WorldWideScience

Sample records for rapid pcr identification

  1. Rapid identification of Sporothrix schenckii in biopsy tissue by PCR.

    Science.gov (United States)

    Liu, X; Zhang, Z; Hou, B; Wang, D; Sun, T; Li, F; Wang, H; Han, S

    2013-12-01

    The dimorphic fungus Sporothrix schenckii is the etiological agent of sporotrichosis, an important cutaneous mycosis with a worldwide distribution. At present, it is challenging to rapidly discover and identify Sporothrix schenckii in biopsy tissues nowadays. To explore new methods for rapid diagnosis of sporotrichosis. We screened specific primers for Sporothrix schenckii using 50 clinical isolates from patients with sporotrichosis. DNA was extracted from the lesions of 30 cases of clinically suspected sporotrichosis using the Graham s method of CTAB and amplified by PCR using the screened specific primers. The primer S2-R2 was applicable for the identification of S. schenckii from different geographic areas and clinical types with high specificity and sensitivity. Twenty-five out of the thirty cases (83.3%) amplified using the primer S2-R2 showed positive bands. Further positive bands were observed in 95.6% of cases tested positive by fungal culture. Using the PCR technique and specific primers, we developed a new diagnostic method that can rapidly diagnose sporotrichosis with tissues obtained from clinical biopsies. © 2012 The Authors. Journal of the European Academy of Dermatology and Venereology © 2012 European Academy of Dermatology and Venereology.

  2. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  3. RUCS: rapid identification of PCR primers for unique core sequences.

    Science.gov (United States)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

    2017-12-15

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online.

  4. A rapid and direct real time PCR-based method for identification of Salmonella spp

    DEFF Research Database (Denmark)

    Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.

    2003-01-01

    The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated...... to be especially convenient because the pre-mix containing all PCR reagents except for the bacterial cells could be kept at -20 degreesC for at least I month before its use. The optimized TaqMan((R)) real-time PCR assay is a useful, simple and rapid method for routine identification of Salmonella spp...

  5. Rapid identification of Yersinia pestis and Brucella melitensis by chip-based continuous flow PCR

    Science.gov (United States)

    Dietzsch, Michael; Hlawatsch, Nadine; Melzer, Falk; Tomaso, Herbert; Gärtner, Claudia; Neubauer, Heinrich

    2012-06-01

    To combat the threat of biological agents like Yersinia pestis and Brucella melitensis in bioterroristic scenarios requires fast, easy-to-use and safe identification systems. In this study we describe a system for rapid amplification of specific genetic markers for the identification of Yersinia pestis and Brucella melitensis. Using chip based PCR and continuous flow technology we were able to amplify the targets simultaneously with a 2-step reaction profile within 20 minutes. The subsequent analysis of amplified fragments by standard gel electrophoresis requires another 45 minutes. We were able to detect both pathogens within 75 minutes being much faster than most other nucleic acid amplification technologies.

  6. Multiplex Solid-Phase PCR for Rapid Detection and Identification of Salmonella spp. at Sub-species

    DEFF Research Database (Denmark)

    Cao, Cuong; Høgberg, Jonas; Wolff, Anders

    -PCR gel electrophoresis. The method will be useful for development of point-of-care devices for rapid detection and identification of Salmonella spp. A solid-phase PCR for rapid detection and identification of S. enteritidis, S. typhimurium and S. dublin is developed. The method offers advantages......This study presents a solid-phase PCR (SP-PCR) for rapid detection, identification, and sub-typing of various Salmonella species, the major food-borne cause of salmonellosis. The target DNA is firstly amplified with PCR primers (one primer is labeled with fluorophores) in the liquid phase...... by the liquid phase primer thus generating new templates for the SP-PCR. After the reaction, PCR products labeled with fluorophores remain attached to the substrate and can be visualized directly by fluorescence readout devices. Using this method, S. enteritidis, S. typhimurium and S. dublin can be detected...

  7. Rapid identification and differentiation of Saccharomyces cerevisiae, Saccharomyces bayanus and their hybrids by multiplex PCR.

    Science.gov (United States)

    Torriani, S; Zapparoli, G; Malacrinò, P; Suzzi, G; Dellaglio, F

    2004-01-01

    To develop a multiplex PCR assay for the specific identification and differentiation of Saccharomyces cerevisiae, S. bayanus and their hybrids. Two sets of primers with sequences complementary to the region YBR033w were used. A single amplicon of 1710 bp or 329 bp was obtained with species S. cerevisiae and S. bayanus, respectively, while the presence of both bands was observed in S. pastorianus because of its hybrid nature. Both amplification products were also obtained after amplification from DNA of several laboratory S. cerevisiae x S. bayanus hybrid strains. Multiplex PCR was optimized for the rapid and reliable identification of S. cerevisiae, S. bayanus and their hybrids. The procedure may be used for routine detection of the most common Saccharomyces sensu stricto yeasts involved in industrial fermentation processes, overcoming the problems of conventional techniques.

  8. Rapid and high-throughput pan-Orthopoxvirus detection and identification using PCR and mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Mark W Eshoo

    2009-07-01

    Full Text Available The genus Orthopoxvirus contains several species of related viruses, including the causative agent of smallpox (Variola virus. In addition to smallpox, several other members of the genus are capable of causing human infection, including monkeypox, cowpox, and other zoonotic rodent-borne poxviruses. Therefore, a single assay that can accurately identify all orthopoxviruses could provide a valuable tool for rapid broad orthopovirus identification. We have developed a pan-Orthopoxvirus assay for identification of all members of the genus based on four PCR reactions targeting Orthopoxvirus DNA and RNA helicase and polymerase genes. The amplicons are detected using electrospray ionization-mass spectrometry (PCR/ESI-MS on the Ibis T5000 system. We demonstrate that the assay can detect and identify a diverse collection of orthopoxviruses, provide sub-species information and characterize viruses from the blood of rabbitpox infected rabbits. The assay is sensitive at the stochastic limit of PCR and detected virus in blood containing approximately six plaque-forming units per milliliter from a rabbitpox virus-infected rabbit.

  9. Real time PCR for the rapid identification and drug susceptibility of Mycobacteria present in Bronchial washings

    Directory of Open Access Journals (Sweden)

    Thilini Piushani Keerthirathne

    2016-10-01

    Full Text Available Abstract Background Mycobacteria have a spectrum of virulence and different susceptibilities to antibiotics. Distinguishing mycobacterial species is vital as patients with non-tuberculous mycobacterial (NTM infections present clinical features that are similar to those of patients with tuberculosis. Thus, rapid differentiation of Mycobacterium tuberculosis complex from NTM is critical to administer appropriate treatment. Hence the aim of the study was to rapid identification of mycobacterial species present in bronchial washings using multiplex real time Polymerase Chain Reaction (PCR and to determine the drug susceptibility in identified mycobacterial species. Methods Sputum smear negative bronchoscopy specimens (n = 150 were collected for a period of one year, from patients attending the General Hospital Kandy, Sri Lanka. The specimens were processed with modified Petroff’s method and were cultured on Löwenstein– Jensen medium. DNA, extracted from the mycobacterial isolates were subjected to a SYBR green mediated real time multiplex, PCR assay with primers specific for the M. tuberculosis complex, M. avium complex, M. chelonae-M.abscessus group and M. fortuitum group. DNA sequencing was performed for the species confirmation, by targeting the 16S rRNA gene and the drug susceptibility testing was performed for the molecularly identified isolates of M. tuberculosis and NTM. Results The optimized SYBR Green mediated multiplex real-time PCR assay was able to identify the presence of genus Mycobacterium in 25 out of 26 AFB positive isolates, two M. tuberculosis complex, three M. avium complex and two isolates belonging to M. chelonae-M. abscessus group. DNA sequencing confirmed the presence of M. tuberculosis, M. chelonae-M. abscessus, M. intracellulare, M. avium, Rhodococcus sp. and M. celatum. Remaining isolates were identified as Mycobacterium sp. All the NTM isolates were sensitive to amikacin and seven were resistant to ciproflaxacin

  10. A multiplex PCR for rapid identification of Brassica species in the triangle of U.

    Science.gov (United States)

    Koh, Joshua C O; Barbulescu, Denise M; Norton, Sally; Redden, Bob; Salisbury, Phil A; Kaur, Sukhjiwan; Cogan, Noel; Slater, Anthony T

    2017-01-01

    Within the Brassicaceae, six species from the genus Brassica are widely cultivated throughout the world as oilseed, condiment, fodder or vegetable crops. The genetic relationships among the six Brassica species are described by U's triangle model. Extensive shared traits and diverse morphotypes among Brassica species make identification and classification based on phenotypic data alone challenging and unreliable, especially when dealing with large germplasm collections. Consequently, a major issue for genebank collections is ensuring the correct identification of species. Molecular genotyping based on simple sequence repeat (SSR) marker sequencing or the Illumina Infinium Brassica napus 60K single nucleotide polymorphism (SNP) array has been used to identify species and assess genetic diversity of Brassica collections. However, these methods are technically challenging, expensive and time-consuming, making them unsuitable for routine or rapid screening of Brassica accessions for germplasm management. A cheaper, faster and simpler method for Brassica species identification is described here. A multiplex polymerase chain reaction (MPCR) consisting of new and existing primers specific to the Brassica A, B and C genomes was able to reliably distinguish all six Brassica species in the triangle of U with 16 control samples of known species identity. Further validation against 120 Brassica accessions previously genotyped showed that the MPCR is highly accurate and comparable to more advanced techniques such as SSR marker sequencing or the Illumina Infinium B. napus 60K SNP array. In addition, the MPCR was sensitive enough to detect seed contaminations in pooled seed samples of Brassica accessions. A cheap and fast multiplex PCR assay for identification of Brassica species in the triangle of U was developed and validated in this study. The MPCR assay can be readily implemented in any basic molecular laboratory and should prove useful for the management of Brassica

  11. Development of a multiplex PCR assay for rapid identification of Burkholderia pseudomallei, Burkholderia thailandensis, Burkholderia mallei and Burkholderia cepacia complex.

    Science.gov (United States)

    Koh, Seng Fook; Tay, Sun Tee; Sermswan, Rasana; Wongratanacheewin, Surasakdi; Chua, Kek Heng; Puthucheary, Savithri D

    2012-09-01

    We have developed a multiplex PCR assay for rapid identification and differentiation of cultures for Burkholderia pseudomallei, Burkholderia thailandensis, Burkholderia mallei and Burkholderia cepacia complex. The assay is valuable for use in clinical and veterinary laboratories, and in a deployable laboratory during outbreaks. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Rapid Identification of Measles Virus Vaccine Genotype by Real-Time PCR.

    Science.gov (United States)

    Roy, Felicia; Mendoza, Lillian; Hiebert, Joanne; McNall, Rebecca J; Bankamp, Bettina; Connolly, Sarah; Lüdde, Amy; Friedrich, Nicole; Mankertz, Annette; Rota, Paul A; Severini, Alberto

    2017-03-01

    During measles outbreaks, it is important to be able to rapidly distinguish between measles cases and vaccine reactions to avoid unnecessary outbreak response measures such as case isolation and contact investigations. We have developed a real-time reverse transcription-PCR (RT-PCR) method specific for genotype A measles virus (MeV) (MeVA RT-quantitative PCR [RT-qPCR]) that can identify measles vaccine strains rapidly, with high throughput, and without the need for sequencing to determine the genotype. We have evaluated the method independently in three measles reference laboratories using two platforms, the Roche LightCycler 480 system and the Applied Biosystems (ABI) 7500 real-time PCR system. In comparison to the standard real-time RT-PCR method, the MeVA RT-qPCR showed 99.5% specificity for genotype A and 94% sensitivity for both platforms. The new assay was able to detect RNA from five currently used vaccine strains, AIK-C, CAM-70, Edmonston-Zagreb, Moraten, and Shanghai-191. The MeVA RT-qPCR assay has been used successfully for measles surveillance in reference laboratories, and it could be readily deployed to national and subnational laboratories on a wide scale. Copyright © 2017 American Society for Microbiology.

  13. A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.

    1999-01-01

    The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories...

  14. Duplex real-time PCR assay for rapid identification of Staphylococcus aureus isolates from dairy cow milk.

    Science.gov (United States)

    Pilla, Rachel; Snel, Gustavo G M; Malvisi, Michela; Piccinini, Renata

    2013-05-01

    Staphylococcus aureus isolates from dairy cow mastitis are not always consistent with the characteristic morphology described, and molecular investigation is often needed. The aim of the study was to develop a duplex real-time PCR assay for rapid identification of Staph. aureus isolates, targeting both nuc and Sa442. Overall, 140 isolates collected from dairy cow mastitis in 90 different herds, were tested. All strains had been identified using morphological and biochemical characteristics. DNA from each strain was amplified in real-time PCR assay, to detect nuc or Sa442. Thereafter, a duplex real-time PCR assay was performed, and specificity of the amplified products was assessed by high resolution melting curve analysis. Out of 124 Staph. aureus isolates, 33 did not show the typical morphology or enzymic activity; in 118 strains, the two melt-curve peaks consistent with nuc and Sa442 were revealed, while 2 isolates showed only the peak consistent with Sa442. Four isolates bacteriologically identified as Staph. aureus, were PCR-negative and were further identified as Staph. pseudintermedius by sequencing. Staph. pseudintermedius and coagulase-negative staphylococci did not carry nuc or Sa442. The results showed the correct identification of all isolates, comprehending also coagulase-or nuc-negative Staph. aureus, while other coagulase-positive Staphylococci were correctly identified as non-Staph. aureus. Both sensitivity and specificity were 100%. High resolution melting analysis allowed easy detection of unspecific products. Finally, the duplex real-time PCR was applied directly to 40 milk samples, to detect infected mammary quarters. The assay confirmed the results of bacteriological analysis, on Staph. aureus-positive or-negative samples. Therefore, the proposed duplex real-time PCR could be used in laboratory routine as a cost-effective and powerful tool for high-throughput identification of atypical Staph. aureus isolates causing dairy cow mastitis. Also, it

  15. Rapid and Accurate Identification by Real-Time PCR of Biotoxin-Producing Dinoflagellates from the Family Gymnodiniaceae

    Directory of Open Access Journals (Sweden)

    Kirsty F. Smith

    2014-03-01

    Full Text Available The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR assays targeting the large subunit ribosomal RNA (LSU rRNA gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.

  16. Rapid identification of Campylobacter jejuni from poultry carcasses and slaughtering environment samples by real-time PCR.

    Science.gov (United States)

    Ivanova, Mirena; Singh, Randhir; Dharmasena, Muthu; Gong, Chao; Krastanov, Albert; Jiang, Xiuping

    2014-06-01

    The objective of this study was to develop a real-time PCR assay for rapid identification of Campylobacter jejuni and to apply the method in analyzing samples from poultry processing. A C. jejuni-specific primer set targeting a portion of the C. jejuni hippuricase gene was developed. The specificity of the newly designed primer pair was verified using 5 C. jejuni strains and 20 other bacterial strains. Sensitivity was determined to be as low as 1 genome copy per reaction. A total of 73 samples were collected at different sites along the processing line during 2 visits to a poultry slaughterhouse and were examined by direct plating onto modified charcoal cefoperazone deoxycholate agar or after enrichment in Bolton broth followed by plating on modified charcoal cefoperazone deoxycholate agar. The newly developed real-time PCR assay was used to identify the presumptive colonies as belonging to C. jejuni. A real-time PCR assay targeting 16S ribosomal RNA was also applied to determine Campylobacter spp. prevalence. Results from the real-time PCR analysis indicated considerable variability in Campylobacter contamination, with incidence rates of 72.7 and 27.6% for sampling days A and B, respectively. Campylobacter was isolated from 100% of prescalded and preeviscerated carcasses on sampling day A. In contrast, on sampling day B, the highest number of Campylobacter-positive carcasses was recovered after evisceration (60%). The chilling process significantly reduced (P Campylobacter population, but the percentage of positive samples on sampling day A increased to 80%. All samples collected from the processing environment, except scalding tank 3 and the prechiller and chiller tanks, were 100% positive on day A, whereas no campylobacters were isolated from machinery on sampling day B. Our results revealed the widespread of C. jejuni in poultry processing and proved that the newly developed real-time PCR assay is a simple, specific, and inexpensive method for rapid C. jejuni

  17. Rapid identification and enumeration of Saccharomyces cerevisiae cells in wine by real-time PCR.

    Science.gov (United States)

    Martorell, P; Querol, A; Fernández-Espinar, M T

    2005-11-01

    Despite the beneficial role of Saccharomyces cerevisiae in the food industry for food and beverage production, it is able to cause spoilage in wines. We have developed a real-time PCR method to directly detect and quantify this yeast species in wine samples to provide winemakers with a rapid and sensitive method to detect and prevent wine spoilage. Specific primers were designed for S. cerevisiae using the sequence information obtained from a cloned random amplified polymorphic DNA band that differentiated S. cerevisiae from its sibling species Saccharomyces bayanus, Saccharomyces pastorianus, and Saccharomyces paradoxus. The specificity of the primers was demonstrated for typical wine spoilage yeast species. The method was useful for estimating the level of S. cerevisiae directly in sweet wines and red wines without preenrichment when yeast is present in concentrations as low as 3.8 and 5 CFU per ml. This detection limit is in the same order as that obtained from glucose-peptone-yeast growth medium (GPY). Moreover, it was possible to quantify S. cerevisiae in artificially contaminated samples accurately. Limits for accurate quantification in wine were established, from 3.8 x 10(5) to 3.8 CFU/ml in sweet wine and from 5 x 10(6) to 50 CFU/ml in red wine.

  18. Rapid detection and identification of 12 respiratory viruses using a dual priming oligonucleotide system-based multiplex PCR assay.

    Science.gov (United States)

    Kim, Suk Ran; Ki, Chang-Seok; Lee, Nam Yong

    2009-03-01

    Acute viral respiratory infections are among the most common causes of human disease. Rapid and accurate diagnosis of viral respiratory infections is important for providing timely therapeutic interventions. This study evaluated a new multiplex PCR assay (Seegene Inc., Seoul, Korea) for simultaneous detection and identification of 12 respiratory viruses using two primer mixes. The viruses included parainfluenza viruses 1, 2, and 3, human metapneumovirus, human coronavirus 229E/NL63 and OC43, adenovirus, influenza viruses A and B, human respiratory syncytial viruses A and B, and human rhinovirus A. The analytical sensitivity of the assay was 10-100 copies per reaction for each type of virus. There was no cross-reactivity with common bacterial or viral pathogens. A comparison with conventional viral culture and immunofluorescence was carried out using 101 respiratory specimens from 92 patients. Using viral culture, 57 specimens (56.4%) were positive without co-infection. The same viruses were identified in all 57 specimens using the multiplex PCR. Seven of the 57 specimens (12.3%) were found to be co-infected with other respiratory viruses, and 19 of 44 (43.2%) specimens which were negative by culture were positive by the multiplex PCR. The Seeplex Respiratory Virus Detection assay represents a significant improvement over the conventional methods for the detection of a broad spectrum of respiratory viruses.

  19. [Rapid identification of Riemerella anatipestifer on the basis of specific PCR amplifying 16S rDNA].

    Science.gov (United States)

    Qu, Feng-fa; Cai, Chang; Zheng, Xian-jin; Zhang, Da-bing

    2006-02-01

    which were probably infected with RA were chosen to identify the accuracy and sensitivity of this PCR method. Several other conventional detecting methods including bacteria isolating, differentiating culture, biochemical experiments and serotyping were used at the same time. The templates of PCR were extracted from brains or livers by boiling method with Chelex 100. Finally, 3 cases were identified as RA infection by the conventional methods and 4 by the PCR method, which proved the good accuracy and sensitivity of the PCR method. Thus, this PCR assay provides a rapid and accurate method for identification of Riemerella anatipestifer. It will help to make the final decision in clinical diagnose or species identification, especially when a new serotype or sub-serotype of RA comes up.

  20. A multiplex PCR for rapid identification of Brassica species in the triangle of U

    OpenAIRE

    Koh, Joshua C. O.; Denise M Barbulescu; Norton, Sally; Redden, Bob; Salisbury, Phil A.; Kaur, Sukhjiwan; Cogan, Noel; Slater, Anthony T.

    2017-01-01

    Background Within the Brassicaceae, six species from the genus Brassica are widely cultivated throughout the world as oilseed, condiment, fodder or vegetable crops. The genetic relationships among the six Brassica species are described by U?s triangle model. Extensive shared traits and diverse morphotypes among Brassica species make identification and classification based on phenotypic data alone challenging and unreliable, especially when dealing with large germplasm collections. Consequentl...

  1. Accurate and rapid identification of the Burkholderia pseudomallei near-neighbour, Burkholderia ubonensis, using real-time PCR.

    Science.gov (United States)

    Price, Erin P; Sarovich, Derek S; Webb, Jessica R; Ginther, Jennifer L; Mayo, Mark; Cook, James M; Seymour, Meagan L; Kaestli, Mirjam; Theobald, Vanessa; Hall, Carina M; Busch, Joseph D; Foster, Jeffrey T; Keim, Paul; Wagner, David M; Tuanyok, Apichai; Pearson, Talima; Currie, Bart J

    2013-01-01

    Burkholderia ubonensis is an environmental bacterium belonging to the Burkholderia cepacia complex (Bcc), a group of genetically related organisms that are associated with opportunistic but generally nonfatal infections in healthy individuals. In contrast, the near-neighbour species Burkholderia pseudomallei causes melioidosis, a disease that can be fatal in up to 95% of cases if left untreated. B. ubonensis is frequently misidentified as B. pseudomallei from soil samples using selective culturing on Ashdown's medium, reflecting both the shared environmental niche and morphological similarities of these species. Additionally, B. ubonensis shows potential as an important biocontrol agent in B. pseudomallei-endemic regions as certain strains possess antagonistic properties towards B. pseudomallei. Current methods for characterising B. ubonensis are laborious, time-consuming and costly, and as such this bacterium remains poorly studied. The aim of our study was to develop a rapid and inexpensive real-time PCR-based assay specific for B. ubonensis. We demonstrate that a novel B. ubonensis-specific assay, Bu550, accurately differentiates B. ubonensis from B. pseudomallei and other species that grow on selective Ashdown's agar. We anticipate that Bu550 will catalyse research on B. ubonensis by enabling rapid identification of this organism from Ashdown's-positive colonies that are not B. pseudomallei.

  2. Accurate and rapid identification of the Burkholderia pseudomallei near-neighbour, Burkholderia ubonensis, using real-time PCR.

    Directory of Open Access Journals (Sweden)

    Erin P Price

    Full Text Available Burkholderia ubonensis is an environmental bacterium belonging to the Burkholderia cepacia complex (Bcc, a group of genetically related organisms that are associated with opportunistic but generally nonfatal infections in healthy individuals. In contrast, the near-neighbour species Burkholderia pseudomallei causes melioidosis, a disease that can be fatal in up to 95% of cases if left untreated. B. ubonensis is frequently misidentified as B. pseudomallei from soil samples using selective culturing on Ashdown's medium, reflecting both the shared environmental niche and morphological similarities of these species. Additionally, B. ubonensis shows potential as an important biocontrol agent in B. pseudomallei-endemic regions as certain strains possess antagonistic properties towards B. pseudomallei. Current methods for characterising B. ubonensis are laborious, time-consuming and costly, and as such this bacterium remains poorly studied. The aim of our study was to develop a rapid and inexpensive real-time PCR-based assay specific for B. ubonensis. We demonstrate that a novel B. ubonensis-specific assay, Bu550, accurately differentiates B. ubonensis from B. pseudomallei and other species that grow on selective Ashdown's agar. We anticipate that Bu550 will catalyse research on B. ubonensis by enabling rapid identification of this organism from Ashdown's-positive colonies that are not B. pseudomallei.

  3. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    Endemic of avian influenza virus (AIV) in Asia and epizootics in some European regions have caused considerable public concern on a possible pandemic of AIV. A rapid method for virus detection and effective surveillance in wild avian, poultry production as well as in humans is required....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  4. Rapid and accurate identification of Mycobacterium tuberculosis complex and common non-tuberculous mycobacteria by multiplex real-time PCR targeting different housekeeping genes.

    Science.gov (United States)

    Nasr Esfahani, Bahram; Rezaei Yazdi, Hadi; Moghim, Sharareh; Ghasemian Safaei, Hajieh; Zarkesh Esfahani, Hamid

    2012-11-01

    Rapid and accurate identification of mycobacteria isolates from primary culture is important due to timely and appropriate antibiotic therapy. Conventional methods for identification of Mycobacterium species based on biochemical tests needs several weeks and may remain inconclusive. In this study, a novel multiplex real-time PCR was developed for rapid identification of Mycobacterium genus, Mycobacterium tuberculosis complex (MTC) and the most common non-tuberculosis mycobacteria species including M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and the M. gordonae in three reaction tubes but under same PCR condition. Genetic targets for primer designing included the 16S rDNA gene, the dnaJ gene, the gyrB gene and internal transcribed spacer (ITS). Multiplex real-time PCR was setup with reference Mycobacterium strains and was subsequently tested with 66 clinical isolates. Results of multiplex real-time PCR were analyzed with melting curves and melting temperature (T (m)) of Mycobacterium genus, MTC, and each of non-tuberculosis Mycobacterium species were determined. Multiplex real-time PCR results were compared with amplification and sequencing of 16S-23S rDNA ITS for identification of Mycobacterium species. Sensitivity and specificity of designed primers were each 100 % for MTC, M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and M. gordonae. Sensitivity and specificity of designed primer for genus Mycobacterium was 96 and 100 %, respectively. According to the obtained results, we conclude that this multiplex real-time PCR with melting curve analysis and these novel primers can be used for rapid and accurate identification of genus Mycobacterium, MTC, and the most common non-tuberculosis Mycobacterium species.

  5. Rapid identification of Brucella isolates to the species level by real time PCR based single nucleotide polymorphism (SNP analysis

    Directory of Open Access Journals (Sweden)

    Smith Catherine J

    2008-06-01

    Full Text Available Abstract Background Brucellosis, caused by members of the genus Brucella, remains one of the world's major zoonotic diseases. Six species have classically been recognised within the family Brucella largely based on a combination of classical microbiology and host specificity, although more recently additional isolations of novel Brucella have been reported from various marine mammals and voles. Classical identification to species level is based on a biotyping approach that is lengthy, requires extensive and hazardous culturing and can be difficult to interpret. Here we describe a simple and rapid approach to identification of Brucella isolates to the species level based on real-time PCR analysis of species-specific single nucleotide polymorphisms (SNPs that were identified following a robust and extensive phylogenetic analysis of the genus. Results Seven pairs of short sequence Minor Groove Binding (MGB probes were designed corresponding to SNPs shown to possess an allele specific for each of the six classical Brucella spp and the marine mammal Brucella. Assays were optimised to identical reaction parameters in order to give a multiple outcome assay that can differentiate all the classical species and Brucella isolated from marine mammals. The scope of the assay was confirmed by testing of over 300 isolates of Brucella, all of which typed as predicted when compared to other phenotypic and genotypic approaches. The assay is sensitive being capable of detecting and differentiating down to 15 genome equivalents. We further describe the design and testing of assays based on three additional SNPs located within the 16S rRNA gene that ensure positive discrimination of Brucella from close phylogenetic relatives on the same platform. Conclusion The multiple-outcome assay described represents a new tool for the rapid, simple and unambiguous characterisation of Brucella to the species level. Furthermore, being based on a robust phylogenetic framework, the

  6. Microchip-based one step DNA extraction and real-time PCR in one chamber for rapid pathogen identification.

    Science.gov (United States)

    Lee, Jeong-Gun; Cheong, Kwang Ho; Huh, Nam; Kim, Suhyeon; Choi, Jeong-Woo; Ko, Christopher

    2006-07-01

    Optimal detection of a pathogen present in biological samples depends on the ability to extract DNA molecules rapidly and efficiently. In this paper, we report a novel method for efficient DNA extraction and subsequent real-time detection in a single microchip by combining laser irradiation and magnetic beads. By using a 808 nm laser and carboxyl-terminated magnetic beads, we demonstrate that a single pulse of 40 seconds lysed pathogens including E. coli and Gram-positive bacterial cells as well as the hepatitis B virus mixed with human serum. We further demonstrate that the real-time pathogen detection was performed with pre-mixed PCR reagents in a real-time PCR machine using the same microchip, after laser irradiation in a hand-held device equipped with a small laser diode. These results suggest that the new sample preparation method is well suited to be integrated into lab-on-a-chip application of the pathogen detection system.

  7. Rapid Identification of Pathogens from Positive Blood Cultures by Multiplex PCR using the FilmArray System

    Science.gov (United States)

    Blaschke, Anne J.; Heyrend, Caroline; Byington, Carrie L.; Fisher, Mark A.; Barker, Elizabeth; Garrone, Nicholas F.; Thatcher, Stephanie A.; Pavia, Andrew T.; Barney, Trenda; Alger, Garrison D.; Daly, Judy A.; Ririe, Kirk M.; Ota, Irene; Poritz, Mark A.

    2012-01-01

    Sepsis is a leading cause of death. Rapid and accurate identification of pathogens and antimicrobial resistance directly from blood culture could improve patient outcomes. The FilmArray® (FA; Idaho Technology, Inc., Salt Lake City, UT) Blood Culture (BC) panel can identify > 25 pathogens and 4 antibiotic resistance genes from positive blood cultures in 1 hour. We compared a development version of the panel to conventional culture and susceptibility testing on 102 archived blood cultures from adults and children with bacteremia. Of 109 pathogens identified by culture, 95% were identified by FA. Among 111 prospectively collected blood cultures, the FA identified 84 of 92 pathogens (91%) covered by the panel. Among 25 Staphylococcus aureus and 21 Enterococcus species detected, FA identified all culture-proven MRSA and VRE. The FA BC panel is an accurate method for the rapid identification of pathogens and resistance genes from blood culture. PMID:22999332

  8. Development of a rapid diagnostic method for identification of Staphylococcus aureus and antimicrobial resistance in positive blood culture bottles using a PCR-DNA-chromatography method.

    Science.gov (United States)

    Ohshiro, Takeya; Miyagi, Chihiro; Tamaki, Yoshikazu; Mizuno, Takuya; Ezaki, Takayuki

    2016-06-01

    Blood culturing and the rapid reporting of results are essential for infectious disease clinics to obtain bacterial information that can affect patient prognosis. When gram-positive coccoid cells are observed in blood culture bottles, it is important to determine whether the strain is Staphylococcus aureus and whether the strain has resistance genes, such as mecA and blaZ, for proper antibiotic selection. Previous work led to the development of a PCR method that is useful for rapid identification of bacterial species and antimicrobial susceptibility. However, that method has not yet been adopted in community hospitals due to the high cost and methodological complexity. We report here the development of a quick PCR and DNA-chromatography test, based on single-tag hybridization chromatography, that permits detection of S. aureus and the mecA and blaZ genes; results can be obtained within 1 h for positive blood culture bottles. We evaluated this method using 42 clinical isolates. Detection of S. aureus and the resistance genes by the PCR-DNA-chromatography method was compared with that obtained via the conventional identification method and actual antimicrobial susceptibility testing. Our method had a sensitivity of 97.0% and a specificity of 100% for the identification of the bacterial species. For the detection of the mecA gene of S. aureus, the sensitivity was 100% and the specificity was 95.2%. For the detection of the blaZ gene of S. aureus, the sensitivity was 100% and the specificity was 88.9%. The speed and simplicity of this PCR-DNA-chromatography method suggest that our method will facilitate rapid diagnoses. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  9. A new real-time PCR assay for rapid identification of the S. aureus/MRSA strains

    Directory of Open Access Journals (Sweden)

    Ivan Manga

    2013-01-01

    Full Text Available The Methicillin-resistant Staphylococcus aureus (MRSA with the livestock-associated MRSA (LA-MRSA are of great interest to scientists and general public. The aim of our study was to present a new more rapid and reliable diagnostic method working on the RT-PCR platform applicable for monitoring of MRSA/S. aureus. The parallel testing of the S. aureus specific nuc gene sequence and the mecA gene sequence was utilised for this purpose. A collection of ten S. aureus/MRSA reference strains, fifteen genetically related non S. aureus reference strains and fifty-six environmental samples was employed for estimation of the assay performance and parameters. The environmental samples acquired in the Czech livestock farms were represented with the livestock and human nasal mucosae or skin swabs, the slaughter meat swabs and were chosen preferentially from individuals with previously confi rmed or suspected positive MRSA/S. aureus cases. The classic selective cultivation approach with the biochemical test and agar disk diffusion test was accepted as reference diagnostic method. As there were no culture positive samples that were negative using RT-PCR, our method featured with 100% sensitivity in comparison to reference method. The limit of detection allowed to identify from tens to hundreds copies of S. aureus/MRSA genome. Further, the RT-PCR assay featured with 100% inclusivity and 95% exclusivity at Cq value below 30. These parameters suggested on powerful and reliable diagnostic method with real potential of practical utilisation. We consider our method as ideal for testing of individual suspected colonies, when the results can be acquired in less than 1.5 hour.

  10. Rapid identification of Iranian Acinetobacter baumannii strains by single PCR assay using BLA oxa-51 -like carbapenemase and evaluation of the antimicrobial resistance profiles of the isolates.

    Science.gov (United States)

    Akbari, Mahdi; Mahdi, Akbari; Niakan, Mohammad; Mohammad, Niakan; Taherikalani, Morovat; Morovat, Taherikalani; Feizabadi, Mohammad Mehdi; Mhammad-Mahdi, Feizabadi; Azadi, Namam Ali; Namam-Ali, Azadi; Soroush, Setareh; Setareh, Soroush; Emaneini, Mohammad; Mohammad, Emaneini; Abdolkarimi, Amir; Amir, Abdolkarimi; Maleki, Abbas; Abbas, Maleki; Hematian, Ali; Ali, Hematian

    2010-06-01

    The rapid identification of relevant bacterial pathogens is of utmost importance in clinical settings. The aim of this study was to test a rapid identification technique for A. baumannii strains from Tehran Hospitals and to determine the antibiotic resistance profiles of the isolates. A hundred strains of Acinetobacter spp. grown from clinical specimens were identified as A. baumannii by conventional methods. Using PCR a bla OXA-51 -like gene was detected in all A. baumannii isolates but not in other species of acinetobacter. More than half of the isolates proved resistant to a variety of antibiotics by the disk diffusion technique. The rate of resistance to gentamicin, imipenem, ampicillin-sulbactam and amikacin was determined to be 45%, 53%, 62% and 62%, respectively. Moreover, most isolates (more than 90%) showed resistance to cephalosporins. This study shows that the demonstration of the bla OXA-51-like gene is a reliable and rapid way for the presumptive identification of A. baumannii and reveals that the rate of antibiotic resistance is high in Iranian A. baumannii isolates to a variety of antibiotics.

  11. Performance of a PCR assay for the rapid identification of the Klebsiella pneumoniae ST258 epidemic clone in Latin American clinical isolates.

    Science.gov (United States)

    Gomez, S A; Rapoport, M; Piergrossi, N; Faccone, D; Pasteran, F; De Belder, D; ReLAVRA-Group; Petroni, A; Corso, A

    2016-10-01

    The worldwide dissemination of Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella pneumoniae ST258 demands a rapid PCR-based typing method to detect unique genes of the ST258 clone. This study evaluates a PCR developed by Adler et al. (2014) for the detection of ST258 in K. pneumoniae clinical isolates centered on the identification of the pilv-I and prp genes. We tested 143 clinical isolates from Argentina (n=109), Chile (n=1), Colombia (n=1), Costa Rica (n=2), Ecuador (n=5), El Salvador (n=2), Nicaragua (n=5), Panamá (n=2), Paraguay (n=2), Perú (n=3) and Trinidad and Tobago (n=11) recovered from 2006 to 2015. blaKPC, pilv-l and prp genes were detected by PCR and sequenced by standard procedures. ST258 and non-ST258 were defined by PFGE and/or MLST. Isolates were grouped according to PFGE patterns: 58 were compatible with ST258 (group 1) and 85 with non-ST258 (group 2). MLST study was done on an arbitrary selection of isolates. The pilv-l gene was present only in ST258 isolates, regardless of the presence of the blaKPC gene. Results for the prp gene were variable. Its presence did not define ST258. The pilv-I PCR had a sensitivity and specificity of 100%, respectively, for the detection of ST258 in the isolates under investigation. Given our findings, the pilv-I PCR could replace more time and resource consuming methods, allowing for more rapid detection of the circulating high risk K. pneumoniae clone ST258 in Latin American (LA) countries. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Polymorphism-specific PCR enhances the diagnostic performance of American tegumentary leishmaniasis and allows the rapid identification of Leishmania species from Argentina

    Directory of Open Access Journals (Sweden)

    Marco Jorge D

    2012-08-01

    Full Text Available Abstract Background The diagnosis of the leishmaniases poses enormous challenges in Argentina. The Polymorphism-Specific PCR (PS-PCR designed and validated in our laboratories has been proven effective for typifying the Leishmania genus from cultured material. Here we evaluated the performance of this method in the diagnosis of American tegumentary leishmaniasis (ATL and the rapid identification of Leishmania spp. directly from clinical specimens. Methods A total of 63 patients from northwestern Argentina, with cutaneous or mucocutaneous lesions, underwent an ATL diagnosis protocol which included clinical examination, Leishmanin skin test, and microscopic examination of dermal smears. In addition, we performed PS-PCR on DNA directly extracted from the specimens scraped from the lesions. Results Out of the 63 patients, 44 were classified as ATL cases and 19 as non-ATL cases. The diagnostic sensitivity of the microscopic analysis of dermal smears and PS-PCR individually were 70.5% and 81%, respectively. When performing both tests in parallel, this parameter increased significantly to 97.6% (p = 0.0018. The specificities, on the other hand, were 100%, 84.2%, and 83.3% for the combination, respectively (p > 0.05. Using the PS-PCR analysis we successfully identified the Leishmania spp. in 31 out of the 44 ATL cases. Twenty-eight (90.3% cases were caused by L. (V. braziliensis, two (6.5% by L. (V. guyanensis, and one (3.2% by L. (V. panamensis. Conclusions The efficacy of the ATL diagnosis was significantly improved by combining the dermal smear examination with a PS-PCR analysis. Our strategy allowed us to reach the diagnosis of ATL with high accuracy regarding the species of the etiological agent in 70.5% of the cases. Moreover, we diagnosed two cases of the disseminated cutaneous form caused by L. (V. braziliensis and a cutaneous case due to L. (V. panamensis infection, both findings reported for the first time in Argentina.

  13. Polymorphism-specific PCR enhances the diagnostic performance of American tegumentary leishmaniasis and allows the rapid identification of Leishmania species from Argentina.

    Science.gov (United States)

    Marco, Jorge D; Barroso, Paola A; Mimori, Tatsuyuki; Locatelli, Fabricio M; Tomatani, Ayako; Mora, María C; Cajal, S Pamela; Nasser, Julio R; Parada, Luis A; Taniguchi, Taketoshi; Korenaga, Masataka; Basombrío, Miguel A; Hashiguchi, Yoshihisa

    2012-08-15

    The diagnosis of the leishmaniases poses enormous challenges in Argentina. The Polymorphism-Specific PCR (PS-PCR) designed and validated in our laboratories has been proven effective for typifying the Leishmania genus from cultured material. Here we evaluated the performance of this method in the diagnosis of American tegumentary leishmaniasis (ATL) and the rapid identification of Leishmania spp. directly from clinical specimens. A total of 63 patients from northwestern Argentina, with cutaneous or mucocutaneous lesions, underwent an ATL diagnosis protocol which included clinical examination, Leishmanin skin test, and microscopic examination of dermal smears. In addition, we performed PS-PCR on DNA directly extracted from the specimens scraped from the lesions. Out of the 63 patients, 44 were classified as ATL cases and 19 as non-ATL cases. The diagnostic sensitivity of the microscopic analysis of dermal smears and PS-PCR individually were 70.5% and 81%, respectively. When performing both tests in parallel, this parameter increased significantly to 97.6% (p = 0.0018). The specificities, on the other hand, were 100%, 84.2%, and 83.3% for the combination, respectively (p > 0.05). Using the PS-PCR analysis we successfully identified the Leishmania spp. in 31 out of the 44 ATL cases. Twenty-eight (90.3%) cases were caused by L. (V.) braziliensis, two (6.5%) by L. (V.) guyanensis, and one (3.2%) by L. (V.) panamensis. The efficacy of the ATL diagnosis was significantly improved by combining the dermal smear examination with a PS-PCR analysis. Our strategy allowed us to reach the diagnosis of ATL with high accuracy regarding the species of the etiological agent in 70.5% of the cases. Moreover, we diagnosed two cases of the disseminated cutaneous form caused by L. (V.) braziliensis and a cutaneous case due to L. (V.) panamensis infection, both findings reported for the first time in Argentina.

  14. A lab-on-a-chip device for rapid identification of avian influenza viral RNA by solid-phase PCR

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    This paper describes a lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid-phase PCR on a microfluidic chip.......This paper describes a lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid-phase PCR on a microfluidic chip....

  15. A lab-on-a-chip device for rapid identification of avian influenza viral RNA by solid-phase PCR.

    Science.gov (United States)

    Sun, Yi; Dhumpa, Raghuram; Bang, Dang Duong; Høgberg, Jonas; Handberg, Kurt; Wolff, Anders

    2011-04-21

    The endemic of Avian Influenza Virus (AIV) in Asia and epizootics in some European regions have caused serious economic losses. Multiplex reverse-transcriptase (RT) PCR has been developed to detect and subtype AIV. However, the number of targets that can be amplified in a single run is limited because of uncontrollable primer-primer interferences. In this paper, we describe a lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid-phase PCR on a microfluidic chip. A simple UV cross-linking method was used to immobilize the DNA probes on unmodified glass surface, which makes it convenient to integrate microarray with microfluidics. This solid-phase RT-PCR method combined RT amplification of extracted RNA in the liquid phase and species-specific nested PCR on the solid phase. Using the developed approach, AIV viruses and their subtypes were unambiguously identified by the distinct patterns of amplification products. The whole process was reduced to less than 1 hour and the sample volume used in the microfluidic chip was at least 10 times less than in the literature. By spatially separating the primers, highly multiplexed amplification can be performed in solid-phase PCR. Moreover, multiplex PCR and sequence detection were done in one step, which greatly simplified the assay and reduced the processing time. Furthermore, by incorporating the microarray into a microchamber-based PCR chip, the sample and the reagent consumption were greatly reduced, and the problems of bubble formation and solution evaporation were effectively prevented. This microarray-based PCR microchip can be widely employed for virus detection and effective surveillance in wild avian and in poultry productions.

  16. Rapid detection and identification of Wuchereria bancrofti, Brugia malayi, B. pahangi, and Dirofilaria immitis in mosquito vectors and blood samples by high resolution melting real-time PCR.

    Science.gov (United States)

    Thanchomnang, Tongjit; Intapan, Pewpan M; Tantrawatpan, Chairat; Lulitanond, Viraphong; Chungpivat, Sudchit; Taweethavonsawat, Piyanan; Kaewkong, Worasak; Sanpool, Oranuch; Janwan, Penchom; Choochote, Wej; Maleewong, Wanchai

    2013-12-01

    A simple, rapid, and high-throughput method for detection and identification of Wuchereria bancrofti, Brugia malayi, Brugia pahangi, and Dirofilaria immitis in mosquito vectors and blood samples was developed using a real-time PCR combined with high-resolution melting (HRM) analysis. Amplicons of the 4 filarial species were generated from 5S rRNA and spliced leader sequences by the real-time PCR and their melting temperatures were determined by the HRM method. Melting of amplicons from W. bancrofti, B. malayi, D. immitis, and B. pahangi peaked at 81.5±0.2℃, 79.0±0.3℃, 76.8±0.1℃, and 79.9±0.1℃, respectively. This assay is relatively cheap since it does not require synthesis of hybridization probes. Its sensitivity and specificity were 100%. It is a rapid and technically simple approach, and an important tool for population surveys as well as molecular xenomonitoring of parasites in vectors.

  17. Genotype-specific real-time PCR combined with high-resolution melting analysis for rapid identification of red-spotted grouper nervous necrosis virus.

    Science.gov (United States)

    Toubanaki, Dimitra K; Karagouni, Evdokia

    2017-08-01

    A real-time genotype-specific polymerase chain reaction (PCR) assay combined with high-resolution melting (HRM) analysis was developed to assess the most common genotypes of nervous necrosis viruses or nodaviruses. Nodaviruses are the causal agents of viral nervous necrosis infections, which have been wreaking havoc in the aquaculture industry worldwide, with fish mortality up to 100%. The four different genotypes of nodaviruses correlate with differences in viral pathogenicity. Therefore, rational development of effective vaccines and diagnostics requires analysis of genetic variation among viruses. The aim of the present study was to develop a real-time tetra-primer genotype-specific PCR assay for genotype identification. Four primers were utilized for simultaneous amplification of nodavirus genotype-specific products in a single closed-tube PCR after a reverse-transcription reaction using RNA isolated from fish samples. For high-throughput sample analysis, SYBR Green-based real-time PCR was used in combination with HRM analysis. The assay was evaluated in terms of specificity and sensitivity. The analysis resulted in melting curves that were indicative of each genotype. The detection limit when using reference plasmids was 100 ag/µL for both genotypes, while the sensitivity of the assays when testing a complex mixture was 10 fg/µL for red-spotted grouper nervous necrosis virus (RGNNV) and 100 fg/µL for striped jack nervous necrosis virus (SJNNV). To test the capability of this method under real-world conditions, 58 samples were examined. All samples belonged to the RGNNV genotype, which was fully validated. The results were in full agreement with genotyping by reference methods. The proposed methodology provides a rapid, sensitive, specific, robust and automatable assay for nodavirus genotyping, making it a useful tool for diagnosis and screening for epidemiological studies.

  18. Rapid and accurate species and genomic species identification and exhaustive population diversity assessment of Agrobacterium spp. using recA-based PCR.

    Science.gov (United States)

    Shams, M; Vial, L; Chapulliot, D; Nesme, X; Lavire, C

    2013-07-01

    Agrobacteria are common soil bacteria that interact with plants as commensals, plant growth promoting rhizobacteria or alternatively as pathogens. Indigenous agrobacterial populations are composites, generally with several species and/or genomic species and several strains per species. We thus developed a recA-based PCR approach to accurately identify and specifically detect agrobacteria at various taxonomic levels. Specific primers were designed for all species and/or genomic species of Agrobacterium presently known, including 11 genomic species of the Agrobacterium tumefaciens complex (G1-G9, G13 and G14, among which only G2, G4, G8 and G14 still received a Latin epithet: pusense, radiobacter, fabrum and nepotum, respectively), A. larrymoorei, A. rubi, R. skierniewicense, A. sp. 1650, and A. vitis, and for the close relative Allorhizobium undicola. Specific primers were also designed for superior taxa, Agrobacterium spp. and Rhizobiaceace. Primer specificities were assessed with target and non-target pure culture DNAs as well as with DNAs extracted from composite agrobacterial communities. In addition, we showed that the amplicon cloning-sequencing approach used with Agrobacterium-specific or Rhizobiaceae-specific primers is a way to assess the agrobacterial diversity of an indigenous agrobacterial population. Hence, the agrobacterium-specific primers designed in the present study enabled the first accurate and rapid identification of all species and/or genomic species of Agrobacterium, as well as their direct detection in environmental samples. Copyright © 2013 Elsevier GmbH. All rights reserved.

  19. Rapid detection and identification of Stachybotrys and Chaetomium species using tissue PCR analysis

    DEFF Research Database (Denmark)

    Lewinska, Anna Malgorzata; Peuhkuri, Ruut Hannele; Rode, Carsten

    2016-01-01

    Indoor fungi are a worldwide problem causing negative health effects for infected building's occupants and even deterioration of building structures. Different fungal species affect buildings and their inhabitants differently. Therefore, rapid and accurate identification of fungi to the species l...

  20. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    Administrator

    2010-11-08

    Nov 8, 2010 ... Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 16: 11141-11156. Fang H, Hedin G (2003). Rapid screening and identification of methicillin-resistant Staphylococcus aureus from clinical samples by selective-broth and real-time PCR assay.

  1. Rapid identification viruses from nasal pharyngeal aspirates in acute viral respiratory infections by RT-PCR and electrospray ionization mass spectrometry.

    Science.gov (United States)

    Chen, Kuan-Fu; Rothman, Richard E; Ramachandran, Padmini; Blyn, Lawrence; Sampath, Rangarajan; Ecker, David J; Valsamakis, Alexandra; Gaydos, Charlotte A

    2011-04-01

    Diagnosis of the etiologic agent of respiratory viral infection relies traditionally on culture or antigen detection. This pilot evaluation compared performance characteristics of the RT-PCR and electrospray ionization mass spectrometry (RT-PCR/ESI-MS) platform to conventional virologic methods for identifying multiple clinically relevant respiratory viruses in nasopharyngeal aspirates. The RT-PCR/ESI-MS respiratory virus surveillance kit was designed to detect respiratory syncytial virus, influenza A and B, parainfluenza types 1-4, adenoviridae types A-F, coronaviridae, human bocavirus, and human metapneumovirus. Patients (N=192) attending an emergency department during the 2007-2008 respiratory season consented, and "excess" frozen archived nasopharyngeal aspirates were analysed; 46 were positive by conventional virology and 69 by RT-PCR/ESI-MS, among which there were six samples with multiple viral pathogens detected. The sensitivity and specificity of the assay were 89.1% and 80.3%, respectively. Additional viruses that were not identified by conventional virology assays were detected (4 human bocaviruses and 7 coronaviruses). Samples in which the RT-PCR/ESI-MS results disagreed with conventional virology were sent for analysis by a third method using a commercial RT-PCR-based assay, which can identify viruses not detectable by conventional virologic procedures. Time to first result of RT-PCR/ESI-MS was 8h. RT-PCR/ESI-MS demonstrated capacity to detect respiratory viruses identifiable and unidentifiable by conventional methods rapidly. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Performance of the Real Fungus-ID kit based on multiplex RT-PCR assay for the rapid detection and identification of Trichophyton spp. and Microsporum spp. in clinical specimens with suspected dermatophyte infection.

    Science.gov (United States)

    Wang, H-Y; Kim, H; Choi, E H; Lee, H

    2016-01-01

    The aim of this study was to evaluate the performance of a commercially available multiplex RT-PCR assay for the rapid detection and identification of dermatophytes directly from clinical samples and cultures. The multiplex RT-PCR assay was used to evaluate 118 clinical isolates from various specimen types and a total of 140 known specimens were compared with both conventional methods, commercially available PCR-REBA, and ITS sequence analysis. In this study, multiplex RT-PCR assay yield significantly more positive results than culture (91·9 vs 39·5%) and conventional methods including KOH microscopy (91·9 vs 71·3%). Although the results among the multiplex RT-PCR, PCR-REBA and ITS sequence analysis were concordant (100%) in 118 clinical isolates, concordant results between multiplex RT-PCR assay and culture were at 66% (78/118). The overall positive rates for the PCR-REBA, multiplex RT-PCR assay and ITS sequence analysis were 98·8, 91·9, and 52·9% respectively. In addition, the concordance rate of multiplex RT-PCR assay and the PCR-REBA assay was 93% (95% confidence interval (CI), 89·9-96·1, P culture can take up to 2-3 weeks. The use of the multiplex RT-PCR molecular diagnostic assay was rapid and reliable for detecting pathogen infections. Even though the use of molecular diagnostic technology is more expensive than conventional methods, the clinical and economic benefit of saving time relative to expense remains to be elucidated. Therefore, the multiplex RT-PCR assay may provide the essential information to accelerate therapeutic decisions for earlier and adequate antibiotic treatment in the acute phase of fungal pathogen infections. © 2015 The Society for Applied Microbiology.

  3. PCR identification of Fusarium genus based on nuclear ribosomal ...

    African Journals Online (AJOL)

    No amplification products were detected with PCR of DNA from Rhizoctonia solani and Macrophomina phaseolina isolates using these primers. The assay is useful for rapid identification of Fusarium spp. cultures. The application of these PCR methods for early diagnosis of the seedling and wilt disease of cotton needs to ...

  4. Development of a rapid, cost-effective TaqMan Real-Time PCR Assay for identification and differentiation of Coccidioides immitis and Coccidioides posadasii.

    Science.gov (United States)

    Sheff, Kelly W; York, Emily R; Driebe, Elizabeth M; Barker, Bridget M; Rounsley, Steven D; Waddell, Victor G; Beckstrom-Sternberg, Stephen M; Beckstrom-Sternberg, James S; Keim, Paul S; Engelthaler, David M

    2010-05-01

    Coccidioidomycosis is an infection caused by Coccidioides immitis or C. posadasii. We developed a TaqMan real-time PCR assay that rapidly and accurately differentiates the species. This assay can be used as a tool to improve disease surveillance, increase understanding of the natural history of the infection, and assist in clinical differentiation studies.

  5. Rapid Identification and Quantification of Aureococcus anophagefferens by qPCR Method (Taqman) in the Qinhuangdao Coastal Area: A Region for Recurrent Brown Tide Breakout in China.

    Science.gov (United States)

    Wang, Li-Ping; Lei, Kun

    2016-12-01

    Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.

  6. Identification of periodontopathogen microorganisms by PCR technique

    Directory of Open Access Journals (Sweden)

    Milićević Radovan

    2008-01-01

    Full Text Available INTRODUCTION Periodontitis is an inflammatory disease of the supporting tissues of teeth and is a major cause of tooth loss in adults. The onset and progression of periodontal disease is attributed to the presence of elevated levels of a consortium of pathogenic bacteria. Gram negative bacteria, mainly strict anaerobes, play the major role. OBJECTIVE The present study aimed to assess the presence of the main types of microorganisms involved in the aetiopathogenesis of periodontal disease: Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Eikenella corrodens, Treponema denticola, Tanerella forsythia and Prevotella intermedia in different samples collected from the oral cavity of 90 patients diagnosed with periodontitis. METHOD Bacterial DNA detection was performed in diverse biological materials, namely in dental plaque, gingival tissue and saliva, by means of multiplex PCR, a technique that allows simultaneous identification of two different bacterial genomes. RESULTS In the dental plaque of the periodontitis patients, Treponema denticola dominated. In the gingival tissue, Tannerella forsythia and Treponema denticola were the microbiota most frequently detected, whilst in saliva Treponema denticola and Eikenella corrodens were found with the highest percentage. CONCLUSION The identification of microorganisms by multiplex PCR is specific and sensitive. Rapid and precise assessment of different types of periodontopathogens is extremely important for early detection of the infection and consequently for the prevention and treatment of periodontal disease. In everyday clinical practice, for routine bacterial evaluation in patients with periodontal disease, the dental plaque is the most suitable biological material, because it is the richest in periodontal bacteria.

  7. PCR Assay Based on the gyrB Gene for Rapid Identification of Acinetobacter baumannii-calcoaceticus Complex at Specie Level.

    Science.gov (United States)

    Teixeira, Aline B; Barin, Juliana; Hermes, Djuli M; Barth, Afonso L; Martins, Andreza F

    2017-05-01

    The genus Acinetobacter sp. comprises more than 50 species, and four are closely related and difficult to be distinguished by either phenotypic or genotypic methods: the Acinetobacter calcoaceticus-baumannii complex (ABC). The correct identification at species level is necessary mainly due to the epidemiological aspects. We evaluated a multiplex PCR for gyrB gene to identify the species of the ABC using the sequencing of the ITS 16S-23S fragment as a gold standard. Isolates identified as Acinetobacter calcoaceticus-baumannii from three hospitals at southern Brazil in 2011 were included in this study. A total of 117 isolates were obtained and 106 (90.6%) were confirmed as A. baumannii, 6 (5.1%) as A. nosocomialis and 4 (3.4%) as A. pittii by PCR for gyrB gene. Only one isolate did not present a product of the PCR for the gyrB gene; this isolate was identified as Acinetobacter genospecie 10 by sequencing of ITS. We also noted that the non-A. baumannii isolates were recovered from respiratory tract (8/72.7%), blood (2/18.2%) and urine (1/9.1%), suggesting that these species can cause serious infection. These findings evidenced that the multiplex PCR of the gyrB is a feasible and simple method to identify isolates of the ABC at the species level. © 2016 Wiley Periodicals, Inc.

  8. PCR-Based Rapid Identification System Using Bridged Nucleic Acids for Detection of Clarithromycin-Resistant Mycobacterium avium-M. intracellulare Complex Isolates

    Science.gov (United States)

    Shiono, Ayako; Egashira, Hiroshi; Kishi, Etsuko; Hagiwara, Koichi; Nakamura, Hidetoshi; Kanazawa, Minoru; Nagata, Makoto

    2016-01-01

    The nontuberculous mycobacteria (NTM) cause miscellaneous disorders in humans, especially in the lungs, which present with a variety of radiological features. To date, knowledge of the pathogenic role of the Mycobacterium avium-intracellulare complex (MAC) in the human lung and the definitive criteria for initiating multidrug therapy are still lacking. However, there is little doubt that clarithromycin is the most efficacious drug among the various treatment regimens for lung NTM. In this study, with the use of a bridged nucleic acid (BNA) probe a detection system based on a real-time PCR (BNA-PCR) for the identification of the point mutations at position 2058 or 2059 in domain V of the 23S rRNA gene responsible for clarithromycin resistance was developed and has been assessed using MAC isolates from clinical samples. Out of 199 respiratory specimens, the drug susceptibility test demonstrated 12 strains resistant to clarithromycin, while the BNA-PCR showed 8 strains carrying the point mutation at position 2058 or 2059 of the 23S rRNA gene. This system revealed that there were mycobacterial strains resistant to clarithromycin which do not carry previously identified resistance genes. This paper documents a novel system for detecting clarithromycin-resistant strains and demonstrates that although these mutations are tacitly assumed to account for >90% of the reported resistant mutants, there is a significant fraction of resistant mutants that do not harbor these mutations. Therefore, unknown mechanisms affecting clarithromycin resistance remain to be elucidated. PMID:26739154

  9. Comparison of an in-house multiplex PCR with two commercial immuno-chromatographic tests for rapid identification and differentiation of MTB from NTM isolates.

    Science.gov (United States)

    Kumar, Parveen; Benny, Prit; Jain, Manisha; Singh, Sarman

    2014-03-01

    Species specific diagnosis of mycobacterial infection is crucial because treatment of infections caused by Mycobacterium tuberculosis (MTB) differs from that of non-tuberculous mycobacterial (NTM) species. The species identification used to be cumbersome and non-reproducible a decade ago. Recently, some commercial tests have been made available to differentiate the MTB and NTM growths in culture media. Sensitivity and specificity of these tests was evaluated. In this double blind study 572 clinical samples were cultured in an automated BACTEC-MGIT-960 system. A total of 147 (25.7%) samples were MGIT culture positive. These cultures were subjected to an in-house m-PCR (which amplifies hsp-65, esat-6 and ITS region for MAC), two commercial immune-chromatographic tests (ICTs) and phenotypic tests. Of the 147 MGIT positive cultures, m-PCR was able to correctly identify MTB in 123 cultures and NTM in 24 which included 3 MAC isolates. m-PCR showed 100% agreement with two gold standard methods-the nitrate reductase assay and PNB tests-in correctly identifying MTB. Commercial strips were able to correctly identify MTB in 120 (97.5%) of 123 cultures, while 3 (2.5%) isolates were falsely identified as NTM. However, none of the growth negative spent medium gave false positive results in any of the tests. None of the commercial strips misidentified any of the 24 NTM as MTB; hence, specificity of these strips was 100%. Of the 2 IC test systems, both SD Bioline and BD TBc strip tests missed 2.5% of MTB isolates and misidentified these as NTM. The in-house m-PCR was found to be the most accurate and efficient tool for identifying the MTB, MAC and other NTMs. Copyright © 2014 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  10. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples.

    Science.gov (United States)

    Leblanc-Maridor, Mily; Beaudeau, François; Seegers, Henri; Denis, Martine; Belloc, Catherine

    2011-05-22

    Campylobacter spp., especially Campylobacter jejuni (C. jejuni) and Campylobacter coli (C. coli), are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 10² CFU/g of faeces, 1.3 × 10² CFU/g of feed, and 1.0 × 10³ CFU/m² for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R² = 0.90 and R² = 0.93 respectively. The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new diagnostic tool for studying the epidemiology of

  11. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples

    Directory of Open Access Journals (Sweden)

    Denis Martine

    2011-05-01

    Full Text Available Abstract Background Campylobacter spp., especially Campylobacter jejuni (C. jejuni and Campylobacter coli (C. coli, are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. Results With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 102 CFU/g of faeces, 1.3 × 102 CFU/g of feed, and 1.0 × 103 CFU/m2 for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R2 = 0.90 and R2 = 0.93 respectively. Conclusion The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new

  12. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples

    Science.gov (United States)

    2011-01-01

    Background Campylobacter spp., especially Campylobacter jejuni (C. jejuni) and Campylobacter coli (C. coli), are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. Results With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 102 CFU/g of faeces, 1.3 × 102 CFU/g of feed, and 1.0 × 103 CFU/m2 for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R2 = 0.90 and R2 = 0.93 respectively. Conclusion The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new diagnostic tool for studying

  13. Occurrence of Listeria species in meat, chicken products and human stools in Assiut city, Egypt with PCR use for rapid identification of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ashraf Mohamed Abd El-Malek

    Full Text Available The present research was conducted to check the presence of Listeria spp. in some meat and chicken products purchased from retail supermarkets in Assiut (Egypt. A total of 100 samples including 25 samples each of minced frozen beef, luncheon, frozen chicken legs and frozen chicken breast fillets were collected over a 7-month period between January and July 2009 and analyzed for the presence of Listeria spp. In addition, 28 stool cultures examined for Listeria spp. from hospitalized children resident in Assiut Pediatric University Hospital with diarrhea or fever. Out of the total 100 meat samples examined, Listeria spp. were detected in 8 (32% of minced frozen beef, 8 (32% of luncheon, 13 (52% of frozen chicken leg and 14 (56% of frozen chicken fillet samples analyzed, respectively. Regarding the examined 28 stool cultures from hospitalized children with underlying disease in Assiut Univ. hospital, 2 (7.14% were found positive for Listeria spp. For identification of L. monocytogenes using polymerase chain reaction (PCR, two primers were selected to detect 217-pb fragment ofthe prfA (transcriptional activator of the virulence factor gene for L. monocytogenes. 13 selected Listeria isolates displayed beta-haemolysis on sheep blood agar and positive CAMP test were further identified using PCR. PCR results showed that L. monocytogenes were confirmed in one of minced imported frozen meat examined, two of luncheon samples and two of frozen chicken legs with the total incidence of 5 isolates (5% from the total 100 examined food samples. This suggests the presence of a significant public health hazard linked to the consumption of these meat and chicken products sold in Assiut city contaminated with L. monocytogenes. The public health significance of these pathogens as well as recommended sanitary measures was discussed. [Veterinary World 2010; 3(8.000: 353-359

  14. Rapid diagnostic multiplex PCR (RD-PCR) to discriminate Schistosoma haematobium and S. bovis.

    Science.gov (United States)

    Webster, B L; Rollinson, D; Stothard, J R; Huyse, T

    2010-03-01

    Schistosoma haematobium and S. bovis are widespread schistosome species causing human and cattle schistosomiasis, respectively, in Africa. The sympatric occurrence of these two species and their ability to infect the same Bulinus intermediate snail hosts necessitates precise methods of identification of the larval stages. A rapid diagnostic 'mulitplex' one-step polymerase chain reaction protocol (RD-PCR) was developed using cytochrome oxidase subunit 1 (COX1) mitochondrial DNA (mtDNA) to discriminate between S. haematobium and S. bovis. A single forward primer and two species-specific reverse primers were used to produce a polymerase chain reaction (PCR) fragment of 306 bp and 543 bp for S. bovis and S. haematobium, respectively. Serial dilutions were carried out on various lifecycle stages and species combinations to test the sensitivity and specificity of the primers. This RD-PCR proved highly sensitive, detecting a single larval stage and as little as 0.78 ng of genomic DNA (gDNA) from an adult schistosome, providing a cost-effective, rapid and robust molecular tool for high-throughput screening of S. haematobium and S. bovis populations. In areas where human and cattle schistosomiasis overlap and are transmitted in close proximity, this mitochondrial assay will be a valuable identification tool for epidemiological studies, especially when used in conjunction with other nuclear diagnostic markers.

