPA) was self-assembled onto Au substrate, then GG1PD formed by the covalent functionalization between the amino terminals of G1PD and carboxyl terminals of rGO was covalently linked onto MPA, and finally AuNPs were decorated onto GG1PD by strong physicochemical interaction between AuNPs and -OH of rGO in GG1PD, which was characterized through different techniques and confirmed by computational calculation. This 3D controllable thin-film electrode was optimized and evaluated using [Fe(CN) 6 ] 3-/4- as the redox probe and employed to covalently immobilize thiol-functionalized single-stranded DNA as biorecognition element to form the DNA nanobiosensor, which achieved fast, ultrasensitive, and high-selective differential pulse voltammetric analysis of DNA hybridization in a linear range from 1 × 10 -6 to 1 × 10 -13 g m -1 with a low detection limit of 9.07 × 10 -14 g m -1 . This work will open a new pathway for the controllable 3D nanoarchitecture of the layer-by-layer-assembled metal nanoparticles-functionalized lower-generation PD with two-dimensional layered nanomaterials as cores that can be employed as ultrasensitive and label-free nanobiodevices for the fast diagnosis of specific genome diseases in the field of biomedicine.

  10. Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene

    DEFF Research Database (Denmark)

    Candiloro, Ida Lm; Mikeska, Thomas; Hokland, Peter

    2008-01-01

    ABSTRACT: BACKGROUND: Methylation-sensitive high resolution melting (MS-HRM) methodology is able to recognise heterogeneously methylated sequences by their characteristic melting profiles. To further analyse heterogeneously methylated sequences, we adopted a digital approach to MS-HRM (dMS-HRM) t......ABSTRACT: BACKGROUND: Methylation-sensitive high resolution melting (MS-HRM) methodology is able to recognise heterogeneously methylated sequences by their characteristic melting profiles. To further analyse heterogeneously methylated sequences, we adopted a digital approach to MS-HRM (d......MS-HRM) that involves the amplification of single templates after limiting dilution to quantify and to determine the degree of methylation. We used this approach to study methylation of the CDKN2B (p15) cell cycle progression inhibitor gene which is inactivated by DNA methylation in haematological malignancies...... the methylated alleles and assess the degree of methylation. Direct sequencing of selected dMS-HRM products was used to determine the exact DNA methylation pattern and confirmed the degree of methylation estimated by dMS-HRM. CONCLUSION: dMS-HRM is a powerful technique for the analysis of methylation in CDKN2B...

  11. Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

    Science.gov (United States)

    Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

    2013-06-24

    Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable

  12. Rapid Amplification of the 5'cDNA End of Reindeer Ghrelin by Inverse Nested PCR%反向嵌套PCR技术扩增驯鹿Ghrelin cDNA 5'末端序列

    Institute of Scientific and Technical Information of China (English)

    朱雪敏; 张义; 张剑平; 杨银凤

    2008-01-01

    为了研究Ghrelin在驯鹿生长发育过程中的作用和功能,以驯鹿为研究对象,采用反向嵌套PCR RACE技术原理,根据已知的序列设计1条5'末端磷酸化的特异性反转录引物和2对特异性反向嵌套PCR引物,首先进行反转录(RT),然后将反转录成的cDNA进行环化,最后进行反向嵌套巢式PCR,成功地扩增了驯鹿Ghrelin cDNA 5'末端序列.与锚定PCR相比,反向嵌套PCR法具有特异性强、扩增效率高等优点,是一种非常有效的扩增cDNA 5'末端序列的方法.

  13. Application of a Novel and Automated Branched DNA in Situ Hybridization Method for the Rapid and Sensitive Localization of mRNA Molecules in Plant Tissues

    Directory of Open Access Journals (Sweden)

    Andrew J. Bowling

    2014-04-01

    Full Text Available Premise of the study: A novel branched DNA detection technology, RNAscope in situ hybridization (ISH, originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. Methods and Results: Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC and phosphoenolpyruvate carboxykinase (PEPCK. Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. Conclusions: RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.

  14. Dietary restriction but not angiotensin II type 1 receptor blockade improves DNA damage-related vasodilator dysfunction in rapidly aging Ercc1Δ/- mice.

    Science.gov (United States)

    Wu, Haiyan; van Thiel, Bibi S; Bautista-Niño, Paula K; Reiling, Erwin; Durik, Matej; Leijten, Frank P J; Ridwan, Yanto; Brandt, Renata M C; van Steeg, Harry; Dollé, Martijn E T; Vermeij, Wilbert P; Hoeijmakers, Jan H J; Essers, Jeroen; van der Pluijm, Ingrid; Danser, A H Jan; Roks, Anton J M

    2017-08-01

    DNA damage is an important contributor to endothelial dysfunction and age-related vascular disease. Recently, we demonstrated in a DNA repair-deficient, prematurely aging mouse model ( Ercc1 Δ/- mice) that dietary restriction (DR) strongly increases life- and health span, including ameliorating endothelial dysfunction, by preserving genomic integrity. In this mouse mutant displaying prominent accelerated, age-dependent endothelial dysfunction we investigated the signaling pathways involved in improved endothelium-mediated vasodilation by DR, and explore the potential role of the renin-angiotensin system (RAS). Ercc1 Δ/- mice showed increased blood pressure and decreased aortic relaxations to acetylcholine (ACh) in organ bath experiments. Nitric oxide (NO) signaling and phospho-Ser 1177 -eNOS were compromised in Ercc1 Δ / - DR improved relaxations by increasing prostaglandin-mediated responses. Increase of cyclo-oxygenase 2 and decrease of phosphodiesterase 4B were identified as potential mechanisms. DR also prevented loss of NO signaling in vascular smooth muscle cells and normalized angiotensin II (Ang II) vasoconstrictions, which were increased in Ercc1 Δ/- mice. Ercc1 Δ/ - mutants showed a loss of Ang II type 2 receptor-mediated counter-regulation of Ang II type 1 receptor-induced vasoconstrictions. Chronic losartan treatment effectively decreased blood pressure, but did not improve endothelium-dependent relaxations. This result might relate to the aging-associated loss of treatment efficacy of RAS blockade with respect to endothelial function improvement. In summary, DR effectively prevents endothelium-dependent vasodilator dysfunction by augmenting prostaglandin-mediated responses, whereas chronic Ang II type 1 receptor blockade is ineffective. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  15. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  16. The 'E' factor -- evolving endodontics.

    Science.gov (United States)

    Hunter, M J

    2013-03-01

    Endodontics is a constantly developing field, with new instruments, preparation techniques and sealants competing with trusted and traditional approaches to tooth restoration. Thus general dental practitioners must question and understand the significance of these developments before adopting new practices. In view of this, the aim of this article, and the associated presentation at the 2013 British Dental Conference & Exhibition, is to provide an overview of endodontic methods and constantly evolving best practice. The presentation will review current preparation techniques, comparing rotary versus reciprocation, and question current trends in restoration of the endodontically treated tooth.

  17. Evaluation of genetic diversity in Chinese kale (Brassica oleracea L. var. alboglabra Bailey) by using rapid amplified polymorphic DNA and sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Zhang, J; Zhang, L G

    2014-02-14

    Chinese kale is an original Chinese vegetable of the Cruciferae family. To select suitable parents for hybrid breeding, we thoroughly analyzed the genetic diversity of Chinese kale. Random amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) molecular markers were used to evaluate the genetic diversity across 21 Chinese kale accessions from AVRDC and Guangzhou in China. A total of 104 bands were detected by 11 RAPD primers, of which 66 (63.5%) were polymorphic, and 229 polymorphic bands (68.4%) were observed in 335 bands amplified by 17 SRAP primer combinations. The dendrogram showed the grouping of the 21 accessions into 4 main clusters based on RAPD data, and into 6 clusters based on SRAP and combined data (RAPD + SRAP). The clustering of accessions based on SRAP data was consistent with petal colors. The Mantel test indicated a poor fit for the RAPD and SRAP data (r = 0.16). These results have an important implication for Chinese kale germplasm characterization and improvement.

  18. Extreme insular dwarfism evolved in a mammoth.

    Science.gov (United States)

    Herridge, Victoria L; Lister, Adrian M

    2012-08-22

    The insular dwarfism seen in Pleistocene elephants has come to epitomize the island rule; yet our understanding of this phenomenon is hampered by poor taxonomy. For Mediterranean dwarf elephants, where the most extreme cases of insular dwarfism are observed, a key systematic question remains unresolved: are all taxa phyletic dwarfs of a single mainland species Palaeoloxodon antiquus (straight-tusked elephant), or are some referable to Mammuthus (mammoths)? Ancient DNA and geochronological evidence have been used to support a Mammuthus origin for the Cretan 'Palaeoloxodon' creticus, but these studies have been shown to be flawed. On the basis of existing collections and recent field discoveries, we present new, morphological evidence for the taxonomic status of 'P'. creticus, and show that it is indeed a mammoth, most probably derived from Early Pleistocene Mammuthus meridionalis or possibly Late Pliocene Mammuthus rumanus. We also show that Mammuthus creticus is smaller than other known insular dwarf mammoths, and is similar in size to the smallest dwarf Palaeoloxodon species from Sicily and Malta, making it the smallest mammoth species known to have existed. These findings indicate that extreme insular dwarfism has evolved to a similar degree independently in two elephant lineages.

  19. Peripartum hysterectomy: an evolving picture.

    LENUS (Irish Health Repository)

    Turner, Michael J

    2012-02-01

    Peripartum hysterectomy (PH) is one of the obstetric catastrophes. Evidence is emerging that the role of PH in modern obstetrics is evolving. Improving management of postpartum hemorrhage and newer surgical techniques should decrease PH for uterine atony. Rising levels of repeat elective cesarean deliveries should decrease PH following uterine scar rupture in labor. Increasing cesarean rates, however, have led to an increase in the number of PHs for morbidly adherent placenta. In the case of uterine atony or rupture where PH is required, a subtotal PH is often sufficient. In the case of pathological placental localization involving the cervix, however, a total hysterectomy is required. Furthermore, the involvement of other pelvic structures may prospectively make the diagnosis difficult and the surgery challenging. If resources permit, PH for pathological placental localization merits a multidisciplinary approach. Despite advances in clinical practice, it is likely that peripartum hysterectomy will be more challenging for obstetricians in the future.

  20. Infrared spectroscopy of evolved objects

    International Nuclear Information System (INIS)

    Aitken, D.K.; Roche, P.F.

    1984-01-01

    In this review, the authors are concerned with spectroscopic observations of evolved objects made in the wavelength range 1-300μm. Spectroscopic observations can conveniently be divided into studies of narrow lines, bands and broader continua. The vibrational frequencies of molecular groups fall mainly in this spectral region and appear as vibration-rotation bands from the gas phase, and as less structured, but often broader, features from the solid state. Many ionic lines, including recombination lines of abundant species and fine structure lines of astrophysically important ions also appear in this region. The continuum can arise from a number of mechanisms - photospheric emission, radiation from dust, free-free transitions in ionized gas and non-thermal processes. (Auth.)

  1. The evolving war on cancer.

    Science.gov (United States)

    Haber, Daniel A; Gray, Nathanael S; Baselga, Jose

    2011-04-01

    Building on years of basic scientific discovery, recent advances in the fields of cancer genetics and medicinal chemistry are now converging to revolutionize the treatment of cancer. Starting with serendipitous observations in rare subsets of cancer, a paradigm shift in clinical research is poised to ensure that new molecular insights are rapidly applied to shape emerging cancer therapies. Could this mark a turning point in the "War on Cancer"? Copyright © 2011 Elsevier Inc. All rights reserved.

  2. At the forefront: evidence of the applicability of using environmental DNA to quantify the abundance of fish populations in natural lentic waters with additional sampling considerations

    Science.gov (United States)

    Klobucar, Stephen L.; Rodgers, Torrey W.; Budy, Phaedra

    2017-01-01

    Environmental DNA (eDNA) sampling has proven to be a valuable tool for detecting species in aquatic ecosystems. Within this rapidly evolving field, a promising application is the ability to obtain quantitative estimates of relative species abundance based on eDNA concentration rather than traditionally labor-intensive methods. We investigated the relationship between eDNA concentration and Arctic char (Salvelinus alpinus) abundance in five well-studied natural lakes; additionally, we examined the effects of different temporal (e.g., season) and spatial (e.g., depth) scales on eDNA concentration. Concentrations of eDNA were linearly correlated with char population estimates ( = 0.78) and exponentially correlated with char densities ( = 0.96 by area; 0.82 by volume). Across lakes, eDNA concentrations were greater and more homogeneous in the water column during mixis; however, when stratified, eDNA concentrations were greater in the hypolimnion. Overall, our findings demonstrate that eDNA techniques can produce effective estimates of relative fish abundance in natural lakes. These findings can guide future studies to improve and expand eDNA methods while informing research and management using rapid and minimally invasive sampling.

  3. DNA preservation in silk.

    Science.gov (United States)

    Liu, Yawen; Zheng, Zhaozhu; Gong, He; Liu, Meng; Guo, Shaozhe; Li, Gang; Wang, Xiaoqin; Kaplan, David L

    2017-06-27

    The structure of DNA is susceptible to alterations at high temperature and on changing pH, irradiation and exposure to DNase. Options to protect and preserve DNA during storage are important for applications in genetic diagnosis, identity authentication, drug development and bioresearch. In the present study, the stability of total DNA purified from human dermal fibroblast cells, as well as that of plasmid DNA, was studied in silk protein materials. The DNA/silk mixtures were stabilized on filter paper (silk/DNA + filter) or filter paper pre-coated with silk and treated with methanol (silk/DNA + PT-filter) as a route to practical utility. After air-drying and water extraction, 50-70% of the DNA and silk could be retrieved and showed a single band on electrophoretic gels. 6% silk/DNA + PT-filter samples provided improved stability in comparison with 3% silk/DNA + filter samples and DNA + filter samples for DNA preservation, with ∼40% of the band intensity remaining at 37 °C after 40 days and ∼10% after exposure to UV light for 10 hours. Quantitative analysis using the PicoGreen assay confirmed the results. The use of Tris/borate/EDTA (TBE) buffer enhanced the preservation and/or extraction of the DNA. The DNA extracted after storage maintained integrity and function based on serving as a functional template for PCR amplification of the gene for zinc finger protein 750 (ZNF750) and for transgene expression of red fluorescence protein (dsRed) in HEK293 cells. The high molecular weight and high content of a crystalline beta-sheet structure formed on the coated surfaces likely accounted for the preservation effects observed for the silk/DNA + PT-filter samples. Although similar preservation effects were also obtained for lyophilized silk/DNA samples, the rapid and simple processing available with the silk-DNA-filter membrane system makes it appealing for future applications.

  4. Orbital Decay in Binaries with Evolved Stars

    Science.gov (United States)

    Sun, Meng; Arras, Phil; Weinberg, Nevin N.; Troup, Nicholas; Majewski, Steven R.

    2018-01-01

    Two mechanisms are often invoked to explain tidal friction in binary systems. The ``dynamical tide” is the resonant excitation of internal gravity waves by the tide, and their subsequent damping by nonlinear fluid processes or thermal diffusion. The ``equilibrium tide” refers to non-resonant excitation of fluid motion in the star’s convection zone, with damping by interaction with the turbulent eddies. There have been numerous studies of these processes in main sequence stars, but less so on the subgiant and red giant branches. Motivated by the newly discovered close binary systems in the Apache Point Observatory Galactic Evolution Experiment (APOGEE-1), we have performed calculations of both the dynamical and equilibrium tide processes for stars over a range of mass as the star’s cease core hydrogen burning and evolve to shell burning. Even for stars which had a radiative core on the main sequence, the dynamical tide may have very large amplitude in the newly radiative core in post-main sequence, giving rise to wave breaking. The resulting large dynamical tide dissipation rate is compared to the equilibrium tide, and the range of secondary masses and orbital periods over which rapid orbital decay may occur will be discussed, as well as applications to close APOGEE binaries.

  5. CERN internal communication is evolving

    CERN Multimedia

    2016-01-01

    CERN news will now be regularly updated on the CERN People page (see here).      Dear readers, All over the world, communication is becoming increasingly instantaneous, with news published in real time on websites and social networks. In order to keep pace with these changes, CERN's internal communication is evolving too. From now on, you will be informed of what’s happening at CERN more often via the “CERN people” page, which will frequently be updated with news. The Bulletin is following this trend too: twice a month, we will compile the most important articles published on the CERN site, with a brand-new layout. You will receive an e-mail every two weeks as soon as this new form of the Bulletin is available. If you have interesting news or stories to share, tell us about them through the form at: https://communications.web.cern.ch/got-story-cern-website​. You can also find out about news from CERN in real time...

  6. Economies Evolve by Energy Dispersal

    Directory of Open Access Journals (Sweden)

    Stanley Salthe

    2009-10-01

    Full Text Available Economic activity can be regarded as an evolutionary process governed by the 2nd law of thermodynamics. The universal law, when formulated locally as an equation of motion, reveals that a growing economy develops functional machinery and organizes hierarchically in such a way as to tend to equalize energy density differences within the economy and in respect to the surroundings it is open to. Diverse economic activities result in flows of energy that will preferentially channel along the most steeply descending paths, leveling a non-Euclidean free energy landscape. This principle of 'maximal energy dispersal‘, equivalent to the maximal rate of entropy production, gives rise to economic laws and regularities. The law of diminishing returns follows from the diminishing free energy while the relation between supply and demand displays a quest for a balance among interdependent energy densities. Economic evolution is dissipative motion where the driving forces and energy flows are inseparable from each other. When there are multiple degrees of freedom, economic growth and decline are inherently impossible to forecast in detail. Namely, trajectories of an evolving economy are non-integrable, i.e. unpredictable in detail because a decision by a player will affect also future decisions of other players. We propose that decision making is ultimately about choosing from various actions those that would reduce most effectively subjectively perceived energy gradients.

  7. Recommendation in evolving online networks

    Science.gov (United States)

    Hu, Xiao; Zeng, An; Shang, Ming-Sheng

    2016-02-01

    Recommender system is an effective tool to find the most relevant information for online users. By analyzing the historical selection records of users, recommender system predicts the most likely future links in the user-item network and accordingly constructs a personalized recommendation list for each user. So far, the recommendation process is mostly investigated in static user-item networks. In this paper, we propose a model which allows us to examine the performance of the state-of-the-art recommendation algorithms in evolving networks. We find that the recommendation accuracy in general decreases with time if the evolution of the online network fully depends on the recommendation. Interestingly, some randomness in users' choice can significantly improve the long-term accuracy of the recommendation algorithm. When a hybrid recommendation algorithm is applied, we find that the optimal parameter gradually shifts towards the diversity-favoring recommendation algorithm, indicating that recommendation diversity is essential to keep a high long-term recommendation accuracy. Finally, we confirm our conclusions by studying the recommendation on networks with the real evolution data.

  8. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Science.gov (United States)

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

  9. Idiopathic pulmonary fibrosis: evolving concepts.

    Science.gov (United States)

    Ryu, Jay H; Moua, Teng; Daniels, Craig E; Hartman, Thomas E; Yi, Eunhee S; Utz, James P; Limper, Andrew H

    2014-08-01

    Idiopathic pulmonary fibrosis (IPF) occurs predominantly in middle-aged and older adults and accounts for 20% to 30% of interstitial lung diseases. It is usually progressive, resulting in respiratory failure and death. Diagnostic criteria for IPF have evolved over the years, and IPF is currently defined as a disease characterized by the histopathologic pattern of usual interstitial pneumonia occurring in the absence of an identifiable cause of lung injury. Understanding of the pathogenesis of IPF has shifted away from chronic inflammation and toward dysregulated fibroproliferative repair in response to alveolar epithelial injury. Idiopathic pulmonary fibrosis is likely a heterogeneous disorder caused by various interactions between genetic components and environmental exposures. High-resolution computed tomography can be diagnostic in the presence of typical findings such as bilateral reticular opacities associated with traction bronchiectasis/bronchiolectasis in a predominantly basal and subpleural distribution, along with subpleural honeycombing. In other circumstances, a surgical lung biopsy may be needed. The clinical course of IPF can be unpredictable and may be punctuated by acute deteriorations (acute exacerbation). Although progress continues in unraveling the mechanisms of IPF, effective therapy has remained elusive. Thus, clinicians and patients need to reach informed decisions regarding management options including lung transplant. The findings in this review were based on a literature search of PubMed using the search terms idiopathic pulmonary fibrosis and usual interstitial pneumonia, limited to human studies in the English language published from January 1, 2000, through December 31, 2013, and supplemented by key references published before the year 2000. Copyright © 2014 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  10. Evolving expectations from international organisations

    International Nuclear Information System (INIS)

    Ruiz Lopez, C.