  15. PCR Assay for Species-Specific Identification of Bacteroides thetaiotaomicron

    Science.gov (United States)

    Teng, Lee-Jene; Hsueh, Po-Ren; Tsai, Jui-Chang; Chiang, Feng-Lin; Chen, Ching-Yi; Ho, Shen-Wu; Luh, Kwen-Tay

    2000-01-01

    Bacteroides thetaiotaomicron is the second most frequently encountered species of the anaerobes isolated from clinical specimens. We developed a PCR-based assay for the rapid identification of B. thetaiotaomicron. Specific primers were based on shared amplicons of about 1.2 kb generated from B. thetaiotaomicron by randomly amplified polymorphic DNA. This 1.2-kb fragment was sequenced and then used to design a set of PCR amplification primers. This PCR generated an amplification product of 721 bp, which was unique to all 65 isolates of B. thetaiotaomicron tested. There was no amplification with isolates of other bacterial species. Restriction enzyme digestion of the amplification product and dot blot hybridization further verified the specificity of the assay. These results suggest that this PCR assay targets a nucleotide sequence that is strongly conserved in B. thetaiotaomicron. This simple and rapid PCR assay provides a rapid and accurate method for identification of B. thetaiotaomicron and shows promise for the detection of B. thetaiotaomicron in clinical samples. PMID:10747167

  16. A Lab on a chip device for rapid identification of Avian Influenza virus by on-chip sample preparation and solid phase PCR

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2009-01-01

    In this paper, we describe a novel lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid phase PCR on microchip. The device can handle viral samples in an automatic way. Moreover, multiplex PCR and sequence detection are done in one-step, which greatly simplifies...

  17. Development and evaluation of hexaplex PCR for rapid detection of methicillin, cadmium/zinc and antiseptic-resistant staphylococci, with simultaneous identification of PVL-positive and -negative Staphylococcus aureus and coagulase negative staphylococci.

    Science.gov (United States)

    Panda, Sasmita; Kar, Sarita; Choudhury, Ranginee; Sharma, Savitri; Singh, Durg V

    2014-03-01

    We developed a multiplex PCR to detect the presence of methicillin- (mecA), cadmium/zinc-(czrC) and antiseptic-resistant (qacA/B) staphylococci and to identify Panton-Valentine leukocidin (PVL)-positive and -negative Staphylococcus aureus and coagulase-negative staphylococci (CoNS) from infected and healthy eyes. The assay was validated on 177 staphylococci comprising of 55 each of S. aureus and CoNS isolated from infected eyes and five S. aureus and 62 CoNS isolated from healthy eyes and nine direct ocular samples. Nine direct ocular samples for in situ testing consisted of corneal scrapings (4), conjunctiva swabs (2) and others (3). Multiplex PCR result was correlated with genotype data obtained with single PCR and dot-blot assay. The control strains that were positive in multiplex PCR for 16S rRNA, nuc, mecA, pvl, czrC and qacA/B genes were also positive in the dot-blot assay. The specificity of amplified genes obtained with reference strains was further confirmed by DNA sequencing. The single step-hexaplex PCR method can be used for rapid detection of mecA, nuc, pvl, czrC and qacA/B genes in staphylococci with simultaneous identification of PVL-positive and -negative S. aureus and CoNS from a variety of ocular samples. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  18. Multiplex PCR provides a low-cost alternative to DNA probe methods for rapid identification of Mycobacterium avium and Mycobacterium intracellulare.

    OpenAIRE

    Cousins, D; Francis, B; Dawson, D

    1996-01-01

    A multiplex PCR designed to differentiate Mycobacterium tuberculosis complex organisms from M. avium and M. intracellulare was used to test 105 isolates identified by DNA probe methods as M. avium, M. intracellulare, or M. avium complex type X. The multiple PCR correctly identified 33 of 34 isolates identified by commercial probe methods as M. avium and all 51 isolates identified as M. intracellulare. The 20 isolates identified as M. avium complex type X by probe were identified as Mycobacter...

  19. Two Unusual Occurrences of Trichomoniasis: Rapid Species Identification by PCR▿

    Science.gov (United States)

    Bellanger, A. P.; Cabaret, O.; Costa, J. M.; Foulet, F.; Bretagne, S.; Botterel, F.

    2008-01-01

    PCR analysis in two unusual occurrences of trichomoniasis, trichomonal empyema due to Trichomonas tenax and Trichomonas vaginalis in an infant urine sample, allowed us to obtain rapid and accurate trichomonad species identification. The weak sensitivity of wet preparations and the low viability of the flagellates can be remedied by the PCR method. PMID:18632901

  20. Development of a PCR for identification of Bordetella hinzii.

    Science.gov (United States)

    Register, Karen B

    2013-06-01

    Bordetella hinzii infects primarily poultry and immunocompromised humans. It is closely related to the etiologic agent of turkey coryza, Bordetella avium. Distinguishing between B. avium and B. hinzii is difficult, and there is no method for identification of B. hinzii suitable for use by diagnostic laboratories. This report details the development of a B. hinzii-specific PCR targeting the ompA gene. Assay sensitivity is 100% based on analysis of 48 B. hinzii isolates from diverse geographic locations representing all known ribotypes. Evaluation of 71 isolates of B. avium and 20 other bacterial isolates from poultry, comprising gram-negative and gram-positive commensals and pathogens of nine genera, demonstrated an assay specificity of 100%. The ompA PCR is a rapid, reliable, and accurate method for identification of B. hinzii and provides a valuable new tool for veterinary diagnostic laboratories investigating poultry respiratory disease outbreaks.

  1. Use of a Real-Time PCR TaqMan Assay for Rapid Identification and Differentiation of Burkholderia pseudomallei and Burkholderia mallei

    OpenAIRE

    U?Ren, Jana M.; Van Ert, Matthew N.; Schupp, James M.; Easterday, W Ryan; Simonson, Tatum S.; Okinaka, Richard T.; Pearson, Talima; Keim, Paul

    2005-01-01

    A TaqMan allelic-discrimination assay designed around a synonymous single-nucleotide polymorphism was used to genotype Burkholderia pseudomallei and Burkholderia mallei isolates. The assay rapidly identifies and discriminates between these two highly pathogenic bacteria and does not cross-react with genetic near neighbors, such as Burkholderia thailandensis and Burkholderia cepacia.

  2. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    A rapid and sensitive method for excluding the presence of methicillin-resistant Staphylococcus aureus (MRSA) in clinical samples was developed. The combination of MRSA detection by mecA coaA PCR with prior enrichment in selective broth was tested for 300 swabs. PCR identified 26 MRSApositive samples, ...

  3. Template preparation for rapid PCR in Colletotrichum lindemuthianum

    Directory of Open Access Journals (Sweden)

    Roca M. Gabriela

    2003-01-01

    Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.

  4. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-02-07

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    OpenAIRE

    Nelly eDatukishvili; Tamara eKutateladze; Inga eGabriadze; Kakha eBitskinashvili; Boris eVishnepolsky

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of C...

  6. Development of a PCR for identification of Naegleria fowleri from the environment.

    OpenAIRE

    Kilvington, S; Beeching, J

    1995-01-01

    A species-specific PCR for the identification of Naegleria fowleri was developed. In sensitivity studies, 10 trophozoites or cysts and 1 trophozoite or cyst could be detected after 35 and 45 cycles, respectively. In conjunction with a rapid DNA isolation method, this PCR was used to identify N. fowleri directly from primary cultures of environmental samples.

  7. Detection and identification of aquatic birnaviruses by PCR assay.

    Science.gov (United States)

    Blake, S L; Schill, W B; McAllister, P E; Lee, M K; Singer, J T; Nicholson, B L

    1995-04-01

    A reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for the detection and identification of aquatic birnaviruses. The four sets of primers (PrA, PrB, PrC, and PrD) that we used are specific for regions of cDNA coded by genome segment A of aquatic birnaviruses. PrA identifies a large fragment (1,180 bp) within the pVP2-coding region, and PrB identifies a 524-bp fragment within the sequence amplified by PrA. Primer set PrC frames a genome fragment (339 bp) within the NS-VP3-coding region, and PrD identifies a 174-bp sequence within the fragment identified by PrC. PrB and PrD amplified cDNAs from all nine recognized serotypes of aquatic birnavirus serogroup A as well as the N1 isolate that may represent a 10th serotype. These results indicate that these three primer sequences are highly conserved and can be used in PCR assays for group identification of these viruses. PrA routinely produced amplification products from eight serotypes but exhibited variable results with one serotype, and primer PrC identified 6 of the 11 virus isolates tested. The qualitative sensitivity of the RT-PCR assay was evaluated by comparison of the results with those of cell culture isolation assays. With the exception of one sample, the RT-PCR assay with primer PrD was as accurate as cell culture isolation for detecting virus in kidney and spleen tissues from naturally infected, asymptomatic carrier fish. These results indicate that the RT-PCR assay can be a rapid and reliable substitute for cell culture methods for the detection of aquatic birnaviruses.

  8. [Rapid detection of Shigella dysenteriae by PCR assay].

    Science.gov (United States)

    Chen, Hongyuan; Zhong, Qingping; Wang, Li; Sun, Yuanming

    2010-09-01

    Based on the invasive plasmid antigen H gene (ipaH) of S. dysenteriae, one pair of specific primers was designed for PCR assays in this study. The concentrations of dNTP, Mg2+ and primer, dosage of Taq DNA polymerase, annealing temperature and circulating parameter in the PCR amplification system were optimized. In this way, a rapid and stable method of PCR assay for the detection of S. dysenteriae was established. The specificity and sensitivity of PCR were also analyzed. The detection limits of pure culture and genomic DNA in the PCR assay were 1.06 x 10(2) cfu/ml and 106.34 pg/PCR system, respectively. The detection limit for S. dysenteriae in artificially contaminated food samples was 3.21 x 10(4) cfu/ml. These results indicated that the PCR method for S. dysenteriae detection was simple, rapid, high in specificity and sensitivity and suitable for the detection of pathogens in foods caused by Shigella dysenteriae.

  9. Rapid Identification of Sporothrix Species by T3B Fingerprinting

    Science.gov (United States)

    de Oliveira, Manoel Marques Evangelista; Sampaio, Paula; Almeida-Paes, Rodrigo; Pais, Célia; Gutierrez-Galhardo, Maria Clara

    2012-01-01

    This article describes PCR fingerprinting using the universal primer T3B to distinguish among species of the Sporothrix complex, S. brasiliensis, S. globosa, S. mexicana, and S. schenckii. This methodology generated distinct banding patterns, allowing the correct identification of all 35 clinical isolates at the species level, confirmed by partial calmodulin (CAL) gene sequence analyses. This methodology is simple, reliable, rapid, and cheap, making it an ideal routine identification system for clinical mycology laboratories. PMID:22403427

  10. Rapid diagnosis and identification by PCR of Yersinia ruckeri isolated of Oncorhynchus mykiss from Canta, Lima, Peru Diagnóstico e identificación rápidos por PCR de Yersinia ruckeri aislada de Oncorhynchus mykiss procedentes de Canta, Lima, Perú

    Directory of Open Access Journals (Sweden)

    Susana Sirvas-Cornejo

    2012-02-01

    Full Text Available Twenty individuals of rainbow trout were sampled (fry and juveniles from Acochinchan Fishfarm (Canta, Lima - Peru, and analyzed with the Polimerase Chain Reaction test (PCR in order to achieve a rapid identification of Yersinia ruckeri, which is the pathogen agent that causes the enteric red mouth disease (ERM and produces high rates of mortality. Nine fish samples were asymptomatic, while 11 of them showed signs of ERM. In addition, 22 bacterial strains were isolated from the liver, spleen and kidney. PCR and specific primers (16S rRNA, were used to amplified a specific 575 bp DNA fragment of Yersinia ruckeri. Nineteen strains were identified as Yersinia ruckeri by PCR in symptomatic and asymptomatic fishes. It was established a diagnosis time of 26 hours, compared with the 2 or 3 days that would take the diagnosis using biochemical tests.Se muestrearon 20 ejemplares (alevines y juveniles de trucha arco iris cultivados en la piscifactoría Acochinchán (Canta, Lima, Perú, y se les aplico la técnica de la Reacción en Cadena de la Polimerasa (PCR con la finalidad de obtener una identificación rápida del agente patógeno Yersinia ruckeri que produce la enfermedad entérica de la boca roja (ERM y genera elevadas tasas de mortalidad. Nueve ejemplares fueron asintomáticos mientras que 11 presentaron signos de ERM. Se aislaron 22 cepas bacterianas del hígado, bazo y riñón. Se empleó la técnica de la PCR para la amplificación y cebadores específicos (ARNr 16S, que permitieron amplificar un fragmento de ADN de 575 pb de Yersinia ruckeri. Diecinueve cepas fueron identificadas como Yersinia ruckeri mediante la PCR, tanto en peces sintomáticos como asintomáticos. Se estableció un tiempo de diagnóstico de 26 horas, en comparación con los 2 ó 3 días que duraría el diagnóstico empleando las pruebas bioquímicas.

  11. SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

    Directory of Open Access Journals (Sweden)

    Daijun Ling

    Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

  12. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

    Science.gov (United States)

    Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

    2018-01-01

    ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

  13. Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

    Science.gov (United States)

    Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

    2017-10-25

    Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

  14. [Application of rapid PCR to authenticate medicinal snakes].

    Science.gov (United States)

    Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

    2014-10-01

    To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

  15. SCAR makers and multiplex PCR-based rapid molecular typing of Lentinula edodes strains.

    Science.gov (United States)

    Wu, Xueqian; Li, Haibo; Zhao, Weiwei; Fu, Lizhong; Peng, Huazheng; He, Liang; Cheng, Junwen; Wei, Hailong; Wu, Qingqi

    2010-11-01

    Lentinula edodes is the second most important cultivated mushroom worldwide, the most commercial strains have been identified only through traditional phenotypic analysis. In this study, a simple rapid PCR-based molecular method was developed for distinguishing commercial strains of L. edodes by developing specific sequence characterized amplified region (SCAR) markers and establishing multiplex PCR assays with the SCAR primers. Derived from the randomly amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) techniques, 10 informative SCAR markers were generated from 10 polymorphic RAPD and SRAP bands. The differences in SCAR phenotypes among different strains made these SCAR markers potentially useful to characterize 6 strains and identify them from other studied strains. Moreover, different SCAR phenotypes also made the other 17 studied strains to be divided into four distinguishable groups. The multiplex PCR assays were further established for the joint use of some SCAR markers efficiently. Compared with some identification methods reported previously, the special feature of this new molecular method is technically rapid and convenient in the practical use and suitable for analyzing large numbers of samples. Thus, the simple rapid PCR-based molecular method can be used as a helpful assistant tool for the lentinula industry. To our knowledge, this study is the first to describe a development of a new SCAR maker-based multiplex PCR assay for rapid molecular typing of edible mushroom.

  16. Rapid detection of Pseudomonas aeruginosa from positive blood cultures by quantitative PCR

    Directory of Open Access Journals (Sweden)

    Cattoir Vincent

    2010-08-01

    Full Text Available Abstract Background Pseudomonas aeruginosa is responsible for numerous bloodstream infections associated with severe adverse outcomes in case of inappropriate initial antimicrobial therapy. The present study was aimed to develop a novel quantitative PCR (qPCR assay, using ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive blood cultures (BCs. Methods Over the period August 2008 to June 2009, 100 BC bottles positive for gram-negative bacilli were tested in order to evaluate performances of the qPCR technique with conventional methods as gold standard (i.e. culture and phenotypic identification. Results Thirty-three strains of P. aeruginosa, 53 strains of Enterobactericaeae, nine strains of Stenotrophomonas maltophilia and two other gram-negative species were isolated while 3 BCs were polymicrobial including one mixture containing P. aeruginosa. All P. aeruginosa clinical isolates were detected by qPCR except a single strain in mixed culture. Performances of the qPCR technique were: specificity, 100%; positive predictive value, 100%; negative predictive value, 98.5%; and sensitivity, 97%. Conclusions This reliable technique may offer a rapid (

  17. Identification of Bifidobacterium spp. using hsp60 PCR-RFLP analysis: an update.

    Science.gov (United States)

    Stenico, Verena; Michelini, Samanta; Modesto, Monica; Baffoni, Loredana; Mattarelli, Paola; Biavati, Bruno

    2014-04-01

    A PCR-RFLP technique has been applied on 13 species of Bifidobacterium in order to update a previous study carried out by Baffoni et al. This method is based on the restriction endonuclease activity of HaeIII on the PCR-amplified hsp60 partial gene sequence, and allows a rapid and efficient identification of Bifidobacterium spp. strains at species and subspecies level. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  19. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  20. Development of multiplex-PCR assay for rapid detection of Candida spp.

    Directory of Open Access Journals (Sweden)

    Ni Made A. Tarini

    2010-05-01

    Full Text Available Aim Candida spp. infection commonly occur in immunocompromised patients. Biochemical assay for identification of Candida spp. is time-consuming and shows many undetermined results. Specific detection for antibody, antigen and metabolites of Candida spp. had low sensitivity and specificity. In this study, we developed a rapid diagnostic method, Multiplex-PCR, to identify Candida spp.Methods Five Candida spp. isolates were cultured, identifi ed with germ tube and API® 20 C AUX (BioMerieux® SA kit. Furthermore, DNA was purified by QIAamp DNA mini (Qiagen® kit for Multiplex-PCR assay.Results DNA detection limit by Multiplex-PCR assays for C. albicans, C. tropicalis, C. parapsilosis, C. krusei and C. glabrata were 4 pg, 0.98 pg, 0.98 pg, 0.5 pg and 16 pg respectively. This assay was also more sensitive than culture in that Multiplex-PCR could detect 2.6-2.9 x 100 CFU/ml, whereas culture 2.6-2.9 x 102 CFU/ml.Conclusion Multiplex-PCR is much more sensitive than culture and thus, can be recommended as a sensitive and specific assay for identification of Candida spp. (Med J Indones 2010; 19:83-7Keywords: Candida spp., multiplex-PCR

  1. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  2. Evaluation of a PCR assay for identification and differentiation of Campylobacter fetus subspecies

    DEFF Research Database (Denmark)

    Hum, S.; Quinn, K.; Brunner, J.

    1997-01-01

    Objective To evaluate a polymerase chain reaction assay for identification of Campylobacter fetus and differentiation of the defined subspecies. Design Characterisation of bacterial strains by traditional phenotyping, polymerase chain reaction, a probabilistic identification scheme and macrorestr......Objective To evaluate a polymerase chain reaction assay for identification of Campylobacter fetus and differentiation of the defined subspecies. Design Characterisation of bacterial strains by traditional phenotyping, polymerase chain reaction, a probabilistic identification scheme...... by traditional phenotypic methods and the PCR assay was found to be 80.8%. The polymerase chain reaction proved to be a reliable technique for the species and subspecies identification of C fetus; equivocal results were obtained in only two instances. Initial misidentifications by conventional phenotyping...... methods were attributed to methodological differences used in various laboratories. Conclusion Our results indicate that misidentification of C fetus in routine diagnostic laboratories may be relatively common. The PCR assay evaluated gave rapid and reproducible results and is thus a valuable adjunctive...

  3. Rapid identification of methicillin-resistant Staphylococcus aureus transmission in hospitals by use of phage-derived open reading frame typing enhanced by multiplex PCR and reverse line blot assay.

    Science.gov (United States)

    O'Sullivan, Matthew V N; Kong, Fanrong; Sintchenko, Vitali; Gilbert, Gwendolyn L

    2010-08-01

    The relatively high-level clonality of methicillin-resistant Staphylococcus aureus (MRSA) and its frequent high-level endemicity in nosocomial settings complicate the development of methods for rapid subtyping of MRSA strains that are capable of identifying person-to-person transmission in hospitals. Phage-derived open reading frame (PDORF) typing is an MRSA typing method targeting mobile genetic elements that was recently described and evaluated using a geographically restricted set of isolates. The objective of this study was to develop a multiplex PCR-reverse line blot (mPCR/RLB) assay for PDORF typing and to test its applicability on a broad range of isolates and in an environment where MRSA is highly endemic. The 16 targets were identified using a 23-primer-pair mPCR/RLB assay with two probes for each target. The method was evaluated using 42 MRSA reference strains, including those representing major international clones, and 35 isolates from episodes of suspected nosocomial transmission. In vivo stability was explored using 81 isolate pairs. Pulsed-field gel electrophoresis (PFGE) and spa typing were performed for comparison. Among the 42 reference strains, there were 33 PFGE subtypes, 30 PDORF types, and 22 spa types. Simpson's index of diversity was 0.987, 0.971, and 0.926 for PFGE subtyping, PDORF typing, and spa typing, respectively. Typing of clinical isolates by PDORF typing and PFGE demonstrated concordant results. mPCR/RLB-based PDORF typing has similar discriminatory power to that of PFGE, can assist in tracking MRSA transmission events in a setting of high-level endemicity, and has the advantage of being a high-throughput technique.

  4. Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

    Science.gov (United States)

    Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

    2016-02-01

    Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

  5. Rapid detection and simultaneous genotyping of Cronobacter spp. (formerly Enterobacter sakazakii) in powdered infant formula using real-time PCR and high resolution melting (HRM) analysis

    National Research Council Canada - National Science Library

    Cai, Xian-Quan; Yu, Hai-Qiong; Ruan, Zhou-Xi; Yang, Lei-Liang; Bai, Jian-Shan; Qiu, De-Yi; Jian, Zhi-Hua; Xiao, Yi-Qian; Yang, Jie-Yang; Le, Thanh Hoa; Zhu, Xing-Quan

    2013-01-01

    .... The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis targeting the OmpA gene for the specific detection and rapid identification of Cronobacter spp...

  6. Rapid Detection and Simultaneous Genotyping of Cronobacter spp. (formerly Enterobacter sakazakii) in Powdered Infant Formula Using Real-time PCR and High Resolution Melting (HRM) Analysis: e67082

    National Research Council Canada - National Science Library

    Xian-Quan Cai; Hai-Qiong Yu; Zhou-Xi Ruan; Lei-Liang Yang; Jian-Shan Bai; De-Yi Qiu; Zhi-Hua Jian; Yi-Qian Xiao; Jie-Yang Yang; Thanh Hoa Le; Xing-Quan Zhu

    2013-01-01

    .... The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis targeting the OmpA gene for the specific detection and rapid identification of Cronobacter spp...

  7. Rapid detection of Actinobacillus actinomycetemcomitans, Prevotella intermedia and Porphyromona gingivalis by multiplex PCR.

    Science.gov (United States)

    García, L; Tercero, J C; Legido, B; Ramos, J A; Alemany, J; Sanz, M

    1998-01-01

    The identification of specific periodontal pathogens by conventional methods, mainly anaerobic cultivation, is difficult, time consuming and even sometimes unreliable. Therefore, a multiplex PCR method for simultaneous detection of Actinobacillus actinomycetemcomitans (A.a.), Porphyromona gingivalis (P.g.) and Prevotella intermedia (P.i.) was developed for rapid and easy identification of these specific bacterial pathogens in subgingival plaque samples. In this paper, there is a detailed description of the oligonucleotide primer selection, DNA extraction and PCR conditions and the sequencing of the amplified products. The locus chosen to be amplified is a highly variable region in the 16S ribosomal DNA. For the development of this technique ATCC cultures and pure cultures from subgingival plaque samples taken from periodontitis patients were used. As an internal positive control a recombinant plasmid was developed. This simple DNA extraction procedure and the DNA amplification and visualization of the amplified product permits the detection of the bacteria in a working day. Thus, this multiplex PCR method is a rapid and effective detection method for specific periodontal pathogens.

  8. Rapid sex determination using PCR technique compared to classic cytogenetics.

    Science.gov (United States)

    Settin, Ahmad; Elsobky, Ezzat; Hammad, Ayman; Al-Erany, Abeer

    2008-01-01

    Fetal sexual differentiation relies on the translation of chromosomal sex established at fertilization into gonadal sex and somatic sex as development proceeds. In cases where chromosomal, gonadal, and somatic sex are incongruent in human infants and children, rapid establishment of the diagnosis and implementation of medical and surgical management is of paramount importance, since the gender identity is so important to the psychological well-being throughout life. This work was done in order to test the value of PCR technique for rapid sex determination compared to classic cytogenetic technique. Subjects included 20, cases including 10 neonates with ambiguous genitalia, 2 adult females with delayed puberty and 8 adult males with infertility, in addition to 20 normal infants of both sexes as a control group. The diagnosis of sex was attempted through examination, cytogenetic study, ultrasonography, gonadal biopsy and hormonal analysis, in addition to PCR amplification for the detection of SRY and ATL1 gene loci on Y and X chromosomes respectively. Four neonates were diagnosed as partial testicular feminization showed both positive bands for the Y and X chromosomes and a karyogram of 46/XY. Three neonates were diagnosed as true hermaphrodites showed positive amplification for both Y and X chromosomes with a mosaic karyogram 46,XX/XY. Three neonates were diagnosed as cases of adrenogenital syndrome showed positive amplification of only the Xchromosome and had a karyogram of 46/XX. One of the two adult females was diagnosed as turner syndrome showed positive amplification of the X chromosome and a karyogram of 45/XO; the other one was diagnosed as complete testicular feminization had a positive amplification of X and Y chromosomes and a karyogram of 46/XY. The 8 adult males with infertility showed a positive amplification of X and Y chromosome and a karyogram of 47/XXY (Klinefelter syndrome) in 7 cases and 46/XY gonadal dysgenesis in one case. We concluded that PCR

  9. Rapid detection of Panton-Valentine leukocidin from clinical isolates of Staphylococcus aureus strains by real-time PCR

    NARCIS (Netherlands)

    Deurenberg, Ruud H; Vink, Cornelis; Driessen, Christel; Bes, Michèle; London, Nancy; Etienne, Jerome; Stobberingh, Ellen E

    2004-01-01

    To allow rapid identification of Panton-Valentine leukocidin (PVL)-producing Staphylococcus aureus strains, a real-time PCR assay for detection of PVL was developed. This assay is convenient, since it can be applied directly on bacterial suspensions and does not require previous DNA purification.

  10. Development a rapid and accurate multiplex real time PCR method for the detection Chlamydia trachomatis and Mycoplasma hominis.

    Science.gov (United States)

    Safarkar, Roya; Mehrabadi, Jalil Fallah; Noormohammadi, Zahra; Mirnejad, Reza

    2017-11-01

    Sexually transmitted diseases easily spread among sexually active people and often have no symptoms. Rapid and accurate method for detecting these infections are necessary in early stages. The traditional detection methods of them are difficult and time-consuming. In this study, multiplex real time PCR was optimized for rapid identification of Chlamydia trachomatis and Mycoplasma hominis in a single tube and was performed with our designed primers. The sensitivity test was carried out to designed primers with diluted genomic DNA. To defined the specificity, non STD bacteria were used as DNA template. This study indicated that the developed multiplex real time PCR can be an effective alternative procedure to the conventional methods for rapid and accurate identification of C Chlamydia trachomatis and Mycoplasma hominis. Multiplex real-time PCR Results of them were checked with melting curves. The sensitivity of our designed primer by multiplex real time PCR for Chlamydia trachomatis and Mycoplasma hominis were 4.78×1010 and 8.35×1010 , respectively, Which the primers did not amplify any product from a non-STD species. Multiplex real time PCR by our new primers and analysis of melting curves were successfully usable for rapid and accurate detection of Chlamydia trachomatis and Mycoplasma hominis. This assay instead of traditional culture method, has considerable potential to be rapid, accurate and highly sensitive molecular diagnostic tool for simultaneous and direct detection. © 2017 Wiley Periodicals, Inc.

  11. Rapid Molecular Detection of Multidrug-Resistant Tuberculosis by PCR-Nucleic Acid Lateral Flow Immunoassay

    Science.gov (United States)

    Kamphee, Hatairat; Chaiprasert, Angkana; Prammananan, Therdsak; Wiriyachaiporn, Natpapas; Kanchanatavee, Airin; Dharakul, Tararaj

    2015-01-01

    Several existing molecular tests for multidrug-resistant tuberculosis (MDR-TB) are limited by complexity and cost, hindering their widespread application. The objective of this proof of concept study was to develop a simple Nucleic Acid Lateral Flow (NALF) immunoassay as a potential diagnostic alternative, to complement conventional PCR, for the rapid molecular detection of MDR-TB. The NALF device was designed using antibodies for the indirect detection of labeled PCR amplification products. Multiplex PCR was optimized to permit the simultaneous detection of the drug resistant determining mutations in the 81-bp hot spot region of the rpoB gene (rifampicin resistance), while semi-nested PCR was optimized for the S315T mutation detection in the katG gene (isoniazid resistance). The amplification process additionally targeted a conserved region of the genes as Mycobacterium tuberculosis (Mtb) DNA control. The optimized conditions were validated with the H37Rv wild-type (WT) Mtb isolate and Mtb isolates with known mutations (MT) within the rpoB and katG genes. Results indicate the correct identification of WT (drug susceptible) and MT (drug resistant) Mtb isolates, with the least limit of detection (LOD) being 104 genomic copies per PCR reaction. NALF is a simple, rapid and low-cost device suitable for low resource settings where conventional PCR is already employed on a regular basis. Moreover, the use of antibody-based NALF to target primer-labels, without the requirement for DNA hybridization, renders the device generic, which could easily be adapted for the molecular diagnosis of other infectious and non-infectious diseases requiring nucleic acid detection. PMID:26355296

  12. Rapid Molecular Detection of Multidrug-Resistant Tuberculosis by PCR-Nucleic Acid Lateral Flow Immunoassay.

    Directory of Open Access Journals (Sweden)

    Hatairat Kamphee

    Full Text Available Several existing molecular tests for multidrug-resistant tuberculosis (MDR-TB are limited by complexity and cost, hindering their widespread application. The objective of this proof of concept study was to develop a simple Nucleic Acid Lateral Flow (NALF immunoassay as a potential diagnostic alternative, to complement conventional PCR, for the rapid molecular detection of MDR-TB. The NALF device was designed using antibodies for the indirect detection of labeled PCR amplification products. Multiplex PCR was optimized to permit the simultaneous detection of the drug resistant determining mutations in the 81-bp hot spot region of the rpoB gene (rifampicin resistance, while semi-nested PCR was optimized for the S315T mutation detection in the katG gene (isoniazid resistance. The amplification process additionally targeted a conserved region of the genes as Mycobacterium tuberculosis (Mtb DNA control. The optimized conditions were validated with the H37Rv wild-type (WT Mtb isolate and Mtb isolates with known mutations (MT within the rpoB and katG genes. Results indicate the correct identification of WT (drug susceptible and MT (drug resistant Mtb isolates, with the least limit of detection (LOD being 104 genomic copies per PCR reaction. NALF is a simple, rapid and low-cost device suitable for low resource settings where conventional PCR is already employed on a regular basis. Moreover, the use of antibody-based NALF to target primer-labels, without the requirement for DNA hybridization, renders the device generic, which could easily be adapted for the molecular diagnosis of other infectious and non-infectious diseases requiring nucleic acid detection.

  13. Multiplex PCR for Differential Identification of Broad Tapeworms (Cestoda: Diphyllobothrium) Infecting Humans▿

    Science.gov (United States)

    Wicht, Barbara; Yanagida, Tetsuya; Scholz, Tomáš; Ito, Akira; Jiménez, Juan A.; Brabec, Jan

    2010-01-01

    The specific identification of broad tapeworms (genus Diphyllobothrium) infecting humans is very difficult to perform by morphological observation. Molecular analysis by PCR and sequencing represents the only reliable tool to date to identify these parasites to the species level. Due to the recent spread of human diphyllobothriosis in several countries, a correct diagnosis has become crucial to better understand the distribution and the life cycle of human-infecting species as well as to prevent the introduction of parasites to disease-free water systems. Nevertheless, PCR and sequencing, although highly precise, are too complicated, long, and expensive to be employed in medical laboratories for routine diagnostics. In the present study we optimized a cheap and rapid molecular test for the differential identification of the most common Diphyllobothrium species infecting humans (D. latum, D. dendriticum, D. nihonkaiense, and D. pacificum), based on a multiplex PCR with the cytochrome c oxidase subunit 1 gene of mitochondrial DNA. PMID:20592146

  14. Development of duplex-PCR for identification of Aeromonas species

    Directory of Open Access Journals (Sweden)

    Carina Lucena Mendes-Marques

    2013-05-01

    Full Text Available Introduction The number of reports of intestinal infections caused by Aeromonas spp. has increased significantly in recent years. In most clinical laboratories, identification of these bacteria is carried out by general phenotypic tests that sometimes do not accurately differentiate Aeromonas and Vibrio. Methods A duplex-polymerase chain reaction (PCR was developed directed to 2 targets identifying Aeromonas spp. pathogenic to humans. Results The duplex-PCR results were reproducible and specific for Aeromonas spp. pathogenic to humans. Conclusions This method will allow differentiation between Vibrio and Aeromonas spp. in patients with in cholera-like symptoms and can also be used in water quality monitoring.

  15. Development of a novel hexa-plex PCR method for identification and serotyping of Salmonella species.

    Science.gov (United States)

    Li, Ruichao; Wang, Yang; Shen, Jianzhong; Wu, Congming

    2014-01-01

    Salmonella is one of the most important foodborne pathogens, which causes a huge economic burden worldwide. To detect Salmonella rapidly is very meaningful in preventing salmonellosis and decreasing economic losses. Currently, isolation of Salmonella is confirmed by biochemical and serobased serotyping methods, which are time consuming, labor intensive, and complicated. To solve this problem, a hexa-plex polymerase chain reaction (PCR) method was developed using comparative genomics analysis and multiplex PCR technology to detect Salmonella and Salmonella Typhimurium, Salmonella Enteritidis, Salmonella Agona, Salmonella Choleraesuis, and Salmonella Pullorum simultaneously. The accuracy of this method was tested by a collection of 142 Salmonella. Furthermore, the strategy described in this article to mine serovar-specific fragments for Salmonella could be used to find specific fragments for other Salmonella serotypes and bacteria. The combination of this strategy and multiplex PCR is promising in the rapid identification of foodborne pathogens.

  16. Multiplex real-time PCR for identification of canine parvovirus antigenic types.

    Science.gov (United States)

    Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Narang, Deepti

    2016-07-01

    Canine parvovirus (CPV) is an important disease causing gastroenteritis and/or haemorrhagic gastroenteritis in dogs. There are four antigenic types of CPV reported worldwide viz. CPV 2, CPV 2a, CPV 2b and CPV 2c. The diagnosis of CPV with the identification of the antigen type responsible remains problematic. In the present study, identification as well as antigenic typing of CPV was done using a de novo multiplex real time PCR to combat the problem of antigenic type identification. From the study it could be concluded that the here developed multiplex real time PCR assay could be used for rapid detection of CPV as well as typing of its three antigenic types. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

    Directory of Open Access Journals (Sweden)

    Kirill V Sergueev

    Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

  18. Automated 5 ' nuclease PCR assay for identification of Salmonella enterica

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Ahrens, Peter; Rådström, P.

    2000-01-01

    A simple and ready-to-go test based on a 5' nuclease (TaqMan) PCR technique was developed for identification of presumptive Salmonella enterica isolates. The results were compared with those of conventional methods. The TaqMan assay was evaluated for its ability to accurately detect 210 S. enterica...... isolates, including 100 problematic "rough" isolates. An internal positive control was designed to use the same Salmonella primers for amplification of a spiked nonrelevant template (116 bp) in the sample tube. The PCR test correctly identified all the Salmonella strains by resulting in positive end...... Salmonella strains tested resulted in positive FAM and TET signals. In addition, it was found that the complete PCR mixture, predispensed in microwell plates, could be stored for up to 3 months at -20 degrees C, Thus, the diagnostic TaqMan assay developed can be a useful and simple alternative method...

  19. Multiplex PCR Assay for Identification of Human Diarrheagenic Escherichia coli

    OpenAIRE

    Toma, Claudia; Lu, Yan; Higa, Naomi; Nakasone, Noboru; Chinen, Isabel; Baschkier, Ariela; Rivas, Marta; Iwanaga, Masaaki

    2003-01-01

    A multiplex PCR assay for the identification of human diarrheagenic Escherichia coli was developed. The targets selected for each category were eae for enteropathogenic E. coli, stx for Shiga toxin-producing E. coli, elt and est for enterotoxigenic E. coli, ipaH for enteroinvasive E. coli, and aggR for enteroaggregative E. coli. This assay allowed the categorization of a diarrheagenic E. coli strain in a single reaction tube.

  20. Identification of Staphylococcus spp. using (GTG)₅-PCR fingerprinting.

    Science.gov (United States)

    Svec, Pavel; Pantůček, Roman; Petráš, Petr; Sedláček, Ivo; Nováková, Dana

    2010-12-01

    A group of 212 type and reference strains deposited in the Czech Collection of Microorganisms (Brno, Czech Republic) and covering 41 Staphylococcus species comprising 21 subspecies was characterised using rep-PCR fingerprinting with the (GTG)₅ primer in order to evaluate this method for identification of staphylococci. All strains were typeable using the (GTG)₅ primer and generated PCR products ranging from 200 to 4500 bp. Numerical analysis of the obtained fingerprints revealed (sub)species-specific clustering corresponding with the taxonomic position of analysed strains. Taxonomic position of selected strains representing the (sub)species that were distributed over multiple rep-PCR clusters was verified and confirmed by the partial rpoB gene sequencing. Staphylococcus caprae, Staphylococcus equorum, Staphylococcus sciuri, Staphylococcus piscifermentans, Staphylococcus xylosus, and Staphylococcus saprophyticus revealed heterogeneous fingerprints and each (sub)species was distributed over several clusters. However, representatives of the remaining Staphylococcus spp. were clearly separated in single (sub)species-specific clusters. These results showed rep-PCR with the (GTG)₅ primer as a fast and reliable method applicable for differentiation and straightforward identification of majority of Staphylococcus spp. Copyright © 2010 Elsevier GmbH. All rights reserved.

  1. A new PCR approach for the identification of Fusarium graminearum.

    Science.gov (United States)

    de Biazio, Gleison Ricardo; Leite, Gabriela Guimarães Sousa; Tessmann, Dauri José; Barbosa-Tessmann, Ione Parra

    2008-07-01

    The main objective of this work was to develop a PCR protocol for the identification of Fusarium graminearum, based on a pair of primers targeted to a segment of the 3´coding region of the gaoA gene that codes for the enzyme galactose oxidase (GO). This region has low homology with the same region of GO genes from other fungi. Genomic DNA from 17 strains of Fusarium spp. isolated from diseased cereals, from several other Fusarium species, and from other fungi genera was analyzed in a PCR assay using this primer set. The 17 strains of Fusarium spp. were also analyzed for the GO enzyme production in submerse fermentation in a new formulated liquid medium. All strains that were morphologically and molecularly identified as F. graminearum were able to secrete the enzyme and had a positive result in the used PCR protocol. No DNA fragment was amplified using genomic DNA from other Fusarium species and species of other fungi genera. The results suggest that the proposed PCR protocol is specific and can be considered as a new molecular tool for the identification of F. graminearum. In addition, the new formulated medium is a cheap alternative for screening for GO screening production by F. graminearum.

  2. Identification of different subtypes of rapid growing Atypical Mycobacterium from water and soil sources: Using PCR-RFLP using hsp65 and rRNA 16s-23s genes.

    Science.gov (United States)

    Varahram, Mohammad; Farnia, Parissa; Saif, Shima; Marashian, Mehran; Farnia, Poopak; Ghanavi, Jaladein; Velayati, Ali Akbar

    2016-12-01

    Nontuberculosis mycobacteria (NTM) are a diverse group of microorganisms that cause a variety of diseases in humans including skin, respiratory, and gastrointestinal tract infection. Generally, NTM are classified into two categories: rapid (7days). In this study, we aimed to investigate NTM frequency and prevalence in environmental samples. Additionally, we tried to identify various subtypes of isolated rapid growing mycobacteria (RGM). Through a prospective descriptive cross-sectional study, water and soil samples were gathered from four neighboring towns around Tehran, the capital of Iran, at different geographic directions. Every 100m(2) of the studied areas gave one sample containing 6g of soil in 3-5cm depth deposited in 50mL sterile water as sampling media. After digestion and decontamination, DNA from culture-positive specimens (RGM) were extracted using phenol-chloroform methods. Then the molecular identification of species and subspecies were performed using 16s-23s rRNA and hsp65 gene. In total, 341 RGM were found, out of which 322 (94.4%) were identified and 20 (5.8%) could not be identified. The most frequent RGM was, Mycobacterium fortuitum (72; 22%), Mycobacterium senegalense (58; 17.7%), Mycobacterium parafortuitum (44; 13.4%) and Mycobacterium conceptionense type 1 (24; 7.2%), and Mycobacterium cheloni type 1 (20; 6.0%). As shown in Table 1, M. fortuitum had more subtypes (8), and the frequency of subtypes 1 (27.7%), 4 (16.6%), and 5 (13.8%) were higher. Among subtypes of M. senegalense, subtype 1 had a higher frequency (70.4%) in comparison to subtype 2 (29.5%). M. cheloni had just one subtype. Our results showed M. fortuitum as the most prominent strain isolated from environmental samples. The frequency was similar in different places, irrespective of climatic variations. Availability of various subtypes of M. fortuitum might indicate a large circulation of this RGM in soil and water of Iranian territory. This high prevalence of M. fortuitum might

  3. Species identification in meat products using real-time PCR.

    Science.gov (United States)

    Jonker, K M; Tilburg, J J H C; Hagele, G H; de Boer, E

    2008-05-01

    One of the most convenient methods for the identification of animal species in processed meat products is the examination of DNA sequences. Real-time polymerase chain reaction (qPCR) techniques are particularly suitable because even small fragments of DNA formed during heat processing of the meat can be amplified and identified. A real-time PCR method has been developed and evaluated for the identification of processed meat products. In test mixtures containing beef, pork, horse, mutton, chicken and turkey, it was possible to identify these species down to a level of 0.05%. By adjusting the number of cycles, it was possible to detect levels as low as 0.01% of these species. Cross-reactivity between these species was not found, except for pure horsemeat (250 ng DNA) in the assay for turkey meat. Cross-reactivity of deer, roe, ostrich, kangaroo, goat, domestic duck, mallard, goose, pigeon, guinea fowl, quail and pheasant was also investigated and it was found that amounts as high as 250 ng DNA of these species in the reaction vial did not result in (false) positive signals except for amounts higher than 125 ng deer DNA and higher than 50 ng pigeon DNA in the determination of chicken and beef, respectively. More than 150 meat samples were examined using DNA hybridization and real-time PCR. A comparison of the results showed a better performance of the real-time procedure compared to DNA hybridization.

  4. Confirmed identification and toxin profiling of Campylobacter jejuni using a thermostabilized multiplex PCR formulation.

    Science.gov (United States)

    Ramachandran, Nitya; Ramlal, Shylaja; Batra, Harsh Vardhan

    2017-07-01

    Cytolethal distending toxin (CDT) producing Campylobacter jejuni species are one of the leading causes of human gastroenteritis worldwide. The main intent of the study was to develop a multiplex PCR assay for the confirmed identification and toxin profiling of C. jejuni. The genes targeted were rpo B as genus specific, hip O for species; cdt A, cdt B, cdt C encoding respective subunit proteins of CDT with Internal Amplification Control (IAC). To enhance its application as a pre-mixed ready-to-use format, the master mix of developed mPCR was dried by lyophilization and stability was assessed. Thermostabilized reagents showed stability of 1.5 months at room-temperature and upto six months at 4 °C without any loss of functionality. The assay was evaluated on a number of presumptive Campylobacter isolates along with biochemical tests. Results obtained indicated the accurate identification of C. jejuni by developed mPCR format in contrast to misconception associated with biochemical assays. The assay was also tested on spiked samples for its real-time utility. Altogether, the room-temperature storable and ready-to- use mPCR format developed in this study could be preferred for rapid detection and confirmed identification of toxigenic strains of C. jejuni in place of conventional biochemical assays. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  5. PCR-RFLP identification of prohibited animal derived DNA in animal feed.

    Science.gov (United States)

    Shinoda, Naoki; Hashimoto, Yoshiyasu; Takagi, Masami; Kojima, Fumio; Onodera, Takashi; Sugiura, Katsuaki

    2011-01-01

    A method for confirming identification of prohibited species tissue in animal feed has been developed on the basis of PCR-RFLP analysis. In Japan, to prevent the spread of BSE through animal feed, the use of animal protein in feed has been regulated. Species-specific PCR detection of prohibited species materials in feed has been used as one of a series of laboratory tests to ensure the proper implementation of the feed regulations. However, since the result of this PCR method is determined only by amplicon length, it is sometimes necessary to confirm whether or not the positive result is due to the effect of a non-specific reaction. For this purpose, DNA sequencing is the best way to confirm the test result but it is not suitable for routine analysis because of the required time and cost. In this study, we developed an easy and rapid method to confirm the species identification (mammals, ruminants and cattle) by using 4 restriction enzymes: SmlI, MboI, BlnI and Hpy188III. This PCR-RFLP method, which ensures identification of prohibited animal species in feed, is useful for enhancing the reliability of feed inspection for BSE prevention. This method will be added to the Official Methods of Feed Analysis.

  6. Rapid method for identification of transgenic fish zygosity

    Directory of Open Access Journals (Sweden)

    . Alimuddin

    2007-07-01

    Full Text Available Identification of zygosity in transgenik fish is normally achieved by PCR analysis with genomic DNA template extracted from the tissue of progenies which are derived by mating the transgenic fish and wild-type counterpart.  This method needs relatively large amounts of fish material and is time- and labor-intensive. New approaches addressing this problem could be of great help for fish biotechnologists.  In this experiment, we applied a quantitative real-time PCR (qr-PCR method to analyze zygosity in a stable line of transgenic zebrafish (Danio rerio carrying masu salmon, Oncorhynchus masou D6-desaturase-like gene. The qr-PCR was performed using iQ SYBR Green Supermix in the iCycler iQ Real-time PCR Detection System (Bio-Rad Laboratories, USA.  Data were analyzed using the comparative cycle threshold method.  The results demonstrated a clear-cut identification of all transgenic fish (n=20 classified as a homozygous or heterozygous.  Mating of those fish with wild-type had revealed transgene transmission to the offspring following expected Mendelian laws. Thus, we found that the qTR-PCR to be effective for a rapid and precise determination of zygosity in transgenic fish. This technique could be useful in the establishment of breeding programs for mass transgenic fish production and in experiments in which zygosity effect could have a functional impact. Keywords: quantitative real-time PCR; zygosity; transgenic fish; mass production   ABSTRAK Identifikasi sigositas ikan transgenik biasanya dilakukan menggunakan analisa PCR dengan cetakan DNA genomik yang diekstraksi dari jaringan ikan hasil persilangan antara ikan transgenik dan ikan normal.   Metode ini memerlukan ikan dalam jumlah yang banyak, dan juga waktu serta tenaga.  Pendekatan baru untuk mengatasi masalah tersebut akan memberikan manfaat besar kepada peneliti bioteknologi perikanan.  Pada penelitian ini, kami menggunakan metode PCR real-time kuantitatif (krt-PCR untuk

  7. Identification of campylobacteria isolated from Danish broilers by phenotypic tests and species-specific PCR assays

    DEFF Research Database (Denmark)

    Wainø, M; Bang, Dan; Lund, Marianne

    2003-01-01

    To validate a phenotypic Campylobacter species identification method employed to identify campylobacters in broilers by comparison with campylobacterial species identification using various species-specific PCR analyses.......To validate a phenotypic Campylobacter species identification method employed to identify campylobacters in broilers by comparison with campylobacterial species identification using various species-specific PCR analyses....

  8. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples.

    Science.gov (United States)

    Leach, L; Zhu, Y; Chaturvedi, S

    2018-02-01

    Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.

  9. A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.

    Science.gov (United States)

    Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2018-01-24

    Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of

  10. Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Science.gov (United States)

    2011-01-01

    Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

  11. Identification of six Listeria species by real-time PCR assay.

    Science.gov (United States)

    Hage, E; Mpamugo, O; Ohai, C; Sapkota, S; Swift, C; Wooldridge, D; Amar, C F L

    2014-06-01

    The Listeria genus comprises 10 recognized species. Listeria monocytogenes causes listeriosis in humans and other animals primarily via contaminated food or animal feed. Listeria ivanovii causes listeriosis in animals and on rare occasions in humans. The identification of nonpathogenic species of Listeria in foods indicates that conditions exist that support the growth of pathogenic strains and is used to facilitate the implementation of control and prevention measures. This study shows the development and evaluation of a 5'exonuclease real-time PCR assay for the rapid identification of Listeria seeligeri, Listeria welshimeri, L. monocytogenes, L. ivanovii, Listeria grayi and Listeria innocua. The assay consists of two triplexes that were evaluated using 53 cultures of Gram-positive bacteria, including 49 Listeria spp. from human, animal, food or food-processing environments. The assay was rapid, specific and reproducible and could identify each of the six species from a mixture of strains. The developed assay proved to be a powerful means of rapidly identifying Listeria species and could be usefully implemented in busy specialist reference laboratories. The identification of species of Listeria from foods is important to monitor pathogenic strains and facilitates the implementation of control measures. This study shows the development and evaluation of a 5'exonuclease real-time PCR assay for the rapid identification of L. seeligeri, L. welshimeri, L. monocytogenes and L. ivanovii, L. grayi, L. innocua. The developed assay proved to be specific, rapid and reproducible and therefore could be implemented in busy specialist reference laboratories. © 2014 The Society for Applied Microbiology.

  12. Identification of Staphylococcus spp. by PCR-restriction fragment length polymorphism analysis of dnaJ gene.

    Science.gov (United States)

    Hauschild, Tomasz; Stepanovic, Srdjan

    2008-12-01

    A PCR-restriction fragment length polymorphism (RFLP) analysis method that analyzes a part of the dnaJ gene was designed for the rapid and accurate identification of Staphylococcus spp. XapI or Bsp143I digestion of the PCR-generated products rendered distinctive RFLP patterns that allowed 41 reference species and subspecies to be identified with a high degree of specificity. The novel method was validated by the identification of 23 clinical staphylococcal strains, and the results were compared with those obtained by other genotypic identification methods. A 100% concordance of the results was shown. Therefore, PCR-RFLP analysis of the dnaJ gene is proposed as a reliable and reproducible method for the identification of Staphylococcus spp.

  13. Application of Reverse Transcriptase -PCR (RT-PCR) for rapid detection of viable Escherichia coli in drinking water samples.

    Science.gov (United States)

    Molaee, Neda; Abtahi, Hamid; Ghannadzadeh, Mohammad Javad; Karimi, Masoude; Ghaznavi-Rad, Ehsanollah

    2015-01-01

    Polymerase chain reaction (PCR) is preferred to other methods for detecting Escherichia coli (E. coli) in water in terms of speed, accuracy and efficiency. False positive result is considered as the major disadvantages of PCR. For this reason, reverse transcriptase-polymerase chain reaction (RT-PCR) can be used to solve this problem. The aim of present study was to determine the efficiency of RT-PCR for rapid detection of viable Escherichia coli in drinking water samples and enhance its sensitivity through application of different filter membranes. Specific primers were designed for 16S rRNA and elongation Factor II genes. Different concentrations of bacteria were passed through FHLP and HAWP filters. Then, RT-PCR was performed using 16srRNA and EF -Tu primers. Contamination of 10 wells was determined by RT-PCR in Arak city. To evaluate RT-PCR efficiency, the results were compared with most probable number (MPN) method. RT-PCR is able to detect bacteria in different concentrations. Application of EF II primers reduced false positive results compared to 16S rRNA primers. The FHLP hydrophobic filters have higher ability to absorb bacteria compared with HAWB hydrophilic filters. So the use of hydrophobic filters will increase the sensitivity of RT-PCR. RT-PCR shows a higher sensitivity compared to conventional water contamination detection method. Unlike PCR, RT-PCR does not lead to false positive results. The use of EF-Tu primers can reduce the incidence of false positive results. Furthermore, hydrophobic filters have a higher ability to absorb bacteria compared to hydrophilic filters.

  14. Universal Probe Library based real-time PCR for rapid detection of bacterial pathogens from positive blood culture bottles.

    Science.gov (United States)

    Zhu, Lingxiang; Shen, Ding-Xia; Zhou, Qiming; Liu, Chao-Jun; Li, Zexia; Fang, Xiangdong; Li, Quan-Zhen

    2014-03-01

    A set of real-time PCR based assays using the locked nucleic acid probes from Roche Universal ProbeLibrary were developed for rapid detection of eight bacterial species from positive blood culture bottles. Four duplex real-time PCR reactions targeting to one Gram-positive bacterium and one Gram-negative bacterium were optimized for species identification according to Gram stain results. We also included mecA-specific primers and probes in the assays to indicate the presence of methicillin resistance in the bacterial species. The analytical sensitivity was in the range of 1-10 CFU per PCR reaction mixture. The specificity and cross reactivity of the assay was validated by 28 ATCC reference strains and 77 negative blood culture specimens. No cross-reactivity was observed in these samples thus demonstrating 100 % specificity. 72 previously characterized clinical isolates were tested by the real-time PCR assay and validated the accuracy and feasibility of the real-time PCR assay. Furthermore, 55 positive blood culture samples were tested using real-time PCR and 50 (90.9 %) of them were identified as the same species as judged by biochemical analysis. In total, real-time PCR showed 98.2 % consistent to that of traditional methods. Real-time PCR can be used as a supplement for early detection of the frequently-occurred pathogens from the positive blood cultures.

  15. Identification of Candida spp. by phenotypic tests and PCR

    Directory of Open Access Journals (Sweden)

    Sandra Aparecida Marinho

    2010-06-01

    Full Text Available The correct identification of Candida species is of great importance, as it presents prognostic and therapeutical significance, allowing an early and appropriate antifungical therapy. The purpose of this study was to identify isolates of Candida spp. from oral mucosa of 38 patients with oral candidosis evaluated in 2004 by phenotypic methods and PCR, discriminating C. albicans from the other Candida species. The tests used for phenotypic analysis were germ-tube and chlamydoconidia production, culture in CHROMAgarTM Candida, carbohydrate assimilation test, growth at 45ºC and culture in Tween 80 agar. Genotypic confirmation was performed by PCR. Phenotypic tests showed that 63.2% strains formed germ-tubes, 73.7% produced chlamydoconidia, and 63.2% showed green colonies in chromogenic medium, presumptively indicating C. albicans or C. dubliniensis. The carbohydrate assimilation test confirmed these results. A total of 21% strains were identified as C. krusei and 13.2% were indicative of C. tropicalis. Of these later strains, three produced chlamydoconidia. The association of other phenotypic tests with culture in Tween 80 agar identified 95.8% of strains as C. albicans and 4.2% as C. dubliniensis. All 24 strains indicative of C. albicans and C. dubliniensis were confirmed by PCR as C. albicans.

  16. Identification of five sea cucumber species through PCR-RFLP analysis

    Science.gov (United States)

    Lv, Yingchun; Zheng, Rong; Zuo, Tao; Wang, Yuming; Li, Zhaojie; Xue, Yong; Xue, Changhu; Tang, Qingjuan

    2014-10-01

    Sea cucumbers are traditional marine food and Chinese medicine in Asia. The rapid expansion of sea cucumber market has resulted in various problems, such as commercial fraud and mislabeling. Conventionally, sea cucumber species could be distinguished by their morphological and anatomical characteristics; however, their identification becomes difficult when they are processed. The aim of this study was to develop a new convenient method of identifying and distinguishing sea cucumber species. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of mitochondrial cytochrome oxidase I gene ( COI) was used to identifing five sea cucumber species ( Apostichopus japonicus, Cucumaria frondosa, Thelenota ananas, Parastichopus californicus and Actinopyga lecanora). A 692 bp fragment of COI was searched for BamHI, KpnI, PstI, XbaI and Eco31I restriction sites with DNAMAN 6.0, which were then used to PCR-RFLP analysis. These five sea cucumber species can be discriminated from mixed sea cucumbers. The developed PCR-RFLP assay will facilitate the identification of sea cucumbers, making their source tracing and quality controlling feasible.

  17. Identification and differentiation of Trichophyton rubrum clinical isolates using PCR-RFLP and RAPD methods.

    Science.gov (United States)

    Hryncewicz-Gwóźdź, A; Jagielski, T; Dobrowolska, A; Szepietowski, J C; Baran, E

    2011-06-01

    Trichophyton rubrum represents the most frequently isolated causative agent of superficial dermatophyte infections. Several genotyping methods have recently been introduced to improve the delineation between pathogenic fungi at both the species and the strain levels. The purpose of this study was to apply selected DNA fingerprinting methods to the identification and strain discrimination of T. rubrum clinical isolates. Fifty-seven isolates from as many tinea patients were subjected to species identification by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) analysis and strain differentiation using a randomly amplified polymorphic DNA (RAPD) method, with two primers designated 1 and 6. Using PCR-RFLP, 55 of the isolates studied were confirmed to be T. rubrum. Among those, a total of 40 and five distinct profiles were obtained by RAPD with primers 1 and 6, respectively. The combination of profiles from both RAPD assays resulted in 47 genotypes and an overall genotypic diversity rate of 85.4%. A dendrogram analysis performed on the profiles generated by RAPD with primer 1 showed most of the isolates (87.3%) to be genetically related. PCR-RFLP serves as a rapid and reliable method for the identification of T. rubrum species, while the RAPD analysis is rather a disadvantageous tool for T. rubrum strain typing.

  18. Identification of infectious agents in onychomycoses by PCR-terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Verrier, Julie; Pronina, Marina; Peter, Corinne; Bontems, Olympia; Fratti, Marina; Salamin, Karine; Schürch, Stéphanie; Gindro, Katia; Wolfender, Jean-Luc; Harshman, Keith; Monod, Michel

    2012-03-01

    A fast and reliable assay for the identification of dermatophyte fungi and nondermatophyte fungi (NDF) in onychomycosis is essential, since NDF are especially difficult to cure using standard treatment. Diagnosis is usually based on both direct microscopic examination of nail scrapings and macroscopic and microscopic identification of the infectious fungus in culture assays. In the last decade, PCR assays have been developed for the direct detection of fungi in nail samples. In this study, we describe a PCR-terminal restriction fragment length polymorphism (TRFLP) assay to directly and routinely identify the infecting fungi in nails. Fungal DNA was easily extracted using a commercial kit after dissolving nail fragments in an Na(2)S solution. Trichophyton spp., as well as 12 NDF, could be unambiguously identified by the specific restriction fragment size of 5'-end-labeled amplified 28S DNA. This assay enables the distinction of different fungal infectious agents and their identification in mixed infections. Infectious agents could be identified in 74% (162/219) of cases in which the culture results were negative. The PCR-TRFLP assay described here is simple and reliable. Furthermore, it has the possibility to be automated and thus routinely applied to the rapid diagnosis of a large number of clinical specimens in dermatology laboratories.

  19. Novel Multitarget Real-Time PCR Assay for Rapid Detection of Bordetella Species in Clinical Specimens ▿

    Science.gov (United States)

    Tatti, Kathleen M.; Sparks, Kansas N.; Boney, Kathryn O.; Tondella, Maria Lucia

    2011-01-01

    A novel multitarget real-time PCR (RT-PCR) assay for the rapid identification of Bordetella pertussis, B. parapertussis, and B. holmesii was developed using multicopy insertion sequences (ISs) in combination with the pertussis toxin subunit S1 (ptxS1) singleplex assay. The RT-PCR targets for the multiplex assay include IS481, commonly found in B. pertussis and B. holmesii; IS1001 of B. parapertussis; and the IS1001-like sequence of B. holmesii. Overall, 402 Bordetella species and 66 non-Bordetella species isolates were tested in the multitarget assay. Cross-reactivity was found only with 5 B. bronchiseptica isolates, which were positive with IS1001 of B. parapertussis. The lower limit of detection (LLOD) of the multiplex assay was similar to the LLOD of each target in an individual assay format, which was approximately 1 genomic equivalent per reaction for all targets. A total of 197 human clinical specimens obtained during cough-illness outbreak investigations were used to evaluate the multitarget RT-PCR assay. The multiplex assay results from 87 clinical specimens were compared to the individual RT-PCR assay and culture results. The multitarget assay is useful as a diagnostic tool to confirm B. pertussis infections and to rapidly identify other Bordetella species. In conclusion, the use of this multitarget RT-PCR approach increases specificity, while it decreases the amount of time, reagents, and specimen necessary for RT-PCRs used for accurate diagnosis of pertussis-like illness. PMID:21940464

  20. Candida albicans identification: comparison among nine phenotypic systems and a multiplex PCR.

    Science.gov (United States)

    Liguori, G; Di Onofrio, V; Gallé, F; Lucariello, A; Albano, L; Catania, M R; Guida, M

    2010-09-01

    Candida albicans is the most common fungal pathogen isolated from clinical samples and is also the most common yeast species carried as a commensal by healthy individuals although some non-C. albicans species account for an important number of infections. To compare nine phenotypic systems for C. albicans identification [API 20C AUX; RapID Yeast Identification panel (RYIP); Vitek2 ID-YST system; chromogenic media, CHRO-Magar, Oxoid Chromogenic Candida Agar (OCCA), Candida ID2, Candida Identification Agar, CandiSelect 4, and Chromalbicans Agar] with multiplex PCR. A collection of 390 yeast strains was obtained by routine isolation from oral and vaginal swabs. All of the yeasts isolated were tested for germ tube formation, and then submitted to a multiplex PCR protocol tested in previous studies, and to nine phenotypical commercial methods, together with the reference ATCC strains. Comparison was limited to the ability of the tests to identify C. albicans. 253 isolates were provisionally identified as C. albicans by germ tube, and their identities were further confirmed with the multiplex PCR. Sensitivity of phenotypical systems ranged from 81.9% (Vitek2) to 87.7% (Candida ID2 e CHROMagar). For specificity, the highest value was 96.8% for Candida ID2, and the lowest value (75.1%) was for Chromalbicans Agar. Although with differences in discriminatory power, the methods tested showed overall acceptable levels of sensitivity and specificity respect to the multiplex PCR; therefore, all could be useful for C. albicans identification where molecular differentiation is not available.