    2008-01-01

    The author stated that implementation of the geological disposal concept requires a strategy that provides national decision makers with sufficient confidence in the level of long-term safety and protection ultimately achieved. The concept of protection against harm has a broader meaning than radiological protection in terms of risk and dose. It includes the protection of the environment and socio-economic interests of communities. She recognised that a number of countries have established regulatory criteria already, and others are now discussing what constitutes a proper regulatory test and suitable time frame for judging the safety of long-term disposal. Each regulatory programme seeks to define reasonable tests of repository performance, using protection criteria and safety approaches consistent with the culture, values and expectations of the citizens of the country concerned. This means that there are differences in how protection and safety are addressed in national approaches to regulation and in the bases used for that. However, as was recognised in the Cordoba Workshop, it would be important to reach a minimum level of consistency and be able to explain the differences. C. Ruiz-Lopez presented an overview of the development of international guidance from ICRP, IAEA and NEA from the Cordoba workshop up to now, and positions of independent National Advisory Bodies. The evolution of these guidelines over time demonstrates an evolving understanding of long-term implications, with the recognition that dose and risk constraints should not be seen as measures of detriment beyond a few hundred years, the emphasis on sound engineering practices, and the introduction of new concepts and approaches which take into account social and economical aspects (e.g. constrained optimisation, BAT, managerial principles). In its new recommendations, ICRP (draft 2006) recognizes. in particular, that decision making processes may depend on other societal concerns and considers

  11. Evolving fuzzy rules for relaxed-criteria negotiation.

    Science.gov (United States)

    Sim, Kwang Mong

    2008-12-01

    In the literature on automated negotiation, very few negotiation agents are designed with the flexibility to slightly relax their negotiation criteria to reach a consensus more rapidly and with more certainty. Furthermore, these relaxed-criteria negotiation agents were not equipped with the ability to enhance their performance by learning and evolving their relaxed-criteria negotiation rules. The impetus of this work is designing market-driven negotiation agents (MDAs) that not only have the flexibility of relaxing bargaining criteria using fuzzy rules, but can also evolve their structures by learning new relaxed-criteria fuzzy rules to improve their negotiation outcomes as they participate in negotiations in more e-markets. To this end, an evolutionary algorithm for adapting and evolving relaxed-criteria fuzzy rules was developed. Implementing the idea in a testbed, two kinds of experiments for evaluating and comparing EvEMDAs (MDAs with relaxed-criteria rules that are evolved using the evolutionary algorithm) and EMDAs (MDAs with relaxed-criteria rules that are manually constructed) were carried out through stochastic simulations. Empirical results show that: 1) EvEMDAs generally outperformed EMDAs in different types of e-markets and 2) the negotiation outcomes of EvEMDAs generally improved as they negotiated in more e-markets.

  12. 5′ Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice

    Directory of Open Access Journals (Sweden)

    Eric Waltari

    2018-03-01

    Full Text Available Using 5′ rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM, and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

  13. 5' Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice.

    Science.gov (United States)

    Waltari, Eric; Jia, Manxue; Jiang, Caroline S; Lu, Hong; Huang, Jing; Fernandez, Cristina; Finzi, Andrés; Kaufmann, Daniel E; Markowitz, Martin; Tsuji, Moriya; Wu, Xueling

    2018-01-01

    Using 5' rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR) repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM), and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

  14. Evolving Deep Networks Using HPC

    Energy Technology Data Exchange (ETDEWEB)

    Young, Steven R. [ORNL, Oak Ridge; Rose, Derek C. [ORNL, Oak Ridge; Johnston, Travis [ORNL, Oak Ridge; Heller, William T. [ORNL, Oak Ridge; Karnowski, thomas P. [ORNL, Oak Ridge; Potok, Thomas E. [ORNL, Oak Ridge; Patton, Robert M. [ORNL, Oak Ridge; Perdue, Gabriel [Fermilab; Miller, Jonathan [Santa Maria U., Valparaiso

    2017-01-01

    While a large number of deep learning networks have been studied and published that produce outstanding results on natural image datasets, these datasets only make up a fraction of those to which deep learning can be applied. These datasets include text data, audio data, and arrays of sensors that have very different characteristics than natural images. As these “best” networks for natural images have been largely discovered through experimentation and cannot be proven optimal on some theoretical basis, there is no reason to believe that they are the optimal network for these drastically different datasets. Hyperparameter search is thus often a very important process when applying deep learning to a new problem. In this work we present an evolutionary approach to searching the possible space of network hyperparameters and construction that can scale to 18, 000 nodes. This approach is applied to datasets of varying types and characteristics where we demonstrate the ability to rapidly find best hyperparameters in order to enable practitioners to quickly iterate between idea and result.

  15. DNA repair and cancer

    International Nuclear Information System (INIS)

    Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha

    2012-01-01

    DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)

  16. Evolving approaches to the ethical management of genomic data.

    Science.gov (United States)

    McEwen, Jean E; Boyer, Joy T; Sun, Kathie Y

    2013-06-01

    The ethical landscape in the field of genomics is rapidly shifting. Plummeting sequencing costs, along with ongoing advances in bioinformatics, now make it possible to generate an enormous volume of genomic data about vast numbers of people. The informational richness, complexity, and frequently uncertain meaning of these data, coupled with evolving norms surrounding the sharing of data and samples and persistent privacy concerns, have generated a range of approaches to the ethical management of genomic information. As calls increase for the expanded use of broad or even open consent, and as controversy grows about how best to handle incidental genomic findings, these approaches, informed by normative analysis and empirical data, will continue to evolve alongside the science. Published by Elsevier Ltd.

  17. Evolving Technologies: A View to Tomorrow

    Science.gov (United States)

    Tamarkin, Molly; Rodrigo, Shelley

    2011-01-01

    Technology leaders must participate in strategy creation as well as operational delivery within higher education institutions. The future of higher education--the view to tomorrow--is irrevocably integrated and intertwined with evolving technologies. This article focuses on two specific evolving technologies: (1) alternative IT sourcing; and (2)…

  18. Evolvability Search: Directly Selecting for Evolvability in order to Study and Produce It

    DEFF Research Database (Denmark)

    Mengistu, Henok; Lehman, Joel Anthony; Clune, Jeff

    2016-01-01

    of evolvable digital phenotypes. Although some types of selection in evolutionary computation indirectly encourage evolvability, one unexplored possibility is to directly select for evolvability. To do so, we estimate an individual's future potential for diversity by calculating the behavioral diversity of its...... immediate offspring, and select organisms with increased offspring variation. While the technique is computationally expensive, we hypothesized that direct selection would better encourage evolvability than indirect methods. Experiments in two evolutionary robotics domains confirm this hypothesis: in both...... domains, such Evolvability Search produces solutions with higher evolvability than those produced with Novelty Search or traditional objective-based search algorithms. Further experiments demonstrate that the higher evolvability produced by Evolvability Search in a training environment also generalizes...

  19. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  20. Rapid detection and quantification of cell free cytomegalovirus by a high-speed centrifugation-based microculture assay: comparison to longitudinally analyzed viral DNA load and pp67 late transcript during lactation.

    Science.gov (United States)

    Hamprecht, Klaus; Witzel, Simone; Maschmann, Jens; Dietz, Klaus; Baumeister, Andrea; Mikeler, Elfriede; Goelz, Rangmar; Speer, Christian P; Jahn, Gerhard

    2003-12-01

    Human cytomegalovirus (HCMV) is reactivated in nearly every seropositive breastfeeding mother during lactation [Lancet 357 (2001) 513]. Conventional tissue culture (TC) and low-speed centrifugation-enhanced microtiter culture methods are not able to detect HCMV from milk during all stages of lactation. Development of a sensitive and quantitative microculture technique to describe the dynamics of HCMV reactivation in different milk compartments during lactation. Milk samples were collected longitudinally from seropositive breastfeeding mothers of preterm infants. Native milk samples were separated into fraction 1 (aqueous extract of milk fat), fraction 2 (cell and fat free milk whey) and fraction 3 (milk cells). Each of these fractions was screened qualitatively (TC, nPCR, pp67 late mRNA) and quantitatively (high-speed centrifugation-based microculture, quantitative PCR). Prior to low-speed centrifugation-enhanced inoculation, virus particles were concentrated by high-speed centrifugation (60 min at 50,000 x g, 4 degrees C). Using fraction 2 we were able to describe the dynamics of viral reactivation during lactation. We present the course of the quantitative virolactia and DNAlactia and qualitative detection of HCMV pp67 late mRNA in milk whey of four mothers (three transmitters and one non-transmitter). In all these cases virolactia described an unimodal and self limited course. Peak levels of virolactia for transmitters (T1: day 44; T2: day 43; T3: day 50) were closely related the onset of viruria of the corresponding preterm infants (U1: day 39; U2a/U2b: day 44/57; U3: day 60). The courses of viral load coincidence with the courses of DNA load. We present a rapid and highly sensitive microculture method for the quantification of cell free HCMV from milk whey and aqueous extracts from milk fat. Viral reactivation during lactation describes an unimodal course. Our findings have strong implications for quality control of any virus inactivation procedure.

  1. Sex determination: ways to evolve a hermaphrodite.

    OpenAIRE

    Braendle , Christian; Félix , Marie-Anne

    2006-01-01

    Most species of the nematode genus Caenorhabditis reproduce through males and females; C. elegans and C. briggsae, however, produce self-fertile hermaphrodites instead of females. These transitions to hermaphroditism evolved convergently through distinct modifications of germline sex determination mechanisms.

  2. WSC-07: Evolving the Web Services Challenge

    NARCIS (Netherlands)

    Blake, M. Brian; Cheung, William K.W.; Jaeger, Michael C.; Wombacher, Andreas

    Service-oriented architecture (SOA) is an evolving architectural paradigm where businesses can expose their capabilities as modular, network-accessible software services. By decomposing capabilities into modular services, organizations can share their offerings at multiple levels of granularity

  3. Marshal: Maintaining Evolving Models, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — SIFT proposes to design and develop the Marshal system, a mixed-initiative tool for maintaining task models over the course of evolving missions. Marshal-enabled...

  4. Satcom access in the Evolved Packet Core

    NARCIS (Netherlands)

    Cano Soveri, M.D.; Norp, A.H.J.; Popova, M.P.

    2011-01-01

    Satellite communications (Satcom) networks are increasingly integrating with terrestrial communications networks, namely Next Generation Networks (NGN). In the area of NGN the Evolved Packet Core (EPC) is a new network architecture that can support multiple access technologies. When Satcom is

  5. Satcom access in the evolved packet core

    NARCIS (Netherlands)

    Cano, M.D.; Norp, A.H.J.; Popova, M.P.

    2012-01-01

    Satellite communications (Satcom) networks are increasingly integrating with terrestrial communications networks, namely Next Generation Networks (NGN). In the area of NGN the Evolved Packet Core (EPC) is a new network architecture that can support multiple access technologies. When Satcom is

  6. Biomimetic molecular design tools that learn, evolve, and adapt

    Directory of Open Access Journals (Sweden)

    David A Winkler

    2017-06-01

    Full Text Available A dominant hallmark of living systems is their ability to adapt to changes in the environment by learning and evolving. Nature does this so superbly that intensive research efforts are now attempting to mimic biological processes. Initially this biomimicry involved developing synthetic methods to generate complex bioactive natural products. Recent work is attempting to understand how molecular machines operate so their principles can be copied, and learning how to employ biomimetic evolution and learning methods to solve complex problems in science, medicine and engineering. Automation, robotics, artificial intelligence, and evolutionary algorithms are now converging to generate what might broadly be called in silico-based adaptive evolution of materials. These methods are being applied to organic chemistry to systematize reactions, create synthesis robots to carry out unit operations, and to devise closed loop flow self-optimizing chemical synthesis systems. Most scientific innovations and technologies pass through the well-known “S curve”, with slow beginning, an almost exponential growth in capability, and a stable applications period. Adaptive, evolving, machine learning-based molecular design and optimization methods are approaching the period of very rapid growth and their impact is already being described as potentially disruptive. This paper describes new developments in biomimetic adaptive, evolving, learning computational molecular design methods and their potential impacts in chemistry, engineering, and medicine.

  7. Biomimetic molecular design tools that learn, evolve, and adapt

    Science.gov (United States)

    2017-01-01

    A dominant hallmark of living systems is their ability to adapt to changes in the environment by learning and evolving. Nature does this so superbly that intensive research efforts are now attempting to mimic biological processes. Initially this biomimicry involved developing synthetic methods to generate complex bioactive natural products. Recent work is attempting to understand how molecular machines operate so their principles can be copied, and learning how to employ biomimetic evolution and learning methods to solve complex problems in science, medicine and engineering. Automation, robotics, artificial intelligence, and evolutionary algorithms are now converging to generate what might broadly be called in silico-based adaptive evolution of materials. These methods are being applied to organic chemistry to systematize reactions, create synthesis robots to carry out unit operations, and to devise closed loop flow self-optimizing chemical synthesis systems. Most scientific innovations and technologies pass through the well-known “S curve”, with slow beginning, an almost exponential growth in capability, and a stable applications period. Adaptive, evolving, machine learning-based molecular design and optimization methods are approaching the period of very rapid growth and their impact is already being described as potentially disruptive. This paper describes new developments in biomimetic adaptive, evolving, learning computational molecular design methods and their potential impacts in chemistry, engineering, and medicine. PMID:28694872

  8. Higher rates of sex evolve in spatially heterogeneous environments.

    Science.gov (United States)

    Becks, Lutz; Agrawal, Aneil F

    2010-11-04

    The evolution and maintenance of sexual reproduction has puzzled biologists for decades. Although this field is rich in hypotheses, experimental evidence is scarce. Some important experiments have demonstrated differences in evolutionary rates between sexual and asexual populations; other experiments have documented evolutionary changes in phenomena related to genetic mixing, such as recombination and selfing. However, direct experiments of the evolution of sex within populations are extremely rare (but see ref. 12). Here we use the rotifer, Brachionus calyciflorus, which is capable of both sexual and asexual reproduction, to test recent theory predicting that there is more opportunity for sex to evolve in spatially heterogeneous environments. Replicated experimental populations of rotifers were maintained in homogeneous environments, composed of either high- or low-quality food habitats, or in heterogeneous environments that consisted of a mix of the two habitats. For populations maintained in either type of homogeneous environment, the rate of sex evolves rapidly towards zero. In contrast, higher rates of sex evolve in populations experiencing spatially heterogeneous environments. The data indicate that the higher level of sex observed under heterogeneity is not due to sex being less costly or selection against sex being less efficient; rather sex is sufficiently advantageous in heterogeneous environments to overwhelm its inherent costs. Counter to some alternative theories for the evolution of sex, there is no evidence that genetic drift plays any part in the evolution of sex in these populations.

  9. Evolving effective incremental SAT solvers with GP

    OpenAIRE

    Bader, Mohamed; Poli, R.

    2008-01-01

    Hyper-Heuristics could simply be defined as heuristics to choose other heuristics, and it is a way of combining existing heuristics to generate new ones. In a Hyper-Heuristic framework, the framework is used for evolving effective incremental (Inc*) solvers for SAT. We test the evolved heuristics (IncHH) against other known local search heuristics on a variety of benchmark SAT problems.

  10. Enzymatic Ligation of Large Biomolecules to DNA

    DEFF Research Database (Denmark)

    Sørensen, Rasmus Schøler; Okholm, Anders Hauge; Schaffert, David Henning

    2013-01-01

    The ability to synthesize, characterize, and manipulate DNA forms the foundation of a range of advanced disciplines including genomics, molecular biology, and biomolecular engineering. In particular for the latter field, DNA has proven useful as a structural or functional component in nanoscale s....... As a proof of principle, parallelly labeled oligonucleotides were used to produce nanopatterned DNA origami structures, demonstrating rapid and versatile incorporation of non-DNA components into DNA nanoarchitectures....

  11. Mechanisms of DNA uptake by cells

    Energy Technology Data Exchange (ETDEWEB)

    Lacks, S.A.

    1977-01-01

    Three categories of cellular uptake of DNA can be distinguished. First, in the highly transformable bacteria, such as Diplococcus pneumoniae, Haemophilus influenzae and Bacillus subtilis, elaborate mechanisms of DNA transport have evolved, presumably for the purpose of genetic exchange. These mechanisms can introduce substantial amounts of DNA into the cell. Second, methods have been devised for the forced introduction of DNA by manipulation of bacterial cells under nonphysiological conditions. By such means small but significant amounts of DNA have been introduced into various bacteria, including Escherichia coli. Third, mammalian cells are able to take up biologically active DNA. This has been most clearly demonstrated with viral DNA, although the mechanism of uptake is not well understood. The intention, here, is to survey current understanding of the various mechanisms of DNA uptake. A review of experience with the bacterial systems may throw some light on the mammalian system and lead to suggestions for enhancing DNA uptake by mammalian cells.

  12. Application of a random walk model to geographic distributions of animal mitochondrial DNA variation.

    Science.gov (United States)

    Neigel, J E; Avise, J C

    1993-12-01

    In rapidly evolving molecules, such as animal mitochondrial DNA, mutations that delineate specific lineages may not be dispersed at sufficient rates to attain an equilibrium between genetic drift and gene flow. Here we predict conditions that lead to nonequilibrium geographic distributions of mtDNA lineages, test the robustness of these predictions and examine mtDNA data sets for consistency with our model. Under a simple isolation by distance model, the variance of an mtDNA lineage's geographic distribution is expected be proportional to its age. Simulation results indicated that this relationship is fairly robust. Analysis of mtDNA data from natural populations revealed three qualitative distributional patterns: (1) significant departure of lineage structure from equilibrium geographic distributions, a pattern exhibited in three rodent species with limited dispersal; (2) nonsignificant departure from equilibrium expectations, exhibited by two avian and two marine fish species with potentials for relatively long-distance dispersal; and (3) a progression from nonequilibrium distributions for younger lineages to equilibrium distributions for older lineages, a condition displayed by one surveyed avian species. These results demonstrate the advantages of considering mutation and genealogy in the interpretation of mtDNA geographic variation.

  13. Evolving Intelligent Systems Methodology and Applications

    CERN Document Server

    Angelov, Plamen; Kasabov, Nik

    2010-01-01

    From theory to techniques, the first all-in-one resource for EIS. There is a clear demand in advanced process industries, defense, and Internet and communication (VoIP) applications for intelligent yet adaptive/evolving systems. Evolving Intelligent Systems is the first self- contained volume that covers this newly established concept in its entirety, from a systematic methodology to case studies to industrial applications. Featuring chapters written by leading world experts, it addresses the progress, trends, and major achievements in this emerging research field, with a strong emphasis on th

  14. Interactively Evolving Compositional Sound Synthesis Networks

    DEFF Research Database (Denmark)

    Jónsson, Björn Þór; Hoover, Amy K.; Risi, Sebastian

    2015-01-01

    the space of potential sounds that can be generated through such compositional sound synthesis networks (CSSNs). To study the effect of evolution on subjective appreciation, participants in a listener study ranked evolved timbres by personal preference, resulting in preferences skewed toward the first......While the success of electronic music often relies on the uniqueness and quality of selected timbres, many musicians struggle with complicated and expensive equipment and techniques to create their desired sounds. Instead, this paper presents a technique for producing novel timbres that are evolved...

  15. On the Benefits of Divergent Search for Evolved Representations

    DEFF Research Database (Denmark)

    Lehman, Joel; Risi, Sebastian; Stanley, Kenneth O

    2012-01-01

    Evolved representations in evolutionary computation are often fragile, which can impede representation-dependent mechanisms such as self-adaptation. In contrast, evolved representations in nature are robust, evolvable, and creatively exploit available representational features. This paper provide...

  16. Preface: evolving rotifers, evolving science: Proceedings of the XIV International Rotifer Symposium

    Czech Academy of Sciences Publication Activity Database

    Devetter, Miloslav; Fontaneto, D.; Jersabek, Ch.D.; Welch, D.B.M.; May, L.; Walsh, E.J.

    2017-01-01

    Roč. 796, č. 1 (2017), s. 1-6 ISSN 0018-8158 Institutional support: RVO:60077344 Keywords : evolving rotifers * 14th International Rotifer Symposium * evolving science Subject RIV: EG - Zoology OBOR OECD: Zoology Impact factor: 2.056, year: 2016

  17. An oxygen-rich dust disk surrounding an evolved star in the Red Rectangle

    NARCIS (Netherlands)

    Waters, LBFM; Waelkens, C; van Winckel, H; Molster, FJ; Tielens, AGGM; van Loon, JT; Morris, PW; Cami, J; Bouwman, J; de Koter, A; de Jong, T; de Graauw, T

    1998-01-01

    The Red Rectangle(1) is the prototype of a class of carbon-rich reflection nebulae surrounding low-mass stars in the final stages of evolution. The central star of this nebula has ejected most of its layers (during the red-giant phase), which now form the surrounding cloud, and is rapidly evolving

  18. Views on Evolvability of Embedded Systems

    NARCIS (Netherlands)

    Laar, P. van de; Punter, T.

    2011-01-01

    Evolvability, the ability to respond effectively to change, represents a major challenge to today's high-end embedded systems, such as those developed in the medical domain by Philips Healthcare. These systems are typically developed by multi-disciplinary teams, located around the world, and are in

  19. Views on evolvability of embedded systems

    NARCIS (Netherlands)

    Laar, van de P.J.L.J.; Punter, H.T.

    2011-01-01

    Evolvability, the ability to respond effectively to change, represents a major challenge to today's high-end embedded systems, such as those developed in the medical domain by Philips Healthcare. These systems are typically developed by multi-disciplinary teams, located around the world, and are in

  20. Designing Garments to Evolve Over Time

    DEFF Research Database (Denmark)

    Riisberg, Vibeke; Grose, Lynda

    2017-01-01

    This paper proposes a REDO of the current fashion paradigm by investigating how garments might be designed to evolve over time. The purpose is to discuss ways of expanding the traditional role of the designer to include temporal dimensions of creating, producing and using clothes and to suggest...... to a REDO of design education, to further research and the future fashion and textile industry....

  1. EVOLVING AN EMPIRICAL METHODOLOGY DOR DETERMINING ...

    African Journals Online (AJOL)

    The uniqueness of this approach, is that it can be applied to any forest or dynamic feature on the earth, and can enjoy universal application as well. KEY WORDS: Evolving empirical methodology, innovative mathematical model, appropriate interval, remote sensing, forest environment planning and management. Global Jnl ...

  2. Continual Learning through Evolvable Neural Turing Machines

    DEFF Research Database (Denmark)

    Lüders, Benno; Schläger, Mikkel; Risi, Sebastian

    2016-01-01

    Continual learning, i.e. the ability to sequentially learn tasks without catastrophic forgetting of previously learned ones, is an important open challenge in machine learning. In this paper we take a step in this direction by showing that the recently proposed Evolving Neural Turing Machine (ENTM...

  3. Did Language Evolve Like the Vertebrate Eye?

    Science.gov (United States)

    Botha, Rudolf P.