  1. Identification and Quantification of Celery Allergens Using Fiber Optic Surface Plasmon Resonance PCR

    Directory of Open Access Journals (Sweden)

    Devin Daems

    2017-07-01

    Full Text Available Abstract: Accurate identification and quantification of allergens is key in healthcare, biotechnology and food quality and safety. Celery (Apium graveolens is one of the most important elicitors of food allergic reactions in Europe. Currently, the golden standards to identify, quantify and discriminate celery in a biological sample are immunoassays and two-step molecular detection assays in which quantitative PCR (qPCR is followed by a high-resolution melting analysis (HRM. In order to provide a DNA-based, rapid and simple detection method suitable for one-step quantification, a fiber optic PCR melting assay (FO-PCR-MA was developed to determine different concentrations of celery DNA (1 pM–0.1 fM. The presented method is based on the hybridization and melting of DNA-coated gold nanoparticles to the FO sensor surface in the presence of the target gene (mannitol dehydrogenase, Mtd. The concept was not only able to reveal the presence of celery DNA, but also allowed for the cycle-to-cycle quantification of the target sequence through melting analysis. Furthermore, the developed bioassay was benchmarked against qPCR followed by HRM, showing excellent agreement (R2 = 0.96. In conclusion, this innovative and sensitive diagnostic test could further improve food quality control and thus have a large impact on allergen induced healthcare problems.

  2. Multilevel D-loop PCR identification of hunting game

    Directory of Open Access Journals (Sweden)

    V. Parkanyi

    2014-03-01

    Full Text Available The control region of mtDNA (D-loop was used for hair samples of the five hunting game species identification: red deer (Cervus elaphus, roe deer (Capreolus capreolus, fallow deer (Dama dama, mouflon (Ovis aries musimon, and wild boar (Sus scrofa. For D-loop multilevel PCR detection scheme was applied in six primers (CE CVZV 1 = 5′-GATCACGAGCTTGATCACCA-3′; CE CVZV 2 = 5′-AGGAGTGGGCGATTTTAGGT-3′; DD CVZV 3 = 5′-CGCGTGAAACCAACAACCCGC-3′; DD CVZV 4 = 5′-CCGGGTCGGGGCCTTAGACG-3′; SSW CVZV 5 = 5′-ACACGTGCGTACACGCGCATA-3′; SSW CVZV 6 = 5′-GGTGCCTGCT T TCGTAGCACG-3′ designed to identify unknown biological samples of the hunting game animals. The PCR reaction volume was 25 μl at conditions 95 °C for 2 min, 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, 35 cycles, with last extension at 72 °C for 10 min. D-loop mtDNA amplicons of the game animals are characterized with specific PCR product sizes depending on species: red deer = 163 bp and 140 bp, fallow deer = 280 bp and 138 bp, roe deer = 303 bp, 280 bp, 160 bp and 138 bp, mouflon = 299 bp and 178 bp, wild boar = 137 bp and 229 bp.

  3. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. PCR-based rapid genotyping of Stenotrophomonas maltophilia isolates

    Directory of Open Access Journals (Sweden)

    Zarrilli Raffaele

    2008-11-01

    Full Text Available Abstract Background All bacterial genomes contain repetitive sequences which are members of specific DNA families. Such repeats may occur as single units, or found clustered in multiple copies in a head-to-tail configuration at specific loci. The number of clustered units per locus is a strain-defining parameter. Assessing the length variability of clusters of repeats is a versatile typing methodology known as multilocus variable number of tandem repeat analysis (MLVA. Results Stenotrophomonas maltophilia is an environmental bacterium increasingly involved in nosocomial infections and resistant to most antibiotics. The availability of the whole DNA sequence of the S. maltophilia strain K279a allowed us to set up fast and accurate PCR-based diagnostic protocols based on the measurement of length variations of loci carrying a variable number of short palindromic repeats marking the S. maltophilia genome. On the basis of the amplimers size, it was possible to deduce the number of repeats present at 12 different loci in a collection of S. maltophilia isolates, and therefore label each of them with a digit. PCR-negative regions were labelled 0. Co-amplification of two pairs of loci provided a 4-digit code sufficient for immediate subtyping. By increasing the number of loci analyzed, it should be possible to assign a more specific digit profile to isolates. In general, MLVA data match genotyping data obtained by PFGE (pulsed-field gel electrophoresis. However, some isolates exhibiting the same PCR profiles at all loci display distinct PFGE patterns. Conclusion The utilization of the present protocol allows to type several S. maltophilia isolates in hours. The results are immediately interpretable without the need for sophisticated softwares. The data can be easily reproducible, and compared among different laboratories.

  5. Real-Time PCR Assay for the Identification of the Brown Marmorated Stink Bug (Halyomorpha halys

    Directory of Open Access Journals (Sweden)

    Manpreet K Dhami

    2016-02-01

    Full Text Available The brown marmorated stink bug, Halyomorpha halys (Hemiptera: Pentatomidae, is a gregarious crop pest that has rapidly spread across the world in the last two decades. It is an excellent hitchhiker species, especially as an over-wintering adult. During this period it is often associated with non-biological commodities such as shipping containers and machinery that travel long distances. Inadequate identification keys and similarity to common species has assisted its spread across Europe, while accurate identification from immature stages or eggs is not possible. We developed a real-time TaqMan PCR assay for the accurate and sensitive detection of the brown marmorated stink bug from all life stages. The assay performance against required diagnostic criterion and within a quarantine framework are described.

  6. Real-Time PCR Assay for the Identification of the Brown Marmorated Stink Bug (Halyomorpha halys).

    Science.gov (United States)

    Dhami, Manpreet K; Dsouza, Melissa; Waite, David W; Anderson, Diane; Li, Dongmei

    2016-01-01

    The brown marmorated stink bug, Halyomorpha halys (Hemiptera: Pentatomidae), is a gregarious crop pest that has rapidly spread across the world in the last two decades. It is an excellent hitchhiker species, especially as an over-wintering adult. During this period it is often associated with non-biological commodities such as shipping containers and machinery that travel long distances. Inadequate identification keys and similarity to common species has assisted its spread across Europe, while accurate identification from immature stages or eggs is not possible. We developed a real-time TaqMan PCR assay for the accurate and sensitive detection of the brown marmorated stink bug from all life stages. The assay performance against required diagnostic criterion and within a quarantine framework are described.

  7. Multiplex real-time PCR assay for rapid detection of methicillin-resistant staphylococci directly from positive blood cultures.

    Science.gov (United States)

    Wang, Hye-Young; Kim, Sunghyun; Kim, Jungho; Park, Soon-Deok; Uh, Young; Lee, Hyeyoung

    2014-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is the most prevalent cause of bloodstream infections (BSIs) and is recognized as a major nosocomial pathogen. This study aimed to evaluate a newly designed multiplex real-time PCR assay capable of the simultaneous detection of mecA, S. aureus, and coagulase-negative staphylococci (CoNS) in blood culture specimens. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays (M&D, Republic of Korea) use the TaqMan probes 16S rRNA for Staphylococcus spp., the nuc gene for S. aureus, and the mecA gene for methicillin resistance. The detection limit of the multiplex real-time PCR assay was 10(3) CFU/ml per PCR for each gene target. The multiplex real-time PCR assay was evaluated using 118 clinical isolates from various specimen types and a total of 350 positive blood cultures from a continuous monitoring blood culture system. The results obtained with the multiplex real-time PCR assay for the three targets were in agreement with those of conventional identification and susceptibility testing methods except for one organism. Of 350 positive bottle cultures, the sensitivities of the multiplex real-time PCR kit were 100% (166/166 cultures), 97.2% (35/36 cultures), and 99.2% (117/118 cultures) for the 16S rRNA, nuc, and mecA genes, respectively, and the specificities for all three targets were 100%. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays are very useful for the rapid accurate diagnosis of staphylococcal BSIs. In addition, the Real-MRSA and Real-MRCoNS multiplex real-time PCR assays could have an important impact on the choice of appropriate antimicrobial therapy, based on detection of the mecA gene. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  8. Multiplex Real-Time PCR Assay for Rapid Detection of Methicillin-Resistant Staphylococci Directly from Positive Blood Cultures

    Science.gov (United States)

    Wang, Hye-young; Kim, Sunghyun; Kim, Jungho; Park, Soon-Deok

    2014-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is the most prevalent cause of bloodstream infections (BSIs) and is recognized as a major nosocomial pathogen. This study aimed to evaluate a newly designed multiplex real-time PCR assay capable of the simultaneous detection of mecA, S. aureus, and coagulase-negative staphylococci (CoNS) in blood culture specimens. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays (M&D, Republic of Korea) use the TaqMan probes 16S rRNA for Staphylococcus spp., the nuc gene for S. aureus, and the mecA gene for methicillin resistance. The detection limit of the multiplex real-time PCR assay was 103 CFU/ml per PCR for each gene target. The multiplex real-time PCR assay was evaluated using 118 clinical isolates from various specimen types and a total of 350 positive blood cultures from a continuous monitoring blood culture system. The results obtained with the multiplex real-time PCR assay for the three targets were in agreement with those of conventional identification and susceptibility testing methods except for one organism. Of 350 positive bottle cultures, the sensitivities of the multiplex real-time PCR kit were 100% (166/166 cultures), 97.2% (35/36 cultures), and 99.2% (117/118 cultures) for the 16S rRNA, nuc, and mecA genes, respectively, and the specificities for all three targets were 100%. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays are very useful for the rapid accurate diagnosis of staphylococcal BSIs. In addition, the Real-MRSA and Real-MRCoNS multiplex real-time PCR assays could have an important impact on the choice of appropriate antimicrobial therapy, based on detection of the mecA gene. PMID:24648566

  9. Molecular Identification of Helicoverpa armigera (Lepidoptera: Noctuidae: Heliothinae) in Argentina and Development of a Novel PCR-RFLP Method for its Rapid Differentiation From H. zea and H. gelotopoeon.

    Science.gov (United States)

    Arneodo, Joel D; Balbi, Emilia I; Flores, Fernando M; Sciocco-Cap, Alicia

    2015-12-01

    Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae: Heliothinae) is among the most voracious global pests of agriculture. Adults of this species were identified recently in northern Argentina by dissection of male genitalia. In this work, a rapid and simple molecular tool was designed to distinguish H. armigera from the morphologically similar indigenous bollworms Helicoverpa zea (Boddie) and Helicoverpa gelotopoeon (Dyar), regardless of the life stage. Amplification of partial COI gene with a new primer pair, and subsequent digestion with endonuclease HinfI, yielded different RFLP profiles for the three main Helicoverpa pests currently present in South America. The method was validated in Helicoverpa specimens collected across Argentina, whose identity was further corroborated by COI sequencing and phylogenetic analysis. The data reported here constitute the first molecular confirmation of this pest in the country. The survey revealed the occurrence of H. armigera in northern and central Argentina, including the main soybean- and maize-producing area. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  11. Identification and quantification of ice nucleation active microorganisms by digital droplet PCR (ddPCR)

    Science.gov (United States)

    Linden, Martin; Pöschl, Ulrich; Fröhlich-Nowoisky, Janine

    2015-04-01

    Several bioaerosol types, including bacteria, fungi, pollen and lichen, have been identified as sources of biological ice nucleators (IN) which induce ice formation already at temperatures as high as -10 °C or above. Accordingly, they potentially contribute widely to environmental ice nucleation in the atmosphere and are of great interest in the study of natural heterogenous ice nucleation processes. Ice nucleation active microorganisms have been found and studied among bacteria (Proteobacteria) and fungi (phyla Basidiomycota and Ascomycota). The mechanisms enabling the microorganisms to ice nucleation are subject to ongoing research. While it has been demonstrated that whole cells can act as ice nucleators in the case of bacteria due to the presence of specific membrane proteins, cell-free ice nucleation active particles seem to be responsible for this phenomenon in fungi and lichen. The identification and quantification of these ice nucleation active microorganisms and their IN in atmospheric samples is crucial to understand their contribution to the pool of atmospheric IN. This is not a trivial task since the respective microorganisms are often prevalent in lowest concentrations and a variety of states, be it viable cells, spores or cell debris from dead cells. Molecular biology provides tools to identify and quantify ice nucleation active microorganisms independent of their state by detecting genetic markers specific for the organism of interest. Those methods are not without their drawbacks in terms of sample material concentration required or reliable standardization. Digital Droplet Polymerase Chain Reaction (ddPCR) was chosen for our demands as a more elegant, quick and specific method in the investigation of ice nucleation active microorganisms in atmospheric samples. The advantages of ddPCR lie in the simultaneous detection and quantification of genetic markers and their original copy numbers in a sample. This is facilitated by the fractionation of the

  12. Rapid detection and ruling out of neonatal sepsis by PCR coupled with Electrospray Ionization Mass Spectrometry (PCR/ESI-MS).

    Science.gov (United States)

    Delcò, Cristina; Karam, Oliver; Pfister, Riccardo; Gervaix, Alain; Renzi, Gesuele; Emonet, Stéphane; Schrenzel, Jacques; Posfay-Barbe, Klara M

    2017-05-01

    Sepsis is an important cause of morbidity and mortality in neonates and clinicians are typically required to administer empiric antibiotics while waiting for blood culture results. However, prolonged and inappropriate use of antibiotics is associated with various complications and adverse events. Better tools to rapidly rule out bacterial infections are therefore needed. We aimed to assess the negative predictive value of PCR coupled with Electrospray Ionization Mass Spectrometry (PCR/ESI-MS) compared to conventional blood cultures in neonatal sepsis. Prospective observational study. All consecutive neonates (PCR/ESI-MS analysis were collected at the same time as samples for the blood culture, before the initiation of antibiotics. Our primary objective was to evaluate the negative predictive value of PCR/ESI-MS for the detection of bacteria in the bloodstream of newborns with suspected sepsis. Our secondary objective was the evaluation of the sensitivity, specificity and positive predictive value of the PCR/ESI-MS in such a neonatal population. We analysed 114 samples over 14months. The median age and weight were 32weeks+3days and 1840g, respectively. Two patients had negative PCR/ESI-MS results, but positive blood cultures. Overall, the negative predictive value was 98% (95%CI: 92% to 100%). Based on these results, PCR/ESI-MS analysis of blood samples of neonates with suspected sepsis appears to have a very good negative predictive value when compared to blood cultures as gold standard. This novel test might allow for early reassessment of the need for antibiotics. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. [Evaluation of the efficacies of rapid antigen test, multiplex PCR, and real-time PCR for the detection of a novel influenza A (H1N1) virus].

    Science.gov (United States)

    Hwang, Yusun; Kim, Kyounghee; Lee, Miae

    2010-04-01

    In April 2009, a novel influenza A (H1N1) virus was detected in the US, and at the time of conducting this study, H1N1 infection had reached pandemic proportions. In Korea, rapid antigen tests and PCR assays have been developed to detect the H1N1 virus. We evaluated the efficacies of rapid antigen test, multiplex PCR, and real-time PCR for detecting the H1N1 virus. From August to September 2009, we tested 734 samples obtained from nasopharyngeal swab or nasal swab using rapid antigen test (SD Influenza Antigen, Standard Diagnostics, Inc., Korea) and multiplex PCR (Seeplex FluA ACE Subtyping, Seegene, Korea). We also tested 224 samples using the AdvanSure real-time PCR (LG Life Sciences, Korea) to compare the results obtained using real-time PCR with those obtained using multiplex PCR. Furthermore, 99 samples were tested using the AdvanSure real-time PCR and the AccuPower real-time PCR (Bioneer, Korea). In comparison with the results of multiplex PCR, the sensitivity and specificity of the rapid antigen test were 48.0% and 99.8%, respectively. The concordance rate for multiplex PCR and the AdvanSure real-time PCR was 99.6% (kappa=0.991, P=0.000), and that for the AdvanSure real-time PCR and the AccuPower real-time PCR was 97.0% (kappa=0.936, P=0.000). The rapid antigen test is significantly less sensitive than PCR assay; therefore, it is not useful for H1N1 detection; however multiplex PCR, the AdvanSure real-time PCR, and the Accu-Power real-time PCR can be useful for H1N1 detection.

  14. Species identification of Cannabis sativa using real-time quantitative PCR (qPCR).

    Science.gov (United States)

    Johnson, Christopher E; Premasuthan, Amritha; Satkoski Trask, Jessica; Kanthaswamy, Sree

    2013-03-01

    Most narcotics-related cases in the United States involve Cannabis sativa. Material is typically identified based on the cystolithic hairs on the leaves and with chemical tests to identify of the presence of cannabinoids. Suspect seeds are germinated into a viable plant so that morphological and chemical tests can be conducted. Seed germination, however, causes undue analytical delays. DNA analyses that involve the chloroplast and nuclear genomes have been developed for identification of C. sativa materials, but they require several nanograms of template DNA. Using the trnL 3' exon-trnF intragenic spacer regions within the C. sativa chloroplast, we have developed a real-time quantitative PCR assay that is capable of identifying picogram amounts of chloroplast DNA for species determination of suspected C. sativa material. This assay provides forensic science laboratories with a quick and reliable method to identify an unknown sample as C. sativa. © 2013 American Academy of Forensic Sciences.

  15. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  16. Rapid identification of mycobacteria and rapid detection of drug resistance in Mycobacterium tuberculosis in cultured isolates and in respiratory specimens.

    Science.gov (United States)

    Yam, Wing-Cheong; Siu, Kit-Hang Gilman

    2013-01-01

    Recent advances in molecular biology and better understanding of the genetic basis of drug resistance have allowed rapid identification of mycobacteria and rapid detection of drug resistance of Mycobacterium tuberculosis present in cultured isolates or in respiratory specimens. In this chapter, several simple nucleic acid amplification-based techniques are introduced as molecular approach for clinical diagnosis of tuberculosis. A one-tube nested IS6110-based polymerase chain reaction (PCR) is used for M. tuberculosis complex identification; the use of a multiplex allele-specific PCR is demonstrated to detect the isoniazid resistance; PCR-sequencing assays are applied for rifampicin and ofloxacin resistance detection and 16S rDNA sequencing is utilized for identification of mycobacterial species from cultures of acid fast bacilli (AFB). Despite the high specificity and sensitivity of the molecular techniques, mycobacterial culture remains the "Gold Standard" for tuberculosis diagnosis. Negative results of molecular tests never preclude the infection or the presence of drug resistance. These technological advancements are, therefore, not intended to replace the conventional tests, but rather have major complementary roles in tuberculosis diagnosis.

  17. A rapid, one step molecular identification of Trichoderma citrinoviride and Trichoderma reesei.

    Science.gov (United States)

    Saroj, Dina B; Dengeti, Shrinivas N; Aher, Supriya; Gupta, Anil K

    2015-06-01

    Trichoderma species are widely used as production hosts for industrial enzymes. Identification of Trichoderma species requires a complex molecular biology based identification involving amplification and sequencing of multiple genes. Industrial laboratories are required to run identification tests repeatedly in cell banking procedures and also to prove absence of production host in the product. Such demands can be fulfilled by a brief method which enables confirmation of strain identity. This communication describes one step identification method for two common Trichoderma species; T. citrinoviride and T. reesei, based on identification of polymorphic region in the nucleotide sequence of translation elongation factor 1 alpha. A unique forward primer and common reverse primer resulted in 153 and 139 bp amplicon for T. citrinoviride and T. reesei, respectively. Simplification was further introduced by using mycelium as template for PCR amplification. Method described in this communication allows rapid, one step identification of two Trichoderma species.

  18. Gold Nanorod-based Photo-PCR System for One-Step, Rapid Detection of Bacteria.

    Science.gov (United States)

    Kim, Jinjoo; Kim, Hansol; Park, Ji Ho; Jon, Sangyong

    2017-01-01

    The polymerase chain reaction (PCR) has been an essential tool for diagnosis of infectious diseases, but conventional PCR still has some limitations with respect to applications to point-of-care (POC) diagnostic systems that require rapid detection and miniaturization. Here we report a light-based PCR method, termed as photo-PCR, which enables rapid detection of bacteria in a single step. In the photo-PCR system, poly(enthylene glycol)-modified gold nanorods (PEG-GNRs), used as a heat generator, are added into the PCR mixture, which is subsequently periodically irradiated with a 808-nm laser to create thermal cycling. Photo-PCR was able to significantly reduce overall thermal cycling time by integrating bacterial cell lysis and DNA amplification into a single step. Furthermore, when combined with KAPA2G fast polymerase and cooling system, the entire process of bacterial genomic DNA extraction and amplification was further shortened, highlighting the potential of photo-PCR for use in a portable, POC diagnostic system.

  19. Development of rapid PCR-RFLP technique for identification of ...

    African Journals Online (AJOL)

    Species differentiation was realized by digestion of the amplified ~195 bp fragments with Sse9I restriction enzyme. The results indicate that 7/7 of Kebab loghmeh, 9/10 of minced meat, 4/8 of beef burger and 2/5 samples of canned stew samples, were contaminated with one of prohibited ruminant species residual.

  20. MOLD SPECIFIC QUANTITATIVE PCR FOR RAPID IDENTIFICATION AND ENUMERATION

    Science.gov (United States)

    There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...

  1. Molecular diagnosis of Old World leishmaniasis: real-time PCR based on tryparedoxin peroxidase gene for the detection and identification of Leishmania spp.

    Science.gov (United States)

    Khosravi, Sharifeh; Hejazi, Saied Hossein; Hashemzadeh, Mortaza; Eslami, Gilda; Darani, Hossein Yousofi

    2012-03-01

    Rapid and accurate diagnosis and identification of Leishmania sp causing cutaneous leishmaniasis is crucial in control and therapeutic programs. The problem of diagnosis with traditional methods is that they have a low sensitivity or time consuming but molecular techniques would be an alternative method for rapid and accurate diagnosis. In this work, tryparedoxine peroxidase gene-based real-time PCR was used for accurate identification of Leishmania spp causing Old-World cutaneous leishmaniasis. In this study, biopsies of specimens were taken from the ulcerative sites in 100 patients and used for direct microscopy, culture in NNN or fixed in alcohol for identification of Leishmania spp using tryparedoxin peroxidase gene-based realtime PCR (qPCR). Using direct microscopy and culture method, Leishmania parasites were isolated from 68 out of 100 patient samples. However, 13 patients with negative finding on traditional tests, had positive results on RT-PCR test. After melting curve analysis of PCR product, Leishmania major in 75 and L. tropica in 4 cases were identified. The sensitivity and specificity of RT-PCR for diagnosis of cutaneous leishmaniasis was 98.7 and 59.8%, respectively. Results of this study showed that RT-PCR was the most sensitive diagnostic test for cutaneous leishmaniasis and represents a tool for rapid species identification.

  2. Usefulness of capillary electrophoresis-based multiplex PCR assay for species-specific identification of Candida spp.

    Science.gov (United States)

    Mallus, F; Martis, S; Serra, C; Loi, G; Camboni, T; Manzin, A

    2013-02-15

    The study evaluated the performances of a commercial multiplex PCR assay, the Seegene Seeplex STI Master Panel 3, for Candida spp. identification. Eighty clinical strains of Candida spp. were identified with this system and a homemade multiplex PCR assay. The results were also compared with those obtained with two phenotypic methods. The study provided a preliminary evaluation of a multiplex assay from Seegene that uses capillary electrophoresis as the detection of amplified products. The Seeplex assay was found to be a rapid and useful method for identifying large numbers of yeast isolates in the clinical laboratory context. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. PCR strategy for identification and differentiation of small pox and other orthopoxviruses.

    Science.gov (United States)

    Ropp, S L; Jin, Q; Knight, J C; Massung, R F; Esposito, J J

    1995-08-01

    Rapid identification and differentiation of orthopoxviruses by PCR were achieved with primers based on genome sequences encoding the hemagglutinin (HA) protein, an infected-cell membrane antigen that distinguishes orthopoxviruses from other poxvirus genera. The initial identification step used a primer pair of consensus sequences for amplifying an HA DNA fragment from the three known North American orthopoxviruses (raccoonpox, skunkpox, and volepox viruses), and a second pair for amplifying virtually the entire HA open reading frame of the Eurasian-African orthopoxviruses (variola, vaccinia, cowpox, monkeypox, camelpox, ectromelia, and gerbilpox viruses). RsaI digest electropherograms of the amplified DNAs of the former subgroup provided species differentiation, and TaqI digests differentiated the Eurasian-African orthopoxviruses, including vaccinia virus from the vaccinia virus subspecies buffalopox virus. Endonuclease HhaI digest patterns distinguished smallpox variola major viruses from alastrim variola minor viruses. For the Eurasian-African orthopoxviruses, a confirmatory step that used a set of higher-sequence-homology primers was developed to provide sensitivity to discern individual virus HA DNAs from cross-contaminated orthopoxvirus DNA samples; TaqI and HhaI digestions of the individual amplified HA DNAs confirmed virus identity. Finally, a set of primers and modified PCR conditions were developed on the basis of base sequence differences within the HA genes of the 10 species, which enabled production of a single DNA fragment of a particular size that indicated the specific species.

  4. DNA Sequence Signatures for Rapid Detection of Six Target Bacterial Pathogens Using PCR Assays

    Directory of Open Access Journals (Sweden)

    Kenjiro Nagamine

    2015-01-01

    Full Text Available Using Streptococcus pyogenes as a model, we previously established a stepwise computational workflow to effectively identify species-specific DNA signatures that could be used as PCR primer sets to detect target bacteria with high specificity and sensitivity. In this study, we extended the workflow for the rapid development of PCR assays targeting Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Clostridium tetani , and Staphylococcus aureus , which are of safety concern for human tissue intended for transplantation. Twenty-one primer sets that had sensitivity of detecting 5–50 fg DNA from target bacteria with high specificity were selected. These selected primer sets can be used in a PCR array for detecting target bacteria with high sensitivity and specificity. The workflow could be widely applicable for the rapid development of PCR-based assays for a wide range of target bacteria, including those of biothreat agents.

  5. PCR-based identification of Klebsiella pneumoniae subsp. rhinoscleromatis, the agent of rhinoscleroma.

    Directory of Open Access Journals (Sweden)

    Cindy Fevre

    2011-05-01

    Full Text Available Rhinoscleroma is a chronic granulomatous infection of the upper airways caused by the bacterium Klebsiella pneumoniae subsp. rhinoscleromatis. The disease is endemic in tropical and subtropical areas, but its diagnosis remains difficult. As a consequence, and despite available antibiotherapy, some patients evolve advanced stages that can lead to disfiguration, severe respiratory impairment and death by anoxia. Because identification of the etiologic agent is crucial for the definitive diagnosis of the disease, the aim of this study was to develop two simple PCR assays. We took advantage of the fact that all Klebsiella pneumoniae subsp. rhinoscleromatis isolates are (i of capsular serotype K3; and (ii belong to a single clone with diagnostic single nucleotide polymorphisms (SNP. The complete sequence of the genomic region comprising the capsular polysaccharide synthesis (cps gene cluster was determined. Putative functions of the 21 genes identified were consistent with the structure of the K3 antigen. The K3-specific sequence of gene Kr11509 (wzy was exploited to set up a PCR test, which was positive for 40 K3 strains but negative when assayed on the 76 other Klebsiella capsular types. Further, to discriminate Klebsiella pneumoniae subsp. rhinoscleromatis from other K3 Klebsiella strains, a specific PCR assay was developed based on diagnostic SNPs in the phosphate porin gene phoE. This work provides rapid and simple molecular tools to confirm the diagnostic of rhinoscleroma, which should improve patient care as well as knowledge on the prevalence and epidemiology of rhinoscleroma.

  6. Reliability of a multiplex PCR assay for the identification of the major Campylobacter taxa.

    Science.gov (United States)

    Hayashi, K; Tazumi, A; Nakajima, T; Endo, A; Moore, J E; Millar, B C; Matsuda, M

    2011-01-01

    The primer pair (C412F/C1228R) constructed previously for the polymerase chain reaction (PCR) identification of the genus Campylobacter using an approximate 800 base pair (bp) 16S rRNA gene target segment proved to be useful for the identification of a total of 49 Campylobacter lari isolates including urease-positive thermophilic Campylobacter (UPTC) organisms (n=25). When the primer pair (CLF/R) developed previously for the PCR identification of C. lari species using an approximate 250 bp glyA segment was employed, 27 C. lari isolates, including all the UPTC isolates, were identified to be PCR-negative (55%). Therefore, this PCR procedure developed for the molecular identification of C. lari was shown to be unreliable for C. lari identification. Nucleotide sequencing analysis clarified the reason(s) why PCR-negative examples occurred in many C. lari isolates, including UPTC isolates. The primer pair target sequences in the C. lari-specific PCR-negative isolates apparently varied at the 3' end region, as compared with C. lari-specific PCR-positive isolates. Thus, the multiplex PCR assay developed previously was shown to be unreliable for the molecular identification of C. lari subspecies organisms.

  7. [Rapid identification system for seedlings of medicinal Chrysanthemum morifolium].

    Science.gov (United States)

    Mao, Pengfei; Guo, Qiaosheng; Wang, Tao; Shao, Qingsong

    2012-04-01

    To achieve the rapid identification for seedlings of medicinal Chrysanthemum morifolium, the discriminant equation was established and the software for rapid identification was designed. Leaf structure of medicinal Chrysanthemum of 12 cultivars was analyzed to establish the discriminant equation based on variance analysis and discriminant analysis. On this basis, the identification program and software (based on the python language) were designed. Through the analysis of variance and multiple comparisons for the 11 leaf parameter index data of 12 different cultivars, it was found that that the leaf parameters were significant different from each other and reached significant levels. The discriminant equation and the rapid identification software were set up based on the analysis of various indicators. The rapid identification system of seedlings of medicinal Chrysanthemum could be achieved through the establishment of discriminant equation combined with computer technology.

  8. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP for rapid diagnosis of neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Anusha Rohit

    2016-01-01

    Full Text Available Background & objectives: The difficulties in diagnosis of neonatal sepsis are due to varied clinical presentation, low sensitivity of blood culture which is considered the gold standard and empirical antibiotic usage affecting the outcome of results. Though polymerase chain reaction (PCR based detection of bacterial 16S rRNA gene has been reported earlier, this does not provide identification of the causative agent. In this study, we used restriction fragment length polymorphism (RFLP of amplified 16S rRNA gene to identify the organisms involved in neonatal sepsis and compared the findings with blood culture. Methods: Blood samples from 97 neonates were evaluated for diagnosis of neonatal sepsis using BacT/Alert (automated blood culture and PCR-RFLP. Results: Bacterial DNA was detected by 16S rRNA gene PCR in 55 cases, while BacT/Alert culture was positive in 34 cases. Staphylococcus aureus was the most common organism detected with both methods. Klebsiella spp. was isolated from four samples by culture but was detected by PCR-RFLP in five cases while Acinetobacter spp. was isolated from one case but detected in eight cases by PCR-RFLP. The sensitivity of PCR was found to be 82.3 per cent with a negative predictive value of 85.7 per cent. Eighty of the 97 neonates had prior exposure to antibiotics. Interpretation & conclusions:The results of our study demonstrate that PCR-RFLP having a rapid turnaround time may be useful for the early diagnosis of culture negative neonatal sepsis.

  9. A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.

    Science.gov (United States)

    Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin

    2017-01-01

    This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.

  10. Non-invasive cytology brush PCR for the diagnosis and causative species identification of American cutaneous leishmaniasis in Peru.

    Science.gov (United States)

    Valencia, Braulio Mark; Veland, Nicolas; Alba, Milena; Adaui, Vanessa; Arevalo, Jorge; Low, Donald E; Llanos-Cuentas, Alejandro; Boggild, Andrea K

    2012-01-01

    Traditional methods of detecting Leishmania from cutaneous lesions involve invasive diagnostic procedures, such as scrapings, which cause discomfort, require technical expertise, and carry risks of invasive procedures. We compared the performance of 2 novel, molecular-based non-invasive methods for the diagnosis of cutaneous leishmaniasis (CL). Consecutive patients presenting to the Leishmania Clinic at the Hospital Nacional Cayetano Heredia were enrolled. PCR was performed on filter paper lesion impressions (FPLIs), cytology brushes, and lancets for detection of Leishmania DNA. Smears from lesion scrapings and leishmanin skin test were also performed. Outcome measures were sensitivity and specificity. Composite reference standard was any 2 of 5 tests positive. Species identification was performed by PCR assays of positive specimens. Ninety patients with 129 lesions were enrolled, 117 of which fulfilled reference criteria for a diagnosis of CL. Of these 117 lesions, 113 were positive by PCR of lancets used for lesion scrapings versus 116 by PCR of FPLIs (p=0.930) or 116 by PCR of cytology brushes (p=0.930). Sensitivity and specificity of PCR on lancets were 96.6% [95% CI 93.3-99.9%] and 100%, respectively. Sensitivity and specificity of FPLI PCR were 99.1% [95% CI 97.4-100%] and 100%, respectively. Sensitivity and specificity of cytology brush PCR were 99.1% [95% CI 97.4-100%] and 100%, respectively. Giemsa-stained lesion smear and leishmanin skin test had inferior sensitivities at 47.9% [95% CI 38.9-57.0%] and 82.3% [95% CI 73.9-90.7%], respectively, compared to PCR of invasive or non-invasive specimens (pPCR constitutes a sensitive and specific alternative to traditional diagnostic assays performed on invasive specimens such as lesion scrapings. It performs comparatively to non-invasive FPLI PCR. This novel, rapid, and well-tolerated method has the potential for widespread use in the field and in pediatric populations where traditional specimen collection is

  11. A PCR Based Microbial Monitoring Alternative Method of Detection and Identification of Microbes Aboard ISS

    Science.gov (United States)

    Khodadad, Christina; Oubre, Cherie; Castro, Victoria; Flint, Stephanie; Ott, Mark; Roman, Monserrate; Wheeler, Ray; Melendez, Orlando

    2017-01-01

    Previous research has shown that microorganisms and potential human pathogens have been detected on the International Space Station (ISS) with additional introduction of new microflora occurring with every exchange of crew or addition of equipment and supplies. These microbes are readily transferred between crew and subsystems (i.e. ECLSS, environmental control and life support systems). As this can be detrimental to astronaut health and optimal performance of ISS systems, monitoring of systems such as ECLSS to include identification of microbial contaminants could prevent adverse effects on human health and life support systems. Current monitoring on ISS is laborious and utilizes culture based methods followed by sample return to Earth for complete analysis. Future, long-distance spaceflight missions will require real-time monitoring capabilities that enable efficient and rapid assessments of the microbial environment allowing for expedited decisions and more targeted response to cope with anomalies. Polymerase chain reaction (PCR), a molecular microbial monitoring method was chosen and numerous PCR instruments investigated for their potential to perform in microgravity conditions. Using ISS as a test bed for PCR verification in microgravity will enable NASA to assess whether molecular based microbiological sensors may be components of reliable, closed-loop life support and habitation systems in spacecraft, enhancing infrastructure capabilities through increased efficiency, reliability, and time savings by enabling sample analysis on orbit. NASA selected the Water Monitoring Suite as one of the rapid spaceflight hardware demonstration activities utilizing a streamlined process to minimize the time required to fly experimental flight hardware. The RAZOR EX (BioFire Defense, Salt Lake City, UT) system was part of the water monitoring suite and is a commercial off-the-shelf (COTS) real-time PCR instrument designed for field work. The RAZOR EX was originally designed

  12. A multiplex RT-PCR for rapid and simultaneous detection of viruses and viroids in chrysanthemum.

    Science.gov (United States)

    Song, A; You, Y; Chen, F; Li, P; Jiang, J; Chen, S

    2013-01-01

    Chrysanthemum plants are subject to serious virus diseases, so detection and identification of virus pathogens is important to prevent the virus spread. A reliable one-step multiplex RT-PCR was developed to simultaneously detect two viruses and two viriods: chrysanthemum virus B, tomato Aspermy virus, chrysanthemum stunt viroid and chrysanthemum chlorotic mottle viroid. In addition, we investigated the detection limit and the efficiency of single and multiplex RT-PCR assays. The results showed that the multiplex RT-PCR assay proved to be as sensitive as the single one. In conclusion, this technique is potentially useful in routine diagnosis of chrysanthemum viruses and viroids. The multiplex RT-PCR assay described in this study is the first report of simultaneous detection of virus and viroid in chrysanthemum, which provides a fast, convenient, cost-saving way to detect the virus and viroid mixed infections in plants. © 2012 The Society for Applied Microbiology.

  13. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  14. Real-time PCR assays compared to culture-based approaches for identification of aerobic bacteria in chronic wounds.

    Science.gov (United States)

    Melendez, J H; Frankel, Y M; An, A T; Williams, L; Price, L B; Wang, N-Y; Lazarus, G S; Zenilman, J M

    2010-12-01

    Chronic wounds cause substantial morbidity and disability. Infection in chronic wounds is clinically defined by routine culture methods that can take several days to obtain a final result, and may not fully describe the community of organisms or biome within these wounds. Molecular diagnostic approaches offer promise for a more rapid and complete assessment. We report the development of a suite of real-time PCR assays for rapid identification of bacteria directly from tissue samples. The panel of assays targets 14 common, clinically relevant, aerobic pathogens and demonstrates a high degree of sensitivity and specificity using a panel of organisms commonly associated with chronic wound infection. Thirty-nine tissue samples from 29 chronic wounds were evaluated and the results compared with those obtained by culture. As revealed by culture and PCR, the most common organisms were methicillin-resistant Staphylococcus aureus (MRSA) followed by Streptococcus agalactiae (Group B streptococcus) and Pseudomonas aeruginosa. The sensitivities of the PCR assays were 100% and 90% when quantitative and qualitative culture results were used as the reference standard, respectively. The assays allowed the identification of bacterial DNA from ten additional organisms that were not revealed by quantitative or qualitative cultures. Under optimal conditions, the turnaround time for PCR results is as short as 4-6 h. Real-time PCR is a rapid and inexpensive approach that can be easily introduced into clinical practice for detection of organisms directly from tissue samples. Characterization of the anaerobic microflora by real-time PCR of chronic wounds is warranted. © 2010 The Authors. Journal Compilation © 2010 European Society of Clinical Microbiology and Infectious Diseases.

  15. Multiplex-PCR for Identification of Two Species in Genus Hishimonus (Hemiptera: Cicadellidae) in Jujube Orchards.

    Science.gov (United States)

    Hao, Shaodong; Wang, He; Tao, Wanqiang; Wang, Jinzhong; Zhang, Zhiyong; Zhang, Qiuling; Zhang, Minzhao; Guo, Li; Shi, Xiaoyu

    2015-10-01

    The insect family Cicadellidae includes economically important vectors of plant pathogens. Hishimonus sellatus (Uhler) transmits jujube witches'-broom (JWB). Currently, H. sellatus and Hishimonus lamellatus Cai et Kuoh are observed to co-occur at the same locality on jujube. H. lamellatus is now suspected to be a JWB vector. As such, correct identification of Hishimonus species present in vineyards is essential for epidemiological surveys. However, traditional identification of Hishimonus by morphology is limited to the adult male. We provide a comprehensive description of morphological and molecular tools for discriminating between H. sellatus and H. lamellatus, for use in identification and monitoring of the two Hishimonus species and studies of their plant hosts. A rapid and inexpensive method is introduced to identify H. sellatus and H. lamellatus occurring in jujube orchards. This method is based on amplification of mitochondrial cytochrome oxidase I (COI) gene, using PCR with multiplexed, species-specific primers. The reliability of this new method has been tested on different populations from different sites in Beijing region of China. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Direct Identification of Enteroviruses in Cerebrospinal Fluid of Patients with Suspected Meningitis by Nested PCR Amplification

    Directory of Open Access Journals (Sweden)

    Alexandr Krasota

    2016-01-01

    Full Text Available Enteroviruses, the most common human viral pathogens worldwide, have been associated with serous meningitis, encephalitis, syndrome of acute flaccid paralysis, myocarditis and the onset of diabetes type 1. In the future, the rapid identification of the etiological agent would allow to adjust the therapy promptly and thereby improve the course of the disease and prognosis. We developed RT-nested PCR amplification of the genomic region coding viral structural protein VP1 for direct identification of enteroviruses in clinical specimens and compared it with the existing analogs. One-hundred-fifty-nine cerebrospinal fluids (CSF from patients with suspected meningitis were studied. The amplification of VP1 genomic region using the new method was achieved for 86 (54.1% patients compared with 75 (47.2%, 53 (33.3% and 31 (19.5% achieved with previously published methods. We identified 11 serotypes of the Enterovirus species B in 2012, including relatively rare echovirus 14 (E-14, E-15 and E-32, and eight serotypes of species B and 5 enteroviruses A71 (EV-A71 in 2013. The developed method can be useful for direct identification of enteroviruses in clinical material with the low virus loads such as CSF.

  17. PCR for the identification and differentiation of Histomonas meleagridis, Tetratrichomonas gallinarum and Blastocystis spp.

    Science.gov (United States)

    Grabensteiner, E; Hess, M

    2006-12-20

    In the present investigation PCR assays were developed for the rapid detection and differentiation of two poultry flagellates: Histomonas meleagridis and Tetratrichomonas gallinarum as well as the protozoan microorganism: Blastocystis spp. The nucleotide sequences of the small subunit ribosomal RNAs were used for primer construction obtaining fragments which vary in size for each microorganism. The established PCRs were able to detect DNA obtained from one microorganism of T. gallinarum and Blastocystis spp. propagated in vitro, proving the high analytical sensitivity of the method. DNA isolated from 10 protozoa was sufficient to detect H. meleagridis. To assess specificity, each PCR assay was performed with DNA from either H. meleagridis and/or T. gallinarum and/or Blastocystis spp. as well as with DNA from several other protozoan parasites (Eimeria tenella, Toxoplasma gondii, Cryptosporidia spp., Trichomonas gallinae, Entamoeba invadens, Entamoeba ranarum), fungi (Aspergillus fumigatus, Candida albicans), bacteria (Staphylococcae, Streptococcae, E. coli, Clostridium perfringens, Camplyobacter jejuni, Proteus) and viruses (fowl adenovirus serotype 4, avian reovirus) as well as livers and caecal samples from turkeys and specified pathogen free (spf) chickens. No cross-reactions with any of these samples were observed with the primer sets for the detection of H. meleagridis and Blastocystis spp. The primers designed for the identification of T. gallinarum yielded a PCR product with DNA of Trichomonas gallinae that had the identical size as the amplicon obtained with DNA from T. gallinarum. However, no PCR products resulted from any of the other samples tested with these primers. Liver and caecal samples from turkeys and chickens from flocks with outbreaks of histomonosis also named as "histomoniasis" originating from geographically distinct regions were investigated with the established PCRs. This is also the first report about the detection of the nucleic acid of H

  18. Multiplex PCR for the identification of white Tuber species.

    Science.gov (United States)

    Amicucci, A; Guidi, C; Zambonelli, A; Potenza, L; Stocchi, V

    2000-08-15

    Species-specific primers selected from the internal transcribed spacer region sequence were used to set up a multiplex polymerase chain reaction (PCR) able to simultaneously identify the white truffle species Tuber magnatum, Tuber borchii, Tuber maculatum and Tuber puberulum. Furthermore, a primer specific for the competitive fungus Sphaerosporella brunnea was designed and added to the multiplex PCR set, allowing the detection of the Tuber species and the contaminant fungus in a one-step reaction.

  19. Rapid Diagnosis of Azole-Resistant Aspergillosis by Direct PCR Using Tissue Specimens

    NARCIS (Netherlands)

    van der Linden, Jan W. M.; Snelders, Eveline; Arends, Jan P.; Daenen, Simon M.; Melchers, Willem J. G.; Verweij, Paul E.

    We report the use of PCR techniques on a formalin-fixed and paraffin-embedded tissue specimen for direct detection of one dominant azole resistance mechanism in a case of disseminated invasive aspergillosis. Rapid detection of mutations associated with azole resistance directly in tissue

  20. Rapid diagnosis of azole-resistant aspergillosis by direct PCR using tissue specimens.

    NARCIS (Netherlands)

    Linden, J.W.M. van der; Snelders, E.; Arends, J.P.; Daenen, S.M.G.J.; Melchers, W.J.G.; Verweij, P.E.

    2010-01-01

    We report the use of PCR techniques on a formalin-fixed and paraffin-embedded tissue specimen for direct detection of one dominant azole resistance mechanism in a case of disseminated invasive aspergillosis. Rapid detection of mutations associated with azole resistance directly in tissue

  1. A duplex PCR for rapid and simultaneous detection of Brucella spp. in human blood samples.

    Science.gov (United States)

    Mirnejad, Reza; Mohamadi, Mozafar; Piranfar, Vahbeh; Mortazavi, Seied Mojtaba; Kachuei, Reza

    2013-06-01

    To design a duplex PCR for rapid and simultaneous detection of Brucella species. in human blood samples. Fifty-two peripheral bloods samples were collected from suspicious patients with brucellosis. Following DNA extraction, PCR assay were performed, using three primers that could simultaneously identify and differentiate three major species of pathogenic Brucella in humans and animals. Of the 52 peripheral bloods samples tested, 25 sample (48%) showed positive reactions in PCR. Twelve samples were positive for Brucella abortus 39 (B. abortus 39) (23%), 13 for Brucella melitensis 39 (B. melitensis 39) (25%) and 0 for Brucella ovis 39 (B. ovis 39) (0%). This work demonstrates that in case where specific primers were utilized, duplex PCR has proved to be a simple, fast, and relatively inexpensive method for simultaneous detection of important species of Brucella in clinical samples. Copyright © 2013 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  2. Rapid identification of the medicinal plant Taraxacum formosanum ...

    African Journals Online (AJOL)

    Administrator

    2011-06-06

    Jun 6, 2011 ... Original identification of medicinal plants is essential for quality control. In this study, the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA served as a DNA barcode and was amplified by allele-specific PCR. This approach was exploited to differentiate Taraxacum formosanum from five.

  3. Standardization of a multiplex PCR for the identification of coagulase-positive Staphylococcus

    OpenAIRE

    Gandra,Eliezer Avila; Fernandez,Maria Aparecida; Silva,Jorge Adolfo; Silva,Wladimir Padilha da

    2011-01-01

    The enterotoxigenic species Staphylococcus aureus, S. hyicus and S. intermedius show very similar characteristics, making their identification through conventional microbiological methods difficult. This study aimed at the development of a Multiplex PCR (mPCR) for the identification of S. aureus, S. intermedius and S. hyicus using the nuc gene as the target sequence. The results obtained suggest that the set of primers used was specific for the three species of Staphylococcus evaluate with a ...

  4. PCR

    African Journals Online (AJOL)

    sunny

    (5'-. MGATAAGRTGTAATCCW-3') and. (5'-. TGGAAGCCATCATCGACGAAGCCAT-3') were designed to amplify a new partial rbcS gene by PCR. About 400 bp DNA fragment was obtained by PCR. This DNA fragment was cloned into the pMD18-T vector. (TakaRa) for sequencing. Sequence analysis of this DNA fragment.

  5. Real-time PCR for rapidly detecting aniline-degrading bacteria in activated sludge.

    Science.gov (United States)

    Kayashima, Takakazu; Suzuki, Hisako; Maeda, Toshinari; Ogawa, Hiroaki I

    2013-05-01

    We developed a detection method that uses quantitative real-time PCR (qPCR) and the TaqMan system to easily and rapidly assess the population of aniline-degrading bacteria in activated sludge prior to conducting a biodegradability test on a chemical compound. A primer and probe set for qPCR was designed by a multiple alignment of conserved amino acid sequences encoding the large (α) subunit of aniline dioxygenase. PCR amplification tests showed that the designed primer and probe set targeted aniline-degrading strains such as Acidovorax sp., Gordonia sp., Rhodococcus sp., and Pseudomonas putida, thereby suggesting that the developed method can detect a wide variety of aniline-degrading bacteria. There was a strong correlation between the relative copy number of the α-aniline dioxygenase gene in activated sludge obtained with the developed qPCR method and the number of aniline-degrading bacteria measured by the Most Probable Number method, which is the conventional method, and a good correlation with the lag time of the BOD curve for aniline degradation produced by the biodegradability test in activated sludge samples collected from eight different wastewater treatment plants in Japan. The developed method will be valuable for the rapid and accurate evaluation of the activity of inocula prior to conducting a ready biodegradability test. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. PCR

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... The overall prevalence of human cytomegalovirus (HCMV) infection in 16 ... Key words: Cytomegalovirus, PCR, human cytomegalovirus (HCMV) and ELISA. .... McGeoch DJ, Hayward GS (2003). The human cytomegalovirus genome revisited: Comparison with the chimpanzee cytomegalovirus genome.

  7. Clinical usefulness of multiplex PCR lateral flow in MRSA detection: a novel, rapid genetic testing method.

    Science.gov (United States)

    Nihonyanagi, Shin; Kanoh, Yuhsaku; Okada, Kiyomi; Uozumi, Toshiki; Kazuyama, Yukumasa; Yamaguchi, Tokiko; Nakazaki, Nobuhiko; Sakurai, Keizou; Hirata, Yasuyoshi; Munekata, Shinichi; Ohtani, Shinichi; Takemoto, Tsuyoshi; Bandoh, Yuki; Akahoshi, Tohru

    2012-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) with exogenous cassette DNA containing the methicillin-resistant gene mecA (SCCmec) poses a problem as a drug-resistant bacterium responsible for hospital- and community-acquired infections. The frequency of MRSA detection has recently been increasing rapidly in Japan, and SCCmec has also been classified more diversely into types I-V. A rapid test is essential for early diagnosis and treatment of MRSA infections, but detection by conventional methods requires at least two days. The newly developed multiplex PCR lateral flow method allows specific amplification of femA to detect S. aureus, mecA to detect SCCmec, and kdpC to detect SCCmec type II; moreover, PCR products can be evaluated visually in about 3 h. In the present study, we developed a PCR lateral flow method for MRSA using this method and investigated its clinical usefulness in the detection of MRSA. The results showed a diagnostic concordance rate of 91.7% for MRSA and methicillin-susceptible S. aureus between bacteriological examination and PCR lateral flow, and a high level of specificity in PCR lateral flow. In addition, a higher detection rate for S. aureus using the same sample was observed for PCR lateral flow (70.2%) than for bacteriological tests (48.6%). The above results show that PCR lateral flow for MRSA detection has high sensitivity, specificity, and speed, and its clinical application as a method for early diagnosis of MRSA infections appears to be feasible.

  8. Rapid and sensitive diagnosis of fungal keratitis with direct PCR without template DNA extraction.

    Science.gov (United States)

    Zhao, G; Zhai, H; Yuan, Q; Sun, S; Liu, T; Xie, L

    2014-10-01

    This study was aimed at developing a direct PCR assay without template DNA extraction for the rapid and sensitive diagnosis of infectious keratitis. Eighty corneal scrapings from 67 consecutive patients with clinically suspected infectious keratitis were analysed prospectively. Direct PCR was performed with all scrapings, with specific primers for fungi, bacteria, herpes simplex virus-1 (HSV-1) and Acanthamoeba simultaneously. The results were compared with those obtained from culture, smear, and confocal microscopy. Discrepant results were resolved according to the therapeutic effects of the corresponding antimicrobial drugs. The lowest detection limit of direct PCR was ten copies of each pathogen. Sixty-six scrapings yielded positive results with direct PCR, giving a total positive detection rate of 82.5% (66/80). For 34 patients with high suspicion of fungal keratitis, the positive detection rate of direct PCR was 84.8% (39/46). This rate increased to 91.2% (31/34) when repeated scrapings were excluded, and was significantly higher than the rates obtained with culture (35.3%, 12/34) and smear (64.7%, 22/34) (p keratitis with direct PCR and culture were 98.0% and 47.1% (p keratitis, and it is expected to have an impact on the diagnosis and treatment of infectious keratitis in the future. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  9. Evaluation of 11 PCR assays for species-level identification of Campylobacter jejuni and Campylobacter coli

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Jordan, Penelope J.

    2003-01-01

    We examined the sensitivity and specificity of 11 PCR assays described for the species identification of Campylobacter jejuni and Campylobacter coli by using 111 type, reference, and field strains of C. jejuni, C. coli, and Campylobacter lari. For six assays, an additional 21 type strains...... representing related Campylobacter, Arcobacter, and Helicobacter species were also included. PCR tests were initially established in the laboratory by optimizing conditions with respect to five type and reference strains of C. jejuni, C. coli, and C. lari. One PCR test for C. coli failed to give appropriate...... gave amplicons in four of seven C. jejuni PCR tests only where purified DNA was used as the template; corresponding results were seen with one strain of C. coli in each of three assays for the latter species. Our findings indicate that a polyphasic strategy for PCR-based identification should be used...

  10. Development of real-time PCR assay for genetic identification of the mottled skate, Beringraja pulchra.

    Science.gov (United States)

    Hwang, In Kwan; Lee, Hae Young; Kim, Min-Hee; Jo, Hyun-Su; Choi, Dong-Ho; Kang, Pil-Won; Lee, Yang-Han; Cho, Nam-Soo; Park, Ki-Won; Chae, Ho Zoon

    2015-10-01

    The mottled skate, Beringraja pulchra is one of the commercially important fishes in the market today. However, B. pulchra identification methods have not been well developed. The current study reports a novel real-time PCR method based on TaqMan technology developed for the genetic identification of B. pulchra. The mitochondrial cytochrome oxidase subunit 1 (COI) nucleotide sequences of 29 B. pulchra, 157 skates and rays reported in GenBank DNA database were comparatively analyzed and the COI sequences specific to B. pulchra was identified. Based on this information, a system of specific primers and Minor Groove Binding (MGB) TaqMan probe were designed. The assay successfully discriminated in 29 specimens of B. pulchra and 27 commercial samples with unknown species identity. For B. pulchra DNA, an average Threshold Cycle (Ct) value of 19.1±0.1 was obtained. Among 27 commercial samples, two samples showed average Ct values 19.1±0.0 and 26.7±0.1, respectively and were confirmed to be B. pulchra based on sequencing. The other samples tested showed undetectable or extremely weak signals for the target fragment, which was also consistent with the sequencing results. These results reveal that the method developed is a rapid and efficient tool to identify B. pulchra and might prevent fraud or mislabeling during the distribution of B. pulchra products. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  11. Development of a Multiplex PCR Assay for Rapid Molecular Serotyping of Haemophilus parasuis

    Science.gov (United States)

    Peters, Sarah E.; Wang, Jinhong; Hernandez-Garcia, Juan; Weinert, Lucy A.; Luan, Shi-Lu; Chaudhuri, Roy R.; Angen, Øystein; Aragon, Virginia; Williamson, Susanna M.; Langford, Paul R.; Rycroft, Andrew N.; Wren, Brendan W.; Maskell, Duncan J.; Tucker, Alexander W.

    2015-01-01

    Haemophilus parasuis causes Glässer's disease and pneumonia in pigs. Indirect hemagglutination (IHA) is typically used to serotype this bacterium, distinguishing 15 serovars with some nontypeable isolates. The capsule loci of the 15 reference strains have been annotated, and significant genetic variation was identified between serovars, with the exception of serovars 5 and 12. A capsule locus and in silico serovar were identified for all but two nontypeable isolates in our collection of >200 isolates. Here, we describe the development of a multiplex PCR, based on variation within the capsule loci of the 15 serovars of H. parasuis, for rapid molecular serotyping. The multiplex PCR (mPCR) distinguished between all previously described serovars except 5 and 12, which were detected by the same pair of primers. The detection limit of the mPCR was 4.29 × 105 ng/μl bacterial genomic DNA, and high specificity was indicated by the absence of reactivity against closely related commensal Pasteurellaceae and other bacterial pathogens of pigs. A subset of 150 isolates from a previously sequenced H. parasuis collection was used to validate the mPCR with 100% accuracy compared to the in silico results. In addition, the two in silico-nontypeable isolates were typeable using the mPCR. A further 84 isolates were analyzed by mPCR and compared to the IHA serotyping results with 90% concordance (excluding those that were nontypeable by IHA). The mPCR was faster, more sensitive, and more specific than IHA, enabling the differentiation of 14 of the 15 serovars of H. parasuis. PMID:26424843

  12. Multiplex PCR assay for direct identification of group B streptococcal alpha-protein-like protein genes.

    Science.gov (United States)

    Creti, Roberta; Fabretti, Francesca; Orefici, Graziella; von Hunolstein, Christina

    2004-03-01

    We developed a group B streptococcus multiplex PCR assay which allows, by direct analysis of the amplicon size, determination of the surface protein antigen genes of alpha-C protein, epsilon protein, Rib, Alp2, Alp3, and Alp4. The multiplex PCR assay offers a rapid and simple method of subtyping Streptococcus agalactiae based on surface protein genes.

  13. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...... of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using...... and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection....

  14. Etiological Analysis of Fungal Keratitis and Rapid Identification of Predominant Fungal Pathogens.

    Science.gov (United States)

    He, Dan; Hao, Jilong; Gao, Song; Wan, Xue; Wang, Wanting; Shan, Qiushi; Wang, Li

    2016-02-01

    Fungal keratitis is a worldwide-distributed refractory and potentially blinding ocular infection caused by various fungi. It is necessary to investigate the etiological and epidemiological characteristics of this disease and establish a rapid and specific pathogenic identification method. Here, we isolated and identified fungal pathogens of 275 patients with presumed fungal keratitis from Jilin Province, China, and conducted statistical analyses of epidemiological information. The positive rate of fungal culture was 72.0 %. Fusarium sp. was the most common genus among 210 fungal isolates. The predominant species were Fusarium solani, Aspergillus fumigatus, and Candida glabrata, which accounted for over 50 % of the isolated organisms. Corneal trauma and previous use of drugs were the most important predisposing factors. In addition, a multiplex polymerase chain reaction (PCR) was designed with species-specific primers of the three species that could identify them with amplicons of approximately 330 bp from F. solani, 275 bp from A. fumigatus, and 230 bp from C. glabrata. Additionally, PCR with fungal universal primers and multiplex PCR were performed using DNA prepared by an improved DNA extraction method from corneal scrapings. With this method, fungal pathogens from corneal scrapings could be specifically and rapidly identified within 8 h. The culture-independent rapid identification of corneal scrapings may have great significance for the early diagnosis and treatment of fungal keratitis.

  15. Comprehensive and Rapid Real-Time PCR Analysis of 21 Foodborne Outbreaks

    Directory of Open Access Journals (Sweden)

    Hiroshi Fukushima

    2009-01-01

    Full Text Available A set of four duplex SYBR Green I PCR (SG-PCR assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.

  16. Identification of Tilletia species using rep-PCR fingerprinting technique

    Directory of Open Access Journals (Sweden)

    Župunski Vesna

    2011-01-01

    Full Text Available Analyzing 167 non-processed seed samples of wheat, it was found that 145 samples (86.8 % were contaminated with Tilletia species, while 22 (13.2 % samples were not contaminated. By using rep-PCR fingerprinting technique, it was found that DNA isolates of T. tritici originated from Serbian wheat samples had 80 % similarity with positive control for T. tritici. One isolate shared similarity of 60% with T. tritici, T. controversa and T. laevis. It was supposed that this isolate belongs to T. bromi. Isolate of T. laevis shared a similarity of 70 % with isolates of T. tritici and T. controversa, while T. walkeri was more than 10 % similar with T. tritici, T. controversa and T. laevis. Although T. controversa and T. tritici had high percent of genetic similarity, they were clustered separately. Our results suggest that rep-PCR fingerprinting could be a useful tool for monitoring presence of morphologically similar Tilletia species in wheat production areas.

  17. A Rapid and Low-Cost PCR Thermal Cycler for Low Resource Settings.

    Directory of Open Access Journals (Sweden)

    Grace Wong

    Full Text Available Many modern molecular diagnostic assays targeting nucleic acids are typically confined to developed countries or to the national reference laboratories of developing-world countries. The ability to make technologies for the rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a revolutionary step forward in global health. Many molecular assays are also developed based on polymerase chain reactions (PCR, which require thermal cyclers that are relatively heavy (>20 pounds and need continuous electrical power. The temperature ramping speed of most economical thermal cyclers are relatively slow (2 to 3 °C/s so a polymerase chain reaction can take 1 to 2 hours. Most of all, these thermal cyclers are still too expensive ($2k to $4k for low-resource setting uses.In this article, we demonstrate the development of a low-cost and rapid water bath based thermal cycler that does not require active temperature control or continuous power supply during PCR. This unit costs $130 to build using commercial off-the-shelf items. The use of two or three vacuum-insulated stainless-steel Thermos food jars containing heated water (for denaturation and annealing/extension steps and a layer of oil on top of the water allow for significantly stabilized temperatures for PCR to take place. Using an Arduino-based microcontroller, we automate the "archaic" method of hand-transferring PCR tubes between water baths.We demonstrate that this innovative unit can deliver high speed PCR (17 s per PCR cycle with the potential to go beyond the 1,522 bp long amplicons tested in this study and can amplify from templates down to at least 20 copies per reaction. The unit also accepts regular PCR tubes and glass capillary tubes. The PCR efficiency of our thermal cycler is not different from other commercial thermal cyclers. When combined with a rapid nucleic acid detection approach, the thermos thermal cycler (TTC can enable on-site molecular

  18. Identification of Tilletia species using rep-PCR fingerprinting technique

    OpenAIRE

    Župunski Vesna; Ignjatović-Micić Dragana; Nikolić Ana; Stanković Slavica; Jevtić Radivoje; Lević Jelena; Ivanović Dragica

    2011-01-01

    Analyzing 167 non-processed seed samples of wheat, it was found that 145 samples (86.8 %) were contaminated with Tilletia species, while 22 (13.2 %) samples were not contaminated. By using rep-PCR fingerprinting technique, it was found that DNA isolates of T. tritici originated from Serbian wheat samples had 80 % similarity with positive control for T. tritici. One isolate shared similarity of 60% with T. tritici, T. controversa and T. laevis. It was suppos...

  19. Single-step blood direct PCR: A robust and rapid method to diagnose triplet repeat disorders.

    Science.gov (United States)

    Singh, Inder; Swarup, Vishnu; Shakya, Sunil; Goyal, Vinay; Faruq, Mohammed; Srivastava, Achal Kumar

    2017-08-15

    DNA extraction prior to polymerase chain reaction (PCR) amplification in genetic diagnoses of triplet repeat disorders (TRDs) is tedious and labour-intensive and has the limitations of sample contamination with foreign DNA, including that from preceding samples. Therefore, we aimed to develop a rapid, robust, and cost-effective method for expeditious genetic investigation of TRDs from whole blood as a DNA template. Peripheral blood samples were collected from 70 clinically suspected patients of progressive ataxia. The conventional method using genomic DNA and single-step Blood-Direct PCR (BD-PCR) method with just 2μl of whole blood sample were tested to amplify triplet repeat expansion in genes related to spinocerebellar ataxia (SCA) types 1, 2, 3, 12 and Friedreich's ataxia (FRDA). Post-PCR, the allele sizes were mapped and repeat numbers were calculated using GeneMapper and macros run in Microsoft Excel programmes. Successful amplification of target regions was achieved in all samples by both methods. The frequency of the normal and mutated allele was concordant between both methods, diagnosing 37% positive for a mutation in either of the candidate genes. The BD-PCR resulted in higher intensities of product peaks of normal and pathogenic alleles. The nearly-accurate sizing of the normal and expanded allele was achieved in a shorter time (4-5h), without DNA extraction and any risk of cross contamination, which suggests the BD-PCR to be a reliable, inexpensive, and rapid method to confirm TRDs. This technique can be introduced in routine diagnostic procedures of other tandem repeat disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Rapid method for simulating gas spectra using reversed PCR temperature calibration models based on Hitran data

    DEFF Research Database (Denmark)

    Bak, J.