    2002-01-01

    Offers a critical appraisal of the way in which the idea that human language or some of its features evolved like the vertebrate eye by natural selection is articulated in Pinker and Bloom's (1990) selectionist account of language evolution. Argues that this account is less than insightful because it fails to draw some of the conceptual…

  4. Foldability of a Natural De Novo Evolved Protein.

    Science.gov (United States)

    Bungard, Dixie; Copple, Jacob S; Yan, Jing; Chhun, Jimmy J; Kumirov, Vlad K; Foy, Scott G; Masel, Joanna; Wysocki, Vicki H; Cordes, Matthew H J

    2017-11-07

    The de novo evolution of protein-coding genes from noncoding DNA is emerging as a source of molecular innovation in biology. Studies of random sequence libraries, however, suggest that young de novo proteins will not fold into compact, specific structures typical of native globular proteins. Here we show that Bsc4, a functional, natural de novo protein encoded by a gene that evolved recently from noncoding DNA in the yeast S. cerevisiae, folds to a partially specific three-dimensional structure. Bsc4 forms soluble, compact oligomers with high β sheet content and a hydrophobic core, and undergoes cooperative, reversible denaturation. Bsc4 lacks a specific quaternary state, however, existing instead as a continuous distribution of oligomer sizes, and binds dyes indicative of amyloid oligomers or molten globules. The combination of native-like and non-native-like properties suggests a rudimentary fold that could potentially act as a functional intermediate in the emergence of new folded proteins de novo. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Forces shaping the fastest evolving regions in the human genome.

    Directory of Open Access Journals (Sweden)

    Katherine S Pollard

    2006-10-01

    Full Text Available Comparative genomics allow us to search the human genome for segments that were extensively changed in the last approximately 5 million years since divergence from our common ancestor with chimpanzee, but are highly conserved in other species and thus are likely to be functional. We found 202 genomic elements that are highly conserved in vertebrates but show evidence of significantly accelerated substitution rates in human. These are mostly in non-coding DNA, often near genes associated with transcription and DNA binding. Resequencing confirmed that the five most accelerated elements are dramatically changed in human but not in other primates, with seven times more substitutions in human than in chimp. The accelerated elements, and in particular the top five, show a strong bias for adenine and thymine to guanine and cytosine nucleotide changes and are disproportionately located in high recombination and high guanine and cytosine content environments near telomeres, suggesting either biased gene conversion or isochore selection. In addition, there is some evidence of directional selection in the regions containing the two most accelerated regions. A combination of evolutionary forces has contributed to accelerated evolution of the fastest evolving elements in the human genome.

  6. The DNA Files

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-06-09

    The DNA Files is a radio documentary which disseminates genetics information over public radio. The documentaries explore subjects which include the following: How genetics affects society. How human life began and how it evolved. Could new prenatal genetic tests hold the key to disease prevention later in life? Would a national genetic data base sacrifice individual privacy? and Should genes that may lead to the cure for cancer be privately owned? This report serves as a project update for the second quarter of 1998. It includes the spring/summer 1998 newsletter, the winter 1998 newsletter, the program clock, and the latest flyer.

  7. Evolving technologies drive the new roles of Biomedical Engineering.

    Science.gov (United States)

    Frisch, P H; St Germain, J; Lui, W

    2008-01-01

    Rapidly changing technology coupled with the financial impact of organized health care, has required hospital Biomedical Engineering organizations to augment their traditional operational and business models to increase their role in developing enhanced clinical applications utilizing new and evolving technologies. The deployment of these technology based applications has required Biomedical Engineering organizations to re-organize to optimize the manner in which they provide and manage services. Memorial Sloan-Kettering Cancer Center has implemented a strategy to explore evolving technologies integrating them into enhanced clinical applications while optimally utilizing the expertise of the traditional Biomedical Engineering component (Clinical Engineering) to provide expanded support in technology / equipment management, device repair, preventive maintenance and integration with legacy clinical systems. Specifically, Biomedical Engineering is an integral component of the Medical Physics Department which provides comprehensive and integrated support to the Center in advanced physical, technical and engineering technology. This organizational structure emphasizes the integration and collaboration between a spectrum of technical expertise for clinical support and equipment management roles. The high cost of clinical equipment purchases coupled with the increasing cost of service has driven equipment management responsibilities to include significant business and financial aspects to provide a cost effective service model. This case study details the dynamics of these expanded roles, future initiatives and benefits for Biomedical Engineering and Memorial Sloan Kettering Cancer Center.

  8. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  9. Data on haplotype diversity in the hypervariable region I, II and III of mtDNA amongst the Brahmin population of Haryana

    Directory of Open Access Journals (Sweden)

    Kapil Verma

    2018-04-01

    Full Text Available Human mitochondrial DNA (mtDNA is routinely analysed for pathogenic mutations, evolutionary studies, estimation of time of divergence within or between species, phylogenetic studies and identification of degraded remains. The data on various regions of human mtDNA has added enormously to the knowledge pool of population genetics as well as forensic genetics. The displacement-loop (D-loop in the control region of mtDNA is rated as the most rapidly evolving part, due to the presence of variations in this region. The control region consists of three hypervariable regions. These hypervariable regions (HVI, HVII and HVIII tend to mutate 5–10 times faster than nuclear DNA. The high mutation rate of these hypervariable regions is used in population genetic studies and human identity testing. In the present data, potentially informative hypervariable regions of mitochondrial DNA (mtDNA i.e. HVI (np 16024–16365, HVII (np 73–340 and HVIII (np 438–576 were estimated to understand the genetic diversity amongst Brahmin population of Haryana. Blood samples had been collected from maternally unrelated individuals from the different districts of Haryana. An array of parameters comprising of polymorphic sites, transitions, transversions, deletions, gene diversity, nucleotide diversity, pairwise differences, Tajima's D test, Fu's Fs test, mismatch observed variance and expected heterozygosity were estimated. The observed polymorphisms with their respective haplogroups in comparison to rCRS were assigned. Keywords: Mitochondrial DNA, D-loop, Hypervariable regions, Forensic genetics

  10. Environmental Noise, Genetic Diversity and the Evolution of Evolvability and Robustness in Model Gene Networks

    Science.gov (United States)

    Steiner, Christopher F.

    2012-01-01

    The ability of organisms to adapt and persist in the face of environmental change is accepted as a fundamental feature of natural systems. More contentious is whether the capacity of organisms to adapt (or “evolvability”) can itself evolve and the mechanisms underlying such responses. Using model gene networks, I provide evidence that evolvability emerges more readily when populations experience positively autocorrelated environmental noise (red noise) compared to populations in stable or randomly varying (white noise) environments. Evolvability was correlated with increasing genetic robustness to effects on network viability and decreasing robustness to effects on phenotypic expression; populations whose networks displayed greater viability robustness and lower phenotypic robustness produced more additive genetic variation and adapted more rapidly in novel environments. Patterns of selection for robustness varied antagonistically with epistatic effects of mutations on viability and phenotypic expression, suggesting that trade-offs between these properties may constrain their evolutionary responses. Evolution of evolvability and robustness was stronger in sexual populations compared to asexual populations indicating that enhanced genetic variation under fluctuating selection combined with recombination load is a primary driver of the emergence of evolvability. These results provide insight into the mechanisms potentially underlying rapid adaptation as well as the environmental conditions that drive the evolution of genetic interactions. PMID:23284934

  11. The evolving definition of systemic arterial hypertension.

    Science.gov (United States)

    Ram, C Venkata S; Giles, Thomas D

    2010-05-01

    Systemic hypertension is an important risk factor for premature cardiovascular disease. Hypertension also contributes to excessive morbidity and mortality. Whereas excellent therapeutic options are available to treat hypertension, there is an unsettled issue about the very definition of hypertension. At what level of blood pressure should we treat hypertension? Does the definition of hypertension change in the presence of co-morbid conditions? This article covers in detail the evolving concepts in the diagnosis and management of hypertension.

  12. The evolving epidemiology of inflammatory bowel disease.

    LENUS (Irish Health Repository)

    Shanahan, Fergus

    2009-07-01

    Epidemiologic studies in inflammatory bowel disease (IBD) include assessments of disease burden and evolving patterns of disease presentation. Although it is hoped that sound epidemiologic studies provide aetiological clues, traditional risk factor-based epidemiology has provided limited insights into either Crohn\\'s disease or ulcerative colitis etiopathogenesis. In this update, we will summarize how the changing epidemiology of IBD associated with modernization can be reconciled with current concepts of disease mechanisms and will discuss studies of clinically significant comorbidity in IBD.

  13. Development and the evolvability of human limbs

    OpenAIRE

    Young, Nathan M.; Wagner, Günter P.; Hallgrímsson, Benedikt

    2010-01-01

    The long legs and short arms of humans are distinctive for a primate, the result of selection acting in opposite directions on each limb at different points in our evolutionary history. This mosaic pattern challenges our understanding of the relationship of development and evolvability because limbs are serially homologous and genetic correlations should act as a significant constraint on their independent evolution. Here we test a developmental model of limb covariation in anthropoid primate...

  14. Quantum games on evolving random networks

    OpenAIRE

    Pawela, Łukasz

    2015-01-01

    We study the advantages of quantum strategies in evolutionary social dilemmas on evolving random networks. We focus our study on the two-player games: prisoner's dilemma, snowdrift and stag-hunt games. The obtained result show the benefits of quantum strategies for the prisoner's dilemma game. For the other two games, we obtain regions of parameters where the quantum strategies dominate, as well as regions where the classical strategies coexist.

  15. The Evolving Leadership Path of Visual Analytics

    Energy Technology Data Exchange (ETDEWEB)

    Kluse, Michael; Peurrung, Anthony J.; Gracio, Deborah K.

    2012-01-02

    This is a requested book chapter for an internationally authored book on visual analytics and related fields, coordianted by a UK university and to be published by Springer in 2012. This chapter is an overview of the leadship strategies that PNNL's Jim Thomas and other stakeholders used to establish visual analytics as a field, and how those strategies may evolve in the future.

  16. Evolving artificial metalloenzymes via random mutagenesis

    Science.gov (United States)

    Yang, Hao; Swartz, Alan M.; Park, Hyun June; Srivastava, Poonam; Ellis-Guardiola, Ken; Upp, David M.; Lee, Gihoon; Belsare, Ketaki; Gu, Yifan; Zhang, Chen; Moellering, Raymond E.; Lewis, Jared C.

    2018-03-01

    Random mutagenesis has the potential to optimize the efficiency and selectivity of protein catalysts without requiring detailed knowledge of protein structure; however, introducing synthetic metal cofactors complicates the expression and screening of enzyme libraries, and activity arising from free cofactor must be eliminated. Here we report an efficient platform to create and screen libraries of artificial metalloenzymes (ArMs) via random mutagenesis, which we use to evolve highly selective dirhodium cyclopropanases. Error-prone PCR and combinatorial codon mutagenesis enabled multiplexed analysis of random mutations, including at sites distal to the putative ArM active site that are difficult to identify using targeted mutagenesis approaches. Variants that exhibited significantly improved selectivity for each of the cyclopropane product enantiomers were identified, and higher activity than previously reported ArM cyclopropanases obtained via targeted mutagenesis was also observed. This improved selectivity carried over to other dirhodium-catalysed transformations, including N-H, S-H and Si-H insertion, demonstrating that ArMs evolved for one reaction can serve as starting points to evolve catalysts for others.

  17. CMIP6 Data Citation of Evolving Data

    Directory of Open Access Journals (Sweden)

    Martina Stockhause

    2017-06-01

    Full Text Available Data citations have become widely accepted. Technical infrastructures as well as principles and recommendations for data citation are in place but best practices or guidelines for their implementation are not yet available. On the other hand, the scientific climate community requests early citations on evolving data for credit, e.g. for CMIP6 (Coupled Model Intercomparison Project Phase 6. The data citation concept for CMIP6 is presented. The main challenges lie in limited resources, a strict project timeline and the dependency on changes of the data dissemination infrastructure ESGF (Earth System Grid Federation to meet the data citation requirements. Therefore a pragmatic, flexible and extendible approach for the CMIP6 data citation service was developed, consisting of a citation for the full evolving data superset and a data cart approach for citing the concrete used data subset. This two citation approach can be implemented according to the RDA recommendations for evolving data. Because of resource constraints and missing project policies, the implementation of the second part of the citation concept is postponed to CMIP7.

  18. Mechanisms of bacterial DNA replication restart

    Science.gov (United States)

    Windgassen, Tricia A; Wessel, Sarah R; Bhattacharyya, Basudeb

    2018-01-01

    Abstract Multi-protein DNA replication complexes called replisomes perform the essential process of copying cellular genetic information prior to cell division. Under ideal conditions, replisomes dissociate only after the entire genome has been duplicated. However, DNA replication rarely occurs without interruptions that can dislodge replisomes from DNA. Such events produce incompletely replicated chromosomes that, if left unrepaired, prevent the segregation of full genomes to daughter cells. To mitigate this threat, cells have evolvedDNA replication restart’ pathways that have been best defined in bacteria. Replication restart requires recognition and remodeling of abandoned replication forks by DNA replication restart proteins followed by reloading of the replicative DNA helicase, which subsequently directs assembly of the remaining replisome subunits. This review summarizes our current understanding of the mechanisms underlying replication restart and the proteins that drive the process in Escherichia coli (PriA, PriB, PriC and DnaT). PMID:29202195

  19. Photochemical Acceleration of DNA Strand Displacement by Using Ultrafast DNA Photo-crosslinking.

    Science.gov (United States)

    Nakamura, Shigetaka; Hashimoto, Hirokazu; Kobayashi, Satoshi; Fujimoto, Kenzo

    2017-10-18

    DNA strand displacement is an essential reaction in genetic recombination, biological processes, and DNA nanotechnology. In particular, various DNA nanodevices enable complicated calculations. However, it takes time before the output is obtained, so acceleration of DNA strand displacement is required for a rapid-response DNA nanodevice. Herein, DNA strand displacement by using DNA photo-crosslinking to accelerate this displacement is evaluated. The DNA photo-crosslinking of 3-cyanovinylcarbazole ( CNV K) was accelerated at least 20 times, showing a faster DNA strand displacement. The rate of photo-crosslinking is a key factor and the rate of DNA strand displacement is accelerated through ultrafast photo-crosslinking. The rate of DNA strand displacement was regulated by photoirradiation energy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Uncoupling of satellite DNA and centromeric function in the genus Equus.

    Science.gov (United States)

    Piras, Francesca M; Nergadze, Solomon G; Magnani, Elisa; Bertoni, Livia; Attolini, Carmen; Khoriauli, Lela; Raimondi, Elena; Giulotto, Elena

    2010-02-12

    In a previous study, we showed that centromere repositioning, that is the shift along the chromosome of the centromeric function without DNA sequence rearrangement, has occurred frequently during the evolution of the genus Equus. In this work, the analysis of the chromosomal distribution of satellite tandem repeats in Equus caballus, E. asinus, E. grevyi, and E. burchelli highlighted two atypical features: 1) several centromeres, including the previously described evolutionary new centromeres (ENCs), seem to be devoid of satellite DNA, and 2) satellite repeats are often present at non-centromeric termini, probably corresponding to relics of ancestral now inactive centromeres. Immuno-FISH experiments using satellite DNA and antibodies against the kinetochore protein CENP-A demonstrated that satellite-less primary constrictions are actually endowed with centromeric function. The phylogenetic reconstruction of centromere repositioning events demonstrates that the acquisition of satellite DNA occurs after the formation of the centromere during evolution and that centromeres can function over millions of years and many generations without detectable satellite DNA. The rapidly evolving Equus species gave us the opportunity to identify different intermediate steps along the full maturation of ENCs.

  1. Uncoupling of satellite DNA and centromeric function in the genus Equus.

    Directory of Open Access Journals (Sweden)

    Francesca M Piras

    2010-02-01

    Full Text Available In a previous study, we showed that centromere repositioning, that is the shift along the chromosome of the centromeric function without DNA sequence rearrangement, has occurred frequently during the evolution of the genus Equus. In this work, the analysis of the chromosomal distribution of satellite tandem repeats in Equus caballus, E. asinus, E. grevyi, and E. burchelli highlighted two atypical features: 1 several centromeres, including the previously described evolutionary new centromeres (ENCs, seem to be devoid of satellite DNA, and 2 satellite repeats are often present at non-centromeric termini, probably corresponding to relics of ancestral now inactive centromeres. Immuno-FISH experiments using satellite DNA and antibodies against the kinetochore protein CENP-A demonstrated that satellite-less primary constrictions are actually endowed with centromeric function. The phylogenetic reconstruction of centromere repositioning events demonstrates that the acquisition of satellite DNA occurs after the formation of the centromere during evolution and that centromeres can function over millions of years and many generations without detectable satellite DNA. The rapidly evolving Equus species gave us the opportunity to identify different intermediate steps along the full maturation of ENCs.

  2. Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.

    Science.gov (United States)

    Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří

    2016-11-01

    Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.

  3. Altruistic functions for selfish DNA.

    Science.gov (United States)

    Faulkner, Geoffrey J; Carninci, Piero

    2009-09-15

    Mammalian genomes are comprised of 30-50% transposed elements (TEs). The vast majority of these TEs are truncated and mutated fragments of retrotransposons that are no longer capable of transposition. Although initially regarded as important factors in the evolution of gene regulatory networks, TEs are now commonly perceived as neutrally evolving and non-functional genomic elements. In a major development, recent works have strongly contradicted this "selfish DNA" or "junk DNA" dogma by demonstrating that TEs use a host of novel promoters to generate RNA on a massive scale across most eukaryotic cells. This transcription frequently functions to control the expression of protein-coding genes via alternative promoters, cis regulatory non protein-coding RNAs and the formation of double stranded short RNAs. If considered in sum, these findings challenge the designation of TEs as selfish and neutrally evolving genomic elements. Here, we will expand upon these themes and discuss challenges in establishing novel TE functions in vivo.

  4. Evolvability Is an Evolved Ability: The Coding Concept as the Arch-Unit of Natural Selection.

    Science.gov (United States)

    Janković, Srdja; Ćirković, Milan M

    2016-03-01

    Physical processes that characterize living matter are qualitatively distinct in that they involve encoding and transfer of specific types of information. Such information plays an active part in the control of events that are ultimately linked to the capacity of the system to persist and multiply. This algorithmicity of life is a key prerequisite for its Darwinian evolution, driven by natural selection acting upon stochastically arising variations of the encoded information. The concept of evolvability attempts to define the total capacity of a system to evolve new encoded traits under appropriate conditions, i.e., the accessible section of total morphological space. Since this is dependent on previously evolved regulatory networks that govern information flow in the system, evolvability itself may be regarded as an evolved ability. The way information is physically written, read and modified in living cells (the "coding concept") has not changed substantially during the whole history of the Earth's biosphere. This biosphere, be it alone or one of many, is, accordingly, itself a product of natural selection, since the overall evolvability conferred by its coding concept (nucleic acids as information carriers with the "rulebook of meanings" provided by codons, as well as all the subsystems that regulate various conditional information-reading modes) certainly played a key role in enabling this biosphere to survive up to the present, through alterations of planetary conditions, including at least five catastrophic events linked to major mass extinctions. We submit that, whatever the actual prebiotic physical and chemical processes may have been on our home planet, or may, in principle, occur at some time and place in the Universe, a particular coding concept, with its respective potential to give rise to a biosphere, or class of biospheres, of a certain evolvability, may itself be regarded as a unit (indeed the arch-unit) of natural selection.

  5. Revealing evolved massive stars with Spitzer

    Science.gov (United States)

    Gvaramadze, V. V.; Kniazev, A. Y.; Fabrika, S.

    2010-06-01

    Massive evolved stars lose a large fraction of their mass via copious stellar wind or instant outbursts. During certain evolutionary phases, they can be identified by the presence of their circumstellar nebulae. In this paper, we present the results of a search for compact nebulae (reminiscent of circumstellar nebulae around evolved massive stars) using archival 24-μm data obtained with the Multiband Imaging Photometer for Spitzer. We have discovered 115 nebulae, most of which bear a striking resemblance to the circumstellar nebulae associated with luminous blue variables (LBVs) and late WN-type (WNL) Wolf-Rayet (WR) stars in the Milky Way and the Large Magellanic Cloud (LMC). We interpret this similarity as an indication that the central stars of detected nebulae are either LBVs or related evolved massive stars. Our interpretation is supported by follow-up spectroscopy of two dozen of these central stars, most of which turn out to be either candidate LBVs (cLBVs), blue supergiants or WNL stars. We expect that the forthcoming spectroscopy of the remaining objects from our list, accompanied by the spectrophotometric monitoring of the already discovered cLBVs, will further increase the known population of Galactic LBVs. This, in turn, will have profound consequences for better understanding the LBV phenomenon and its role in the transition between hydrogen-burning O stars and helium-burning WR stars. We also report on the detection of an arc-like structure attached to the cLBV HD 326823 and an arc associated with the LBV R99 (HD 269445) in the LMC. Partially based on observations collected at the German-Spanish Astronomical Centre, Calar Alto, jointly operated by the Max-Planck-Institut für Astronomie Heidelberg and the Instituto de Astrofísica de Andalucía (CSIC). E-mail: vgvaram@mx.iki.rssi.ru (VVG); akniazev@saao.ac.za (AYK); fabrika@sao.ru (SF)

  6. Evolving Random Forest for Preference Learning

    DEFF Research Database (Denmark)

    Abou-Zleikha, Mohamed; Shaker, Noor

    2015-01-01

    This paper introduces a novel approach for pairwise preference learning through a combination of an evolutionary method and random forest. Grammatical evolution is used to describe the structure of the trees in the Random Forest (RF) and to handle the process of evolution. Evolved random forests ...... obtained for predicting pairwise self-reports of users for the three emotional states engagement, frustration and challenge show very promising results that are comparable and in some cases superior to those obtained from state-of-the-art methods....

  7. An evolving network model with community structure

    International Nuclear Information System (INIS)

    Li Chunguang; Maini, Philip K

    2005-01-01

    Many social and biological networks consist of communities-groups of nodes within which connections are dense, but between which connections are sparser. Recently, there has been considerable interest in designing algorithms for detecting community structures in real-world complex networks. In this paper, we propose an evolving network model which exhibits community structure. The network model is based on the inner-community preferential attachment and inter-community preferential attachment mechanisms. The degree distributions of this network model are analysed based on a mean-field method. Theoretical results and numerical simulations indicate that this network model has community structure and scale-free properties

  8. Radio Imaging of Envelopes of Evolved Stars

    Science.gov (United States)

    Cotton, Bill

    2018-04-01

    This talk will cover imaging of stellar envelopes using radio VLBI techniques; special attention will be paid to the technical differences between radio and optical/IR interferomery. Radio heterodyne receivers allow a straightforward way to derive spectral cubes and full polarization observations. Milliarcsecond resolution of very bright, i.e. non thermal, emission of molecular masers in the envelopes of evolved stars can be achieved using VLBI techniques with baselines of thousands of km. Emission from SiO, H2O and OH masers are commonly seen at increasing distance from the photosphere. The very narrow maser lines allow accurate measurements of the velocity field within the emitting region.

  9. Mobile computing acceptance grows as applications evolve.

    Science.gov (United States)

    Porn, Louis M; Patrick, Kelly

    2002-01-01

    Handheld devices are becoming more cost-effective to own, and their use in healthcare environments is increasing. Handheld devices currently are being used for e-prescribing, charge capture, and accessing daily schedules and reference tools. Future applications may include education on medications, dictation, order entry, and test-results reporting. Selecting the right handheld device requires careful analysis of current and future applications, as well as vendor expertise. It is important to recognize the technology will continue to evolve over the next three years.

  10. Evolved Minimal Frustration in Multifunctional Biomolecules.

    Science.gov (United States)

    Röder, Konstantin; Wales, David J

    2018-05-25

    Protein folding is often viewed in terms of a funnelled potential or free energy landscape. A variety of experiments now indicate the existence of multifunnel landscapes, associated with multifunctional biomolecules. Here, we present evidence that these systems have evolved to exhibit the minimal number of funnels required to fulfil their cellular functions, suggesting an extension to the principle of minimum frustration. We find that minimal disruptive mutations result in additional funnels, and the associated structural ensembles become more diverse. The same trends are observed in an atomic cluster. These observations suggest guidelines for rational design of engineered multifunctional biomolecules.

  11. SALT Spectroscopy of Evolved Massive Stars

    Science.gov (United States)

    Kniazev, A. Y.; Gvaramadze, V. V.; Berdnikov, L. N.

    2017-06-01

    Long-slit spectroscopy with the Southern African Large Telescope (SALT) of central stars of mid-infrared nebulae detected with the Spitzer Space Telescope and Wide-Field Infrared Survey Explorer (WISE) led to the discovery of numerous candidate luminous blue variables (cLBVs) and other rare evolved massive stars. With the recent advent of the SALT fiber-fed high-resolution echelle spectrograph (HRS), a new perspective for the study of these interesting objects is appeared. Using the HRS we obtained spectra of a dozen newly identified massive stars. Some results on the recently identified cLBV Hen 3-729 are presented.

  12. DNA Camouflage

    Science.gov (United States)

    2016-01-08

    1 DNA Camouflage Supplementary Information Bijan Zakeri1,2*, Timothy K. Lu1,2*, Peter A. Carr2,3* 1Department of Electrical Engineering and...ll.mit.edu). Distribution A: Public Release   2 Supplementary Figure 1 DNA camouflage with the 2-state device. (a) In the presence of Cre, DSD-2[α...10 1 + Cre 1 500 1,000 length (bp) chromatogram alignment template − Cre   4 Supplementary Figure 3 DNA camouflage with a switchable

  13. The future of forensic DNA analysis

    Science.gov (United States)

    Butler, John M.

    2015-01-01

    The author's thoughts and opinions on where the field of forensic DNA testing is headed for the next decade are provided in the context of where the field has come over the past 30 years. Similar to the Olympic motto of ‘faster, higher, stronger’, forensic DNA protocols can be expected to become more rapid and sensitive and provide stronger investigative potential. New short tandem repeat (STR) loci have expanded the core set of genetic markers used for human identification in Europe and the USA. Rapid DNA testing is on the verge of enabling new applications. Next-generation sequencing has the potential to provide greater depth of coverage for information on STR alleles. Familial DNA searching has expanded capabilities of DNA databases in parts of the world where it is allowed. Challenges and opportunities that will impact the future of forensic DNA are explored including the need for education and training to improve interpretation of complex DNA profiles. PMID:26101278

  14. HIV Maintains an Evolving and Dispersed Population in Multiple Tissues during Suppressive Combined Antiretroviral Therapy in Individuals with Cancer.

    Science.gov (United States)

    Rose, Rebecca; Lamers, Susanna L; Nolan, David J; Maidji, Ekaterina; Faria, N R; Pybus, Oliver G; Dollar, James J; Maruniak, Samuel A; McAvoy, Andrew C; Salemi, Marco; Stoddart, Cheryl A; Singer, Elyse J; McGrath, Michael S

    2016-10-15

    While combined antiretroviral therapy (cART) can result in undetectable plasma viral loads, it does not eradicate HIV infection. Furthermore, HIV-infected individuals while on cART remain at an increased risk of developing serious comorbidities, such as cancer, neurological disease, and atherosclerosis, suggesting that during cART, tissue-based HIV may contribute to such pathologies. We obtained DNA and RNA env, nef, and pol sequences using single-genome sequencing from postmortem tissues of three HIV(+) cART-treated (cART(+)) individuals with undetectable viral load and metastatic cancer at death and performed time-scaled Bayesian evolutionary analyses. We used a sensitive in situ hybridization technique to visualize HIV gag-pol mRNA transcripts in cerebellum and lymph node tissues from one patient. Tissue-associated virus evolved at similar rates in cART(+) and cART-naive (cART(-)) patients. Phylogenetic trees were characterized by two distinct features: (i) branching patterns consistent with constant viral evolution and dispersal among tissues and (ii) very recently derived clades containing both DNA and RNA sequences from multiple tissues. Rapid expansion of virus near death corresponded to wide-spread metastasis. HIV RNA(+) cells clustered in cerebellum tissue but were dispersed in lymph node tissue, mirroring the evolutionary patterns observed for that patient. Activated, infiltrating macrophages were associated with HIV RNA. Our data provide evidence that tissues serve as a sanctuary for wild-type HIV during cART and suggest the importance of macrophages as an alternative reservoir and mechanism of virus spread. Combined antiretroviral therapy (cART) reduces plasma HIV to undetectable levels; however, removal of cART results in plasma HIV rebound, thus highlighting its inability to entirely rid the body of infection. Additionally, HIV-infected individuals on cART remain at high risk of serious diseases, which suggests a contribution from residual HIV. In

  15. Differential recruitment of DNA Ligase I and III to DNA repair sites

    Science.gov (United States)

    Mortusewicz, Oliver; Rothbauer, Ulrich; Cardoso, M. Cristina; Leonhardt, Heinrich

    2006-01-01

    DNA ligation is an essential step in DNA replication, repair and recombination. Mammalian cells contain three DNA Ligases that are not interchangeable although they use the same catalytic reaction mechanism. To compare the recruitment of the three eukaryotic DNA Ligases to repair sites in vivo we introduced DNA lesions in human cells by laser microirradiation. Time lapse microscopy of fluorescently tagged proteins showed that DNA Ligase III accumulated at microirradiated sites before DNA Ligase I, whereas we could detect only a faint accumulation of DNA Ligase IV. Recruitment of DNA Ligase I and III to repair sites was cell cycle independent. Mutational analysis and binding studies revealed that DNA Ligase I was recruited to DNA repair sites by interaction with PCNA while DNA Ligase III was recruited via its BRCT domain mediated interaction with XRCC1. Selective recruitment of specialized DNA Ligases may have evolved to accommodate the particular requirements of different repair pathways and may thus enhance efficiency of DNA repair. PMID:16855289

  16. DNA repair in cancer: emerging targets for personalized therapy

    International Nuclear Information System (INIS)

    Abbotts, Rachel; Thompson, Nicola; Madhusudan, Srinivasan

    2014-01-01

    Genomic deoxyribonucleic acid (DNA) is under constant threat from endogenous and exogenous DNA damaging agents. Mammalian cells have evolved highly conserved DNA repair machinery to process DNA damage and maintain genomic integrity. Impaired DNA repair is a major driver for carcinogenesis and could promote aggressive cancer biology. Interestingly, in established tumors, DNA repair activity is required to counteract oxidative DNA damage that is prevalent in the tumor microenvironment. Emerging clinical data provide compelling evidence that overexpression of DNA repair factors may have prognostic and predictive significance in patients. More recently, DNA repair inhibition has emerged as a promising target for anticancer therapy. Synthetic lethality exploits intergene relationships where the loss of function of either of two related genes is nonlethal, but loss of both causes cell death. Exploiting this approach by targeting DNA repair has emerged as a promising strategy for personalized cancer therapy. In the current review, we focus on recent advances with a particular focus on synthetic lethality targeting in cancer

  17. Uptake of DNA by cancer cells without a transfection reagent

    Directory of Open Access Journals (Sweden)

    Yanping Kong

    Full Text Available Abstract Background Cancer cells exhibit elevated levels of glucose uptake and may obtain pre-formed, diet-derived fatty acids from the bloodstream to boost their rapid growth; they may also use nucleic acid from their microenvironment. The study of processing nucleic acid by cancer cells will help improve the understanding of the metabolism of cancer. DNA is commonly packaged into a viral or lipid particle to be transferred into cells; this process is called transfection in laboratory. Cancer cells are known for having gene mutations and the evolving ability of endocytosis. Their uptake of DNAs might be different from normal cells; they may take in DNAs directly from the environment. In this report, we studied the uptake of DNAs in cancer cells without a transfection reagent. Methods A group of DNA fragments were prepared with PCR and labeled with isotope phosphorous-32 to test their uptake by Huh 7 (liver cancer and THLE3 (normal liver cells after incubation overnight by counting radioactivity of the cells’ genomic DNA. Multiple cell lines including breast cancer and lung cancer were tested with the same method. DNA molecules were also labeled with fluorescence to test the location in the cells using a kit of “label it fluorescence in situ hybridization (FISH” from Mirus (USA. Results The data demonstrated that hepatocellular carcinoma cells possess the ability to take in large DNA fragments directly without a transfection reagent whereas normal liver cells cannot. Huh7 and MDA-MB231 cells displayed a significantly higher Rhodamine density in the cytoplasmic phagosomes and this suggests that the mechanism of uptake of large DNA by cancer cells is likely endocytosis. The efficacy of uptake is related to the DNA’s size. Some cell lines of lung cancer and breast cancer also showed similar uptake of DNA. Conclusions In the present study, we have revealed the evidence that some cancer cells, but not nontumorigenic cells, can take DNA

  18. BOOK REVIEW: OPENING SCIENCE, THE EVOLVING GUIDE ...

    Science.gov (United States)

    The way we get our funding, collaborate, do our research, and get the word out has evolved over hundreds of years but we can imagine a more open science world, largely facilitated by the internet. The movement towards this more open way of doing and presenting science is coming, and it is not taking hundreds of years. If you are interested in these trends, and would like to find out more about where this is all headed and what it means to you, consider downloding Opening Science, edited by Sönke Bartling and Sascha Friesike, subtitled The Evolving Guide on How the Internet is Changing Research, Collaboration, and Scholarly Publishing. In 26 chapters by various authors from a range of disciplines the book explores the developing world of open science, starting from the first scientific revolution and bringing us to the next scientific revolution, sometimes referred to as “Science 2.0”. Some of the articles deal with the impact of the changing landscape of how science is done, looking at the impact of open science on Academia, or journal publishing, or medical research. Many of the articles look at the uses, pitfalls, and impact of specific tools, like microblogging (think Twitter), social networking, and reference management. There is lots of discussion and definition of terms you might use or misuse like “altmetrics” and “impact factor”. Science will probably never be completely open, and Twitter will probably never replace the journal article,

  19. Evolving NASA's Earth Science Data Systems

    Science.gov (United States)

    Walter, J.; Behnke, J.; Murphy, K. J.; Lowe, D. R.

    2013-12-01

    NASA's Earth Science Data and Information System Project (ESDIS) is charged with managing, maintaining, and evolving NASA's Earth Observing System Data and Information System (EOSDIS) and is responsible for processing, archiving, and distributing NASA Earth science data. The system supports a multitude of missions and serves diverse science research and other user communities. Keeping up with ever-changing information technology and figuring out how to leverage those changes across such a large system in order to continuously improve and meet the needs of a diverse user community is a significant challenge. Maintaining and evolving the system architecture and infrastructure is a continuous and multi-layered effort. It requires a balance between a "top down" management paradigm that provides a coherent system view and maintaining the managerial, technological, and functional independence of the individual system elements. This presentation will describe some of the key elements of the current system architecture, some of the strategies and processes we employ to meet these challenges, current and future challenges, and some ideas for meeting those challenges.

  20. The Comet Cometh: Evolving Developmental Systems.

    Science.gov (United States)

    Jaeger, Johannes; Laubichler, Manfred; Callebaut, Werner

    In a recent opinion piece, Denis Duboule has claimed that the increasing shift towards systems biology is driving evolutionary and developmental biology apart, and that a true reunification of these two disciplines within the framework of evolutionary developmental biology (EvoDevo) may easily take another 100 years. He identifies methodological, epistemological, and social differences as causes for this supposed separation. Our article provides a contrasting view. We argue that Duboule's prediction is based on a one-sided understanding of systems biology as a science that is only interested in functional, not evolutionary, aspects of biological processes. Instead, we propose a research program for an evolutionary systems biology, which is based on local exploration of the configuration space in evolving developmental systems. We call this approach-which is based on reverse engineering, simulation, and mathematical analysis-the natural history of configuration space. We discuss a number of illustrative examples that demonstrate the past success of local exploration, as opposed to global mapping, in different biological contexts. We argue that this pragmatic mode of inquiry can be extended and applied to the mathematical analysis of the developmental repertoire and evolutionary potential of evolving developmental mechanisms and that evolutionary systems biology so conceived provides a pragmatic epistemological framework for the EvoDevo synthesis.

  1. Evolving technology, shifting expectations : cultivating pedagogy for a rapidly changing GIS landscape

    NARCIS (Netherlands)

    Ricker, Britta; Thatcher, Jim

    2017-01-01

    AbstractAs humans and natural processes continuously reshape the surface of the Earth, there is an unceasing need to document and analyze them through the use of Geographic Information Systems (GIS). The public is gaining more access to spatial technologies that were once only available to highly

  2. INDIAN BUSINESSMEN IN FRANCE: AN INITIAL EXAMINATION OF THEIR ACTIVITIES IN A RAPIDLY-EVOLVING CONTEXT

    Directory of Open Access Journals (Sweden)

    Vasoodeven Vuddamalay

    2010-12-01

    Full Text Available The aim of this article is to understand the implications of the recent economic and political evolution of Indian immigration in Europe, and specifically in France, their businesses and entrepreneurial groups, as well as their links with the countries of origin/welcoming countries and their transnational networks, using an historical and geoanthropological approach. The analysis also covers the essential links that the transnational entrepreneurs establish between France/Europe and the rest of the world, particularly with the emerging cities of Asia, the Middle East and, possibly, certain parts of Africa, such as South Africa, the Mascarene Islands and East Africa. To that end, the author begins by contextualising Indian business projects in France, before going on to examine the current situation of ethnic shops, the transnational companies of traditional trading communities and, to some extent, their Institute of Information Technology networks. The author also carries out a study of the “Mittal Case” as a new paradigm of research within the changing world economy, as the traditional North-South separation is undermined and the complexities of fields in research on trading and business groups is renewed. Finally, the author situates these debates within the growing world knowledge of the communities of Indian immigrants in France and their small ethnic businessmen and traders.

  3. Evolving Technology, Shifting Expectations: Cultivating Pedagogy for a Rapidly Changing GIS Landscape

    Science.gov (United States)

    Ricker, Britta; Thatcher, Jim

    2017-01-01

    As humans and natural processes continuously reshape the surface of the Earth, there is an unceasing need to document and analyze them through the use of Geographic Information Systems (GIS). The public is gaining more access to spatial technologies that were once only available to highly trained professionals. With technological evolution comes a…

  4. Are randomised trials needed in the era of rapidly evolving technologies?

    Science.gov (United States)

    Treasure, Tom

    2009-03-01

    New technologies are expensive. The health care budget cannot expand indefinitely so if new treatments are introduced they may have to displace other treatments, or prevent other new treatments coming into practice. This is not simply a money saving exercise; it is accepted that new high technology treatments may cost more to implement but they must be worth the money spent in comparison with other treatments. Therefore cardiothoracic surgeons must first demonstrate that our treatments are effective. Then we need evidence of cost effectiveness in comparison with other therapies.

  5. An RNA gene expressed during cortical development evolved rapidly in humans

    DEFF Research Database (Denmark)

    Pollard, Katherine S; Salama, Sofie R; Lambert, Nelle

    2006-01-01

    in the developing human neocortex from 7 to 19 gestational weeks, a crucial period for cortical neuron specification and migration. HAR1F is co-expressed with reelin, a product of Cajal-Retzius neurons that is of fundamental importance in specifying the six-layer structure of the human cortex. HAR1 and the other...

  6. Transforming Research in Oceanography through Education, Ethnography and Rapidly Evolving Technologies: An NSF-INSPIRE project.

    Science.gov (United States)

    German, C. R.; Croff Bell, K. L.; Pallant, A.; Mirmalek, Z.; Jasanoff, S.; Rajan, K.

    2014-12-01

    This paper will discuss a new NSF-INSPIRE project that brings together research conducted in the fields of Ocean Sciences, Education & Human Resources and Computer and Information Science & Engineering. Specifically, our objective is to investigate new methods by which telepresence can be used to conduct cutting edge research and provide authentic educational experiences to undergraduate students, remotely. We choose to conduct this research in an Oceanographic context for two reasons: first with the move toward smaller research ships in the national Oceanographic research fleet, we anticipate that access to berth space at sea will continue to be at a premium. Any component of traditional oceanographic research that can be ported to shore without loss of effectiveness would be of immediate benefit to the Ocean Sciences. Equally, however, we argue that any improvements to work place and/or education practices that we can identify while delivering research and education from the bottom of the deep ocean should be readily mappable to any other scientific or engineering activities that seek to make use of telepresence in less extreme remote environments. Work on our TREET project, to-date, has included recruitment of 6 early career scientists keen to take advantage of the research opportunity provided, together with two senior science mentors with experience using Telepresence and a cohort of undergraduate students at three of the ECS partner Universities, spanning 4 time zones across the continental US. Following a 12-week synchronous on-line seminar series taught in Spring-Summer 2014, the entire team joined together at the Inner Space Center in Sept-Oct 2014 to participate, virtually, in a cruise of research and exploration to the Kick'Em Jenny underwater volcano and adjacent cold seep sites, conducted by the Ocean Exploration Trust's ROV Hercules aboard the Exploration Vessel Nautilus. Our presentation will include preliminary results from that cruise.

  7. DNA:DNA hybridization studies on the pink-pigmented facultative methylotrophs.

    Science.gov (United States)

    Hood, D W; Dow, C S; Green, P N

    1987-03-01

    The genomic relatedness among 36 strains of pink-pigmented facultatively methylotrophic bacteria (PPFMs) was estimated by determination of DNA base composition and by DNA:DNA hybridization studies. A reproducible hybridization system was developed for the rapid analysis of multiple DNA samples. Results indicated that the PPFMs comprise four major and several minor homology groups, and that they should remain grouped in a single genus, Methylobacterium.

  8. DNA glue

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  9. Hyperstretching DNA

    NARCIS (Netherlands)

    Schakenraad, Koen; Biebricher, Andreas S.; Sebregts, Maarten; Ten Bensel, Brian; Peterman, Erwin J.G.; Wuite, Gijs J L; Heller, Iddo; Storm, Cornelis; Van Der Schoot, Paul

    2017-01-01

    The three-dimensional structure of DNA is highly susceptible to changes by mechanical and biochemical cues in vivo and in vitro. In particular, large increases in base pair spacing compared to regular B-DNA are effected by mechanical (over)stretching and by intercalation of compounds that are widely

  10. Evolving water science in the Anthropocene

    NARCIS (Netherlands)

    Savenije, H.H.G.; Hoekstra, A.Y.; Van der Zaag, P.

    2014-01-01

    This paper reviews the changing relation between human beings and water since the Industrial Revolution, a period that has been called the Anthropocene because of the unprecedented scale at which humans have altered the planet during this time. We show how the rapidly changing world urges us to

  11. Distance Education: An Evolving Instructional Technology Application.

    Science.gov (United States)

    Dwyer, Francis

    1999-01-01

    Focuses on the several levels of questions that need to be considered before planning and implementing a distance education program. Discusses systems procedures to be followed in developing pilot lessons (modules) prior to "rapid prototyping." Concludes by providing a generic research plan for ensuring the development of sustained quality…

  12. Evolving Digital Publishing Opportunities across Composition Studies

    Science.gov (United States)

    Hawishler, Gail E.; Selfe, Cynthia L.

    2014-01-01

    In this article, the authors report since the early 1980s, the profession has seen plenty of changes in the arena of digital scholarly publishing: during this time, while the specific challenges have seldom remained the same, the presence and the pressures of rapid technological change endure. In fact, as an editorial team that has, in part,…

  13. Evolvability as a Quality Attribute of Software Architectures

    NARCIS (Netherlands)

    Ciraci, S.; van den Broek, P.M.; Duchien, Laurence; D'Hondt, Maja; Mens, Tom

    We review the definition of evolvability as it appears on the literature. In particular, the concept of software evolvability is compared with other system quality attributes, such as adaptability, maintainability and modifiability.