    1999-01-01

    A computer program was produced to make rapid simulations of CO gas spectra at a spectral resolution of 1 cm(-1) and at temperatures ranging from 295 to 845 K and concentrations from 5 to 400 mg/m(3). The program is based on loadings and scores from three principal component regression (PCR) temp...... a uniform slab of gas at various temperatures, concentrations, and pathlengths. The gain in speed of the calculations of the spectra is based on the fact that the PCR models include mathematical pretreatments and compress the data effectively.......A computer program was produced to make rapid simulations of CO gas spectra at a spectral resolution of 1 cm(-1) and at temperatures ranging from 295 to 845 K and concentrations from 5 to 400 mg/m(3). The program is based on loadings and scores from three principal component regression (PCR......) temperature calibration models. Three sets of 12 Hitran-simulated high-density spectra, each set spanning the entire temperature range at constant concentrations (50, 150, and 300 mg/m(3)), were used as calibration spectra in the PCR temperature models. All the spectra were convoluted with a sine...

  1. Real-time PCR TaqMan assay for rapid screening of bloodstream infection

    Science.gov (United States)

    2014-01-01

    Background Sepsis is one of the main causes of mortality and morbidity. The rapid detection of pathogens in blood of septic patients is essential for adequate antimicrobial therapy and better prognosis. This study aimed to accelerate the detection and discrimination of Gram-positive (GP) and Gram-negative (GN) bacteria and Candida species in blood culture samples by molecular methods. Methods The Real-GP®, -GN®, and -CAN® real-time PCR kit (M&D, Wonju, Republic of Korea) assays use the TaqMan probes for detecting pan-GP, pan-GN, and pan-Candida species, respectively. The diagnostic performances of the real-time PCR kits were evaluated with 115 clinical isolates, 256 positive and 200 negative blood culture bottle samples, and the data were compared to results obtained from conventional blood culture. Results Eighty-seven reference strains and 115 clinical isolates were correctly identified with specific probes corresponding to GP-bacteria, GN-bacteria and Candida, respectively. The overall sensitivity and specificity of the real-time PCR kit with blood culture samples were 99.6% and 89.5%, respectively. Conclusions The Real-GP®, -GN®, and -CAN® real-time PCR kits could be useful tools for the rapid and accurate screening of bloodstream infections (BSIs). PMID:24393579

  2. Real-time PCR assay for rapid qualitative and quantitative detection of Entamoeba histolytica.

    Science.gov (United States)

    Orosz, Erika; Perkátai, Katalin; Kapusinszky, Beatrix; Farkas, Agnes; Kucsera, István

    2012-12-01

    Simple real-time PCR assay with one set of primer and probe for rapid, sensitive qualitative and quantitative detection of Entamoeba histolytica has been used. Consensus sequences were used to amplify a species-specific region of the 16S rRNA gene, and fluorescence resonance energy transfer hybridization probes were used for detection in a LightCycler platform (Roche). The anchor probe sequence was designed to be a perfect match for the 16S rRNA gene of Entamoeba species, while the acceptor probe sequence was designed for Entamoeba histolytica, which allowed differentiation. The performed characteristics of the real-time PCR assay were compared with ELISA antigen and microscopical detection from 77 samples of individuals with suspected clinical diagnosis of imported E. histolytica infection. Stool and liver abscess pus samples were examined with analytical sensitivity of 5 parasites per PCR reaction. The melting curve means Tms (standard deviation) in clinical isolates were 54°C. The real-time assay was 100% sensitive and specific for differentiation of Entamoeba histolytica, compared with conventional ELISA or microscopy. This real-time PCR assay with melting curve analysis is rapid, and specific for the detection and differentiation of Entamoeba histolytica. The suitability for routine use of this assay in clinical diagnostic laboratories is discussed.

  3. Rapid detection of human parechoviruses in clinical samples by real-time PCR

    NARCIS (Netherlands)

    Benschop, Kimberley; Molenkamp, Richard; van der Ham, Alwin; Wolthers, Katja; Beld, Marcel

    2008-01-01

    BACKGROUND: Human parechoviruses (HPeVs) have been associated with severe conditions such as neonatal sepsis and meningitis in young children. Rapid identification of an infectious agent in such serious conditions in these patients is essential for adequate decision making regarding treatment and

  4. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    OpenAIRE

    Bi Yanzhen; Qiao Xianfeng; Hua Zaidong; Zhang Liping; Liu Ximei; Li Li; Hua Wenjun; Xiao Hongwei; Zhou Jingrong; Wei Qingxin; Zheng Xinmin

    2012-01-01

    Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to pr...

  5. Rapid detection of Listeria monocytogenes in food using culture enrichment combined with real-time PCR.

    Science.gov (United States)

    O'Grady, Justin; Ruttledge, Margaret; Sedano-Balbás, Sara; Smith, Terry J; Barry, Thomas; Maher, Majella

    2009-02-01

    A rapid method for the detection of Listeria monocytogenes in foods combining culture enrichment and real-time PCR was compared to the ISO 11290-1 standard method. The culture enrichment component of the rapid method is based on the ISO standard and includes 24h incubation in half-Fraser broth, 4h incubation in Fraser broth followed by DNA extraction and real-time PCR detection of the ssrA gene of L. monocytogenes. An internal amplification control, which is co-amplified with the same primers as the L. monocytogenes DNA, was also included in the assay. The method has a limit of detection of 1-5CFU/25g food sample and can be performed in 2 working days compared to up to 7days for the ISO standard. A variety of food samples from retail outlets and food processing plants (n=175) and controls (n=31) were tested using rapid and conventional methods. The rapid method was 99.44% specific, 96.15% sensitive and 99.03% accurate when compared to the standard method. This method has the potential to be used as an alternative to the standard method for food quality assurance providing rapid detection of L. monocytogenes in food.

  6. Investigation of QF-PCR Application for Rapid Prenatal Diagnosis of Chromosomal Aneuploidies in Iranian Population.

    Science.gov (United States)

    Nasiri, Habib; Noori-Dalooi, Mohammad-Reza; Dastan, Jila; Ghaffari, Saeed-Reza

    2011-03-01

    G-Banding followed by standard chromosome analysis is routinely used for prenatal detection of chromosomal abnormalities. In recent years, molecular cytogenetic techniques have been developed for rapid diagnosis of chromosomal abnormalities. Among these methods Quantitative Florescence Polymerase Chain Reaction (QF-PCR) has been widely used for this purpose. Heterozygosity of short tandem repeat (STR) markers which leads to informativity is the most critical requirement for feasibility of QF-PCR. In this study we analyzed several short tandem repeats on chromosomes 13, 18, 21, X and Y on amniotic fluid samples obtained from PND candidates to diagnose conditions such as Down, Edward and Patau syndromes and also numerical sex chromosome abnormalities such as Klinefelter and Turner syndromes. Most of the analyzed STRs had acceptable heterozygosity (66.3-94.7) to be used in QF-PCR based prenatal diagnosis. Moreover, results obtained from both methods (standard karyotype and QF-PCR) for all samples were in accordance with each other. In case of using appropriate STR markers, and in certain clinical indications, QF-PCR could be used as useful technique for prenatal diagnosis even in consanguine populations such as Iranians.

  7. Rapid multiplex PCR assay to identify respiratory viral pathogens: moving forward diagnosing the common cold.

    Science.gov (United States)

    Layman, Clifton P; Gordon, Sarah M; Elegino-Steffens, Diane U; Agee, Willie; Barnhill, Jason; Hsue, Gunther

    2013-09-01

    Upper respiratory tract infections (URIs) can be a serious burden to the healthcare system. The majority of URIs are viral in etiology, but definitive diagnosis can prove difficult due to frequently overlapping clinical presentations of viral and bacterial infections, and the variable sensitivity, and lengthy turn-around time of viral culture. We tested new automated nested multiplex PCR technology, the FilmArray(®) system, in the TAMC department of clinical investigations, to determine the feasibility of replacing the standard viral culture with a rapid turn-around system. We conducted a feasibility study using a single-blinded comparison study, comparing PCR results with archived viral culture results from a convenience sample of cryopreserved archived nasopharyngeal swabs from acutely ill ED patients who presented with complaints of URI symptoms. A total of 61 archived samples were processed. Viral culture had previously identified 31 positive specimens from these samples. The automated nested multiplex PCR detected 38 positive samples. In total, PCR was 94.5% concordant with the previously positive viral culture results. However, PCR was only 63.4% concordant with the negative viral culture results, owing to PCR detection of 11 additional viral pathogens not recovered on viral culture. The average time to process a sample was 75 minutes. We determined that an automated nested multiplex PCR is a feasible alternative to viral culture in an acute clinical setting. We were able to detect at least 94.5% as many viral pathogens as viral culture is able to identify, with a faster turn-around time.

  8. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E; Krogsdam, A M; Jorgensen, H F

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  9. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  10. Evaluation of chromogenic media and seminested PCR in the identification of Candida species

    Science.gov (United States)

    Daef, Enas; Moharram, Ahmed; Eldin, Salwa Seif; Elsherbiny, Nahla; Mohammed, Mona

    2014-01-01

    Identification of Candida cultured from various clinical specimens to the species level is increasingly necessary for clinical laboratories. Although sn PCR identifies the species within hours but its cost-effectiveness is to be considered. So there is always a need for media which help in the isolation and identification at the species level. The study aimed to evaluate the performance of different chromogenic media and to compare the effectiveness of the traditional phenotypic methods vs. seminested polymerase chain reaction (sn PCR) for identification of Candida species. One hundred and twenty seven Candida strains isolated from various clinical specimens were identified by conventional methods, four different chromogenic media and sn PCR. HiCrome Candida Differential and CHROMagar Candida media showed comparably high sensitivities and specificities in the identification of C. albicans, C. tropicalis, C. glabrata and C. krusei. CHROMagar Candida had an extra advantage of identifying all C. parapsilosis isolates. CHROMagar-Pal’s medium identified C. albicans, C. tropicalis and C. krusei with high sensitivities and specificities, but couldn’t identify C. glabrata or C. parapsilosis. It was the only medium that identified C. dubliniensis with a sensitivity and specificity of 100%. Biggy agar showed the least sensitivities and specificities. The overall concordance of the snPCR compared to the conventional tests including CHROMAgar Candida in the identification of Candida species was 97.5%. The use of CHROMAgar Candida medium is an easy and accurate method for presumptive identification of the most commonly encountered Candida spp. PMID:24948942

  11. Identification of Erwinia species isolated from apples and pears by differential PCR.

    Science.gov (United States)

    Gehring, I; Geider, K

    2012-04-01

    Many pathogenic and epiphytic bacteria isolated from apples and pears belong to the genus Erwinia; these include the species E. amylovora, E. pyrifoliae, E. billingiae, E. persicina, E. rhapontici and E. tasmaniensis. Identification and classification of freshly isolated bacterial species often requires tedious taxonomic procedures. To facilitate routine identification of Erwinia species, we have developed a PCR method based on species-specific oligonucleotides (SSOs) from the sequences of the housekeeping genes recA and gpd. Using species-specific primers that we report here, differentiation was done with conventional PCR (cPCR) and quantitative PCR (qPCR) applying two consecutive primer annealing temperatures. The specificity of the primers depends on terminal Single Nucleotide Polymorphisms (SNPs) that are characteristic for the target species. These PCR assays enabled us to distinguish eight Erwinia species, as well as to identify new Erwinia isolates from plant surfaces. When performed with mixed bacterial cultures, they only detected a single target species. This method is a novel approach to classify strains within the genus Erwinia by PCR and it can be used to confirm other diagnostic data, especially when specific PCR detection methods are not already available. The method may be applied to classify species within other bacterial genera. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Validation of the multiplex PCR for identification of Brucella spp.

    Directory of Open Access Journals (Sweden)

    Lívia de Lima Orzil

    2016-05-01

    Full Text Available ABSTRACT: A multiplex PCR technique for detection of Brucella spp. in samples of bacterial suspension was validated as a complementary tool in the diagnosis of the disease. This technique allows the characterization of the agent without performing biochemical tests, which greatly reduces the time for a final diagnosis, and provides more security for the analyst by reducing the time of exposure to microorganisms. The validation was performed in accordance with the Manual of Diagnostic Tests from OIE (2008 and following the requirements present in the ABNT NBR ISO/IEC 17025:2005. The mPCR validated in this study identified the different species of Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis of bacterial suspension obtained from the slaughterhouse samples, as well as distinguished the biovars (1, 2 e 4; 3b, 5, 6 e 9 of B. abortus in grouped form and differentiated the field strains from vaccine strains, as a quick, useful and less expensive technique in diagnosis of brucellosis in Brazil.

  13. PCR-based identification of drowning: four case reports.

    Science.gov (United States)

    Rácz, Evelin; Könczöl, Franciska; Tóth, Dénes; Patonai, Zoltán; Porpáczy, Zoltán; Kozma, Zsolt; Poór, Viktor S; Sipos, Katalin

    2016-09-01

    Proper diagnosis in drowning victims is often difficult due to the lack of signs specific to drowning. The diatom test is a widely used procedure for the diagnosis. Some types of water contain only minimal amounts of diatom cells which may provide false-negative results, while a negative diatom test result does not exclude drowning. In proving drowning, we used a polymerase chain reaction (PCR)-based biological method in addition to the conventional methods. DNA was extracted from postmortem spleen tissues and water of the drowning site. Samples were tested with algae (diatoms and small green algae)- and cyanobacteria (blue-green algae)-specific primers. We present here multiple drowning cases in which diatom tests of the postmortem tissue samples and the water were negative. In each case, the presence of phytoplanktonic DNA strengthened the autopsy diagnosis of drowning even in the absence of visible diatoms. In the future, the PCR method may be of consideration as a possible supplement of the diatom test in the examination of presumed drowning cases.

  14. Diagnosis and identification of Leishmania spp. from Giemsa-stained slides, by real-time PCR and melting curve analysis in south-west of Iran.

    Science.gov (United States)

    Khademvatan, S; Neisi, N; Maraghi, S; Saki, J

    2011-12-01

    The aim of present study was describing a real-time PCR assay for the diagnosis and direct identification of Leishmania species on Giemsa-stained slides in south-west of Iran. Altogether, 102 Giemsa-stained slides were collected from different part of south-west of Iran between 2008 and 2011. All the Giemsa-stained slides were examined under light microscope. After DNA extraction, real-time PCR amplification and detection were conducted with fluorescent SYBR Green I. For identification, PCR products were analysed with melting curve analysis. One hundred and two archived slides from suspected lesion examined by microscopy and real-time PCR. The sensitivity of the real-time PCR on Giemsa-stained slid was 98% (96/102). The melting curve analysis (T(m)) were 88·3±0·2°C for L. tropica (MHOM/IR/02/Mash10), 86·5±0·2°C for L. major (MHOM/IR/75/ER) and 89·4±0·3°C for L. infantum (MCAN/IR/97/LON 49), respectively. This study is first report in use of real-time PCR for diagnosis and identification of Leishmania spp. in Iran. Up to now, in Iran, the majority of identification of Leishmania species is restriction fragment length polymorphism (PCR-RFLP) of ITS1 and kinetoplast DNA. Our data showed that Giemsa-stained slides that were stored more than 3 years, can be use for Leishmania DNA extraction and amplification by real-time PCR. Compared to conventional PCR-based methods, the real-time PCR is extremely rapid with results and more samples can be processed at one time.

  15. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Identification of Reference Genes for Real-Time Quantitative PCR Experiments in the Liverwort Marchantia polymorpha

    OpenAIRE

    Denis Saint-Marcoux; Hélène Proust; Liam Dolan; Langdale, Jane A

    2015-01-01

    Real-time quantitative polymerase chain reaction (qPCR) has become widely used as a method to compare gene transcript levels across different conditions. However, selection of suitable reference genes to normalize qPCR data is required for accurate transcript level analysis. Recently, Marchantia polymorpha has been adopted as a model for the study of liverwort development and land plant evolution. Identification of appropriate reference genes has therefore become a necessity for gene expressi...

  17. [PCR-derived technology in gene identification and typing of Yersinia pestis].

    Science.gov (United States)

    Wang, Mei; Tang, Xinyuan; Wang, Zuyun

    2015-01-01

    Application of the PCR-derived technology in gene identification and genotypes of different ecotype Yersinia pestis to make the high-throughput experimental results can reflect the epidemic history and compare the diversity in genome, pathogenicity, so that results from these experiments provide an important basis for clinical diagnosis, treatment and origin. But the experiment should be considered typing ability, practicality, budget and other experimental factors or conditions, because each PCR-derivative technology has advantages and disadvantages.

  18. Impact of a Rapid Herpes Simplex Virus PCR Assay on Duration of Acyclovir Therapy.

    Science.gov (United States)

    Van, Tam T; Mongkolrattanothai, Kanokporn; Arevalo, Melissa; Lustestica, Maryann; Dien Bard, Jennifer

    2017-05-01

    Herpes simplex virus (HSV) infections of the central nervous system (CNS) are associated with significant morbidity and mortality rates in children. This study assessed the impact of a direct HSV (dHSV) PCR assay on the time to result reporting and the duration of acyclovir therapy for children with signs and symptoms of meningitis and encephalitis. A total of 363 patients with HSV PCR results from cerebrospinal fluid (CSF) samples were included in this retrospective analysis, divided into preimplementation and postimplementation groups. For the preimplementation group, CSF testing was performed using a laboratory-developed real-time PCR assay; for the postimplementation group, CSF samples were tested using a direct sample-to-answer assay. All CSF samples were negative for HSV. Over 60% of patients from both groups were prescribed acyclovir. The average HSV PCR test turnaround time for the postimplementation group was reduced by 14.5 h (23.6 h versus 9.1 h; P < 0.001). Furthermore, 79 patients (43.6%) in the postimplementation group had dHSV PCR results reported <4 h after specimen collection. The mean time from specimen collection to acyclovir discontinuation was 17.1 h shorter in the postimplementation group (31.1 h versus 14 h; P < 0.001). The median duration of acyclovir therapy was also significantly reduced in the postimplementation group (29.2 h versus 14.3 h; P = 0.01). Our investigation suggests that implementation of rapid HSV PCR testing can decrease turnaround times and the duration of unnecessary acyclovir therapy. Copyright © 2017 American Society for Microbiology.

  19. Molecular Detection and Species-Specific Identification of Medically Important Aspergillus Species by Real-Time PCR in Experimental Invasive Pulmonary Aspergillosis ▿

    Science.gov (United States)

    Walsh, Thomas J.; Wissel, Mark C.; Grantham, Kevin J.; Petraitiene, Ruta; Petraitis, Vidmantas; Kasai, Miki; Francesconi, Andrea; Cotton, Margaret P.; Hughes, Johanna E.; Greene, Lora; Bacher, John D.; Manna, Pradip; Salomoni, Martin; Kleiboeker, Steven B.; Reddy, Sushruth K.

    2011-01-01

    Diagnosis of invasive pulmonary aspergillosis (IPA) remains a major challenge to clinical microbiology laboratories. We developed rapid and sensitive quantitative PCR (qPCR) assays for genus- and species-specific identification of Aspergillus infections by use of TaqMan technology. In order to validate these assays and understand their potential diagnostic utility, we then performed a blinded study of bronchoalveolar lavage (BAL) fluid specimens from well-characterized models of IPA with the four medically important species. A set of real-time qPCR primers and probes was developed by utilizing unique ITS1 regions for genus- and species-specific detection of the four most common medically important Aspergillus species (Aspergillus fumigatus, A. flavus, A. niger, and A. terreus). Pan-Aspergillus and species-specific qPCRs with BAL fluid were more sensitive than culture for detection of IPA caused by A. fumigatus in untreated (P PCR amplification from BAL fluid yielded similar sensitivities for untreated and treated animals. Pan-Aspergillus PCR was more sensitive than culture for detection of A. flavus in treated animals (P = 0.002). BAL fluid pan-Aspergillus and species-specific PCRs were comparable in sensitivity to BAL fluid galactomannan (GM) assay. The copy numbers from the qPCR assays correlated with quantitative cultures to determine the pulmonary residual fungal burdens in lung tissue. Pan-Aspergillus and species-specific qPCR assays may improve the rapid and accurate identification of IPA in immunocompromised patients. PMID:21976757

  20. Standardization of a multiplex PCR for the identification of coagulase-positive Staphylococcus

    Directory of Open Access Journals (Sweden)

    Eliezer Avila Gandra

    2011-12-01

    Full Text Available The enterotoxigenic species Staphylococcus aureus, S. hyicus and S. intermedius show very similar characteristics, making their identification through conventional microbiological methods difficult. This study aimed at the development of a Multiplex PCR (mPCR for the identification of S. aureus, S. intermedius and S. hyicus using the nuc gene as the target sequence. The results obtained suggest that the set of primers used was specific for the three species of Staphylococcus evaluate with a detection limit of 10² CFU.mL-1.

  1. Rapid identification of single microbes by various Raman spectroscopic techniques

    Science.gov (United States)

    Rösch, Petra; Harz, Michaela; Schmitt, Michael; Peschke, Klaus-Dieter; Ronneberger, Olaf; Burkhardt, Hans; Motzkus, Hans-Walter; Lankers, Markus; Hofer, Stefan; Thiele, Hans; Popp, Jürgen

    2006-02-01

    A fast and unambiguous identification of microorganisms is necessary not only for medical purposes but also in technical processes such as the production of pharmaceuticals. Conventional microbiological identification methods are based on the morphology and the ability of microbes to grow under different conditions on various cultivation media depending on their biochemical properties. These methods require pure cultures which need cultivation of at least 6 h but normally much longer. Recently also additional methods to identify bacteria are established e.g. mass spectroscopy, polymerase chain reaction (PCR), flow cytometry or fluorescence spectroscopy. Alternative approaches for the identification of microorganisms are vibrational spectroscopic techniques. With Raman spectroscopy a spectroscopic fingerprint of the microorganisms can be achieved. Using UV-resonance Raman spectroscopy (UVRR) macromolecules like DNA/RNA and proteins are resonantly enhanced. With an excitation wavelength of e.g. 244 nm it is possible to determine the ratio of guanine/cytosine to all DNA bases which allows a genotypic identification of microorganisms. The application of UVRR requires a large amount of microorganisms (> 10 6 cells) e.g. at least a micro colony. For the analysis of single cells micro-Raman spectroscopy with an excitation wavelength of 532 nm can be used. Here, the obtained information is from all type of molecules inside the cells which lead to a chemotaxonomic identification. In this contribution we show how wavelength dependent Raman spectroscopy yields significant molecular information applicable for the identification of microorganisms on a single cell level.

  2. Comparison of the BAX System with a multiplex PCR method for simultaneous detection and identification of Campylobacter jejuni and Campylobacter coli in environmental samples.

    Science.gov (United States)

    Manfreda, Gerardo; De Cesare, Alessandra; Bondioli, Valentina; Franchini, Achille

    2003-11-01

    The Campylobacter detection is performed by conventional culture methods and the identification of Campylobacter jejuni and Campylobacter coli is principally based on the hippurate hydrolysis test. The two major drawbacks of this biochemical test for species identification include the inconsistency of the results and the presence of atypical strains, which can lead to the misidentification of an isolate. As an alternative, multiplex polymerase chain reaction (mPCR) protocols for the simultaneous detection and identification of different Campylobacter species have been developed. This study examined the performances of an experimental BAX System assay for the C. jejuni and C. coli identification in comparison to a multiplex PCR protocol recently published. The samples tested were represented by 106 environmental swabs collected on Teflon strips and tables, stainless steel saws, hooks and trays, ceramic floors and walls, as well as equipment surfaces, located in a swine (N=50) and a poultry (N=56) slaughterhouse. The highest Campylobacter detection rate was obtained after 48 h of enrichment by using both the PCR procedures. After 24 h, the BAX System provides a more rapid and accurate Campylobacter detection and identification assay than the multiplex PCR. Except for two samples, all the broths where Campylobacter cells were detected after 24 or 48 h of enrichment, with at least one of the PCR protocols, gave Campylobacter colonies using the culture method.

  3. Rapid identification of the medicinal plant Taraxacum formosanum ...

    African Journals Online (AJOL)

    Rapid identification of the medicinal plant Taraxacum formosanum and distinguishing of this plant from its adulterants by ribosomal DNA internal transcribed spacer (ITS) based DNA barcode. YC Chiang, WT Chang, MD Chen, GH Lai, HJ Chen, J Chao, MK Lin, YS Chang, YM Chou, MS Lee, MS Lee ...

  4. Development of rapid phenotypic system for the identification of ...

    Indian Academy of Sciences (India)

    Rapid and accurate identification of bacterial pathogens is a fundamental goal of clinical microbiology. The diagnosis and surveillance of diseases is dependent, to a great extent, on laboratory services, which cannot function without effective reliable reagents and diagnostics. Despite the advancement in microbiology ...

  5. Rapid identification of Candida species by confocal Raman microspectroscopy

    NARCIS (Netherlands)

    K. Maquelin (Kees); L.P. Choo-Smith; H.P. Endtz (Hubert); H.A. Bruining (Hajo); G.J. Puppels (Gerwin)

    2002-01-01

    textabstractCandida species are important nosocomial pathogens associated with high mortality rates. Rapid detection and identification of Candida species can guide a clinician at an early stage to prescribe antifungal drugs or to adjust empirical therapy when resistant species are

  6. Identification of Chicken Originated Campylobacter coli and Campylobacter jejuni by Polymerase Chain Reaction (PCR)

    OpenAIRE

    ERTAŞ, Hasan Basri; ÇETİNKAYA, Burhan; MUZ, Adile; ÖNGÖR, Hasan

    2014-01-01

    The purpose of this study was to isolate Campylobacter species from the intestines and livers of chicken and to identify Campylobacter coli and Campylobacter jejuni by both conventional methods and Polymerase Chain Reaction (PCR). Four specific primers derived from the ceuE gene present in the genomes of C. coli and C. jejuni were used for PCR identification. In the examination of 150 intestine and liver samples by culture and PCR, 25 (16.6%) and 32 (21.3%) were identified as C. coli and C...

  7. Autoclave method for rapid preparation of bacterial PCR-template DNA.

    Science.gov (United States)

    Simmon, Keith E; Steadman, Dewey D; Durkin, Sarah; Baldwin, Amy; Jeffrey, Wade H; Sheridan, Peter; Horton, Rene; Shields, Malcolm S

    2004-02-01

    An autoclave method for preparing bacterial DNA for PCR template is presented, it eliminates the use of detergents, organic solvents, and mechanical cellular disruption approaches, thereby significantly reducing processing time and costs while increasing reproducibility. Bacteria are lysed by rapid heating and depressurization in an autoclave. The lysate, cleared by microcentrifugation, was either used directly in the PCR reaction, or concentrated by ultrafiltration. This approach was compared with seven established methods of DNA template preparation from four bacterial sources which included boiling Triton X-100 and SDS, bead beating, lysozyme/proteinase K, and CTAB lysis method components. Bacteria examined were Enterococcus and Escherichia coli, a natural marine bacterial community and an Antarctic cyanobacterial-mat. DNAs were tested for their suitability as PCR templates by repetitive element random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE) analysis. The autoclave method produced PCR amplifiable template comparable or superior to the other methods, with greater reproducibility, much shorter processing time, and at a significantly lower cost.

  8. Use of PCR-restriction fragment length polymorphism analysis for identification of yeast species isolated from bovine intramammary infection.

    Science.gov (United States)

    Fadda, M E; Pisano, M B; Scaccabarozzi, L; Mossa, V; Deplano, M; Moroni, P; Liciardi, M; Cosentino, S

    2013-01-01

    This study reports a rapid PCR-based technique using a one-enzyme RFLP for discrimination of yeasts isolated from bovine clinical and subclinical mastitis milk samples. We analyzed a total of 1,486 milk samples collected over 1 yr in south Sardinia and northern Italy, and 142 yeast strains were preliminarily grouped based on their cultural morphology and physiological characteristics. Assimilation tests were conducted using the identification kit API ID 32C and APILAB Plus software (bioMérieux, Marcy l'Etoile, France). For PCR-RFLP analysis, the 18S-ITS1-5.8S ribosomal(r)DNA region was amplified and then digested with HaeIII, and dendrogram analysis of RFLP fragments was carried out. Furthermore, within each of the groups identified by the API or PCR-RFLP methods, the identification of isolates was confirmed by sequencing of the D1/D2 region using an ABI Prism 310 automatic sequencer (Applied Biosystems, Foster City, CA). The combined phenotypic and molecular approach enabled the identification of 17 yeast species belonging to the genera Candida (47.9%), Cryptococcus (21.1%), Trichosporon (19.7%), Geotrichum (7.1%), and Rhodotorula (4.2%). All Candida species were correctly identified by the API test and their identification confirmed by sequencing. All strains identified with the API system as Geotrichum candidum, Cryptococcus uniguttulatus, and Rhodotorula glutinis also produced characteristic restriction patterns and were confirmed as Galactomyces geotrichum (a teleomorph of G. candidum), Filobasidium uniguttulatum (teleomorph of Crypt. uniguttulatus), and R. glutinis, respectively, by D1/D2 rDNA sequencing. With regard to the genus Trichosporon, preliminary identification by API was problematic, whereas the RFLP technique used in this study gave characteristic restriction profiles for each species. Moreover, sequencing of the D1/D2 region allowed not only successful identification of Trichosporon gracile where API could not, but also correct identification of

  9. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae.

    Directory of Open Access Journals (Sweden)

    Dongmei Li

    Full Text Available Spider mites of the genus Tetranychus are difficult to identify due to their limited diagnostic characters. Many of them are morphologically similar and males are needed for species-level identification. Tetranychus urticae is a common interception and non-regulated pest at New Zealand's borders, however, most of the intercepted specimens are females and the identification was left at Tetranychus sp. Consequently, the shipments need to be fumigated. DNA sequencing and PCR-restriction fragment length polymorphism (PCR-RFLP protocols could be used to facilitate the accurate identification. However, in the context of border security practiced in New Zealand, insect identifications are required to be provided within four hours of receiving the samples; thus, those molecular methods are not sufficient to meet this requirement. Therefore, a real-time PCR TaqMan assay was developed for identification of T. urticae by amplification of a 142 bp Internal Transcribed Spacer (ITS 1 sequence. The developed assay is rapid, detects all life stages of T. urticae within three hours, and does not react with closely related species. Plasmid DNA containing ITS1 sequence of T. uritcae was serially diluted and used as standards in the real-time PCR assay. The quantification cycle (Cq value of the assay depicted a strong linear relationship with T. urticae DNA content, with a regression coefficient of 0.99 and efficiency of 98%. The detection limit was estimated to be ten copies of the T. urticae target region. The assay was validated against a range of T. urticae specimens from various countries and hosts in a blind panel test. Therefore the application of the assay at New Zealand will reduce the unnecessary fumigation and be beneficial to both the importers and exporters. It is expected that the implementation of this real-time PCR assay would have wide applications in diagnostic and research agencies worldwide.

  10. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae).

    Science.gov (United States)

    Li, Dongmei; Fan, Qing-Hai; Waite, David W; Gunawardana, Disna; George, Sherly; Kumarasinghe, Lalith

    2015-01-01

    Spider mites of the genus Tetranychus are difficult to identify due to their limited diagnostic characters. Many of them are morphologically similar and males are needed for species-level identification. Tetranychus urticae is a common interception and non-regulated pest at New Zealand's borders, however, most of the intercepted specimens are females and the identification was left at Tetranychus sp. Consequently, the shipments need to be fumigated. DNA sequencing and PCR-restriction fragment length polymorphism (PCR-RFLP) protocols could be used to facilitate the accurate identification. However, in the context of border security practiced in New Zealand, insect identifications are required to be provided within four hours of receiving the samples; thus, those molecular methods are not sufficient to meet this requirement. Therefore, a real-time PCR TaqMan assay was developed for identification of T. urticae by amplification of a 142 bp Internal Transcribed Spacer (ITS) 1 sequence. The developed assay is rapid, detects all life stages of T. urticae within three hours, and does not react with closely related species. Plasmid DNA containing ITS1 sequence of T. uritcae was serially diluted and used as standards in the real-time PCR assay. The quantification cycle (Cq) value of the assay depicted a strong linear relationship with T. urticae DNA content, with a regression coefficient of 0.99 and efficiency of 98%. The detection limit was estimated to be ten copies of the T. urticae target region. The assay was validated against a range of T. urticae specimens from various countries and hosts in a blind panel test. Therefore the application of the assay at New Zealand will reduce the unnecessary fumigation and be beneficial to both the importers and exporters. It is expected that the implementation of this real-time PCR assay would have wide applications in diagnostic and research agencies worldwide.

  11. Non-Invasive Cytology Brush PCR for the Diagnosis and Causative Species Identification of American Cutaneous Leishmaniasis in Peru

    Science.gov (United States)

    Alba, Milena; Adaui, Vanessa; Arevalo, Jorge; Low, Donald E.; Llanos-Cuentas, Alejandro; Boggild, Andrea K.

    2012-01-01

    Background Traditional methods of detecting Leishmania from cutaneous lesions involve invasive diagnostic procedures, such as scrapings, which cause discomfort, require technical expertise, and carry risks of invasive procedures. We compared the performance of 2 novel, molecular-based non-invasive methods for the diagnosis of cutaneous leishmaniasis (CL). Methods Consecutive patients presenting to the Leishmania Clinic at the Hospital Nacional Cayetano Heredia were enrolled. PCR was performed on filter paper lesion impressions (FPLIs), cytology brushes, and lancets for detection of Leishmania DNA. Smears from lesion scrapings and leishmanin skin test were also performed. Outcome measures were sensitivity and specificity. Composite reference standard was any 2 of 5 tests positive. Species identification was performed by PCR assays of positive specimens. Results Ninety patients with 129 lesions were enrolled, 117 of which fulfilled reference criteria for a diagnosis of CL. Of these 117 lesions, 113 were positive by PCR of lancets used for lesion scrapings versus 116 by PCR of FPLIs (p = 0.930) or 116 by PCR of cytology brushes (p = 0.930). Sensitivity and specificity of PCR on lancets were 96.6% [95% CI 93.3–99.9%] and 100%, respectively. Sensitivity and specificity of FPLI PCR were 99.1% [95% CI 97.4–100%] and 100%, respectively. Sensitivity and specificity of cytology brush PCR were 99.1% [95% CI 97.4–100%] and 100%, respectively. Giemsa-stained lesion smear and leishmanin skin test had inferior sensitivities at 47.9% [95% CI 38.9–57.0%] and 82.3% [95% CI 73.9–90.7%], respectively, compared to PCR of invasive or non-invasive specimens (p<0.001). Conclusions Cytology brush PCR constitutes a sensitive and specific alternative to traditional diagnostic assays performed on invasive specimens such as lesion scrapings. It performs comparatively to non-invasive FPLI PCR. This novel, rapid, and well-tolerated method has the potential for widespread use in

  12. Development of a real-time SYBR Green PCR assay for the rapid detection of Dermatophilus congolensis.

    Science.gov (United States)

    García, Alfredo; Martínez, Remigio; Benitez-Medina, José Manuel; Risco, David; Garcia, Waldo Luis; Rey, Joaquín; Alonso, Juan Manuel; Hermoso de Mendoza, Javier

    2013-01-01

    Methods such as real time (RT)-PCR have not been developed for the rapid detection and diagnosis of Dermatophilus (D.) congolensis infection. In the present study, a D. congolensis-specific SYBR Green RT-PCR assay was evaluated. The detection limit of the RT-PCR assay was 1 pg of DNA per PCR reaction. No cross-reaction with nucleic acids extracted from Pseudomonas aeruginosa, Mycobacterium tuberculosis, Staphylococcus aureus, or Austwickia chelonae was observed. Finally, the RT-PCR assay was used to evaluate clinical samples collected from naturally infected animals with D. congolensis. The results showed that this assay is a fast and reliable method for diagnosing dermatophilosis.

  13. Development of a real-time SYBR Green PCR assay for the rapid detection of Dermatophilus congolensis

    OpenAIRE

    García, Alfredo; Martínez, Remigio; Benitez-Medina, José Manuel; Risco, David; García, Waldo Luis; Rey, Joaquín; Alonso, Juan Manuel; de Mendoza, Javier Hermoso

    2013-01-01

    Methods such as real time (RT)-PCR have not been developed for the rapid detection and diagnosis of Dermatophilus (D.) congolensis infection. In the present study, a D. congolensis-specific SYBR Green RT-PCR assay was evaluated. The detection limit of the RT-PCR assay was 1 pg of DNA per PCR reaction. No cross-reaction with nucleic acids extracted from Pseudomonas aeruginosa, Mycobacterium tuberculosis, Staphylococcus aureus, or Austwickia chelonae was observed. Finally, the RT-PCR assay was ...

  14. Rapid and accurate identification of microorganisms contaminating cosmetic products based on DNA sequence homology.

    Science.gov (United States)

    Fujita, Y; Shibayama, H; Suzuki, Y; Karita, S; Takamatsu, S

    2005-12-01

    The aim of this study was to develop rapid and accurate procedures to identify microorganisms contaminating cosmetic products, based on the identity of the nucleotide sequences of the internal transcribed spacer (ITS) region of the ribosomal RNA coding DNA (rDNA). Five types of microorganisms were isolated from the inner portion of lotion bottle caps, skin care lotions, and cleansing gels. The rDNA ITS region of microorganisms was amplified through the use of colony-direct PCR or ordinal PCR using DNA extracts as templates. The nucleotide sequences of the amplified DNA were determined and subjected to homology search of a publicly available DNA database. Thereby, we obtained DNA sequences possessing high similarity with the query sequences from the databases of all the five organisms analyzed. The traditional identification procedure requires expert skills, and a time period of approximately 1 month to identify the microorganisms. On the contrary, 3-7 days were sufficient to complete all the procedures employed in the current method, including isolation and cultivation of organisms, DNA sequencing, and the database homology search. Moreover, it was possible to develop the skills necessary to perform the molecular techniques required for the identification procedures within 1 week. Consequently, the current method is useful for rapid and accurate identification of microorganisms, contaminating cosmetics.

  15. Species-specific PCR for the identification of Cooperia curticei (Nematoda: Trichostrongylidae) in sheep.

    Science.gov (United States)

    Amarante, M R V; Bassetto, C C; Neves, J H; Amarante, A F T

    2014-12-01

    Agricultural ruminants usually harbour mixed infections of gastrointestinal nematodes. A specific diagnosis is important because distinct species can differ significantly in their fecundity and pathogenicity. Haemonchus spp. and Cooperia spp. are the most important gastrointestinal nematodes infecting ruminants in subtropical/tropical environments. In Brazil, C. punctata is more adapted to cattle than sheep. Additionally, C. spatulata appears to be more adapted to cattle, whereas C. curticei is more adapted to sheep. However, infection of sheep with C. punctata is common when cattle and sheep share the same pasture. Although morphological analyses have been widely used to identify nematodes, molecular methods can overcome technical limitations and help improve species-specific diagnoses. Genetic markers in the first and second internal transcribed spacers (ITS-1 and ITS-2, respectively) of nuclear ribosomal DNA (rDNA) have been used successfully to detect helminths. In the present study, the ITS-1 region was analysed and used to design a species-specific oligonucleotide primer pair to identify C. curticei. The polymerase chain reaction (PCR) product was sequenced and showed 97% similarity to C. oncophora partial ITS-1 clones and 99% similarity to the C. curticei sequence JF680982. The specificity of this primer pair was corroborated by the analysis of 17 species of helminths, including C. curticei, C. punctata and C. spatulata. Species-specific diagnosis, which has implications for rapid and reliable identification, can support studies on the biology, ecology and epidemiology of trichostrongylid nematodes in a particular geographical location.

  16. Development of a real-time PCR method for the identification of Atlantic mackerel (Scomber scombrus).

    Science.gov (United States)

    Velasco, Amaya; Sánchez, Ana; Martínez, Icíar; Santaclara, Francisco J; Pérez-Martín, Ricardo I; Sotelo, Carmen G

    2013-12-01

    A Real Time-PCR method based on TaqMan technology for the identification of Scomber scombrus has been developed. A system of specific primers and a Minor Groove Binding (MGB) TaqMan probe based on sequences of the mitochondrial cytochrome b region was designed. The method was successfully tested in 81 specimens of S. scombrus and related species and validated in 26 different commercial samples. An average Threshold Cycle (Ct) value of 15.3 was obtained with S. scombrus DNA. With the other species tested fluorescence signal was not detected or Ct was significantly higher (P<0.001). The efficiency of the assay was estimated to be 92.41%, with 100% specificity, and no cross reactivity was detected with any other species. These results reveal that the developed method is a rapid and efficient tool to unequivocally identify S. scombrus and may aid in the prevention of fraud or mislabelling in mackerel products. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. A novel real time PCR assay using melt curve analysis for ivory identification.

    Science.gov (United States)

    Kitpipit, Thitika; Penchart, Kitichaya; Ouithavon, Kanita; Satasook, Chutamas; Linacre, Adrian; Thanakiatkrai, Phuvadol

    2016-10-01

    Demand for ivory and expansion of human settlements have resulted in a rapid decline in the number of elephants. Enforcement of local and international laws and regulations requires identification of the species from which any ivory, or ivory products, originated. Further geographical assignment of the dead elephant from which the ivory was taken can assist in forensic investigations. In this study, a real-time PCR assay using melt curve analysis was developed and fully validated for forensic use. The presence or absence of three Elephantidae-specific and elephant species-specific melting peaks was used to identify the elephant species. Using 141 blood and ivory samples from the three extant elephant species, the assay demonstrated very high reproducibility and accuracy. The limit of detection was as low as 0.031ng of input DNA for conventional amplification and 0.002ng for nested amplification. Both DNA concentrations are typically encountered in forensic casework, especially for degraded samples. No cross-reactivity was observed for non-target species. Evaluation of direct amplification and nested amplification demonstrated the assay's flexibility and capability of analyzing low-template DNA samples and aged samples. Additionally, blind trial testing showed the assay's suitability application in real casework. In conclusion, wildlife forensic laboratories could use this novel, quick, and low-cost assay to help combat the continuing poaching crises leading to the collapse of elephant numbers in the wild. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. Rapid and sensitive detection of salmonid alphavirus using TaqMan real-time PCR.

    Science.gov (United States)

    Shi, Wen; Song, Aochen; Gao, Shuai; Wang, Yuting; Tang, Lijie; Xu, Yigang; Ren, Tong; Li, Yijing; Liu, Min

    2017-08-01

    Salmonid alphavirus (SAV) infection has led to the spread of salmon pancreas disease (PD) and sleeping disease (SD) to salmonids in several countries in Europe, resulting in tremendous economic losses to the fish farming industry. Recently, with increases in the fish import trade, many countries in which SAV has been unreported, such as China, may be seriously threatened by these diseases. It is therefore necessary to develop efficient detection methods for the prevention and diagnosis of SAV infection. In this study, a rapid and sensitive TaqMan real-time PCR method was established and assessed for this purpose. A specificity assay showed no cross-reactions with other common RNA viruses. Regression analysis and standard curves calculated from the Ct values of 10-fold serial dilutions of the standard plasmid showed that the assay was highly reproducible over a wide range of RNA input concentrations. The real-time PCR assay was able to detect SAV at a concentration as low as 1.5 × 10 1 copies, indicating that it is 10 7 times more sensitive than the approved conventional RT-PCR method (detection limit, 1.5 × 10 7 copies) after use on the same samples. Assessment of infected fish samples showed that this assay has a higher sensitivity than the previously reported Q_nsP1 assay. Thus, this TaqMan real-time PCR assay provides a rapid, sensitive, and specific detection method for SAV, offering improved technical support for the clinical diagnosis and epidemiology of SAV. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Development of a high-speed real-time PCR system for rapid and precise nucleotide recognition

    Science.gov (United States)

    Terazono, Hideyuki; Takei, Hiroyuki; Hattori, Akihiro; Yasuda, Kenji

    2010-04-01

    Polymerase chain reaction (PCR) is a common method used to create copies of a specific target region of a DNA sequence and to produce large quantities of DNA. A few DNA molecules, which act as templates, are rapidly amplified by PCR into many billions of copies. PCR is a key technology in genome-based biological analysis, revolutionizing many life science fields such as medical diagnostics, food safety monitoring, and countermeasures against bioterrorism. Thus, many applications have been developed with the thermal cycling. For these PCR applications, one of the most important key factors is reduction in the data acquisition time. To reduce the acquisition time, it is necessary to decrease the temperature transition time between the high and low ends as much as possible. We have developed a novel rapid real-time PCR system based on rapid exchange of media maintained at different temperatures. This system consists of two thermal reservoirs and a reaction chamber for PCR observation. The temperature transition was achieved within 0.3 sec, and good thermal stability was achieved during thermal cycling with rapid exchange of circulating media. This system allows rigorous optimization of the temperatures required for each stage of the PCR processes. Resulting amplicons were confirmed by electrophoresis. Using the system, rapid DNA amplification was accomplished within 3.5 min, including initial heating and complete 50 PCR cycles. It clearly shows that the device could allow us faster temperature switching than the conventional conduction-based heating systems based on Peltier heating/cooling.

  20. Multiplex one-step Real-time PCR by Taqman-MGB method for rapid detection of pan and H5 subtype avian influenza viruses.

    Directory of Open Access Journals (Sweden)

    Zhujun Zhang

    Full Text Available Avian influenza virus (AIV can infect a variety of avian species and mammals, leading to severe economic losses in poultry industry and posing a substantial threat to public health. Currently, traditional virus isolation and identification is inadequate for the early diagnosis because of its labor-intensive and time-consuming features. Real-time RT-PCR (RRT-PCR is an ideal method for the detection of AIV since it is highly specific, sensitive and rapid. In addition, as the new quencher MGB is used in RRT-PCR, it only needs shorter probe and helps the binding of target gene and probe. In this study, a pan-AIV RRT-PCR for the detection of all AIVs and H5-AIV RRT-PCR for detection of H5 AIV based on NP gene of AIV and HA gene of H5 AIV were successfully established using Taqman-MGB method. We tested 14 AIV strains in total and the results showed that the pan-AIV RRT-PCR can detect AIV of various HA subtypes and the H5-AIV RRT-PCR can detect H5 AIV circulating in poultry in China in recent three years, including H5 viruses of clade 7.2, clade 2.3.4.4 and clade 2.3.2.1. Furthermore, the multiplex detection limit for pan-AIV and H5-AIV RRT-PCR was 5 copies per reaction. When this multiplex method was applied in the detection of experimental and live poultry market samples, the detection rates of pan-AIV and H5 AIV in RRT-PCR were both higher than the routine virus isolation method with embryonated chicken eggs. The multiplex RRT-PCR method established in our study showed high sensitivity, reproducibility and specificity, suggesting the promising application of our method for surveillance of both pan AIV and prevalent H5 AIV in live poultry markets and clinical samples.

  1. Comparison of multiplex real-time PCR and PCR-reverse blot hybridization assay for the direct and rapid detection of bacteria and antibiotic resistance determinants in positive culture bottles.

    Science.gov (United States)

    Wang, Hye-Young; Kim, Seoyong; Kim, Jungho; Park, Soon Deok; Kim, Hyo Youl; Uh, Young; Lee, Hyeyoung

    2016-09-01

    The aim of this study was to evaluate the performance of a commercially available multiplex real-time PCR assay and a PCR-reverse blot hybridization assay (PCR-REBA) for the rapid detection of bacteria and identification of antibiotic resistance genes directly from blood culture bottles and to compare the results of these molecular assays with conventional culture methods. The molecular diagnostic methods were used to evaluate 593 blood culture bottles from patients with bloodstream infections. The detection positivity of multiplex real-time PCR assay for Gram-positive bacteria, Gram-negative bacteria and Candida spp. was equivalent to PCR-REBA as 99.6 %, 99.1 % and 100 %, respectively. Using conventional bacterial cultures as the gold standard, the sensitivity, specificity, positive predictive value and negative predictive value of these two molecular methods were 99.5 % [95 % confidence interval (CI), 0.980-1.000; PReal-methicillin-resistant Staphylococcusaureus multiplex real-time PCR assay targeting the mecA gene to detect methicillin resistance was lower than that of the PCR-REBA method, detecting an overall positivity of 98.4 % (n=182; 95 % CI, 0.964-1.000; P<0.009) and 99.5 % (n=184; 95 % CI, 0.985-1.000; P<0.0001), respectively. The entire two methods take about 3 h, while results from culture can take up to 48-72 h. Therefore, the use of these two molecular methods was rapid and reliable for the characterization of causative pathogens in bloodstream infections.

  2. Rapid detection and differentiation of mycobacterial species using a multiplex PCR system

    Directory of Open Access Journals (Sweden)

    Andrea Santos Lima

    2013-07-01

    Full Text Available Introduction The early diagnosis of mycobacterial infections is a critical step for initiating treatment and curing the patient. Molecular analytical methods have led to considerable improvements in the speed and accuracy of mycobacteria detection. Methods The purpose of this study was to evaluate a multiplex polymerase chain reaction system using mycobacterial strains as an auxiliary tool in the differential diagnosis of tuberculosis and diseases caused by nontuberculous mycobacteria (NTM Results Forty mycobacterial strains isolated from pulmonary and extrapulmonary origin specimens from 37 patients diagnosed with tuberculosis were processed. Using phenotypic and biochemical characteristics of the 40 mycobacteria isolated in LJ medium, 57.5% (n=23 were characterized as the Mycobacterium tuberculosis complex (MTBC and 20% (n=8 as nontuberculous mycobacteria (NTM, with 22.5% (n=9 of the results being inconclusive. When the results of the phenotypic and biochemical tests in 30 strains of mycobacteria were compared with the results of the multiplex PCR, there was 100% concordance in the identification of the MTBC and NTM species, respectively. A total of 32.5% (n=13 of the samples in multiplex PCR exhibited a molecular pattern consistent with NTM, thus disagreeing with the final diagnosis from the attending physician. Conclusions Multiplex PCR can be used as a differential method for determining TB infections caused by NTM a valuable tool in reducing the time necessary to make clinical diagnoses and begin treatment. It is also useful for identifying species that were previously not identifiable using conventional biochemical and phenotypic techniques.

  3. Rapid identification of nine species of diphyllobothriidean tapeworms by pyrosequencing

    Science.gov (United States)

    Thanchomnang, Tongjit; Tantrawatpan, Chairat; Intapan, Pewpan M.; Sanpool, Oranuch; Lulitanond, Viraphong; Tourtip, Somjintana; Yamasaki, Hiroshi; Maleewong, Wanchai

    2016-01-01

    The identification of diphyllobothriidean tapeworms (Cestoda: Diphyllobothriidea) that infect humans and intermediate/paratenic hosts is extremely difficult due to their morphological similarities, particularly in the case of Diphyllobothrium and Spirometra species. A pyrosequencing method for the molecular identification of pathogenic agents has recently been developed, but as of yet there have been no reports of pyrosequencing approaches that are able to discriminate among diphyllobothriidean species. This study, therefore, set out to establish a pyrosequencing method for differentiating among nine diphyllobothriidean species, Diphyllobothrium dendriticum, Diphyllobothrium ditremum, Diphyllobothrium latum, Diphyllobothrium nihonkaiense, Diphyllobothrium stemmacephalum, Diplogonoporus balaenopterae, Adenocephalus pacificus, Spirometra decipiens and Sparganum proliferum, based on the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene as a molecular marker. A region of 41 nucleotides in the cox1 gene served as a target, and variations in this region were used for identification using PCR plus pyrosequencing. This region contains nucleotide variations at 12 positions, which is enough for the identification of the selected nine species of diphyllobothriidean tapeworms. This method was found to be a reliable tool not only for species identification of diphyllobothriids, but also for epidemiological studies of cestodiasis caused by diphyllobothriidean tapeworms at public health units in endemic areas. PMID:27853295

  4. Rapid detection and differentiation of important Campylobacter spp. in poultry samples by dot blot and PCR.

    Science.gov (United States)

    Fontanot, Marco; Iacumin, Lucilla; Cecchini, Francesca; Comi, Giuseppe; Manzano, Marisa

    2014-10-01

    The detection of Campylobacter, the most commonly reported cause of foodborne gastroenteritis in the European Union, is very important for human health. The most commonly recognised risk factor for infection is the handling and/or consumption of undercooked poultry meat. The methods typically applied to evaluate the presence/absence of Campylobacter in food samples are direct plating and/or enrichment culture based on the Horizontal Method for Detection and Enumeration of Campylobacter spp. (ISO 10272-1B: 2006) and PCR. Molecular methods also allow for the detection of cells that are viable but cannot be cultivated on agar media and that decrease the time required for species identification. The current study proposes the use of two molecular methods for species identification: dot blot and PCR. The dot blot method had a sensitivity of 25 ng for detection of DNA extracted from a pure culture using a digoxigenin-labelled probe for hybridisation; the target DNA was extracted from the enrichment broth at 24 h. PCR was performed using a pair of sensitive and specific primers for the detection of Campylobacter jejuni and Campylobacter coli after 24 h of enrichment in Preston broth. The initial samples were contaminated by 5 × 10 C. jejuni cells/g and 1.5 × 10(2)C. coli cells/g, thus the number of cells present in the enrichment broth at 0 h was 1 or 3 cell/g, respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Poly Peak Parser: Method and software for identification of unknown indels using Sanger Sequencing of PCR products

    Science.gov (United States)

    Hill, Jonathon T.; Demarest, Bradley L.; Bisgrove, Brent W.; Su, Yi-chu; Smith, Megan; Yost, H. Joseph

    2015-01-01

    Background Genome editing techniques, including ZFN, TALEN and CRISPR, have created a need to rapidly screen many F1 individuals to identify carriers of indels and determine the sequences of the mutations. Current techniques require multiple clones of the targeted region to be sequenced for each individual, which is inefficient when many individuals must be analyzed. Direct Sanger sequencing of a PCR amplified region surrounding the target site is efficient, but Sanger sequencing genomes heterozygous for an indel results in a string of “double peaks” due to the mismatched region. Results In order to facilitate indel identification, we developed an online tool called Poly Peak Parser (available at http://yost.genetics.utah.edu/software.php) that is able to separate chromatogram data containing ambiguous base calls into wild-type and mutant allele sequences. This tool allows the nature of the indel to be determined from a single sequencing run per individual performed directly on a PCR product spanning the targeted site, without cloning. Conclusions The method and algorithm described here facilitate rapid identification and sequence characterization of heterozygous mutant carriers generated by genome editing. Although designed for screening F1 individuals, this tool can also be used to identify heterozygous indels in many contexts. PMID:25160973

  6. Ultra-fast DNA-based multiplex convection PCR method for meat species identification with possible on-site applications.

    Science.gov (United States)

    Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-08-15

    The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Detection of bacterial 16S rRNA and identification of four clinically important bacteria by real-time PCR.

    Directory of Open Access Journals (Sweden)

    Robert J Clifford

    Full Text Available Within the paradigm of clinical infectious disease research, Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa represent the four most clinically relevant, and hence most extensively studied bacteria. Current culture-based methods for identifying these organisms are slow and cumbersome, and there is increasing need for more rapid and accurate molecular detection methods. Using bioinformatic tools, 962,279 bacterial 16S rRNA gene sequences were aligned, and regions of homology were selected to generate a set of real-time PCR primers that target 93.6% of all bacterial 16S rRNA sequences published to date. A set of four species-specific real-time PCR primer pairs were also designed, capable of detecting less than 100 genome copies of A. baumannii, E. coli, K. pneumoniae, and P. aeruginosa. All primers were tested for specificity in vitro against 50 species of Gram-positive and -negative bacteria. Additionally, the species-specific primers were tested against a panel of 200 clinical isolates of each species, randomly selected from a large repository of clinical isolates from diverse areas and sources. A comparison of culture and real-time PCR demonstrated 100% concordance. The primers were incorporated into a rapid assay capable of positive identification from plate or broth cultures in less than 90 minutes. Furthermore, our data demonstrate that current targets, such as the uidA gene in E.coli, are not suitable as species-specific genes due to sequence variation. The assay described herein is rapid, cost-effective and accurate, and can be easily incorporated into any research laboratory capable of real-time PCR.

  8. Real-time PCR approach in dermatophyte detection and Trichophyton rubrum identification.

    Science.gov (United States)

    Kobylak, Natalia; Bykowska, Barbara; Nowicki, Roman; Brillowska-Dąbrowska, Anna

    2015-01-01

    Dermatophytes are keratinophilic molds that infect human hair, nails and skin. Diagnosis of dermatophytosis is based on morphological, serological and biochemical features. However, identification is difficult and laborious due to similarities between microorganisms. Thus, there is considerable interest to develop mycological diagnostic procedures based on molecular biology methods. In this study, fast, two-step DNA extraction method and real-time PCR was used for detection of dermatophytes DNA using pan-dermatophyte primers and identification of Trichophyton rubrum from pure cultures. The applied method allowed correct detection of all dermatophytes and correct identification of Trichophyton rubrum in less than 2 hours.

  9. Rapid Preclinical Detection of Sheeppox Virus by a Real-Time PCR Assay▿

    Science.gov (United States)

    Balinsky, C. A.; Delhon, G.; Smoliga, G.; Prarat, M.; French, R. A.; Geary, S. J.; Rock, D. L.; Rodriguez, L. L.

    2008-01-01

    Sheeppox virus (SPPV) is a member of the Capripoxvirus (CaPV) genus of the Poxviridae family. Members of this genus, which also include goatpox and lumpy skin disease viruses, cause economically significant disease in sheep, goats, and cattle. A rapid diagnostic assay for CaPV would be useful for disease surveillance as well as for detection of CaPV in clinical samples and for outbreak management. Here we describe a fluorogenic probe hydrolysis (TaqMan) PCR assay designed for rapid detection of CaPV and tested on sheep experimentally infected with a virulent strain of SPPV. This assay can detect SPPV in buffy coats, nasal swabs, oral swabs, scabs, and skin lesions as well as in lung and lymph nodes collected at necropsy. This single-tube diagnostic assay can be performed in 2 h or less and can detect viral DNA in preclinical, clinical, and postmortem samples. PMID:18032617

  10. Rapid preclinical detection of sheeppox virus by a real-time PCR assay.

    Science.gov (United States)

    Balinsky, C A; Delhon, G; Smoliga, G; Prarat, M; French, R A; Geary, S J; Rock, D L; Rodriguez, L L

    2008-02-01

    Sheeppox virus (SPPV) is a member of the Capripoxvirus (CaPV) genus of the Poxviridae family. Members of this genus, which also include goatpox and lumpy skin disease viruses, cause economically significant disease in sheep, goats, and cattle. A rapid diagnostic assay for CaPV would be useful for disease surveillance as well as for detection of CaPV in clinical samples and for outbreak management. Here we describe a fluorogenic probe hydrolysis (TaqMan) PCR assay designed for rapid detection of CaPV and tested on sheep experimentally infected with a virulent strain of SPPV. This assay can detect SPPV in buffy coats, nasal swabs, oral swabs, scabs, and skin lesions as well as in lung and lymph nodes collected at necropsy. This single-tube diagnostic assay can be performed in 2 h or less and can detect viral DNA in preclinical, clinical, and postmortem samples.

  11. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  12. Development of a novel multiplex PCR assay for rapid detection of virulence associated genes of Pasteurella multocida from pigs

    National Research Council Canada - National Science Library

    Rajkhowa, S

    2015-01-01

    Significance and Impact of the Study: The study reports the development and evaluation of a novel multiplex PCR assay for the rapid detection of 11 important VAGs of Pasteurella multocida isolates from pigs...

  13. Reverse transcription-PCR-electrospray ionization mass spectrometry for rapid detection of biothreat and common respiratory pathogens.

    Science.gov (United States)

    Jeng, Kevin; Hardick, Justin; Rothman, Richard; Yang, Samuel; Won, Helen; Peterson, Stephen; Hsieh, Yu-Hsiang; Masek, Billie Jo; Carroll, Karen C; Gaydos, Charlotte A

    2013-10-01

    Electrospray ionization mass spectrometry (ESI-MS) analysis of reverse transcription (RT)-PCR amplicons from human respiratory samples allows for broad pathogen identification approximately 8 h after collection. We investigated the performance characteristics of a high-throughput RT-PCR-coupled ESI-MS assay for distinguishing biothreat (BT) agents from common bacterial, fungal, and viral respiratory pathogens in bronchoalveolar lavage (BAL) fluid specimens from subjects with suspected respiratory infections. In a retrospective case series, 202 BAL fluid specimens were collected at the Johns Hopkins Hospital between August 2010 and February 2011 from patients with suspected acute respiratory infections. Samples were processed using standard bacterial, viral, and fungal testing in the clinical microbiology laboratory as part of routine care and then were blindly spiked with either water or nucleic acids from BT organisms (Bacillus anthracis, Yersinia pestis, Francisella tularensis, Brucella spp., Burkholderia spp., and Rickettsia prowazekii) and tested by RT-PCR-ESI-MS. The sensitivities and specificities of RT-PCR-ESI-MS versus standard clinical methods were as follows: for mock BT DNA, 98.5% sensitivity (95% confidence interval [CI], 94.2 to 99.7%) and 100% specificity (95% CI, 93.1 to 100.0%); for bacterial pathogens, 81.8% sensitivity (95% CI, 74.3 to 87.6%) and 73.6% specificity (95% CI, 64.2 to 81.4%); for viral pathogens, 93.3% sensitivity (95% CI, 66.0 to 99.7%) and 97.3% specificity (95% CI, 89.7 to 99.5%); for fungal pathogens, 42.6% sensitivity (95% CI, 29.5 to 56.7%) and 97.8% specificity (95% CI, 91.8 to 99.6%). Our data suggest that RT-PCR-ESI-MS is a useful adjunct to standard culture protocols for rapid detection of both BT and common respiratory pathogens; further study is required for assay validation, especially for fungal detection, and potential implementation.

  14. The Rotary Zone Thermal Cycler: A Low-Power System Enabling Automated Rapid PCR

    Science.gov (United States)

    Bartsch, Michael S.; Renzi, Ronald F.; Van de Vreugde, James L.; Kim, Hanyoup; Knight, Daniel L.; Sinha, Anupama; Branda, Steven S.; Patel, Kamlesh D.

    2015-01-01

    Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling) to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis. PMID:25826708

  15. New 16-plex PCR method for rapid detection of diarrheagenic Escherichia coli directly from stool samples.

    Science.gov (United States)

    Antikainen, J; Tarkka, E; Haukka, K; Siitonen, A; Vaara, M; Kirveskari, J

    2009-08-01

    A rapid 16-plex polymerase chain reaction (PCR) suitable for routine diagnostics of diarrheagenic Escherichia coli (EHEC, EIEC, EAEC, ETEC, and EPEC) was developed, validated with control strains, and tested with 250 diarrhoeal stool samples. The specificity was 100% when tested with 289 control bacterial strains, and the analytical sensitivity of automated DNA extraction directly from stool samples was made by boiling the bacterial culture (10(4)-10(5) colony forming units/ml). The assay design starting directly from extraction of stool DNA allowed same day analysis without compromising sensitivity and specificity, which makes it superior compared to PCR after culturing the bacteria. The 16-plex PCR method demonstrated high prevalence of diarrheagenic E. coli in stool samples of patients returning from abroad (39.0%) in contrast to the patients with no travel history (8.7%; p < 0.001). The high prevalence of diarrheagenic E. coli suggests that their screening should be part of normal diarrhoea diagnostics, at least in the leading diagnostic laboratories.