  14. Evolving colon injury management: a review.

    Science.gov (United States)

    Greer, Lauren T; Gillern, Suzanne M; Vertrees, Amy E

    2013-02-01

    The colon is the second most commonly injured intra-abdominal organ in penetrating trauma. Management of traumatic colon injuries has evolved significantly over the past 200 years. Traumatic colon injuries can have a wide spectrum of severity, presentation, and management options. There is strong evidence that most non-destructive colon injuries can be successfully managed with primary repair or primary anastomosis. The management of destructive colon injuries remains controversial with most favoring resection with primary anastomosis and others favor colonic diversion in specific circumstances. The historical management of traumatic colon injuries, common mechanisms of injury, demographics, presentation, assessment, diagnosis, management, and complications of traumatic colon injuries both in civilian and military practice are reviewed. The damage control revolution has added another layer of complexity to management with continued controversy.

  15. Pulmonary Sporotrichosis: An Evolving Clinical Paradigm.

    Science.gov (United States)

    Aung, Ar K; Spelman, Denis W; Thompson, Philip J

    2015-10-01

    In recent decades, sporotrichosis, caused by thermally dimorphic fungi Sporothrix schenckii complex, has become an emerging infection in many parts of the world. Pulmonary infection with S. schenckii still remains relatively uncommon, possibly due to underrecognition. Pulmonary sporotrichosis presents with distinct clinical and radiological patterns in both immunocompetent and immunocompromised hosts and can often result in significant morbidity and mortality despite treatment. Current understanding regarding S. schenckii biology, epidemiology, immunopathology, clinical diagnostics, and treatment options has been evolving in the recent years with increased availability of molecular sequencing techniques. However, this changing knowledge has not yet been fully translated into a better understanding of the clinical aspects of pulmonary sporotrichosis, as such current management guidelines remain unsupported by high-level clinical evidence. This article examines recent advances in the knowledge of sporotrichosis and its application to the difficult challenges of managing pulmonary sporotrichosis. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  16. Resiliently evolving supply-demand networks

    Science.gov (United States)

    Rubido, Nicolás; Grebogi, Celso; Baptista, Murilo S.

    2014-01-01

    The ability to design a transport network such that commodities are brought from suppliers to consumers in a steady, optimal, and stable way is of great importance for distribution systems nowadays. In this work, by using the circuit laws of Kirchhoff and Ohm, we provide the exact capacities of the edges that an optimal supply-demand network should have to operate stably under perturbations, i.e., without overloading. The perturbations we consider are the evolution of the connecting topology, the decentralization of hub sources or sinks, and the intermittence of supplier and consumer characteristics. We analyze these conditions and the impact of our results, both on the current United Kingdom power-grid structure and on numerically generated evolving archetypal network topologies.

  17. Development and the evolvability of human limbs.

    Science.gov (United States)

    Young, Nathan M; Wagner, Günter P; Hallgrímsson, Benedikt

    2010-02-23

    The long legs and short arms of humans are distinctive for a primate, the result of selection acting in opposite directions on each limb at different points in our evolutionary history. This mosaic pattern challenges our understanding of the relationship of development and evolvability because limbs are serially homologous and genetic correlations should act as a significant constraint on their independent evolution. Here we test a developmental model of limb covariation in anthropoid primates and demonstrate that both humans and apes exhibit significantly reduced integration between limbs when compared to quadrupedal monkeys. This result indicates that fossil hominins likely escaped constraints on independent limb variation via reductions to genetic pleiotropy in an ape-like last common ancestor (LCA). This critical change in integration among hominoids, which is reflected in macroevolutionary differences in the disparity between limb lengths, facilitated selection for modern human limb proportions and demonstrates how development helps shape evolutionary change.

  18. Evolving spiking networks with variable resistive memories.

    Science.gov (United States)

    Howard, Gerard; Bull, Larry; de Lacy Costello, Ben; Gale, Ella; Adamatzky, Andrew

    2014-01-01

    Neuromorphic computing is a brainlike information processing paradigm that requires adaptive learning mechanisms. A spiking neuro-evolutionary system is used for this purpose; plastic resistive memories are implemented as synapses in spiking neural networks. The evolutionary design process exploits parameter self-adaptation and allows the topology and synaptic weights to be evolved for each network in an autonomous manner. Variable resistive memories are the focus of this research; each synapse has its own conductance profile which modifies the plastic behaviour of the device and may be altered during evolution. These variable resistive networks are evaluated on a noisy robotic dynamic-reward scenario against two static resistive memories and a system containing standard connections only. The results indicate that the extra behavioural degrees of freedom available to the networks incorporating variable resistive memories enable them to outperform the comparative synapse types.

  19. Life cycle planning: An evolving concept

    International Nuclear Information System (INIS)

    Moore, P.J.R.; Gorman, I.G.

    1994-01-01

    Life-cycle planning is an evolving concept in the management of oil and gas projects. BHP Petroleum now interprets this idea to include all development planning from discovery and field appraisal to final abandonment and includes safety, environmental, technical, plant, regulatory, and staffing issues. This article describes in the context of the Timor Sea, how despite initial successes and continuing facilities upgrades, BHPP came to perceive that current operations could be the victim of early development successes, particularly in the areas of corrosion and maintenance. The search for analogies elsewhere lead to the UK North Sea, including the experiences of Britoil and BP, both of which performed detailed Life of Field studies in the later eighties. These materials have been used to construct a format and content for total Life-cycle plans in general and the social changes required to ensure their successful application in Timor Sea operations and deployment throughout Australia

  20. Argentina and Brazil: an evolving nuclear relationship

    International Nuclear Information System (INIS)

    Redick, J.R.

    1990-01-01

    Argentina and Brazil have Latin America's most advanced nuclear research and power programs. Both nations reject the Non-Proliferation Treaty (NPT), and have not formally embraced the Tlatelolco Treaty creating a regional nuclear-weapon-free zone. Disturbing ambiguities persist regarding certain indigenous nuclear facilities and growing nuclear submarine and missile capabilities. For these, and other reasons, the two nations are widely considered potential nuclear weapon states. However both nations have been active supporters of the International Atomic Energy Agency (IAEA) and have, in recent years, assumed a generally responsible position in regard to their own nuclear export activities (requiring IAEA safeguards). Most important, however, has been the advent of bilateral nuclear cooperation. This paper considers the evolving nuclear relationship in the context of recent and dramatic political change in Argentina and Brazil. It discusses current political and nuclear developments and the prospects for maintaining and expanding present bilateral cooperation into an effective non-proliferation arrangement. (author)

  1. The genotype-phenotype map of an evolving digital organism

    OpenAIRE

    Fortuna, Miguel A.; Zaman, Luis; Ofria, Charles; Wagner, Andreas

    2017-01-01

    To understand how evolving systems bring forth novel and useful phenotypes, it is essential to understand the relationship between genotypic and phenotypic change. Artificial evolving systems can help us understand whether the genotype-phenotype maps of natural evolving systems are highly unusual, and it may help create evolvable artificial systems. Here we characterize the genotype-phenotype map of digital organisms in Avida, a platform for digital evolution. We consider digital organisms fr...

  2. Construction and evaluation of normalized cDNA libraries enriched with full-length sequences for rapid discovery of new genes from Sisal (Agave sisalana Perr.) different developmental stages.

    Science.gov (United States)

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-10-12

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing.

  3. Geminin: a major DNA replication safeguard in higher eukaryotes

    DEFF Research Database (Denmark)

    Melixetian, Marina; Helin, Kristian

    2004-01-01

    Eukaryotes have evolved multiple mechanisms to restrict DNA replication to once per cell cycle. These mechanisms prevent relicensing of origins of replication after initiation of DNA replication in S phase until the end of mitosis. Most of our knowledge of mechanisms controlling prereplication...

  4. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  5. DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Castelino, J

    1993-12-31

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

  6. Chromatin challenges during DNA replication and repair

    DEFF Research Database (Denmark)

    Groth, Anja; Rocha, Walter; Verreault, Alain

    2007-01-01

    Inheritance and maintenance of the DNA sequence and its organization into chromatin are central for eukaryotic life. To orchestrate DNA-replication and -repair processes in the context of chromatin is a challenge, both in terms of accessibility and maintenance of chromatin organization. To meet...... the challenge of maintenance, cells have evolved efficient nucleosome-assembly pathways and chromatin-maturation mechanisms that reproduce chromatin organization in the wake of DNA replication and repair. The aim of this Review is to describe how these pathways operate and to highlight how the epigenetic...... landscape may be stably maintained even in the face of dramatic changes in chromatin structure....

  7. The evolving energy budget of accretionary wedges

    Science.gov (United States)

    McBeck, Jessica; Cooke, Michele; Maillot, Bertrand; Souloumiac, Pauline

    2017-04-01

    The energy budget of evolving accretionary systems reveals how deformational processes partition energy as faults slip, topography uplifts, and layer-parallel shortening produces distributed off-fault deformation. The energy budget provides a quantitative framework for evaluating the energetic contribution or consumption of diverse deformation mechanisms. We investigate energy partitioning in evolving accretionary prisms by synthesizing data from physical sand accretion experiments and numerical accretion simulations. We incorporate incremental strain fields and cumulative force measurements from two suites of experiments to design numerical simulations that represent accretionary wedges with stronger and weaker detachment faults. One suite of the physical experiments includes a basal glass bead layer and the other does not. Two physical experiments within each suite implement different boundary conditions (stable base versus moving base configuration). Synthesizing observations from the differing base configurations reduces the influence of sidewall friction because the force vector produced by sidewall friction points in opposite directions depending on whether the base is fixed or moving. With the numerical simulations, we calculate the energy budget at two stages of accretion: at the maximum force preceding the development of the first thrust pair, and at the minimum force following the development of the pair. To identify the appropriate combination of material and fault properties to apply in the simulations, we systematically vary the Young's modulus and the fault static and dynamic friction coefficients in numerical accretion simulations, and identify the set of parameters that minimizes the misfit between the normal force measured on the physical backwall and the numerically simulated force. Following this derivation of the appropriate material and fault properties, we calculate the components of the work budget in the numerical simulations and in the

  8. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  9. DNA data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  10. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  11. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  12. Bacterial CRISPR/Cas DNA endonucleases: A revolutionary technology that could dramatically impact viral research and treatment

    International Nuclear Information System (INIS)

    Kennedy, Edward M.; Cullen, Bryan R.

    2015-01-01

    CRISPR/Cas systems mediate bacterial adaptive immune responses that evolved to protect bacteria from bacteriophage and other horizontally transmitted genetic elements. Several CRISPR/Cas systems exist but the simplest variant, referred to as Type II, has a single effector DNA endonuclease, called Cas9, which is guided to its viral DNA target by two small RNAs, the crRNA and the tracrRNA. Initial efforts to adapt the CRISPR/Cas system for DNA editing in mammalian cells, which focused on the Cas9 protein from Streptococcus pyogenes (Spy), demonstrated that Spy Cas9 can be directed to DNA targets in mammalian cells by tracrRNA:crRNA fusion transcripts called single guide RNAs (sgRNA). Upon binding, Cas9 induces DNA cleavage leading to mutagenesis as a result of error prone non-homologous end joining (NHEJ). Recently, the Spy Cas9 system has been adapted for high throughput screening of genes in human cells for their relevance to a particular phenotype and, more generally, for the targeted inactivation of specific genes, in cell lines and in vivo in a number of model organisms. The latter aim seems likely to be greatly enhanced by the recent development of Cas9 proteins from bacterial species such as Neisseria meningitidis and Staphyloccus aureus that are small enough to be expressed using adeno-associated (AAV)-based vectors that can be readily prepared at very high titers. The evolving Cas9-based DNA editing systems therefore appear likely to not only impact virology by allowing researchers to screen for human genes that affect the replication of pathogenic human viruses of all types but also to derive clonal human cell lines that lack individual gene products that either facilitate or restrict viral replication. Moreover, high titer AAV-based vectors offer the possibility of directly targeting DNA viruses that infect discrete sites in the human body, such as herpes simplex virus and hepatitis B virus, with the hope that the entire population of viral DNA genomes

  13. Bacterial CRISPR/Cas DNA endonucleases: A revolutionary technology that could dramatically impact viral research and treatment

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, Edward M.; Cullen, Bryan R., E-mail: bryan.cullen@duke.edu

    2015-05-15

    CRISPR/Cas systems mediate bacterial adaptive immune responses that evolved to protect bacteria from bacteriophage and other horizontally transmitted genetic elements. Several CRISPR/Cas systems exist but the simplest variant, referred to as Type II, has a single effector DNA endonuclease, called Cas9, which is guided to its viral DNA target by two small RNAs, the crRNA and the tracrRNA. Initial efforts to adapt the CRISPR/Cas system for DNA editing in mammalian cells, which focused on the Cas9 protein from Streptococcus pyogenes (Spy), demonstrated that Spy Cas9 can be directed to DNA targets in mammalian cells by tracrRNA:crRNA fusion transcripts called single guide RNAs (sgRNA). Upon binding, Cas9 induces DNA cleavage leading to mutagenesis as a result of error prone non-homologous end joining (NHEJ). Recently, the Spy Cas9 system has been adapted for high throughput screening of genes in human cells for their relevance to a particular phenotype and, more generally, for the targeted inactivation of specific genes, in cell lines and in vivo in a number of model organisms. The latter aim seems likely to be greatly enhanced by the recent development of Cas9 proteins from bacterial species such as Neisseria meningitidis and Staphyloccus aureus that are small enough to be expressed using adeno-associated (AAV)-based vectors that can be readily prepared at very high titers. The evolving Cas9-based DNA editing systems therefore appear likely to not only impact virology by allowing researchers to screen for human genes that affect the replication of pathogenic human viruses of all types but also to derive clonal human cell lines that lack individual gene products that either facilitate or restrict viral replication. Moreover, high titer AAV-based vectors offer the possibility of directly targeting DNA viruses that infect discrete sites in the human body, such as herpes simplex virus and hepatitis B virus, with the hope that the entire population of viral DNA genomes

  14. Advances in the Study of Moving Sediments and Evolving Seabeds

    Science.gov (United States)

    Davies, Alan G.; Thorne, Peter D.

    2008-01-01

    Sands and mud are continually being transported around the world’s coastal seas due to the action of tides, wind and waves. The transport of these sediments modifies the boundary between the land and the sea, changing and reshaping its form. Sometimes the nearshore bathymetry evolves slowly over long time periods, at other times more rapidly due to natural episodic events or the introduction of manmade structures at the shoreline. For over half a century we have been trying to understand the physics of sediment transport processes and formulate predictive models. Although significant progress has been made, our capability to forecast the future behaviour of the coastal zone from basic principles is still relatively poor. However, innovative acoustic techniques for studying the fundamentals of sediment movement experimentally are now providing new insights, and it is expected that such observations, coupled with developing theoretical works, will allow us to take further steps towards the goal of predicting the evolution of coastlines and coastal bathymetry. This paper presents an overview of our existing predictive capabilities, primarily in the field of non-cohesive sediment transport, and highlights how new acoustic techniques are enabling our modelling efforts to achieve greater sophistication and accuracy. The paper is aimed at coastal scientists and managers seeking to understand how detailed physical studies can contribute to the improvement of coastal area models and, hence, inform coastal zone management strategies.

  15. Meiosis evolves: adaptation to external and internal environments.

    Science.gov (United States)

    Bomblies, Kirsten; Higgins, James D; Yant, Levi

    2015-10-01

    306 I. 306 II. 307 III. 312 IV. 317 V. 318 319 References 319 SUMMARY: Meiosis is essential for the fertility of most eukaryotes and its structures and progression are conserved across kingdoms. Yet many of its core proteins show evidence of rapid or adaptive evolution. What drives the evolution of meiosis proteins? How can constrained meiotic processes be modified in response to challenges without compromising their essential functions? In surveying the literature, we found evidence of two especially potent challenges to meiotic chromosome segregation that probably necessitate adaptive evolutionary responses: whole-genome duplication and abiotic environment, especially temperature. Evolutionary solutions to both kinds of challenge are likely to involve modification of homologous recombination and synapsis, probably via adjustments of core structural components important in meiosis I. Synthesizing these findings with broader patterns of meiosis gene evolution suggests that the structural components of meiosis coevolve as adaptive modules that may change in primary sequence and function while maintaining three-dimensional structures and protein interactions. The often sharp divergence of these genes among species probably reflects periodic modification of entire multiprotein complexes driven by genomic or environmental changes. We suggest that the pressures that cause meiosis to evolve to maintain fertility may cause pleiotropic alterations of global crossover rates. We highlight several important areas for future research. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  16. Complement and the control of HIV infection: an evolving story.

    Science.gov (United States)

    Frank, Michael M; Hester, Christopher; Jiang, Haixiang

    2014-05-01

    Thirty years ago, investigators isolated and later determined the structure of HIV-1 and its envelope proteins. Using techniques that were effective with other viruses, they prepared vaccines designed to generate antibody or T-cell responses, but they were ineffective in clinical trials. In this article, we consider the role of complement in host defense against enveloped viruses, the role it might play in the antibody response and why complement has not controlled HIV-1 infection. Complement consists of a large group of cell-bound and plasma proteins that are an integral part of the innate immune system. They provide a first line of defense against microbes and also play a role in the immune response. Here we review the studies of complement-mediated HIV destruction and the role of complement in the HIV antibody response. HIV-1 has evolved a complex defense to prevent complement-mediated killing reviewed here. As part of these studies, we have discovered that HIV-1 envelope, on administration into animals, is rapidly broken down into small peptides that may prove to be very inefficient at provident the type of antigenic stimulation that leads to an effective immune response. Improving complement binding and stabilizing envelope may improve the vaccine response.

  17. DNA isolation from rat tail or ear

    NARCIS (Netherlands)

    Cuppen, E.

    2010-01-01

    This protocol describes a rapid procedure for isolating DNA from rat tail or ear punches. The simplest version of the protocol can be scaled for use in 96-well (deep-well) plates. The quality of the DNA is sufficient for any polymerase chain reaction (PCR)-based genotyping approach.

  18. On the Critical Role of Divergent Selection in Evolvability

    Directory of Open Access Journals (Sweden)

    Joel Lehman

    2016-08-01

    Full Text Available An ambitious goal in evolutionary robotics is to evolve increasingly complex robotic behaviors with minimal human design effort. Reaching this goal requires evolutionary algorithms that can unlock from genetic encodings their latent potential for evolvability. One issue clouding this goal is conceptual confusion about evolvability, which often obscures the aspects of evolvability that are important or desirable. The danger from such confusion is that it may establish unrealistic goals for evolvability that prove unproductive in practice. An important issue separate from conceptual confusion is the common misalignment between selection and evolvability in evolutionary robotics. While more expressive encodings can represent higher-level adaptations (e.g. sexual reproduction or developmental systems that increase long-term evolutionary potential (i.e. evolvability, realizing such potential requires gradients of fitness and evolvability to align. In other words, selection is often a critical factor limiting increasing evolvability. Thus, drawing from a series of recent papers, this article seeks to both (1 clarify and focus the ways in which the term evolvability is used within artificial evolution, and (2 argue for the importance of one type of selection, i.e. divergent selection, for enabling evolvability. The main argument is that there is a fundamental connection between divergent selection and evolvability (on both the individual and population level that does not hold for typical goal-oriented selection. The conclusion is that selection pressure plays a critical role in realizing the potential for evolvability, and that divergent selection in particular provides a principled mechanism for encouraging evolvability in artificial evolution.

  19. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  20. Approximating centrality in evolving graphs: toward sublinearity

    Science.gov (United States)

    Priest, Benjamin W.; Cybenko, George

    2017-05-01

    The identification of important nodes is a ubiquitous problem in the analysis of social networks. Centrality indices (such as degree centrality, closeness centrality, betweenness centrality, PageRank, and others) are used across many domains to accomplish this task. However, the computation of such indices is expensive on large graphs. Moreover, evolving graphs are becoming increasingly important in many applications. It is therefore desirable to develop on-line algorithms that can approximate centrality measures using memory sublinear in the size of the graph. We discuss the challenges facing the semi-streaming computation of many centrality indices. In particular, we apply recent advances in the streaming and sketching literature to provide a preliminary streaming approximation algorithm for degree centrality utilizing CountSketch and a multi-pass semi-streaming approximation algorithm for closeness centrality leveraging a spanner obtained through iteratively sketching the vertex-edge adjacency matrix. We also discuss possible ways forward for approximating betweenness centrality, as well as spectral measures of centrality. We provide a preliminary result using sketched low-rank approximations to approximate the output of the HITS algorithm.

  1. Functional Topology of Evolving Urban Drainage Networks

    Science.gov (United States)

    Yang, Soohyun; Paik, Kyungrock; McGrath, Gavan S.; Urich, Christian; Krueger, Elisabeth; Kumar, Praveen; Rao, P. Suresh C.

    2017-11-01

    We investigated the scaling and topology of engineered urban drainage networks (UDNs) in two cities, and further examined UDN evolution over decades. UDN scaling was analyzed using two power law scaling characteristics widely employed for river networks: (1) Hack's law of length (L)-area (A) [L∝Ah] and (2) exceedance probability distribution of upstream contributing area (δ) [P>(A≥δ>)˜aδ-ɛ]. For the smallest UDNs ((A≥δ>) plots for river networks are abruptly truncated, those for UDNs display exponential tempering [P>(A≥δ>)=aδ-ɛexp⁡>(-cδ>)]. The tempering parameter c decreases as the UDNs grow, implying that the distribution evolves in time to resemble those for river networks. However, the power law exponent ɛ for large UDNs tends to be greater than the range reported for river networks. Differences in generative processes and engineering design constraints contribute to observed differences in the evolution of UDNs and river networks, including subnet heterogeneity and nonrandom branching.

  2. An Evolving Worldview: Making Open Source Easy

    Science.gov (United States)

    Rice, Z.

    2017-12-01

    NASA Worldview is an interactive interface for browsing full-resolution, global satellite imagery. Worldview supports an open data policy so that academia, private industries and the general public can use NASA's satellite data to address Earth science related issues. Worldview was open sourced in 2014. By shifting to an open source approach, the Worldview application has evolved to better serve end-users. Project developers are able to have discussions with end-users and community developers to understand issues and develop new features. Community developers are able to track upcoming features, collaborate on them and make their own contributions. Developers who discover issues are able to address those issues and submit a fix. This reduces the time it takes for a project developer to reproduce an issue or develop a new feature. Getting new developers to contribute to the project has been one of the most important and difficult aspects of open sourcing Worldview. After witnessing potential outside contributors struggle, a focus has been made on making the installation of Worldview simple to reduce the initial learning curve and make contributing code easy. One way we have addressed this is through a simplified setup process. Our setup documentation includes a set of prerequisites and a set of straightforward commands to clone, configure, install and run. This presentation will emphasize our focus to simplify and standardize Worldview's open source code so that more people are able to contribute. The more people who contribute, the better the application will become over time.

  3. How does cognition evolve? Phylogenetic comparative psychology.

    Science.gov (United States)

    MacLean, Evan L; Matthews, Luke J; Hare, Brian A; Nunn, Charles L; Anderson, Rindy C; Aureli, Filippo; Brannon, Elizabeth M; Call, Josep; Drea, Christine M; Emery, Nathan J; Haun, Daniel B M; Herrmann, Esther; Jacobs, Lucia F; Platt, Michael L; Rosati, Alexandra G; Sandel, Aaron A; Schroepfer, Kara K; Seed, Amanda M; Tan, Jingzhi; van Schaik, Carel P; Wobber, Victoria

    2012-03-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution.

  4. An evolving network model with modular growth

    International Nuclear Information System (INIS)

    Zou Zhi-Yun; Liu Peng; Lei Li; Gao Jian-Zhi

    2012-01-01

    In this paper, we propose an evolving network model growing fast in units of module, according to the analysis of the evolution characteristics in real complex networks. Each module is a small-world network containing several interconnected nodes and the nodes between the modules are linked by preferential attachment on degree of nodes. We study the modularity measure of the proposed model, which can be adjusted by changing the ratio of the number of inner-module edges and the number of inter-module edges. In view of the mean-field theory, we develop an analytical function of the degree distribution, which is verified by a numerical example and indicates that the degree distribution shows characteristics of the small-world network and the scale-free network distinctly at different segments. The clustering coefficient and the average path length of the network are simulated numerically, indicating that the network shows the small-world property and is affected little by the randomness of the new module. (interdisciplinary physics and related areas of science and technology)

  5. How does cognition evolve? Phylogenetic comparative psychology

    Science.gov (United States)

    Matthews, Luke J.; Hare, Brian A.; Nunn, Charles L.; Anderson, Rindy C.; Aureli, Filippo; Brannon, Elizabeth M.; Call, Josep; Drea, Christine M.; Emery, Nathan J.; Haun, Daniel B. M.; Herrmann, Esther; Jacobs, Lucia F.; Platt, Michael L.; Rosati, Alexandra G.; Sandel, Aaron A.; Schroepfer, Kara K.; Seed, Amanda M.; Tan, Jingzhi; van Schaik, Carel P.; Wobber, Victoria

    2014-01-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution. PMID:21927850

  6. A local-world evolving hypernetwork model

    International Nuclear Information System (INIS)

    Yang Guang-Yong; Liu Jian-Guo

    2014-01-01

    Complex hypernetworks are ubiquitous in the real system. It is very important to investigate the evolution mechanisms. In this paper, we present a local-world evolving hypernetwork model by taking into account the hyperedge growth and local-world hyperedge preferential attachment mechanisms. At each time step, a newly added hyperedge encircles a new coming node and a number of nodes from a randomly selected local world. The number of the selected nodes from the local world obeys the uniform distribution and its mean value is m. The analytical and simulation results show that the hyperdegree approximately obeys the power-law form and the exponent of hyperdegree distribution is γ = 2 + 1/m. Furthermore, we numerically investigate the node degree, hyperedge degree, clustering coefficient, as well as the average distance, and find that the hypernetwork model shares the scale-free and small-world properties, which shed some light for deeply understanding the evolution mechanism of the real systems. (interdisciplinary physics and related areas of science and technology)

  7. Evolving autonomous learning in cognitive networks.

    Science.gov (United States)

    Sheneman, Leigh; Hintze, Arend

    2017-12-01

    There are two common approaches for optimizing the performance of a machine: genetic algorithms and machine learning. A genetic algorithm is applied over many generations whereas machine learning works by applying feedback until the system meets a performance threshold. These methods have been previously combined, particularly in artificial neural networks using an external objective feedback mechanism. We adapt this approach to Markov Brains, which are evolvable networks of probabilistic and deterministic logic gates. Prior to this work MB could only adapt from one generation to the other, so we introduce feedback gates which augment their ability to learn during their lifetime. We show that Markov Brains can incorporate these feedback gates in such a way that they do not rely on an external objective feedback signal, but instead can generate internal feedback that is then used to learn. This results in a more biologically accurate model of the evolution of learning, which will enable us to study the interplay between evolution and learning and could be another step towards autonomously learning machines.

  8. Diverticular Disease: Traditional and Evolving Paradigms.

    Science.gov (United States)

    Lamanna, Lenore; Moran, Patricia E

    Diverticular disease includes diverticulosis, which are sac protrusions of the intestinal mucosa, and diverticulitis, inflammation of the diverticula. Diverticular disease is listed as one of the top 10 leading physician diagnoses for gastrointestinal disorders in outpatient clinic visits in the United States. There are several classifications of diverticular disease ranging from asymptomatic diverticulosis to diverticulitis with complications. Several theories are linked to the development of diverticula which includes the physiology of the colon itself, collagen cross-linking, and recently challenged, low-fiber intake. The differential diagnoses of lower abdominal pain in addition to diverticular disease have overlapping signs and symptoms, which can make a diagnosis challenging. Identification of the distinct signs and symptoms of each classification will assist the practitioner in making the correct diagnosis and lead to appropriate management. The findings from recent studies have changed the paradigm of diverticular disease. The purpose of this article is to discuss traditional dogma and evolving concepts in the pathophysiology, prevention, and management of diverticular disease. Practitioners must be knowledgeable about diverticular disease for improved outcomes.

  9. Minority games, evolving capitals and replicator dynamics

    International Nuclear Information System (INIS)

    Galla, Tobias; Zhang, Yi-Cheng

    2009-01-01

    We discuss a simple version of the minority game (MG) in which agents hold only one strategy each, but in which their capitals evolve dynamically according to their success and in which the total trading volume varies in time accordingly. This feature is known to be crucial for MGs to reproduce stylized facts of real market data. The stationary states and phase diagram of the model can be computed, and we show that the ergodicity breaking phase transition common for MGs, and marked by a divergence of the integrated response, is present also in this simplified model. An analogous majority game turns out to be relatively void of interesting features, and the total capital is found to diverge in time. Introducing a restraining force leads to a model akin to the replicator dynamics of evolutionary game theory, and we demonstrate that here a different type of phase transition is observed. Finally we briefly discuss the relation of this model with one strategy per player to more sophisticated minority games with dynamical capitals and several trading strategies per agent

  10. An evolving model of online bipartite networks

    Science.gov (United States)

    Zhang, Chu-Xu; Zhang, Zi-Ke; Liu, Chuang

    2013-12-01

    Understanding the structure and evolution of online bipartite networks is a significant task since they play a crucial role in various e-commerce services nowadays. Recently, various attempts have been tried to propose different models, resulting in either power-law or exponential degree distributions. However, many empirical results show that the user degree distribution actually follows a shifted power-law distribution, the so-called Mandelbrot’s law, which cannot be fully described by previous models. In this paper, we propose an evolving model, considering two different user behaviors: random and preferential attachment. Extensive empirical results on two real bipartite networks, Delicious and CiteULike, show that the theoretical model can well characterize the structure of real networks for both user and object degree distributions. In addition, we introduce a structural parameter p, to demonstrate that the hybrid user behavior leads to the shifted power-law degree distribution, and the region of power-law tail will increase with the increment of p. The proposed model might shed some lights in understanding the underlying laws governing the structure of real online bipartite networks.

  11. The Evolving Classification of Pulmonary Hypertension.

    Science.gov (United States)

    Foshat, Michelle; Boroumand, Nahal

    2017-05-01

    - An explosion of information on pulmonary hypertension has occurred during the past few decades. The perception of this disease has shifted from purely clinical to incorporate new knowledge of the underlying pathology. This transfer has occurred in light of advancements in pathophysiology, histology, and molecular medical diagnostics. - To update readers about the evolving understanding of the etiology and pathogenesis of pulmonary hypertension and to demonstrate how pathology has shaped the current classification. - Information presented at the 5 World Symposia on pulmonary hypertension held since 1973, with the last meeting occurring in 2013, was used in this review. - Pulmonary hypertension represents a heterogeneous group of disorders that are differentiated based on differences in clinical, hemodynamic, and histopathologic features. Early concepts of pulmonary hypertension were largely influenced by pharmacotherapy, hemodynamic function, and clinical presentation of the disease. The initial nomenclature for pulmonary hypertension segregated the clinical classifications from pathologic subtypes. Major restructuring of this disease classification occurred between the first and second symposia, which was the first to unite clinical and pathologic information in the categorization scheme. Additional changes were introduced in subsequent meetings, particularly between the third and fourth World Symposia meetings, when additional pathophysiologic information was gained. Discoveries in molecular diagnostics significantly progressed the understanding of idiopathic pulmonary arterial hypertension. Continued advancements in imaging modalities, mechanistic pathogenicity, and molecular biomarkers will enable physicians to define pulmonary hypertension phenotypes based on the pathobiology and allow for treatment customization.

  12. Evolving application of biomimetic nanostructured hydroxyapatite

    Directory of Open Access Journals (Sweden)

    Norberto Roveri

    2010-11-01

    Full Text Available Norberto Roveri, Michele IafiscoLaboratory of Environmental and Biological Structural Chemistry (LEBSC, Dipartimento di Chimica ‘G. Ciamician’, Alma Mater Studiorum, Università di Bologna, Bologna, ItalyAbstract: By mimicking Nature, we can design and synthesize inorganic smart materials that are reactive to biological tissues. These smart materials can be utilized to design innovative third-generation biomaterials, which are able to not only optimize their interaction with biological tissues and environment, but also mimic biogenic materials in their functionalities. The biomedical applications involve increasing the biomimetic levels from chemical composition, structural organization, morphology, mechanical behavior, nanostructure, and bulk and surface chemical–physical properties until the surface becomes bioreactive and stimulates cellular materials. The chemical–physical characteristics of biogenic hydroxyapatites from bone and tooth have been described, in order to point out the elective sides, which are important to reproduce the design of a new biomimetic synthetic hydroxyapatite. This review outlines the evolving applications of biomimetic synthetic calcium phosphates, details the main characteristics of bone and tooth, where the calcium phosphates are present, and discusses the chemical–physical characteristics of biomimetic calcium phosphates, methods of synthesizing them, and some of their biomedical applications.Keywords: hydroxyapatite, nanocrystals, biomimetism, biomaterials, drug delivery, remineralization

  13. A versatile non-radioactive assay for DNA methyltransferase activity and DNA binding

    Science.gov (United States)

    Frauer, Carina; Leonhardt, Heinrich

    2009-01-01

    We present a simple, non-radioactive assay for DNA methyltransferase activity and DNA binding. As most proteins are studied as GFP fusions in living cells, we used a GFP binding nanobody coupled to agarose beads (GFP nanotrap) for rapid one-step purification. Immobilized GFP fusion proteins were subsequently incubated with different fluorescently labeled DNA substrates. The absolute amounts and molar ratios of GFP fusion proteins and bound DNA substrates were determined by fluorescence spectroscopy. In addition to specific DNA binding of GFP fusion proteins, the enzymatic activity of DNA methyltransferases can also be determined by using suicide DNA substrates. These substrates contain the mechanism-based inhibitor 5-aza-dC and lead to irreversible covalent complex formation. We obtained covalent complexes with mammalian DNA methyltransferase 1 (Dnmt1), which were resistant to competition with non-labeled canonical DNA substrates, allowing differentiation between methyltransferase activity and DNA binding. By comparison, the Dnmt1C1229W catalytic site mutant showed DNA-binding activity, but no irreversible covalent complex formation. With this assay, we could also confirm the preference of Dnmt1 for hemimethylated CpG sequences. The rapid optical read-out in a multi-well format and the possibility to test several different substrates in direct competition allow rapid characterization of sequence-specific binding and enzymatic activity. PMID:19129216

  14. Epigenetic changes of DNA repair genes in cancer

    OpenAIRE

    Lahtz, Christoph; Pfeifer, Gerd P.

    2011-01-01

    ‘Every Hour Hurts, The Last One Kills'. That is an old saying about getting old. Every day, thousands of DNA damaging events take place in each cell of our body, but efficient DNA repair systems have evolved to prevent that. However, our DNA repair system and that of most other organisms are not as perfect as that of Deinococcus radiodurans, for example, which is able to repair massive amounts of DNA damage at one time. In many instances, accumulation of DNA damage has been linked to cancer, ...

  15. Change and innovation: the evolving industry

    International Nuclear Information System (INIS)

    Lay, K.L.

    1999-01-01

    The rapidly increasing demand for energy is creating significant opportunities for energy companies world wide but only those companies equipped to take early advantage of the new markets will profit. Some of the recent technological advances such as telephones, washing machines, air conditioning and the Internet are mentioned. Success will be largely judged by a company's ability to maximise technology and make life easier and more productive. The paper discusses competition in global markets, environmental concerns, how consumers are benefiting, and cleaner energy. It is suggested that with the right vision and innovation, man can achieve a cleaner and more cost-effective world. (uk)

  16. Rapid shallow breathing

    Science.gov (United States)

    Tachypnea; Breathing - rapid and shallow; Fast shallow breathing; Respiratory rate - rapid and shallow ... Shallow, rapid breathing has many possible medical causes, including: Asthma Blood clot in an artery in the ...

  17. Rapid serial visual presentation design for cognition

    CERN Document Server

    Spence, Robert

    2013-01-01

    A powerful new image presentation technique has evolved over the last twenty years, and its value demonstrated through its support of many and varied common tasks. Conceptually, Rapid Serial Visual Presentation (RSVP) is basically simple, exemplified in the physical world by the rapid riffling of the pages of a book in order to locate a known image. Advances in computation and graphics processing allow RSVP to be applied flexibly and effectively to a huge variety of common tasks such as window shopping, video fast-forward and rewind, TV channel selection and product browsing. At its heart is a

  18. Effects of radiation on DNA

    International Nuclear Information System (INIS)

    Medina, V.F.O.

    1978-01-01

    Irradiation has been shown to depress DNA (deoxyribonucleic acid) synthesis resulting in deficient DNA synthesis. In one experiment, Hela S 3 cells completed the next division after a dose of 500 rads to 200 kw X-rays. Another experiment showed that the amount of DNA synthesized was dependent on the stage in the generation cycle at which the cells are irradiated (Giffites and Tolmach, 1975). DNA synthesis was measured by radioactive thymidine incorporation. The smallest deficiency (20-35%) after a dose of 500 rad X-ray was observed in Hela S 3 cells irradiated in early G 1 or early G 2 , while the greatest deficiency (55-70*) after 500 rad X-ray was found in cells irradiated at mitosis or at the Gsub(1)/S transition. Using velocity sedimentation in alkaline gradients of the DNA from hamster, Elkind, et al 1972, studied repair processes as a function of X-ray dose. DNA containing material released by alkaline lysis was found initially contained in a complex-containing lipid, the sedimentation of which was anomalous relative to denatured RNA from unirradated cells. Doses of X-rays small enough to be in the range that permits high survival (100-800 rads) speed the resolution of single-stranded DNA from this DNA complex, giving rise to a species having a number average molecular weight of 2 x 10 8 daltons. Larger doses greater than 1000 to 2000 rads resulted in a degradation of these DNA strands. Incubation after irradiation resulted in the rapid repair of damage, although the rate of repair of damage to the complex resulted in a reassociation of lipid and DNA. This evidence supports the possibility that a large DNA-membrane structure is a principal target of radiation

  19. Mechanical design of DNA nanostructures

    Science.gov (United States)

    Castro, Carlos E.; Su, Hai-Jun; Marras, Alexander E.; Zhou, Lifeng; Johnson, Joshua

    2015-03-01

    Structural DNA nanotechnology is a rapidly emerging field that has demonstrated great potential for applications such as single molecule sensing, drug delivery, and templating molecular components. As the applications of DNA nanotechnology expand, a consideration of their mechanical behavior is becoming essential to understand how these structures will respond to physical interactions. This review considers three major avenues of recent progress in this area: (1) measuring and designing mechanical properties of DNA nanostructures, (2) designing complex nanostructures based on imposed mechanical stresses, and (3) designing and controlling structurally dynamic nanostructures. This work has laid the foundation for mechanically active nanomachines that can generate, transmit, and respond to physical cues in molecular systems.Structural DNA nanotechnology is a rapidly emerging field that has demonstrated great potential for applications such as single molecule sensing, drug delivery, and templating molecular components. As the applications of DNA nanotechnology expand, a consideration of their mechanical behavior is becoming essential to understand how these structures will respond to physical interactions. This review considers three major avenues of recent progress in this area: (1) measuring and designing mechanical properties of DNA nanostructures, (2) designing complex nanostructures based on imposed mechanical stresses, and (3) designing and controlling structurally dynamic nanostructures. This work has laid the foundation for mechanically active nanomachines that can generate, transmit, and respond to physical cues in molecular systems. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr07153k

  20. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  1. Innovations in scholarly publishing. Evolving trends in research communication in a digital age: examples from the BMJ.

    Science.gov (United States)

    Jain, Anita

    2014-01-01

    As technology and communication evolve rapidly in this digital age, scholarly publishing is also undergoing a makeover to match the diverse needs of researchers and clinicians. The BMJ has been at the forefront of innovating the presentation of research to increase its readabillty and usefulness. This article presents some of recent formats used for research communication at the BMJ.

  2. Interstitial laser coagulation in the treatment of benign prostatic hyperplasia using a diode laser system: results of an evolving technology

    NARCIS (Netherlands)

    Mårtenson, A. C.; de la Rosette, J. J. M. C. H.

    1999-01-01

    Interstitial laser coagulation (ILC) treatment is a recent technique in the treatment of BPH that is evolving rapidly. The results of a prospective randomised study vs transurethral resection of the prostate (TURP) is presented as well as results of patients treated with a temperature sensing laser

  3. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  4. Quantum mechanics in an evolving Hilbert space

    Science.gov (United States)

    Artacho, Emilio; O'Regan, David D.

    2017-03-01

    Many basis sets for electronic structure calculations evolve with varying external parameters, such as moving atoms in dynamic simulations, giving rise to extra derivative terms in the dynamical equations. Here we revisit these derivatives in the context of differential geometry, thereby obtaining a more transparent formalization, and a geometrical perspective for better understanding the resulting equations. The effect of the evolution of the basis set within the spanned Hilbert space separates explicitly from the effect of the turning of the space itself when moving in parameter space, as the tangent space turns when moving in a curved space. New insights are obtained using familiar concepts in that context such as the Riemann curvature. The differential geometry is not strictly that for curved spaces as in general relativity, a more adequate mathematical framework being provided by fiber bundles. The language used here, however, will be restricted to tensors and basic quantum mechanics. The local gauge implied by a smoothly varying basis set readily connects with Berry's formalism for geometric phases. Generalized expressions for the Berry connection and curvature are obtained for a parameter-dependent occupied Hilbert space spanned by nonorthogonal Wannier functions. The formalism is applicable to basis sets made of atomic-like orbitals and also more adaptative moving basis functions (such as in methods using Wannier functions as intermediate or support bases), but should also apply to other situations in which nonorthogonal functions or related projectors should arise. The formalism is applied to the time-dependent quantum evolution of electrons for moving atoms. The geometric insights provided here allow us to propose new finite-difference time integrators, and also better understand those already proposed.

  5. Public participation at Fernald: FERMCO's evolving role

    International Nuclear Information System (INIS)

    Williams, J.B.; Fellman, R.W.; Brettschneider, D.J.

    1995-01-01

    In an effort to improve public involvement in the site restoration decision making process, the DOE has established site specific advisory boards, of which the Fernald Citizens Task Force is one. The Fernald Task Force is focused on making recommendations in four areas: (1) What should be the future use of the site? (2) Determinations of cleanup levels (how clean is clean?) (3) Where should the wastes be disposed of? (4) What should be the cleanup priorities? Because these questions are being asked very early in the decision-making process, the answers are necessarily qualified, and are based on a combination of preliminary data, assumptions, and professional judgment. The requirement to make progress in the absence of accurate data has necessitated FERMCO and the Task Force to employ an approach similar to sensitivity analysis, in which a range of possible data values are evaluated and the relative importance of the various factors is assessed. Because of its charter to provide recommendations of future site use, the Task Force has developed a sitewide perspective, compared to the more common operable unit specific focus of public participation under CERCLA. The relationship between FERMCO and the Task Force is evolving toward one of partnership with DOE in managing the obstacles and hidden opportunities for success. The Task Force likely will continue to participate in the Fernald project long after its initial recommendations have been made. DOE already has made the commitment that the process of public participation will extend into the Remedial Design phase. There is substantial reason for optimism that continuing the Task Force process through the design phase will assist in developing the appropriate balance of cost and engineered protectiveness

  6. Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

    Energy Technology Data Exchange (ETDEWEB)

    Winston Chen, C.H.; Taranenko, N.I.; Zhu, Y.F.; Chung, C.N.; Allman, S.L.