  16. Rapid PCR-based assay for Sclerotinia sclerotiorum detection on soybean seeds

    Directory of Open Access Journals (Sweden)

    Edilaine Mauricia Gelinski Grabicoski

    2015-02-01

    Full Text Available Caused by Sclerotinia sclerotiorum, white mold is an important seed-transmitted disease of soybean (Glycine max. Incubation-based methods available for the detection and quantification of seed-borne inoculum such as the blotter test, paper roll and Neon-S assay are time-consuming, laborious, and not always sensitive. In this study, we developed and evaluated a molecular assay for the detection of S. sclerotiorum in soybean seeds using a species-specific PCR (polymerase chain reaction primer set and seed soaking (without DNA extraction for up to 72 h. The PCR products were amplified in all the samples infected with the pathogen, but not in the other samples of plant material or the other seed-borne fungi DNA. The minimum amount of DNA detected was 10 pg, or one artificially infested seed in a 400-seed sample (0.25 % fungal incidence and one naturally infected seed in a 300-seed sample (0.33 % incidence. The PCR-based assay was rapid (< 9 h, did not require DNA extraction and was very sensitive.

  17. The rotary zone thermal cycler: a low-power system enabling automated rapid PCR.

    Directory of Open Access Journals (Sweden)

    Michael S Bartsch

    Full Text Available Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC, a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR amplification, and second strand cDNA synthesis.

  18. Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

    Directory of Open Access Journals (Sweden)

    Xian-Quan Cai

    2014-01-01

    Full Text Available Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.

  19. Quantitative real-time PCR (qPCR) assay for human-dog-cat species identification and nuclear DNA quantification.

    Science.gov (United States)

    Kanthaswamy, S; Premasuthan, A; Ng, J; Satkoski, J; Goyal, V

    2012-03-01

    In the United States, human forensic evidence collected from crime scenes is usually comingled with biomaterial of canine and feline origins. Knowledge of the concentration of nuclear DNA extracted from a crime scene biological sample and the species from which the sample originated is essential for DNA profiling. The ability to accurately detect and quantify target DNA in mixed-species samples is crucial when target DNA may be overwhelmed by non-target DNA. We have designed and evaluated a species-specific (human, dog and cat) nuclear DNA identification assay based on the TaqMan(®) quantitative real-time PCR (qPCR) technology that can simultaneously detect and measure minute quantities of DNA specific to either humans, dogs and/or cats. The fluorogenic triplex assay employs primers and hydrolysis probes that target the human TH01 locus as well as the dog and cat Melanocortin 1 Receptor (MC1R) sequences in a species-specific manner. We also demonstrate that the assay is a highly sensitive, reliable and robust method for identifying and quantifying mixed-species templates of human-dog-cat origin with as little as 0.4 pg of human and cat nuclear DNA, respectively, and 4.0 pg of dog nuclear DNA. Published by Elsevier Ireland Ltd.

  20. Rapid differentiation of mycobacteria by simplex real-time PCR with melting temperature calling analysis.

    Science.gov (United States)

    Lin, L; Yin, X; Wang, Q

    2015-09-01

    This study aimed to develop a rapid, simple and cost-effective method for the differentiation of Mycobacterium species. A total of 80 clinical mycobacterial isolates belonging to 12 different species and 16 reference strains of 16 different species were differentiated by the simplex real-time PCR coupled with melting temperature calling analysis. By comparing their melting profiles with those of the reference strains, all clinical mycobacterial isolates were differentiated as Mycobacterium tuberculosis complex or nontuberculous mycobacteria, and the latter were further divided into five groups. In comparison with 16S-23S internal transcribed spacer sequencing method as the gold standard method, both sensitivity and specificity of the assay were 100% when it was used for the differentiation between Myco. tuberculosis complex and nontuberculous mycobacteria. The simplex real-time PCR coupled with melting temperature calling analysis could be an alternative method for the differentiation between Myco. tuberculosis complex and nontuberculous mycobacteria. Rapid differentiation of mycobacteria could shorten the diagnostic time of mycobacterial diseases. It is also helpful for achieving optimal therapy and appropriate patient management. © 2015 The Society for Applied Microbiology.

  1. Rapid Color Test Identification System for Screening of Counterfeit Fluoroquinolone

    Directory of Open Access Journals (Sweden)

    B. K. Singh

    2009-01-01

    Full Text Available The protocol of rapid identification system consists of three chemical color reactions; two group tests for fluoroquinolone class and a compound specific test each for norfloxacin, ciprofloxacin, gatifloxacin, ofloxacin, levofloxacin and sparfloxacin. The group color reactions are based on (a Oxidizing behavior of quinolone and (b Fluorine functional groups, both of which are characteristic of fluoroquinolone class. The compound specific color reactions are developed taking into consideration unique chemical behavior of each compound. The proposed chemical color tests have high selectivity⁄specificity, are ideal for screening purpose. The color of each test was defined by two standard color systems namely CIE lab and Munsell color. A suspected counterfeit tablet of any of the above mentioned drugs can be identified within 10-15 min using this rapid identification system.

  2. Real-time PCR using mycobacteriophage DNA for rapid phenotypic drug susceptibility results for Mycobacterium tuberculosis.

    Science.gov (United States)

    Pholwat, Suporn; Ehdaie, Beeta; Foongladda, Suporn; Kelly, Kimberly; Houpt, Eric

    2012-03-01

    Managing drug-resistant Mycobacterium tuberculosis requires drug susceptibility testing, yet conventional drug susceptibility testing is slow, and molecular testing does not yield results for all antituberculous drugs. We addressed these challenges by utilizing real-time PCR of mycobacteriophage D29 DNA to evaluate the drug resistance of clinical M. tuberculosis isolates. Mycobacteriophages infect and replicate in viable bacterial cells faster than bacterial cells replicate and have been used for detection and drug resistance testing for M. tuberculosis either by using reporter cells or phages with engineered reporter constructs. Our primary protocol involved culturing M. tuberculosis isolates for 48 h with and without drugs at critical concentrations, followed by incubation with 10(3) PFU/ml of D29 mycobacteriophage for 24 h and then real-time PCR. Many drugs could be incubated instantly with M. tuberculosis and phage for 24 h alone. The change in phage DNA real-time PCR cycle threshold (C(T)) between control M. tuberculosis and M. tuberculosis treated with drugs was calculated and correlated with conventional agar proportion drug susceptibility results. Specifically, 9 susceptible clinical isolates, 22 multidrug-resistant (MDR), and 1 extensively drug-resistant (XDR) M. tuberculosis strains were used and C(T) control-C(T) drug cutoffs of between +0.3 and -6.0 yielded 422/429 (98%) accurate results for isoniazid, rifampin, streptomycin, ethambutol, amikacin, kanamycin, capreomycin, ofloxacin, moxifloxacin, ethionamide, para-aminosalicylic acid, cycloserine, and linezolid. Moreover, the ΔC(T) values correlated with isolate MIC for most agents. This D29 quantitative PCR assay offers a rapid, accurate, 1- to 3-day phenotypic drug susceptibility test for first- and second-line drugs and may suggest an approximate MIC.

  3. A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.

    Science.gov (United States)

    Chan, Kamfai; Wong, Pui-Yan; Yu, Peter; Hardick, Justin; Wong, Kah-Yat; Wilson, Scott A; Wu, Tiffany; Hui, Zoe; Gaydos, Charlotte; Wong, Season S

    2016-01-01

    The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR) and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR), thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.

  4. A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.

    Directory of Open Access Journals (Sweden)

    Kamfai Chan

    Full Text Available The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR, thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.

  5. The significance of gtf genes in caries expression: a rapid identification of Streptococcus mutans from dental plaque of child patients.

    Science.gov (United States)

    Mishra, Apurva; Pandey, Ramesh K; Manickam, Natesan

    2015-01-01

    Rapid phylogenetic and functional gene (gtfB) identification of S. mutans from the dental plaque derived from children. Dental plaque collected from fifteen patients of age group 7-12 underwent centrifugation followed by genomic DNA extraction for S. mutans. Genomic DNA was processed with S. mutans specific primers in suitable PCR condtions for phylogenetic and functional gene (gtfB) identification. The yield and results were confirmed by agarose gel electrophoresis. 1% agarose gel electrophoresis depicts the positive PCR amplification at 1,485 bp when compared with standard 1 kbp indicating the presence of S. mutans in the test sample. Another PCR reaction was set using gtfB primers specific for S. mutans for functional gene identification. 1.2% agarose gel electrophoresis was done and a positive amplication was observed at 192 bp when compared to 100 bp standards. With the advancement in molecular biology techniques, PCR based identification and quantification of the bacterial load can be done within hours using species-specific primers and DNA probes. Thus, this technique may reduce the laboratory time spend in conventional culture methods, reduces the possibility of colony identification errors and is more sensitive to culture techniques.

  6. Rapid detection and identification of human hookworm infections through high resolution melting (HRM analysis.

    Directory of Open Access Journals (Sweden)

    Romano Ngui

    Full Text Available BACKGROUND: Hookworm infections are still endemic in low and middle income tropical countries with greater impact on the socioeconomic and public health of the bottom billion of the world's poorest people. In this study, a real-time polymerase chain reaction (PCR coupled with high resolution melting-curve (HRM analysis was evaluated for an accurate, rapid and sensitive tool for species identification focusing on the five human hookworm species. METHODS: Real-time PCR coupled with HRM analysis targeting the second internal transcribed spacer (ITS-2 of nuclear ribosomal DNA as the genetic marker was used to identify and distinguish hookworm species in human samples. Unique and distinct characteristics of HRM patterns were produced for each of the five hookworm species. The melting curves were characterized by peaks of 79.24±0.05°C and 83.00±0.04°C for Necator americanus, 79.12±0.10°C for Ancylostoma duodenale, 79.40±0.10°C for Ancylostoma ceylanicum, 79.63±0.05°C for Ancylostoma caninum and 79.70±0.14°C for Ancylostoma braziliense. An evaluation of the method's sensitivity and specificity revealed that this assay was able to detect as low as 0.01 ng/µl hookworm DNA and amplification was only recorded for hookworm positive samples. CONCLUSION: The HRM assay developed in this study is a rapid and straightforward method for the diagnosis, identification and discrimination of five human hookworms. This assay is simple compared to other probe-based genotyping methods as it does not require multiplexing, DNA sequencing or post-PCR processing. Therefore, this method offers a new alternative for rapid detection of human hookworm species.

  7. Rapid detection and identification of human hookworm infections through high resolution melting (HRM) analysis.

    Science.gov (United States)

    Ngui, Romano; Lim, Yvonne A L; Chua, Kek Heng

    2012-01-01

    Hookworm infections are still endemic in low and middle income tropical countries with greater impact on the socioeconomic and public health of the bottom billion of the world's poorest people. In this study, a real-time polymerase chain reaction (PCR) coupled with high resolution melting-curve (HRM) analysis was evaluated for an accurate, rapid and sensitive tool for species identification focusing on the five human hookworm species. Real-time PCR coupled with HRM analysis targeting the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA as the genetic marker was used to identify and distinguish hookworm species in human samples. Unique and distinct characteristics of HRM patterns were produced for each of the five hookworm species. The melting curves were characterized by peaks of 79.24±0.05°C and 83.00±0.04°C for Necator americanus, 79.12±0.10°C for Ancylostoma duodenale, 79.40±0.10°C for Ancylostoma ceylanicum, 79.63±0.05°C for Ancylostoma caninum and 79.70±0.14°C for Ancylostoma braziliense. An evaluation of the method's sensitivity and specificity revealed that this assay was able to detect as low as 0.01 ng/µl hookworm DNA and amplification was only recorded for hookworm positive samples. The HRM assay developed in this study is a rapid and straightforward method for the diagnosis, identification and discrimination of five human hookworms. This assay is simple compared to other probe-based genotyping methods as it does not require multiplexing, DNA sequencing or post-PCR processing. Therefore, this method offers a new alternative for rapid detection of human hookworm species.

  8. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    Directory of Open Access Journals (Sweden)

    Bi Yanzhen

    2012-07-01

    Full Text Available Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. Conclusions ABI-REC has the following advantages: (i rapid and highly efficient; (ii native DNA cloning without introduction of extra bases; (iii restriction-free; (iv easy positioning of directional and site-specific recombination owing to formulated primer design. ABI

  9. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy.

    Science.gov (United States)

    Bi, Yanzhen; Qiao, Xianfeng; Hua, Zaidong; Zhang, Liping; Liu, Ximei; Li, Li; Hua, Wenjun; Xiao, Hongwei; Zhou, Jingrong; Wei, Qingxin; Zheng, Xinmin

    2012-07-06

    Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN) promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. ABI-REC has the following advantages: (i) rapid and highly efficient; (ii) native DNA cloning without introduction of extra bases; (iii) restriction-free; (iv) easy positioning of directional and site-specific recombination owing to formulated primer design. ABI-REC is a novel approach to DNA engineering and gene functional

  10. The identification and characterization of Clostridium perfringens by real-time PCR, location of enterotoxin gene, and heat resistance.

    Science.gov (United States)

    Grant, Kathie A; Kenyon, Sarah; Nwafor, Ijeoma; Plowman, June; Ohai, Charles; Halford-Maw, Robin; Peck, Michael W; McLauchlin, Jim

    2008-10-01

    Clostridium perfringens carrying the enterotoxin gene is an important cause of both foodborne and non-foodborne diarrheal disease. Rapid identification of isolates carrying the enterotoxin gene is invaluable for outbreak investigation whilst information on the genomic location of the enterotoxin (cpe) gene can improve our understanding of disease transmission. This paper describes the validation of a real-time polymerase chain reaction (PCR) assay for the identification of C. perfringens and assessment of the potential to cause diarrhea, together with an investigation into the genomic location of the cpe genes in isolates from confirmed incidents of C. perfringens diarrhea. The real-time assay was shown to be specific for the identification of 253 C. perfringens cultures and gave results concordant with those from motility nitrate and lactose gelatine media, the Nagler reaction, and a conventional block-based PCR assay. The cpe gene was detected in 223 of 253 C. perfringens cultures isolated in association with human gastrointestinal disease. A subset of cpe-positive C. perfringens isolates associated with separate incidents of diarrheal disease were investigated further for plasmid or chromosomal location of the cpe gene using a multiplex PCR assay. The cpe gene was plasmid encoded in two isolates from cases of sporadic diarrhea and six isolates from cases of food poisoning. The cpe gene from the remaining 11 isolates from different food poisoning outbreaks was found to be chromosomally encoded. One of the C. perfringens strains with a plasmid encoded cpe gene formed spores of high heat resistance and five formed spores that were sensitive to heating. Eight of the isolates with a chromosomal cpe gene formed heat-resistant spores, and two formed spores with an intermediate heat resistance.

  11. Use of TaqMan® real-time PCR for rapid detection of Salmonella enterica serovar Typhi.

    Science.gov (United States)

    Ranjbar, Reza; Naghoni, Ali; Farshad, Shohreh; Lashini, Hadi; Najafi, Ali; Sadeghifard, Nourkhoda; Mammina, Caterina

    2014-06-01

    We evaluated the performances of a newly designed real-time polymerase chain reaction (PCR) assay using TaqMan® probes to detect Salmonella Typhi. TaqMan® real-time PCR assays were performed by designed primers and probe based on the staG gene for detecting S. Typhi. The specificity of the assay was evaluated on 15 Salmonella serovars. The analytical specificity was evaluated on 20 non-Salmonella microorganisms. The analytical sensitivity was assessed using decreasing DNA quantities of S. Typhi ATCC 19430. Finally the detection capability of the TaqMan® real-time PCR assay on isolates recovered from patients with Salmonella infections was compared to the conventional PCR assay. Only S. Typhi strain had positive results when subjected to the assay using Typhi-specific real-time PCR. No amplification products were observed in real-time PCR with any of the non-Salmonella microorganisms tested. The TaqMan® real-time PCR was more sensitive than the conventional PCR. In conclusion, we found that the easy-to-use real-time PCR assays were faster than conventional PCR systems. The staG-based TaqMan® real-time PCR assay showed to be specific and sensitive method for the safe and rapid detection of the S. Typhi.

  12. Improved method for rapid and accurate isolation and identification of Streptococcus mutans and Streptococcus sobrinus from human plaque samples.

    Science.gov (United States)

    Villhauer, Alissa L; Lynch, David J; Drake, David R

    2017-08-01

    Mutans streptococci (MS), specifically Streptococcus mutans (SM) and Streptococcus sobrinus (SS), are bacterial species frequently targeted for investigation due to their role in the etiology of dental caries. Differentiation of S. mutans and S. sobrinus is an essential part of exploring the role of these organisms in disease progression and the impact of the presence of either/both on a subject's caries experience. Of vital importance to the study of these organisms is an identification protocol that allows us to distinguish between the two species in an easy, accurate, and timely manner. While conducting a 5-year birth cohort study in a Northern Plains American Indian tribe, the need for a more rapid procedure for isolating and identifying high volumes of MS was recognized. We report here on the development of an accurate and rapid method for MS identification. Accuracy, ease of use, and material and time requirements for morphological differentiation on selective agar, biochemical tests, and various combinations of PCR primers were compared. The final protocol included preliminary identification based on colony morphology followed by PCR confirmation of species identification using primers targeting regions of the glucosyltransferase (gtf) genes of SM and SS. This method of isolation and identification was found to be highly accurate, more rapid than the previous methodology used, and easily learned. It resulted in more efficient use of both time and material resources. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Rapid detection of Mycobacterium avium in stool samples from AIDS patients by immunomagnetic PCR.

    OpenAIRE

    Li, Z; Bai, G H; von Reyn, C. F.; Marino, P.; Brennan, M J; Gine, N; Morris, S. L.

    1996-01-01

    Direct PCR detection of bacteria in clinical samples is often hindered by the presence of compounds that inhibit the PCR. To improve and accelerate the diagnosis of Mycobacterium avium-M. intracellulare complex infections, an immunomagnetic PCR (IM-PCR) assay was developed. This IM-PCR procedure combines the separation of mycobacteria by antimycobacterial monoclonal antibody coupled to magnetic beads with an M. avium-M. intracellulare complex-specific PCR protocol based on 16S rRNA gene seque...

  14. Real-Time PCR and High-Resolution Melt Analysis for Rapid Detection of Mycobacterium leprae Drug Resistance Mutations and Strain Types

    Science.gov (United States)

    Li, Wei; Matsuoka, Masanori; Kai, Masanori; Thapa, Pratibha; Khadge, Saraswoti; Hagge, Deanna A.; Brennan, Patrick J.

    2012-01-01

    Drug resistance surveillance and strain typing of Mycobacterium leprae are necessary to investigate ongoing transmission of leprosy in regions of endemicity. To enable wider implementation of these molecular analyses, novel real-time PCR–high-resolution melt (RT-PCR-HRM) assays without allele-specific primers or probes and post-PCR sample handling were developed. For the detection of mutations within drug resistance-determining regions (DRDRs) of folP1, rpoB, and gyrA, targets for dapsone, rifampin, and fluoroquinolones, real-time PCR-HRM assays were developed. Wild-type and drug-resistant mouse footpad-derived strains that included three folP1, two rpoB, and one gyrA mutation types in a reference panel were tested. RT-PCR-HRM correctly distinguished the wild type from the mutant strains. In addition, RT-PCR-HRM analyses aided in recognizing samples with mixed or minor alleles and also a mislabeled sample. When tested in 121 sequence-characterized clinical strains, HRM identified all the folP1 mutants representing two mutation types, including one not within the reference panel. The false positives (PCR inhibition. A second set of RT-PCR-HRM assays for identification of three previously reported single nucleotide polymorphisms (SNPs) that have been used for strain typing were developed and validated in 22 reference and 25 clinical strains. Real-time PCR-HRM is a sensitive, simple, rapid, and high-throughput tool for routine screening known DRDR mutants in new and relapsed cases, SNP typing, and detection of minor mutant alleles in the wild-type background at lower costs than current methods and with the potential for quality control in leprosy investigations. PMID:22170923

  15. Rapid detection method for Bacillus anthracis using a combination of multiplexed real-time PCR and pyrosequencing and its application for food biodefense.

    Science.gov (United States)

    Janzen, Timothy W; Thomas, Matthew C; Goji, Noriko; Shields, Michael J; Hahn, Kristen R; Amoako, Kingsley K

    2015-02-01

    Bacillus anthracis, the causative agent of anthrax, has the capacity to form highly resilient spores as part of its life cycle. The potential for the dissemination of these spores using food as a vehicle is a huge public health concern and, hence, requires the development of a foodborne bioterrorism response approach. In this work, we address a critical gap in food biodefense by presenting a novel, combined, sequential method involving the use of real-time PCR and pyrosequencing for the rapid, specific detection of B. anthracis spores in three food matrices: milk, apple juice, and bottled water. The food samples were experimentally inoculated with 40 CFU ml(-1), and DNA was extracted from the spores and analyzed after immunomagnetic separation. Applying the combination of multiplex real-time PCR and pyrosequencing, we successfully detected the presence of targets on both of the virulence plasmids and the chromosome. The results showed that DNA amplicons generated from a five-target multiplexed real-time PCR detection using biotin-labeled primers can be used for single-plex pyrosequencing detection. The combined use of multiplexed real-time PCR and pyrosequencing is a novel, rapid detection method for B. anthracis from food and provides a tool for accurate, quantitative identification with potential biodefense applications.

  16. Rapid Purification of Salmonella DNA in Minced Meat and Detection by Real-time PCR

    DEFF Research Database (Denmark)

    Jenikova, G.; Jensen, Annette Nygaard; Demnerova, K.

    2001-01-01

    of DNeasy was found to be 6-8 CFU in just 19 end-point fluorescence (C-t) values, while this was 22 C-t for a combination of DNeasy and BactXtractor. Extraction by DNeasy resulted in C-t cells per 25 g, when the samples were inoculated with Salmonella......Four rapid and simple DNA purification and sample treatment protocols were evaluated for detection of Salmonella enterica in spiked minced meat, using a fluorogenic 5' nuclease (TaqMan) PCR assay in an ABI-Prism 7700 Sequence Detector. The detection limit with the single separation treatment...... before the overnight preenrichment. The method is currently being adapted to a BioRobot 3000 platform. However, the use of paramagnetic beads (DNA Direct) resulted in poor and variable detection limit....

  17. Contribution of real-time PCR to Plasmodium species identification and to clinical decisions: a nationwide study in a non-endemic setting.

    Science.gov (United States)

    Grossman, T; Schwartz, E; Vainer, J; Agmon, V; Glazer, Y; Goldmann, D; Marva, E

    2017-04-01

    Treatment choice for patients with malaria in Israeli hospitals is based on microscopy and rapid diagnostic tests (RDTs). Here, we demonstrate the cumulative value of real-time polymerase chain reaction (PCR) in optimizing the treatment of malaria. Between January 2009 and December 2015, 451 samples from 357 patients were tested in our laboratory using a real-time PCR assay. Hospital laboratory results (without real-time PCR) were compared to those obtained in our laboratory. A total of 307 patients had a malaria-positive laboratory finding in the hospital. Out of those, 288 were confirmed positive and 19 negative using real-time PCR. Two negative hospital results were found to be positive by real-time PCR. More specifically, of 153 cases positive for Plasmodium falciparum by real-time PCR, only 138 (90%) had been correctly identified at the hospitals. Similarly, 66 (67%) of 99 cases positive for P. vivax, 2 (11%) of 18 cases positive for P. ovale, and 3 (30%) of 10 cases positive for P. malariae had been correctly identified. Of 10 cases of mixed infection, only one had been identified as such at the hospital. Thus, real-time PCR was required for correct identification in 81 (28%) out of 290 positive cases. In 52 (18%) of those, there was an erroneous categorization of relapsing versus non-relapsing parasites. In a nationwide study, we found that the use of real-time PCR is definitely beneficial and may change the decision regarding the choice of treatment.

  18. Continuous-Flow Detector for Rapid Pathogen Identification

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, Louise M. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Skulan, Andrew J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Singh, Anup K. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Cummings, Eric B. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Fiechtner, Gregory J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics

    2006-09-01

    This report describes the continued development of a low-power, portable detector for the rapid identification of pathogens such as B. anthracis and smallpox. Based on our successful demonstration of the continuous filter/concentrator inlet, we believe strongly that the inlet section will enable differentiation between viable and non-viable populations, between types of cells, and between pathogens and background contamination. Selective, continuous focusing of particles in a microstream enables highly selective and sensitive identification using fluorescently labeled antibodies and other receptors such as peptides, aptamers, or small ligands to minimize false positives. Processes such as mixing and lysing will also benefit from the highly localized particle streams. The concentrator is based on faceted prisms to contract microfluidic flows while maintaining uniform flowfields. The resulting interfaces, capable of high throughput, serve as high-, low-, and band-pass filters to direct selected bioparticles to a rapid, affinity-based detection system. The proposed device is superior to existing array-based detectors as antibody-pathogen binding can be accomplished in seconds rather than tens of minutes or even hours. The system is being designed to interface with aerosol collectors under development by the National Laboratories or commercial systems. The focused stream is designed to be interrogated using diode lasers to differentiate pathogens by light scattering. Identification of particles is done using fluorescently labeled antibodies to tag the particles, followed by multiplexed laser-induced fluorescence (LIF) detection (achieved by labeling each antibody with a different dye).

  19. Rapid detection of Ceratocystis platani inoculum by quantitative real-time PCR assay.

    Science.gov (United States)

    Luchi, Nicola; Ghelardini, Luisa; Belbahri, Lassaâd; Quartier, Marion; Santini, Alberto

    2013-09-01

    Ceratocystis platani is the causal agent of canker stain of plane trees, a lethal disease able to kill mature trees in one or two successive growing seasons. The pathogen is a quarantine organism and has a negative impact on anthropogenic and natural populations of plane trees. Contaminated sawdust produced during pruning and sanitation fellings can contribute to disease spread. The goal of this study was to design a rapid, real-time quantitative PCR assay to detect a C. platani airborne inoculum. Airborne inoculum traps (AITs) were placed in an urban setting in the city of Florence, Italy, where the disease was present. Primers and TaqMan minor groove binder (MGB) probes were designed to target cerato-platanin (CP) and internal transcribed spacer 2 (ITS2) genes. The detection limits of the assay were 0.05 pg/μl and 2 fg/μl of fungal DNA for CP and ITS, respectively. Pathogen detection directly from AITs demonstrated specificity and high sensitivity for C. platani, detecting DNA concentrations as low as 1.2 × 10(-2) to 1.4 × 10(-2) pg/μl, corresponding to ∼10 conidia per ml. Airborne inoculum traps were able to detect the C. platani inoculum within 200 m of the closest symptomatic infected plane tree. The combination of airborne trapping and real-time quantitative PCR assay provides a rapid and sensitive method for the specific detection of a C. platani inoculum. This technique may be used to identify the period of highest risk of pathogen spread in a site, thus helping disease management.

  20. Identification of some Fusarium species from selected crop seeds using traditional method and BIO-PCR

    Directory of Open Access Journals (Sweden)

    Tomasz Kulik

    2012-12-01

    Full Text Available We identified a species level of the fungal cultures isolated from selected crop seeds using traditional method and BIO-PCR. The use of BIO-PCR did not correspond completely to the morphological analyses. Both methods showed increased infection with F. poae in winter wheat seed sample originated from north Poland. Fungal culture No 40 (isolated from faba bean and identified with traditional method as mixed culture with F. culmorum and F. graminearum did not produce expected product after PCR reaction with species specific primers OPT18F470, OPT18R470. However, the use of additional primers Fc01F, Fc01R allowed for reliable identification of F. culmorum in the culture.

  1. Rapid PCR-Based Diagnosis of Septic Arthritis by Early Gram-Type Classification and Pathogen Identification▿

    Science.gov (United States)

    Yang, Samuel; Ramachandran, Padmini; Hardick, Andrew; Hsieh, Yu-Hsiang; Quianzon, Celeste; Kuroki, Marcos; Hardick, Justin; Kecojevic, Aleksandar; Abeygunawardena, Avanthi; Zenilman, Jonathan; Melendez, Johan; Doshi, Vishal; Gaydos, Charlotte; Rothman, Richard E.

    2008-01-01

    Septic arthritis (SA) is a rheumatologic emergency associated with significant morbidity and mortality. Delayed or inadequate treatment of SA can lead to irreversible joint destruction and disability. Current methods of diagnosing SA rely on synovial fluid analysis and culture which are known to be imprecise and time-consuming. We report a novel adaptation of a probe-based real-time PCR assay targeting the 16S rRNA gene for early and accurate diagnosis of bacterial SA. The assay algorithm consists of initial broad-range eubacterial detection, followed by Gram typing and species characterization of the pathogen. The platform demonstrated a high analytical sensitivity with a limit of detection of 101 CFU/ml with a panel of SA-related organisms. Gram typing and pathogen-specific probes correctly identified their respective targets in a mock test panel of 36 common clinically relevant pathogens. One hundred twenty-one clinical synovial fluid samples from patients presenting with suspected acute SA were tested. The sensitivity and specificity of the assay were 95% and 97%, respectively, versus synovial fluid culture results. Gram-typing probes correctly identified 100% of eubacterial positive samples as to gram-positive or gram-negative status, and pathogen-specific probes correctly identified the etiologic agent in 16/20 eubacterial positive samples. The total assay time from sample collection to result is 3 h. We have demonstrated that a real-time broad-based PCR assay has high analytical and clinical performance with an improved time to detection versus culture for SA. This assay may be a useful diagnostic adjunct for clinicians, particularly those practicing in the acute care setting where rapid pathogen detection and identification would assist in disposition and treatment decisions. PMID:18305128

  2. Sap-direct RT-PCR for the rapid detection of coleus blumei viroids of the genus Coleviroid from natural host plants.

    Science.gov (United States)

    Jiang, Dongmei; Wu, Zujian; Xie, Lianhui; Sano, Teruo; Li, Shifang

    2011-06-01

    A simple and fast sap-direct RT-PCR (reverse transcription-polymerase chain reaction) for the rapid detection of 3 viroids of the genus Coleviroid is presented. The templates for cDNA synthesis were obtained directly from the sap of coleus using a pipettor, a common tool in molecular biology laboratories, and 3 coleus blumei viroids (CbVds) were detected simultaneously using a pair of universal primers designed according to sequences in the central conserved region (CCR) of CbVds. RT-PCR results demonstrated that CbVd-1, CbVd-5, and CbVd-6 can be detected accurately in viroid-infected plants but not in viroid-free plants. The results of RT-PCR, dot-blot, sequencing, and batch-detection revealed that this method can be used to identify CbVds rapidly. The method also reduces cross-contamination among different samples to a minimum. It is considered that this rapid and simple technique is an effective method for the identification and cloning of CbVds. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  3. Application of PCR-DGGE method for identification of nematode communities in pepper growing soil

    OpenAIRE

    Nguyen, Thi Phuong; Ha, Duy Ngo; Nguyen, Huu Hung; Duong, Duc Hieu

    2017-01-01

    Soil nematodes play an important role in indication for assessing soil environments and ecosystems. Previous studies of nematode community analyses based on molecular identification have shown to be useful for assessing soil environments. Here we applied PCR-DGGE method for molecular analysis of five soil nematode communities (designed as S1 to S5) collected from four provinces in Southeastern Vietnam (Binh Duong, Ba Ria Vung Tau, Binh Phuoc and Dong Nai) based on SSU gene. By sequencing DNA ...

  4. Method for Rapid Protein Identification in a Large Database

    Directory of Open Access Journals (Sweden)

    Wenli Zhang

    2013-01-01

    Full Text Available Protein identification is an integral part of proteomics research. The available tools to identify proteins in tandem mass spectrometry experiments are not optimized to face current challenges in terms of identification scale and speed owing to the exponential growth of the protein database and the accelerated generation of mass spectrometry data, as well as the demand for nonspecific digestion and post-modifications in complex-sample identification. As a result, a rapid method is required to mitigate such complexity and computation challenges. This paper thus aims to present an open method to prevent enzyme and modification specificity on a large database. This paper designed and developed a distributed program to facilitate application to computer resources. With this optimization, nearly linear speedup and real-time support are achieved on a large database with nonspecific digestion, thus enabling testing with two classical large protein databases in a 20-blade cluster. This work aids in the discovery of more significant biological results, such as modification sites, and enables the identification of more complex samples, such as metaproteomics samples.

  5. Rapid molecular identification of human taeniid cestodes by pyrosequencing approach.

    Directory of Open Access Journals (Sweden)

    Tongjit Thanchomnang

    Full Text Available Taenia saginata, T. solium, and T. asiatica are causative agents of taeniasis in humans. The difficulty of morphological identification of human taeniids can lead to misdiagnosis or confusion. To overcome this problem, several molecular methods have been developed, but use of these tends to be time-consuming. Here, a rapid and high-throughput pyrosequencing approach was developed for the identification of three human taeniids originating from various countries. Primers targeting the mitochondrial cytochrome c oxidase subunit 1 (cox1 gene of the three Taenia species were designed. Variations in a 26-nucleotide target region were used for identification. The reproducibility and accuracy of the pyrosequencing technology was confirmed by Sanger sequencing. This technique will be a valuable tool to distinguish between sympatric human taeniids that occur in Thailand, Asia and Pacific countries. This method could potentially be used for the molecular identification of the taeniid species that might be associated with suspicious cysts and lesions, or cyst residues in humans or livestock at the slaughterhouse.

  6. Rapid Molecular Identification of Human Taeniid Cestodes by Pyrosequencing Approach

    Science.gov (United States)

    Thanchomnang, Tongjit; Tantrawatpan, Chairat; Intapan, Pewpan M.; Sanpool, Oranuch; Janwan, Penchom; Lulitanond, Viraphong; Tourtip, Somjintana; Yamasaki, Hiroshi; Maleewong, Wanchai

    2014-01-01

    Taenia saginata, T. solium, and T. asiatica are causative agents of taeniasis in humans. The difficulty of morphological identification of human taeniids can lead to misdiagnosis or confusion. To overcome this problem, several molecular methods have been developed, but use of these tends to be time-consuming. Here, a rapid and high-throughput pyrosequencing approach was developed for the identification of three human taeniids originating from various countries. Primers targeting the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the three Taenia species were designed. Variations in a 26-nucleotide target region were used for identification. The reproducibility and accuracy of the pyrosequencing technology was confirmed by Sanger sequencing. This technique will be a valuable tool to distinguish between sympatric human taeniids that occur in Thailand, Asia and Pacific countries. This method could potentially be used for the molecular identification of the taeniid species that might be associated with suspicious cysts and lesions, or cyst residues in humans or livestock at the slaughterhouse. PMID:24945530

  7. Molecular identification of ovine Theileria species by a new PCR-RFLP method.

    Science.gov (United States)

    Heidarpour Bami, M; Haddadzadeh, H R; Kazemi, B; Khazraiinia, P; Bandehpour, M; Aktas, M

    2009-05-12

    Theileria spp. infect wild and domestic ruminants in the tropical and subtropical regions of the world. Two species, T. lestoquardi and T. ovis, are suspected to cause ovine theileriosis in Iran. The epidemiological aspects of ovine theileriosis in Iran are poorly understood, and further investigations by sensitive and precise techniques are required. In this study, the use of a nested PCR for amplification of a fragment of the 18S ribosomal DNA from virtually all species of Theileria is described. For differentiation of various Theileria spp. a RFLP assay was developed as a diagnostic tool enabling direct, concurrent, highly specific and sensitive identification of Theileria spp. The sensitivity of the nested PCR for Theileria species was 10(-5)% parasitemia. Restriction fragment length polymorphism (RFLP) of the PCR products allowed differentiation between three different Theileria species (T. annulata, T. lestoquardi and T. ovis) and seems to be useful for differentiation of other species such as T. separata and Theileria spp. china. From 100 field blood samples obtained from sheep in East and South-East Iran, 56% were positive for Theileria spp. by nested-PCR compared with 21% by microscopic examination. Out of 56 positive samples, 12.5% (7/56) were positive for T. ovis and 87/5% (49/56) were positive for T. lestoquardi. This is the first report in which T. ovis has been detected in Iran using molecular identification techniques.

  8. A novel polymerase chain reaction (PCR) for rapid isolation of a new ...

    African Journals Online (AJOL)

    mediated self-formed panhandle PCR, for gene or chromosome walking. It combined the advantages of ligation-mediated PCR in its specificity and of panhandle PCR in its efficiency. Self-formed panhandle PCR was used for a new rbcS gene ...

  9. Rapid identification of cytokinins by an immunological method

    Energy Technology Data Exchange (ETDEWEB)

    Morris, R.O.; Jameson, P.E.; Morris, J.W. (Univ. of Missouri-Columbia (USA)); Laloue, M. (Centre Nationale de la Recherche Scientifique, Gif-sur-Yvette (France))

    1991-04-01

    A method for rapid identification of bacterial cytokinins has been developed in which cultures are fed ({sup 3}H)adenine, the cytokinins (including, {sup 3}H-labeled cytokinins) are isolated by immunoaffinity chromatography, and analyzed by HPLC with on-line scintillation counting. Analysis of Agrobacterium tumefaciens strains showed that some produced primarily trans-zeatin, whereas others produced primarily trans-zeatin riboside. Pseudomonas syringae pv savastanoi produced mixtures of transzeatin, dihydrozeatin, 1{double prime}-methyl-trans-zeatin riboside, and other unknown cytokinin-like substances. Corynebacterium fascians, produced cis-zeatin, isopentenyladenine and isopentenyladenosine. The technique is designed for qualitative rather than quantitative studies and allows ready identification of bacterial cytokinins. It may also have utility in the study of plant cytokinins if adequate incorporation of label into cytokinin precursor pools can be achieved.

  10. Real-time PCR for Leishmania species identification: Evaluation and comparison with classical techniques.

    Science.gov (United States)

    de Morais, Rayana Carla Silva; da Costa Oliveira, Cintia Nascimento; de Albuquerque, Suênia da Cunha Gonçalves; Mendonça Trajano Silva, Lays Adrianne; Pessoa-E-Silva, Rômulo; Alves da Cruz, Heidi Lacerda; de Brito, Maria Edileuza Felinto; de Paiva Cavalcanti, Milena

    2016-06-01

    Cutaneous leishmaniasis (CL) is a parasitic disease caused by various Leishmania species. Several studies have shown that real time quantitative PCR (qPCR) can be used for Leishmania spp. identification by analyzing the melting temperature (Tm). Thus, the aim of this study was to evaluate the viability of qPCR for differentiating eight closely related Leishmania species that cause the same clinical form of the disease and to compare the results with classical techniques. qPCR assays for standardizing the Tm using reference strains were performed. After the CL diagnosis on blood samples of domestic animals, positive samples were analyzed by their Tm and qPCR products were purified and sequenced. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by Tm. A Restriction Fragment Length Polymorphism (RFLP) assay, a reference test, was also standardized, by using the reference strains. Through standardization of Tm for Leishmania spp., two Tm ranges were created for analysis: 1 (Tm = 78-79.99 °C) included Leishmania (V.) braziliensis, Leishmania (V.) panamensis, Leishmania (V.) lainsoni, Leishmania (V.) guyanensis and Leishmania (V.) shawi; and 2 (Tm = 80-82.2 °C) included Leishmania (V.) naiffi, Leishmania (L.) amazonensis and Leishmania (L.) mexicana. A total of 223 positive blood samples were analyzed, with 58 included in range 1 and 165 in range 2. L. (V.) braziliensis, L. (V.) panamensis and L. (V.) guyanensis were identified by sequencing, while L. (V.) braziliensis, L. (L.) mexicana and L. (V.) panamensis were identified by RFLP analysis. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by qPCR Tm analysis; five were classified in range 1 and five in range 2. A concordance of 80% was calculated between qPCR and the gold-standard (MLEE) with no significant difference between the methods (p = 0.6499); a similar result was observed for sequencing

  11. Rapid detection of equine influenza virus H3N8 subtype by insulated isothermal RT-PCR (iiRT-PCR) assay using the POCKIT™ Nucleic Acid Analyzer.

    Science.gov (United States)

    Balasuriya, Udeni B R; Lee, Pei-Yu Alison; Tiwari, Ashish; Skillman, Ashley; Nam, Bora; Chambers, Thomas M; Tsai, Yun-Long; Ma, Li-Juan; Yang, Pai-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-10-01

    Equine influenza (EI) is an acute, highly contagious viral respiratory disease of equids. Currently, equine influenza virus (EIV) subtype H3N8 continues to be the most important respiratory pathogen of horses in many countries around the world. The need to achieve a rapid diagnosis and to implement effective quarantine and movement restrictions is critical in controlling the spread of EIV. In this study, a novel, inexpensive and user-friendly assay based on an insulated isothermal RT-PCR (iiRT-PCR) method on the POCKIT™, a field-deployable device, was described and validated for point-of-need detection of EIV-H3N8 in clinical samples. The newly established iiRT-PCR assay targeting the EIV HA3 gene was evaluated for its sensitivity using in vitro transcribed (IVT) RNA, as well as ten-fold serial dilutions of RNA extracted from the prototype H3N8 strain A/equine/Miami/1/63. Inclusivity and exclusivity panels were tested for specificity evaluation. Published real-time RT-PCR (rRT-PCR) assays targeting the NP and HA3 genes were used as the reference standards for comparison of RNA extracted from field strains and from nasal swab samples collected from experimentally infected horses, respectively. Limit of detection with a 95% probability (LoD95%) was estimated to be 11copies of IVT RNA. Clinical sensitivity analysis using RNA prepared from serial dilutions of a prototype EIV (Miami 1/63/H3N8) showed that the iiRT-PCR assay was about 100-fold more sensitive than the rRT-PCR assay targeting the NP gene of EIV subtype H3N8. The iiRT-PCR assay identified accurately fifteen EIV H3N8 strains and two canine influenza virus (CIV) H3N8 strains, and did not cross-react with H6N2, H7N7, H1N1 subtypes or any other equine respiratory viral pathogens. Finally, 100% agreement was found between the iiRT-PCR assay and the universal influenza virus type A rRT-PCR assay in detecting the EIV A/equine/Kentucky/7/07 strain in 56 nasal swab samples collected from experimentally inoculated

  12. Detection and differentiation of Plum pox virus using real-time multiplex PCR with SYBR Green and melting curve analysis: a rapid method for strain typing.

    Science.gov (United States)

    Varga, Aniko; James, Delano

    2005-02-01

    A real-time multiplex PCR procedure with melting curve analysis, using the green fluorescence dye SYBR Green I, was developed for rapid and reliable identification of Plum pox virus (PPV) isolates of strains D and M. Members of the different strains were identified by their distinctive melting temperatures (T(m)s); 84.3-84.43 degrees C for D isolates, and 85.34-86.11 degrees C for M isolates. The associated amplicon sizes were 114 and 380 bp, respectively. The procedure was used for detection and identification of PPV in both herbaceous and woody hosts. The Tm for members of a particular strain was very similar, with a host effect that did not hinder strain identification. Universal primers included in the study detected all isolates of PPV tested, amplifying a 74 bp fragment. The Tm of this fragment varied from 80.12 to 81.52 degrees C and may have supplementary value for PPV identification. SYBR Green-based detection was compared to detection using a hybridization LUX fluorogenic primer. Better resolution of the melting peaks was observed with SYBR Green I, than with the LUX primers, hence strain identification with SYBR Green I was more reliable. This is a simple approach to PPV strain identification with the relatively inexpensive dye SYBR Green I, and eliminates any need for electrophoretic analysis of amplicons or RFLP patterns using ethidium bromide.

  13. Magnetic nanoparticle-enhanced PCR for the detection and identification of Staphylococcus aureus and Salmonella enteritidis.

    Science.gov (United States)

    Houhoula, Dimitra; Papaparaskevas, Joseph; Zatsou, Katerina; Nikolaras, Nikolaos; Malkawi, Hanan I; Mingenot-Leclercq, Marie-Paule; Konteles, Spyros; Koussisis, Stamatis; Tsakris, Athanassios; Charvalos, Ekatherina

    2017-07-01

    This paper evaluated magnetic nanoparticle-enhanced PCR for the detection and identification of Staphylococcus aureus and Salmonella enteritidis. Two different types of magnetic nanoparticles designated MPIO (iron concentration 2.5 mg/ml, size 1 µm) and NP (iron concentration 8.7 mg/ml, size 60 nm), both conjugated with S. aureus or S. enteritidis antibodies were evaluated as an enrichment procedure for PCR-detection of the pathogens in Trypticase Soy Broth, milk, blood and meat broth. Bacterial suspensions (1.5x108 cfu/ml) were prepared and serial diluted 10-1. The MPIO and NP nanoparticles were added, followed by incubation for 1 hour at room temperature, magnetic separation of the pellet, DNA extraction and PCR, targeting the femA and invA sequences. The nanoparticle-free and the NP-supplemented dilutions were positive down to the 1.5x102 cfu/ml concentration for both bacteria. The MPIO-supplemented dilutions were positive down to approx. 2x100 cfu/ml concentration, respectively. Bacteria-free TSB was negative by PCR. MPIO nanoparticles (size 1 µm) enhanced the detection of S. aureus and S. enteritidis by PCR, whilst NP nanoparticles (size 60 nm) did not, thus indicating that the size of the magnetic nanoparticles play a significant role in the enrichment procedure.

  14. PCR Identification and Phylogenetic Analysis ofTrichomonas gallinaefrom Domestic Pigeons in Guangzhou, China.

    Science.gov (United States)

    Qiu, Shen-Ben; Lv, Meng-Na; He, Xi; Weng, Ya-Biao; Zou, Shang-Shu; Wang, Xin-Qiu; Lin, Rui-Qing

    2017-06-01

    Avian trichomoniasis caused by Trichomonas gallinae is a serious protozoan disease worldwide. The domestic pigeon ( Columba livia domestica ) is the main host for T. gallinae and plays an important role in the spread of the disease. Based on the internal transcribed spacers of nuclear ribosomal DNA of this parasite, a pair of primers (TgF2/TgR2) was designed and used to develop a PCR assay for the diagnosis of T. gallinae infection in domestic pigeons. This approach allowed the identification of T. gallinae , and no amplicons were produced when using DNA from other common avian pathogens. The minimum amount of DNA detectable by the specific PCR assay developed in this study was 15 pg. Clinical samples from Guangzhou, China, were examined using this PCR assay and a standard microscopy method, and their molecular characteristics were determined by phylogenetic analysis. All of the T. gallinae -positive samples detected by microscopic examination were also detected as positive by the PCR assay. Most of the samples identified as negative by microscopic examination were detected as T. gallinae positive by the PCR assay and were confirmed by sequencing. The positive samples of T. gallinae collected from Guangzhou, China, were identified as T. gallinae genotype B by sequencing and phylogenetic analyses, providing relevant data for studying the ecology and population genetic structures of trichomonads and for the prevention and control of the diseases they cause.

  15. PCR Identification and Phylogenetic Analysis of Trichomonas gallinae from Domestic Pigeons in Guangzhou, China

    Science.gov (United States)

    Qiu, Shen-Ben; Lv, Meng-Na; He, Xi; Weng, Ya-Biao; Zou, Shang-Shu; Wang, Xin-Qiu; Lin, Rui-Qing

    2017-01-01

    Avian trichomoniasis caused by Trichomonas gallinae is a serious protozoan disease worldwide. The domestic pigeon (Columba livia domestica) is the main host for T. gallinae and plays an important role in the spread of the disease. Based on the internal transcribed spacers of nuclear ribosomal DNA of this parasite, a pair of primers (TgF2/TgR2) was designed and used to develop a PCR assay for the diagnosis of T. gallinae infection in domestic pigeons. This approach allowed the identification of T. gallinae, and no amplicons were produced when using DNA from other common avian pathogens. The minimum amount of DNA detectable by the specific PCR assay developed in this study was 15 pg. Clinical samples from Guangzhou, China, were examined using this PCR assay and a standard microscopy method, and their molecular characteristics were determined by phylogenetic analysis. All of the T. gallinae-positive samples detected by microscopic examination were also detected as positive by the PCR assay. Most of the samples identified as negative by microscopic examination were detected as T. gallinae positive by the PCR assay and were confirmed by sequencing. The positive samples of T. gallinae collected from Guangzhou, China, were identified as T. gallinae genotype B by sequencing and phylogenetic analyses, providing relevant data for studying the ecology and population genetic structures of trichomonads and for the prevention and control of the diseases they cause. PMID:28719959

  16. Multiplex PCR-based identification of Streptococcus canis, Streptococcus zooepidemicus and Streptococcus dysgalactiae subspecies from dogs.

    Science.gov (United States)

    Moriconi, M; Acke, E; Petrelli, D; Preziuso, S

    2017-02-01

    Streptococcus canis (S. canis), Streptococcus equi subspecies zooepidemicus (S. zooepidemicus) and Streptococcus dysgalactiae subspecies (S. dysgalactiae subspecies) are β-haemolytic Gram positive bacteria infecting animals and humans. S. canis and S. zooepidemicus are considered as two of the major zoonotic species of Streptococcus, while more research is needed on S. dysgalactiae subspecies bacteria. In this work, a multiplex-PCR protocol was tested on strains and clinical samples to detect S. canis, S. dysgalactiae subspecies and S. equi subspecies bacteria in dogs. All strains were correctly identified as S. canis, S. equi subspecies or S. dysgalactiae subspecies by the multiplex-PCR. The main Streptococcus species isolated from symptomatic dogs were confirmed S. canis. The multiplex-PCR protocol described is a rapid, accurate and efficient method for identifying S. canis, S. equi subspecies and S. dysgalactiae subspecies in dogs and could be used for diagnostic purposes and for epidemiological studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Evaluation of a quantitative real-time PCR for rapid detection of Riemerella Anatipestifer infection in birds.

    Science.gov (United States)

    Zhang, Qingshan; Wan, Chunhe; Li, Chenxi; Bai, Xiaofei; Liu, Ming; Liu, Siguo; Zhang, Yun

    2017-08-05

    To establish an accurate, rapid, and a quantifiable method for the detection of Riemerella anatipestifer infection, a widespread infectious disease in birds, we developed a TaqMan-based real-time PCR assay by using DtxR gene-specific primers and a TaqMan probe. The standard curve established with a linear correlation (R2) of 0.998 and efficiency of 99% between the Ct value and the logarithm of the plasmid copy number. The reproducibility and specificity of the real-time PCR assay were confirmed by using plasmids containing DtxR genes or DNAs extracted from well-known bacteria or viruses causing duck diseases. The real-time PCR assay was 100 times more sensitive than the conventional PCR. The results reveal that the established real-time PCR assay might be a useful method for diagnosis and quantitative detection of Riemerella anatipestifer in birds.

  18. Optimization of real-time PCR assay for rapid and sensitive detection of eubacterial 16S ribosomal DNA in platelet concentrates.

    NARCIS (Netherlands)

    Mohammadi, T.; Reesink, H.W.; Vandenbroucke-Grauls, C.M.J.E.; Savelkoul, P.H.M.

    2003-01-01

    A real-time PCR assay was developed for rapid detection of eubacterial 16S ribosomal DNA in platelet concentrates. The sensitivity of this assay can be hampered by contaminating DNA in the PCR reagents. Digestion of the PCR reagents with Sau3AI prior to PCR amplification was effective in eliminating

  19. Rapid real-time diagnostic PCR for Trichophyton rubrum and Trichophyton mentagrophytes in patients with tinea unguium and tinea pedis using specific fluorescent probes.

    Science.gov (United States)

    Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi

    2013-03-01

    Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  20. Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays

    Science.gov (United States)

    Inderbitzin, Patrik; Davis, R. Michael; Bostock, Richard M.; Subbarao, Krishna V.

    2013-01-01

    Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae), a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex) PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex) PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers. PMID:23823707

  1. Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays.

    Directory of Open Access Journals (Sweden)

    Patrik Inderbitzin

    Full Text Available Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae, a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers.

  2. A Multiplex-PCR approach to identification of the Brazilian intermediate hosts of Schistosoma mansoni

    Directory of Open Access Journals (Sweden)

    THDA Vidigal

    2002-10-01

    Full Text Available Due to difficulties concerning morphological identification of planorbid snails of the genus Biomphalaria, and given a high variation of characters and in the organs with muscular tissue, we designed specific polymerase chain reaction (PCR primers for Brazilian snail hosts of Schistosoma mansoni from available sequences of internal transcribed spacer 2 (ITS2 of the ribosomal RNA gene. From the previous sequencing of the ITS2 region, one primer was designed to anchor in the 5.8S conserved region and three other species-specific primers in the 28S region, flanking the ITS2 region. These four primers were simultaneously used in the same reaction (Multiplex-PCR, under high stringency conditions. Amplification of the ITS2 region of Biomphalaria snails produced distinct profiles (between 280 and 350 bp for B. glabrata, B. tenagophila and B. straminea. The present study demonstrates that Multiplex-PCR of ITS2-DNAr showed to be a promising auxiliary tool for the morphological identification of Biomphalaria snails, the intermediate hosts of S. mansoni.

  3. Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus.

    Science.gov (United States)

    Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O

    2017-10-01

    Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.

  4. Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

    African Journals Online (AJOL)

    Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

  5. PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

    Science.gov (United States)

    Janczarek, Monika; Palusińska-Szysz, Marta

    2016-05-01

    Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.

  6. Rapid detection and identification of four major Schistosoma species by high-resolution melt (HRM) analysis.

    Science.gov (United States)

    Li, Juan; Zhao, Guang-Hui; Lin, RuiQing; Blair, David; Sugiyama, Hiromu; Zhu, Xing-Quan

    2015-11-01

    Schistosomiasis, caused by blood flukes belonging to several species of the genus Schistosoma, is a serious and widespread parasitic disease. Accurate and rapid differentiation of these etiological agents of animal and human schistosomiasis to species level can be difficult. We report a real-time PCR assay coupled with a high-resolution melt (HRM) assay targeting a portion of the nuclear 18S rDNA to detect, identify, and distinguish between four major blood fluke species (Schistosoma japonicum, Schistosoma mansoni, Schistosoma haematobium, and Schistosoma mekongi). Using this system, the Schistosoma spp. was accurately identified and could also be distinguished from all other trematode species with which they were compared. As little as 10(-5) ng genomic DNA from a Schistosoma sp. could be detected. This process is inexpensive, easy, and can be completed within 3 h. Examination of 21 representative Schistosoma samples from 15 geographical localities in seven endemic countries validated the value of the HRM detection assay and proved its reliability. The melting curves were characterized by peaks of 83.65 °C for S. japonicum and S. mekongi, 85.65 °C for S. mansoni, and 85.85 °C for S. haematobium. The present study developed a real-time PCR coupled with HRM analysis assay for detection and differential identification of S. mansoni, S. haematobium, S. japonicum, and S. mekongi. This method is rapid, sensitive, and inexpensive. It has important implications for epidemiological studies of Schistosoma.

  7. 16S rRNA gene-based identification of bacteria in postoperative endophthalmitis by PCR-Denaturing Gradient Gel Electrophoresis (PCR-DGGE) fingerprinting

    Science.gov (United States)

    Navarro-Noya, Yendi; Hernández-Rodríguez, César; Zenteno, Juan C.; Buentello-Volante, Beatriz; Cancino-Díaz, Mario E.; Jan-Roblero, Janet; Cancino-Díaz, Juan C.

    2012-01-01

    Conventional microbiological culture techniques are frequently insufficient to confirm endophthalmitis clinical cases which could require urgent medical attention because it could lead to permanent vision loss. We are proposing PCR-DGGE and 16S rRNA gene libraries as an alternative to improve the detection and identification rate of bacterial species from endophthalmitis cases. PMID:24031830

  8. 16S rRNA gene-based identification of bacteria in postoperative endophthalmitis by PCR- Denaturing Gradient Gel Electrophoresis (PCR-DGGE fingerprinting

    Directory of Open Access Journals (Sweden)

    Yendi Navarro-Noya

    2012-03-01

    Full Text Available Conventional microbiological culture techniques are frequently insufficient to confirm endophthalmitis clinical cases which could require urgent medical attention because it could lead to permanent vision loss. We are proposing PCR-DGGE and 16S rRNA gene libraries as an alternative to improve the detection and identification rate of bacterial species from endophthalmitis cases.

  9. Development of a novel multiplex PCR assay for rapid detection of virulence associated genes of Pasteurella multocida from pigs.

    Science.gov (United States)

    Rajkhowa, S

    2015-09-01

    As the pathogenicity of Pasteurella multocida is associated with various virulence factors (VFs), the aim of the study was to develop a novel multiplex PCR (m-PCR) assay for the rapid detection of important virulence associated genes (VAGs) of P. multocida isolates from pigs. The target recognized VFs used in the study were diverse adhesins (ptfA and pfhA), toxins (toxA), siderophores (tonB and hgbA), sialidases (nanB, nanH) and outer membrane proteins (ompA, ompH, oma87 and plpB). The primers for the genes encoding these VFs were designed by primer3 software (http://bioinfo.ut.ee/primer3-0.4.0/) using gene sequences available in Genbank. The detection limit of the developed assay was 10(2)  CFU ml(-1) . The m-PCR did not produce any nonspecific amplification products when tested against Bordetella bronchiseptica which also commonly infects pigs. We applied m-PCR to the field samples, and the results obtained were the same as the single PCR results. The developed assay would be very useful for veterinary diagnostic laboratories and for others interested in the rapid virulence profiling of porcine P. multocida isolates circulating in the piggeries. The study reports the development and evaluation of a novel multiplex PCR assay for the rapid detection of 11 important VAGs of Pasteurella multocida isolates from pigs. Rapid and simultaneous detection of recognized VFs of the organism are essential to know the virulo-types of P. multocida isolates circulating in the piggeries. The developed novel assay will be very useful for the rapid detection of VAGs of P. multocida isolates from pigs. © 2015 The Society for Applied Microbiology.

  10. Development of a multiplex real-time PCR assay for the rapid diagnosis of neonatal late onset sepsis.

    Science.gov (United States)

    van den Brand, Marre; Peters, Remco P H; Catsburg, Arnold; Rubenjan, Anna; Broeke, Ferdi J; van den Dungen, Frank A M; van Weissenbruch, Mirjam M; van Furth, A Marceline; Kõressaar, Triinu; Remm, Maido; Savelkoul, Paul H M; Bos, Martine P

    2014-11-01

    The diagnosis of late onset sepsis (LOS), a severe condition with high prevalence in preterm infants, is hampered by the suboptimal sensitivity and long turnaround time of blood culture. Detection of the infecting pathogen directly in blood by PCR would provide a much more timely result. Unfortunately, PCR-based assays reported so far are labor intensive and often lack direct species identification. Therefore we developed a real-time multiplex PCR assay tailored to LOS diagnosis which is easy-to-use, is applicable on small blood volumes and provides species-specific results within 4h. Species-specific PCR assays were selected from literature or developed using bioinformatic tools for the detection of the most prevalent etiologic pathogens: Enterococcus faecalis, Staphylococcus aureus, Staphylococcus spp., Streptococcus agalactiae, Escherichia coli, Pseudomonas aeruginosa, Klebsiella spp. and Serratia marcescens. The PCR assays showed 100% specificity, full coverage of the target pathogens and a limit of detection (LOD) of ≤10CFUeq./reaction. These LOD values were maintained in the multiplex format or when bacterial DNA was isolated from blood. Clinical evaluation showed high concordance between the multiplex PCR and blood culture. In conclusion, we developed a multiplex PCR that allows the direct detection of the most important bacterial pathogens causing LOS in preterm infants. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. A PCR-based method for identification of bifidobacteria from the human alimentary tract at the species level

    NARCIS (Netherlands)

    Venema, K.; Maathuis, A.J.H.

    2003-01-01

    A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12

  12. Sex identification of four penguin species using locus-specific PCR.

    Science.gov (United States)

    Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng

    2013-01-01

    Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.

  13. Extraction of DNA from honey and its amplification by PCR for botanical identification

    Directory of Open Access Journals (Sweden)

    Sona Arun Jain

    2013-12-01

    Full Text Available The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

  14. Pentaplex PCR as screening assay for jellyfish species identification in food products.

    Science.gov (United States)

    Armani, Andrea; Giusti, Alice; Castigliego, Lorenzo; Rossi, Aurelio; Tinacci, Lara; Gianfaldoni, Daniela; Guidi, Alessandra

    2014-12-17

    Salted jellyfish, a traditional food in Asian Countries, is nowadays spreading on the Western markets. In this work, we developed a Pentaplex PCR for the identification of five edible species (Nemopilema nomurai, Rhopilema esculentum, Rhizostoma pulmo, Pelagia noctiluca, and Cotylorhiza tuberculata), which cannot be identified by a mere visual inspection in jellyfish products sold as food. A common degenerated forward primer and five specie-specific reverse primers were designed to amplify COI gene regions of different lengths. Another primer pair targeted the 28SrRNA gene and was intended as common positive reaction control. Considering the high level of degradation in the DNA extracted from acidified and salted products, the maximum length of the amplicons was set at 200 bp. The PCR was developed using 66 reference DNA samples. It gave successful amplifications in 85.4% of 48 ready to eat products (REs) and in 60% of 30 classical salted products (CPs) collected on the market.

  15. A fluorescence-based quantitative real-time PCR assay for accurate Pocillopora damicornis species identification

    Science.gov (United States)

    Thomas, Luke; Stat, Michael; Evans, Richard D.; Kennington, W. Jason

    2016-09-01

    Pocillopora damicornis is one of the most extensively studied coral species globally, but high levels of phenotypic plasticity within the genus make species identification based on morphology alone unreliable. As a result, there is a compelling need to develop cheap and time-effective molecular techniques capable of accurately distinguishing P. damicornis from other congeneric species. Here, we develop a fluorescence-based quantitative real-time PCR (qPCR) assay to genotype a single nucleotide polymorphism that accurately distinguishes P. damicornis from other morphologically similar Pocillopora species. We trial the assay across colonies representing multiple Pocillopora species and then apply the assay to screen samples of Pocillopora spp. collected at regional scales along the coastline of Western Australia. This assay offers a cheap and time-effective alternative to Sanger sequencing and has broad applications including studies on gene flow, dispersal, recruitment and physiological thresholds of P. damicornis.

  16. Use of Triplex PCR for Rapid Detection of PVL and Differentiation of MRSA from Methicillin Resistant Coagulase Negative Staphylococci

    Science.gov (United States)

    Abimanyu, Nagarajan; Krishnan, Arunkumar; Murugesan, Saravanan; Subramanian G, Kaushik; Gurumurthy, Sivakumar; Krishnan, Padma

    2013-01-01

    Introduction: Methicillin-Resistant Staphylococcus aureus (MRSA) has become a major public health problem in both hospitals and communities. Panton – Valentine Leucocidin (PVL) has been reported to be an important marker for the highly pathogenic community acquired S. aureus infections. A rapid detection of these MRSA is very important for its treatment. The specific detection of MRSA is always a problem due to the prevalence of methicillin resistance among the coagulase negative Staphylococci. Hence, this study was done to develop a rapid triplex PCR for the detection of PVL positive MRSA and for the simultaneous differentiation of MRSA from Coagulase Negative Staphylococci (CoNS). Materials and Methods: We developed a triplex PCR for the specific detection of PVL positive Community Acquired (CA) – MRSA and for its simultaneous differentiation from the coagulase negative Staphylococci. We used PCR for targeting the fem A gene which is specific for S. aureus, mecA which is specific for methicillin-resistance and luk - PV which is specific for the PVL toxin. The method was evaluated with a total of 100 clinical isolates of Staphylococcus spp. Results: The triplex PCR was successfully standardized by using the reference strains and it was evaluated by using clinical strains. The method was found to be rapid, highly sensitive (100%), specific (99%) and cost effective. Conclusion: Triplex PCR can be used as a diagnostic tool for the detection of the highly pathogenic strains of CA-MRSA. PMID:23542876

  17. Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks.

    Science.gov (United States)

    Wei, B; Cha, S-Y; Kang, M; Park, I-J; Moon, O-K; Park, C-K; Jang, H-K

    2013-05-01

    Infections with Pasteurella multocida, Salmonella enterica, Riemerella anatipestifer, and Escherichia coli result in high morbidity and mortality, which cause significant economic loss in the poultry industry. It can be difficult to distinguish these pathogens based on clinical signs because these pathogens can cause similar clinical signs and coinfections can occur. Thus, rapid and sensitive detection of these 4 major bacterial pathogens are important in ducks. The aim of this study was to develop a multiplex PCR (mPCR) assay for simultaneously detecting and identifying these 4 pathogenic bacteria in a single tube reaction. The target genes used were KMT1 of P. multocida, the invasion protein gene of S. enterica, 16S rDNA of R. anatipestifer, and the alkaline phosphatase gene of E. coli. The detection limit of the assay for all bacterial DNA was 10 pg. The mPCR did not produce any nonspecific amplification products when tested against other related pathogens, including Staphylococcus aureus, Streptococcus pyogenes, Clostridium perfringens, Mycoplasma gallinarum, Mycoplasma synoviae, and Mycoplasma gallisepticum, which can also infect ducks. We applied mPCR to field samples, and the results were the same as the single PCR results. These results suggest that mPCR for the 4 bacteria is a useful and rapid technique to apply to field samples.

  18. Development of a rapid real-time PCR method as a tool to quantify viable Photobacterium phosphoreum bacteria in salmon (Salmo salar) steaks.

    Science.gov (United States)

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka; Prévost, Hervé; Joffraud, Jean-Jacques; Dalgaard, Paw; Pilet, Marie-France; Dousset, Xavier

    2013-04-01

    A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R(2) of 0.99) was obtained between this method and conventional enumeration on marine agar (MA). Quantification was linear over 5 log units as confirmed by using inoculated salmon samples. On naturally contaminated fresh salmon, the new real-time PCR method performed successfully with a quantification limit of 3 log CFU/g. A correlation coefficient (R(2)) of 0.963 was obtained between the PCR method and classic enumeration on MA, followed by identification of colonies (290 isolates identified by real-time PCR or by 16S rRNA gene sequencing). A good correlation with an R(2) of 0.940 was found between the new PCR method and an available specific conductance method for P. phosphoreum. This study presents a rapid tool for producing reliable quantitative data on viable P. phosphoreum bacteria in fresh salmon in 6 h. This new culture-independent method will be valuable for future fish inspection, the assessment of raw material quality in fish processing plants, and studies on the ecology of this important specific spoilage microorganism.

  19. Development of a Rapid Real-Time PCR Method as a Tool To Quantify Viable Photobacterium phosphoreum Bacteria in Salmon (Salmo salar) Steaks

    Science.gov (United States)

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka; Prévost, Hervé; Joffraud, Jean-Jacques; Dalgaard, Paw; Pilet, Marie-France

    2013-01-01

    A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R2 of 0.99) was obtained between this method and conventional enumeration on marine agar (MA). Quantification was linear over 5 log units as confirmed by using inoculated salmon samples. On naturally contaminated fresh salmon, the new real-time PCR method performed successfully with a quantification limit of 3 log CFU/g. A correlation coefficient (R2) of 0.963 was obtained between the PCR method and classic enumeration on MA, followed by identification of colonies (290 isolates identified by real-time PCR or by 16S rRNA gene sequencing). A good correlation with an R2 of 0.940 was found between the new PCR method and an available specific conductance method for P. phosphoreum. This study presents a rapid tool for producing reliable quantitative data on viable P. phosphoreum bacteria in fresh salmon in 6 h. This new culture-independent method will be valuable for future fish inspection, the assessment of raw material quality in fish processing plants, and studies on the ecology of this important specific spoilage microorganism. PMID:23396343

  20. Design of a biological method for rapid detection of presence of PCR inhibitors in aged bone DNA.

    Science.gov (United States)

    Ghasemi, Akram; Mahdieh, Nejat; Tavallaei, Mahmood; Aslani, Mohammad Mehdi; Zafari, Zahra; Shirkavand, Atefeh; Farzad, Maryam Sharafi; Naderi, Mahdi; Azariyan, Sajjad Habibi; Zeinali, Sirous

    2012-01-01

    Molecular human identification is one of the most important tests performed in forensic laboratories. Some of these tests are applied for identification of human remains from natural disasters, wars, etc., but problems may occur as a result of DNA degradation and external DNA contamination. We investigated effects of bacterial DNA on identifying the presence or absence of PCR inhibitors in aged bone DNA. DNA samples were extracted from blood, bone remains and Escherichia coli. These DNA were amplified using human and bacterial specific primers. Using different blood, aged bone, and bacterial DNA dilutions along with PCR based methods; we checked their positive, negative effects, or detecting presence of inhibitors in aged bone DNA by PCR method. Our observation indicated that the addition of bacterial DNA could be a valid biological method for testing the quality of bone DNA to enable us to obtain a usable profile for the identification of human remains. This method will help to test the presence of inhibitors, quantity or even quality of DNA which are of importance in profiling archeological remains. Our method will help to determine if PCR failure is due to presence of inhibitors or lack of amplifiable DNA either because of degradation, minute amount or absence of human DNA.

  1. Development of a multiplex-PCR probe system for the proper identification of Klebsiella variicola.

    Science.gov (United States)

    Garza-Ramos, Ulises; Silva-Sánchez, Jesús; Martínez-Romero, Esperanza; Tinoco, Perla; Pina-Gonzales, Marisol; Barrios, Humberto; Martínez-Barnetche, Jesús; Gómez-Barreto, Rosa Elena; Tellez-Sosa, Juan

    2015-03-13

    Klebsiella variicola was very recently described as a new bacterial species and is very closely related to Klebsiella pneumoniae; in fact, K. variicola isolates were first identified as K. pneumoniae. Therefore, it might be the case that some isolates, which were initially classified as K. pneumoniae, are actually K. variicola. The aim of this study was to devise a multiplex-PCR probe that can differentiate isolates from these sister species. This work describes the development of a multiplex-PCR method to identify K. variicola. This development was based on sequencing a K. variicola clinical isolate (801) and comparing it to other K. variicola and K. pneumoniae genomes. The phylogenetic analysis showed that K. variicola isolates form a monophyletic group that is well differentiated from K. pneumoniae. Notably, the isolate K. pneumoniae 342 and K. pneumoniae KP5-1 might have been misclassified because in our analysis, both clustered with K. variicola isolates rather than with K. pneumoniae. The multiplex-PCR (M-PCR-1 to 3) probe system could identify K. variicola with high accuracy using the shared unique genes of K. variicola and K. pneumoniae genomes, respectively. M-PCR-1 was used to assay a collection of multidrug-resistant (503) and antimicrobial-sensitive (557) K. pneumoniae clinical isolates. We found K. variicola with a prevalence of 2.1% (23/1,060), of them a 56.5% (13/23) of the isolates were multidrug resistant, and 43.5% (10/23) of the isolates were antimicrobial sensitive. The phylogenetic analysis of rpoB of K. variicola-positive isolates identified by multiplex-PCR support the correct identification and differentiation of K. variicola from K. pneumoniae clinical isolates. This multiplex-PCR provides the means to reliably identify and genotype K. variicola. This tool could be very helpful for clinical, epidemiological, and population genetics studies of this species. A low but significant prevalence of K. variicola isolates was found, implying that

  2. PCR Identification and Phylogenetic Analysis of Trichomonas gallinae from Domestic Pigeons in Guangzhou, China

    OpenAIRE

    Qiu, Shen-Ben; Lv, Meng-Na; He, Xi; Weng, Ya-Biao; Zou, Shang-Shu; Wang, Xin-Qiu; Lin, Rui-Qing

    2017-01-01

    Avian trichomoniasis caused by Trichomonas gallinae is a serious protozoan disease worldwide. The domestic pigeon (Columba livia domestica) is the main host for T. gallinae and plays an important role in the spread of the disease. Based on the internal transcribed spacers of nuclear ribosomal DNA of this parasite, a pair of primers (TgF2/TgR2) was designed and used to develop a PCR assay for the diagnosis of T. gallinae infection in domestic pigeons. This approach allowed the identification o...

  3. Genetic Characteristics and Multiple-PCR Development for Capsular Identification of Specific Serotypes of Campylobacter jejuni.

    Science.gov (United States)

    Liang, Hao; Zhang, Aiyu; Gu, Yixin; You, Yuanhai; Zhang, Jianzhong; Zhang, Maojun

    2016-01-01

    The polysaccharide capsule (CPS) of Campylobacter jejuni is a virulence factor linked to cell surface carbohydrate diversity which mainly determines the serotypes. Thirty-four CPS gene cluster structures have been published and some of them can be distinguished by multiple-PCR. Penner serotypes HS1/44c, HS2, HS4c, HS19, HS23/36c and HS41 are markers for Guillain-Barré syndrome (GBS). The capsules may contribute to GBS susceptibility. Analysis of 18 CPS loci revealed high gene content diversity and a mosaic nature of the capsule loci, which are possibly due to gene gain/loss events, and demonstrated a high degree of conservation of genes within serotypes/serotype complexes. A method of multiple-PCR was developed to distinguish five specific serotypes and three GBS-related serotypes. Primers specific for each capsule type were designed on the basis of paralogs or a unique DNA region of the CPS locus. The multiple-PCR can distinguish the eight serotypes in two PCRs with sensitivity and specificity of 100% using 227 strains of known Penner type. The multiple-PCR method will help to distinguish serotypes simply and rapidly.

  4. Emerging technologies for rapid identification of bloodstream pathogens.

    Science.gov (United States)

    Kothari, Atul; Morgan, Margie; Haake, David A

    2014-07-15

    Technologies for rapid microbial identification are poised to revolutionize clinical microbiology and enable informed decision making for patients with life-threatening bloodstream infections. Species identification of microorganisms in positive blood cultures can be performed in minutes using commercial fluorescence in situ hybridization tests or mass spectroscopy. Microorganisms in positive blood cultures can also be identified within 1-2.5 hours using automated polymerase chain reaction-based systems that can also detect selected antibiotic resistance markers, such as methicillin resistance. When combined with antibiotic stewardship programs, these approaches improve clinical outcomes and reduce healthcare expenditures. Tests for direct detection in whole blood samples are highly desirable because of their potential to identify bloodstream pathogens without waiting 1-2 days for blood cultures to become positive. However, results for pathogen detection in whole blood do not overlap with those of conventional blood culture techniques and we are still learning how best to use these approaches. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. Rapid Detection of Enterotoxigenic Clostridium perfringens by Real-Time Fluorescence Resonance Energy Transfer PCR

    National Research Council Canada - National Science Library

    dela Cruz, Wilfred P; Gozum, Mary M.A; Lineberry, Sarah F; Stassen, Sarah D; Daughtry, Marianne; Stassen, Nicholas A; Jones, Morris S; Johnson, Oswald L

    2006-01-01

    ...) produced by some strains during sporulation. We developed a quantitative real-time PCR assay based on fluorescence resonance energy transfer hybridization chemistry that targets the C. perfringens...

  6. Evaluation of a PCR/DNA Probe Colorimetric Membrane Assay for Identification of Campylobacter spp. in Human Stool Specimens

    OpenAIRE

    Collins, Evelyn; Glennon, Maura; Hanley, Shirley; Murray, Anne-Marie; Cormican, Martin; Smith, Terry; Maher, Majella

    2001-01-01

    DNA was extracted from 50 human stool specimens using the QIAamp DNA stool minikit. PCR amplification was followed by post-PCR hybridization to DNA probes specific for the Campylobacter genus, Campylobacter jejuni, and Campylobacter coli in a colorimetric membrane assay. Thirty-two of 38 culture-positive specimens were PCR/DNA probe positive for C. jejuni. The assay is rapid and simple and can be applied to stool specimens for the detection of Campylobacter.

  7. Rapid and inexpensive body fluid identification by RNA profiling-based multiplex High Resolution Melt (HRM) analysis.

    Science.gov (United States)

    Hanson, Erin K; Ballantyne, Jack

    2013-01-01

    Positive identification of the nature of biological material present on evidentiary items can be crucial for understanding the circumstances surrounding a crime. However, traditional protein-based methods do not permit the identification of all body fluids and tissues, and thus molecular based strategies for the conclusive identification of all forensically relevant biological fluids and tissues need to be developed. Messenger RNA (mRNA) profiling is an example of such a molecular-based approach. Current mRNA body fluid identification assays involve capillary electrophoresis (CE) or quantitative RT-PCR (qRT-PCR) platforms, each with its own limitations. Both platforms require the use of expensive fluorescently labeled primers or probes. CE-based assays require separate amplification and detection steps thus increasing the analysis time. For qRT-PCR assays, only 3-4 markers can be included in a single reaction since each requires a different fluorescent dye. To simplify mRNA profiling assays, and reduce the time and cost of analysis, we have developed single- and multiplex body fluid High Resolution Melt (HRM) assays for the identification of common forensically relevant biological fluids and tissues. The incorporated biomarkers include IL19 (vaginal secretions), IL1F7 (skin), ALAS2 (blood), MMP10 (menstrual blood), HTN3 (saliva) and TGM4 (semen).  The HRM assays require only unlabeled PCR primers and a single saturating intercalating fluorescent dye (Eva Green). Each body-fluid-specific marker can easily be identified by the presence of a distinct melt peak. Usually, HRM assays are used to detect variants or isoforms for a single gene target. However, we have uniquely developed duplex and triplex HRM assays to permit the simultaneous detection of multiple targets per reaction. Here we describe the development and initial performance evaluation of the developed HRM assays. The results demonstrate the potential use of HRM assays for rapid, and relatively inexpensive

  8. Culture-independent identification and quantification of Gallibacterium anatis (G. anatis) by real-time quantitative PCR.

    Science.gov (United States)

    Wang, Chong; Robles, Francisco; Ramirez, Saul; Riber, Anja Brinch; Bojesen, Anders Miki

    2016-10-01

    Gallibacterium is a genus within the family Pasteurellaceae characterized by a high level of phenotypic and genetic diversity. No diagnostic method has yet been described, which allows species-specific identification of Gallibacterium anatis. The aim of this study was to develop a real-time quantitative PCR (qPCR) method allowing species-specific identification and quantification of G. anatis. A G. anatis specific DNA sequence was identified in the gyrase subunit B gene (gyrB) and used to design a TaqMan probe and corresponding primers. The specificity of the assay was tested on 52 bacterial strains. Twenty-two of the strains represented all of the presently available 13 phenotypic variants of G. anatis originating from different geographical locations. Nine strains represented each of the additional six Gallibacterium species and 21 strains represented other poultry associated bacterial species of the families Pasteurellaceae, Enterobacteriaceae and Flavobacteriaceae. Regarding specificity none of non-G. anatis strains tested positive with the proposed assay. To test and compare the qPCR method's ability to detect G. anatis from field samples, the sensitivity was compared to a previously published conventional PCR method and culture-based identification, respectively. The detection rates were 97%, 78% and 34% for the current qPCR, the conventional PCR and the culture-based identification method, respectively. The qPCR assay was able to detect the gene gyrB in serial dilutions of 10(8) colony forming units (CFU)/ml to as low as 10(0) CFU/ml copies. The proposed qPCR method is thus highly specific, sensitive and reproducible. In conclusion, we have developed a qPCR method that allows species-specific identification of G. anatis.

  9. PCR-based identification and delineation of members within the Pseudorhabdosynochus lantauensis complex (Monogenea: Diplectanidae).

    Science.gov (United States)

    Li, An-Xing; Wu, Xiang-Yun; Xie, Ming-Quan; Lin, Rui-Qing; Gasser, Robin B; Zhu, Xing-Quan

    2005-12-01

    Molecular methods using genetic markers in the nuclear ribosomal DNA (rDNA) were established to identify and distinguish between two members within the Pseudorhabdosynochus lantauensis complex and two morphologically distinct congeners, Pseudorhabdosynochus epinepheli and Pseudorhabdosynochus coioidesis, from different marine fish species and various geographical origins. Supported by selective DNA sequencing, it was demonstrated that the polymerase chain reaction (PCR)-coupled single-strand conformation polymorphism analysis of the first internal transcribed spacer and restriction fragment length polymorphism analysis of a variable region (representing the D1-D3 domains) in the large subunit of rDNA achieved the identification and delineation of all four taxa examined. These PCR-based approaches provide useful complementary tools to traditional methods for the accurate identification of species within the genus Pseudorhabdosynochus (irrespective of developmental stage) and have major implications for studying the ecology, transmission, and population genetic structures of these and other related parasites and for the prevention and control of the diseases they cause.

  10. Identification of meat species by PCR-RFLP of the mitochondrial COI gene.

    Science.gov (United States)

    Haider, Nadia; Nabulsi, Imad; Al-Safadi, Bassam

    2012-02-01

    Meat authenticity verification is pertinent for economical, religious or public health concerns. The present study investigates the use of PCR-RFLP of a part of the mitochondrial cytochrome c oxidase subunit 1 (COI) gene for identification of species origin of raw meat samples of cow, chicken, turkey, sheep, pig, buffalo, camel and donkey. PCR yielded a 710-bp fragment in all species. The amplicons were digested with seven restriction endonucleases (Hind II, Ava II, Rsa I, Taq I, Hpa II, Tru 1I and Xba I) that were selected based on the preliminary in silico analysis. Different levels of polymorphism were detected among samples. The level of COI variation revealed using only Hpa II was sufficient to generate easily analyzable species-specific restriction profiles that could distinguish unambiguously all targeted species. Compared to previously published reports for the determination of meat origin at the molecular level, the approach developed here is much cheaper and faster for routine identification of meats in food control laboratories. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Identification of methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from burn patients by multiplex PCR.

    Science.gov (United States)

    Montazeri, Effat Abbasi; Khosravi, Azar Dokht; Jolodar, Abbas; Ghaderpanah, Mozhgan; Azarpira, Samireh

    2015-05-01

    Methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant coagulase-negative staphylococci (MRCoNS) as important human pathogens are causes of nosocomial infections worldwide. Burn patients are at a higher risk of local and systemic infections with these microorganisms. A screening method for MRSA by using a multiplex polymerase chain reaction (PCR) targeting the 16S ribosomal RNA (rRNA), mecA, and nuc genes was developed. The aim of the present study was to investigate the potential of this PCR assay for the detection of MRSA strains in samples from burn patients. During an 11-month period, 230 isolates (53.11%) of Staphylococcus spp. were collected from burn patients. The isolates were identified as S. aureus by using standard culture and biochemical tests. DNA was extracted from bacterial colonies and multiplex PCR was used to detect MRSA and MRCoNS strains. Of the staphylococci isolates, 149 (64.9%) were identified as S. aureus and 81 (35.21%) were described as CoNS. Among the latter, 51 (62.97%) were reported to be MRCoNS. From the total S. aureus isolates, 132 (88.6%) were detected as MRSA and 17 (11.4%) were methicillin-susceptible S. aureus (MSSA). The presence of the mecA gene in all isolates was confirmed by using multiplex PCR as a gold standard method. This study presented a high MRSA rate in the region under investigation. The 16S rRNA-mecA-nuc multiplex PCR is a good tool for the rapid characterization of MRSA strains. This paper emphasizes the need for preventive measures and choosing effective antimicrobials against MRSA and MRCoNS infections in the burn units. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  12. Application of rapid onsite PCR (TaqMan) for Phytophthora ramorum under U.S. conditions

    Science.gov (United States)

    Kelvin Hughes; Jenny Tomlinson; Neil Boonham; Kelly Ivors; Matteo Garbelotto; Ian Barker

    2006-01-01

    Currently, diagnosis of Phytophthora ramorum involves sending samples to a laboratory for traditional isolation and morphological characterisation, and/or PCR analysis. This can take as long as 2 weeks from sampling to final diagnosis. However, the Plant Health Group, Central Science Laboratory, has produced on-site DNA extraction and real-time PCR (...

  13. PCR and PCR-RFLP of the 5S-rRNA-NTS region and salvinorin A analyses for the rapid and unequivocal determination of Salvia divinorum.

    Science.gov (United States)

    Bertea, Cinzia M; Luciano, Pino; Bossi, Simone; Leoni, Francesca; Baiocchi, Claudio; Medana, Claudio; Azzolin, Chiara M M; Temporale, Giovanni; Lombardozzi, Maria Antonietta; Maffei, Massimo E

    2006-02-01

    Salvia divinorum Epling & Játiva-M. is a perennial herb belonging to the Lamiaceae family; its active ingredient, the neoclerodane diterpene salvinorin A, is a psychotropic molecule that produces hallucinations. A comparative evaluation of S. divinorum fresh and dried leaves, S. officinalis fresh leaves, and dried powdered leaves claimed to be S. divinorum was done. HPLC-MS data confirmed the presence of salvinorin A in both S. divinorun leaf extracts and the powdered leaves, whereas no salvinorin A was found in S. officinalis. The non-transcribed spacer (NTS) in the 5S-rRNA gene of all leaf samples and the dried powdered leaves was amplified by PCR using a pair of primers located at the 3' and 5' ends of the coding sequence of 5S-rRNA gene. The resulting PCR products (about 500bp for S. divinorum and 300bp for S. officinalis) were gel purified, subcloned into pGEM-T Easy vector and sequenced. By aligning the isolated nucleotide sequences, great diversities were found in the spacer region of the two species. Specific S. divinorum primers were designed on the sequence of the 5S-rRNA gene spacer region. In addition, a PCR-restriction fragment length polymorphism (PCR-RFLP) method was applied using NdeI and TaqI restriction enzymes. An NdeI site, absent in S. officinalis, was found in S. divinorum NTS region at 428-433bp. For TaqI, multiple sites (161-164, 170-173, and 217-220bp) were found in S. officinalis, whereas a unique site was found in S. divinorum (235-238bp). The results of this work show that the combined use of analytical chemical (HPLC-MS) and molecular (DNA fingerprinting) methods lead to the precise and unequivocal identification of S. divinorum.

  14. Identification of reference genes for real-time quantitative PCR experiments in the liverwort Marchantia polymorpha.

    Science.gov (United States)

    Saint-Marcoux, Denis; Proust, Hélène; Dolan, Liam; Langdale, Jane A

    2015-01-01

    Real-time quantitative polymerase chain reaction (qPCR) has become widely used as a method to compare gene transcript levels across different conditions. However, selection of suitable reference genes to normalize qPCR data is required for accurate transcript level analysis. Recently, Marchantia polymorpha has been adopted as a model for the study of liverwort development and land plant evolution. Identification of appropriate reference genes has therefore become a necessity for gene expression studies. In this study, transcript levels of eleven candidate reference genes have been analyzed across a range of biological contexts that encompass abiotic stress, hormone treatment and different developmental stages. The consistency of transcript levels was assessed using both geNorm and NormFinder algorithms, and a consensus ranking of the different candidate genes was then obtained. MpAPT and MpACT showed relatively constant transcript levels across all conditions tested whereas the transcript levels of other candidate genes were clearly influenced by experimental conditions. By analyzing transcript levels of phosphate and nitrate starvation reporter genes, we confirmed that MpAPT and MpACT are suitable reference genes in M. polymorpha and also demonstrated that normalization with an inappropriate gene can lead to erroneous analysis of qPCR data.

  15. Identification of reference genes for real-time quantitative PCR experiments in the liverwort Marchantia polymorpha.

    Directory of Open Access Journals (Sweden)

    Denis Saint-Marcoux

    Full Text Available Real-time quantitative polymerase chain reaction (qPCR has become widely used as a method to compare gene transcript levels across different conditions. However, selection of suitable reference genes to normalize qPCR data is required for accurate transcript level analysis. Recently, Marchantia polymorpha has been adopted as a model for the study of liverwort development and land plant evolution. Identification of appropriate reference genes has therefore become a necessity for gene expression studies. In this study, transcript levels of eleven candidate reference genes have been analyzed across a range of biological contexts that encompass abiotic stress, hormone treatment and different developmental stages. The consistency of transcript levels was assessed using both geNorm and NormFinder algorithms, and a consensus ranking of the different candidate genes was then obtained. MpAPT and MpACT showed relatively constant transcript levels across all conditions tested whereas the transcript levels of other candidate genes were clearly influenced by experimental conditions. By analyzing transcript levels of phosphate and nitrate starvation reporter genes, we confirmed that MpAPT and MpACT are suitable reference genes in M. polymorpha and also demonstrated that normalization with an inappropriate gene can lead to erroneous analysis of qPCR data.

  16. Rapid and Inexpensive Screening of Genomic Copy Number Variations Using a Novel Quantitative Fluorescent PCR Method

    Directory of Open Access Journals (Sweden)

    Martin Stofanko

    2013-01-01

    Full Text Available Detection of human microdeletion and microduplication syndromes poses significant burden on public healthcare systems in developing countries. With genome-wide diagnostic assays frequently inaccessible, targeted low-cost PCR-based approaches are preferred. However, their reproducibility depends on equally efficient amplification using a number of target and control primers. To address this, the recently described technique called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR was shown to reliably detect four human syndromes by quantifying DNA amplification in an internally controlled PCR reaction. Here, we confirm its utility in the detection of eight human microdeletion syndromes, including the more common WAGR, Smith-Magenis, and Potocki-Lupski syndromes with 100% sensitivity and 100% specificity. We present selection, design, and performance evaluation of detection primers using variety of approaches. We conclude that MQF-PCR is an easily adaptable method for detection of human pathological chromosomal aberrations.

  17. Multiplex PCR method for use in real-time PCR for identification of fish fillets from grouper (Epinephelus and Mycteroperca species) and common substitute species.

    Science.gov (United States)

    Trotta, Michele; Schönhuth, Susana; Pepe, Tiziana; Cortesi, M Luisa; Puyet, Antonio; Bautista, José M

    2005-03-23

    Mitochondrial 16S rRNA sequences from morphological validated grouper (Epinephelus aeneus, E. caninus, E. costae, and E. marginatus; Mycteroperca fusca and M. rubra), Nile perch (Lates niloticus), and wreck fish (Polyprion americanus) were used to develop an analytical system for group diagnosis based on two alternative Polymerase Chain Reaction (PCR) approaches. The first includes conventional multiplex PCR in which electrophoretic migration of different sizes of bands allowed identification of the fish species. The second approach, involving real-time PCR, produced a single amplicon from each species that showed different Tm values allowing the fish groups to be directly identified. Real-time PCR allows the quick differential diagnosis of the three groups of species and high-throughput screening of multiple samples. Neither PCR system cross-reacted with DNA samples from 41 common marketed fish species, thus conforming to standards for species validation. The use of these two PCR-based methods makes it now possible to discriminate grouper from substitute fish species.

  18. Performance of rapid diagnostic test, blood-film microscopy and PCR for the diagnosis of malaria infection among febrile children from Korogwe District, Tanzania.

    Science.gov (United States)

    Mahende, Coline; Ngasala, Billy; Lusingu, John; Yong, Tai-Soon; Lushino, Paminus; Lemnge, Martha; Mmbando, Bruno; Premji, Zul

    2016-07-26

    Rapid diagnostic tests (RDT) and light microscopy are still recommended for diagnosis to guide the clinical management of malaria despite difficult challenges in rural settings. The performance of these tests may be affected by several factors, including malaria prevalence and intensity of transmission. The study evaluated the diagnostic performance of malaria RDT, light microscopy and polymerase chain reaction (PCR) in detecting malaria infections among febrile children at outpatient clinic in Korogwe District, northeastern Tanzania. The study enrolled children aged 2-59 months with fever and/or history of fever in the previous 48 h attending outpatient clinics. Blood samples were collected for identification of Plasmodium falciparum infection using histidine-rich-protein-2 (HRP-2)-based malaria RDT, light microscopy and conventional PCR. A total of 867 febrile patients were enrolled into the study. Malaria-positive samples were 85/867 (9.8 %, 95 % CI, 7.9-12.0 %) by RDT, 72/867 (8.3 %, 95 % CI, 6.5-10.1 %) by microscopy and 79/677 (11.7 %, 95 % CI, 9.3-14.3 %) by PCR. The performance of malaria RDT compared with microscopy results had sensitivity and positive predictive value (PPV) of 88.9 % (95 % CI, 79.3-95.1 %) and 75.3 % (95 % CI, 64.8-84.0 %), respectively. Confirmation of P. falciparum infection with PCR analysis provided lower sensitivity and PPV of 88.6 % (95 % CI, 79.5-94.7 %) and 84.3 % (95 % CI, 74.7-91.4 %) for RDT compared to microscopy. Diagnosis of malaria infection is still a challenge due to variation in results among diagnostic methods. HRP-2 malaria RDT and microscopy were less sensitive than PCR. Diagnostic tools with high sensitivity are required in areas of low malaria transmission.

  19. Rapid identification of non-sporing anaerobes using nuclear magnetic resonance spectroscopy and an identification strategy

    Directory of Open Access Journals (Sweden)

    Menon S

    2007-01-01

    Full Text Available Purpose: The non-sporing anaerobes cause a wide spectrum of infections. They are difficult to culture and their identification is tedious and time-consuming. Rapid identification of anaerobes is highly desirable. Towards this end, the potential of nuclear magnetic resonance (NMR spectroscopy for providing a fingerprint within the proton spectrum of six genera belonging to anaerobes reflecting their characteristic metabolites has been investigated. Methods: NMR analysis was carried out using Mercury plus Varian 300 MHz (7.05 T NMR spectrophotometer on six different anaerobes. These included Bacteroides fragilis, Prevotella melaninogenica, Prevotella denticola, Fusobacterium necrophorum, Peptococcus niger and Peptostreptococcus spp. After the NMR analysis (256/512 scans, the different peaks were noted. The eight pus specimens, which yielded pure culture of anaerobe, also were analysed similarly. Results: The major resonances of multiplex of amino acids/lipid at 0.9 ppm along with lactate/lipid at 1.3 ppm, acetate at 1.92 ppm and multiplex of lysine at 3.0 ppm remained constant to label the organism as an anaerobe. There was a difference found in the MR spectra of different genera and species. A simple algorithm was developed for the identification of the six different anaerobes studied. The MR spectra of the pure culture of the organism matched the MR spectra of pus from which the organism was isolated. Conclusions: MR-based identification was of value in the identification of anaerobes. However, a larger database of the peaks produced by anaerobes needs to be created for identification of all genera and species. It could then have the potential of diagnosing an anaerobic infection in vivo and thus expedite management of deep-seated abscesses.

  20. Identification and differentiation of the twenty six bluetongue virus serotypes by RT-PCR amplification of the serotype-specific genome segment 2.

    Directory of Open Access Journals (Sweden)

    Narender S Maan

    Full Text Available Bluetongue (BT is an arthropod-borne viral disease, which primarily affects ruminants in tropical and temperate regions of the world. Twenty six bluetongue virus (BTV serotypes have been recognised worldwide, including nine from Europe and fifteen in the United States. Identification of BTV serotype is important for vaccination programmes and for BTV epidemiology studies. Traditional typing methods (virus isolation and serum or virus neutralisation tests (SNT or VNT are slow (taking weeks, depend on availability of reference virus-strains or antisera and can be inconclusive. Nucleotide sequence analyses and phylogenetic comparisons of genome segment 2 (Seg-2 encoding BTV outer-capsid protein VP2 (the primary determinant of virus serotype were completed for reference strains of BTV-1 to 26, as well as multiple additional isolates from different geographic and temporal origins. The resulting Seg-2 database has been used to develop rapid (within 24 h and reliable RT-PCR-based typing assays for each BTV type. Multiple primer-pairs (at least three designed for each serotype were widely tested, providing an initial identification of serotype by amplification of a cDNA product of the expected size. Serotype was confirmed by sequencing of the cDNA amplicons and phylogenetic comparisons to previously characterised reference strains. The results from RT-PCR and sequencing were in perfect agreement with VNT for reference strains of all 26 BTV serotypes, as well as the field isolates tested. The serotype-specific primers showed no cross-amplification with reference strains of the remaining 25 serotypes, or multiple other isolates of the more closely related heterologous BTV types. The primers and RT-PCR assays developed in this study provide a rapid, sensitive and reliable method for the identification and differentiation of the twenty-six BTV serotypes, and will be updated periodically to maintain their relevance to current BTV distribution and

  1. Identification, quantification and subtyping of Gardnerella vaginalis in noncultured clinical vaginal samples by quantitative PCR.

    Science.gov (United States)

    Balashov, Sergey V; Mordechai, Eli; Adelson, Martin E; Gygax, Scott E

    2014-02-01

    Gardnerella vaginalis is an important component of the human vaginal microflora. It is proposed to play a key role in the pathogenesis of bacterial vaginosis (BV), the most common vaginal condition. Here we describe the development, validation and comparative analysis of a novel molecular approach capable of G. vaginalis identification, quantification and subtyping in noncultured vaginal specimens. Using two quantitative PCR (qPCR) assays, we analysed G. vaginalis bacterial loads and clade distribution in 60 clinical vaginal-swab samples. A very high pathogen prevalence was revealed by species-specific qPCR not only among BV patients (100 %), but also in healthy women (97 %), although the G. vaginalis concentration was significantly lower in non-BV samples. G. vaginalis clades identified in vaginal specimens by subtyping multiplex qPCR, which targets four clade-specific genetic markers, had frequencies of 53 % for clade 1, 25 % for clade 2, 32 % for clade 3 and 83 % for clade 4. Multiple clades were found in 70 % of samples. Single G. vaginalis clades were represented by clade 1 and clade 4 in 28 % of specimens. A positive association with BV was shown for clade 1 and clade 3, while clade 2 was positively associated with intermediate vaginal microflora, but not with BV. Clade 4 demonstrated no correlation with the disorder. The presence of multiple clades had a high positive association with BV, whereas G. vaginalis identified as a single clade was negatively linked with the condition. Polyclonal G. vaginalis infection may be a risk factor for BV.

  2. Rapid Detection of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in Fresh Chicken Meat and By-Products in Bangkok, Thailand, Using Modified Multiplex PCR.

    Science.gov (United States)

    Saiyudthong, S; Phusri, K; Buates, S

    2015-07-01

    A multiplex PCR assay for simultaneous detection and differentiation of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari was developed and validated to assess the occurrence of these bacteria in fresh chicken meat and by-products in Bangkok, Thailand, by using a new combination of four previously published PCR primers for C. jejuni, C. coli, C. lari, and a universal 16S rDNA gene as an internal control. The specificity was determined by using 13 strains of other bacteria. With pure culture DNA, the detection limit was 0.017 ng/PCR for C. jejuni and C. coli and was 0.016 ng/PCR for C. lari. It can detect 10 CFU of C. jejuni, C. coli, and C. lari in 2 g of chicken meat within a 16-h enrichment time. Our multiplex PCR assay was applied for identification of Campylobacter spp. in 122 supermarket samples and 108 fresh market samples. Of the 230 samples evaluated by multiplex PCR, 54.0, 3.3, and 10.7% of supermarket samples were positive for C. jejuni, C. coli, and mixed C. jejuni and C. coli, respectively, and 56.5 and 33.3% of fresh market samples were positive for C. jejuni and mixed C. jejuni and C. coli, respectively. No sample was positive for C. lari. Fresh market samples had significantly higher C. jejuni and C. coli contamination than those from supermarkets (relative risk: 1.3; P = 0.0001). Compared with the culture method (a gold standard), the sensitivity, specificity, positive predictive value, negative predictive value, and diagnostic accuracy of multiplex PCR were 97.7, 86.8, 96.1, 92.0, and 95.2%, respectively. No significant difference was observed between results from two methods (P = 0.55). Therefore, the established multiplex PCR was not only rapid and easy to perform but had a high sensitivity and specificity to distinguish between C. jejuni, C. coli, and C. lari, even in samples containing mixed contamination. Our study indicated that fresh chicken meat and by-products from fresh markets were significantly less hygienic than those

  3. [Rapid identification of microorganisms using MALDI-TOF mass spectrometry].

    Science.gov (United States)

    Sogawa, Kazuyuki; Watanabe, Masaharu; Nomura, Fumio

    2013-01-01

    In a clinical diagnostic microbiology laboratory, the current method of identifying bacterial isolates is based mainly on phenotypic characteristics, such as the growth pattern on different media, colony morphology, Gram stain, and various biochemical reactions. These techniques collectively allow high-level accuracy in identifying most bacterial isolates, but they are costly and time-consuming. In our clinical microbiology laboratory, we prospectively assessed the ability of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) to identify bacterial strains that were routinely isolated from clinical samples. Bacterial colonies obtained from a total of 468 strains of 92 bacterial species isolated at the Department of Clinical Laboratory at Chiba University were directly placed on target MALDI plates, followed by the addition of CHCA matrix solution. The plates were then subjected to MALDI-TOF MS measurement, and the microorganisms were identified by pattern matching by the libraries in the BioTyper 2.0 software. The identification rates at species and genus levels were 91.7% (429/468) and 97.0% (454/468), respectively. MALDI-TOF MS is a rapid, simple, and high-throughput proteomic technique for the identification of a variety of bacterial species. Since colony to colony differences and the effects of culture duration on the results are minimal, it can be implemented in a conventional laboratory setting. Although for some pathogens, the preanalytic processes should be refined and current database should be improved to obtain more accurate results, the MALDI-TOF MS-based method generally performs as well as the conventional methods and is a promising technology in clinical laboratories.

  4. Differential identification of Sporothrix spp. and Leishmania spp. by conventional PCR and qPCR in multiplex format.

    Science.gov (United States)

    Rodríguez-Brito, Sabrina; Camacho, Emma; Mendoza, Mireya; Niño-Vega, Gustavo A

    2015-01-01

    Sporotrichosis and cutaneous leishmaniasis are skin infections with similar clinical manifestations but different treatment methods. The present study aimed to evaluate qPCR and conventional PCR for differential detection of the etiological agents of both infections in multiplex format. Assays were designed using two sets of reported primers: SS1/SS2, designed on the 18S ribosomal RNA gene from Sporothrix spp., and JW11/JW12, designed on the kinetoplast DNA (kDNA) minicircles of Leishmania spp. qPCR detected 200 fg of DNA per reaction for both Sporothrix and Leishmania. Melting curve analysis revealed two distinctive Tm peaks for Sporothrix spp. (85.5°C), and Leishmania spp. (82.6°C). A detection limit of 20 pg was determined for the diagnosis of both with conventional PCR. No other clinically important organisms were detected by either PCR or qPCR. However, a Blast analysis on GenBank databases, using as query the sequence of the PCR fragment obtained with primers SS1/SS2, showed 100% identity to environmental fungi of the Ophiostomales order. Lower percentages of identity (≤80%), with mismatches at primers' sequence regions were obtained for other environmental or clinically important fungi. Proper handling of clinical samples is required to avoid false negatives due to contamination with environmental fungi of the Ophiostomales order. © The Author 2014. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Real-time PCR assays for detection of Brucella spp. and the identification of genotype ST27 in bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Wu, Qingzhong; McFee, Wayne E; Goldstein, Tracey; Tiller, Rebekah V; Schwacke, Lori

    2014-05-01

    Rapid detection of Brucella spp. in marine mammals is challenging. Microbiologic culture is used for definitive diagnosis of brucellosis, but is time consuming, has low sensitivity and can be hazardous to laboratory personnel. Serological methods can aid in diagnosis, but may not differentiate prior exposure versus current active infection and may cross-react with unrelated Gram-negative bacteria. This study reports a real-time PCR assay for the detection of Brucella spp. and application to screen clinical samples from bottlenose dolphins stranded along the coast of South Carolina, USA. The assay was found to be 100% sensitive for the Brucella strains tested, and the limit of detection was 0.27fg of genomic DNA from Brucella ceti B1/94 per PCR volume. No amplification was detected for the non-Brucella pathogens tested. Brucella DNA was detected in 31% (55/178) of clinical samples tested. These studies indicate that the real-time PCR assay is highly sensitive and specific for the detection of Brucella spp. in bottlenose dolphins. We also developed a second real-time PCR assay for rapid identification of Brucella ST27, a genotype that is associated with human zoonotic infection. Positive results were obtained for Brucella strains which had been identified as ST27 by multilocus sequence typing. No amplification was found for other Brucella strains included in this study. ST27 was identified in 33% (18/54) of Brucella spp. DNA-positive clinical samples. To our knowledge, this is the first report on the use of a real-time PCR assay for identification of Brucella genotype ST27 in marine mammals. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Interlaboratory validation of a real-time PCR 24-hour rapid method for detection of Salmonella in foods.

    Science.gov (United States)

    Cheng, Chorng-Ming; Van Khanh, T; Lin, Wen; Ruby, Richard M

    2009-05-01

    The efficacy of a 24-h Salmonella real-time, or quantitative, PCR (qPCR) detection method was assessed through a collaborative effort involving eight Federal and state laboratories. Eleven foods including mashed potatoes, soft cheese, chili powder, chocolate, eggs, sprouts, apple juice, fish, shrimp, ground beef, and ground chicken were tested. For each food, seven blind samples were distributed to each participant for testing. These included six samples equivalently inoculated with 1 to 5 CFU/25 g of various serotypes of Salmonella (Gaminara, Weltevreden, Heidelberg, Senftenberg, Enteritidis, Newport, Typhimurium, and Kentucky for each food) and 10 to 50 CFU/25 g of the competitor Enterobacter cloacae. The seventh sample was inoculated with 10 to 50 CFU/25 g of the competitor, E. cloacae, only. These samples were tested for Salmonella by using four methods in parallel: (i) 24-h qPCR method detecting Salmonella from modified buffered peptone water enrichment medium; (ii) 48-h qPCR method detecting Salmonella from a secondary selective enrichment broth; (iii) modified Bacteriological Analytical Manual method; and (iv) VIDAS, an immunoassay system. The results of the statistical analysis showed there was no significant (P > or = 0.05) difference between either of the qPCR methods and the modified Bacteriological Analytical Manual method for 10 of 11 foods. For the one exception, sprouts, detection by qPCR required 48 h. Both qPCR methods showed a detection limit of 0.08 to 0.2 CFU/g. These results provide a solid basis for using this 24-h qPCR rapid screening method to detect Salmonella in foods.

  7. Nested PCR for Rapid Detection of Mumps Virus in Cerebrospinal Fluid from Patients with Neurological Diseases

    OpenAIRE

    Poggio, Gustavo Palacios; Rodriguez, Claudia; Cisterna, Daniel; Freire, María Cecilia; Cello, Jerónimo

    2000-01-01

    In this study, we have developed a reverse transcription (RT)-nested polymerase chain reaction (n-PCR) for the detection of mumps virus RNA in cerebrospinal fluid (CSF) from patients with neurological infections. A specific 112-bp fragment was amplified by this method with primers from the nucleoprotein of the mumps virus genome. The mumps virus RT–n-PCR was capable of detecting 0.001 PFU/ml and 0.005 50% tissue culture infective dose/ml. This method was found to be specific, since no PCR pro...

  8. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  9. Development of a Taqman real-time PCR assay for rapid detection and quantification of Vibrio tapetis in extrapallial fluids of clams

    Directory of Open Access Journals (Sweden)

    Adeline Bidault

    2015-12-01

    Full Text Available The Gram-negative bacterium Vibrio tapetis is known as the causative agent of Brown Ring Disease (BRD in the Manila clam Venerupis (=Ruditapes philippinarum. This bivalve is the second most important species produced in aquaculture and has a high commercial value. In spite of the development of several molecular methods, no survey has been yet achieved to rapidly quantify the bacterium in the clam. In this study, we developed a Taqman real-time PCR assay targeting virB4 gene for accurate and quantitative identification of V. tapetis strains pathogenic to clams. Sensitivity and reproducibility of the method were assessed using either filtered sea water or extrapallial fluids of clam injected with the CECT4600T V. tapetis strain. Quantification curves of V. tapetis strain seeded in filtered seawater (FSW or extrapallial fluids (EF samples were equivalent showing reliable qPCR efficacies. With this protocol, we were able to specifically detect V. tapetis strains down to 1.125 101 bacteria per mL of EF or FSW, taking into account the dilution factor used for appropriate template DNA preparation. This qPCR assay allowed us to monitor V. tapetis load both experimentally or naturally infected Manila clams. This technique will be particularly useful for monitoring the kinetics of massive infections by V. tapetis and for designing appropriate control measures for aquaculture purposes.

  10. Identification of Naegleria fowleri in domestic water sources by nested PCR.

    Science.gov (United States)

    Marciano-Cabral, Francine; MacLean, Rebecca; Mensah, Alex; LaPat-Polasko, Laurie

    2003-10-01

    The free-living amoeboflagellate Naegleria fowleri is the causative agent of primary amoebic meningoencephalitis (PAM), a rapidly fatal disease of the central nervous system. In the United States, the disease is generally acquired while swimming and diving in freshwater lakes and ponds. In addition to swimming, exposure to N. fowleri and the associated disease can occur by total submersion in bathwater or small backyard wading pools. In the present study, swipe samples and residual pipe water from homes in Arizona were examined for N. fowleri by nested PCR due to the death of two previously healthy children from PAM. Since neither child had a history of swimming in a freshwater lake or pond prior to the onset of disease symptoms, the domestic water supply was the suspected source of infection. Of 19 samples collected from bathroom and kitchen pipes and sink traps, 17 samples were positive for N. fowleri by PCR. A sample from a Micro-Wynd II filter was obtained by passing water from bathtubs through the filter. Organisms attached to the filter also tested positive by PCR. The two samples that tested negative for N. fowleri were one that was obtained from a kitchen sink trap and a swipe sample from the garbage disposal of one home.

  11. Serotype specific primers and gel-based RT-PCR assays for 'typing' African horse sickness virus: identification of strains from Africa.

    Directory of Open Access Journals (Sweden)

    Narender S Maan

    Full Text Available African horse sickness is a devastating, transboundary animal disease, that is 'listed' by the Office International des Epizooties (OIE. Although attenuated, inactivated and subunit vaccines have been developed for African horse sickness virus (AHSV, these are serotype-specific and their effective deployment therefore relies on rapid and reliable identification of virus type. AHSV serotype is controlled by the specificity of interactions between neutralising antibodies, and components of the outer-capsid, particularly protein VP2 (encoded by AHSV genome segment 2 (Seg-2. We report the development and evaluation of novel gel based reverse transcription-PCR (RT-PCR assays targeting AHSV Seg-2, which can be used to very significantly increase the speed and reliability of detection and identification (compared to virus neutralisation tests of the nine serotypes of AHSV. Primer sets were designed targeting regions of Seg-2 that are conserved between strains within each of the AHSV serotype (types 1 to 9. These assays were evaluated using multiple AHSV strains from the orbivirus reference collection at IAH (www.reoviridae.org/dsRNA_virus_proteins/ReoID/AHSV-isolates.htm. In each case the Seg-2 primers showed a high level of specificity and failed to cross-amplify the most closely related heterologous AHSV types, or other related orbiviruses (such as bluetongue virus (BTV, or equine encephalosis virus (EEV. The assays are rapid and sensitive, and can be used to detect and type viral RNA in blood, tissue samples, or cultivated viral suspensions within 24 h. They were used to identify AHSV strains from recent outbreaks in sub-Saharan African countries. These methods also generate cDNAs suitable for sequencing and phylogenetic analyses of Seg-2, identifying distinct virus lineages within each virus-type and helping to identify strain movements/origins. The RT-PCR methods described here provide a robust and versatile tool for rapid and specific detection

  12. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    ) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect ... axenic cultivation system for P. carinii and confirmed our microscopy findings that no organism multiplication had occurred during culture. For all cultures analyzed, QTD PCR assays showed a decrease in P. carinii DNA that exceeded the expected decrease due to dilution of the inoculum upon transfer....... In conclusion, a rapid, sensitive, and reproducible quantitative PCR assay for P. carinii f. sp. carinii has been developed and is applicable to in vivo as well as in vitro systems. The assay should prove useful for conducting studies in which quantification of organism burden or growth assessment is critical...

  13. A One-Step, Real-Time PCR Assay for Rapid Detection of Rhinovirus

    Science.gov (United States)

    Do, Duc H.; Laus, Stella; Leber, Amy; Marcon, Mario J.; Jordan, Jeanne A.; Martin, Judith M.; Wadowsky, Robert M.

    2010-01-01

    One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID50 (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform. PMID:19948820

  14. Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hipO) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples

    DEFF Research Database (Denmark)

    Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl

    2002-01-01

    to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples......Identification of sources Campylobacter infection in the poultry houses is in general problematic due to the lack of reliable methods to detect campylobacteria in environmental samples. Detection of campylobacteria in environmental samples by conventional culture methods is difficult and of limited...... sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...

  15. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  16. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  17. Development of a rapid DNA extraction method and one-step nested PCR for the detection of Naegleria fowleri from the environment.

    Science.gov (United States)

    Ahmad, Arine Fadzlun; Lonnen, James; Andrew, Peter W; Kilvington, Simon

    2011-10-15

    Naegleria fowleri is a small free-living amoebo-flagellate found in natural and manmade thermal aquatic habitats worldwide. The organism is pathogenic to man causing fatal primary amoebic meningoencephalitis (PAM). Infection typically results from bathing in contaminated water and is usually fatal. It is, therefore, important to identify sites containing N. fowleri in the interests of preventive public health microbiology. Culture of environmental material is the conventional method for the isolation of N. fowleri but requires several days incubation and subsequent biochemical or molecular tests to confirm identification. Here, a nested one-step PCR test, in conjunction with a direct DNA extraction from water or sediment material, was developed for the rapid and reliable detection of N. fowleri from the environment. Here, the assay detected N, fowleri in 18/109 river water samples associated with a nuclear power plant in South West France and 0/10 from a similar site in the UK. Although culture of samples yielded numerous thermophilic free-living amoebae, none were N. fowleri or other thermophilic Naegleria spp. The availability of a rapid, reliable and sensitive one-step nested PCR method for the direct detection of N. fowleri from the environment may aid ecological studies and enable intervention to prevent PAM cases. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  18. Evaluation of a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the identification of Campylobacter strains isolated from diarrheal patients in Japan.

    Science.gov (United States)

    Kabir, S M Lutful; Kikuchi, Ken; Asakura, Masahiro; Shiramaru, Sachi; Tsuruoka, Naoki; Goto, Aeko; Hinenoya, Atsushi; Yamasaki, Shinji

    2011-01-01

    We have developed a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the detection and identification of Campylobacter jejuni, C. coli, and C. fetus. The applicability of this assay was evaluated with 325 Campylobacter strains isolated from diarrheal patients in Japan and the results were compared with those obtained by other genetic methods, including hipO gene detection and 16S rRNA gene sequencing. Of the 325 strains analyzed, 314 and 11 were identified as C. jejuni and C. coli, respectively, by combination of hipO gene detection and 16S rRNA gene sequencing. When the multiplex PCR assay was employed, 309, 310, and 314 strains were identified as C. jejuni on the basis of cdtA, cdtB, and cdtC gene-specific primers, respectively. Similarly, 11, 11, and 10 strains were identified as C. coli on the basis of cdtA, cdtB, and cdtC gene-specific primers, respectively. Sequence analysis of the cdt gene region of 6 strains (5 C. jejuni and 1 C. coli) which did not yield specific PCR products in any of the cdt gene-based multiplex PCR assays revealed deletions or mutations of the cdt genes. Pulsed-field gel electrophoresis indicated that C. jejuni and C. coli strains were genetically diverse. Taken together, these findings suggest that the cdtC gene-based multiplex PCR seems to be a particularly simple and rapid method for differentiating between species of Campylobacter strains, such as C. jejuni and C. coli. However, combination of these multiplex PCR assays will allow more accurate identification.

  19. Deletion-targeted multiplex PCR (DTM-PCR) for identification of Beijing/W genotypes of Mycobacterium tuberculosis.

    Science.gov (United States)

    Chen, Jing; Tsolaki, Anthony G; Shen, Xin; Jiang, Xi; Mei, Jian; Gao, Qian

    2007-09-01

    Beijing/W strains of Mycobacterium tuberculosis cause the vast majority of tuberculosis cases in Shanghai, China. Such highly prevalent strains are considered as hypervirulent and are often associated with multi-drug resistance, treatment failure and HIV status. We present a reliable and fast detection method to identify these Beijing/W strains, which can be applied to screening large numbers of samples at low cost. Using this Deletion-Targeted Multiplex PCR (DTM-PCR) method for detecting these strains, we obtained 100% sensitivity and specificity.

  20. Rapid and accurate identification of Xanthomonas citri subspecies citri by fluorescence in situ hybridization.

    Science.gov (United States)

    Waite, D W; Griffin, R; Taylor, R; George, S

    2016-11-01

    Citrus canker is an economically important disease caused by the bacterial pathogen Xanthomonas citri subsp. citri (Xcc). This organism targets a wide range of citrus plants, including sweet orange, grapefruit, lemon and lime. As Xcc is spread by environmental factors such as wind and rain, it is difficult to control its movement once the disease has established. In order to facilitate monitoring of citrus canker we sought to design a novel diagnostic protocol based on fluorescence in situ hybridization (FISH) for identification of bacterial cells directly from canker pustules without cultivation or DNA extraction. This method was validated for specificity against a range of Xanthomonas species and strains. We show that our assay is extremely rapid (typically requiring between 2 and 3 h), and possesses a similar specificity to existing PCR diagnostic tools. The sensitivity of the assay is comparable to that of an existing PCR-based technique and sufficient for identifying Xcc in symptomatic plant material. The method is easily transferable to diagnosticians without prior experience using FISH. Xanthomonas citri subsp. citri (Xcc) is an aggressive and hardy pathogen of citrus plants worldwide. Outbreaks are difficult and costly to contain and the establishment of citrus canker results in restricted trade. In order to extend the existing toolkit for identification of Xcc we developed a novel diagnostic approach based on fluorescence in situ hybridization. Our approach is of comparable specificity and sensitivity to existing methods but can be performed directly on infected tissue making it significantly faster than existing PCRs, and requiring fewer laboratory resources. © 2016 The Society for Applied Microbiology.

  1. Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

    DEFF Research Database (Denmark)

    Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

    2013-01-01

    bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent......Studies on the value of culture-independent molecular identification of bacteria in cardiac valves are mostly restricted to comparing agreement of identification to what is obtained by culture to the number of identified bacteria in culture-negative cases. However, evaluation of the usefulness...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...

  2. Rapid and specific detection of porcine parvovirus using real-time PCR and high resolution melting (HRM) analysis.

    Science.gov (United States)

    Yu, Hai-Qiong; Cai, Xian-Quan; Lin, Zhi-Xiong; Li, Xiang-Li; Yue, Qiao-Yun; Li, Rong; Zhu, Xing-Quan

    2015-02-28

    Porcine parvovirus (PPV) is the important causative agent for infectious infertility, which is a fairly tough virus that multiplies normally in the intestine of pigs without causing clinical signs in the world. We developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the detection of PPV. Primers targeting the VP gene were highly specific, as evidenced by the negative amplification of closely related viruses, such as porcine circovirus 2 (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), classical swine fever virus (CSFV), or Japanese encephalitis virus (JEV). The performance of unlabeled real time PCR was compared to TaqMan real time PCR, and the detection limits of the two methods were nearly equal. Moreover, there was good correlation between Cp and diluted genomic DNA when tested with the two methods. The assay has the accuracy of 100% in reference to labeled real time PCR, when it was tested on 45 clinical samples. The present study demonstrated that the established assay integrating real-time PCR and HRM is relatively cost-effective and more stable, which provides an alternative tool for rapid, simple, specific and sensitive detection of PPV.

  3. A Rapid and Sensitive Diagnosis of Typhoid Fever Based On Nested PCR-Voltammetric DNA Biosensor Using Flagellin Gene Fragment

    Directory of Open Access Journals (Sweden)

    Yeni Wahyuni Hartati

    2016-03-01

    Full Text Available Typhoid fever caused by Salmonella typhi is an important issue for public health in the world. Laboratory methods for rapid and sensitive diagnosis are very important for disease management. The purpose of this study was to determine the performance of nested PCR–voltammetric DNA biosensor using flagellin gene (fla of S. typhi as a marker. The differential pulse voltammetry using pencil graphite electrode was applied to measure the guanine oxidation signal of probes vs synthetic target stDNA and probes vs fla PCR product hybridizations. The probe DNA selectivity was examined by hybridized probes vs non-complementary sequence. The result showed that the first round nested PCR product can not be visualized by agarose electrophoresis, whereas using the voltammetric biosensor methods can be detected both for the first or second round nested PCR product. The average peak current of hybridized probe vs first and second round of PCR product was 2.32 and 1.47 μA respectively, at 0.9 V. Detection of the DNA sequences of the infectious diseases from PCR amplified real sample was also carried out using this voltammetric DNA biosensor methods.

  4. A simple PCR-based method for the rapid genotyping of inherited fifth complement component (C5)-deficient mice.

    Science.gov (United States)

    Wang, Qingkai; Wang, Na; Zhang, Xin; Hu, Weiguo

    2015-01-01

    The fifth component of complement (C5) is considered to be the center of complement activation and function. However, there are no genetically engineered knockout mice for this gene, and the only commercially available inherited C5-deficient mice, in which a "TA" nucleotide deletion in the coding frame was previously identified, are in theC57BL/10Sn genetic background rather than the commonly used backgrounds C57BL/6 and BALB/c. Therefore, these mice must be backcrossed into the desired genetic background. Here, we developed an ARMS (amplification refractory mutation system) PCR method using a specific primer pair that was able to discriminate between the genotypes when the resulting product was analyzed by agarose gel electrophoresis. These results were supported by quantitative RT-PCR and semi-quantitative PCR and were consistent with the results from sequencing each backcrossed generation. Using ARMS-PCR method, we generated C5-deficient mice in the C57BL/6 background over 9 backcrossed generations and further verified the phenotype using complement-mediated hemolytic assays. In this study, we describe a simple, rapid and reliable PCR-based method for genotyping inherited C5-deficient mice that may be used to backcross C57BL/10Sn mice into other genetic backgrounds.

  5. Establishment of a 10-Plex Quantitative Fluorescent-PCR Assay for rapid diagnosis of sex chromosome aneuploidies.

    Directory of Open Access Journals (Sweden)

    Xingmei Xie

    Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.

  6. Rapid and generic identification of influenza A and other respiratory viruses with mass spectrometry

    NARCIS (Netherlands)

    Majchrzykiewicz-Koehorst, J.A.; Heikens, E.; Trip, H.; Hulst, A.G.; Jong, A.L. de; Viveen, M.C.; Sedee, N.J.A.; van der Plas, J.; Coenjaerts, F.E.J.; Paauw, A.

    2015-01-01

    The rapid identification of existing and emerging respiratory viruses is crucial in combating outbreaks and epidemics. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is a rapid and reliable identification method in bacterial diagnostics, but has not been

  7. Rapid identification of pathogens in blood cultures with a modified fluorescence in situ hybridization assay

    NARCIS (Netherlands)

    Peters, Remco P. H.; van Agtmael, Michiel A.; Simoons-Smit, Alberdina M.; Danner, Sven A.; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2006-01-01

    We evaluated a modified fluorescence in situ hybridization (FISH) assay for rapid ( <1 h) identification of microorganisms in growth-positive blood cultures. The results were compared to those of the standard FISH technique and conventional culturing. The rapid identification of microorganisms with

  8. Field-deployable, quantitative, rapid identification of active Ebola virus infection in unprocessed blood.

    Science.gov (United States)

    Shah, Kavit; Bentley, Emma; Tyler, Adam; Richards, Kevin S R; Wright, Edward; Easterbrook, Linda; Lee, Diane; Cleaver, Claire; Usher, Louise; Burton, Jane E; Pitman, James K; Bruce, Christine B; Edge, David; Lee, Martin; Nazareth, Nelson; Norwood, David A; Moschos, Sterghios A

    2017-11-01

    The West African Ebola virus outbreak underlined the importance of delivering mass diagnostic capability outside the clinical or primary care setting in effectively containing public health emergencies caused by infectious disease. Yet, to date, there is no solution for reliably deploying at the point of need the gold standard diagnostic method, real time quantitative reverse transcription polymerase chain reaction (RT-qPCR), in a laboratory infrastructure-free manner. In this proof of principle work, we demonstrate direct performance of RT-qPCR on fresh blood using far-red fluorophores to resolve fluorogenic signal inhibition and controlled, rapid freeze/thawing to achieve viral genome extraction in a single reaction chamber assay. The resulting process is entirely free of manual or automated sample pre-processing, requires no microfluidics or magnetic/mechanical sample handling and thus utilizes low cost consumables. This enables a fast, laboratory infrastructure-free, minimal risk and simple standard operating procedure suited to frontline, field use. Developing this novel approach on recombinant bacteriophage and recombinant human immunodeficiency virus (HIV; Lentivirus), we demonstrate clinical utility in symptomatic EBOV patient screening using live, infectious Filoviruses and surrogate patient samples. Moreover, we evidence assay co-linearity independent of viral particle structure that may enable viral load quantification through pre-calibration, with no loss of specificity across an 8 log-linear maximum dynamic range. The resulting quantitative rapid identification (QuRapID) molecular diagnostic platform, openly accessible for assay development, meets the requirements of resource-limited countries and provides a fast response solution for mass public health screening against emerging biosecurity threats.

  9. Development of a PCR test for identification of Haemophilus somnus in pure and mixed cultures

    DEFF Research Database (Denmark)

    Angen, Øystein; Ahrens, Peter; Tegtmeier, Conny

    1998-01-01

    . somnus by DNA-DNA hybridization as well as representatives of the 16 ribotypes previously described within this species. The specificity of the test was evaluated on a broad collection of strains within the family Pasteurellaceae and on other Gram positive and negative species. None of these strains gave......Based on the 16S rRNA sequences of a collection of well-characterized strains of Haemophilus somnus a set of primers was selected as candidates for a species-specific PCR test. All investigated H. somnus strains were found positive in the test, including 12 strains earlier found to represent H...... for identification of bacteria belonging to this phenotypically heterogeneous and often slow growing species....

  10. Effect on MRSA transmission of rapid PCR testing of patients admitted to critical care.

    Science.gov (United States)

    Cunningham, R; Jenks, P; Northwood, J; Wallis, M; Ferguson, S; Hunt, S

    2007-01-01

    We report a significant reduction in the rate of meticillin-resistant Staphylococcus aureus (MRSA) transmission on a critical care unit when admission screening by culture was replaced with a same-day polymerase chain reaction (PCR) test. This was an observational cohort study, set in a 19-bed mixed medical and surgical adult critical care unit in southwest England. We studied 1305 patients admitted between April 2005 and February 2006. Standard MRSA culture methods were used to screen 612 patients between April 2005 and August 2005, and the IDI MRSA PCR test was used to screen 693 patients between September 2005 and February 2006. Standard infection control precautions were instituted when positive results were obtained by either method. Outcome measures included carriage rate, turnaround time for results and rate of subsequent MRSA transmission on the unit. The overall carriage rate on admission to the unit was 7.0%. Culture results were available in three working days, PCR results within one working day. The mean incidence of MRSA transmission was 13.89/1000 patient days during the culture phase and 4.9/1000 patient days during the PCR phase (relative risk reduction 0.65, 95% CI 0.28-1.07). PCR screening for MRSA on admission to critical care units is feasible in routine clinical practice, provides quicker results than culture-based screening and is associated with a significant reduction in subsequent MRSA transmission.

  11. Development of a rapid PCR assay for screening of maternal colonization by group B streptococcus and neonatal invasive Escherichia coli during labor.

    Science.gov (United States)

    Martínez de Tejada, Begoña; Stan, Catalin M; Boulvain, Michel; Renzi, Gesuele; François, Patrice; Irion, Olivier; Schrenzel, Jacques

    2010-01-01

    Group B Streptococcus (GBS) and Escherichiacoli(E. coli) are the leading causes of early-onset neonatal disease (EOD). Intrapartum antibiotic prophylaxis of GBS-colonized women decreases vertical transmission and EOD due to GBS. Nevertheless, no intervention has been developed to reduce the risk of EOD related to E. coli. Timely and accurate identification of colonized mothers is necessary to implement preventive strategies against neonatal sepsis. To screen for colonization during labor, we developed a real-time PCR assay for the simultaneous detection of GBS and neonatal invasive strains of E. coli. Specific DNA targets for GBS are publicly available. For neonatal invasive E. coli, we analyzed candidate DNA targets by DNA hybridization on microarrays of invasive strains isolated from neonatal E. coli sepsis or meningitis (K1 and not K1 'invasive' serotypes). Specificity of DNA probes was tested against a panel of bacteria and by simulating clinical conditions (spiking vaginal samples from pregnant women). Then, the characteristics of the selected probes were evaluated in a pilot study including 200 women in labor. Prevalence of rectovaginal GBS and of vaginal and cervical E. coliserotype K1 colonization were 16.0, 3.5 and 3.5% by culture and 27, 10 and 8.5% by PCR, respectively. The prevalence of other invasive E. coli in the vagina and in the cervix, detected by PCR, was around 10%. Compared to the culture, considered as the gold standard, the sensitivities of the PCRs for the GBS and E. coli K1 were 97 and 71%, respectively. Specificities were 86 and 92%, respectively. Specificity is difficult to interpret, as a false-positive PCR result may in fact be a false-negative result of the culture. The turnaround time needed for PCR analysis was 2.5 h, compared to a minimum of 48 h for the culture. Our rapid PCR is reliable in detecting GBS in women in labor. Optimization of the PCR for invasive E. coli is needed before its implementation in clinical practice. More

  12. Comprehensive biothreat cluster identification by PCR/electrospray-ionization mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Rangarajan Sampath

    Full Text Available Technology for comprehensive identification of biothreats in environmental and clinical specimens is needed to protect citizens in the case of a biological attack. This is a challenge because there are dozens of bacterial and viral species that might be used in a biological attack and many have closely related near-neighbor organisms that are harmless. The biothreat agent, along with its near neighbors, can be thought of as a biothreat cluster or a biocluster for short. The ability to comprehensively detect the important biothreat clusters with resolution sufficient to distinguish the near neighbors with an extremely low false positive rate is required. A technological solution to this problem can be achieved by coupling biothreat group-specific PCR with electrospray ionization mass spectrometry (PCR/ESI-MS. The biothreat assay described here detects ten bacterial and four viral biothreat clusters on the NIAID priority pathogen and HHS/USDA select agent lists. Detection of each of the biothreat clusters was validated by analysis of a broad collection of biothreat organisms and near neighbors prepared by spiking biothreat nucleic acids into nucleic acids extracted from filtered environmental air. Analytical experiments were carried out to determine breadth of coverage, limits of detection, linearity, sensitivity, and specificity. Further, the assay breadth was demonstrated by testing a diverse collection of organisms from each biothreat cluster. The biothreat assay as configured was able to detect all the target organism clusters and did not misidentify any of the near-neighbor organisms as threats. Coupling biothreat cluster-specific PCR to electrospray ionization mass spectrometry simultaneously provides the breadth of coverage, discrimination of near neighbors, and an extremely low false positive rate due to the requirement that an amplicon with a precise base composition of a biothreat agent be detected by mass spectrometry.

  13. Identification of Reference Genes for RT-qPCR Data Normalization in Cannabis sativa Stem Tissues.

    Science.gov (United States)

    Mangeot-Peter, Lauralie; Legay, Sylvain; Hausman, Jean-Francois; Esposito, Sergio; Guerriero, Gea

    2016-09-15

    Gene expression profiling via quantitative real-time PCR is a robust technique widely used in the life sciences to compare gene expression patterns in, e.g., different tissues, growth conditions, or after specific treatments. In the field of plant science, real-time PCR is the gold standard to study the dynamics of gene expression and is used to validate the results generated with high throughput techniques, e.g., RNA-Seq. An accurate relative quantification of gene expression relies on the identification of appropriate reference genes, that need to be determined for each experimental set-up used and plant tissue studied. Here, we identify suitable reference genes for expression profiling in stems of textile hemp (Cannabis sativa L.), whose tissues (isolated bast fibres and core) are characterized by remarkable differences in cell wall composition. We additionally validate the reference genes by analysing the expression of putative candidates involved in the non-oxidative phase of the pentose phosphate pathway and in the first step of the shikimate pathway. The goal is to describe the possible regulation pattern of some genes involved in the provision of the precursors needed for lignin biosynthesis in the different hemp stem tissues. The results here shown are useful to design future studies focused on gene expression analyses in hemp.

  14. Identification of Leishmania Species Isolated from Human Cutaneous Leishmaniasis in Mehran, Western Iran Using Nested PCR

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein FEIZ HADDAD

    2016-03-01

    Full Text Available Background: The incidence of cutaneous leishmaniasis in the city of Mehran has risen sharply in recent years because the city borders Iraq, which has allowed entrance of different Leishmania strains. These strains have different shapes, periods of disease, and healing of lesions. The present study identified and determined cutaneous leishmaniasis species in this region. Methods: This cross-sectional study was carried out by preparing slides from 92 patients with suspected cutaneous leishmaniasis lesions from Mehran during 2012-2013. Parasite genomic DNA was extracted and CSB2XF and CSB1XR primers were used to amplify the Leishmania minicircle kDNA regions. The parasite species were detected by specific 13Z and LIR primers by applying nested PCR technique.Results: All banding patterns were diagnosed as L. major parasite by comparison of standard models with amplified fragments 560 bp in length from bands. The patients were 56.5% male and 43.5% female. The most frequently-infected age group was the 21-30 years group at a rate of 27.2%. About 56.3% of patients had a single lesion and a significant correlation was observed between age and number of lesions (P > 0.05. Conclusion: The nested PCR technique was shown to be an effective method with high sensitivity and specificity for identification of human Leishmania parasites. Molecular analysis revealed that parasites isolated from Mehran were identified as L. major and the disease was rural in form.

  15. Identification of Reference Genes for RT-qPCR Data Normalization in Cannabis sativa Stem Tissues

    Directory of Open Access Journals (Sweden)

    Lauralie Mangeot-Peter

    2016-09-01

    Full Text Available Gene expression profiling via quantitative real-time PCR is a robust technique widely used in the life sciences to compare gene expression patterns in, e.g., different tissues, growth conditions, or after specific treatments. In the field of plant science, real-time PCR is the gold standard to study the dynamics of gene expression and is used to validate the results generated with high throughput techniques, e.g., RNA-Seq. An accurate relative quantification of gene expression relies on the identification of appropriate reference genes, that need to be determined for each experimental set-up used and plant tissue studied. Here, we identify suitable reference genes for expression profiling in stems of textile hemp (Cannabis sativa L., whose tissues (isolated bast fibres and core are characterized by remarkable differences in cell wall composition. We additionally validate the reference genes by analysing the expression of putative candidates involved in the non-oxidative phase of the pentose phosphate pathway and in the first step of the shikimate pathway. The goal is to describe the possible regulation pattern of some genes involved in the provision of the precursors needed for lignin biosynthesis in the different hemp stem tissues. The results here shown are useful to design future studies focused on gene expression analyses in hemp.

  16. IDENTIFICATION OF LACTIC ACID BACTERIA ISOLATED FROM RED WINE SAMPLES BY RT-qPCR

    Directory of Open Access Journals (Sweden)

    Attila Kántor

    2014-02-01

    Full Text Available Lactobacillus represents a highly diverse group of Gram-positive, microaerophilic bacteria that microscopically appear as long to short rods or even coccobacilli. The aim of our study were the identification of some species of lactic acid bacteria in red wine during the fermentation process using a classical microbiological and RT-PCR methods. The changes in different groups of microorganisms were monitored in total counts of bacteria, and Lactobacillus cells. Microbiological parameters were observed during the current collection and processing of wine in 2012. Samples were taken during the fermentation process in wine enterprises and were storage with different conditions. During this period were examined 4 bottles of red wine between Modry Portugal (MP and Frankovka modra (FM. The total counts of bacteria ranged from 4.21 in the wine MP at 4°C of storage to 5.81 log CFU.mL-1 in the wine MP at 25°C of storage, but the total counts of bacteria ranged from 4.85 in the wine FM at 4°C of storage to 5.63 log CFU.mL-1 in the wine FM at 25°C of storage. The higher number of lactobacilli cells was found in wine FM at 25°C. The presence and sensitivity of six Gram+ bacterial species Lactobacillus salivarius, L. buchneri, L. plantarum, L. curvatus, L. brevis and L. hilgardii were detected using Real-Time PCR.

  17. Rapid detection and differentiation of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in food, using multiplex real-time PCR.

    Science.gov (United States)

    Mayr, A M; Lick, S; Bauer, J; Thärigen, D; Busch, U; Huber, I

    2010-02-01

    A multiplex real-time PCR assay based on four differently labeled TaqMan probes for detection and differentiation of the thermophilic Campylobacter species C. jejuni, C. coli, and C. lari was established and validated in food products. This assay combines two previously published PCR assays for C. jejuni and C. coli with a newly developed detection assay for C. lari and an internal amplification control system. The selectivity of the method was determined by analyzing 70 Campylobacter strains and 43 strains of other bacteria. The sensitivity was 50 fg of C. jejuni and C. lari DNA and 500 fg of C. coli DNA per PCR. It was possible to detect 1 to 10 CFU/25 g of food before preenrichment of all three species. More than 400 samples of various foods (poultry, seafood, and meat) were analyzed after 48 h of preenrichment parallel to the conventional diagnostic method of culture and biochemical identification. Using the established real-time PCR assay, 55.4% of the samples were recognized as positive for thermophilic Campylobacter species, whereas with the conventional method only 40.3% of the samples were positive. The real-time PCR assay also detected contaminations with two different Campylobacter species in 32.6% of the analyzed poultry samples, a finding of epidemiological interest. Compared with the original PCR method, which was established for the differentiation of bacterial isolates of C. jejuni and C. coli, this new method also detects and distinguishes C. lari, was validated as an analytical tool for food analysis, and provides reliable and extensive results within 2 days.

  18. Use of Fourier transform infrared spectroscopy (FTIR spectroscopy for rapid and accurate identification of Yeasts isolated from human and animals

    Directory of Open Access Journals (Sweden)

    M. Taha

    2013-06-01

    Full Text Available Rapid and accurate identification of yeast is increasingly important to stipulate the appropriate therapy thus reducing morbidity and mortality related to yeast infections. Vibrational spectroscopic techniques (infrared (IR and Raman could provide potential alternatives to conventional typing methods, because they constitute a rapid, inexpensive and highly specific spectroscopic fingerprint through-which microorganism can be identified. The present study evaluate (FTIR spectroscopy as a sensitive and effective assay for the identification of the most frequent yeast species isolated from human and animals. One hundred and twenty-eight yeasts isolated from infected human mouths/vaginas, chronic diseased cows, crop mycosis in chicken and soil contaminated with pigeon droppings were phenotypically identified. Using universal primers, ITS1/ITS4, we have amplified ITS1-5.8S-ITS2 rDNA regions for 39 yeast isolates as representative samples. The PCR products were digested with restriction enzyme MspI and examined by PCR-RFLP, which was an efficient technique for identification of Candida spp., Cryptococcus neoformans and Trichosporon asahii. Further, identification of the same 39 isolates were done by FTIR spectroscopy and considered as reference for other strains by comparison of their FTIR spectra. The current study has sharply demonstrated the significant spectral differences between the various examined species of Candida, Cryptococcus, Trichosporon, Rhodotorula and Geotrichum isolated from different sources. Decisively, our research has confirmed that FTIR spectroscopy is a promising diagnostic tool, because of its sensitivity, rapidity, high differentiation capacity and simplicity compared to conventional/molecular techniques.

  19. Rapid and Specific Detection of Salmonella spp. in Animal Feed Samples by PCR after Culture Enrichment

    Science.gov (United States)

    Löfström, Charlotta; Knutsson, Rickard; Axelsson, Charlotta Engdahl; Rådström, Peter

    2004-01-01

    A PCR procedure has been developed for routine analysis of viable Salmonella spp. in feed samples. The objective was to develop a simple PCR-compatible enrichment procedure to enable DNA amplification without any sample pretreatment such as DNA extraction or cell lysis. PCR inhibition by 14 different feed samples and natural background flora was circumvented by the use of the DNA polymerase Tth. This DNA polymerase was found to exhibit a high level of resistance to PCR inhibitors present in these feed samples compared to DyNAzyme II, FastStart Taq, Platinum Taq, Pwo, rTth, Taq, and Tfl. The specificity of the Tth assay was confirmed by testing 101 Salmonella and 43 non-Salmonella strains isolated from feed and food samples. A sample preparation method based on culture enrichment in buffered peptone water and DNA amplification with Tth DNA polymerase was developed. The probability of detecting small numbers of salmonellae in feed, in the presence of natural background flora, was accurately determined and found to follow a logistic regression model. From this model, the probability of detecting 1 CFU per 25 g of feed in artificially contaminated soy samples was calculated and found to be 0.81. The PCR protocol was evaluated on 155 naturally contaminated feed samples and compared to an established culture-based method, NMKL-71. Eight percent of the samples were positive by PCR, compared with 3% with the conventional method. The reasons for the differences in sensitivity are discussed. Use of this method in the routine analysis of animal feed samples would improve safety in the food chain. PMID:14711627

  20. Simple Real-Time PCR and Amplicon Sequencing Method for Identification of Plasmodium Species in Human Whole Blood.

    Science.gov (United States)

    Lefterova, Martina I; Budvytiene, Indre; Sandlund, Johanna; Färnert, Anna; Banaei, Niaz

    2015-07-01

    Malaria is the leading identifiable cause of fever in returning travelers. Accurate Plasmodium species identification has therapy implications for P. vivax and P. ovale, which have dormant liver stages requiring primaquine. Compared to microscopy, nucleic acid tests have improved specificity for species identification and higher sensitivity for mixed infections. Here, we describe a SYBR green-based real-time PCR assay for Plasmodium species identification from whole blood, which uses a panel of reactions to detect species-specific non-18S rRNA gene targets. A pan-Plasmodium 18S rRNA target is also amplified to allow species identification or confirmation by sequencing if necessary. An evaluation of assay accuracy, performed on 76 clinical samples (56 positives using thin smear microscopy as the reference method and 20 negatives), demonstrated clinical sensitivities of 95.2% for P. falciparum (20/21 positives detected) and 100% for the Plasmodium genus (52/52), P. vivax (20/20), P. ovale (9/9), and P. malariae (6/6). The sensitivity of the P. knowlesi-specific PCR was evaluated using spiked whole blood samples (100% [10/10 detected]). The specificities of the real-time PCR primers were 94.2% for P. vivax (49/52) and 100% for P. falciparum (51/51), P. ovale (62/62), P. malariae (69/69), and P. knowlesi (52/52). Thirty-three specimens were used to test species identification by sequencing the pan-Plasmodium 18S rRNA PCR product, with correct identification in all cases. The real-time PCR assay also identified two samples with mixed P. falciparum and P. ovale infection, which was confirmed by sequencing. The assay described here can be integrated into a malaria testing algorithm in low-prevalence areas, allowing definitive Plasmodium species identification shortly after malaria diagnosis by microscopy. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  2. BOX-PCR-based identification of bacterial species belonging to Pseudomonas syringae: P. viridiflava group

    Directory of Open Access Journals (Sweden)

    Abi S.A. Marques

    2008-01-01

    Full Text Available The phenotypic characteristics and genetic fingerprints of a collection of 120 bacterial strains, belonging to Pseudomonas syringae sensu lato group, P. viridiflava and reference bacteria were evaluated, with the aim of species identification. The numerical analysis of 119 nutritional characteristics did not show patterns that would help with identification. Regarding the genetic fingerprinting, the results of the present study supported the observation that BOX-PCR seems to be able to identify bacterial strains at species level. After numerical analyses of the bar-codes, all pathovars belonging to each one of the nine described genomospecies were clustered together at a distance of 0.72, and could be separated at genomic species level. Two P. syringae strains of unknown pathovars (CFBP 3650 and CFBP 3662 and the three P. syringae pv. actinidiae strains were grouped in two extra clusters and might eventually constitute two new species. This genomic species clustering was particularly evident for genomospecies 4, which gathered P. syringae pvs. atropurpurea, coronafaciens, garçae, oryzae, porri, striafaciens, and zizaniae at a noticeably low distance.

  3. PCR-Based Identification and Characterization of Fusarium sp. Associated with Mango Malformation

    Directory of Open Access Journals (Sweden)

    M. Arif

    2011-01-01

    Full Text Available Mango malformation is the most serious disease of mango causing considerable damage to the mango orchards worldwide. It is a major threat for mango cultivation in north Indian belt. In recent years, Fusarium sp. is finding wide acceptability in scientific community as a causal agent of this disease. However, little information is known about the variability in Fusarium isolates from malformed mango tissues. Therefore, the major objective of present study was the identification and analysis of genetic diversity among Fusarium isolates collected from malformed mango tissues. Two texon selective primers, ITS-Fu-f and ITS-Fu-r, were used for quick identification of Fusarium spp. The fungal genomic DNA was extracted from using CTAB method and was utilized as template for PCR amplification. Total 224 bands were amplified by 18 RAPD primers at an average of 12.44 bands per primer. The size of the obtained amplicons ranged from 0.264 kb (minimum to 3.624 kb (maximum. Data scored from 25 isolates of Fusarium sp. with 18 RAPD primers were used to generate similarity coefficients. The similarity coefficient ranged from 0.17 to 0.945. Based on DNA fingerprints, all isolates were categorized into two major clusters. This study indicated a wide variability among different isolates of Fusarium.

  4. A rapid RT-PCR based method to isolate complementary DNA fragments flanking retrovirus integration sites

    NARCIS (Netherlands)

    P.J.M. Valk (Peter); M. Joosten (Marieke); Y. Vankan; H.R. Delwel (Ruud); B. Löwenberg (Bob)

    1997-01-01

    textabstractProto-oncogenes in retrovirally induced myeloid mouse leukemias are frequently activated following retroviral insertion. The identification of common virus integration sites (VISs) and isolation of the transforming oncogene is laborious and time consuming.

  5. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  6. Improved protocol for rapid identification of certain spa types using high resolution melting curve analysis.

    Science.gov (United States)

    Mayerhofer, Benjamin; Stöger, Anna; Pietzka, Ariane T; Fernandez, Haizpea Lasa; Prewein, Bernhard; Sorschag, Sieglinde; Kunert, Renate; Allerberger, Franz; Ruppitsch, Werner

    2015-01-01

    Methicillin-resistant Staphylococcus aureus is one of the most significant pathogens associated with health care. For efficient surveillance, control and outbreak investigation, S. aureus typing is essential. A high resolution melting curve analysis was developed and evaluated for rapid identification of the most frequent spa types found in an Austrian hospital consortium covering 2,435 beds. Among 557 methicillin-resistant Staphylococcus aureus isolates 38 different spa types were identified by sequence analysis of the hypervariable region X of the protein A gene (spa). Identification of spa types through their characteristic high resolution melting curve profiles was considerably improved by double spiking with genomic DNA from spa type t030 and spa type t003 and allowed unambiguous and fast identification of the ten most frequent spa types t001 (58%), t003 (12%), t190 (9%), t041 (5%), t022 (2%), t032 (2%), t008 (2%), t002 (1%), t5712 (1%) and t2203 (1%), representing 93% of all isolates within this hospital consortium. The performance of the assay was evaluated by testing samples with unknown spa types from the daily routine and by testing three different high resolution melting curve analysis real-time PCR instruments. The ten most frequent spa types were identified from all samples and on all instruments with 100% specificity and 100% sensitivity. Compared to classical spa typing by sequence analysis, this gene scanning assay is faster, cheaper and can be performed in a single closed tube assay format. Therefore it is an optimal screening tool to detect the most frequent endemic spa types and to exclude non-endemic spa types within a hospital.

  7. Rapid detection of carbapenemase genes by multiplex real-time PCR.

    Science.gov (United States)

    Monteiro, Jussimara; Widen, Raymond H; Pignatari, Antonio C C; Kubasek, Carly; Silbert, Suzane

    2012-04-01

    To develop a single multiplex real-time PCR assay to detect six different genetic types of carbapenemases already identified in Enterobacteriaceae (KPC, GES, NDM, IMP, VIM and OXA-48). A total of 58 bacterial isolates were tested. Thirty were previously characterized as resistant to carbapenems and documented by PCR and sequencing analysis to carry the following genes: bla(KPC) type, bla(GES) type, bla(IMP) type, bla(VIM) type, bla(OXA-48) and bla(NDM-1). These positive strains included 21 Enterobacteriaceae, 1 Acinetobacter baumannii and 8 Pseudomonas aeruginosa isolates. The remaining 28 isolates previously tested susceptible to carbapenems and were negative for these genes. Bacterial DNA was extracted using the easyMag extractor (bioMérieux, France). The real-time PCR was performed using the Rotor-Gene 6000 instrument (Corbett Life Science, Australia) and specific primers for each carbapenemase target were designed using the DNAStar software (Madison, WI, USA). Each one of the six carbapenemase genes tested presented a different melting curve after PCR amplification. The melting temperature (T(m)) analysis of the amplicons identified was as follows: bla(IMP) type (T(m) 80.1°C), bla(OXA-48) (T(m) 81.6°C), bla(NDM-1) (T(m) 84°C), bla(GES) type (T(m) 88.6°C), bla(VIM) type (T(m) 90.3°C) and bla(KPC) type (T(m) 91.6°C). No amplification was detected among the negative samples. The results showed 100% concordance with the genotypes previously identified. The new assay was able to detect the presence of six different carbapenemase gene types in a single 3 h PCR.

  8. Development of a specific immunomagnetic capture-PCR for rapid detection of viable Mycoplasma agalactiae in sheep milk samples.

    Science.gov (United States)

    Sanna, G; Lecca, V; Foddai, A; Tola, S

    2014-12-01

    To develop an immunomagnetic capture (IMC) to detect viable Mycoplasma agalactiae in routine ovine milk samples. Polyclonal antibodies against two M. agalactiae membrane surface proteins (P80 and P55) were covalently conjugated to magnetic beads (MBs) to form MB-Ab80 and MB-Ab55. Mycoplasma agalactiae cells were captured by a specific antigen-antibody reaction and magnetic separation. Immunomagnetic capture (IMC) was used to isolate and concentrate M. agalactiae in serial decimal dilutions and in artificially contaminated milk to facilitate subsequent detection by PCR. A 375-bp fragment of M. agalactiae was amplified using a pair of M. agalactiae-specific primers in PCR. The limit of detection of IMC-PCR method ranged from 10 to 10(2)  CCU ml(-1) when mycoplasmas were resuspended in PBS and from 10(2) to 10(3)  CCU ml(-1) when mycoplasmas were resuspended in uncontaminated ovine milk. This study also describes the application of IMC-PCR method to test for M. agalactiae in 516 milk samples collected from sheep with suspected contagious agalactia. Its performance was evaluated relative to culture. This report has demonstrated for the first time, the effective use of rapid and reliable IMC combined with PCR assay for the detection of viable M. agalactiae. The method IMC-PCR provides an alternative to conventional microbiological detection, method and it could be applied to quick detection of M. agalactiae in routine sheep milk samples. © 2014 The Authors published by John Wiley & Sons Ltd on behalf of Society for Applied Microbiology.

  9. Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

    Science.gov (United States)

    Benitez, Alvaro J; Winchell, Jonas M

    2016-04-01

    We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

  10. Rapid Molecular Identification of Pathogenic Yeasts by Pyrosequencing Analysis of 35 Nucleotides of Internal Transcribed Spacer 2 ▿

    Science.gov (United States)

    Borman, Andrew M.; Linton, Christopher J.; Oliver, Debra; Palmer, Michael D.; Szekely, Adrien; Johnson, Elizabeth M.

    2010-01-01

    Rapid identification of yeast species isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. Here, we have evaluated the utility of pyrosequencing analysis of a portion of the internal transcribed spacer 2 region (ITS2) for identification of pathogenic yeasts. A total of 477 clinical isolates encompassing 43 different fungal species were subjected to pyrosequencing analysis in a strictly blinded study. The molecular identifications produced by pyrosequencing were compared with those obtained using conventional biochemical tests (AUXACOLOR2) and following PCR amplification and sequencing of the D1-D2 portion of the nuclear 28S large rRNA gene. More than 98% (469/477) of isolates encompassing 40 of the 43 fungal species tested were correctly identified by pyrosequencing of only 35 bp of ITS2. Moreover, BLAST searches of the public synchronized databases with the ITS2 pyrosequencing signature sequences revealed that there was only minimal sequence redundancy in the ITS2 under analysis. In all cases, the pyrosequencing signature sequences were unique to the yeast species (or species complex) under investigation. Finally, when pyrosequencing was combined with the Whatman FTA paper technology for the rapid extraction of fungal genomic DNA, molecular identification could be accomplished within 6 h from the time of starting from pure cultures. PMID:20702674

  11. Rapid detection of Orthopoxvirus by semi-nested PCR directly from clinical specimens: a useful alternative for routine laboratories.

    Science.gov (United States)

    Abrahão, Jônatas Santos; Drumond, Betânia Paiva; Trindade, Giliane de Souza; da Silva-Fernandes, André Tavares; Ferreira, Jaqueline Maria Siqueira; Alves, Pedro Augusto; Campos, Rafael Kroon; Siqueira, Larissa; Bonjardim, Cláudio Antônio; Ferreira, Paulo César Peregrino; Kroon, Erna Geessien

    2010-04-01

    Orthopoxvirus (OPV) has been associated with worldwide exanthematic outbreaks, which have resulted in serious economic losses as well as impact on public health. Although the current classical and molecular methods are useful for the diagnosis of OPV, they are largely inaccessible to unsophisticated clinical laboratories. The major reason for the inaccessibility is that they require both virus isolation and DNA manipulation. In this report, a rapid, sensitive and low-cost semi-nested PCR method is described for the detection of OPV DNA directly from clinical specimens. A set of primers was designed to amplify the conserved OPV vgf gene. The most useful thermal and chemical conditions were selected and minimum non-inhibitory dilutions were determined. More than 100 Brazilian Vaccinia virus (VACV) field clinical specimens were tested using this semi-nested PCR in order to confirm its applicability. Cowpox virus was also detected by PCR from the ear scabs of scarified Balb/c mice. In addition, the method was highly sensitive for the detection of VACV DNA in murine blood and excreta, which are among the suggested reservoirs of OPV. Together, these data suggest that semi-nested PCR can be used for initial screening for OPV and as a routine diagnostic laboratory method. 2010 Wiley-Liss, Inc.

  12. Rapid Detection of Species of the Opportunistic Yeast Trichosporon by PCR

    Science.gov (United States)

    Sugita, Takashi; Nishikawa, Akemi; Shinoda, Takako

    1998-01-01

    Trichosporon species are opportunistic pathogens, associated with a high mortality rate in immunocompromised patients. Oligonucleotide primers were used to amplify a 170-bp fragment of small-subunit ribosomal DNA of all species in the genus Trichosporon by PCR. The primers amplify DNAs of all species in the genus Trichosporon, including six causative agents of trichosporonosis. DNAs of other medically important yeasts, such as Candida albicans and Cryptococcus neoformans, are not amplified by this detection system. PMID:9574732

  13. Development and Evaluation of a Blood Culture PCR Assay for Rapid Detection of Salmonella Paratyphi A in Clinical Samples.

    Science.gov (United States)

    Zhou, Liqing; Jones, Claire; Gibani, Malick M; Dobinson, Hazel; Thomaides-Brears, Helena; Shrestha, Sonu; Blohmke, Christoph J; Darton, Thomas C; Pollard, Andrew J

    2016-01-01

    Enteric fever remains an important cause of morbidity in many low-income countries and Salmonella Paratyphi A has emerged as the aetiological agent in an increasing proportion of cases. Lack of adequate diagnostics hinders early diagnosis and prompt treatment of both typhoid and paratyphoid but development of assays to identify paratyphoid has been particularly neglected. Here we describe the development of a rapid and sensitive blood culture PCR method for detection of Salmonella Paratyphi A from blood, potentially allowing for appropriate diagnosis and antimicrobial treatment to be initiated on the same day. Venous blood samples from volunteers experimentally challenged orally with Salmonella Paratyphi A, who subsequently developed paratyphoid, were taken on the day of diagnosis; 10 ml for quantitative blood culture and automated blood culture, and 5 ml for blood culture PCR. In the latter assay, bacteria were grown in tryptone soy broth containing 2.4% ox bile and micrococcal nuclease for 5 hours (37°C) before bacterial DNA was isolated for PCR detection targeting the fliC-a gene of Salmonella Paratyphi A. An optimized broth containing 2.4% ox bile and micrococcal nuclease, as well as a PCR test was developed for a blood culture PCR assay of Salmonella Paratyphi A. The volunteers diagnosed with paratyphoid had a median bacterial burden of 1 (range 0.1-6.9) CFU/ml blood. All the blood culture PCR positive cases where a positive bacterial growth was shown by quantitative blood culture had a bacterial burden of ≥ 0.3 CFU/ ml blood. The blood culture PCR assay identified an equal number of positive cases as automated blood culture at higher bacterial loads (≥0.3 CFU/ml blood), but utilized only half the volume of specimens. The blood culture PCR method for detection of Salmonella Paratyphi A can be completed within 9 hours and offers the potential for same-day diagnosis of enteric fever. Using 5 ml blood, it exhibited a lower limit of detection equal to 0.3 CFU

  14. Development and Evaluation of a Blood Culture PCR Assay for Rapid Detection of Salmonella Paratyphi A in Clinical Samples.

    Directory of Open Access Journals (Sweden)

    Liqing Zhou

    Full Text Available Enteric fever remains an important cause of morbidity in many low-income countries and Salmonella Paratyphi A has emerged as the aetiological agent in an increasing proportion of cases. Lack of adequate diagnostics hinders early diagnosis and prompt treatment of both typhoid and paratyphoid but development of assays to identify paratyphoid has been particularly neglected. Here we describe the development of a rapid and sensitive blood culture PCR method for detection of Salmonella Paratyphi A from blood, potentially allowing for appropriate diagnosis and antimicrobial treatment to be initiated on the same day.Venous blood samples from volunteers experimentally challenged orally with Salmonella Paratyphi A, who subsequently developed paratyphoid, were taken on the day of diagnosis; 10 ml for quantitative blood culture and automated blood culture, and 5 ml for blood culture PCR. In the latter assay, bacteria were grown in tryptone soy broth containing 2.4% ox bile and micrococcal nuclease for 5 hours (37°C before bacterial DNA was isolated for PCR detection targeting the fliC-a gene of Salmonella Paratyphi A.An optimized broth containing 2.4% ox bile and micrococcal nuclease, as well as a PCR test was developed for a blood culture PCR assay of Salmonella Paratyphi A. The volunteers diagnosed with paratyphoid had a median bacterial burden of 1 (range 0.1-6.9 CFU/ml blood. All the blood culture PCR positive cases where a positive bacterial growth was shown by quantitative blood culture had a bacterial burden of ≥ 0.3 CFU/ ml blood. The blood culture PCR assay identified an equal number of positive cases as automated blood culture at higher bacterial loads (≥0.3 CFU/ml blood, but utilized only half the volume of specimens.The blood culture PCR method for detection of Salmonella Paratyphi A can be completed within 9 hours and offers the potential for same-day diagnosis of enteric fever. Using 5 ml blood, it exhibited a lower limit of detection

  15. Systematic review and meta-analysis: rapid diagnostic tests versus placental histology, microscopy and PCR for malaria in pregnant women

    Directory of Open Access Journals (Sweden)

    Kattenberg Johanna H

    2011-10-01

    Full Text Available Abstract Background During pregnancy, malaria infection with Plasmodium falciparum or Plasmodium vivax is related to adverse maternal health and poor birth outcomes. Diagnosis of malaria, during pregnancy, is complicated by the absence or low parasite densities in peripheral blood. Diagnostic methods, other than microscopy, are needed for detection of placental malaria. Therefore, the diagnostic accuracy of rapid diagnostic tests (RDTs, detecting antigen, and molecular techniques (PCR, detecting DNA, for the diagnosis of Plasmodium infections in pregnancy was systematically reviewed. Methods MEDLINE, EMBASE and Web of Science were searched for studies assessing the diagnostic accuracy of RDTs, PCR, microscopy of peripheral and placental blood and placental histology for the detection of malaria infection (all species in pregnant women. Results The results of 49 studies were analysed in metandi (Stata, of which the majority described P. falciparum infections. Although both placental and peripheral blood microscopy cannot reliably replace histology as a reference standard for placental P. falciparum infection, many studies compared RDTs and PCR to these tests. The proportion of microscopy positives in placental blood (sensitivity detected by peripheral blood microscopy, RDTs and PCR are respectively 72% [95% CI 62-80], 81% [95% CI 55-93] and 94% [95% CI 86-98]. The proportion of placental blood microscopy negative women that were negative in peripheral blood microscopy, RDTs and PCR (specificity are 98% [95% CI 95-99], 94% [95% CI 76-99] and 77% [95% CI 71-82]. Based on the current data, it was not possible to determine if the false positives in RDTs and PCR are caused by sequestered parasites in the placenta that are not detected by placental microscopy. Conclusion The findings suggest that RDTs and PCR may have good performance characteristics to serve as alternatives for the diagnosis of malaria in pregnancy, besides any other limitations and

  16. Development and Evaluation of a Blood Culture PCR Assay for Rapid Detection of Salmonella Paratyphi A in Clinical Samples

    Science.gov (United States)

    Zhou, Liqing; Jones, Claire; Gibani, Malick M.; Dobinson, Hazel; Thomaides-Brears, Helena; Shrestha, Sonu; Blohmke, Christoph J.; Darton, Thomas C.; Pollard, Andrew J.

    2016-01-01

    Background Enteric fever remains an important cause of morbidity in many low-income countries and Salmonella Paratyphi A has emerged as the aetiological agent in an increasing proportion of cases. Lack of adequate diagnostics hinders early diagnosis and prompt treatment of both typhoid and paratyphoid but development of assays to identify paratyphoid has been particularly neglected. Here we describe the development of a rapid and sensitive blood culture PCR method for detection of Salmonella Paratyphi A from blood, potentially allowing for appropriate diagnosis and antimicrobial treatment to be initiated on the same day. Methods Venous blood samples from volunteers experimentally challenged orally with Salmonella Paratyphi A, who subsequently developed paratyphoid, were taken on the day of diagnosis; 10 ml for quantitative blood culture and automated blood culture, and 5 ml for blood culture PCR. In the latter assay, bacteria were grown in tryptone soy broth containing 2.4% ox bile and micrococcal nuclease for 5 hours (37°C) before bacterial DNA was isolated for PCR detection targeting the fliC-a gene of Salmonella Paratyphi A. Results An optimized broth containing 2.4% ox bile and micrococcal nuclease, as well as a PCR test was developed for a blood culture PCR assay of Salmonella Paratyphi A. The volunteers diagnosed with paratyphoid had a median bacterial burden of 1 (range 0.1–6.9) CFU/ml blood. All the blood culture PCR positive cases where a positive bacterial growth was shown by quantitative blood culture had a bacterial burden of ≥ 0.3 CFU/ ml blood. The blood culture PCR assay identified an equal number of positive cases as automated blood culture at higher bacterial loads (≥0.3 CFU/ml blood), but utilized only half the volume of specimens. Conclusions The blood culture PCR method for detection of Salmonella Paratyphi A can be completed within 9 hours and offers the potential for same-day diagnosis of enteric fever. Using 5 ml blood, it exhibited a

  17. [Automated RNA amplification for the rapid identification of Mycobacterium tuberculosis complex in respiratory specimens].

    Science.gov (United States)

    Drouillon, V; Houriez, F; Buze, M; Lagrange, P; Herrmann, J-L

    2006-01-01

    Rapid and sensitive detection of Mycobacterium tuberculosis complex (MTB) directly on clinical respiratory specimens is essential for a correct management of patients suspected of tuberculosis. For this purpose PCR-based kits are available to detect MTB in respiratory specimen but most of them need at least 4 hours to be completed. New methods, based on TRC method (TRC: Transcription Reverse transcription Concerted--TRCRapid M. Tuberculosis--Tosoh Bioscience, Tokyo, Japon) and dedicated monitor have been developed. A new kit (TRC Rapid M. tuberculosis and Real-time monitor TRCRapid-160, Tosoh Corporation, Japan) enabling one step amplification and real-time detection of MTB 16S rRNA by a combination of intercalative dye oxazole yellow-linked DNA probe and isothermal RNA amplification directly on respiratory specimens has been tested in our laboratory. 319 respiratory specimens were tested in this preliminary study and results were compared to smear and culture. Fourteen had a positive culture for MTB. Among theses samples, smear was positive in 11 cases (78.6%) and TRC process was positive in 8 cases (57.1%). Overall sensitivity of TRC compared to smear positive samples is 73%. Theses first results demonstrated that a rapid identification of MTB was possible (less than 2 processing hours for 14 specimens and about 1 hour for 1 specimen) in most cases of smear positive samples using ready to use reagents for real time detection of MTB rRNA in clinical samples. New pretreatment and extraction reagents kits to increase the stability of the sputum RNA and the extraction efficiency are now tested in our laboratory.

  18. Rapid analysis for the identification of the seagrass Halophila ovalis ...

    African Journals Online (AJOL)

    Maslin

    2015-02-25

    Feb 25, 2015 ... conventional identification keys alone: i) the variability of morphological characteristics and ii) lack of needed morphological ... Key words: DNA barcoding, Halophila ovalis, rbcL, trnH-psbA, species identification. INTRODUCTION ..... of lignified tissue, the structure of seagrasses is flexible and vulnerable to.

  19. Isolation, identification and differentiation of Campylobacter spp. using multiplex PCR assay from goats in Khartoum State, Sudan.

    Science.gov (United States)

    Elbrissi, Atif; Sabeil, Y A; Khalifa, Khalda A; Enan, Khalid; Khair, Osama M; El Hussein, A M

    2017-03-01

    The aim of this study was to identify and characterize thermophilic Campylobacter species in faecal samples from goats in Khartoum State, Sudan, by application of multiplex polymerase chain reaction. Campylobacteriosis is a zoonotic disease of global concern, and the organisms can be transmitted to human via food, water and through contact with farm animals and pets. There are five clinically related Campylobacter species: Campylobacter jejuni (C. jejuni). Campylobacter coli, Campylobacter lari, Campylobacter upsaliensis and Campylobacter fetus. Conventional cultural methods to diagnose campylobacteriosis are tedious and time consuming. Wide ranges of genes have been reported to be used for PCR-based identification of Campylobacter spp. We used a multiplex PCR assay to simultaneously detect genes from the major five clinically significant Campylobacter spp. The genes selected were hipO (hippuricase) and 23S rRNA from glyA (serine hydroxymethyl transferase) from each of C. jejuni. C. coli, C. lari, and C. upsaliensis; and sapB2 (surface layer protein) from C. fetus subsp. fetus. The assay was used to identify Campylobacter isolates recovered from 336 cultured faecal samples from goats in three localities in Khartoum State. C. coli was the most predominant isolate (234; 69.6%), followed by C. jejuni (19; 5.7%), C. upsaliensis (13; 3.9%), C. fetus subsp. fetus (7; 2.1%) and C. lari (6; 1.8%). Twenty-nine goats showed mixed infection with Campylobacter spp., 21 of which harbored two Campylobacter spp., while eight animals were infected with three species. Ten out of twelve goats that displayed diarrhea harbored C. coli only. C. coli, C. jejuni and C. upsaliensis showed significant variation with localities. The prevalence of C. coli was significantly higher (87; 25.9%) in goats from Omdurman, whereas C. jejuni and C. upsaliensis were significantly higher (11; 3.3%, 9; 2.7%) in goats from Khartoum. The multiplex PCR assay was found to be rapid and easy to perform and

  20. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.

    2011-01-01

    for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were......Fish diseases can be caused by a variety of diverse organisms, including bacteria, fungi, viruses and protozoa, and pose a universal threat to the ornamental fish industry and aquaculture. The lack of rapid, accurate and reliable means by which fish pathogens can be detected and identified has been...... one of the main limitations in fish pathogen diagnosis and fish disease management and has consequently stimulated the search for alternative diagnostic techniques. Here, we describe a method based on multiplex and broad‐range PCR amplification combined with DNA array hybridization...

  1. A Rapid and Simple LC-MS Method Using Collagen Marker Peptides for Identification of the Animal Source of Leather.

    Science.gov (United States)

    Kumazawa, Yuki; Taga, Yuki; Iwai, Kenji; Koyama, Yoh-Ichi

    2016-08-03

    Identification of the animal source of leather is difficult using traditional methods, including microscopic observation and PCR. In the present study, a LC-MS method was developed for detecting interspecies differences in the amino acid sequence of type I collagen, which is a major component of leather, among six animals (cattle, horse, pig, sheep, goat, and deer). After a dechroming procedure and trypsin digestion, six tryptic peptides of type I collagen were monitored by LC-MS in multiple reaction monitoring mode for the animal source identification using the patterns of the presence or absence of the marker peptides. We analyzed commercial leathers from various production areas using this method, and found some leathers in which the commercial label disagreed with the identified animal source. Our method enabled rapid and simple leather certification and could be applied to other animals whether or not their collagen sequences are available in public databases.

  2. A rapid PCR-SSP assay for the hemochromatosis-associated Tyr250Stop mutation in the TFR2 gene.

    Science.gov (United States)

    Rivers, C A; Barton, J C; Acton, R T

    2001-01-01

    Several genes associated with hemochromatosis and primary iron overload have been identified. Mutations in the HFE gene have been detected in 60-100% of hemochromatosis patients of northern, central, and western European descent, although the frequencies of these mutations vary among racial and ethnic groups. Recently, a mutation in the gene encoding transferrin receptor-2 (exon 6, nucleotide 750 C --> G; Y250X) was detected by a PCR-restriction fragment length polymorphism (RFLP) method in Sicilians with hemochromatosis. We describe a modification of the original assay in which the sequence-specific priming PCR assay does not require the use of restriction endonuclease. The modified assay is robust and cost-efficient, and may be more useful for large-scale population studies because it can be performed rapidly on DNA extracted from buccal swabs.

  3. Comparison of Seeplex PneumoBacter aCE detection assay and in-house multiplex PCR for the identification of Streptococcus pneumoniae.

    Science.gov (United States)

    Luznik, Dane; Kosnik, Mitja; Tomic, Viktorija

    2015-01-01

    Rapid and accurate identification of Streptococcus pneumoniae is important for appropriate and prudent antimicrobial use in the treatment of lower respiratory tract infection. It is difficult to separate S. pneumoniae from commensal viridans group streptococci either by classical techniques or molecular methods. Aim of this study was to compare a commercially available multiplex PCR assay Seeplex PneumoBacter ACE Detection assay (Seegene, Seoul, South Korea), and in-house multiplex PCR using primer sets for lytA and cpsA for ability to differentiate S. pneumoniae in a known set of bacteria (S. pneumoniae and viridans group streptococci) and clinical samples. Of 20 viridans streptococcal isolates, 8 were misidentified as S. pneumoniae by commercial PCR test. Of 209 throat swabs tested with Seeplex PneumoBacter ACE Detection assay, 122 (58,4%) were positive for S. pneumoniae while only 11 (5.3%) samples were positive with lytA and cpsA primers. Therefore, the commercial multiplex PCR test appears to have low specificity in diagnosing S. pneumoniae.

  4. Nested PCR for Rapid Detection of Mumps Virus in Cerebrospinal Fluid from Patients with Neurological Diseases

    Science.gov (United States)

    Poggio, Gustavo Palacios; Rodriguez, Claudia; Cisterna, Daniel; Freire, María Cecilia; Cello, Jerónimo

    2000-01-01

    In this study, we have developed a reverse transcription (RT)-nested polymerase chain reaction (n-PCR) for the detection of mumps virus RNA in cerebrospinal fluid (CSF) from patients with neurological infections. A specific 112-bp fragment was amplified by this method with primers from the nucleoprotein of the mumps virus genome. The mumps virus RT–n-PCR was capable of detecting 0.001 PFU/ml and 0.005 50% tissue culture infective dose/ml. This method was found to be specific, since no PCR product was detected in each of the CSF samples from patients with proven non-mumps virus-related meningitis or encephalitis. Mumps virus RNA was detected in all 18 CSF samples confirmed by culture to be infected with mumps virus. Positive PCR results were obtained for the CSF of 26 of 28 patients that were positive for signs of mumps virus infection (i.e., cultivable virus from urine or oropharyngeal samples or positivity for anti-mumps virus immunoglobulin M) but without cultivable virus in their CSF. Overall, mumps virus RNA was detected in CSF of 96% of the patients with a clinical diagnosis of viral central nervous system (CNS) disease and confirmed mumps virus infection, while mumps virus was isolated in CSF of only 39% of the patients. Furthermore, in a retrospective study, we were able to detect mumps virus RNA in 25 of 55 (46%) CSF samples from patients with a clinical diagnosis of viral CNS disease and negative laboratory evidence of viral infection including mumps virus infection. The 25 patients represent 12% of the 236 patients who had a clinical diagnosis of viral CNS infections and whose CSF was examined at our laboratory for a 2-year period. The findings confirm the importance of mumps virus as a causative agent of CNS infections in countries with low vaccine coverage rates. In summary, our study demonstrates the usefulness of the mumps virus RT–n-PCR for the diagnosis of mumps virus CNS disease and suggests that this assay may soon become the “gold standard

  5. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    Science.gov (United States)

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  6. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat

    Directory of Open Access Journals (Sweden)

    Porceddu Enrico

    2009-02-01

    Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability

  7. Clinical impact of a commercially available multiplex PCR system for rapid detection of pathogens in patients with presumed sepsis

    Directory of Open Access Journals (Sweden)

    Linde Hans-Jörg

    2009-08-01

    Full Text Available Abstract Background Timely identification of pathogens is crucial to minimize mortality in patients with severe infections. Detection of bacterial and fungal pathogens in blood by nucleic acid amplification promises to yield results faster than blood cultures (BC. We analyzed the clinical impact of a commercially available multiplex PCR system in patients with suspected sepsis. Methods Blood samples from patients with presumed sepsis were cultured with the Bactec 9240™ system (Becton Dickinson, Heidelberg, Germany and aliquots subjected to analysis with the LightCycler® SeptiFast® (SF Test (Roche Diagnostics, Mannheim, Germany at a tertiary care centre. For samples with PCR-detected pathogens, the actual impact on clinical management was determined by chart review. Furthermore a comparison between the time to a positive blood culture result and the SF result, based on a fictive assumption that it was done either on a once or twice daily basis, was made. Results Of 101 blood samples from 77 patients, 63 (62% yielded concordant negative results, 14 (13% concordant positive and 9 (9% were BC positive only. In 14 (13% samples pathogens were detected by SF only, resulting in adjustment of antibiotic therapy in 5 patients (7,7% of patients. In 3 samples a treatment adjustment would have been made earlier resulting in a total of 8 adjustments in all 101 samples (8%. Conclusion The addition of multiplex PCR to conventional blood cultures had a relevant impact on clinical management for a subset of patients with presumed sepsis.

  8. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Directory of Open Access Journals (Sweden)

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  9. Blood Meal Identification in Field-Captured Sand flies: Comparison of PCR-RFLP and ELISA Assays

    Directory of Open Access Journals (Sweden)

    N Maleki-Ravasan

    2009-07-01

    Full Text Available   Abstract Background: We aimed to develop a PCR-RFLP assay based on available sequences of putative vertebrate hosts to iden­tify blood meals ingested by field female sand fly in the northwest of Iran. In addition, the utility of PCR-RFLP was compared with ELISA as a standard method."nMethods: This experimental study was performed in the Insect Molecular Biology Laboratory of School of Public Health, Tehran University of Medical Sciences, Iran in 2006-2007. For PCR-RFLP a set of conserved vertebrate prim­ers were used to amplify a part of the host mitochondrial cytochrome b (cyt b gene followed by digestion of the PCR products by Hae III enzyme."nResults: The PCR-RFLP and ELISA assays revealed that 34% and 27% of field-collected sand flies had fed on hu­mans, respectively. Additionally, PCR-RFLP assays could reveal specific host DNA as well as the components of mixed blood meals. Results of PCR-RFLP assay showed that the sand flies had fed on cow (54%, human (10%, dog (4%, human and cow (21%, dog and cow (14%, and human and dog (3%. "nConclusion: The results can provide a novel method for rapid diagnosis of blood meal taken by sandflies. The advan­tages and limitations of PCR and ELISA assays are discussed.

  10. Blood Meal Identification in Field-Captured Sand flies: Comparison of PCR-RFLP and ELISA Assays

    Directory of Open Access Journals (Sweden)

    N Maleki-Ravasan

    2009-06-01

    Full Text Available  Background: We aimed to develop a PCR-RFLP assay based on available sequences of putative vertebrate hosts to iden­tify blood meals ingested by field female sand fly in the northwest of Iran. In addition, the utility of PCR-RFLP was compared with ELISA as a standard method.Methods: This experimental study was performed in the Insect Molecular Biology Laboratory of School of Public Health, Tehran University of Medical Sciences, Iran in 2006-2007. For PCR-RFLP a set of conserved vertebrate prim­ers were used to amplify a part of the host mitochondrial cytochrome b (cyt b gene followed by digestion of the PCR products by Hae III enzyme.Results: The PCR-RFLP and ELISA assays revealed that 34% and 27% of field-collected sand flies had fed on hu­mans, respectively. Additionally, PCR-RFLP assays could reveal specific host DNA as well as the components of mixed blood meals. Results of PCR-RFLP assay showed that the sand flies had fed on cow (54%, human (10%, dog (4%, human and cow (21%, dog and cow (14%, and human and dog (3%. Conclusion: The results can provide a novel method for rapid diagnosis of blood meal taken by sandflies. The advan­tages and limitations of PCR and ELISA assays are discussed.

  11. Comparison of a capillary gel electrophoresis-based multiplex PCR assay and ribosomal intergenic transcribed spacer-2 amplicon sequencing for identification of clinically important Candida species.

    Science.gov (United States)

    Monstein, Hans-Jürg; Tärnberg, Maria; Persis, Shohreh; Johansson, Anders G

    2014-01-01

    The performance of a commercially available Seegene Seeplex STI Master Panel 3 multiplex PCR for Candida species identification was compared with an internal transcribed spacer 2 (ITS2) PCR assay. We found that the Seeplex assay was specific for identification of C. albicans, C. krusei, C. parapsilosis, C. glabrata, C. tropicalis and C. dubliniensis. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Identification of pathogens by comprehensive real-time PCR versus conventional methods in community-acquired pneumonia in Japanese adults.

    Science.gov (United States)

    Yoshii, Yutaka; Shimizu, Kenichiro; Morozumi, Miyuki; Chiba, Naoko; Ubukata, Kimiko; Uruga, Hironori; Hanada, Shigeo; Wakui, Hiroshi; Ito, Saburo; Takasaka, Naoki; Minagawa, Shunsuke; Kojima, Jun; Numata, Takanori; Hara, Hiromichi; Kawaishi, Makoto; Saito, Keisuke; Araya, Jun; Kaneko, Yumi; Nakayama, Katsutoshi; Kishi, Kazuma; Kuwano, Kazuyoshi

    2016-01-01

    Community-acquired pneumonia (CAP) has high morbidity and mortality. Unfortunately, the pathogen detection rate using conventional culture methods is relatively low. We compared comprehensive real-time polymerase chain reaction (real-time PCR) analysis of nasopharyngeal swab specimens (NPS) and sputum samples against conventional methods for ability to detect causative pathogens of CAP. We prospectively enrolled adult CAP patients, including those with prior antibiotic use, from December 2012 to May 2014. For each patient, causative pathogens were investigated conventionally and by real-time PCR that can identify 6 bacterial and 11 viral pathogens. Patients numbered 92 (mean age, 63 years; 59 male), including 30 (33%) with prior antibiotic use. Considering all patients, identification of causative pathogens by real-time PCR was significantly more frequent than by conventional methods in all patients (72% vs. 57%, p = 0.018). In patients with prior antibiotic use, identification rates also differed significantly (PCR, 77%; conventional, 50%; p = 0.027). Mixed infections were more frequent according to real-time PCR than conventional methods (26% vs. 4%, p real-time PCR, Streptococcus pneumoniae was most frequently identified (38%) as a causative pathogen, followed by Haemophilus influenzae (37%) and Mycoplasma pneumoniae (5%). PCR also identified viral pathogens (21%), with sensitivity enhanced by simultaneous examination of both NPS and sputum samples rather than only NPS samples. Real-time PCR of NPS and sputum samples could better identify bacterial and viral pathogens in CAP than conventional methods, both overall and in patients with prior antibiotic treatment.

  13. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order...

  14. Rapidly discriminate commercial medicinal Pulsatilla chinensis (Bge.) Regel from its adulterants using ITS2 barcoding and specific PCR-RFLP assay.

    Science.gov (United States)

    Shi, Yuhua; Zhao, Mingming; Yao, Hui; Yang, Pei; Xin, Tianyi; Li, Bin; Sun, Wei; Chen, Shilin

    2017-01-06

    Pulsatillae radix is a conventional traditional Chinese medicine (TCM) with common name Baitouweng, and has notable effects on inflammation and dysentery. Pulsatilla chinensis (Bge.) Regel is the only source plant of Baitouweng recorded in Chinese Pharmacopoeia, but its adulteration often occurs in the market that possibly affects medicinal efficacy and safety. We have established an internal transcribed spacer 2 (ITS2) barcode library based on 105 plant samples from 12 Pulsatilla species and 10 common adulterants. Results indicate that ITS2 barcoding can accurately distinguish Pulsatilla species from their adulterants. Pulsatilla chinensis can be discriminated from 11 congeneric species by two stable single nucleotide polymorphisms (SNPs) in the ITS2 region. Additionally, a quick specific PCR-RFLP identification assay based on the ITS2 barcode was developed. Using specific primers ITS2/PR1 combined with restriction enzyme Bgl I, Pu. chinensis can rapidly be differentiated from other species via simple and low-cost test procedures. Furthermore, 30 commercial Baitouweng products were tested and only two products were derived from authentic Pu. chinensis. Thus, these two molecular approaches provide practical tools for quick identification of commercial Baitouweng products and can help ensure the safe use of this TCM product.

  15. Portable platform for rapid in-field identification of human fecal pollution in water.

    Science.gov (United States)

    Jiang, Yu Sherry; Riedel, Timothy E; Popoola, Jessica A; Morrow, Barrett R; Cai, Sheng; Ellington, Andrew D; Bhadra, Sanchita

    2017-12-13

    Human fecal contamination of water is a public health risk. However, inadequate testing solutions frustrate timely, actionable monitoring. Bacterial culture-based methods are simple but typically cannot distinguish fecal host source. PCR assays can identify host sources but require expertise and infrastructure. To bridge this gap we have developed a field-ready nucleic acid diagnostic platform and rapid sample preparation methods that enable on-site identification of human fecal contamination within 80 min of sampling. Our platform relies on loop-mediated isothermal amplification (LAMP) of human-associated Bacteroides HF183 genetic markers from crude samples. Oligonucleotide strand exchange (OSD) probes reduce false positives by sequence specifically transducing LAMP amplicons into visible fluorescence that can be photographed by unmodified smartphones. Our assay can detect as few as 17 copies/ml of human-associated HF183 targets in sewage-contaminated water without cross-reaction with canine or feline feces. It performs robustly with a variety of environmental water sources and with raw sewage. We have also developed lyophilized assays and inexpensive 3D-printed devices to minimize cost and facilitate field application. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Improved methodology for identification of cryptomonads: combining light microscopy and PCR amplification.

    Science.gov (United States)

    Xia, Shuang; Cheng, Yingyin; Zhu, Huan; Liu, Guoxiang; Hu, Zhengyu

    2013-03-01

    Cryptomonads are unicellular, biflagellate algae. Generally, cryptomonad cells cannot be preserved well because of their fragile nature, and an improved methodology should be developed to identify cryptomonads from natural habitats. In this study, we tried using several cytological fixatives, including glutaraldehyde, formaldehyde, and their combinations to preserve field samples collected from various waters, and the currently used fixative, Lugol's solution was tested for comparison. Results showed that among the fixatives tested, glutaraldehyde preserved the samples best, and the optimal concentration of glutaraldehyde was 2%. The cell morphology was well preserved by glutaraldehyde. Cells kept their original color, volume, and shape, and important taxonomic features such as furrow/gullet complex, ejectosomes, as well as flagella could be observed clearly, whereas these organelles frequently disappeared in Lugol's solution preserved samples. The osmotic adjustments and buffers tested could not preserve cell density significantly higher. Statistical calculation showed the cell density in the samples preserved by 2% glutaraldehyde remained stable after 43 days of the fixation procedure. In addition, DNA was extracted from glutaraldehyde preserved samples by grinding with liquid nitrogen and the 18S rDNA sequence was amplified by PCR. The sequence was virtually identical to the reference sequence, and phylogenetic analyses showed very close relationship between it and sequences from the same organism. To sum up, the present study demonstrated that 2% unbuffered glutaraldehyde, without osmotic adjustments, can preserve cryptomonads cells for identification, in terms of both light microscopy and phylogenetic analyses based on DNA sequences.

  17. Rapid Electrochemical Detection and Identification of Microbiological and Chemical Contaminants for Manned Spaceflight Project

    Data.gov (United States)

    National Aeronautics and Space Administration — A great deal of effort has gone into the development of point-of-use methods to meet the challenge of rapid bacterial identification for both environmental...

  18. hsp65 PCR-restriction analysis (PRA) with capillary electrophoresis in comparison to three other methods for identification of Mycobacterium species.

    Science.gov (United States)

    Sajduda, Anna; Martin, Anandi; Portaels, Françoise; Palomino, Juan Carlos

    2010-02-01

    We developed a scheme for rapid identification of Mycobacterium species using an automated fluorescence capillary electrophoresis instrument. A 441-bp region of the hsp65 gene was examined using PCR-restriction analysis (PRA). The assay was initially evaluated on 38 reference strains. The observed sizes of restriction fragments were consistently smaller than the real sizes for each of the species as deduced from the sequence analysis (mean variance=7bp). Nevertheless, the obtained PRA patterns were highly reproducible and resulted in correct species identifications. A blind test was then successfully performed on 64 test isolates previously characterized by conventional biochemical methods, a commercial INNO-LiPA Mycobacteria assay and/or sequence determination of the 5' end of 16S rRNA gene. A total of 14 of 64 isolates were erroneously identified by conventional methods (78% accuracy). In contrast, PRA performed very well in comparison with the LiPA (89% concordance) and especially with DNA sequencing (93.3% of concordant results). Also, PRA identified seven isolates representing five previously unreported hsp65 alleles. We conclude that hsp65 PRA based on automated capillary electrophoresis is a rapid, simple and reliable method for identification of mycobacteria. Copyright 2010 Elsevier B.V. All rights reserved.

  19. Autoscreening of restriction endonucleases for PCR-restriction fragment length polymorphism identification of fungal species, with Pleurotus spp. as an example.

    Science.gov (United States)

    Yang, Zhi-Hui; Huang, Ji-Xiang; Yao, Yi-Jian

    2007-12-01

    A molecular method based on PCR-restriction fragment length polymorphism (RFLP) analysis of internal transcribed spacer (ITS) ribosomal DNA sequences was designed to rapidly identify fungal species, with members of the genus Pleurotus as an example. Based on the results of phylogenetic analysis of ITS sequences from Pleurotus, a PCR-RFLP endonuclease autoscreening (PRE Auto) program was developed to screen restriction endonucleases for discriminating multiple sequences from different species. The PRE Auto program analyzes the endonuclease recognition sites and calculates the sizes of the fragments in the sequences that are imported into the program in groups according to species recognition. Every restriction endonuclease is scored through the calculation of the average coefficient for the sequence groups and the average coefficient for the sequences within a group, and then virtual electrophoresis maps for the selected restriction enzymes, based on the results of the scoring system, are displayed for the rapid determination of the candidate endonucleases. A total of 85 haplotypes representing 151 ITS sequences were used for the analysis, and 2,992 restriction endonucleases were screened to find the candidates for the identification of species. This method was verified by an experiment with 28 samples representing 12 species of Pleurotus. The results of the digestion by the restriction enzymes showed the same patterns of DNA fragments anticipated by the PRE Auto program, apart from those for four misidentified samples. ITS sequences from 14 samples (of which nine sequences were obtained in this study), including four originally misidentified samples, confirmed the species identities revealed by the PCR-RFLP analysis. The method developed here can be used for the identification of species of other living microorganisms.

  20. Rapid detection of Salmonella in pet food: design and evaluation of integrated methods based on real-time PCR detection.

    Science.gov (United States)

    Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane

    2012-02-01

    Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.

  1. Rapid assembly of multiple DNA fragments through direct transformation of PCR products into E. coli and Lactobacillus.

    Science.gov (United States)

    Cao, Pinghua; Wang, Lei; Zhou, Guangxian; Wang, Yaoyue; Chen, Yulin

    2014-11-01

    This article describes a rapid, highly efficient and versatile method for seamlessly assembling multiple DNA fragments into a vector at any desired position. The inserted fragments and vector backbone were amplified by high-fidelity PCR containing 20 bp to 50 bp overlapping regions at 3' and/or 5' termini. These linearised fragments were equimolarly mixed, and then cyclised in a prolonged overlap extension PCR without adding primers. The resulting PCR products were DNA multimers that could be directly transformed into host strains, yielding the desired chimeric plasmid. The proposed method was illustrated by constructing an Escherichia coli co-expression vector. The feasibility of the method in Lactobacillus was further validated by assembling an E. coli-Lactobacillus shuttle vector. Results showed that three to four fragments could be simultaneously and precisely inserted in a vector in only 2-3 days using the proposed method. The acceptable transformation efficiency was determined through the tested host strains; more than 95% of the colonies were positive transformants. Therefore, the proposed method is sufficiently competent for high-efficiency insertion of multiple DNA fragments into a plasmid and has theoretically good application potential for gene cloning and protein expression because it is simple, easy to implement, flexible and yields highly positive clones. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Combination of RT-PCR and proteomics for the identification of Crimean-Congo hemorrhagic fever virus in ticks

    Directory of Open Access Journals (Sweden)

    Isabel G. Fernández de Mera

    2017-07-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging tick-borne zoonotic disease caused by the CCHF virus (CCHFV. In this study, an experimental approach combining RT-PCR and proteomics was used for the identification and characterization of CCHFV in 106 ticks from 7 species that were collected from small ruminants in Greece. The methodological approach included an initial screening for CCHFV by RT-PCR followed by proteomics analysis of positive and control negative tick samples. This novel approach allowed the identification of CCHFV-positive ticks and provided additional information to corroborate the RT-PCR findings using a different approach. Two ticks, Dermacentor marginatus and Haemaphysalis parva collected from a goat and a sheep, respectively were positive for CCHFV. The sequences for CCHFV RNA segments S and L were characterized by RT-PCR and proteomics analysis of tick samples, respectively. These results showed the possibility of combining analyses at the RNA and protein levels using RT-PCR and proteomics for the characterization of CCHFV in ticks. The results supported that the CCHFV identified in ticks are genetic variants of the AP92 strain. Although the AP92-like strains probably do not represent a high risk of CCHF to the population, the circulation of genetically diverse CCHFV strains could potentially result in the appearance of novel viral genotypes with increased pathogenicity and fitness.

  3. Problems with rapid agglutination methods for identification of Staphylococcus aureus when Staphylococcus saprophyticus is being tested.

    OpenAIRE

    Gregson, D B; Low, D E; Skulnick, M; Simor, A E

    1988-01-01

    Six rapid agglutination tests for identification of Staphylococcus aureus were evaluated by using 62 strains of S. aureus, 63 strains of S. saprophyticus, and 67 strains of other coagulase-negative staphylococci. S. saprophyticus was responsible for 19 of 26 false-positive results and 20 uninterpretable reactions. Thus, urinary staphylococcal isolates that are positive by rapid agglutination tests may require other confirmatory tests for the identification of possible S. saprophyticus.

  4. A proline racemase based PCR for identification of Trypanosoma vivax in cattle blood.

    Science.gov (United States)

    Fikru, Regassa; Hagos, Ashenafi; Rogé, Stijn; Reyna-Bello, Armando; Gonzatti, Mary Isabel; Merga, Bekana; Goddeeris, Bruno Maria; Büscher, Philippe

    2014-01-01

    A study was conducted to develop a Trypanosoma vivax (T. vivax) specific PCR based on the T. vivax proline racemase (TvPRAC) gene. Forward and reverse primers were designed that bind at 764-783 bp and 983-1002 bp of the gene. To assess its specificity, TvPRAC PCR was conducted on DNA extracted from different haemotropic pathogens: T. vivax from Nigeria, Ethiopia and Venezuela, T. congolense Savannah type, T. brucei brucei, T. evansi, T. equiperdum, T. theileri, Theileria parva, Anaplasma marginale, Babesia bovis and Babesia bigemina and from bovine, goat, mouse, camel and human blood. The analytical sensitivity of the TvPRAC PCR was compared with that of the ITS-1 PCR and the 18S PCR-RFLP on a dilution series of T. vivax DNA in water. The diagnostic performance of the three PCRs was compared on 411 Ethiopian bovine blood specimens collected in a former study. TvPRAC PCR proved to be fully specific for T. vivax, irrespective of its geographical origin. Its analytical sensitivity was lower than that of ITS-1 PCR. On these bovine specimens, TvPRAC PCR detected 8.3% T. vivax infections while ITS-1 PCR and 18S PCR-RFLP detected respectively 22.6 and 6.1% T. vivax infections. The study demonstrates that a proline racemase based PCR could be used, preferably in combination with ITS-1 PCR, as a species-specific diagnostic test for T. vivax infections worldwide.

  5. A proline racemase based PCR for identification of Trypanosoma vivax in cattle blood.

    Directory of Open Access Journals (Sweden)

    Regassa Fikru

    Full Text Available A study was conducted to develop a Trypanosoma vivax (T. vivax specific PCR based on the T. vivax proline racemase (TvPRAC gene. Forward and reverse primers were designed that bind at 764-783 bp and 983-1002 bp of the gene. To assess its specificity, TvPRAC PCR was conducted on DNA extracted from different haemotropic pathogens: T. vivax from Nigeria, Ethiopia and Venezuela, T. congolense Savannah type, T. brucei brucei, T. evansi, T. equiperdum, T. theileri, Theileria parva, Anaplasma marginale, Babesia bovis and Babesia bigemina and from bovine, goat, mouse, camel and human blood. The analytical sensitivity of the TvPRAC PCR was compared with that of the ITS-1 PCR and the 18S PCR-RFLP on a dilution series of T. vivax DNA in water. The diagnostic performance of the three PCRs was compared on 411 Ethiopian bovine blood specimens collected in a former study. TvPRAC PCR proved to be fully specific for T. vivax, irrespective of its geographical origin. Its analytical sensitivity was lower than that of ITS-1 PCR. On these bovine specimens, TvPRAC PCR detected 8.3% T. vivax infections while ITS-1 PCR and 18S PCR-RFLP detected respectively 22.6 and 6.1% T. vivax infections. The study demonstrates that a proline racemase based PCR could be used, preferably in combination with ITS-1 PCR, as a species-specific diagnostic test for T. vivax infections worldwide.

  6. A new PCR approach for the identification of Fusarium graminearum Um novo protocolo de PCR para a identificação de Fusarium graminearum

    Directory of Open Access Journals (Sweden)

    Gleison Ricardo de Biazio

    2008-09-01

    Full Text Available The main objective of this work was to develop a PCR protocol for the identification of Fusarium graminearum, based on a pair of primers targeted to a segment of the 3' coding region of the gaoA gene that codes for the enzyme galactose oxidase (GO. This region has low homology with the same region of GO genes from other fungi. Genomic DNA from 17 strains of Fusarium spp. isolated from diseased cereals, from several other Fusarium species, and from other fungi genera was analyzed in a PCR assay using this primer set. The 17 strains of Fusarium spp. were also analyzed for the GO enzyme production in submerse fermentation in a new formulated liquid medium. All strains that were morphologically and molecularly identified as F. graminearum were able to secrete the enzyme and had a positive result in the used PCR protocol. No DNA fragment was amplified using genomic DNA from other Fusarium species and species of other fungi genera. The results suggest that the proposed PCR protocol is specific and can be considered as a new molecular tool for the identification of F. graminearum. In addition, the new formulated medium is a cheap alternative for screening for GO screening production by F. graminearum.O principal objetivo deste trabalho foi desenvolver um novo protocolo de PCR para identificação de isolados de Fusarium graminearum, baseado no uso de um par de iniciadores direcionado para um segmento da região 3' codificadora do gene gaoA que codifica a enzima galactose oxidase (GO. Esta região possui baixa homologia com a mesma região de genes da GO de outros fungos. O DNA genômico de 17 cepas de Fusarium spp. isoladas de cereais infectados com sintomas, de vários outras espécies de Fusarium e de outros gêneros de fungos foi analisado em um protocolo de PCR utilizando os iniciadores desenhados. Os 17 isolados de Fusarium spp. também foram analisados para a produção da enzima GO em fermentação submersa em um novo meio líquido. Todas as

  7. Rapid restriction enzyme-free cloning of PCR products: a high-throughput method applicable for library construction.

    Directory of Open Access Journals (Sweden)

    Vijay K Chaudhary

    Full Text Available Herein, we describe a novel cloning strategy for PCR-amplified DNA which employs the type IIs restriction endonuclease BsaI to create a linearized vector with four base-long 5'-overhangs, and T4 DNA polymerase treatment of the insert in presence of a single dNTP to create vector-compatible four base-long overhangs. Notably, the insert preparation does not require any restriction enzyme treatment. The BsaI sites in the vector are oriented in such a manner that upon digestion with BsaI, a stuffer sequence along with both BsaI recognition sequences is removed. The sequence of the four base-long overhangs produced by BsaI cleavage were designed to be non-palindromic, non-compatible to each other. Therefore, only ligation of an insert carrying compatible ends allows directional cloning of the insert to the vector to generate a recombinant without recreating the BsaI sites. We also developed rapid protocols for insert preparation and cloning, by which the entire process from PCR to transformation can be completed in 6-8 h and DNA fragments ranging in size from 200 to 2200 bp can be cloned with equal efficiencies. One protocol uses a single tube for insert preparation if amplification is performed using polymerases with low 3'-exonuclease activity. The other protocol is compatible with any thermostable polymerase, including those with high 3'-exonuclease activity, and does not significantly increase the time required for cloning. The suitability of this method for high-throughput cloning was demonstrated by cloning batches of 24 PCR products with nearly 100% efficiency. The cloning strategy is also suitable for high efficiency cloning and was used to construct large libraries comprising more than 108 clones/µg vector. Additionally, based on this strategy, a variety of vectors were constructed for the expression of proteins in E. coli, enabling large number of different clones to be rapidly generated.

  8. Identification and molecular epidemiology of dermatophyte isolates by repetitive-sequence-PCR-based DNA fingerprinting using the DiversiLab system in Turkey.

    Science.gov (United States)

    Koc, A Nedret; Atalay, Mustafa A; Inci, Melek; Sariguzel, Fatma M; Sav, Hafize

    2017-05-01

    Dermatophyte species, isolation and identification in clinical samples are still difficult and take a long time. The identification and molecular epidemiology of dermatophytes commonly isolated in a clinical laboratory in Turkey by repetitive sequence-based PCR (rep-PCR) were assessed by comparing the results with those of reference identification. A total of 44 dermatophytes isolated from various clinical specimens of 20 patients with superficial mycoses in Kayseri and 24 patients in Hatay were studied. The identification of dermatophyte isolates was based on the reference identification and rep-PCR using the DiversiLab System (BioMerieux). The genotyping of dermatophyte isolates from different patients was determined by rep-PCR. In the identification of dermatophyte isolates, agreement between rep-PCR and conventional methods was 87.8 % ( 36 of 41). The dermatophyte strains belonged to four clones (A -D) which were determined by the use of rep-PCR. The dermatophyte strains in Clone B, D showed identical patterns with respect to the region. In conclusion, rep-PCR appears to be useful for evaluation of the identification and clonal relationships between Trichophyton rubrum species complex and Trichophyton mentagrophytes species complex isolates. The similarity and diversity of these isolates may be assessed according to different regions by rep-PCR. © 2017 Blackwell Verlag GmbH.

  9. Multiplex Real-Time PCR Method for Simultaneous Identification and Toxigenic Type Characterization of Clostridium difficile From Stool Samples.

    Science.gov (United States)

    Kilic, Abdullah; Alam, Mohammad J; Tisdel, Naradah L; Shah, Dhara N; Yapar, Mehmet; Lasco, Todd M; Garey, Kevin W

    2015-05-01

    The aim of this study was to develop and validate a multiplex real-time PCR assay for simultaneous identification and toxigenic type characterization of Clostridium difficile. The multiplex real-time PCR assay targeted and simultaneously detected triose phosphate isomerase (tpi) and binary toxin (cdtA) genes, and toxin A (tcdA) and B (tcdB) genes in the first and sec tubes, respectively. The results of multiplex real-time PCR were compared to those of the BD GeneOhm Cdiff assay, targeting the tcdB gene alone. The toxigenic culture was used as the reference, where toxin genes were detected by multiplex real-time PCR. A total of 351 stool samples from consecutive patients were included in the study. Fifty-five stool samples (15.6%) were determined to be positive for the presence of C. difficile by using multiplex real-time PCR. Of these, 48 (87.2%) were toxigenic (46 tcdA and tcdB-positive, two positive for only tcdB) and 11 (22.9%) were cdtA-positive. The sensitivity, specificity, negative predictive value (NPV), and positive predictive value (PPV) of the multiplex real-time PCR compared with the toxigenic culture were 95.6%, 98.6%, 91.6%, and 99.3%, respectively. The analytical sensitivity of the multiplex real-time PCR assay was determined to be 10(3) colony forming unit (CFU)/g spiked stool sample and 0.0625 pg genomic DNA from culture. Analytical specificity determined by using 15 enteric and non-clostridial reference strains was 100%. The multiplex real-time PCR assay accurately detected C. difficile isolates from diarrheal stool samples and characterized its toxin genes in a single PCR run.

  10. Rapid and high throughput molecular identification of diverse mosquito species by high resolution melting analysis [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Yvonne Ukamaka Ajamma

    2016-08-01

    Full Text Available Mosquitoes are a diverse group of invertebrates, with members that are among the most important vectors of diseases. The correct identification of mosquitoes is paramount to the control of the diseases that they transmit. However, morphological techniques depend on the quality of the specimen and often unavailable taxonomic expertise, which may still not be able to distinguish mosquitoes among species complexes (sibling and cryptic species. High resolution melting (HRM analyses, a closed-tube, post-polymerase chain reaction (PCR method used to identify variations in nucleic acid sequences, has been used to differentiate species within the Anopheles gambiae and Culex pipiens complexes. We validated the use of PCR-HRM analyses to differentiate species within Anopheles and within each of six genera of culicine mosquitoes, comparing primers targeting cytochrome b (cyt b, NADH dehydrogenase subunit 1 (ND1, intergenic spacer region (IGS and cytochrome c oxidase subunit 1 (COI gene regions. HRM analyses of amplicons from all the six primer pairs successfully differentiated two or more mosquito species within one or more genera (Aedes (Ae. vittatus from Ae. metallicus, Culex (Cx. tenagius from Cx. antennatus, Cx. neavei from Cx. duttoni, cryptic Cx. pipiens species, Anopheles (An. gambiae s.s. from An. arabiensis and Mansonia (Ma. africana from Ma. uniformis based on their HRM profiles. However, PCR-HRM could not distinguish between species within Aedeomyia (Ad. africana and Ad. furfurea, Mimomyia (Mi. hispida and Mi. splendens and Coquillettidia (Cq. aurites, Cq. chrysosoma, Cq. fuscopennata, Cq. metallica, Cq. microannulatus, Cq. pseudoconopas and Cq. versicolor genera using any of the primers. The IGS and COI barcode region primers gave the best and most definitive separation of mosquito species among anopheline and culicine mosquito genera, respectively, while the other markers may serve to confirm identifications of closely related sub

  11. Rapid identification of pathogens from pediatric blood cultures by use of the FilmArray blood culture identification panel.

    Science.gov (United States)

    Zheng, Xiaotian; Polanco, Wanda; Carter, Donna; Shulman, Stanford

    2014-12-01

    The performance of the FilmArray blood culture identification (BCID) panel has been studied in adult patients. We describe here an evaluation of this assay for the rapid identification of pathogens in Bactec Peds Plus/F and Bactec standard anaerobic/F bottles that contained blood samples from pediatric patients at a tertiary care children's hospital. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  12. Rapid and Accurate Identification of Adulterants via an Electronic Nose and DNA Identification Platform: Identification of Fake Velvet Antlers as an Example

    OpenAIRE

    Guojie Xu; Chunsheng Liu; Caili Liao; Xiaolei Ren; Xinyue Zhang; Xiaorui Fu; Xueyong Wang

    2016-01-01

    Background. Adulterants in Chinese medicines had always affected the efficacy of Chinese medicines and resulted in safety problems in drug use. We aimed to take the identification of fake velvet antlers as an example for establishment of a rapid and accurate identification platform for modern pharmaceutical companies and markets of Chinese medicine. Methods. In this study, we developed a novel electronic nose and DNA identification platform for identifying fake velvet antlers. Electronic nose...

  13. Assessment of PCR-DGGE for the identification of diverse Helicobacter species, and application to faecal samples from zoo animals to determine Helicobacter prevalence.

    OpenAIRE

    Abu Al-Soud, Waleed; Bennedsen, Mads; On, Stephen L. W.; Ouis, Ibn-Sina; Vandamme, Peter; Nilsson, Hans-Olof; Ljungh, Åsa; Wadström, Torkel

    2003-01-01

    Helicobacter species are fastidious bacterial pathogens that are difficult to culture by standard methods. A PCR-denaturing gradient gel electrophoresis (PCR-DGGE) technique for detection and identification of different Helicobacter species was developed and evaluated. The method involves PCR detection of Helicobacter DNA by genus-specific primers that target 16S rDNA and subsequent differentiation of Helicobacter PCR products by use of DGGE. Strains are identified by comparing mobilities of ...

  14. Rapid identification of the medicinal plant Taraxacum formosanum ...

    African Journals Online (AJOL)

    Administrator

    2011-06-06

    Jun 6, 2011 ... College J. 8: 35-46. Xue CY, Li DZ, Lu JM, Yang JB, Liu JQ (2006). Molecular authentication of the traditional Tibetan medical plant Swertia mussotii. Planta Med. 72: 721-726. Yuan CC (2001). Textual research of material medica Taraxacum mongolicum and varietal identification. Chinese Wild Plant Res.

  15. Comparison of Three PCR-based Methods for Simplicity and Cost Effectiveness Identification of Cutaneous Leishmaniasis Due to Leishmania tropica.

    Science.gov (United States)

    Mohammadi, Mohammad Ali; Bamorovat, Mehdi; Fasihi Harandi, Majid; Karimi, Tayyebeh; Sharifi, Iraj; Aflatoonian, Mohammad Reza

    2017-01-01

    To compare three molecular methods, PCR-RFLP for internal transcribed spacer, PCR sequencing and high resolution melting analysis shown reliable sensitivity and specificity for detecting Leishmania tropica as a model for cutaneous leishmaniasis (CL) as the perspective overview for scientific and economic approaches. This study was carried out between 2015 and 2016 in Leishmaniasis Research Center in Kerman University of Medical Sciences, Kerman, Iran. The positives smears (n=50) were obtained from patients referred from the health clinics in a major anthroponotic CL (ACL) focus, southeastern Iran. Only smear preparations with the same grade were selected according to the method described by the WHO for future PCR assays. All three molecular methods had capability to identify positive samples at species level with the same specificity and sensitivity. However, these techniques were different in simplicity, consuming time, and cost effectiveness. Although additional enzymatic process in PCR-RFLP provided good resolution to find Leishmania species but this would cause time and cost increases. HRM (high resolution melting) is a relatively new technique that allows direct characterization of PCR amplicons in a closed system with more simplicity, cost effectiveness and time-consuming compared with other PCR-based assays for epidemiological or clinical identification purposes.

  16. Comparison of Three PCR-based Methods for Simplicity and Cost Effectiveness Identification of Cutaneous Leishmaniasis Due to Leishmania tropica

    Directory of Open Access Journals (Sweden)

    Mohammad Ali MOHAMMADI

    2017-06-01

    Full Text Available Background: To compare three molecular methods, PCR-RFLP for internal transcribed spacer, PCR sequencing and high resolution melting analysis shown reliable sensitivity and specificity for detecting Leishmania tropica as a model for cutaneous leishmaniasis (CL as the perspective overview for scientific and economic approaches.Methods: This study was carried out between 2015 and 2016 in Leishmaniasis Research Center in Kerman University of Medical Sciences, Kerman, Iran. The positives smears (n=50 were obtained from patients referred from the health clinics in a major anthroponotic CL (ACL focus, southeastern Iran. Only smear preparations with the same grade were selected according to the method described by the WHO for future PCR assays.Results: All three molecular methods had capability to identify positive samples at species level with the same specificity and sensitivity. However, these techniques were different in simplicity, consuming time, and cost effectiveness. Although additional enzymatic process in PCR-RFLP provided good resolution to find Leishmania species but this would cause time and cost increases.Conclusion: HRM (high resolution melting is a relatively new technique that allows direct characterization of PCR amplicons in a closed system with more simplicity, cost effectiveness and time-consuming compared with other PCR-based assays for epidemiological or clinical identification purposes.

  17. Exploring MALDI-TOF MS approach for a rapid identification of Mycobacterium avium ssp. paratuberculosis field isolates.

    Science.gov (United States)

    Ricchi, M; Mazzarelli, A; Piscini, A; Di Caro, A; Cannas, A; Leo, S; Russo, S; Arrigoni, N

    2017-03-01

    The aim of the study was to explore the suitability of matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS) for a rapid and correct identification of Mycobacterium avium ssp. paratuberculosis (MAP) field isolates. MALDI-TOF MS approach is becoming one of the most popular tests for the identification of intact bacterial cells which has been shown to be fast and reliable. For this purpose, 36 MAP field isolates were analysed through MALDI-TOF MS and the spectra compared with two different databases: one provided by the vendor of the system employed (Biotyper ver. 3·0; Bruker Daltonics) and a homemade database containing spectra from both tuberculous and nontuberculous Mycobacteria. Moreover, principal component analysis procedure was employed to confirm the ability of MALDI-TOF MS to discriminate between very closely related subspecies. Our results suggest MAP can be differentiated from other Mycobacterium species, both when the species are very close (M. intracellulare) and when belonging to different subspecies (M. avium ssp. avium and M. avium ssp. silvaticum). The procedure applied is fast, easy to perform, and achieves an earlier accurate species identification of MAP and nontuberculous Mycobacteria in comparison to other procedures. The gold standard test for the diagnosis of paratuberculosis is still isolation of MAP by cultural methods, but additional assays, such as qPCR and subculturing for determination of mycobactin dependency are required to confirm its identification. We have provided here evidence pertaining to the usefulness of MALDI-TOF MS approach for a rapid identification of this mycobacterium among other members of M. avium complex. © 2016 The Society for Applied Microbiology.

  18. A new real-time PCR method for rapid and specific detection of ling (Molva molva).

    Science.gov (United States)

    Taboada, Ledicia; Sánchez, Ana; Sotelo, Carmen G

    2017-08-01

    Seafood fraud - often involving substitution of one species by another - has attracted much attention as it is prevalent worldwide. Whilst DNA analysis has helped to combat this type of fraud some of the methods currently in use are time-consuming and require sophisticated equipment or highly-trained personnel. This work describes the development of a new, real-time PCR TaqMan assay for the detection of ling (Molva molva) in seafood products. For this purpose, specific primers and a minor groove binding (MGB) TaqMan probe were designed to amplify the 81bp region on the cyt b gene. Efficiency, specificity and cross-reactivity assays showed statistically significant differences between the average Ct value obtained for Molva molva DNA (19.45±0.65) and the average Ct for non-target species DNA (38.3±2.8), even with closely related species such as Molva dypterygia (34.9±0.09). The proposed methodology has been validated with 31 commercial samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Rapid concentration and sensitive detection of hookworm ova from wastewater matrices using a real-time PCR method.

    Science.gov (United States)

    Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S

    2015-12-01

    The risk of human hookworm infections from land application of wastewater matrices could be high in regions with high hookworm prevalence. A rapid, sensitive and specific hookworm detection method from wastewater matrices is required in order to assess human health risks. Currently available methods used to identify hookworm ova to the species level are time consuming and lack accuracy. In this study, a real-time PCR method was developed for the rapid, sensitive and specific detection of canine hookworm (Ancylostoma caninum) ova from wastewater matrices. A. caninum was chosen because of its morphological similarity to the human hookworm (Ancylostoma duodenale and Necator americanus). The newly developed PCR method has high detection sensitivity with the ability to detect less than one A. caninum ova from 1 L of secondary treated wastewater at the mean threshold cycle (CT) values ranging from 30.1 to 34.3. The method is also able to detect four A. caninum ova from 1 L of raw wastewater and from ∼4 g of treated sludge with mean CT values ranging from 35.6 to 39.8 and 39.8 to 39.9, respectively. The better detection sensitivity obtained for secondary treated wastewater compared to raw wastewater and sludge samples could be attributed to sample turbidity. The proposed method appears to be rapid, sensitive and specific compared to traditional methods and has potential to aid in the public health risk assessment associated with land application of wastewater matrices. Furthermore, the method can be adapted to detect other helminth ova of interest from wastewater matrices. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

  20. A sensitive and a rapid multiplex polymerase chain reaction for the identification of Candida species in concentrated oral rinse specimens in patients with diabetes.

    Science.gov (United States)

    Sampath, Asanga; Weerasekera, Manjula; Gunasekara, Chinthika; Dilhari, Ayomi; Bulugahapitiya, Uditha; Fernando, Neluka

    2017-03-01

    Oral candidiasis is being frequently recognized in patients with diabetes, and is associated with multiple pathogens including Candida albicans, Candida parapsilosis, Candida glabrata and Candida tropicalis. The aim of this study was to evaluate a usefulness of a Multiplex Polymerase Chain Reaction as a rapid diagnostic tool for identification of four oral Candida pathogens in patients with diabetes. A multiplex PCR was optimized to identify four Candida species in concentrated oral rinse samples. Common reverse primer, ITS4 and four species-specific forward primers targeting ITS1 and ITS2 regions of yeast genome were used. Species-specific single amplicon were detected by agarose gel electrophoresis. Performance efficacy of multiplex PCR was compared with phenotypic identification. Out of 100 oral rinse samples, 72 were culture positive and of these 43 were at risk of oral Candida infection (>600cfu/ml). Multiple Candida species including C. albicans, C. parapsilosis and C. tropicalis were identified in 22 samples which had risk of oral Candida infection. In total, 85 patients were positive for Candida by multiplex PCR and of them 49 had multiple Candida species. All 43 colonized specimens were also positive by multiplex PCR. C. albicans was the most predominant organism (75/85) followed by C. parapsilosis (47/85), C. tropicalis (17/85) and C. glabrata (6/85). In specimens with multiple species, the two most common organisms were C. albicans and C. parapsilosis. Multiplex PCR yielded a sensitivity of 10 Candida cells/ml of oral rinse sample. Multiplex PCR is found to be rapid, sensitive and specific than phenotypic identification methods in discriminating multiple Candida species in oral rinse specimens.

  1. An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

    Science.gov (United States)

    Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

    2015-08-01

    Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Identification of suitable grapevine reference genes for qRT-PCR derived from heterologous species.

    Science.gov (United States)

    Tashiro, Rebecca M; Philips, Joshua G; Winefield, Christopher S

    2016-02-01

    Identification and validation of suitable reference genes that exhibit robust transcriptional stability across many sample types is an absolute requirement of all qRT-PCR experiments. Often, however, only small numbers of reference genes, validated across limited sample types, are available for non-model species. This points to a clear need to assess and validate a wider range of potential reference genes than is currently available. We therefore looked to test and validate a large number of potential reference genes across a wide range of tissue types and treatments to determine the applicability of these reference genes for use in grapevine and other non-model plant species. Potential reference genes were selected based on stability of gene transcription in the model plant species Arabidopsis or due to their common use in the grapevine community. The selected reference genes were analyzed across two datasets consisting of a range of either 'Sauvignon blanc' or 'Pinot noir' tissues. A total of 11 potential reference genes were screened across the two datasets. Gene stability was analyzed by GeNorm, a widely used Excel application, or an ANOVA-based method developed in red clover. Both analysis methods showed that all 11 potential reference genes are stably expressed in the datasets tested, but the rankings of gene stability differed based on the datasets and analysis method used. Furthermore, the transcript stability of these genes, initially identified in Arabidopsis and now validated in grapevine, suggests applicability across a wide range of non-model plant species in addition to their utility in grapevine.

  3. Identification of Lactobacilli from deep carious lesions by means of species-specific PCR and MALDI-TOF mass spectrometry.

    Science.gov (United States)

    Callaway, Angelika; Kostrzewa, Markus; Willershausen, Brita; Schmidt, Frank; Thiede, Bernd; Küpper, Harald; Kneist, Susanne

    2013-01-01

    The aim of the present study was to compare MALDI-TOF results for the identification of 87 lactobacilli, isolated from soft or hard carious dentin from 70 first molars of 7- to 8-year-old children with those obtained by species-specific PCR. The 87 isolates were analyzed by MALDI-TOF MS (Microflex LT, MALDI Biotyper 3.0, Bruker Daltonik, Bremen, Germany), using a reference data base of 4110 strains including > 90 lactobacillus species. For the identification with species-specific PCR, oligonucleotide primers (16S rRNA) specific for L. casei, L. paracasei, L. rhamnosus, L. gasseri, L. plantarum, and L. acidophilus were used; type strains served as controls. The PCR-products were separated electrophoretically on a 1.5% agarose gel and identified by their position on the gel. For 93% of the strains both methods produced concordant results: 40 strains were identified as L. rhamnosus, 16 as L. paracasei subsp. paracasei, 15 as L. paracasei subsp. tolerans, 4 as L. paracasei, 3 as L. gasseri, 2 as L. plantarum, and 1 as L. casei. In 4.5% of the cases the results were discordant. Of the 3 strains, not identified by species-specific PCR, 1 strain was identified by MALDI-TOF MS as L. spec. and 1 as L. parabuchneri. One strain could not be identified by either method. Both methods are highly sensitive. Limitations can be the precision of the primers (PCR) or the scarcity of strains from a certain habitat in the data base. Additional information is necessary for the strains without or with discordant identification.

  4. Development and application of a reverse transcriptase droplet digital PCR (RT-ddPCR) for sensitive and rapid detection of Japanese encephalitis virus.

    Science.gov (United States)

    Wu, Xulong; Lin, Hua; Chen, Shijie; Xiao, Lu; Yang, Miao; An, Wei; Wang, Yin; Yao, Xueping; Yang, Zexiao

    2017-10-01

    Japanese encephalitis (JE) is one of the most common zoonoses caused by Japanese encephalitis virus (JEV). Droplet digital PCR (ddPCR) is a novel sensitive, accurate method that enables absolute quantitation without the need for calibration curves. The aim of this study was to develop a RT-ddPCR method to detect JEV, and to compare its sensitivity with real-time TaqMan RT-PCR by analysis of clinical samples. The methods of JEV real-time RT-PCR and RT-ddPCR were established and optimal reaction conditions were confirmed. Each method was evaluated for linearity, limit of detection and specificity. A total of 103 porcine samples were analysed by both methods and the detection rate was calculated. Both methods showed a high degree of linearity and positive correlation for standards (R(2)≥0.999). The assays indicated that the detection limit for RT-ddPCR was approximately 2 copies/20μL well, a 100-fold greater sensitivity than TaqMan real-time RT-PCR. The detection results for clinical samples showed that the positive detection rate of RT-ddPCR (27.2%) was higher than that of TaqMan real-time RT-PCR (16.5%). The cross-reaction was performed with other porcine pathogens, and negative amplification of the cross-reaction assay demonstrated the high specificity of this method. The novel JEV RT-ddPCR assay could be used as an efficient molecular biology tool to diagnose JEV, which would facilitate the surveillance of reproductive failure disease in swineries and would be beneficial for public health security. Copyright © 2017. Published by Elsevier B.V.

  5. Multiplex PCR assay for identification of six different Staphylococcus spp. and simultaneous detection of methicillin and mupirocin resistance.

    Science.gov (United States)

    Campos-Peña, E; Martín-Nuñez, E; Pulido-Reyes, G; Martín-Padrón, J; Caro-Carrillo, E; Donate-Correa, J; Lorenzo-Castrillejo, I; Alcoba-Flórez, J; Machín, F; Méndez-Alvarez, S

    2014-07-01

    We describe a new, efficient, sensitive, and fast single-tube multiple-PCR protocol for the identification of the most clinically significant Staphylococcus spp. and the simultaneous detection of the methicillin and mupirocin resistance loci. The protocol identifies at the species level isolates belonging to S. aureus, S. epidermidis, S. haemolyticus, S. hominis, S. lugdunensis, and S. saprophyticus. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  6. Identification of Eastern United States Reticulitermes Termite Species via PCR-RFLP, Assessed Using Training and Test Data

    OpenAIRE

    Ryan C Garrick; Collins, Benjamin D.; Yi, Rachel N.; Rodney J. Dyer; Chaz Hyseni

    2015-01-01

    Reticulitermes termites play key roles in dead wood decomposition and nutrient cycling in forests. They also damage man-made structures, resulting in considerable economic loss. In the eastern United States, five species (R. flavipes, R. virginicus, R. nelsonae, R. hageni and R. malletei) have overlapping ranges and are difficult to distinguish morphologically. Here we present a molecular tool for species identification. It is based on polymerase chain reaction (PCR) amplification of a sectio...

  7. Rapid diagnosis of avian influenza virus in wild birds: Use of a portable rRT-PCR and freeze-dried reagents in the field

    Science.gov (United States)

    Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.

    2011-01-01

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  8. Rapid diagnosis of avian influenza virus in wild birds: use of a portable rRT-PCR and freeze-dried reagents in the field.

    Science.gov (United States)

    Takekawa, John Y; Hill, Nichola J; Schultz, Annie K; Iverson, Samuel A; Cardona, Carol J; Boyce, Walter M; Dudley, Joseph P

    2011-08-02

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  9. Rapid PCR Detection of Staphylococcus aureus Clonal Complex 398 by Targeting the Restriction-Modification System Carrying sau1-hsdS1

    NARCIS (Netherlands)

    Stegger, M.; Lindsay, J.A.; Moodley, A.; Skov, R.; Broens, E.M.; Guardabassi, L.

    2011-01-01

    A PCR targeting sau1-hsdS1 was developed for rapid detection of Staphylococcus aureus clonal complex 398 (CC398). High sensitivity (100%) and specificity (100%) were shown by evaluating the test on a large strain collection (n = 1,307). We recommend this test for accurate, rapid, and inexpensive

  10. Rapid identification of bio-molecules applied for detection of biosecurity agents using rolling circle amplification.

    Directory of Open Access Journals (Sweden)

    Jenny Göransson

    Full Text Available Detection and identification of pathogens in environmental samples for biosecurity applications are challenging due to the strict requirements on specificity, sensitivity and time. We have developed a concept for quick, specific and sensitive pathogen identification in environmental samples. Target identification is realized by padlock- and proximity probing, and reacted probes are amplified by RCA (rolling-circle amplification. The individual RCA products are labeled by fluorescence and enumerated by an instrument, developed for sensitive and rapid digital analysis. The concept is demonstrated by identification of simili biowarfare agents for bacteria (Escherichia coli and Pantoea agglomerans and spores (Bacillus atrophaeus released in field.

  11. Identification of species belonging to the Bifidobacterium genus by PCR-RFLP analysis of a hsp60 gene fragment

    Science.gov (United States)

    2013-01-01

    Background Bifidobacterium represents one of the largest genus within the Actinobacteria, and includes at present 32 species. These species share a high sequence homology of 16S rDNA and several molecular techniques already applied to discriminate among them give ambiguous results. The slightly higher variability of the hsp60 gene sequences with respect to the 16S rRNA sequences offers better opportunities to design or develop molecular assays, allowing identification and differentiation of closely related species. hsp60 can be considered an excellent additional marker for inferring the taxonomy of the members of Bifidobacterium genus. Results This work illustrates a simple and cheap molecular tool for the identification of Bifidobacterium species. The hsp60 universal primers were used in a simple PCR procedure for the direct amplification of 590 bp of the hsp60 sequence. The in silico restriction analysis of bifidobacterial hsp60 partial sequences allowed the identification of a single endonuclease (HaeIII) able to provide different PCR-restriction fragment length polymorphism (RFLP) patterns in the Bifidobacterium spp. type strains evaluated. The electrophoretic analyses allowed to confirm the different RFLP patterns. Conclusions The developed PCR-RFLP technique resulted in efficient discrimination of the tested species and subspecies and allowed the construction of a dichotomous key in order to differentiate the most widely distributed Bifidobacterium species as well as the subspecies belonging to B. pseudolongum and B. animalis. PMID:23815602

  12. Identification of Atlantic cod (Gadus morhua), ling (Molva molva), and Alaska pollock (Gadus chalcogrammus) by PCR-ELISA using duplex PCR.

    Science.gov (United States)

    Taboada, Ledicia; Sánchez, Ana; Velasco, Amaya; Santaclara, Francisco J; Pérez-Martín, Ricardo I; Sotelo, Carmen G

    2014-06-18

    Species-specific PCR-ELISA assays for the identification of Atlantic cod (Gadus morhua), Alaska pollock (Gadus chalcogrammus), and ling (Molva molva) in food products have been developed. The method, comprising a set of primers common to the first two species, a set of primers for M. molva, and a probe for each species, was designed using ND4 and cytochrome b genes as molecular markers. The sensitivity and selectivity were then determined for each assay. These assays were afterward used to analyze DNA extracted from commercial fish products. The presence of the target species was successfully detected in all analyzed samples, demonstrating the applicability of this method to the analysis of food products.

  13. Degenerate PCR primer design for the specific identification of rhinovirus C.

    Science.gov (United States)

    Nam, Young Ran; Lee, Uk; Choi, Han Seok; Lee, Kyoung Jin; Kim, Nari; Jang, Yong Ju; Joo, Chul Hyun

    2015-03-01

    Human rhinovirus (HRV)-A and -B is a common cause of upper respiratory tract infections. Recently, a third species, HRV-C, was categorized based on molecular typing studies. The results showed that the HRV-C genome had diverged from that of HRV-A and -B. Despite its late identification, increasing evidence suggests that HRV-C causes more severe pathogenic infections than HRV-A or -B; however, a large amount of epidemiological data is required to confirm this association in different clinical settings. Consequently, a simple and rapid method for identifying HRV-C is required to expedite such epidemiological studies. Here, two degenerate primer sets (HEV and HRVC) were designed based on bioinformatic analyses. The HEV set targeting the fifth IRES domain sequence within the 5'-UTR, which is highly conserved among enteroviruses, was designed to detect all enteroviruses, whereas the HRVC set, which targeted the VP2 coding region, was designed to detect HRV-C alone. Both primer sets were tested against a panel of standard enteroviruses and clinical lavage samples. HEV detected all enteroviruses tested whereas HRVC was specific for HRV-C. Although the primer design strategy was confirmed with a limited number of samples, extensive tests are required to be applied in clinical settings. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR.

    Science.gov (United States)

    Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S

    2018-01-01

    The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water

    Science.gov (United States)

    Brinkman, Nichole E.; Haugland, Richard A.; Wymer, Larry J.; Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Vesper, Stephen J.

    2003-01-01

    Quantitative PCR (QPCR) technology, incorporating fluorigenic 5′ nuclease (TaqMan) chemistry, was utilized for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C. lusitaniae) in water. Known numbers of target cells were added to distilled and tap water samples, filtered, and disrupted directly on the membranes for recovery of DNA for QPCR analysis. The assay's sensitivities were between one and three cells per filter. The accuracy of the cell estimates was between 50 and 200% of their true value (95% confidence level). In similar tests with surface water samples, the presence of PCR inhibitory compounds necessitated further purification and/or dilution of the DNA extracts, with resultant reductions in sensitivity but generally not in quantitative accuracy. Analyses of a series of freshwater samples collected from a recreational beach showed positive correlations between the QPCR results and colony counts of the corresponding target species. Positive correlations were also seen between the cell quantities of the target Candida species detected in these analyses and colony counts of Enterococcus organisms. With a combined sample processing and analysis time of less than 4 h, this method shows great promise as a tool for rapidly assessing potential exposures to waterborne pathogenic Candida species from drinking and recreational waters and may have applications in the detection of fecal pollution.

  16. Economic Impact of a New Rapid PCR Assay for Detecting Influenza Virus in an Emergency Department and Hospitalized Patients.

    Science.gov (United States)

    Soto, Marcelo; Sampietro-Colom, Laura; Vilella, Anna; Pantoja, Efraín; Asenjo, María; Arjona, Ruth; Hurtado, Juan Carlos; Trilla, Antoni; Alvarez-Martínez, Míriam José; Mira, Aurea; Vila, Jordi; Marcos, María Angeles

    2016-01-01

    Seasonal influenza causes significant morbidity and mortality and has a substantial economic impact on the healthcare system. The main objective of this study was to compare the cost per patient for a rapid commercial PCR assay (Xpert® Flu) with an in-house real-time PCR test for detecting influenza virus. Community patients with influenza like-illness attending the Emergency Department (ED) as well as hospitalized patients in the Hospital Clínic of Barcelona were included. Costs were evaluated from the perspective of the hospital considering the use of resources directly related to influenza testing and treatment. For the purpose of this study, 366 and 691 patients were tested in 2013 and 2014, respectively. The Xpert® Flu test reduced the mean waiting time for patients in the ED by 9.1 hours and decreased the mean isolation time of hospitalized patients by 23.7 hours. This was associated with a 103€ (or about $113) reduction in the cost per patient tested in the ED and 64€ ($70) per hospitalized patient. Sensitivity analyses showed that Xpert® Flu is likely to be cost-saving in hospitals with different contexts and prices.

  17. Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

    Science.gov (United States)

    Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

    2017-10-17

    Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  18. A rapid Q-PCR titration protocol for adenovirus and helper-dependent adenovirus vectors that produces biologically relevant results

    Science.gov (United States)

    Gallaher, Sean D.; Berk, Arnold J.

    2013-01-01

    Adenoviruses are employed in the study of cellular processes and as expression vectors used in gene therapy. The success and reproducibility of these studies is dependent in part on having accurate and meaningful titers of replication competent and helper-dependent adenovirus stocks, which is problematic due to the use of varied and divergent titration protocols. Physical titration methods, which quantify the total number of viral particles, are used by many, but are poor at estimating activity. Biological titration methods, such as plaque assays, are more biologically relevant, but are time consuming and not applicable to helper-dependent gene therapy vectors. To address this, a protocol was developed called “infectious genome titration” in which viral DNA is isolated from the nuclei of cells ~3 h post-infection, and then quantified by Q-PCR. This approach ensures that only biologically active virions are counted as part of the titer determination. This approach is rapid, robust, sensitive, reproducible, and applicable to all forms of adenovirus. Unlike other Q-PCR-based methods, titers determined by this protocol are well correlated with biological activity. PMID:23624118

  19. Comparison of concentration methods for rapid detection of hookworm ova in wastewater matrices using quantitative PCR.

    Science.gov (United States)

    Gyawali, P; Ahmed, W; Jagals, P; Sidhu, J P S; Toze, S

    2015-12-01

    Hookworm infection contributes around 700 million infections worldwide especially in developing nations due to increased use of wastewater for crop production. The effective recovery of hookworm ova from wastewater matrices is difficult due to their low concentrations and heterogeneous distribution. In this study, we compared the recovery rates of (i) four rapid hookworm ova concentration methods from municipal wastewater, and (ii) two concentration methods from sludge samples. Ancylostoma caninum ova were used as surrogate for human hookworm (Ancylostoma duodenale and Necator americanus). Known concentration of A. caninum hookworm ova were seeded into wastewater (treated and raw) and sludge samples collected from two wastewater treatment plants (WWTPs) in Brisbane and Perth, Australia. The A. caninum ova were concentrated from treated and raw wastewater samples using centrifugation (Method A), hollow fiber ultrafiltration (HFUF) (Method B), filtration (Method C) and flotation (Method D) methods. For sludge samples, flotation (Method E) and direct DNA extraction (Method F) methods were used. Among the four methods tested, filtration (Method C) method was able to recover higher concentrations of A. caninum ova consistently from treated wastewater (39-50%) and raw wastewater (7.1-12%) samples collected from both WWTPs. The remaining methods (Methods A, B and D) yielded variable recovery rate ranging from 0.2 to 40% for treated and raw wastewater samples. The recovery rates for sludge samples were poor (0.02-4.7), although, Method F (direct DNA extraction) provided 1-2 orders of magnitude higher recovery rate than Method E (flotation). Based on our results it can be concluded that the recovery rates of hookworm ova from wastewater matrices, especially sludge samples, can be poor and highly variable. Therefore, choice of concentration method is vital for the sensitive detection of hookworm ova in wastewater matrices. Crown Copyright © 2015. Published by Elsevier

  20. Identification of WA-type three-line hybrid rice with real-time polymerase chain reaction (PCR) method.

    Science.gov (United States)

    Cheng, Y; Gao, B D; Chen, H Y; Mao, J J; Cao, A X; Zhu, J G; Zhu, S F

    2012-02-01

    A real-time fluorescent PCR (RTF-PCR) was developed to detect and quantify wild abortive (WA)-type three-line hybrid rice (Oryza sativa L.). The mitochondrial R₂₋₆₃₀ WA gene was reported to be closely related to male sterility in plants, and developed as a molecular maker to identify the cytoplasmic male sterility system of hybrid rice. First, we got the DNA sequence of R₂₋₆₃₀ WA gene in 17 rice species with traditional PCR. Then, a pair of specific primers (P₃, P₄) and TaqMan fluorescence probe (P₃₋₁₄) were designed based on the R₂₋₆₃₀ DNA sequence. The following RTF-PCR was performed on the 17 rice species finally. The results indicate that the probes used here are specific for three-line hybrid rice F₁ and male sterile lines. We can even identify a single hybrid seed using the probes, which confirmed that the probes can be applied to the identification and quantification of the WA-type three-line hybrid rice. In addition, the RFT-PCR system can be optimized when the annealing temperature is 60 °C and the Mg²⁺ concentration is 3.5 mmol/L.

  1. Rv1458c: a new diagnostic marker for identification of Mycobacterium tuberculosis complex in a novel duplex PCR assay.

    Science.gov (United States)

    Shrivastava, Kamal; Garima, Kushal; Narang, Anshika; Bhattacharyya, Kausik; Vishnoi, Ekta; Singh, Roshan Kumar; Chaudhry, Anil; Prasad, Rajendra; Bose, Mridula; Varma-Basil, Mandira

    2017-03-01

    We explored the efficiency of Rv1458c, the gene encoding a putative ABC drug transporter specific for the Mycobacterium tuberculosis complex (MTBC), as a diagnostic marker. A 190 bp region of Rv1458c and a 300 bp region of hsp65 were targeted in a novel duplex PCR assay and the results were compared with those for PCR restriction analysis(PRA) using the restriction enzymes NruI and BamHI. Species identification of a subset of the isolates (n=50) was confirmed by sequencing. Clinical isolates of M. tuberculosis (n=426) obtained from clinically suspected patients of pulmonary tuberculosis and mycobacterial (n=13) and non-mycobacterial (n=8) reference strains were included in the study. The duplex PCR assay correctly identified 320/426 isolates as MTBC and 106/426 isolates as non-tuberculous mycobacteria(NTM). The test was 100 % specific and sensitive when compared with NruI/BamHI PCR restriction analysis and highlighted the use of Rv1458c as a diagnostic marker for MTBC. The duplex PCR assay could be developed for use as a screening test to identify MTBC in clinical specimens in peripheral laboratories with limited resources.

  2. Real-time PCR-based method for the rapid detection of extended RAS mutations using bridged nucleic acids in colorectal cancer.

    Science.gov (United States)

    Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu

    2017-10-27

    Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Human Fecal Source Identification: Real-Time Quantitative PCR Method Standardization

    Science.gov (United States)

    Method standardization or the formal development of a protocol that establishes uniform performance benchmarks and practices is necessary for widespread adoption of a fecal source identification approach. Standardization of a human-associated fecal identification method has been...

  4. HUMAN FECAL SOURCE IDENTIFICATION: REAL-TIME QUANTITATIVE PCR METHOD STANDARDIZATION - abstract

    Science.gov (United States)

    Method standardization or the formal development of a protocol that establishes uniform performance benchmarks and practices is necessary for widespread adoption of a fecal source identification approach. Standardization of a human-associated fecal identification method has been...

  5. Identification of Staphylococcus spp. by PCR-Restriction Fragment Length Polymorphism of gap Gene

    OpenAIRE

    Yugueros, Javier; Temprano, Alejandro; Sánchez, María; Luengo, José María; Naharro, Germán

    2001-01-01

    Oligonucleotide primers specific for the Staphylococcus aureus gap gene were previously designed to identify 12 Staphylococcus spp. by PCR. In the present study, AluI digestion of PCR-generated products rendered distinctive restriction fragment length polymorphism patterns that allowed 24 Staphylococcus spp. to be identified with high specificity.

  6. Identification of Staphylococcus spp. by PCR-Restriction Fragment Length Polymorphism of gap Gene

    Science.gov (United States)

    Yugueros, Javier; Temprano, Alejandro; Sánchez, María; Luengo, José María; Naharro, Germán

    2001-01-01

    Oligonucleotide primers specific for the Staphylococcus aureus gap gene were previously designed to identify 12 Staphylococcus spp. by PCR. In the present study, AluI digestion of PCR-generated products rendered distinctive restriction fragment length polymorphism patterns that allowed 24 Staphylococcus spp. to be identified with high specificity. PMID:11574593

  7. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Hung, Tran Quang; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order to increase the yield of the solid-phase amplification, we studied various parameters including the length, the density, as well as the annealing position of the solid support primer. A dramatic increase in the signal-to-noise (S/N) ratio was observed when increasing the length of solid support primers from 45 to 80 bp. The density of the primer on the surface was found to be important for the S/N ratio of the SP-PCR, and the optimal S/N was obtained with a density of 1.49 × 1011 molecules/mm2. In addition, the use of solid support primers with a short overhang at the 5' end would help improve the S/N ratio of the SP-PCR. With optimized conditions, SP-PCR can achieve amplification efficiency comparable to conventional PCR, with a limit of detection of 1.5 copies/μl (37.5 copies/reaction). These improvements will pave the way for wider applications of SP-PCR in various fields such as clinical diagnosis, high-throughput DNA sequencing, and single-nucleotide polymorphism analysis. Graphical abstract Schematic representation of solid-phase PCR.

  8. Rapid Sanger sequencing of the 16S rRNA gene for identification of some common pathogens.

    Directory of Open Access Journals (Sweden)

    Linxiang Chen

    Full Text Available Conventional Sanger sequencing remains time-consuming and laborious. In this study, we developed a rapid improved sequencing protocol of 16S rRNA for pathogens identification by using a new combination of SYBR Green I real-time PCR and Sanger sequencing with FTA® cards. To compare the sequencing quality of this method with conventional Sanger sequencing, 12 strains, including three kinds of strains (1 reference strain and 3 clinical strains, which were previously identified by biochemical tests, which have 4 Pseudomonas aeruginosa, 4 Staphyloccocus aureus and 4 Escherichia coli, were targeted. Additionally, to validate the sequencing results and bacteria identification, expanded specimens with 90 clinical strains, also comprised of the three kinds of strains which included 30 samples respectively, were performed as just described. The results showed that although statistical differences (P<0.05 were found in sequencing quality between the two methods, their identification results were all correct and consistent. The workload, the time consumption and the cost per batch were respectively light versus heavy, 8 h versus 11 h and $420 versus $400. In the 90 clinical strains, all of the Pseudomonas aeruginosa and Staphyloccocus aureus strains were correctly identified, but only 26.7% of the Escherichia coli strains were recognized as Escherichia coli, while 33.3% as Shigella sonnei and 40% as Shigella dysenteriae. The protocol described here is a rapid, reliable, stable and convenient method for 16S rRNA sequencing, and can be used for Pseudomonas aeruginosa and Staphyloccocus aureus identification, yet it is not completely suitable for discriminating Escherichia coli and Shigella strains.

  9. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  10. Rapid detection and identification of Brachyspira aalborgi from rectal biopsies and faeces of a patient.

    Science.gov (United States)

    Calderaro, Adriana; Villanacci, Vincenzo; Conter, Mauro; Ragni, Patrizia; Piccolo, Giovanna; Zuelli, Claudia; Bommezzadri, Simona; Guégan, Rozenn; Zambelli, Claudia; Perandin, Francesca; Arcangeletti, Maria Cristina; Medici, Maria Cristina; Manca, Nino; Dettori, Giuseppe; Chezzi, Carlo

    2003-03-01

    This study reports for the first time the detection of Brachyspira aalborgi in faeces and rectal biopsies of a female suffering for 3-4 months of abdominal pain with long-standing mucosal diarrhoea, rectal bleeding and suspected carcinoma of the rectum. After pre-treatment of samples (faeces and biopsies) with a liquid medium (trypticase soy broth-TSB) containing foetal calf serum (FCS, 10%) and spectinomycin and rifampicin (TSB-SR) the first detection of B. aalborgi isolate HBS1 was observed after 48 h in the primary plates of selective blood agar modified medium (BAM) containing spectinomycin and rifampicin (BAM-SR), where growth zones were signalled by a small weakly beta-haemolytic halo. Attempts to subculture spirochaetes in agar media failed. The new HBS1 isolate was only propagated in TSB broth and at electron microscopy it showed 4 endoflagella inserted at each tapered end. The phenotypic characterization of HBS1 demonstrated absence of hippurate hydrolysis, indole production, alpha-galactosidase, alpha- and beta-glucosidase activities in accordance with the B. aalborgi type strain. Rapid identification of B. aalborgi isolate HBS1 was performed directly from faeces and rectal biopsies and subsequently from pure cultures by a genetic method based on 16S DNA restriction fragment length polymorphism (RFLP)-polymerase chain reaction (PCR). The sequence of 16S DNA amplicon of the isolate HBS1 was found 99.2% corresponding to that of the B. aalborgi type strain. Our results encourage further investigations for the development of a suitable selective agar medium for the isolating and cultivating B. aalborgi from human specimens.

  11. Rapid sex identification method of spinach (Spinacia oleracea L.) in the vegetative stage using loop-mediated isothermal amplification.

    Science.gov (United States)

    Fujita, Naoko; Ayukawa, Yu; Fuke, Mitsutoshi; Teraoka, Tohru; Watanabe, Kyoko; Arie, Tsutomu; Komatsu, Ken

    2017-01-01

    A LAMP-mediated, simple and rapid method for sex identification in spinach was developed. Nutrient compositional analysis showed a higher iron content in male than female plants. Spinach (Spinacia oleracea L.) is a dioecious plant with its sex determined by the XY system. Male and female floral organs differ morphologically, but plants do not differ in the vegetative stage before flowering. PCR with Y chromosome markers has been used to determine the sex of dioecious plants before flowering. In this study, we developed a genotype-specific loop-mediated isothermal amplification (LAMP) for sex identification of individual vegetative-stage spinach plants, using primers designed for the genomic region flanked by male-specific markers. LAMP could specifically detect spinach males. The method was further modified to omit DNA purification and use just an aliquot of crude leaf extract homogenized in water. We compared the nutrient composition of males and females, finding higher amounts of iron in the males. Our method could therefore be used for rapidly discriminating male plants in the field, which is useful for efficient hybrid breeding.

  12. Rapid identification of Mycobacterium species by lectin agglutination.

    Science.gov (United States)

    Athamna, Abed; Cohen, Dani; Athamna, Muhammad; Ofek, Itzhak; Stavri, Henriette

    2006-05-01

    The purpose of the present study is to explore the possibility that plant lectins can be used for the development of rapid and inexpensive technique for differentiation of mycobacterial species. The method is based on interaction between mycobacteria and lectins as visualized by agglutination in a microtiter plate. We employed 18 mycobacterium species and determined the minimal lectin concentration (MLC) of 23 different lectins. For some of the bacteria as a high as 1000 microg/ml of one or more lectins were required to induce agglutination, while for other strains as low as 1.95 microg/ml of the lectin were needed. A unique pattern of agglutination was observed for each species over a range of 62-1000 microg/ml lectin concentrations. There were little or no variations in MLC within strains (intraspecies) of each of two species tested. In contrast, there were marked interspecies variations in MLC. Analysis of the MLC showed that the highest score of interspecies differences with 23 lectins was obtained at 125 microg/ml lectin concentration. At this concentration it was found that the pattern of agglutinations with only two lectins was sufficient to differentiate mycobacterium species from each other. Because the bacteria-lectin interaction is adaptable to various methods of visualization, our findings may set the stage for developing a rapid and reliable tool to differentiate mycobacterium species.

  13. Small acid soluble proteins for rapid spore identification.

    Energy Technology Data Exchange (ETDEWEB)

    Branda, Steven S.; Lane, Todd W.; VanderNoot, Victoria A.; Jokerst, Amanda S.

    2006-12-01

    This one year LDRD addressed the problem of rapid characterization of bacterial spores such as those from the genus Bacillus, the group that contains pathogenic spores such as B. anthracis. In this effort we addressed the feasibility of using a proteomics based approach to spore characterization using a subset of conserved spore proteins known as the small acid soluble proteins or SASPs. We proposed developing techniques that built on our previous expertise in microseparations to rapidly characterize or identify spores. An alternative SASP extraction method was developed that was amenable to both the subsequent fluorescent labeling required for laser-induced fluorescence detection and the low ionic strength requirements for isoelectric focusing. For the microseparations, both capillary isoelectric focusing and chip gel electrophoresis were employed. A variety of methods were evaluated to improve the molecular weight resolution for the SASPs, which are in a molecular weight range that is not well resolved by the current methods. Isoelectric focusing was optimized and employed to resolve the SASPs using UV absorbance detection. Proteomic signatures of native wild type Bacillus spores and clones genetically engineered to produce altered SASP patterns were assessed by slab gel electrophoresis, capillary isoelectric focusing with absorbance detection as well as microchip based gel electrophoresis employing sensitive laser-induced fluorescence detection.

  14. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

    2014-01-01

    The use of broad range PCR and DNA sequencing of bacterial 16S ribosomal RNA genes for routine diagnostics of bacterial infections was evaluated. Here, the results from more than 2600 analyses during a 6-year period (2003-2009) are presented. Almost half of the samples were from joints and bones......-haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  15. The use of fluorescent fragment length analysis (PCR-FFL) in the direct diagnosis and identification of cutaneous Leishmania species.

    Science.gov (United States)

    Tomás-Pérez, Míriam; Fisa, Roser; Riera, Cristina

    2013-03-01

    Leishmaniasis is a disease caused by different species belonging to the genus Leishmania. It presents different epidemiological and clinical features and requires the development of rapid, sensitive techniques to improve specific diagnosis. In this study, we compared the traditional technique of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) with PCR-fluorescent fragment length analysis (PCR-FFL). Fluorescently tagged primers, designed in the rRNA fragment ITS-1 and 7SL region, were used to amplify fragments, which were later digested and whose sizes were accurately determined using an automated DNA sequencer. We validated the technique using 19 Leishmania strains from five cutaneous Leishmania species before testing 36 clinical samples: 23 skin biopsies and 13 skin scrapings/lesion exudates on filter paper. In real diagnostic, PCR-FFL has proved to be quick, accurate, and more sensitive (83.3% testing the ITS-1 fragment and 94.4% testing the 7SL) than PCR-RFLP analysis (75% and 80.6%). Filter papers improved the specific diagnosis in both techniques using non-invasive samples.

  16. [Rapid identification of Coix seed varieties by near infrared spectroscopy].

    Science.gov (United States)

    Liu, Xing; Mao, Dan-Zhuo; Wang, Zheng-Wu; Yang, Yong-Jian

    2014-05-01

    Unsupervised learning algorithm-principal component analysis (PCA), and supervised learning algorithm-learning vector quantization (LVQ) neural network and support vector machine (SVM) were used to carry out qualitative discriminant analysis of different varieties of coix seed from different regions. Since nutrient compositions of different varieties coix seed samples from different origins were complex and the contents were similar, characteristic variables of two kinds of coix seed were alike, the scores plot of their principal components seriously overlapped and the categories of coix seed were difficult to distinguish While satisfactory results were obtained by LVQ neural network and SVM. The accuracy of LVQ neural network prediction is 90. 91%, while the classification accuracy of SVM, whose penalty parameter and kernel function parameter were optimized, can be up to 100%. The results show that NIRS combined with chemometrics can be used as a rapid, nondestructive and reliable method to identify coix seed varieties and provide technical reference for market regulation.

  17. Restriction fragment length polymorphism of the 5S-rRNA-NTS region: a rapid and precise method for plant identification.

    Science.gov (United States)

    Bertea, Cinzia Margherita; Gnavi, Giorgio

    2012-01-01

    Molecular genetic methods have several advantages over classical morphological and chemical analyses. The genetic method requires genotype instead than phenotype, therefore PCR-based techniques have been widely used for a rapid identification of plant species, varieties and chemotypes. Recently, the molecular discrimination of some higher plant species has been evaluated using sequences of a 5S-rRNA gene spacer region. The variation in the nontranscribed sequence (NTS) region has been used in a number of plant species for studying intraspecific variation, genome evolution, and phylogenetic reconstruction. Here, we describe a rapid method based on the use of the 5S-rRNA-NTS region as a tool for plant DNA fingerprinting, which combines PCR, sequencing and restriction fragment length polymorphism analyses.

  18. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients

    Directory of Open Access Journals (Sweden)

    Ngo Tat Trung

    2018-02-01

    Conclusion: The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients.

  19. Development of a multiplex PCR assay for identification of Campylobacter coli, Campylobacter fetus, Campylobacter hyointestinalis subsp. hyointestinalis, Campylobacter jejuni, Campylobacter lari and Campylobacter upsaliensis

    National Research Council Canada - National Science Library

    Yamazaki-Matsune, Wataru; Taguchi, Masumi; Seto, Kazuko; Kawahara, Ryuji; Kawatsu, Kentaro; Kumeda, Yuko; Kitazato, Miyoshi; Nukina, Masafumi; Misawa, Naoaki; Tsukamoto, Teizo

    2007-01-01

    ...{at}iph.pref.osaka.jp Received 26 April 2007 Accepted 9 July 2007 A multiplex PCR assay has been developed for the identification of the six common Campylobacter taxa associated with human gastroenteritis...

  20. Rapidly Learned Identification of Epileptic Seizures from Sonified EEG

    Directory of Open Access Journals (Sweden)

    Psyche eLoui

    2014-10-01

    Full Text Available Sonification refers to a process by which data are converted into sound, providing an auditory alternative to visual display. Currently, the prevalent method for diagnosing seizures in epilepsy is by visually reading a patient’s electroencephalogram (EEG. However, sonification of the EEG data provides certain advantages due to the nature of human auditory perception. We hypothesized that human listeners will be able to identify seizures from EEGs using the auditory modality alone, and that accuracy of seizure identification will increase after a short training session. Here we describe an algorithm we have used to sonify EEGs of both seizure and non-seizure activity, followed by a training study in which subjects listened to short clips of sonified EEGs and determine whether each clip was of seizure or normal activity, both before and after a short training session. Results show that before training subjects performed at chance level in differentiating seizures vs. non-seizures, but there was a significant improvement of accuracy after the training session. After training, subjects successfully distinguished seizures from non-seizures using the auditory modality alone. Further analyses using signal detection theory demonstrated improvement in sensitivity and reduction in response bias as a result of training. This study demonstrates the potential of sonified EEGs to be used for the detection of seizures. Future studies will attempt to increase accuracy using novel training and sonification modifications, with the goals of managing, predicting, and ultimately controlling seizures using sonification as a possible biofeedback-based intervention for epilepsy.

  1. Rapidly learned identification of epileptic seizures from sonified EEG.

    Science.gov (United States)

    Loui, Psyche; Koplin-Green, Matan; Frick, Mark; Massone, Michael

    2014-01-01

    Sonification refers to a process by which data are converted into sound, providing an auditory alternative to visual display. Currently, the prevalent method for diagnosing seizures in epilepsy is by visually reading a patient's electroencephalogram (EEG). However, sonification of the EEG data provides certain advantages due to the nature of human auditory perception. We hypothesized that human listeners will be able to identify seizures from EEGs using the auditory modality alone, and that accuracy of seizure identification will increase after a short training session. Here, we describe an algorithm that we have used to sonify EEGs of both seizure and non-seizure activity, followed by a training study in which subjects listened to short clips of sonified EEGs and determined whether each clip was of seizure or normal activity, both before and after a short training session. Results show that before training subjects performed at chance level in differentiating seizures from non-seizures, but there was a significant improvement of accuracy after the training session. After training, subjects successfully distinguished seizures from non-seizures using the auditory modality alone. Further analyses using signal detection theory demonstrated improvement in sensitivity and reduction in response bias as a result of training. This study demonstrates the potential of sonified EEGs to be used for the detection of seizures. Future studies will attempt to increase accuracy using novel training and sonification modifications, with the goals of managing, predicting, and ultimately controlling seizures using sonification as a possible biofeedback-based intervention for epilepsy.