    1997-03-01

    Since laser mass spectrometry has the potential for achieving very fast DNA analysis, the authors recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Snager`s enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. The preliminary results indicate laser mass spectrometry can possibly be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, the authors applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

  7. Distinct co-evolution patterns of genes associated to DNA polymerase III DnaE and PolC

    Directory of Open Access Journals (Sweden)

    Engelen Stefan

    2012-02-01

    Full Text Available Abstract Background Bacterial genomes displaying a strong bias between the leading and the lagging strand of DNA replication encode two DNA polymerases III, DnaE and PolC, rather than a single one. Replication is a highly unsymmetrical process, and the presence of two polymerases is therefore not unexpected. Using comparative genomics, we explored whether other processes have evolved in parallel with each polymerase. Results Extending previous in silico heuristics for the analysis of gene co-evolution, we analyzed the function of genes clustering with dnaE and polC. Clusters were highly informative. DnaE co-evolves with the ribosome, the transcription machinery, the core of intermediary metabolism enzymes. It is also connected to the energy-saving enzyme necessary for RNA degradation, polynucleotide phosphorylase. Most of the proteins of this co-evolving set belong to the persistent set in bacterial proteomes, that is fairly ubiquitously distributed. In contrast, PolC co-evolves with RNA degradation enzymes that are present only in the A+T-rich Firmicutes clade, suggesting at least two origins for the degradosome. Conclusion DNA replication involves two machineries, DnaE and PolC. DnaE co-evolves with the core functions of bacterial life. In contrast PolC co-evolves with a set of RNA degradation enzymes that does not derive from the degradosome identified in gamma-Proteobacteria. This suggests that at least two independent RNA degradation pathways existed in the progenote community at the end of the RNA genome world.

  8. Multivalent HA DNA vaccination protects against highly pathogenic H5N1 avian influenza infection in chickens and mice.

    Directory of Open Access Journals (Sweden)

    Srinivas Rao

    Full Text Available Sustained outbreaks of highly pathogenic avian influenza (HPAI H5N1 in avian species increase the risk of reassortment and adaptation to humans. The ability to contain its spread in chickens would reduce this threat and help maintain the capacity for egg-based vaccine production. While vaccines offer the potential to control avian disease, a major concern of current vaccines is their potency and inability to protect against evolving avian influenza viruses.The ability of DNA vaccines encoding hemagglutinin (HA proteins from different HPAI H5N1 serotypes was evaluated for its ability to elicit neutralizing antibodies and to protect against homologous and heterologous HPAI H5N1 strain challenge in mice and chickens after DNA immunization by needle and syringe or with a pressure injection device. These vaccines elicited antibodies that neutralized multiple strains of HPAI H5N1 when given in combinations containing up to 10 HAs. The response was dose-dependent, and breadth was determined by the choice of the influenza virus HA in the vaccine. Monovalent and trivalent HA vaccines were tested first in mice and conferred protection against lethal H5N1 A/Vietnam/1203/2004 challenge 68 weeks after vaccination. In chickens, protection was observed against heterologous strains of HPAI H5N1 after vaccination with a trivalent H5 serotype DNA vaccine with doses as low as 5 microg DNA given twice either by intramuscular needle injection or with a needle-free device.DNA vaccines offer a generic approach to influenza virus immunization applicable to multiple animal species. In addition, the ability to substitute plasmids encoding different strains enables rapid adaptation of the vaccine to newly evolving field isolates.

  9. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson

    2013-01-01

    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  10. Template preparation for rapid PCR in Colletotrichum lindemuthianum

    Directory of Open Access Journals (Sweden)

    Roca M. Gabriela

    2003-01-01

    Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.

  11. A quick DNA extraction protocol: Without liquid nitrogen in ambient ...

    African Journals Online (AJOL)

    Marker assisted selection is an effective technique for quality traits selection in breeding program which are impossible by visual observation. Marker assisted selection in early generation requires rapid DNA extraction protocol for large number of samples in a low cost approach. A rapid and inexpensive DNA extraction ...

  12. DNA vaccines for aquacultured fish

    DEFF Research Database (Denmark)

    Lorenzen, Niels; LaPatra, S.E.

    2005-01-01

    of licensing and public acceptance of the technology. The potential benefits of DNA vaccines for farmed fish include improved animal welfare, reduced environmental impacts of aquaculture activities, increased food quality and quantity, and more sustainable production. Testing under commercial production......Deoxyribonucleic acid (DNA) vaccination is based on the administration of the gene encoding the vaccine antigen, rather than the antigen itself. Subsequent expression of the antigen by cells in the vaccinated hosts triggers the host immune system. Among the many experimental DNA vaccines tested...... in various animal species as well as in humans, the vaccines against rhabdovirus diseases in fish have given some of the most promising results. A single intramuscular (IM) injection of microgram amounts of DNA induces rapid and long-lasting protection in farmed salmonids against economically important...

  13. The Evolving Definition of the Term "Gene".

    Science.gov (United States)

    Portin, Petter; Wilkins, Adam

    2017-04-01

    This paper presents a history of the changing meanings of the term "gene," over more than a century, and a discussion of why this word, so crucial to genetics, needs redefinition today. In this account, the first two phases of 20th century genetics are designated the "classical" and the "neoclassical" periods, and the current molecular-genetic era the "modern period." While the first two stages generated increasing clarity about the nature of the gene, the present period features complexity and confusion. Initially, the term "gene" was coined to denote an abstract "unit of inheritance," to which no specific material attributes were assigned. As the classical and neoclassical periods unfolded, the term became more concrete, first as a dimensionless point on a chromosome, then as a linear segment within a chromosome, and finally as a linear segment in the DNA molecule that encodes a polypeptide chain. This last definition, from the early 1960s, remains the one employed today, but developments since the 1970s have undermined its generality. Indeed, they raise questions about both the utility of the concept of a basic "unit of inheritance" and the long implicit belief that genes are autonomous agents. Here, we review findings that have made the classic molecular definition obsolete and propose a new one based on contemporary knowledge. Copyright © 2017 by the Genetics Society of America.

  14. Epigenetic changes of DNA repair genes in cancer.

    Science.gov (United States)

    Lahtz, Christoph; Pfeifer, Gerd P

    2011-02-01

    'Every Hour Hurts, The Last One Kills'. That is an old saying about getting old. Every day, thousands of DNA damaging events take place in each cell of our body, but efficient DNA repair systems have evolved to prevent that. However, our DNA repair system and that of most other organisms are not as perfect as that of Deinococcus radiodurans, for example, which is able to repair massive amounts of DNA damage at one time. In many instances, accumulation of DNA damage has been linked to cancer, and genetic deficiencies in specific DNA repair genes are associated with tumor-prone phenotypes. In addition to mutations, which can be either inherited or somatically acquired, epigenetic silencing of DNA repair genes may promote tumorigenesis. This review will summarize current knowledge of the epigenetic inactivation of different DNA repair components in human cancer.

  15. Processing of free radical damaged DNA bases

    International Nuclear Information System (INIS)

    Wallace, S.

    2003-01-01

    Free radicals produced during the radiolysis of water gives rise to a plethora of DNA damages including single strand breaks, sites of base loss and a wide variety of purine and pyrimidine base lesions. All these damages are processed in cells by base excision repair. The oxidative DNA glycosylases which catalyze the first step in the removal of a base damage during base excision repair evolved primarily to protect the cells from the deleterious mutagenic effects of single free radical-induced DNA lesions arising during oxidative metabolism. This is evidenced by the high spontaneous mutation rate in bacterial mutants lacking the oxidative DNA glycosylases. However, when a low LET photon transverses the DNA molecule, a burst of free radicals is produced during the radiolysis of water that leads to the formation of clustered damages in the DNA molecule, that are recognized by the oxidative DNA glycosylases. When substrates containing two closely opposed sugar damages or base and sugar damages are incubated with the oxidative DNA glycosylases in vitro, one strand is readily incised by the lyase activity of the DNA glycosylase. Whether or not the second strand is incised depends on the distance between the strand break resulting from the incised first strand and the remaining DNA lesion on the other strand. If the lesions are more than two or three base pairs apart, the second strand is readily cleaved by the DNA glycosylase, giving rise to a double strand break. Even if the entire base excision repair system is reconstituted in vitro, whether or not a double strand break ensues depends solely upon the ability of the DNA glycosylase to cleave the second strand. These data predicted that cells deficient in the oxidative DNA glycosylases would be radioresistant while those that overproduce an oxidative DNA glycosylase would be radiosensitive. This prediction was indeed borne in Escherichia coli that is, mutants lacking the oxidative DNA glycosylases are radioresistant

  16. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)

    RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...

  17. Evolving R Coronae Borealis Stars with MESA

    Science.gov (United States)

    Clayton, Geoffrey C.; Lauer, Amber; Chatzopoulos, Emmanouil; Frank, Juhan

    2018-01-01

    being a WD. Solving the mystery of how the RCB stars evolve will lead to a better understanding of other important types of stellar merger events such as Type Ia SNe.

  18. The evolving integrated vascular surgery residency curriculum.

    Science.gov (United States)

    Smith, Brigitte K; Greenberg, Jacob A; Mitchell, Erica L

    2014-10-01

    PDs voiced concern over the lack of standardization among the differing programs and most of the PDs agree that some degree of programmatic standardization is critical for the continued success of the 0 + 5 training paradigm. Qualitative evaluation of PD experiences with the development of 0 + 5 vascular surgery residency programs reveals the key factors that commonly influence program design. Programs continue to evolve in both structure and content as PDs respond to these influences. Learning from the collective experience of PDs and some standardization of the curricula may help current and future programs avoid common pitfalls in curricular development. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Mechanics of evolving thin film structures

    Science.gov (United States)

    Liang, Jim

    In the Stranski-Krastanov system, the lattice mismatch between the film and the substrate causes the film to break into islands. During annealing, both the surface energy and the elastic energy drive the islands to coarsen. Motivated by several related studies, we suggest that stable islands should form when a stiff ceiling is placed at a small gap above the film. We show that the role of elasticity is reversed: with the ceiling, the total elastic energy stored in the system increases as the islands coarsen laterally. Consequently, the islands select an equilibrium size to minimize the combined elastic energy and surface energy. In lithographically-induced self-assembly, when a two-phase fluid confined between parallel substrates is subjected to an electric field, one phase can self-assemble into a triangular lattice of islands in another phase. We describe a theory of the stability of the island lattice. The islands select the equilibrium diameter to minimize the combined interface energy and electrostatic energy. Furthermore, we study compressed SiGe thin film islands fabricated on a glass layer, which itself lies on a silicon wafer. Upon annealing, the glass flows, and the islands relax. A small island relaxes by in-plane expansion. A large island, however, wrinkles at the center before the in-plane relaxation arrives. The wrinkles may cause significant tensile stress in the island, leading to fracture. We model the island by the von Karman plate theory and the glass layer by the Reynolds lubrication theory. Numerical simulations evolve the in-plane expansion and the wrinkles simultaneously. We determine the critical island size, below which in-plane expansion prevails over wrinkling. Finally, in devices that integrate dissimilar materials in small dimensions, crack extension in one material often accompanies inelastic deformation in another. We analyze a channel crack advancing in an elastic film under tension, while an underlayer creeps. We use a two

  20. Basal metabolic rate can evolve independently of morphological and behavioural traits.

    Science.gov (United States)

    Mathot, K J; Martin, K; Kempenaers, B; Forstmeier, W

    2013-09-01

    Quantitative genetic analyses of basal metabolic rate (BMR) can inform us about the evolvability of the trait by providing estimates of heritability, and also of genetic correlations with other traits that may constrain the ability of BMR to respond to selection. Here, we studied a captive population of zebra finches (Taeniopygia guttata) in which selection lines for male courtship rate have been established. We measure BMR in these lines to see whether selection on male sexual activity would change BMR as a potentially correlated trait. We find that the genetic correlation between courtship rate and BMR is practically zero, indicating that the two traits can evolve independently of each other. Interestingly, we find that the heritability of BMR in our population (h(2)=0.45) is markedly higher than was previously reported for a captive zebra finch population from Norway. A comparison of the two studies shows that additive genetic variance in BMR has been largely depleted in the Norwegian population, especially the genetic variance in BMR that is independent of body mass. In our population, the slope of BMR increase with body mass differs not only between the sexes but also between the six selection lines, which we tentatively attribute to genetic drift and/or founder effects being strong in small populations. Our study therefore highlights two things. First, the evolvability of BMR may be less constrained by genetic correlations and lack of independent genetic variation than previously described. Second, genetic drift in small populations can rapidly lead to different evolvabilities across populations.

  1. Use of DNA markers in forest tree improvement research

    Science.gov (United States)

    D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

    1992-01-01

    DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

  2. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  3. DNA-nuclear matrix interactions and ionizing radiation sensitivity

    International Nuclear Information System (INIS)

    Schwartz, J.L.; Chicago Univ., IL; Vaughan, A.T.M.

    1993-01-01

    The association between inherent ionizing radiation sensitivity and DNA supercoil unwinding in mammalian cells suggests that the DNA-nuclear matrix attachment region (MAR) plays an important role in radiation response. In radioresistant cells, the MAR structure may exist in a more stable, open configuration, limiting DNA unwinding following strand break induction and maintaining DNA ends in close proximity for more rapid and accurate rejoining. In addition, the open configuration at these matrix attachment sites may serve to facilitate rapid DNA processing of breaks by providing (1) sites for repair proteins to collect and (2) energy to drive enzymatic reactions

  4. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    Science.gov (United States)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  5. A bouquet of DNA structures: Emerging diversity.

    Science.gov (United States)

    Kaushik, Mahima; Kaushik, Shikha; Roy, Kapil; Singh, Anju; Mahendru, Swati; Kumar, Mohan; Chaudhary, Swati; Ahmed, Saami; Kukreti, Shrikant

    2016-03-01

    Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson-Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.

  6. A bouquet of DNA structures: Emerging diversity

    Directory of Open Access Journals (Sweden)

    Mahima Kaushik

    2016-03-01

    Full Text Available Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson–Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.

  7. Mechanisms for radiation damage in DNA

    International Nuclear Information System (INIS)

    Sevilla, M.D.

    1993-12-01

    In this project the author has proposed several mechanisms for radiation damage to DNA and its constituents, and has detailed a series of experiments utilizing electron spin resonance spectroscopy, HPLC, GC-mass spectroscopy and ab initio molecular orbital calculations to test the proposed mechanisms. In this years work he has completed several experiments on the role of hydration water on DNA radiation damage, continued the investigation of the localization of the initial charges and their reactions on DNA, investigated protonation reactions in DNA base anions, and employed ab initio molecular orbital theory to gain insight into the initial events of radiation damage to DNA. Ab initio calculations have provided an understanding of the energetics evolved in anion and cation formation, ion radical transfer in DNA as well as proton transfer with DNA base pair radical ions. This has been extended in this years work to a consideration of ionization energies of various components of the DNA deoxyribose backbone and resulting neutral sugar radicals. This information has aided the formation of new radiation models for the effect of radiation on DNA. During this fiscal year four articles have been published, four are in press, one is submitted and several more are in preparation. Four papers have been presented at scientific meetings. This years effort will include another review article on the open-quotes Electron Spin Resonance of Radiation Damage to DNAclose quotes

  8. Diverse CRISPRs evolving in human microbiomes.

    Directory of Open Access Journals (Sweden)

    Mina Rho

    Full Text Available CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats loci, together with cas (CRISPR-associated genes, form the CRISPR/Cas adaptive immune system, a primary defense strategy that eubacteria and archaea mobilize against foreign nucleic acids, including phages and conjugative plasmids. Short spacer sequences separated by the repeats are derived from foreign DNA and direct interference to future infections. The availability of hundreds of shotgun metagenomic datasets from the Human Microbiome Project (HMP enables us to explore the distribution and diversity of known CRISPRs in human-associated microbial communities and to discover new CRISPRs. We propose a targeted assembly strategy to reconstruct CRISPR arrays, which whole-metagenome assemblies fail to identify. For each known CRISPR type (identified from reference genomes, we use its direct repeat consensus sequence to recruit reads from each HMP dataset and then assemble the recruited reads into CRISPR loci; the unique spacer sequences can then be extracted for analysis. We also identified novel CRISPRs or new CRISPR variants in contigs from whole-metagenome assemblies and used targeted assembly to more comprehensively identify these CRISPRs across samples. We observed that the distributions of CRISPRs (including 64 known and 86 novel ones are largely body-site specific. We provide detailed analysis of several CRISPR loci, including novel CRISPRs. For example, known streptococcal CRISPRs were identified in most oral microbiomes, totaling ∼8,000 unique spacers: samples resampled from the same individual and oral site shared the most spacers; different oral sites from the same individual shared significantly fewer, while different individuals had almost no common spacers, indicating the impact of subtle niche differences on the evolution of CRISPR defenses. We further demonstrate potential applications of CRISPRs to the tracing of rare species and the virus exposure of individuals

  9. Evolving a polymerase for hydrophobic base analogues.

    Science.gov (United States)

    Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

    2009-10-21

    Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

  10. The evolving genetic risk for sporadic ALS.

    Science.gov (United States)

    Gibson, Summer B; Downie, Jonathan M; Tsetsou, Spyridoula; Feusier, Julie E; Figueroa, Karla P; Bromberg, Mark B; Jorde, Lynn B; Pulst, Stefan M

    2017-07-18

    To estimate the genetic risk conferred by known amyotrophic lateral sclerosis (ALS)-associated genes to the pathogenesis of sporadic ALS (SALS) using variant allele frequencies combined with predicted variant pathogenicity. Whole exome sequencing and repeat expansion PCR of C9orf72 and ATXN2 were performed on 87 patients of European ancestry with SALS seen at the University of Utah. DNA variants that change the protein coding sequence of 31 ALS-associated genes were annotated to determine which were rare and deleterious as predicted by MetaSVM. The percentage of patients with SALS with a rare and deleterious variant or repeat expansion in an ALS-associated gene was calculated. An odds ratio analysis was performed comparing the burden of ALS-associated genes in patients with SALS vs 324 normal controls. Nineteen rare nonsynonymous variants in an ALS-associated gene, 2 of which were found in 2 different individuals, were identified in 21 patients with SALS. Further, 5 deleterious C9orf72 and 2 ATXN2 repeat expansions were identified. A total of 17.2% of patients with SALS had a rare and deleterious variant or repeat expansion in an ALS-associated gene. The genetic burden of ALS-associated genes in patients with SALS as predicted by MetaSVM was significantly higher than in normal controls. Previous analyses have identified SALS-predisposing variants only in terms of their rarity in normal control populations. By incorporating variant pathogenicity as well as variant frequency, we demonstrated that the genetic risk contributed by these genes for SALS is substantially lower than previous estimates. © 2017 American Academy of Neurology.

  11. DNA Vaccines

    Indian Academy of Sciences (India)

    diseases. Keywords. DNA vaccine, immune response, antibodies, infectious diseases. GENERAL .... tein vaccines require expensive virus/protein purification tech- niques as ... sphere continue to remain major health hazards in developing nations. ... significance since it can be produced at a very low cost and can be stored ...

  12. DNA Investigations.

    Science.gov (United States)

    Mayo, Ellen S.; Bertino, Anthony J.

    1991-01-01

    Presents a simulation activity that allow students to work through the exercise of DNA profiling and to grapple with some analytical and ethical questions involving a couple arranging with a surrogate mother to have a baby. Can be used to teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization. (MDH)

  13. Evolving Perspectives on Lyme Borreliosis in Canada

    Science.gov (United States)

    Sperling, JLH; Middelveen, MJ; Klein, D; Sperling, FAH

    2012-01-01

    With cases now documented in every province, Lyme borreliosis (LB) is emerging as a serious public health risk in Canada. Controversy over the contribution of LB to the burden of chronic disease is maintained by difficulty in capturing accurate Canadian statistics, especially early clinical cases of LB. The use of dogs as sentinel species demon-strates that potential contact with Borrelia burgdorferi spirochetes, as detected by C6 peptide, extends across the country. Dissemination of infected ticks by migratory birds and rapid establishment of significant levels of infection have been well described. Canadian public health response has focused on identification of established populations of the tick vectors, Ixodes scapularis and I. pacificus, on the assumption that these are the only important vectors of the disease across Canada. Strains of B. burgdorferi circulating in Canada and the full range of their reservoir species and coinfections remain to be explored. Ongoing surveys and historical records demonstrate that Borrelia-positive Ixodes species are regu-larly present in regions of Canada that have previously been considered to be outside of the ranges of these species in re-cent modeling efforts. We present data demonstrating that human cases of LB are found across the nation. Consequently, physician education and better early diagnoses are needed to prevent long term sequelae. An international perspective will be paramount for developing improved Canadian guidelines that recognize the complexity and diversity of Lyme borreliosis. PMID:23091570

  14. Evolving water science in the Anthropocene

    Science.gov (United States)

    Savenije, H. H. G.; Hoekstra, A. Y.; van der Zaag, P.

    2013-06-01

    This paper reviews the changing relation between man and water since the industrial revolution, the period that has been called the Anthropocene because of the unprecedented scale at which humans have altered the planet. We show how the rapidly changing reality urges us to continuously improve our understanding of the complex interactions between man and the water system. The paper starts with demonstrating that hydrology and the science of water resources management have played key roles in human and economic development throughout history; yet these roles have often been marginalised or obscured. Knowledge on hydrology and water resources engineering and management helped to transform the landscape, and thus also the very hydrology within catchments itself. It is only fairly recent that water experts have become self-conscious of such mechanisms, exemplified by several concepts that try to internalise them (integrated water resources management, eco-hydrology, socio-hydrology). We have reached a stage where a more systemic understanding of scale interdependencies can inform the sustainable governance of water systems, using new concepts like precipitationsheds, virtual water transfers, water footprint and water value flow.

  15. Adoption of Geospatial Systems towards evolving Sustainable Himalayan Mountain Development

    Science.gov (United States)

    Murthy, M. S. R.; Bajracharya, B.; Pradhan, S.; Shestra, B.; Bajracharya, R.; Shakya, K.; Wesselmann, S.; Ali, M.; Bajracharya, S.; Pradhan, S.

    2014-11-01

    Natural resources dependence of mountain communities, rapid social and developmental changes, disaster proneness and climate change are conceived as the critical factors regulating sustainable Himalayan mountain development. The Himalayan region posed by typical geographic settings, diverse physical and cultural diversity present a formidable challenge to collect and manage data, information and understands varied socio-ecological settings. Recent advances in earth observation, near real-time data, in-situ measurements and in combination of information and communication technology have transformed the way we collect, process, and generate information and how we use such information for societal benefits. Glacier dynamics, land cover changes, disaster risk reduction systems, food security and ecosystem conservation are a few thematic areas where geospatial information and knowledge have significantly contributed to informed decision making systems over the region. The emergence and adoption of near-real time systems, unmanned aerial vehicles (UAV), board-scale citizen science (crowd-sourcing), mobile services and mapping, and cloud computing have paved the way towards developing automated environmental monitoring systems, enhanced scientific understanding of geophysical and biophysical processes, coupled management of socio-ecological systems and community based adaptation models tailored to mountain specific environment. There are differentiated capacities among the ICIMOD regional member countries with regard to utilization of earth observation and geospatial technologies. The region can greatly benefit from a coordinated and collaborative approach to capture the opportunities offered by earth observation and geospatial technologies. The regional level data sharing, knowledge exchange, and Himalayan GEO supporting geospatial platforms, spatial data infrastructure, unique region specific satellite systems to address trans-boundary challenges would go a long way in

  16. An Evolved System of Radiological Protection

    International Nuclear Information System (INIS)

    Kaneko, M.

    2004-01-01

    The current system of radiological protection based on the Linear No-Threshold (LNT) hypothesis has greatly contributed to the minimization of doses received by workers and members of the public. However, it has brought about r adiophobia a mong people and waste of resources due to over-regulation, because the LNT implies that radiation is harmful no matter how small the dose is. The author reviewed the results of research on health effects of radiation including major epidemiological studies on radiation workers and found no clear evidence of deleterious health effects from radiation exposures below the current maximum dose limits (50 mSv/y for workers and 5 mSv/y for members of the public), which have been adopted worldwide in the second half of the 20th century. Now that the existence of bio-defensive mechanisms such as DNA repair, apoptosis and adaptive response are well recognized, the linearity assumption cannot be said to be s cientific . Evidences increasingly imply that there are threshold effects in risk of radiation. A concept of practical thresholds or virtually safe doses will have to be introduced into the new system of radiological protection in order to resolve the low dose issues. Practical thresholds may be defined as dose levels below which induction of detectable radiogenic cancers or hereditary effects are not expected. If any workers and members of the public do not gain benefits from being exposed, excepting intentional irradiation for medical purposes, their radiation exposures should be kept below practical thresholds. On the assumption that the current dose limits are below practical thresholds and with no radiation detriments, there is no need of justification and optimization (ALARA) principles for occupational and public exposures. Then the ethical issue of justification to allow benefit to society to offset radiation detriments to individuals can be resolved. And also the ethical issue of optimization to exchange health or safety for

  17. Combined sequencing of mRNA and DNA from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Florian Mertes

    2016-06-01

    Full Text Available Combined transcriptome and whole genome sequencing of the same ultra-low input sample down to single cells is a rapidly evolving approach for the analysis of rare cells. Besides stem cells, rare cells originating from tissues like tumor or biopsies, circulating tumor cells and cells from early embryonic development are under investigation. Herein we describe a universal method applicable for the analysis of minute amounts of sample material (150 to 200 cells derived from sub-colony structures from human embryonic stem cells. The protocol comprises the combined isolation and separate amplification of poly(A mRNA and whole genome DNA followed by next generation sequencing. Here we present a detailed description of the method developed and an overview of the results obtained for RNA and whole genome sequencing of human embryonic stem cells, sequencing data is available in the Gene Expression Omnibus (GEO database under accession number GSE69471.

  18. The genotype-phenotype map of an evolving digital organism.

    Directory of Open Access Journals (Sweden)

    Miguel A Fortuna

    2017-02-01

    Full Text Available To understand how evolving systems bring forth novel and useful phenotypes, it is essential to understand the relationship between genotypic and phenotypic change. Artificial evolving systems can help us understand whether the genotype-phenotype maps of natural evolving systems are highly unusual, and it may help create evolvable artificial systems. Here we characterize the genotype-phenotype map of digital organisms in Avida, a platform for digital evolution. We consider digital organisms from a vast space of 10141 genotypes (instruction sequences, which can form 512 different phenotypes. These phenotypes are distinguished by different Boolean logic functions they can compute, as well as by the complexity of these functions. We observe several properties with parallels in natural systems, such as connected genotype networks and asymmetric phenotypic transitions. The likely common cause is robustness to genotypic change. We describe an intriguing tension between phenotypic complexity and evolvability that may have implications for biological evolution. On the one hand, genotypic change is more likely to yield novel phenotypes in more complex organisms. On the other hand, the total number of novel phenotypes reachable through genotypic change is highest for organisms with simple phenotypes. Artificial evolving systems can help us study aspects of biological evolvability that are not accessible in vastly more complex natural systems. They can also help identify properties, such as robustness, that are required for both human-designed artificial systems and synthetic biological systems to be evolvable.

  19. The genotype-phenotype map of an evolving digital organism.

    Science.gov (United States)

    Fortuna, Miguel A; Zaman, Luis; Ofria, Charles; Wagner, Andreas

    2017-02-01

    To understand how evolving systems bring forth novel and useful phenotypes, it is essential to understand the relationship between genotypic and phenotypic change. Artificial evolving systems can help us understand whether the genotype-phenotype maps of natural evolving systems are highly unusual, and it may help create evolvable artificial systems. Here we characterize the genotype-phenotype map of digital organisms in Avida, a platform for digital evolution. We consider digital organisms from a vast space of 10141 genotypes (instruction sequences), which can form 512 different phenotypes. These phenotypes are distinguished by different Boolean logic functions they can compute, as well as by the complexity of these functions. We observe several properties with parallels in natural systems, such as connected genotype networks and asymmetric phenotypic transitions. The likely common cause is robustness to genotypic change. We describe an intriguing tension between phenotypic complexity and evolvability that may have implications for biological evolution. On the one hand, genotypic change is more likely to yield novel phenotypes in more complex organisms. On the other hand, the total number of novel phenotypes reachable through genotypic change is highest for organisms with simple phenotypes. Artificial evolving systems can help us study aspects of biological evolvability that are not accessible in vastly more complex natural systems. They can also help identify properties, such as robustness, that are required for both human-designed artificial systems and synthetic biological systems to be evolvable.

  20. An Evolving Asymmetric Game for Modeling Interdictor-Smuggler Problems

    Science.gov (United States)

    2016-06-01

    ASYMMETRIC GAME FOR MODELING INTERDICTOR-SMUGGLER PROBLEMS by Richard J. Allain June 2016 Thesis Advisor: David L. Alderson Second Reader: W...DATES COVERED Master’s thesis 4. TITLE AND SUBTITLE AN EVOLVING ASYMMETRIC GAME FOR MODELING INTERDICTOR- SMUGGLER PROBLEMS 5. FUNDING NUMBERS 6...NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS Approved for public release; distribution is unlimited AN EVOLVING

  1. Adaptation of Escherichia coli to glucose promotes evolvability in lactose.

    Science.gov (United States)

    Phillips, Kelly N; Castillo, Gerardo; Wünsche, Andrea; Cooper, Tim F

    2016-02-01

    The selective history of a population can influence its subsequent evolution, an effect known as historical contingency. We previously observed that five of six replicate populations that were evolved in a glucose-limited environment for 2000 generations, then switched to lactose for 1000 generations, had higher fitness increases in lactose than populations started directly from the ancestor. To test if selection in glucose systematically increased lactose evolvability, we started 12 replay populations--six from a population subsample and six from a single randomly selected clone--from each of the six glucose-evolved founder populations. These replay populations and 18 ancestral populations were evolved for 1000 generations in a lactose-limited environment. We found that replay populations were initially slightly less fit in lactose than the ancestor, but were more evolvable, in that they increased in fitness at a faster rate and to higher levels. This result indicates that evolution in the glucose environment resulted in genetic changes that increased the potential of genotypes to adapt to lactose. Genome sequencing identified four genes--iclR, nadR, spoT, and rbs--that were mutated in most glucose-evolved clones and are candidates for mediating increased evolvability. Our results demonstrate that short-term selective costs during selection in one environment can lead to changes in evolvability that confer longer term benefits. © 2016 The Author(s). Evolution © 2016 The Society for the Study of Evolution.

  2. PCBA demand forecasting using an evolving Takagi-Sugeno system

    NARCIS (Netherlands)

    van Rooijen, M.; Almeida, R.J.; Kaymak, U.

    2016-01-01

    This paper investigates the use of using an evolving fuzzy system for printed circuit board (PCBA) demand forecasting. The algorithm is based on the evolving Takagi-Sugeno (eTS) fuzzy system, which has the ability to incorporate new patterns by changing its internal structure in an on-line fashion.

  3. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  4. DNA aptamer evolved by cell-SELEX for recognition of prostate cancer.

    Directory of Open Access Journals (Sweden)

    Yuanyuan Wang

    Full Text Available Morbidity and mortality of prostate cancer (PCa have increased in recent years worldwide. Currently existing methods for diagnosis and treatment do not make the situation improve, especially for hormone refractory prostate cancer (HRPC. The lack of molecular probes for PCa hindered the early diagnosis of metastasis and accurate staging for PCa. In this work, we have developed a new aptamer probe Wy-5a against PCa cell line PC-3 by cell-SELEX technique. Wy-5a shows high specificity to the target cells with dissociation constants in the nanomolar range, and does not recognize other tested PCa cell lines and other tested tumor cell lines. The staining of clinical tissue sections with fluorescent dye labeled Wy-5a shows that sections from high risk group with metastasis exhibited stronger fluorescence and sections from Benign Prostatic Hyperplasia (BPH did not exhibit notable fluorescence, which suggests that aptamer Wy-5a may bind to protein related to the progression of PCa. The high affinity and specificity of Wy-5a makes this aptamer hold potential for application in diagnosis and target therapy of PCa.

  5. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Science.gov (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  6. Laplacian Estrada and normalized Laplacian Estrada indices of evolving graphs.

    Directory of Open Access Journals (Sweden)

    Yilun Shang

    Full Text Available Large-scale time-evolving networks have been generated by many natural and technological applications, posing challenges for computation and modeling. Thus, it is of theoretical and practical significance to probe mathematical tools tailored for evolving networks. In this paper, on top of the dynamic Estrada index, we study the dynamic Laplacian Estrada index and the dynamic normalized Laplacian Estrada index of evolving graphs. Using linear algebra techniques, we established general upper and lower bounds for these graph-spectrum-based invariants through a couple of intuitive graph-theoretic measures, including the number of vertices or edges. Synthetic random evolving small-world networks are employed to show the relevance of the proposed dynamic Estrada indices. It is found that neither the static snapshot graphs nor the aggregated graph can approximate the evolving graph itself, indicating the fundamental difference between the static and dynamic Estrada indices.

  7. Laplacian Estrada and normalized Laplacian Estrada indices of evolving graphs.

    Science.gov (United States)

    Shang, Yilun

    2015-01-01

    Large-scale time-evolving networks have been generated by many natural and technological applications, posing challenges for computation and modeling. Thus, it is of theoretical and practical significance to probe mathematical tools tailored for evolving networks. In this paper, on top of the dynamic Estrada index, we study the dynamic Laplacian Estrada index and the dynamic normalized Laplacian Estrada index of evolving graphs. Using linear algebra techniques, we established general upper and lower bounds for these graph-spectrum-based invariants through a couple of intuitive graph-theoretic measures, including the number of vertices or edges. Synthetic random evolving small-world networks are employed to show the relevance of the proposed dynamic Estrada indices. It is found that neither the static snapshot graphs nor the aggregated graph can approximate the evolving graph itself, indicating the fundamental difference between the static and dynamic Estrada indices.

  8. Efficient DNA ligation in DNA–RNA hybrid helices by Chlorella virus DNA ligase

    Science.gov (United States)

    Lohman, Gregory J. S.; Zhang, Yinhua; Zhelkovsky, Alexander M.; Cantor, Eric J.; Evans, Thomas C.

    2014-01-01

    Single-stranded DNA molecules (ssDNA) annealed to an RNA splint are notoriously poor substrates for DNA ligases. Herein we report the unexpectedly efficient ligation of RNA-splinted DNA by Chlorella virus DNA ligase (PBCV-1 DNA ligase). PBCV-1 DNA ligase ligated ssDNA splinted by RNA with kcat ≈ 8 x 10−3 s−1 and KM DNA ligase produced only 5′-adenylylated DNA with a 20-fold lower kcat and a KM ≈ 300 nM. The rate of ligation increased with addition of Mn2+, but was strongly inhibited by concentrations of NaCl >100 mM. Abortive adenylylation was suppressed at low ATP concentrations (8, leading to increased product yields. The ligation reaction was rapid for a broad range of substrate sequences, but was relatively slower for substrates with a 5′-phosphorylated dC or dG residue on the 3′ side of the ligation junction. Nevertheless, PBCV-1 DNA ligase ligated all sequences tested with 10-fold less enzyme and 15-fold shorter incubation times than required when using T4 DNA ligase. Furthermore, this ligase was used in a ligation-based detection assay system to show increased sensitivity over T4 DNA ligase in the specific detection of a target mRNA. PMID:24203707

  9. Role of norepinephrine in the regulation of rapid eye movement sleep

    Indian Academy of Sciences (India)

    Sleep and wakefulness are instinctive behaviours that are present across the animal species. Rapid eye movement (REM) sleep is a unique biological phenomenon expressed during sleep. It evolved about 300 million years ago and is noticed in the more evolved animal species. Although it has been objectively identified ...

  10. Revisiting Robustness and Evolvability: Evolution in Weighted Genotype Spaces

    Science.gov (United States)

    Partha, Raghavendran; Raman, Karthik

    2014-01-01

    Robustness and evolvability are highly intertwined properties of biological systems. The relationship between these properties determines how biological systems are able to withstand mutations and show variation in response to them. Computational studies have explored the relationship between these two properties using neutral networks of RNA sequences (genotype) and their secondary structures (phenotype) as a model system. However, these studies have assumed every mutation to a sequence to be equally likely; the differences in the likelihood of the occurrence of various mutations, and the consequence of probabilistic nature of the mutations in such a system have previously been ignored. Associating probabilities to mutations essentially results in the weighting of genotype space. We here perform a comparative analysis of weighted and unweighted neutral networks of RNA sequences, and subsequently explore the relationship between robustness and evolvability. We show that assuming an equal likelihood for all mutations (as in an unweighted network), underestimates robustness and overestimates evolvability of a system. In spite of discarding this assumption, we observe that a negative correlation between sequence (genotype) robustness and sequence evolvability persists, and also that structure (phenotype) robustness promotes structure evolvability, as observed in earlier studies using unweighted networks. We also study the effects of base composition bias on robustness and evolvability. Particularly, we explore the association between robustness and evolvability in a sequence space that is AU-rich – sequences with an AU content of 80% or higher, compared to a normal (unbiased) sequence space. We find that evolvability of both sequences and structures in an AU-rich space is lesser compared to the normal space, and robustness higher. We also observe that AU-rich populations evolving on neutral networks of phenotypes, can access less phenotypic variation compared to

  11. A rapid two step protocol of in vitro propagation of an important ...

    African Journals Online (AJOL)

    chandrakant tiwari

    2013-03-06

    Mar 6, 2013 ... Attempts were made to evolve a rapid in vitro technology ..... Values are given as mean ± standard error (SE) of three replicates; each replicate consisted of 24 .... Seminar on Herbal Conservation, Cultivation, Marketing and.

  12. A polarized view on DNA under tension

    Science.gov (United States)

    van Mameren, Joost; Vermeulen, Karen; Wuite, Gijs J. L.; Peterman, Erwin J. G.

    2018-03-01

    In the past decades, sensitive fluorescence microscopy techniques have contributed significantly to our understanding of the dynamics of DNA. The specific labeling of DNA using intercalating dyes has allowed for quantitative measurement of the thermal fluctuations the polymers undergo. On the other hand, recent advances in single-molecule manipulation techniques have unraveled the mechanical and elastic properties of this intricate polymer. Here, we have combined these two approaches to study the conformational dynamics of DNA under a wide range of tensions. Using polarized fluorescence microscopy in conjunction with optical-tweezers-based manipulation of YOYO-intercalated DNA, we controllably align the YOYO dyes using DNA tension, enabling us to disentangle the rapid dynamics of the dyes from that of the DNA itself. With unprecedented control of the DNA alignment, we resolve an inconsistency in reports about the tilted orientation of intercalated dyes. We find that intercalated dyes are on average oriented perpendicular to the long axis of the DNA, yet undergo fast dynamics on the time scale of absorption and fluorescence emission. In the overstretching transition of double-stranded DNA, we do not observe changes in orientation or orientational dynamics of the dyes. Only beyond the overstretching transition, a considerable depolarization is observed, presumably caused by an average tilting of the DNA base pairs. Our combined approach thus contributes to the elucidation of unique features of the molecular dynamics of DNA.

  13. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    OpenAIRE

    Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...

  14. [Phylogenetic relationships among the genera of Taxodiaceae and Cupressaceae from 28S rDNA sequences].

    Science.gov (United States)

    Li, Chun-Xiang; Yang, Qun

    2003-03-01

    DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.

  15. DNA repair

    International Nuclear Information System (INIS)

    Setlow, R.

    1978-01-01

    Some topics discussed are as follows: difficulty in extrapolating data from E. coli to mammalian systems; mutations caused by UV-induced changes in DNA; mutants deficient in excision repair; other postreplication mechanisms; kinds of excision repair systems; detection of repair by biochemical or biophysical means; human mutants deficient in repair; mutagenic effects of UV on XP cells; and detection of UV-repair defects among XP individuals

  16. The Bright and the Dark Sides of DNA Repair in Stem Cells

    OpenAIRE

    Frosina, Guido

    2010-01-01

    DNA repair is a double-edged sword in stem cells. It protects normal stem cells in both embryonic and adult tissues from genetic damage, thus allowing perpetuation of intact genomes into new tissues. Fast and efficient DNA repair mechanisms have evolved in normal stem and progenitor cells. Upon differentiation, a certain degree of somatic mutations becomes more acceptable and, consequently, DNA repair dims. DNA repair turns into a problem when stem cells transform and become cancerous. Tran...

  17. DNA Tumor Virus Regulation of Host DNA Methylation and Its Implications for Immune Evasion and Oncogenesis.

    Science.gov (United States)

    Kuss-Duerkop, Sharon K; Westrich, Joseph A; Pyeon, Dohun

    2018-02-13

    Viruses have evolved various mechanisms to evade host immunity and ensure efficient viral replication and persistence. Several DNA tumor viruses modulate host DNA methyltransferases for epigenetic dysregulation of immune-related gene expression in host cells. The host immune responses suppressed by virus-induced aberrant DNA methylation are also frequently involved in antitumor immune responses. Here, we describe viral mechanisms and virus-host interactions by which DNA tumor viruses regulate host DNA methylation to evade antiviral immunity, which may contribute to the generation of an immunosuppressive microenvironment during cancer development. Recent trials of immunotherapies have shown promising results to treat multiple cancers; however, a significant number of non-responders necessitate identifying additional targets for cancer immunotherapies. Thus, understanding immune evasion mechanisms of cancer-causing viruses may provide great insights for reversing immune suppression to prevent and treat associated cancers.

  18. DNA Tumor Virus Regulation of Host DNA Methylation and Its Implications for Immune Evasion and Oncogenesis

    Directory of Open Access Journals (Sweden)

    Sharon K. Kuss-Duerkop

    2018-02-01

    Full Text Available Viruses have evolved various mechanisms to evade host immunity and ensure efficient viral replication and persistence. Several DNA tumor viruses modulate host DNA methyltransferases for epigenetic dysregulation of immune-related gene expression in host cells. The host immune responses suppressed by virus-induced aberrant DNA methylation are also frequently involved in antitumor immune responses. Here, we describe viral mechanisms and virus–host interactions by which DNA tumor viruses regulate host DNA methylation to evade antiviral immunity, which may contribute to the generation of an immunosuppressive microenvironment during cancer development. Recent trials of immunotherapies have shown promising results to treat multiple cancers; however, a significant number of non-responders necessitate identifying additional targets for cancer immunotherapies. Thus, understanding immune evasion mechanisms of cancer-causing viruses may provide great insights for reversing immune suppression to prevent and treat associated cancers.

  19. Feasibility of RNA and DNA Extraction from Fresh Pipelle and Archival Endometrial Tissues for Use in Gene Expression and SNP Arrays

    Directory of Open Access Journals (Sweden)

    Heather D. Kissel

    2013-01-01

    Full Text Available Identifying molecular markers of endometrial hyperplasia (neoplasia progression is critical to cancer prevention. To assess RNA and DNA quantity and quality from routinely collected endometrial samples and evaluate the performance of RNA- and DNA-based arrays across endometrial tissue types, we collected fresh frozen (FF Pipelle, FF curettage, and formalin-fixed paraffin-embedded (FFPE hysterectomy specimens (benign indications from eight women. Additionally, neoplastic and uninvolved tissues from 24 FFPE archival hysterectomy specimens with endometrial hyperplasias and carcinomas were assessed. RNA was extracted from 15 of 16 FF and 51 of 51 FFPE samples, with yields >1.2 μg for 13/15 (87% FF and 50/51 (98% FFPE samples. Extracted RNA was of high quality; all samples performed successfully on the Illumina whole-genome cDNA-mediated annealing, selection, extension, and ligation (WG-DASL array and performance did not vary by tissue type. While DNA quantity from FFPE samples was excellent, quality was not sufficient for successful performance on the Affymetrix SNP Array 6.0. In conclusion, FF Pipelle samples, which are minimally invasive, yielded excellent quantity and quality of RNA for gene expression arrays (similar to FF curettage and should be considered for use in genomic studies. FFPE-derived DNA should be evaluated on new rapidly evolving sequencing platforms.

  20. Rapid screening for entry inhibitors of highly pathogenic viruses under low-level biocontainment.

    Directory of Open Access Journals (Sweden)

    Aparna Talekar

    Full Text Available Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses.