Rapid qualitative urinary tract infection pathogen identification by SeptiFast real-time PCR.

Directory of Open Access Journals (Sweden)

Lutz E Lehmann

2011-02-01

Full Text Available Urinary tract infections (UTI are frequent in outpatients. Fast pathogen identification is mandatory for shortening the time of discomfort and preventing serious complications. Urine culture needs up to 48 hours until pathogen identification. Consequently, the initial antibiotic regimen is empirical.To evaluate the feasibility of qualitative urine pathogen identification by a commercially available real-time PCR blood pathogen test (SeptiFast® and to compare the results with dipslide and microbiological culture.Pilot study with prospectively collected urine samples.University hospital.82 prospectively collected urine samples from 81 patients with suspected UTI were included. Dipslide urine culture was followed by microbiological pathogen identification in dipslide positive samples. In parallel, qualitative DNA based pathogen identification (SeptiFast® was performed in all samples.61 samples were SeptiFast® positive, whereas 67 samples were dipslide culture positive. The inter-methodological concordance of positive and negative findings in the gram+, gram- and fungi sector was 371/410 (90%, 477/492 (97% and 238/246 (97%, respectively. Sensitivity and specificity of the SeptiFast® test for the detection of an infection was 0.82 and 0.60, respectively. SeptiFast® pathogen identifications were available at least 43 hours prior to culture results.The SeptiFast® platform identified bacterial DNA in urine specimens considerably faster compared to conventional culture. For UTI diagnosis sensitivity and specificity is limited by its present qualitative setup which does not allow pathogen quantification. Future quantitative assays may hold promise for PCR based UTI pathogen identification as a supplementation of conventional culture methods.

Multiplex real-time PCR for identification of canine parvovirus antigenic types.

Science.gov (United States)

Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Narang, Deepti

2016-07-01

Canine parvovirus (CPV) is an important disease causing gastroenteritis and/or haemorrhagic gastroenteritis in dogs. There are four antigenic types of CPV reported worldwide viz. CPV 2, CPV 2a, CPV 2b and CPV 2c. The diagnosis of CPV with the identification of the antigen type responsible remains problematic. In the present study, identification as well as antigenic typing of CPV was done using a de novo multiplex real time PCR to combat the problem of antigenic type identification. From the study it could be concluded that the here developed multiplex real time PCR assay could be used for rapid detection of CPV as well as typing of its three antigenic types. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of five sea cucumber species through PCR-RFLP analysis

Science.gov (United States)

Lv, Yingchun; Zheng, Rong; Zuo, Tao; Wang, Yuming; Li, Zhaojie; Xue, Yong; Xue, Changhu; Tang, Qingjuan

2014-10-01

Sea cucumbers are traditional marine food and Chinese medicine in Asia. The rapid expansion of sea cucumber market has resulted in various problems, such as commercial fraud and mislabeling. Conventionally, sea cucumber species could be distinguished by their morphological and anatomical characteristics; however, their identification becomes difficult when they are processed. The aim of this study was to develop a new convenient method of identifying and distinguishing sea cucumber species. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of mitochondrial cytochrome oxidase I gene ( COI) was used to identifing five sea cucumber species ( Apostichopus japonicus, Cucumaria frondosa, Thelenota ananas, Parastichopus californicus and Actinopyga lecanora). A 692 bp fragment of COI was searched for BamHI, KpnI, PstI, XbaI and Eco31I restriction sites with DNAMAN 6.0, which were then used to PCR-RFLP analysis. These five sea cucumber species can be discriminated from mixed sea cucumbers. The developed PCR-RFLP assay will facilitate the identification of sea cucumbers, making their source tracing and quality controlling feasible.

Identification of genus Acinetobacter: Standardization of in-house PCR and its comparison with conventional phenotypic methods.

Science.gov (United States)

Kulkarni, Sughosh S; Madalgi, Radhika; Ajantha, Ganavalli S; Kulkarni, Raghavendra D

2017-01-01

Acinetobacter is grouped under nonfermenting Gram-negative bacilli. It is increasingly isolated from pathological samples. The ability of this genus to acquire drug resistance and spread in the hospital settings is posing a grave problem in healthcare. Specific treatment protocols are advocated for Acinetobacter infections. Hence, rapid identification and drug susceptibility profiling are critical in the management of these infections. To standardize an in-house polymerase chain reaction (PCR) for identification of genus Acinetobacter and to compare PCR with two protocols for its phenotypic identification. A total of 96 clinical isolates of Acinetobacter were included in the study. An in-house PCR for genus level identification of Acinetobacter was standardized. All the isolates were phenotypically identified by two protocols. The results of PCR and phenotypic identification protocols were compared. The in-house PCR standardized was highly sensitive and specific for the genus Acinetobacter . There was 100% agreement between the phenotypic and molecular identification of the genus. The preliminary identification tests routinely used in clinical laboratories were also in complete agreement with phenotypic and molecular identification. The in-house PCR for genus level identification is specific and sensitive. However, it may not be essential for routine identification as the preliminary phenotypic identification tests used in the clinical laboratory reliably identify the genus Acinetobacter .

Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

Science.gov (United States)

Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

2018-05-01

Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

Science.gov (United States)

Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

2018-01-01

ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates

DEFF Research Database (Denmark)

Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.

1999-01-01

The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories......, which did not result in any DNA band. A total of 32 out of the 36 rough presumptive isolates were positive in the PCR. All but one isolate were also identified as Salmonella by the two biochemical methods. All 80 Salmonella strains were also tested in the two multiplex serogroup tests based on PCR beads....... The sensitivity of the BAX Salmonella PCR test was assessed by testing a total of 80 Salmonella isolates, covering most serogroups, which correctly identified all the Salmonella strains by resulting in one 800-bp band in the sample tubes. The specificity of the PCR was assessed using 20 non-Salmonella strains...

Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR.

Science.gov (United States)

Fajfr, M; Neubauerová, V; Pajer, P; Kubíčková, P; Růžek, D

2014-09-01

Viral hemorrhagic fevers are caused by viruses from four viral families and develop diseases with high fatality rates. However, no commercial diagnostic assay for these pathogens is available. We developed real-time RT-PCR assays for viruses Ebola, Marburg, Lassa, Guanarito, Machupo, Junin, Sabiá, Seoul, Puumala, Hantaan, Crimean-Congo hemorrhagic fever virus and Rift Valley fever virus. The assays were optimized for identical reaction conditions and can be performed using several types of real-time PCR instruments, both capillary and plate, including a portable Ruggedized Advanced Pathogen Identification Device (R.A.P.I.D.) (Idaho Technology, Inc.). In combination with primers and probes from previously published studies, we present a simple system for rapid identification of hemorrhagic filoviruses, arenaviruses and bunyaviruses with sufficient sensitivity for first contact laboratory and diagnosis under field conditions.

Rapid identification of Enterobacter hormaechei and Enterobacter cloacae genetic cluster III.

Science.gov (United States)

Ohad, S; Block, C; Kravitz, V; Farber, A; Pilo, S; Breuer, R; Rorman, E

2014-05-01

Enterobacter cloacae complex bacteria are of both clinical and environmental importance. Phenotypic methods are unable to distinguish between some of the species in this complex, which often renders their identification incomplete. The goal of this study was to develop molecular assays to identify Enterobacter hormaechei and Ent. cloacae genetic cluster III which are relatively frequently encountered in clinical material. The molecular assays developed in this study are qPCR technology based and served to identify both Ent. hormaechei and Ent. cloacae genetic cluster III. qPCR results were compared to hsp60 sequence analysis. Most clinical isolates were assigned to Ent. hormaechei subsp. steigerwaltii and Ent. cloacae genetic cluster III. The latter was proportionately more frequently isolated from bloodstream infections than from other material (P < 0·05). The qPCR assays detecting Ent. hormaechei and Ent. cloacae genetic cluster III demonstrated high sensitivity and specificity. The presented qPCR assays allow accurate and rapid identification of clinical isolates of the Ent. cloacae complex. The improved identifications obtained can specifically assist analysis of Ent. hormaechei and Ent. cloacae genetic cluster III in nosocomial outbreaks and can promote rapid environmental monitoring. An association was observed between Ent. cloacae cluster III and systemic infection that deserves further attention. © 2014 The Society for Applied Microbiology.

Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

Directory of Open Access Journals (Sweden)

Kirill V Sergueev

Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

International Nuclear Information System (INIS)

Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

2005-01-01

Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

Evaluation of a PCR assay for identification and differentiation of Campylobacter fetus subspecies

DEFF Research Database (Denmark)

Hum, S.; Quinn, K.; Brunner, J.

1997-01-01

methods were attributed to methodological differences used in various laboratories. Conclusion Our results indicate that misidentification of C fetus in routine diagnostic laboratories may be relatively common. The PCR assay evaluated gave rapid and reproducible results and is thus a valuable adjunctive......Objective To evaluate a polymerase chain reaction assay for identification of Campylobacter fetus and differentiation of the defined subspecies. Design Characterisation of bacterial strains by traditional phenotyping, polymerase chain reaction, a probabilistic identification scheme...... by traditional phenotypic methods and the PCR assay was found to be 80.8%. The polymerase chain reaction proved to be a reliable technique for the species and subspecies identification of C fetus; equivocal results were obtained in only two instances. Initial misidentifications by conventional phenotyping...

Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

Science.gov (United States)

Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

2000-06-15

Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

Rapid molecular identification and characteristics of Lactobacillus strains.

Science.gov (United States)

Markiewicz, L H; Biedrzycka, E; Wasilewska, E; Bielecka, M

2010-09-01

Eleven type strains and 24 Lactobacillus isolates, preliminarily classified to the species due to phenotypic features, were investigated. Standard methods of identification with species-specific PCRs and typing with PFGE (with ApaI, NotI and SmaI restriction enzymes) allowed us to distinguish 16 unique strains belonging to 5 species (L. acidophilus, L. delbrueckii ssp. bulgaricus, L. plantarum, L. rhamnosus, L. salivarius). Alternative approach with 16S-23S rDNA ARDRA identification (with merely two restrictases, BsuRI and TaqI) and PCR-based typing (RAPD with two random- and rep-PCR with (GTG)(5) primers) showed to be more discriminative, i.e. 21 unique strains were classified in the same species as above. As a result, 7 out of 24 phenotypically species-assigned isolates were reclassified. The alternative procedure of rapid identification and typing of Lactobacillus isolates appeared to be equally effective and shortened from 1 week to 2-3 d (in comparison to the standard methods).

PCR methodology as a valuable tool for identification of endodontic pathogens.

Science.gov (United States)

Siqueira, José F; Rôças, Isabela N

2003-07-01

This paper reviews the principles of polymerase chain reaction (PCR) methodology, its application in identification of endodontic pathogens and the perspectives regarding the knowledge to be reached with the use of this highly sensitive, specific and accurate methodology as a microbial identification test. Studies published in the medical, dental and biological literature. Evaluation of published epidemiological studies examining the endodontic microbiota through PCR methodology. PCR technology has enabled the detection of bacterial species that are difficult or even impossible to culture as well as cultivable bacterial strains showing a phenotypically divergent or convergent behaviour. Moreover, PCR is more rapid, much more sensitive, and more accurate when compared with culture. Its use in endodontics to investigate the microbiota associated with infected root canals has expanded the knowledge on the bacteria involved in the pathogenesis of periradicular diseases. For instance, Tannerella forsythensis (formerly Bacteroides forsythus), Treponema denticola, other Treponema species, Dialister pneumosintes, and Prevotella tannerae were detected in infected root canals for the first time and in high prevalence when using PCR analysis. The diversity of endodontic microbiota has been demonstrated by studies using PCR amplification, cloning and sequencing of the PCR products. Moreover, other fastidious bacterial species, such as Porphyromonas endodontalis, Porphyromonas gingivalis and some Eubacterium spp., have been reported in endodontic infections at a higher prevalence than those reported by culture procedures.

Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars

Directory of Open Access Journals (Sweden)

Ramadass P

2002-01-01

Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.

New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

Science.gov (United States)

Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

2015-01-01

We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

New multiplex PCR methods for rapid screening of genetically modified organisms in foods

Directory of Open Access Journals (Sweden)

Nelly eDatukishvili

2015-07-01

Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Feroze Ahmed Ganaie

2015-01-01

Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

Rapid identification of dairy lactic acid bacteria by M13-generated, RAPD-PCR fingerprint databases.

Science.gov (United States)

Rossetti, Lia; Giraffa, Giorgio

2005-11-01

About a thousand lactic acid bacteria (LAB) isolated from dairy products, especially cheeses, were identified and typed by species-specific PCR and RAPD-PCR, respectively. RAPD-PCR profiles, which were obtained by using the M13 sequence as a primer, allowed us to implement a large database of different fingerprints, which were analysed by BioNumerics software. Cluster analysis of the combined RAPD-PCR fingerprinting profiles enabled us to implement a library, which is a collection of library units, which in turn is a selection of representative database entries. A library unit, in this case, can be considered to be a definable taxon. The strains belonged to 11 main RAPD-PCR fingerprinting library units identified as Lactobacillus casei/paracasei, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus brevis, Enterococcus faecium, Enterococcus faecalis, Streptococcus thermophilus and Lactococcus lactis. The possibility to routinely identify newly typed, bacterial isolates by consulting the library of the software was valued. The proposed method could be suggested to refine previous strain identifications, eliminate redundancy and dispose of a technologically useful LAB strain collection. The same approach could also be applied to identify LAB strains isolated from other food ecosystems.

Identification of Clinical Staphylococcal Isolates from Humans by Internal Transcribed Spacer PCR

Science.gov (United States)

Couto, Isabel; Pereira, Sandro; Miragaia, Maria; Sanches, Ilda Santos; de Lencastre, Hermínia

2001-01-01

The emergence of coagulase-negative staphylococci not only as human pathogens but also as reservoirs of antibiotic resistance determinants requires the deployment and development of methods for their rapid and reliable identification. Internal transcribed spacer-PCR (ITS-PCR) was used to identify a collection of 617 clinical staphylococcal isolates. The amplicons were resolved in high-resolution agarose gels and visually compared with the patterns obtained for the control strains of 29 staphylococcal species. Of the 617 isolates studied, 592 (95.95%) were identified by ITS-PCR and included 11 species: 302 isolates of Staphylococcus epidermidis, 157 of S. haemolyticus, 79 of S. aureus, 21 of S. hominis, 14 of S. saprophyticus, 8 of S. warneri, 6 of S. simulans, 2 of S. lugdunensis, and 1 each of S. caprae, S. carnosus, and S. cohnii. All species analyzed had unique ITS-PCR patterns, although some were very similar, namely, the group S. saprophyticus, S. cohnii, S. gallinarum, S. xylosus, S. lentus, S. equorum, and S. chromogenes, the pair S. schleiferi and S. vitulus, and the pair S. piscifermentans and S. carnosus. Four species, S. aureus, S. caprae, S. haemolyticus, and S. lugdunensis, showed polymorphisms on their ITS-PCR patterns. ITS-PCR proved to be a valuable alternative for the identification of staphylococci, offering, within the same response time and at lower cost, higher reliability than the currently available commercial systems. PMID:11526135

Identification of clinical staphylococcal isolates from humans by internal transcribed spacer PCR.

Science.gov (United States)

Couto, I; Pereira, S; Miragaia, M; Sanches, I S; de Lencastre, H

2001-09-01

The emergence of coagulase-negative staphylococci not only as human pathogens but also as reservoirs of antibiotic resistance determinants requires the deployment and development of methods for their rapid and reliable identification. Internal transcribed spacer-PCR (ITS-PCR) was used to identify a collection of 617 clinical staphylococcal isolates. The amplicons were resolved in high-resolution agarose gels and visually compared with the patterns obtained for the control strains of 29 staphylococcal species. Of the 617 isolates studied, 592 (95.95%) were identified by ITS-PCR and included 11 species: 302 isolates of Staphylococcus epidermidis, 157 of S. haemolyticus, 79 of S. aureus, 21 of S. hominis, 14 of S. saprophyticus, 8 of S. warneri, 6 of S. simulans, 2 of S. lugdunensis, and 1 each of S. caprae, S. carnosus, and S. cohnii. All species analyzed had unique ITS-PCR patterns, although some were very similar, namely, the group S. saprophyticus, S. cohnii, S. gallinarum, S. xylosus, S. lentus, S. equorum, and S. chromogenes, the pair S. schleiferi and S. vitulus, and the pair S. piscifermentans and S. carnosus. Four species, S. aureus, S. caprae, S. haemolyticus, and S. lugdunensis, showed polymorphisms on their ITS-PCR patterns. ITS-PCR proved to be a valuable alternative for the identification of staphylococci, offering, within the same response time and at lower cost, higher reliability than the currently available commercial systems.

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

Science.gov (United States)

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

A new methodology for rapid detection of Lactobacillus delbrueckii subsp. bulgaricus based on multiplex PCR.

Science.gov (United States)

Nikolaou, Anastasios; Saxami, Georgia; Kourkoutas, Yiannis; Galanis, Alex

2011-02-01

In this study we present a novel multiplex PCR assay for rapid and efficient detection of Lactobacillus delbrueckii subsp. bulgaricus. The accuracy of our method was confirmed by the successful identification of L. delbrueckii subsp. bulgaricus in commercial yoghurts and food supplements and it may be readily applied to the food industry. Copyright © 2010 Elsevier B.V. All rights reserved.

Comparison of four methods for rapid identification of Staphylococcus aureus directly from BACTEC 9240 blood culture system.

Science.gov (United States)

Ozen, N S; Ogunc, D; Mutlu, D; Ongut, G; Baysan, B O; Gunseren, F

2011-01-01

Differentiation of Staphylococcus aureus (S. aureus) from coagulase-negative staphylococci is very important in blood stream infections. Identification of S. aureus and coagulase-negative staphylococci (CoNS) from blood cultures takes generally 18-24 h after positive signaling on continuously monitored automated blood culture system. In this study, we evaluated the performance of tube coagulase test (TCT), slide agglutination test (Dry Spot Staphytect Plus), conventional polymerase chain reaction (PCR) and LightCycler Staphylococcus MGrade kit directly from blood culture bottles to achieve rapid identification of S. aureus by using the BACTEC 9240 blood culture system. A total of 129 BACTEC 9240 bottles growing gram-positive cocci suggesting Staphylococci were tested directly from blood culture broths (BCBs) with TCT, Dry Spot Staphytect Plus, conventional PCR and LightCycler Staphylococcus MGrade kit for rapid identification of S. aureus. The sensitivities of the tests were 99, 68, 99 and 100%, respectively. Our results suggested that 2 h TCT was found to be simple and inexpensive method for the rapid identification of S. aureus directly from positive blood cultures.

Template preparation for rapid PCR in Colletotrichum lindemuthianum

Directory of Open Access Journals (Sweden)

Roca M. Gabriela

2003-01-01

Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

Science.gov (United States)

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

Rapid real-time PCR assay for culture and tissue identification of Geomyces destructans: the etiologic agent of bat geomycosis (white nose syndrome).

Science.gov (United States)

Chaturvedi, Sudha; Rudd, Robert J; Davis, April; Victor, Tanya R; Li, Xiaojiang; Appler, Kim A; Rajkumar, Sunanda S; Chaturvedi, Vishnu

2011-10-01

Geomyces destructans is the etiologic agent of bat geomycosis, commonly referred to as white nose syndrome (WNS). This infection has caused severe morbidity and mortality in little brown bats (Myotis lucifugus) and has also spread to other bat species with significant decline in the populations. Currently, G. destructans infection is identified by culture, ITS-PCR, and histopathology. We hypothesized that a real-time PCR assay would considerably improve detection of G. destructans in bats. The 100 bp sequence of the Alpha-L-Rhamnosidase gene was validated as a target for real-time PCR. The assay sensitivity was determined from serial dilution of DNA extracted from G. destructans conidia (5 × 10(-1)-5 × 10(7)), and the specificity was tested using DNA from 30 closely and distantly related fungi and 5 common bacterial pathogens. The real-time PCR assay was highly sensitive with detection limit of two G. destructans conidia per reaction at 40 PCR cycles. The assay was also highly specific as none of the other fungal or bacterial DNA cross-reacted in the real-time PCR assay. One hundred and forty-seven bat tissue samples, suspected of infection with G. destructans, were used to compare the real-time PCR assay to other methods employed for the detection of G. destructans. Real-time PCR was highly sensitive with 80 of 147 (55%) samples testing positive for G. destructans DNA. In comparison, histopathology examination revealed 64/147 (44%) positive samples. The internal transcribed spacer (ITS)-PCR yielded positive amplicon for G. destructans from 37 tissue samples (25%). The least sensitive assay was the fungal culture with only 17 tissue samples (12%) yielding G. destructans in culture. The data suggested that the real-time PCR assay is highly promising for rapid, sensitive, and specific identification of G. destructans. Further trials and inter-laboratory comparisons of this novel assay are recommended to improve the diagnosis of bat geomycosis.

Identification of periodontopathogen microorganisms by PCR technique

Directory of Open Access Journals (Sweden)

Milićević Radovan

2008-01-01

Full Text Available INTRODUCTION Periodontitis is an inflammatory disease of the supporting tissues of teeth and is a major cause of tooth loss in adults. The onset and progression of periodontal disease is attributed to the presence of elevated levels of a consortium of pathogenic bacteria. Gram negative bacteria, mainly strict anaerobes, play the major role. OBJECTIVE The present study aimed to assess the presence of the main types of microorganisms involved in the aetiopathogenesis of periodontal disease: Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Eikenella corrodens, Treponema denticola, Tanerella forsythia and Prevotella intermedia in different samples collected from the oral cavity of 90 patients diagnosed with periodontitis. METHOD Bacterial DNA detection was performed in diverse biological materials, namely in dental plaque, gingival tissue and saliva, by means of multiplex PCR, a technique that allows simultaneous identification of two different bacterial genomes. RESULTS In the dental plaque of the periodontitis patients, Treponema denticola dominated. In the gingival tissue, Tannerella forsythia and Treponema denticola were the microbiota most frequently detected, whilst in saliva Treponema denticola and Eikenella corrodens were found with the highest percentage. CONCLUSION The identification of microorganisms by multiplex PCR is specific and sensitive. Rapid and precise assessment of different types of periodontopathogens is extremely important for early detection of the infection and consequently for the prevention and treatment of periodontal disease. In everyday clinical practice, for routine bacterial evaluation in patients with periodontal disease, the dental plaque is the most suitable biological material, because it is the richest in periodontal bacteria.

[Application of rapid PCR to authenticate medicinal snakes].

Science.gov (United States)

Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

2014-10-01

To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

On-site identification of meat species in processed foods by a rapid real-time polymerase chain reaction system.

Science.gov (United States)

Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori

2017-09-01

Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.

Comparison of PCR method with the culture method for identification of gonococci from endocervical swabs

Directory of Open Access Journals (Sweden)

Alam A

2002-01-01

Full Text Available Gonococcal infection remains still a major cause of morbidity among sexually active individuals. Diagnosis of the infection in a female case is more difficult than that in a male. This was a prospective study among 269 female commercial sex workers (CSWs to screen them for gonococcal infection, comparing the rapid method of identification of gonococci by polymerase chain reaction (PCR with the selective culture method. A total of 92 (34.2% CSWs were identified positive for Neisseria gonorrhoeae by combination of the two methods. The PCR method identified 87 of the specimens to harbour cppB gene of N. gonorrhoeae, whereas culture method identified 83 specimens showing colonies of gonococci. Taking into consideration of the total positive cases (92, the PCR method showed a sensitivity of 94.57%, whereas sensitivity of culture method was 90.22%. The selective culture method appears to be the most applicable in the identification of gonococci from clinical specimens, particularly in the less resourceful countries like Bangladesh.

Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples.

Science.gov (United States)

Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R

2011-09-01

In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.

Comparison of four methods for rapid identification of Staphylococcus aureus directly from BACTEC 9240 blood culture system

Directory of Open Access Journals (Sweden)

N S Ozen

2011-01-01

Full Text Available Purpose: Differentiation of Staphylococcus aureus (S. aureus from coagulase-negative staphylococci is very important in blood stream infections. Identification of S. aureus and coagulase-negative staphylococci (CoNS from blood cultures takes generally 18-24 h after positive signaling on continuously monitored automated blood culture system. In this study, we evaluated the performance of tube coagulase test (TCT, slide agglutination test (Dry Spot Staphytect Plus, conventional polymerase chain reaction (PCR and LightCycler Staphylococcus MGrade kit directly from blood culture bottles to achieve rapid identification of S. aureus by using the BACTEC 9240 blood culture system. Materials and Methods: A total of 129 BACTEC 9240 bottles growing gram-positive cocci suggesting Staphylococci were tested directly from blood culture broths (BCBs with TCT, Dry Spot Staphytect Plus, conventional PCR and LightCycler Staphylococcus MGrade kit for rapid identification of S. aureus. Results: The sensitivities of the tests were 99, 68, 99 and 100%, respectively. Conclusion: Our results suggested that 2 h TCT was found to be simple and inexpensive method for the rapid identification of S. aureus directly from positive blood cultures.

Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

Science.gov (United States)

Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

2016-02-01

Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

A dual PCR-based sequencing approach for the identification and discrimination of Echinococcus and Taenia taxa.

Science.gov (United States)

Boubaker, Ghalia; Marinova, Irina; Gori, Francesca; Hizem, Amani; Müller, Norbert; Casulli, Adriano; Jerez Puebla, Luis Enrique; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

2016-08-01

Reliable and rapid molecular tools for the genetic identification and differentiation of Echinococcus species and/or genotypes are crucial for studying spatial and temporal transmission dynamics. Here, we describe a novel dual PCR targeting regions in the small (rrnS) and large (rrnL) subunits of mitochondrial ribosomal RNA (rRNA) genes, which enables (i) the specific identification of species and genotypes of Echinococcus (rrnS + L-PCR) and/or (ii) the identification of a range of taeniid cestodes, including different species of Echinococcus, Taenia and some others (17 species of diphyllidean helminths). This dual PCR approach was highly sensitive, with an analytical detection limit of 1 pg for genomic DNA of Echinococcus. Using concatenated sequence data derived from the two gene markers (1225 bp), we identified five unique and geographically informative single nucleotide polymorphisms (SNPs) that allowed genotypes (G1 and G3) of Echinococcus granulosus sensu stricto to be distinguished, and 25 SNPs that allowed differentiation within Echinococcus canadensis (G6/7/8/10). In conclusion, we propose that this dual PCR-based sequencing approach can be used for molecular epidemiological studies of Echinococcus and other taeniid cestodes. Copyright © 2016 Elsevier Ltd. All rights reserved.

A multiplex PCR method for the identification of commercially important salmon and trout species (Oncorhynchus and Salmo) in North America.

Science.gov (United States)

Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H

2010-09-01

The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to

Genetic identification of the main opportunistic Mucorales by PCR-restriction fragment length polymorphism.

Science.gov (United States)

Machouart, M; Larché, J; Burton, K; Collomb, J; Maurer, P; Cintrat, A; Biava, M F; Greciano, S; Kuijpers, A F A; Contet-Audonneau, N; de Hoog, G S; Gérard, A; Fortier, B

2006-03-01

Mucormycosis is a rare and opportunistic infection caused by fungi belonging to the order Mucorales. Recent reports have demonstrated an increasing incidence of mucormycosis, which is frequently lethal, especially in patients suffering from severe underlying conditions such as immunodeficiency. In addition, even though conventional mycology and histopathology assays allow for the identification of Mucorales, they often fail in offering a species-specific diagnosis. Due to the lack of other laboratory tests, a precise identification of these molds is thus notoriously difficult. In this study we aimed to develop a molecular biology tool to identify the main Mucorales involved in human pathology. A PCR strategy selectively amplifies genomic DNA from molds belonging to the genera Absidia, Mucor, Rhizopus, and Rhizomucor, excluding human DNA and DNA from other filamentous fungi and yeasts. A subsequent digestion step identified the Mucorales at genus and species level. This technique was validated using both fungal cultures and retrospective analyses of clinical samples. By enabling a rapid and precise identification of Mucorales strains in infected patients, this PCR-restriction fragment length polymorphism-based method should help clinicians to decide on the appropriate treatment, consequently decreasing the mortality of mucormycosis.

SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

Directory of Open Access Journals (Sweden)

Daijun Ling

Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

Rapid method for identification of transgenic fish zygosity

Directory of Open Access Journals (Sweden)

. Alimuddin

2007-07-01

Full Text Available Identification of zygosity in transgenik fish is normally achieved by PCR analysis with genomic DNA template extracted from the tissue of progenies which are derived by mating the transgenic fish and wild-type counterpart.  This method needs relatively large amounts of fish material and is time- and labor-intensive. New approaches addressing this problem could be of great help for fish biotechnologists.  In this experiment, we applied a quantitative real-time PCR (qr-PCR method to analyze zygosity in a stable line of transgenic zebrafish (Danio rerio carrying masu salmon, Oncorhynchus masou D6-desaturase-like gene. The qr-PCR was performed using iQ SYBR Green Supermix in the iCycler iQ Real-time PCR Detection System (Bio-Rad Laboratories, USA.  Data were analyzed using the comparative cycle threshold method.  The results demonstrated a clear-cut identification of all transgenic fish (n=20 classified as a homozygous or heterozygous.  Mating of those fish with wild-type had revealed transgene transmission to the offspring following expected Mendelian laws. Thus, we found that the qTR-PCR to be effective for a rapid and precise determination of zygosity in transgenic fish. This technique could be useful in the establishment of breeding programs for mass transgenic fish production and in experiments in which zygosity effect could have a functional impact. Keywords: quantitative real-time PCR; zygosity; transgenic fish; mass production   ABSTRAK Identifikasi sigositas ikan transgenik biasanya dilakukan menggunakan analisa PCR dengan cetakan DNA genomik yang diekstraksi dari jaringan ikan hasil persilangan antara ikan transgenik dan ikan normal.   Metode ini memerlukan ikan dalam jumlah yang banyak, dan juga waktu serta tenaga.  Pendekatan baru untuk mengatasi masalah tersebut akan memberikan manfaat besar kepada peneliti bioteknologi perikanan.  Pada penelitian ini, kami menggunakan metode PCR real-time kuantitatif (krt-PCR untuk

Diagnostic value of nested-PCR for identification of Malassezia species in dandruff

Science.gov (United States)

Jusuf, N. K.; Nasution, T. A.; Ullyana, S.

2018-03-01

Dandruff or pityriasis simplex is a condition of abnormal occurrence of formation of yellowish white scales from the scalp. Many factors play a role in the pathogenesis of dandruff, i.e.colonization of Malassezia species. Examination of Malassezia species previously done by culture as the gold standard. However, there are various difficulties in doing the culture. Identification method with anested-polymerase chain reaction (nested-PCR) is expected to provide quickly and easily detected. This study aimedto determine the diagnostic value of nested-PCR in the identification of Malassezia species in dandruff. From 21 subjects, scales from the scalp were taken and sent to the laboratory for nested-PCR identification. Statistical analysis of diagnostic test carried out to determine sensitivity, specificity, positive predictive value, and negative predictive value. The results showed nested-PCR detected 10 sample (47.6%) positive for Malassezia species consist of M. sympodialis (23.8%); M. slooffiae (9.5%); M. furfur (4.8%); M. globosa and M. furfur (4.8%); and M. restricta and M. sympodialis (4.8%). Detection of Malassezia species by nested-PCR has 100% in sensitivity whereas the specificity was 55%. Nested-PCR test has high sensitivity. Therefore nested-PCR may be considered for a faster and simpler alternative examination in identification for Malassezia species in dandruff.

A rapid, one step molecular identification of Trichoderma citrinoviride and Trichoderma reesei.

Science.gov (United States)

Saroj, Dina B; Dengeti, Shrinivas N; Aher, Supriya; Gupta, Anil K

2015-06-01

Trichoderma species are widely used as production hosts for industrial enzymes. Identification of Trichoderma species requires a complex molecular biology based identification involving amplification and sequencing of multiple genes. Industrial laboratories are required to run identification tests repeatedly in cell banking procedures and also to prove absence of production host in the product. Such demands can be fulfilled by a brief method which enables confirmation of strain identity. This communication describes one step identification method for two common Trichoderma species; T. citrinoviride and T. reesei, based on identification of polymorphic region in the nucleotide sequence of translation elongation factor 1 alpha. A unique forward primer and common reverse primer resulted in 153 and 139 bp amplicon for T. citrinoviride and T. reesei, respectively. Simplification was further introduced by using mycelium as template for PCR amplification. Method described in this communication allows rapid, one step identification of two Trichoderma species.

Molecular detection and species-specific identification of medically important Aspergillus species by real-time PCR in experimental invasive pulmonary aspergillosis.

Science.gov (United States)

Walsh, Thomas J; Wissel, Mark C; Grantham, Kevin J; Petraitiene, Ruta; Petraitis, Vidmantas; Kasai, Miki; Francesconi, Andrea; Cotton, Margaret P; Hughes, Johanna E; Greene, Lora; Bacher, John D; Manna, Pradip; Salomoni, Martin; Kleiboeker, Steven B; Reddy, Sushruth K

2011-12-01

Diagnosis of invasive pulmonary aspergillosis (IPA) remains a major challenge to clinical microbiology laboratories. We developed rapid and sensitive quantitative PCR (qPCR) assays for genus- and species-specific identification of Aspergillus infections by use of TaqMan technology. In order to validate these assays and understand their potential diagnostic utility, we then performed a blinded study of bronchoalveolar lavage (BAL) fluid specimens from well-characterized models of IPA with the four medically important species. A set of real-time qPCR primers and probes was developed by utilizing unique ITS1 regions for genus- and species-specific detection of the four most common medically important Aspergillus species (Aspergillus fumigatus, A. flavus, A. niger, and A. terreus). Pan-Aspergillus and species-specific qPCRs with BAL fluid were more sensitive than culture for detection of IPA caused by A. fumigatus in untreated (P < 0.0007) and treated (P ≤ 0.008) animals, respectively. For infections caused by A. terreus and A. niger, culture and PCR amplification from BAL fluid yielded similar sensitivities for untreated and treated animals. Pan-Aspergillus PCR was more sensitive than culture for detection of A. flavus in treated animals (P = 0.002). BAL fluid pan-Aspergillus and species-specific PCRs were comparable in sensitivity to BAL fluid galactomannan (GM) assay. The copy numbers from the qPCR assays correlated with quantitative cultures to determine the pulmonary residual fungal burdens in lung tissue. Pan-Aspergillus and species-specific qPCR assays may improve the rapid and accurate identification of IPA in immunocompromised patients.

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

International Nuclear Information System (INIS)

Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

2004-01-01

Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

Science.gov (United States)

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-01

The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples.

Science.gov (United States)

Leach, L; Zhu, Y; Chaturvedi, S

2018-02-01

Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.

Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

Directory of Open Access Journals (Sweden)

Wang Zhen

2011-11-01

Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

A locked nucleic acid (LNA-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture.

Directory of Open Access Journals (Sweden)

Lingxiang Zhu

Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.

Science.gov (United States)

Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping

2018-01-24

Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of

Identification and Quantification of Celery Allergens Using Fiber Optic Surface Plasmon Resonance PCR.

Science.gov (United States)

Daems, Devin; Peeters, Bernd; Delport, Filip; Remans, Tony; Lammertyn, Jeroen; Spasic, Dragana

2017-07-31

Abstract : Accurate identification and quantification of allergens is key in healthcare, biotechnology and food quality and safety. Celery ( Apium graveolens ) is one of the most important elicitors of food allergic reactions in Europe. Currently, the golden standards to identify, quantify and discriminate celery in a biological sample are immunoassays and two-step molecular detection assays in which quantitative PCR (qPCR) is followed by a high-resolution melting analysis (HRM). In order to provide a DNA-based, rapid and simple detection method suitable for one-step quantification, a fiber optic PCR melting assay (FO-PCR-MA) was developed to determine different concentrations of celery DNA (1 pM-0.1 fM). The presented method is based on the hybridization and melting of DNA-coated gold nanoparticles to the FO sensor surface in the presence of the target gene (mannitol dehydrogenase, Mtd ). The concept was not only able to reveal the presence of celery DNA, but also allowed for the cycle-to-cycle quantification of the target sequence through melting analysis. Furthermore, the developed bioassay was benchmarked against qPCR followed by HRM, showing excellent agreement ( R ² = 0.96). In conclusion, this innovative and sensitive diagnostic test could further improve food quality control and thus have a large impact on allergen induced healthcare problems.

The significance of gtf genes in caries expression: a rapid identification of Streptococcus mutans from dental plaque of child patients.

Science.gov (United States)

Mishra, Apurva; Pandey, Ramesh K; Manickam, Natesan

2015-01-01

Rapid phylogenetic and functional gene (gtfB) identification of S. mutans from the dental plaque derived from children. Dental plaque collected from fifteen patients of age group 7-12 underwent centrifugation followed by genomic DNA extraction for S. mutans. Genomic DNA was processed with S. mutans specific primers in suitable PCR condtions for phylogenetic and functional gene (gtfB) identification. The yield and results were confirmed by agarose gel electrophoresis. 1% agarose gel electrophoresis depicts the positive PCR amplification at 1,485 bp when compared with standard 1 kbp indicating the presence of S. mutans in the test sample. Another PCR reaction was set using gtfB primers specific for S. mutans for functional gene identification. 1.2% agarose gel electrophoresis was done and a positive amplication was observed at 192 bp when compared to 100 bp standards. With the advancement in molecular biology techniques, PCR based identification and quantification of the bacterial load can be done within hours using species-specific primers and DNA probes. Thus, this technique may reduce the laboratory time spend in conventional culture methods, reduces the possibility of colony identification errors and is more sensitive to culture techniques.

Molecular identification of Mucorales in human tissues: contribution of PCR electrospray-ionization mass spectrometry.

Science.gov (United States)

Alanio, A; Garcia-Hermoso, D; Mercier-Delarue, S; Lanternier, F; Gits-Muselli, M; Menotti, J; Denis, B; Bergeron, A; Legrand, M; Lortholary, O; Bretagne, S

2015-06-01

Molecular methods are crucial for mucormycosis diagnosis because cultures are frequently negative, even if microscopy suggests the presence of hyphae in tissues. We assessed PCR/electrospray-ionization mass spectrometry (PCR/ESI-MS) for Mucorales identification in 19 unfixed tissue samples from 13 patients with proven or probable mucormycosis and compared the results with culture, quantitative real-time PCR, 16S-23S rRNA gene internal transcribed spacer region (ITS PCR) and 18S PCR sequencing. Concordance with culture identification to both genus and species levels was higher for PCR/ESI-MS than for the other techniques. Thus, PCR/ESI-MS is suitable for Mucorales identification, within 6 hours, for tissue samples for which microscopy results suggest the presence of hyphae. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Specific PCR Identification between Peucedanum praeruptorum and Angelica decursiva and Identification between Them and Adulterant Using DNA Barcode.

Science.gov (United States)

Han, Bang-Xing; Yuan, Yuan; Huang, Lu-Qi; Zhao, Qun; Tan, Ling-Ling; Song, Xiang-Wen; He, Xiao-Mei; Xu, Tao; Liu, Feng; Wang, Jian

2017-01-01

The traditional Chinese medicine (TCM) Qianhu and Zihuaqianhu are the dried roots of Peucedanum praeruptorum and Angelica decursiva , respectively. Since the plant sources of Qianhu and Zihuaqianhu are more complex, the chemical compositions of P. praeruptorum and A. decursiva are significantly different, and many adulterants exist because of the differences in traditional understanding and medication habits. Therefore, the rapid and accurate identification methods are required. The aim was to study the feasibility of using DNA barcoding to distinguish between Traditional Chinese medicine Qianhu ( Peucedanum praeruptorum ), Zihuaqianhu ( Angelica decursiva ), and common adulterants, based on internal transcribed spacer (ITS) sequences, as well as specific PCR identification between P. praeruptorum and A. decursiva . The ITS sequences of P. praeruptorum , A. decursiva , and adulterant were studied, and a phylogenetic tree was constructed. Based on the ITS barcode, the specific PCR primer pairs QH-CP19s/QH-CP19a and ZHQH-CP3s/ZHQH-CP3a were designed for P. praeruptorum and A. decursiva , respectively. The amplification conditions were optimized, and specific PCR products were obtained. The results showed that the phylogenetic trees constructed using the BI and MP methods were consistent, and P. praeruptorum and A. decursiva sequence haplotypes formed their own monophyly. The experimental results showed that in PCR products, the target bands appeared in the genuine drug and not in the adulterant, which suggests the high specificity of the two primer pairs. The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant. The specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva . Peucedanum praeruptorum and Angelica decursiva sequence haplotypes formed their own monophyly.The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant.Specific PCR is a

Rapid Detection of the Chlamydiaceae and Other Families in the Order Chlamydiales: Three PCR Tests

Science.gov (United States)

Everett, Karin D. E.; Hornung, Linda J.; Andersen, Arthur A.

1999-01-01

Few identification methods will rapidly or specifically detect all bacteria in the order Chlamydiales, family Chlamydiaceae. In this study, three PCR tests based on sequence data from over 48 chlamydial strains were developed for identification of these bacteria. Two tests exclusively recognized the Chlamydiaceae: a multiplex test targeting the ompA gene and the rRNA intergenic spacer and a TaqMan test targeting the 23S ribosomal DNA. The multiplex test was able to detect as few as 200 inclusion-forming units (IFU), while the TaqMan test could detect 2 IFU. The amplicons produced in these tests ranged from 132 to 320 bp in length. The third test, targeting the 23S rRNA gene, produced a 600-bp amplicon from strains belonging to several families in the order Chlamydiales. Direct sequence analysis of this amplicon has facilitated the identification of new chlamydial strains. These three tests permit ready identification of chlamydiae for diagnostic and epidemiologic study. The specificity of these tests indicates that they might also be used to identify chlamydiae without culture or isolation. PMID:9986815

PCR detection and identification of oral streptococci in saliva samples using gtf genes.

Science.gov (United States)

Hoshino, Tomonori; Kawaguchi, Mamoru; Shimizu, Noriko; Hoshino, Naoko; Ooshima, Takashi; Fujiwara, Taku

2004-03-01

Oral streptococci are major constituents of dental plaque, and their prevalence is implicated in various pathologies. Therefore, accurate identification of oral streptococci would be valuable for studies of cariogenic plaque and for diagnostic use in infective endocarditis. Many oral streptococci possess glucosyltransferase enzymes that synthesize glucan, which is an obligate component of dental plaque. We established a rapid and precise method to identify oral streptococci by PCR using the species-specific region from the glucosyltransferase gene. With the species-specific primers, Streptococcus mutans, S. sobrinus, S. salivarius, S. sanguinis, S. oralis, and S. gordonii could be successfully distinguished. Further, we developed a simple method to extract the bacterial DNA from saliva. Using the resultant DNA as a template, the proposed PCR detection was performed. Their distribution was in accord with results of conventional biochemical tests. These findings indicate that the present PCR method is useful for the analysis of oral streptococci and can be successfully used in clinical applications to identify pathogenic bacteria associated with oral infectious disease and/or endocarditis.

Rapid identification of red-flesh loquat cultivars using EST-SSR markers based on manual cultivar identification diagram strategy.

Science.gov (United States)

Li, X Y; Xu, H X; Chen, J W

2014-04-29

Manual cultivar identification diagram is a new strategy for plant cultivar identification based on DNA markers, providing information to efficiently separate cultivars. We tested 25 pairs of apple EST-SSR primers for amplification of PCR products from loquat cultivars. These EST-SSR primers provided clear amplification products from the loquat cultivars, with a relatively high transferability rate of 84% to loquat; 11 pairs of primers amplified polymorphic products. After analysis of 24 red-fleshed loquat accessions, we found that only 7 pairs of primers could clearly separate all of them. A cultivar identification diagram of the 24 cultivars was constructed using polymorphic bands from the DNA fingerprints and EST-SSR primers. Any two of the 24 cultivars could be rapidly separated from each other, according to the polymorphic bands from the cultivars; the corresponding primers were marked in the correct position on the cultivar identification diagram. This red-flesh loquat cultivar identification diagram can separate the 24 red-flesh loquat cultivars, which is of benefit for loquat cultivar identification for germplasm management and breeding programs.

Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

Science.gov (United States)

Zhang, D F; Zhang, Q Q; Li, A H

2014-11-01

Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR

Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

Directory of Open Access Journals (Sweden)

Van Esbroeck Marjan

2011-03-01

Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

Culture-independent identification and quantification of Gallibacterium anatis (G. anatis) by real-time quantitative PCR

DEFF Research Database (Denmark)

Wang, Chong; Robles, Francisco; Ramirez, Saul

2016-01-01

Gallibacterium is a genus within the family Pasteurellaceae characterized by a high level of phenotypic and genetic diversity. No diagnostic method has yet been described, which allows species-specific identification of Gallibacterium anatis. The aim of this study was to develop a real...... published conventional PCR method and culture-based identification, respectively. The detection rates were 97%, 78% and 34% for the current qPCR, the conventional PCR and the culture-based identification method, respectively. The qPCR assay was able to detect the gene gyrB in serial dilutions of 10......-time quantitative PCR (qPCR) method allowing species-specific identification and quantification of G. anatis. A G. anatis specific DNA sequence was identified in the gyrase subunit B gene (gyrB) and used to design a TaqMan probe and corresponding primers. The specificity of the assay was tested on 52 bacterial...

Improved method for rapid and accurate isolation and identification of Streptococcus mutans and Streptococcus sobrinus from human plaque samples.

Science.gov (United States)

Villhauer, Alissa L; Lynch, David J; Drake, David R

2017-08-01

Mutans streptococci (MS), specifically Streptococcus mutans (SM) and Streptococcus sobrinus (SS), are bacterial species frequently targeted for investigation due to their role in the etiology of dental caries. Differentiation of S. mutans and S. sobrinus is an essential part of exploring the role of these organisms in disease progression and the impact of the presence of either/both on a subject's caries experience. Of vital importance to the study of these organisms is an identification protocol that allows us to distinguish between the two species in an easy, accurate, and timely manner. While conducting a 5-year birth cohort study in a Northern Plains American Indian tribe, the need for a more rapid procedure for isolating and identifying high volumes of MS was recognized. We report here on the development of an accurate and rapid method for MS identification. Accuracy, ease of use, and material and time requirements for morphological differentiation on selective agar, biochemical tests, and various combinations of PCR primers were compared. The final protocol included preliminary identification based on colony morphology followed by PCR confirmation of species identification using primers targeting regions of the glucosyltransferase (gtf) genes of SM and SS. This method of isolation and identification was found to be highly accurate, more rapid than the previous methodology used, and easily learned. It resulted in more efficient use of both time and material resources. Copyright © 2017 Elsevier B.V. All rights reserved.

Rapid detection and identification of Stachybotrys and Chaetomium species using tissue PCR analysis

DEFF Research Database (Denmark)

Lewinska, Anna Malgorzata; Peuhkuri, Ruut Hannele; Rode, Carsten

2016-01-01

level is essential for health risk assessment and building remediation. This study focuses on molecular identification of two common indoor fungal genera: Stachybotrys and Chaetomium. This study proposes two new DNA barcode candidates for Stachybotrys and Chaetomium: the gene encoding mitogen activated...... protein kinase (hogA) and the intergenic region between histone 3 and histone 4 (h3-h4) as well as it introduces a rapid - 3.5 h - protocol for direct Stachybotrys and Chaetomium species identification, which bypasses culture cultivation, DNA extraction and DNA sequencing....

Identification and Quantification of Celery Allergens Using Fiber Optic Surface Plasmon Resonance PCR

Directory of Open Access Journals (Sweden)

Devin Daems

2017-07-01

Full Text Available Abstract: Accurate identification and quantification of allergens is key in healthcare, biotechnology and food quality and safety. Celery (Apium graveolens is one of the most important elicitors of food allergic reactions in Europe. Currently, the golden standards to identify, quantify and discriminate celery in a biological sample are immunoassays and two-step molecular detection assays in which quantitative PCR (qPCR is followed by a high-resolution melting analysis (HRM. In order to provide a DNA-based, rapid and simple detection method suitable for one-step quantification, a fiber optic PCR melting assay (FO-PCR-MA was developed to determine different concentrations of celery DNA (1 pM–0.1 fM. The presented method is based on the hybridization and melting of DNA-coated gold nanoparticles to the FO sensor surface in the presence of the target gene (mannitol dehydrogenase, Mtd. The concept was not only able to reveal the presence of celery DNA, but also allowed for the cycle-to-cycle quantification of the target sequence through melting analysis. Furthermore, the developed bioassay was benchmarked against qPCR followed by HRM, showing excellent agreement (R2 = 0.96. In conclusion, this innovative and sensitive diagnostic test could further improve food quality control and thus have a large impact on allergen induced healthcare problems.

PCR strategy for identification and differentiation of small pox and other orthopoxviruses.

Science.gov (United States)

Ropp, S L; Jin, Q; Knight, J C; Massung, R F; Esposito, J J

1995-08-01

Rapid identification and differentiation of orthopoxviruses by PCR were achieved with primers based on genome sequences encoding the hemagglutinin (HA) protein, an infected-cell membrane antigen that distinguishes orthopoxviruses from other poxvirus genera. The initial identification step used a primer pair of consensus sequences for amplifying an HA DNA fragment from the three known North American orthopoxviruses (raccoonpox, skunkpox, and volepox viruses), and a second pair for amplifying virtually the entire HA open reading frame of the Eurasian-African orthopoxviruses (variola, vaccinia, cowpox, monkeypox, camelpox, ectromelia, and gerbilpox viruses). RsaI digest electropherograms of the amplified DNAs of the former subgroup provided species differentiation, and TaqI digests differentiated the Eurasian-African orthopoxviruses, including vaccinia virus from the vaccinia virus subspecies buffalopox virus. Endonuclease HhaI digest patterns distinguished smallpox variola major viruses from alastrim variola minor viruses. For the Eurasian-African orthopoxviruses, a confirmatory step that used a set of higher-sequence-homology primers was developed to provide sensitivity to discern individual virus HA DNAs from cross-contaminated orthopoxvirus DNA samples; TaqI and HhaI digestions of the individual amplified HA DNAs confirmed virus identity. Finally, a set of primers and modified PCR conditions were developed on the basis of base sequence differences within the HA genes of the 10 species, which enabled production of a single DNA fragment of a particular size that indicated the specific species.

Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

OpenAIRE

Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan

2014-01-01

Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA...

Ultra-fast DNA-based multiplex convection PCR method for meat species identification with possible on-site applications.

Science.gov (United States)

Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee

2017-08-15

The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

Rapid Detection and Identification of Human Hookworm Infections through High Resolution Melting (HRM) Analysis

Science.gov (United States)

Ngui, Romano; Lim, Yvonne A. L.; Chua, Kek Heng

2012-01-01

Background Hookworm infections are still endemic in low and middle income tropical countries with greater impact on the socioeconomic and public health of the bottom billion of the world's poorest people. In this study, a real-time polymerase chain reaction (PCR) coupled with high resolution melting-curve (HRM) analysis was evaluated for an accurate, rapid and sensitive tool for species identification focusing on the five human hookworm species. Methods Real-time PCR coupled with HRM analysis targeting the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA as the genetic marker was used to identify and distinguish hookworm species in human samples. Unique and distinct characteristics of HRM patterns were produced for each of the five hookworm species. The melting curves were characterized by peaks of 79.24±0.05°C and 83.00±0.04°C for Necator americanus, 79.12±0.10°C for Ancylostoma duodenale, 79.40±0.10°C for Ancylostoma ceylanicum, 79.63±0.05°C for Ancylostoma caninum and 79.70±0.14°C for Ancylostoma braziliense. An evaluation of the method's sensitivity and specificity revealed that this assay was able to detect as low as 0.01 ng/µl hookworm DNA and amplification was only recorded for hookworm positive samples. Conclusion The HRM assay developed in this study is a rapid and straightforward method for the diagnosis, identification and discrimination of five human hookworms. This assay is simple compared to other probe-based genotyping methods as it does not require multiplexing, DNA sequencing or post-PCR processing. Therefore, this method offers a new alternative for rapid detection of human hookworm species. PMID:22844538

Rapid detection and identification of human hookworm infections through high resolution melting (HRM analysis.

Directory of Open Access Journals (Sweden)

Romano Ngui

Full Text Available BACKGROUND: Hookworm infections are still endemic in low and middle income tropical countries with greater impact on the socioeconomic and public health of the bottom billion of the world's poorest people. In this study, a real-time polymerase chain reaction (PCR coupled with high resolution melting-curve (HRM analysis was evaluated for an accurate, rapid and sensitive tool for species identification focusing on the five human hookworm species. METHODS: Real-time PCR coupled with HRM analysis targeting the second internal transcribed spacer (ITS-2 of nuclear ribosomal DNA as the genetic marker was used to identify and distinguish hookworm species in human samples. Unique and distinct characteristics of HRM patterns were produced for each of the five hookworm species. The melting curves were characterized by peaks of 79.24±0.05°C and 83.00±0.04°C for Necator americanus, 79.12±0.10°C for Ancylostoma duodenale, 79.40±0.10°C for Ancylostoma ceylanicum, 79.63±0.05°C for Ancylostoma caninum and 79.70±0.14°C for Ancylostoma braziliense. An evaluation of the method's sensitivity and specificity revealed that this assay was able to detect as low as 0.01 ng/µl hookworm DNA and amplification was only recorded for hookworm positive samples. CONCLUSION: The HRM assay developed in this study is a rapid and straightforward method for the diagnosis, identification and discrimination of five human hookworms. This assay is simple compared to other probe-based genotyping methods as it does not require multiplexing, DNA sequencing or post-PCR processing. Therefore, this method offers a new alternative for rapid detection of human hookworm species.

Conventional Morphology Versus PCR Sequencing, rep-PCR, and MALDI-TOF-MS for Identification of Clinical Aspergillus Isolates Collected Over a 2-Year Period in a University Hospital at Kayseri, Turkey.

Science.gov (United States)

Atalay, Altay; Koc, Ayse Nedret; Suel, Ahmet; Sav, Hafize; Demir, Gonca; Elmali, Ferhan; Cakir, Nuri; Seyedmousavi, Seyedmojtaba

2016-09-01

Aspergillus species cause a wide range of diseases in humans, including allergies, localized infections, or fatal disseminated diseases. Rapid detection and identification of Aspergillus spp. facilitate effective patient management. In the current study we compared conventional morphological methods with PCR sequencing, rep-PCR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) for the identification of Aspergillus strains. A total of 24 consecutive clinical isolates of Aspergillus were collected during 2012-2014. Conventional morphology and rep-PCR were performed in our Mycology Laboratory. The identification, evaluation, and reporting of strains using MALDI-TOF-MS were performed by BioMérieux Diagnostic, Inc. in Istanbul. DNA sequence analysis of the clinical isolates was performed by the BMLabosis laboratory in Ankara. Samples consisted of 18 (75%) lower respiratory tract specimens, 3 otomycosis (12.5%) ear tissues, 1 sample from keratitis, and 1 sample from a cutaneous wound. According to DNA sequence analysis, 12 (50%) specimens were identified as A. fumigatus, 8 (33.3%) as A. flavus, 3 (12.5%) as A. niger, and 1 (4.2%) as A. terreus. Statistically, there was good agreement between the conventional morphology and rep-PCR and MALDI-TOF methods; kappa values were κ = 0.869, 0.871, and 0.916, respectively (P < 0.001). The good level of agreement between the methods included in the present study and sequence method could be due to the identification of Aspergillus strains that were commonly encountered. Therefore, it was concluded that studies conducted with a higher number of isolates, which include other Aspergillus strains, are required. © 2016 Wiley Periodicals, Inc.

Development of Candida-Specific Real-Time PCR Assays for the Detection and Identification of Eight Medically Important Candida Species.

Science.gov (United States)

Zhang, Jing; Hung, Guo-Chiuan; Nagamine, Kenjiro; Li, Bingjie; Tsai, Shien; Lo, Shyh-Ching

2016-01-01

Culture-based identification methods have been the gold standard for the diagnosis of fungal infection. Currently, molecular technologies such as real-time PCR assays with short turnaround time can provide desirable alternatives for the rapid detection of Candida microbes. However, most of the published PCR primer sets are not Candida specific and likely to amplify DNA from common environmental contaminants, such as Aspergillus microbes. In this study, we designed pan-Candida primer sets based on the ribosomal DNA-coding regions conserved within Candida but distinct from those of Aspergillus and Penicillium. We demonstrate that the final two selected pan-Candida primer sets would not amplify Aspergillus DNA and could be used to differentiate eight medically important Candida pathogens in real-time PCR assays based on their melting profiles, with a sensitivity of detection as low as 10 fg of Candida genomic DNA. Moreover, we further evaluated and selected species-specific primer sets covering Candida albicans, Candida glabrata, Candida tropicalis, and Candida dubliniensis and show that they had high sensitivity and specificity. These real-time PCR primer sets could potentially be assembled into a single PCR array for the rapid detection of Candida species in various clinical settings, such as corneal transplantation.

Molecular identification of Indian crocodile species: PCR-RFLP method for forensic authentication*.

Science.gov (United States)

Meganathan, P R; Dubey, Bhawna; Haque, Ikramul

2009-09-01

South East Asian countries are known for illegal poaching and trade of crocodiles clandestinely, to be used in skin, medicinal, and cosmetic industries. Besides crocodiles being listed in the Convention on International Trade in Endangered Species of Wild Fauna and Flora, India has its Wildlife Protection Act, 1972 for conservation of crocodile species. Hitherto, lack of any rapid and reliable technique for examinations of crocodile-based crime exhibits such as skin, bones, etc. has been a major problem for an effective promulgation of law on illegal trade. DNA-based identification of species using PCR-RFLP technique for an apt identification of all the three Indian crocodile species namely, Crocodylus porosus, Crocodylus palustris and Gavialis gangeticus is presented here. A 628 bp segment of cytochrome b gene was amplified using novel primers followed by restriction digestion with three enzymes i.e., HaeIII, MboI, and MwoI, separately and in combination. The technique has produced a species-specific pattern for identifying the three crocodile species individually, which fulfills the requirement for its forensic application. It is expected that the technique will prove handy in identification of all the three Indian crocodile species and strengthen conservation efforts.

Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.

Science.gov (United States)

Keane, O M; Budd, K E; Flynn, J; McCoy, F

2013-09-21

Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.

Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

Science.gov (United States)

Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

2018-02-01

The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

A new real-time PCR assay for rapid identification of the S. aureus/MRSA strains

Directory of Open Access Journals (Sweden)

Ivan Manga

2013-01-01

Full Text Available The Methicillin-resistant Staphylococcus aureus (MRSA with the livestock-associated MRSA (LA-MRSA are of great interest to scientists and general public. The aim of our study was to present a new more rapid and reliable diagnostic method working on the RT-PCR platform applicable for monitoring of MRSA/S. aureus. The parallel testing of the S. aureus specific nuc gene sequence and the mecA gene sequence was utilised for this purpose. A collection of ten S. aureus/MRSA reference strains, fifteen genetically related non S. aureus reference strains and fifty-six environmental samples was employed for estimation of the assay performance and parameters. The environmental samples acquired in the Czech livestock farms were represented with the livestock and human nasal mucosae or skin swabs, the slaughter meat swabs and were chosen preferentially from individuals with previously confi rmed or suspected positive MRSA/S. aureus cases. The classic selective cultivation approach with the biochemical test and agar disk diffusion test was accepted as reference diagnostic method. As there were no culture positive samples that were negative using RT-PCR, our method featured with 100% sensitivity in comparison to reference method. The limit of detection allowed to identify from tens to hundreds copies of S. aureus/MRSA genome. Further, the RT-PCR assay featured with 100% inclusivity and 95% exclusivity at Cq value below 30. These parameters suggested on powerful and reliable diagnostic method with real potential of practical utilisation. We consider our method as ideal for testing of individual suspected colonies, when the results can be acquired in less than 1.5 hour.

Evaluation of PCR electrospray-ionization mass spectrometry for rapid molecular diagnosis of bovine mastitis.

Science.gov (United States)

Perreten, Vincent; Endimiani, Andrea; Thomann, Andreas; Wipf, Juliette R K; Rossano, Alexandra; Bodmer, Michèle; Raemy, Andreas; Sannes-Lowery, Kristin A; Ecker, David J; Sampath, Rangarajan; Bonomo, Robert A; Washington, Cicely

2013-06-01

Bovine mastitis, an inflammatory disease of the mammary gland, is one of the most costly diseases affecting the dairy industry. The treatment and prevention of this disease is linked heavily to the use of antibiotics in agriculture and early detection of the primary pathogen is essential to control the disease. Milk samples (n=67) from cows suffering from mastitis were analyzed for the presence of pathogens using PCR electrospray-ionization mass spectrometry (PCR/ESI-MS) and were compared with standard culture diagnostic methods. Concurrent identification of the primary mastitis pathogens was obtained for 64% of the tested milk samples, whereas divergent results were obtained for 27% of the samples. The PCR/ESI-MS failed to identify some of the primary pathogens in 18% of the samples, but identified other pathogens as well as microorganisms in samples that were negative by culture. The PCR/ESI-MS identified bacteria to the species level as well as yeasts and molds in samples that contained a mixed bacterial culture (9%). The sensitivity of the PCR/ESI-MS for the most common pathogens ranged from 57.1 to 100% and the specificity ranged from 69.8 to 100% using culture as gold standard. The PCR/ESI-MS also revealed the presence of the methicillin-resistant gene mecA in 16.2% of the milk samples, which correlated with the simultaneous detection of staphylococci including Staphylococcus aureus. We demonstrated that PCR/ESI-MS, a more rapid diagnostic platform compared with bacterial culture, has the significant potential to serve as an important screening method in the diagnosis of bovine clinical mastitis and has the capacity to be used in infection control programs for both subclinical and clinical disease. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

A TaqMan real-time PCR-based assay for the identification of Fasciola spp.

Science.gov (United States)

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-30

Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.

Evaluation of chromogenic media and seminested PCR in the identification of Candida species

Science.gov (United States)

Daef, Enas; Moharram, Ahmed; Eldin, Salwa Seif; Elsherbiny, Nahla; Mohammed, Mona

2014-01-01

Identification of Candida cultured from various clinical specimens to the species level is increasingly necessary for clinical laboratories. Although sn PCR identifies the species within hours but its cost-effectiveness is to be considered. So there is always a need for media which help in the isolation and identification at the species level. The study aimed to evaluate the performance of different chromogenic media and to compare the effectiveness of the traditional phenotypic methods vs. seminested polymerase chain reaction (sn PCR) for identification of Candida species. One hundred and twenty seven Candida strains isolated from various clinical specimens were identified by conventional methods, four different chromogenic media and sn PCR. HiCrome Candida Differential and CHROMagar Candida media showed comparably high sensitivities and specificities in the identification of C. albicans, C. tropicalis, C. glabrata and C. krusei. CHROMagar Candida had an extra advantage of identifying all C. parapsilosis isolates. CHROMagar-Pal’s medium identified C. albicans, C. tropicalis and C. krusei with high sensitivities and specificities, but couldn’t identify C. glabrata or C. parapsilosis. It was the only medium that identified C. dubliniensis with a sensitivity and specificity of 100%. Biggy agar showed the least sensitivities and specificities. The overall concordance of the snPCR compared to the conventional tests including CHROMAgar Candida in the identification of Candida species was 97.5%. The use of CHROMAgar Candida medium is an easy and accurate method for presumptive identification of the most commonly encountered Candida spp. PMID:24948942

PCR Assay Based on the gyrB Gene for Rapid Identification of Acinetobacter baumannii-calcoaceticus Complex at Specie Level.

Science.gov (United States)

Teixeira, Aline B; Barin, Juliana; Hermes, Djuli M; Barth, Afonso L; Martins, Andreza F

2017-05-01

The genus Acinetobacter sp. comprises more than 50 species, and four are closely related and difficult to be distinguished by either phenotypic or genotypic methods: the Acinetobacter calcoaceticus-baumannii complex (ABC). The correct identification at species level is necessary mainly due to the epidemiological aspects. We evaluated a multiplex PCR for gyrB gene to identify the species of the ABC using the sequencing of the ITS 16S-23S fragment as a gold standard. Isolates identified as Acinetobacter calcoaceticus-baumannii from three hospitals at southern Brazil in 2011 were included in this study. A total of 117 isolates were obtained and 106 (90.6%) were confirmed as A. baumannii, 6 (5.1%) as A. nosocomialis and 4 (3.4%) as A. pittii by PCR for gyrB gene. Only one isolate did not present a product of the PCR for the gyrB gene; this isolate was identified as Acinetobacter genospecie 10 by sequencing of ITS. We also noted that the non-A. baumannii isolates were recovered from respiratory tract (8/72.7%), blood (2/18.2%) and urine (1/9.1%), suggesting that these species can cause serious infection. These findings evidenced that the multiplex PCR of the gyrB is a feasible and simple method to identify isolates of the ABC at the species level. © 2016 Wiley Periodicals, Inc.

Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

Science.gov (United States)

Altınel, Ahmet

2017-01-01

Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

Real-time PCR-based method for rapid detection of Aspergillus niger and Aspergillus welwitschiae isolated from coffee.

Science.gov (United States)

von Hertwig, Aline Morgan; Sant'Ana, Anderson S; Sartori, Daniele; da Silva, Josué José; Nascimento, Maristela S; Iamanaka, Beatriz Thie; Pelegrinelli Fungaro, Maria Helena; Taniwaki, Marta Hiromi

2018-05-01

Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B 2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species. Copyright © 2018 Elsevier B.V. All rights reserved.

IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

Directory of Open Access Journals (Sweden)

Yuny Erwanto

2013-03-01

Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

Development of a high-speed real-time PCR system for rapid and precise nucleotide recognition

Science.gov (United States)

Terazono, Hideyuki; Takei, Hiroyuki; Hattori, Akihiro; Yasuda, Kenji

2010-04-01

Polymerase chain reaction (PCR) is a common method used to create copies of a specific target region of a DNA sequence and to produce large quantities of DNA. A few DNA molecules, which act as templates, are rapidly amplified by PCR into many billions of copies. PCR is a key technology in genome-based biological analysis, revolutionizing many life science fields such as medical diagnostics, food safety monitoring, and countermeasures against bioterrorism. Thus, many applications have been developed with the thermal cycling. For these PCR applications, one of the most important key factors is reduction in the data acquisition time. To reduce the acquisition time, it is necessary to decrease the temperature transition time between the high and low ends as much as possible. We have developed a novel rapid real-time PCR system based on rapid exchange of media maintained at different temperatures. This system consists of two thermal reservoirs and a reaction chamber for PCR observation. The temperature transition was achieved within 0.3 sec, and good thermal stability was achieved during thermal cycling with rapid exchange of circulating media. This system allows rigorous optimization of the temperatures required for each stage of the PCR processes. Resulting amplicons were confirmed by electrophoresis. Using the system, rapid DNA amplification was accomplished within 3.5 min, including initial heating and complete 50 PCR cycles. It clearly shows that the device could allow us faster temperature switching than the conventional conduction-based heating systems based on Peltier heating/cooling.

Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

Directory of Open Access Journals (Sweden)

Tian-Min Qiao

2016-10-01

Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

Science.gov (United States)

Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

2016-01-01

Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

Science.gov (United States)

Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

2016-10-01

Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

Real-time PCR assays for detection of Brucella spp. and the identification of genotype ST27 in bottlenose dolphins (Tursiops truncatus).

Science.gov (United States)

Wu, Qingzhong; McFee, Wayne E; Goldstein, Tracey; Tiller, Rebekah V; Schwacke, Lori

2014-05-01

Rapid detection of Brucella spp. in marine mammals is challenging. Microbiologic culture is used for definitive diagnosis of brucellosis, but is time consuming, has low sensitivity and can be hazardous to laboratory personnel. Serological methods can aid in diagnosis, but may not differentiate prior exposure versus current active infection and may cross-react with unrelated Gram-negative bacteria. This study reports a real-time PCR assay for the detection of Brucella spp. and application to screen clinical samples from bottlenose dolphins stranded along the coast of South Carolina, USA. The assay was found to be 100% sensitive for the Brucella strains tested, and the limit of detection was 0.27fg of genomic DNA from Brucella ceti B1/94 per PCR volume. No amplification was detected for the non-Brucella pathogens tested. Brucella DNA was detected in 31% (55/178) of clinical samples tested. These studies indicate that the real-time PCR assay is highly sensitive and specific for the detection of Brucella spp. in bottlenose dolphins. We also developed a second real-time PCR assay for rapid identification of Brucella ST27, a genotype that is associated with human zoonotic infection. Positive results were obtained for Brucella strains which had been identified as ST27 by multilocus sequence typing. No amplification was found for other Brucella strains included in this study. ST27 was identified in 33% (18/54) of Brucella spp. DNA-positive clinical samples. To our knowledge, this is the first report on the use of a real-time PCR assay for identification of Brucella genotype ST27 in marine mammals. Copyright © 2014 Elsevier B.V. All rights reserved.

Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

DEFF Research Database (Denmark)

Munch, M.; Nielsen, L.P.; Handberg, Kurt

2001-01-01

A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella

International Nuclear Information System (INIS)

Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar

2013-01-01

We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)

A Rapid and Low-Cost PCR Thermal Cycler for Low Resource Settings.

Directory of Open Access Journals (Sweden)

Grace Wong

Full Text Available Many modern molecular diagnostic assays targeting nucleic acids are typically confined to developed countries or to the national reference laboratories of developing-world countries. The ability to make technologies for the rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a revolutionary step forward in global health. Many molecular assays are also developed based on polymerase chain reactions (PCR, which require thermal cyclers that are relatively heavy (>20 pounds and need continuous electrical power. The temperature ramping speed of most economical thermal cyclers are relatively slow (2 to 3 °C/s so a polymerase chain reaction can take 1 to 2 hours. Most of all, these thermal cyclers are still too expensive ($2k to $4k for low-resource setting uses.In this article, we demonstrate the development of a low-cost and rapid water bath based thermal cycler that does not require active temperature control or continuous power supply during PCR. This unit costs $130 to build using commercial off-the-shelf items. The use of two or three vacuum-insulated stainless-steel Thermos food jars containing heated water (for denaturation and annealing/extension steps and a layer of oil on top of the water allow for significantly stabilized temperatures for PCR to take place. Using an Arduino-based microcontroller, we automate the "archaic" method of hand-transferring PCR tubes between water baths.We demonstrate that this innovative unit can deliver high speed PCR (17 s per PCR cycle with the potential to go beyond the 1,522 bp long amplicons tested in this study and can amplify from templates down to at least 20 copies per reaction. The unit also accepts regular PCR tubes and glass capillary tubes. The PCR efficiency of our thermal cycler is not different from other commercial thermal cyclers. When combined with a rapid nucleic acid detection approach, the thermos thermal cycler (TTC can enable on-site molecular

Laboratory evaluation of a quantitative real-time reverse transcription PCR assay for the detection and identification of the four subgroups of avian metapneumovirus.

Science.gov (United States)

Guionie, O; Toquin, D; Sellal, E; Bouley, S; Zwingelstein, F; Allée, C; Bougeard, S; Lemière, S; Eterradossi, N

2007-02-01

Avian metapneumovirus (AMPV) is an important pathogen causing respiratory diseases and egg drops in several avian species. Four AMPV subgroups have been identified. The laboratory diagnosis of AMPV infections relies on serological methods, on labour-intensive virus isolation procedures, and on recently developed subgroup specific reverse transcription PCR (RT-PCR) protocols. In the present study, both the specificity and sensitivity of a commercial real-time reverse transcription PCR (RRT-PCR) for the detection and identification of the four AMPV subgroups were evaluated. Fifteen non-AMPV avian viruses belonging to 7 genera and 32 AMPV belonging to the 4 subgroups were tested. No non-AMPV virus was detected, whereas all AMPV viruses were identified in agreement with their previous molecular and antigenic subgroup assignment. The sensitivity and quantitating ability of the RRT-PCR assay were determined using serial dilutions of RNA derived either from AMPV virus stocks or from runoff transcripts. In all cases, linear dose/responses were observed. The detection limits of the different subgroups ranged from 500 to 5000 RNA copies and from 0.03 to 3.16TCID50/ml. The results were reproducible under laboratory conditions, thus showing that quantitative RRT-PCR is a new and powerful tool for the rapid and sensitive detection, identification and quantitation of AMPVs.

Species level identification of coagulase negative Staphylococcus spp. from buffalo using matrix-assisted laser desorption ionization-time of flight mass spectrometry and cydB real-time quantitative PCR.

Science.gov (United States)

Pizauro, Lucas J L; de Almeida, Camila C; Soltes, Glenn A; Slavic, Durda; Rossi-Junior, Oswaldo D; de Ávila, Fernando A; Zafalon, Luiz F; MacInnes, Janet I

2017-05-01

Incorrect identification of Staphylococcus spp. can have serious clinical and zoonotic repercussions. Accordingly, the aim of this study was to determine if matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and/or cydB real- time quantitative PCR (qPCR) could be used to accurately identify coagulase negative Staphylococcus spp. (CoNS) obtained from buffalo milk and milking environment samples. Seventy-five of 84 CoNS isolates could be identified to the species level (score value >1.99) using MALDI-TOF MS. However, as determined by cytochrome d ubiquinol oxidase subunit II (cydB) qPCR and by 16S RNA and cydB gene sequencing, 10S. agnetis strains were wrongly identified as S. hyicus by MALDI-TOF MS. In addition, 9 isolates identified by MALDI-TOF only to the genus level (score values between 1.70 and 1.99) could be identified to species by cydB qPCR. Our findings suggest that MALDI-TOF MS is a reliable method for rapid identification of S. chromogenes and S. epidermidis (species of interest both in human and veterinary medicine) and may be able to correctly identify other Staphylococcus spp. However, at present not all Staphylococcus spp. found in buffalo milk can be accurately identified by MALDI-TOF MS and for these organisms, the cydB qPCR developed in the current study may provide a reliable alternative method for rapid identification of CoNS species. Copyright © 2017 Elsevier B.V. All rights reserved.

A multiplex PCR method for rapid identification of Brachionus rotifers.

Science.gov (United States)

Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

2009-01-01

Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

Rapid and inexpensive body fluid identification by RNA profiling-based multiplex High Resolution Melt (HRM) analysis.

Science.gov (United States)

Hanson, Erin K; Ballantyne, Jack

2013-01-01

Positive identification of the nature of biological material present on evidentiary items can be crucial for understanding the circumstances surrounding a crime. However, traditional protein-based methods do not permit the identification of all body fluids and tissues, and thus molecular based strategies for the conclusive identification of all forensically relevant biological fluids and tissues need to be developed. Messenger RNA (mRNA) profiling is an example of such a molecular-based approach. Current mRNA body fluid identification assays involve capillary electrophoresis (CE) or quantitative RT-PCR (qRT-PCR) platforms, each with its own limitations. Both platforms require the use of expensive fluorescently labeled primers or probes. CE-based assays require separate amplification and detection steps thus increasing the analysis time. For qRT-PCR assays, only 3-4 markers can be included in a single reaction since each requires a different fluorescent dye. To simplify mRNA profiling assays, and reduce the time and cost of analysis, we have developed single- and multiplex body fluid High Resolution Melt (HRM) assays for the identification of common forensically relevant biological fluids and tissues. The incorporated biomarkers include IL19 (vaginal secretions), IL1F7 (skin), ALAS2 (blood), MMP10 (menstrual blood), HTN3 (saliva) and TGM4 (semen).  The HRM assays require only unlabeled PCR primers and a single saturating intercalating fluorescent dye (Eva Green). Each body-fluid-specific marker can easily be identified by the presence of a distinct melt peak. Usually, HRM assays are used to detect variants or isoforms for a single gene target. However, we have uniquely developed duplex and triplex HRM assays to permit the simultaneous detection of multiple targets per reaction. Here we describe the development and initial performance evaluation of the developed HRM assays. The results demonstrate the potential use of HRM assays for rapid, and relatively inexpensive

Identification and differentiation of the twenty six bluetongue virus serotypes by RT-PCR amplification of the serotype-specific genome segment 2.

Directory of Open Access Journals (Sweden)

Narender S Maan

Full Text Available Bluetongue (BT is an arthropod-borne viral disease, which primarily affects ruminants in tropical and temperate regions of the world. Twenty six bluetongue virus (BTV serotypes have been recognised worldwide, including nine from Europe and fifteen in the United States. Identification of BTV serotype is important for vaccination programmes and for BTV epidemiology studies. Traditional typing methods (virus isolation and serum or virus neutralisation tests (SNT or VNT are slow (taking weeks, depend on availability of reference virus-strains or antisera and can be inconclusive. Nucleotide sequence analyses and phylogenetic comparisons of genome segment 2 (Seg-2 encoding BTV outer-capsid protein VP2 (the primary determinant of virus serotype were completed for reference strains of BTV-1 to 26, as well as multiple additional isolates from different geographic and temporal origins. The resulting Seg-2 database has been used to develop rapid (within 24 h and reliable RT-PCR-based typing assays for each BTV type. Multiple primer-pairs (at least three designed for each serotype were widely tested, providing an initial identification of serotype by amplification of a cDNA product of the expected size. Serotype was confirmed by sequencing of the cDNA amplicons and phylogenetic comparisons to previously characterised reference strains. The results from RT-PCR and sequencing were in perfect agreement with VNT for reference strains of all 26 BTV serotypes, as well as the field isolates tested. The serotype-specific primers showed no cross-amplification with reference strains of the remaining 25 serotypes, or multiple other isolates of the more closely related heterologous BTV types. The primers and RT-PCR assays developed in this study provide a rapid, sensitive and reliable method for the identification and differentiation of the twenty-six BTV serotypes, and will be updated periodically to maintain their relevance to current BTV distribution and

Multiplex PCR identification of Taenia spp. in rodents and carnivores.

Science.gov (United States)

Al-Sabi, Mohammad N S; Kapel, Christian M O

2011-11-01

The genus Taenia includes several species of veterinary and public health importance, but diagnosis of the etiological agent in definitive and intermediate hosts often relies on labor intensive and few specific morphometric criteria, especially in immature worms and underdeveloped metacestodes. In the present study, a multiplex PCR, based on five primers targeting the 18S rDNA and ITS2 sequences, produced a species-specific banding patterns for a range of Taenia spp. Species typing by the multiplex PCR was compared to morphological identification and sequencing of cox1 and/or 12S rDNA genes. As compared to sequencing, the multiplex PCR identified 31 of 32 Taenia metacestodes from rodents, whereas only 14 cysts were specifically identified by morphology. Likewise, the multiplex PCR identified 108 of 130 adult worms, while only 57 were identified to species by morphology. The tested multiplex PCR system may potentially be used for studies of Taenia spp. transmitted between rodents and carnivores.

A quick method for species identification of Japanese eel (Anguilla japonica) using real-time PCR: an onboard application for use during sampling surveys.

Science.gov (United States)

Watanabe, Shun; Minegishi, Yuki; Yoshinaga, Tatsuki; Aoyama, Jun; Tsukamoto, Katsumi

2004-01-01

To compensate for the limited number of morphological characteristics of fish eggs and larvae, we established a convenient and robust method of species identification for eggs of the Japanese eel (Anguilla japonica) using a real-time polymerase chain reaction (PCR) that can be performed onboard research ships at sea. A total of about 1.2 kbp of the mitochondrial 16S ribosomal RNA gene sequences from all species of Anguilla and 3 other anguilliform species were compared to design specific primer pairs and a probe for A. japonica. This real-time PCR amplification was conducted for a total of 44 specimens including A. japonica, A. marmorata, A. bicolor pacifica, and 6 other anguilliform species. Immediate PCR amplification was only observed in A. japonica. We then tested this method under onboard conditions and obtained the same result as had been produced in the laboratory. These results suggest that real-time PCR can be a powerful tool for detecting Japanese eel eggs and newly hatched larvae immediately after onboard sampling during research cruises and will allow targeted sampling efforts to occur rapidly in response to any positive onboard identification of the eggs and larvae of this species.

Identification and molecular epidemiology of dermatophyte isolates by repetitive-sequence-PCR-based DNA fingerprinting using the DiversiLab system in Turkey.

Science.gov (United States)

Koc, A Nedret; Atalay, Mustafa A; Inci, Melek; Sariguzel, Fatma M; Sav, Hafize

2017-05-01

Dermatophyte species, isolation and identification in clinical samples are still difficult and take a long time. The identification and molecular epidemiology of dermatophytes commonly isolated in a clinical laboratory in Turkey by repetitive sequence-based PCR (rep-PCR) were assessed by comparing the results with those of reference identification. A total of 44 dermatophytes isolated from various clinical specimens of 20 patients with superficial mycoses in Kayseri and 24 patients in Hatay were studied. The identification of dermatophyte isolates was based on the reference identification and rep-PCR using the DiversiLab System (BioMerieux). The genotyping of dermatophyte isolates from different patients was determined by rep-PCR. In the identification of dermatophyte isolates, agreement between rep-PCR and conventional methods was 87.8 % ( 36 of 41). The dermatophyte strains belonged to four clones (A -D) which were determined by the use of rep-PCR. The dermatophyte strains in Clone B, D showed identical patterns with respect to the region. In conclusion, rep-PCR appears to be useful for evaluation of the identification and clonal relationships between Trichophyton rubrum species complex and Trichophyton mentagrophytes species complex isolates. The similarity and diversity of these isolates may be assessed according to different regions by rep-PCR. © 2017 Blackwell Verlag GmbH.

PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

Science.gov (United States)

Janczarek, Monika; Palusińska-Szysz, Marta

2016-05-01

Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.

Detection and identification of Rift Valley fever virus in mosquito vectors by quantitative real-time PCR.

Science.gov (United States)

Mwaengo, D; Lorenzo, G; Iglesias, J; Warigia, M; Sang, R; Bishop, R P; Brun, A

2012-10-01

Diagnostic methods allowing for rapid identification of pathogens are crucial for controlling and preventing dissemination after disease outbreaks as well as for use in surveillance programs. For arboviruses, detection of the presence of virus in their arthropod hosts is important for monitoring of viral activity and quantitative information is useful for modeling of transmission dynamics. In this study, molecular detection of Rift Valley fever virus (RVFV) in mosquito samples from the 2006 to 2007 East African outbreaks was performed using quantitative real-time PCR assay (qRT-PCR). Specific RVFV sequence-based primer/fluorogenic (TaqMan) probe sets were derived from the L and S RNA segments of the virus. Both primer-probe L and S segment-based combinations detected genomic RVFV sequences, with generally comparable levels of sensitivity. Viral loads from three mosquito species, Aedes mcintoshi, Aedes ochraceus and Mansonia uniformis were estimated and significant differences of between 5- and 1000-fold were detected between Ae. mcintoshi and M. uniformis using both the L and S primer-probe-based assays. The genetic relationships of the viral sequences in mosquito samples were established by partial M segment sequencing and assigned to the two previously described viral lineages defined by analysis of livestock isolates obtained during the 2006-2007 outbreak, confirming that similar viruses were present in both the vector and mammalian host. The data confirms the utility of qRT-PCR for identification and initial quantification of virus in mosquito samples during RVFV outbreaks. Copyright © 2012 Elsevier B.V. All rights reserved.

The rapid identification for the unaware radioactive material

International Nuclear Information System (INIS)

Jin Yuren; Cheng Zhiwei; Xu Hui; Wang Jiang; Han Xiaoyuan; Long Bin

2010-01-01

The unaware radioactive material(URM) appeared in the society may induce serious deterministic effect, even result in havoc and instability of the society. The rapid and accurate identification for URM is the premise for its reasonable treatment. In this paper, an identification procedure for URM was developed and which was successfully implemented in the identification of an URM. The In-situ HPGe gamma spectrometry etc was employed for the rapid preliminary identification, and the laboratory HPGe gamma spectrometry and ICP-MS as well as the density measurement were used for its final identification. One unaware radioactive material was assayed, and the results indicate that it is a kind of high pure depleted uranium metal with the 235 U/ 238 U atomic ratio of 0.454%. (authors)

A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.

Science.gov (United States)

Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin

2017-01-01

This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.

HybProbes-based real-time PCR assay for specific identification of Streptomyces scabies and Streptomyces europaeiscabiei, the potato common scab pathogens.

Science.gov (United States)

Xu, R; Falardeau, J; Avis, T J; Tambong, J T

2016-02-01

The aim of this study was to develop and validate a HybProbes-based real-time PCR assay targeting the trpB gene for specific identification of Streptomyces scabies and Streptomyces europaeiscabiei. Four primer pairs and a fluorescent probe were designed and evaluated for specificity in identifying S. scabies and Streptomyces europaeiscabiei, the potato common scab pathogens. The specificity of the HybProbes-based real-time PCR assay was evaluated using 46 bacterial strains, 23 Streptomyces strains and 23 non-Streptomyces bacterial species. Specific and strong fluorescence signals were detected from all nine strains of S. scabies and Streptomyces europaeiscabiei. No fluorescence signal was detected from 14 strains of other Streptomyces species and all non-Streptomyces strains. The identification was corroborated by the melting curve analysis that was performed immediately after the amplification step. Eight of the nine S. scabies and S. europaeiscabiei strains exhibited a unique melting peak, at Tm of 69·1°C while one strain, Warba-6, had a melt peak at Tm of 65·4°C. This difference in Tm peaks could be attributed to a guanine to cytosine mutation in strain Warba-6 at the region spanning the donor HybProbe. The reported HybProbes assay provides a more specific tool for accurate identification of S. scabies and S. europaeiscabiei strains. This study reports a novel assay based on HybProbes chemistry for rapid and accurate identification of the potato common scab pathogens. Since the HybProbes chemistry requires two probes for positive identification, the assay is considered to be more specific than conventional PCR or TaqMan real-time PCR. The developed assay would be a useful tool with great potential in early diagnosis and detection of common scab pathogens of potatoes in infected plants or for surveillance of potatoes grown in soil environment. © 2015 Her Majesty the Queen in Right of Canada © 2015 The Society for Applied Microbiology.

A random PCR screening system for the identification of type 1 human herpes simplex virus.

Science.gov (United States)

Yu, Xuelian; Shi, Bisheng; Gong, Yan; Zhang, Xiaonan; Shen, Silan; Qian, Fangxing; Gu, Shimin; Hu, Yunwen; Yuan, Zhenghong

2009-10-01

Several viral diseases exhibit measles-like symptoms. Differentiation of suspected cases of measles with molecular epidemiological techniques in the laboratory is useful for measles surveillance. In this study, a random PCR screening system was undertaken for the identification of isolates from patients with measles-like symptoms who exhibited cytopathic effects, but who had negative results for measles virus-specific reverse transcription (RT)-PCR and indirect immunofluorescence assays. Sequence analysis of random amplified PCR products showed that they were highly homologous to type 1 human herpes simplex virus (HSV-1). The results were further confirmed by an HSV-1-specific TaqMan real-time PCR assay. The random PCR screening system described in this study provides an efficient procedure for the identification of unknown viral pathogens. Measles-like symptoms can also be caused by HSV-1, suggesting the need to include HSV-1 in differential diagnoses of measles-like diseases.

Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

Directory of Open Access Journals (Sweden)

Xiangdong Kong

Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

Science.gov (United States)

Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

2017-04-01

Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

An improved PCR method for direct identification of Porphyra (Bangiales, Rhodophyta) using conchocelis based on a RUBISCO intergenic spacer

Science.gov (United States)

Wang, Chao; Dong, Dong; Wang, Guangce; Zhang, Baoyu; Peng, Guang; Xu, Pu; Tang, Xiaorong

2009-09-01

An improved method of PCR in which the small segment of conchocelis is amplified directly without DNA extraction was used to amplify a RUBISCO intergenic spacer DNA fragment from nine species of red algal genus Porphyra (Bangiales, Rhodophyta), including Porphyra yezoensis (Jiangsu, China), P. haitanensis (Fujian, China), P. oligospermatangia (Qingdao, China), P. katadai (Qingdao, China), P. tenera (Qingdao, China), P. suborboculata (Fujian, China), P. pseudolinearis (Kogendo, Korea), P. linearis (Devon, England), and P. fallax (Seattle, USA). Standard PCR and the method developed here were both conducted using primers specific for the RUBISCO spacer region, after which the two PCR products were sequenced. The sequencing data of the amplicons obtained using both methods were identical, suggesting that the improved PCR method was functional. These findings indicate that the method developed here may be useful for the rapid identification of species of Porphyra in a germplasm bank. In addition, a phylogenetic tree was constructed using the RUBISCO spacer and partial rbcS sequence, and the results were in concordant with possible alternative phylogenies based on traditional morphological taxonomic characteristics, indicating that the RUBISCO spacer is a useful region for phylogenetic studies.

[Real-time PCR in rapid diagnosis of Aeromonas hydrophila necrotizing soft tissue infections].

Science.gov (United States)

Kohayagawa, Yoshitaka; Izumi, Yoko; Ushita, Misuzu; Niinou, Norio; Koshizaki, Masayuki; Yamamori, Yuji; Kaneko, Sakae; Fukushima, Hiroshi

2009-11-01

We report a case of rapidly progressive necrotizing soft tissue infection and sepsis followed by a patient's death. We suspected Vibrio vulnificus infection because the patient's underlying disease was cirrhosis and the course extremely rapid. No microbe had been detected at death. We extracted DNA from a blood culture bottle. SYBR green I real-time PCR was conducted but could not detect V. vulnificus vvh in the DNA sample. Aeromonas hydrophila was cultured and identified in blood and necrotized tissue samples. Real-time PCR was conducted to detect A. hydrophila ahh1, AHCYTOEN and aerA in the DNA sample extracted from the blood culture bottle and an isolated necrotized tissue strain, but only ahh1 was positive. High-mortality in necrotizing soft tissue infections makes it is crucial to quickly detect V. vulnificus and A. hydrophila. We found real-time PCR for vvh, ahh1, AHCYTOEN, and aerA useful in detecting V. vulnificus and A. hydrophila in necrotizing soft tissue infections.

Sex identification of four penguin species using locus-specific PCR.

Science.gov (United States)

Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng

2013-01-01

Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.

Direct Identification of Enteroviruses in Cerebrospinal Fluid of Patients with Suspected Meningitis by Nested PCR Amplification

Directory of Open Access Journals (Sweden)

Alexandr Krasota

2016-01-01

Full Text Available Enteroviruses, the most common human viral pathogens worldwide, have been associated with serous meningitis, encephalitis, syndrome of acute flaccid paralysis, myocarditis and the onset of diabetes type 1. In the future, the rapid identification of the etiological agent would allow to adjust the therapy promptly and thereby improve the course of the disease and prognosis. We developed RT-nested PCR amplification of the genomic region coding viral structural protein VP1 for direct identification of enteroviruses in clinical specimens and compared it with the existing analogs. One-hundred-fifty-nine cerebrospinal fluids (CSF from patients with suspected meningitis were studied. The amplification of VP1 genomic region using the new method was achieved for 86 (54.1% patients compared with 75 (47.2%, 53 (33.3% and 31 (19.5% achieved with previously published methods. We identified 11 serotypes of the Enterovirus species B in 2012, including relatively rare echovirus 14 (E-14, E-15 and E-32, and eight serotypes of species B and 5 enteroviruses A71 (EV-A71 in 2013. The developed method can be useful for direct identification of enteroviruses in clinical material with the low virus loads such as CSF.

Rapid Methods for the Laboratory Identification of Pathogenic Microorganisms.

Science.gov (United States)

1982-09-01

coli Hemophilus influenzae Bacillus anthracis Bacillus circulans Bacillus coagulans Bacillus cereus T Candida albicans Cryptococcus neoformans Legionel...reveree aide If neceeeary and Identify by block number) Lectins: Rapid Identification, Bacillus anthracisjCryptococcus " neoformans. Neisseria...field-type kit for the rapid identification of Bacillus anthracis. We have shown that certain lectins will selectively interact with B. anthracis

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

Science.gov (United States)

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

Rapid identification of the medicinal plant Taraxacum formosanum ...

African Journals Online (AJOL)

Original identification of medicinal plants is essential for quality control. In this study, the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA served as a DNA barcode and was amplified by allele-specific PCR. This approach was exploited to differentiate Taraxacum formosanum from five related adulterants. Using a ...

A rapid method for screening arrayed plasmid cDNA library by PCR

International Nuclear Information System (INIS)

Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

1999-01-01

Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

Science.gov (United States)

Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

2001-10-01

Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

Performance of rapid diagnostic test, blood-film microscopy and PCR for the diagnosis of malaria infection among febrile children from Korogwe District, Tanzania

DEFF Research Database (Denmark)

Mahende, Coline; Ngasala, Billy; Lusingu, John

2016-01-01

with fever and/or history of fever in the previous 48 h attending outpatient clinics. Blood samples were collected for identification of Plasmodium falciparum infection using histidine-rich-protein-2 (HRP-2)-based malaria RDT, light microscopy and conventional PCR. Results: A total of 867 febrile patients......Background: Rapid diagnostic tests (RDT) and light microscopy are still recommended for diagnosis to guide the clinical management of malaria despite difficult challenges in rural settings. The performance of these tests may be affected by several factors, including malaria prevalence and intensity...... of transmission. The study evaluated the diagnostic performance of malaria RDT, light microscopy and polymerase chain reaction (PCR) in detecting malaria infections among febrile children at outpatient clinic in Korogwe District, northeastern Tanzania. Methods: The study enrolled children aged 2-59 months...

Using molecular techniques for rapid detection of Salmonella ...

African Journals Online (AJOL)

PRECIOUS

2010-02-01

Feb 1, 2010 ... A total of 152 samples of chicken and chicken products ... detection of Salmonella species in the collected field samples ... that 16 million new cases of typhoid fever occur each ... vative methods for the rapid identification of Salmonella ... saved for the PCR-Non Selective test (PCR-NS) and 1 ml of the.

The rapid identification of human influenza neuraminidase N1 and N2 subtypes by ELISA.

Science.gov (United States)

Barr, I G; McCaig, M; Durrant, C; Shaw, R

2006-11-10

An ELISA assay was developed to allow the rapid and accurate identification of human influenza A N1 and N2 neuraminidases. Initial testing using a fetuin pre-coating of wells correctly identified 81.7% of the neuraminidase type from a series of human A(H1N1), A(H1N2) and A(H3N2) viruses. This result could be improved to detect the neuraminidase subtype of almost all human influenza A viruses from a large panel of viruses isolated from 2000 to 2005, if the fetuin pre-coating was removed and the viruses were coated directly onto wells. This method is simple, rapid and can be used to screen large numbers of currently circulating human influenza A viruses for their neurraminidase subtype and is a good alternative to RT-PCR.

Molecular detection of Plasmodium knowlesi in a Dutch traveler by real-time PCR.

Science.gov (United States)

Link, Lonneke; Bart, Aldert; Verhaar, Nienke; van Gool, Tom; Pronk, Marjolijn; Scharnhorst, Volkher

2012-07-01

Plasmodium knowlesi infection with low parasitemia presents a diagnostic challenge, as rapid diagnostic tests are often negative and identification to the species level by microscopy is difficult. P. knowlesi malaria in a traveler is described, and real-time PCR is demonstrated to support fast and reliable diagnosis and identification to the species level.

A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

OpenAIRE

Farkhondeh Saba; Moslem Papizadeh; Javad Khansha; Mahshid Sedghi; Mehrnoosh Rasooli; Mohammad Ali Amoozegar; Mohammad Reza Soudi; Seyed Abolhassan Shahzadeh Fazeli

2016-01-01

Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR). Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Me...

Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

Directory of Open Access Journals (Sweden)

Jaroslav Pochop

2013-10-01

Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

Science.gov (United States)

Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

Extraction of DNA from honey and its amplification by PCR for botanical identification

Directory of Open Access Journals (Sweden)

Sona Arun Jain

2013-12-01

Full Text Available The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

Comprehensive and Rapid Real-Time PCR Analysis of 21 Foodborne Outbreaks

Directory of Open Access Journals (Sweden)

Hiroshi Fukushima

2009-01-01

Full Text Available A set of four duplex SYBR Green I PCR (SG-PCR assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.

Development of a Real-Time PCR for a Sensitive One-Step Coprodiagnosis Allowing both the Identification of Carnivore Feces and the Detection of Toxocara spp. and Echinococcus multilocularis

Science.gov (United States)

Umhang, Gérald; Poulle, Marie-Lazarine; Millon, Laurence

2016-01-01

Studying the environmental occurrence of parasites of concern for humans and animals based on coprosamples is an expanding field of work in epidemiology and the ecology of health. Detecting and quantifying Toxocara spp. and Echinococcus multilocularis, two predominant zoonotic helminths circulating in European carnivores, in feces may help to better target measures for prevention. A rapid, sensitive, and one-step quantitative PCR (qPCR) allowing detection of E. multilocularis and Toxocara spp. was developed in the present study, combined with a host fecal test based on the identification of three carnivores (red fox, dog, and cat) involved in the life cycles of these parasites. A total of 68 coprosamples were collected from identified specimens from Vulpes vulpes, Canis lupus familiaris, Canis lupus, Felis silvestris catus, Meles meles, Martes foina, and Martes martes. With DNA coprosamples, real-time PCR was performed in duplex with a qPCR inhibitor control specifically designed for this study. All the coprosample host identifications were confirmed by qPCR combined with sequencing, and parasites were detected and confirmed (E. multilocularis in red foxes and Toxocara cati in cats; 16% of samples presented inhibition). By combining parasite detection and quantification, the host fecal test, and a new qPCR inhibitor control, we created a technique with a high sensitivity that may considerably improve environmental studies of pathogens. PMID:26969697

Development of a Real-Time PCR for a Sensitive One-Step Coprodiagnosis Allowing both the Identification of Carnivore Feces and the Detection of Toxocara spp. and Echinococcus multilocularis.

Science.gov (United States)

Knapp, Jenny; Umhang, Gérald; Poulle, Marie-Lazarine; Millon, Laurence

2016-05-15

Studying the environmental occurrence of parasites of concern for humans and animals based on coprosamples is an expanding field of work in epidemiology and the ecology of health. Detecting and quantifying Toxocara spp. and Echinococcus multilocularis, two predominant zoonotic helminths circulating in European carnivores, in feces may help to better target measures for prevention. A rapid, sensitive, and one-step quantitative PCR (qPCR) allowing detection of E. multilocularis and Toxocara spp. was developed in the present study, combined with a host fecal test based on the identification of three carnivores (red fox, dog, and cat) involved in the life cycles of these parasites. A total of 68 coprosamples were collected from identified specimens from Vulpes vulpes, Canis lupus familiaris, Canis lupus, Felis silvestris catus, Meles meles, Martes foina, and Martes martes With DNA coprosamples, real-time PCR was performed in duplex with a qPCR inhibitor control specifically designed for this study. All the coprosample host identifications were confirmed by qPCR combined with sequencing, and parasites were detected and confirmed (E. multilocularis in red foxes and Toxocara cati in cats; 16% of samples presented inhibition). By combining parasite detection and quantification, the host fecal test, and a new qPCR inhibitor control, we created a technique with a high sensitivity that may considerably improve environmental studies of pathogens. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Multiplex PCR Assay for Identification of Human Diarrheagenic Escherichia coli

OpenAIRE

Toma, Claudia; Lu, Yan; Higa, Naomi; Nakasone, Noboru; Chinen, Isabel; Baschkier, Ariela; Rivas, Marta; Iwanaga, Masaaki

2003-01-01

A multiplex PCR assay for the identification of human diarrheagenic Escherichia coli was developed. The targets selected for each category were eae for enteropathogenic E. coli, stx for Shiga toxin-producing E. coli, elt and est for enterotoxigenic E. coli, ipaH for enteroinvasive E. coli, and aggR for enteroaggregative E. coli. This assay allowed the categorization of a diarrheagenic E. coli strain in a single reaction tube.

Rapid diagnosis and identification by PCR of Yersinia ruckeri isolated of Oncorhynchus mykiss from Canta, Lima, Peru Diagnóstico e identificación rápidos por PCR de Yersinia ruckeri aislada de Oncorhynchus mykiss procedentes de Canta, Lima, Perú

Directory of Open Access Journals (Sweden)

Susana Sirvas-Cornejo

2012-02-01

Full Text Available Twenty individuals of rainbow trout were sampled (fry and juveniles from Acochinchan Fishfarm (Canta, Lima - Peru, and analyzed with the Polimerase Chain Reaction test (PCR in order to achieve a rapid identification of Yersinia ruckeri, which is the pathogen agent that causes the enteric red mouth disease (ERM and produces high rates of mortality. Nine fish samples were asymptomatic, while 11 of them showed signs of ERM. In addition, 22 bacterial strains were isolated from the liver, spleen and kidney. PCR and specific primers (16S rRNA, were used to amplified a specific 575 bp DNA fragment of Yersinia ruckeri. Nineteen strains were identified as Yersinia ruckeri by PCR in symptomatic and asymptomatic fishes. It was established a diagnosis time of 26 hours, compared with the 2 or 3 days that would take the diagnosis using biochemical tests.Se muestrearon 20 ejemplares (alevines y juveniles de trucha arco iris cultivados en la piscifactoría Acochinchán (Canta, Lima, Perú, y se les aplico la técnica de la Reacción en Cadena de la Polimerasa (PCR con la finalidad de obtener una identificación rápida del agente patógeno Yersinia ruckeri que produce la enfermedad entérica de la boca roja (ERM y genera elevadas tasas de mortalidad. Nueve ejemplares fueron asintomáticos mientras que 11 presentaron signos de ERM. Se aislaron 22 cepas bacterianas del hígado, bazo y riñón. Se empleó la técnica de la PCR para la amplificación y cebadores específicos (ARNr 16S, que permitieron amplificar un fragmento de ADN de 575 pb de Yersinia ruckeri. Diecinueve cepas fueron identificadas como Yersinia ruckeri mediante la PCR, tanto en peces sintomáticos como asintomáticos. Se estableció un tiempo de diagnóstico de 26 horas, en comparación con los 2 ó 3 días que duraría el diagnóstico empleando las pruebas bioquímicas.

Rapid detection and identification of Bacillus anthracis in food using pyrosequencing technology.

Science.gov (United States)

Amoako, Kingsley K; Janzen, Timothy W; Shields, Michael J; Hahn, Kristen R; Thomas, Matthew C; Goji, Noriko

2013-08-01

The development of advanced methodologies for the detection of Bacillus anthracis has been evolving rapidly since the release of the anthrax spores in the mail in 2001. Recent advances in detection and identification techniques could prove to be an essential component in the defense against biological attacks. Sequence based such as pyrosequencing, which has the capability to determine short DNA stretches in real-time using biotinylated PCR amplicons, has potential biodefense applications. Using markers from the virulence plasmids (pXO1 and pXO2) and chromosomal regions, we have demonstrated the power of this technology in the rapid, specific and sensitive detection of B. anthracis spores in food matrices including milk, juice, bottled water, and processed meat. The combined use of immunomagnetic separation and pyrosequencing showed positive detection when liquid foods (bottled water, milk, juice), and processed meat were experimentally inoculated with 6CFU/mL and 6CFU/g, respectively, without an enrichment step. Pyrosequencing is completed in about 60min (following PCR amplification) and yields accurate and reliable results with an added layer of confidence. The entire assay (from sample preparation to sequencing information) can be completed in about 7.5h. A typical run on food samples yielded 67-80bp reads with 94-100% identity to the expected sequence. This sequence based approach is a novel application for the detection of anthrax spores in food with potential application in foodborne bioterrorism response and biodefense involving the use of anthrax spores. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

Soil Baiting, Rapid PCR Assay and Quantitative Real Time PCR to Diagnose Late Blight of Potato in Quarantine Programs

Directory of Open Access Journals (Sweden)

Touseef Hussain

2018-05-01

Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.

Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR

OpenAIRE

Luo, Guizhen; Mitchell, Thomas G.

2002-01-01

A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...

Sensitive identification of mycobacterial species using PCR-RFLP on bronchial washings.

Science.gov (United States)

Hidaka, E; Honda, T; Ueno, I; Yamasaki, Y; Kubo, K; Katsuyama, T

2000-03-01

In 98 patients (24 with active pulmonary tuberculosis [TB] lesions, 28 with cured TB lesions, and 46 with nontuberculous opacities [control group] in chest CT scans), we examined whether washing the bronchus after brushing the lesion, then applying polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) to the bronchial washings might be useful for diagnosing TB and nontuberculous mycobacteriosis (NTMosis). After biopsy and brushing with a bronchoscope, the bronchus connecting to the lesion was washed with 20 ml saline. The saline used for washing the brushes (5 ml; brushing sample), and 3 to 10 ml saline aspirated through the forceps channel (washing sample) were examined by PCR-RFLP, which proved able to identify Mycobacterium tuberculosis and seven species of nontuberculous mycobacteria (NTM). The values obtained for the sensitivity of the PCR-RFLP with respect to the brushing sample, the washing sample, and both samples mixed together were 70, 76, and 91%, respectively, when only patients who were culture-positive or radiologically improved after antituberculous therapy were considered as showing true infection. A mixture of brushing and washing samples provides useful material for PCR and culture, and the PCR-RFLP used here is a good method for the simultaneous identification of several species of mycobacterium (including M. tuberculosis).

Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples

Directory of Open Access Journals (Sweden)

Denis Martine

2011-05-01

Full Text Available Abstract Background Campylobacter spp., especially Campylobacter jejuni (C. jejuni and Campylobacter coli (C. coli, are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. Results With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 102 CFU/g of faeces, 1.3 × 102 CFU/g of feed, and 1.0 × 103 CFU/m2 for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R2 = 0.90 and R2 = 0.93 respectively. Conclusion The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new

Real-time PCR for Leishmania species identification: Evaluation and comparison with classical techniques.

Science.gov (United States)

de Morais, Rayana Carla Silva; da Costa Oliveira, Cintia Nascimento; de Albuquerque, Suênia da Cunha Gonçalves; Mendonça Trajano Silva, Lays Adrianne; Pessoa-E-Silva, Rômulo; Alves da Cruz, Heidi Lacerda; de Brito, Maria Edileuza Felinto; de Paiva Cavalcanti, Milena

2016-06-01

Cutaneous leishmaniasis (CL) is a parasitic disease caused by various Leishmania species. Several studies have shown that real time quantitative PCR (qPCR) can be used for Leishmania spp. identification by analyzing the melting temperature (Tm). Thus, the aim of this study was to evaluate the viability of qPCR for differentiating eight closely related Leishmania species that cause the same clinical form of the disease and to compare the results with classical techniques. qPCR assays for standardizing the Tm using reference strains were performed. After the CL diagnosis on blood samples of domestic animals, positive samples were analyzed by their Tm and qPCR products were purified and sequenced. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by Tm. A Restriction Fragment Length Polymorphism (RFLP) assay, a reference test, was also standardized, by using the reference strains. Through standardization of Tm for Leishmania spp., two Tm ranges were created for analysis: 1 (Tm = 78-79.99 °C) included Leishmania (V.) braziliensis, Leishmania (V.) panamensis, Leishmania (V.) lainsoni, Leishmania (V.) guyanensis and Leishmania (V.) shawi; and 2 (Tm = 80-82.2 °C) included Leishmania (V.) naiffi, Leishmania (L.) amazonensis and Leishmania (L.) mexicana. A total of 223 positive blood samples were analyzed, with 58 included in range 1 and 165 in range 2. L. (V.) braziliensis, L. (V.) panamensis and L. (V.) guyanensis were identified by sequencing, while L. (V.) braziliensis, L. (L.) mexicana and L. (V.) panamensis were identified by RFLP analysis. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by qPCR Tm analysis; five were classified in range 1 and five in range 2. A concordance of 80% was calculated between qPCR and the gold-standard (MLEE) with no significant difference between the methods (p = 0.6499); a similar result was observed for sequencing

Exploring MALDI-TOF MS approach for a rapid identification of Mycobacterium avium ssp. paratuberculosis field isolates.

Science.gov (United States)

Ricchi, M; Mazzarelli, A; Piscini, A; Di Caro, A; Cannas, A; Leo, S; Russo, S; Arrigoni, N

2017-03-01

The aim of the study was to explore the suitability of matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS) for a rapid and correct identification of Mycobacterium avium ssp. paratuberculosis (MAP) field isolates. MALDI-TOF MS approach is becoming one of the most popular tests for the identification of intact bacterial cells which has been shown to be fast and reliable. For this purpose, 36 MAP field isolates were analysed through MALDI-TOF MS and the spectra compared with two different databases: one provided by the vendor of the system employed (Biotyper ver. 3·0; Bruker Daltonics) and a homemade database containing spectra from both tuberculous and nontuberculous Mycobacteria. Moreover, principal component analysis procedure was employed to confirm the ability of MALDI-TOF MS to discriminate between very closely related subspecies. Our results suggest MAP can be differentiated from other Mycobacterium species, both when the species are very close (M. intracellulare) and when belonging to different subspecies (M. avium ssp. avium and M. avium ssp. silvaticum). The procedure applied is fast, easy to perform, and achieves an earlier accurate species identification of MAP and nontuberculous Mycobacteria in comparison to other procedures. The gold standard test for the diagnosis of paratuberculosis is still isolation of MAP by cultural methods, but additional assays, such as qPCR and subculturing for determination of mycobactin dependency are required to confirm its identification. We have provided here evidence pertaining to the usefulness of MALDI-TOF MS approach for a rapid identification of this mycobacterium among other members of M. avium complex. © 2016 The Society for Applied Microbiology.

Rapid Identification and Quantification of Aureococcus anophagefferens by qPCR Method (Taqman) in the Qinhuangdao Coastal Area: A Region for Recurrent Brown Tide Breakout in China.

Science.gov (United States)

Wang, Li-Ping; Lei, Kun

2016-12-01

Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.

Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

Science.gov (United States)

Day, J B; Basavanna, U

2015-01-01

To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

OpenAIRE

Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

1999-01-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...

Rapid and Accurate Molecular Identification of the Emerging Multidrug-Resistant Pathogen Candida auris.

Science.gov (United States)

Kordalewska, Milena; Zhao, Yanan; Lockhart, Shawn R; Chowdhary, Anuradha; Berrio, Indira; Perlin, David S

2017-08-01

Candida auris is an emerging multidrug-resistant fungal pathogen causing nosocomial and invasive infections associated with high mortality. C. auris is commonly misidentified as several different yeast species by commercially available phenotypic identification platforms. Thus, there is an urgent need for a reliable diagnostic method. In this paper, we present fast, robust, easy-to-perform and interpret PCR and real-time PCR assays to identify C. auris and related species: Candida duobushaemulonii , Candida haemulonii , and Candida lusitaniae Targeting rDNA region nucleotide sequences, primers specific for C. auris only or C. auris and related species were designed. A panel of 140 clinical fungal isolates was used in both PCR and real-time PCR assays followed by electrophoresis or melting temperature analysis, respectively. The identification results from the assays were 100% concordant with DNA sequencing results. These molecular assays overcome the deficiencies of existing phenotypic tests to identify C. auris and related species. Copyright © 2017 Kordalewska et al.

Rapid Sanger sequencing of the 16S rRNA gene for identification of some common pathogens.

Directory of Open Access Journals (Sweden)

Linxiang Chen

Full Text Available Conventional Sanger sequencing remains time-consuming and laborious. In this study, we developed a rapid improved sequencing protocol of 16S rRNA for pathogens identification by using a new combination of SYBR Green I real-time PCR and Sanger sequencing with FTA® cards. To compare the sequencing quality of this method with conventional Sanger sequencing, 12 strains, including three kinds of strains (1 reference strain and 3 clinical strains, which were previously identified by biochemical tests, which have 4 Pseudomonas aeruginosa, 4 Staphyloccocus aureus and 4 Escherichia coli, were targeted. Additionally, to validate the sequencing results and bacteria identification, expanded specimens with 90 clinical strains, also comprised of the three kinds of strains which included 30 samples respectively, were performed as just described. The results showed that although statistical differences (P<0.05 were found in sequencing quality between the two methods, their identification results were all correct and consistent. The workload, the time consumption and the cost per batch were respectively light versus heavy, 8 h versus 11 h and $420 versus $400. In the 90 clinical strains, all of the Pseudomonas aeruginosa and Staphyloccocus aureus strains were correctly identified, but only 26.7% of the Escherichia coli strains were recognized as Escherichia coli, while 33.3% as Shigella sonnei and 40% as Shigella dysenteriae. The protocol described here is a rapid, reliable, stable and convenient method for 16S rRNA sequencing, and can be used for Pseudomonas aeruginosa and Staphyloccocus aureus identification, yet it is not completely suitable for discriminating Escherichia coli and Shigella strains.

A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans

Science.gov (United States)

Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.

2000-01-01

Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130

Use of species-specific PCR for the identification of 10 sea cucumber species

Science.gov (United States)

Wen, Jing; Zeng, Ling

2014-11-01

We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus.

Science.gov (United States)

Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O

2017-10-01

Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT ™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco ™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.

Rapid identification of drug resistant Candida species causing recurrent vulvovaginal candidiasis.

Science.gov (United States)

Diba, Kambiz; Namaki, Atefeh; Ayatolahi, Haleh; Hanifian, Haleh

2012-01-01

Some yeast agents including Candida albicans, Candida tropicalis and Candida glabrata have a role in recurrent vulvovaginal candidiasis. We studied the frequency of both common and recurrent vulvovaginal candidiasis in symptomatic cases which were referred to Urmia Medical Sciences University related gynecology clinics using morphologic and molecular methods. The aim of this study was the identification of Candida species isolated from recurrent vulvovaginal candidiasis cases using a rapid and reliable molecular method. Vaginal swabs obtained from each case, were cultured on differential media including cornmeal agar and CHROM agar Candida. After 48 hours at 37℃, the cultures were studied for growth characteristics and color production respectively. All isolates were identified using the molecular method of PCR - restriction fragment length polymorphism. Among all clinical specimens, we detected 19 ( 16 % ) non fungal agents, 87 ( 82.1 % ) yeasts and 2 ( 1.9 % ) multiple infections. The yeast isolates identified morphologically included Candida albicans ( n = 62 ), Candida glabrata ( n = 9 ), Candida tropicalis ( n = 8 ), Candida parapsilosis ( n = 8 ) and Candida guilliermondii and Candida krusei ( n = 1 each ). We also obtained very similar results for Candida albicans, Candida glabrata and Candida tropicalis as the most common clinical isolates, by using PCR - Restriction Fragment Length Polymorphism. Use of two differential methods, morphologic and molecular, enabled us to identify most medically important Candida species which particularly cause recurrent vulvovaginal candidiasis.

Original Article. Evaluation of Rapid Detection of Nasopharyngeal Colonization with MRSA by Real-Time PCR

Directory of Open Access Journals (Sweden)

Kang Feng-feng

2012-03-01

Full Text Available Objective To investigate the clinical application of Real-Time PCR for rapid detection of methicillin-resistant Staphylococcus aureus (MRSA directly from nasopharyngeal swab specimens.

Method for rapid detection and identification of chaetomium and evaluation of resistance to peracetic acid.

Science.gov (United States)

Nakayama, Motokazu; Hosoya, Kouichi; Tomiyama, Daisuke; Tsugukuni, Takashi; Matsuzawa, Tetsuhiro; Imanishi, Yumi; Yaguchi, Takashi

2013-06-01

In the beverage industry, peracetic acid has been increasingly used as a disinfectant for the filling machinery and environment due to merits of leaving no residue, it is safe for humans, and its antiseptic effect against fungi and endospores of bacteria. Recently, Chaetomium globosum and Chaetomium funicola were reported resistant to peracetic acid; however, little is known concerning the detail of peracetic acid resistance. Therefore, we assessed the peracetic acid resistance of the species of Chaetomium and related genera under identical conditions and made a thorough observation of the microstructure of their ascospores by transmission electron microscopy. The results of analyses revealed that C. globosum and C. funicola showed the high resistance to peracetic acid (a 1-D antiseptic effect after 900 s and 3-D antiseptic effect after 900 s) and had thick cell walls of ascospores that can impede the action mechanism of peracetic acid. We also developed specific primers to detect the C. globosum clade and identify C. funicola by using PCR to amplify the β-tubulin gene. PCR with the primer sets designed for C. globosum (Chae 4F/4R) and C. funicola (Cfu 2F/2R) amplified PCR products specific for the C. globosum clade and C. funicola, respectively. PCR with these two primer sets did not detect other fungi involved in food spoilage and environmental contamination. This detection and identification method is rapid and simple, with extremely high specificity.

A PCR-based method for identification of bifidobacteria from the human alimentary tract at the species level

NARCIS (Netherlands)

Venema, K.; Maathuis, A.J.H.

2003-01-01

A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12

Identification of Pseudallescheria and Scedosporium Species by Three Molecular Methods▿

Science.gov (United States)

Lu, Qiaoyun; Gerrits van den Ende, A. H. G.; Bakkers, J. M. J. E.; Sun, Jiufeng; Lackner, M.; Najafzadeh, M. J.; Melchers, W. J. G.; Li, Ruoyu; de Hoog, G. S.

2011-01-01

The major clinically relevant species in Scedosporium (teleomorph Pseudallescheria) are Pseudallescheria boydii, Scedosporium aurantiacum, Scedosporium apiospermum, and Scedosporium prolificans, while Pseudallescheria minutispora, Petriellopsis desertorum, and Scedosporium dehoogii are exceptional agents of disease. Three molecular methods targeting the partial β-tubulin gene were developed and evaluated to identify six closely related species of the S. apiospermum complex using quantitative real-time PCR (qPCR), PCR-based reverse line blot (PCR-RLB), and loop-mediated isothermal amplification (LAMP). qPCR was not specific enough for the identification of all species but had the highest sensitivity. The PCR-RLB assay was efficient for the identification of five species. LAMP distinguished all six species unambiguously. The analytical sensitivities of qPCR, PCR-RLB, and LAMP combined with MagNAPure, CTAB (cetyltrimethylammonium bromide), and FTA filter (Whatman) extraction were 50, 5 × 103, and 5 × 102 cells/μl, respectively. When LAMP was combined with a simplified DNA extraction method using an FTA filter, identification to the species level was achieved within 2 h, including DNA extraction. The FTA-LAMP assay is therefore recommended as a cost-effective, simple, and rapid method for the identification of Scedosporium species. PMID:21177887

IDENTIFIKASI TIPE HLA KELAS II DENGAN TEKNIK PCR

Directory of Open Access Journals (Sweden)

Ervi Salwati

2012-09-01

Full Text Available HLA (Human Leukocyte Antigen contains a set of genes located together on the short arm of chromosome 6. These genes control immune responses, graft acceptance or rejection and tumor surveillance. These abilities have close relationship with genetic variation (occur in "many forms" or alleles that bind and present antigens to T lymphocytes. Using advanced technology and molecular biology approaches (PCR technique detection of genetic variation in the HLA region (or HLA typing has been performed based on DNA.. PCR is an in vitro technique to amplify the DNA sequence enzymatically. "Sequence Specific Primers" (SSP are designed for this PCR to obtain amplification of specific alleles or groups of alleles. The PCR products are visualized through agarose gel electrophoresis stained with ethidium bromide. The PCR technique requires small amount of whole blood (0.5 - 1 ml, gives rapid, accurate and complete result. This paper discuss identification of HLA class II typing using PCR-SSP technique and show the examples of the results.   Key words: HLA (Human Leukocyte Antigen class II, PCR (Polymerase Chain Reaction

Differentiation of five enterohepatic Helicobacter species by nested PCR with high-resolution melting curve analysis.

Science.gov (United States)

Wu, Miaoli; Rao, Dan; Zhu, Yujun; Wang, Jing; Yuan, Wen; Zhang, Yu; Huang, Ren; Guo, Pengju

2017-04-01

Enterohepatic Helicobacter species (EHS) are widespread in rodent species around the world. Several studies have demonstrated that infection with EHS can interfere with the outcomes of animal experiments in cancer research and significantly influence the study results. Therefore, it is essential to establish a rapid detection and identification of EHS for biomedical research using laboratory rodents. Our study aimed to develop a rapid and sensitive method to detect and distinguish five enterohepatic Helicobacter species. Nested PCR followed by high-resolution melting curve analysis (HRM) was developed for identification of H. bilis, H. rodentium, H. muridarum, H. typhlonius, as well as H. hepaticus. To validate the accuracy of nested PCR-HRM analysis, quantitative real-time PCR methods for five different enterohepatic Helicobacter species were developed. A total of 50 cecal samples were tested using both nested PCR-HRM analysis and qPCR method. The nested PCR-HRM method could distinguish five enterohepatic Helicobacter species by different melting temperatures. The melting curve were characterized by peaks of 78.7 ± 0.12°C for H. rodentium, 80.51 ± 0.09°C for H. bilis, 81.6 ± 0.1°C for H. typhlonius, 82.11 ± 0.18°C for H. muridarum, and 82.95 ± 0.09°C for H. hepaticus. The nested PCR-HRM assay is a simple, rapid, and cost-effective assay. This assay could be a useful tool for molecular epidemiology study of enterohepatic Helicobacter infection and an attractive alternative for genotyping of enterohepatic Helicobacter species. © 2016 John Wiley & Sons Ltd.

Automated 5 ' nuclease PCR assay for identification of Salmonella enterica

DEFF Research Database (Denmark)

Hoorfar, Jeffrey; Ahrens, Peter; Rådström, P.

2000-01-01

-point fluorescence (FAM) signals for the samples and positive control (TET) signals (relative sensitivity [Delta Rn], >0.6). The diagnostic specificity of the method was assessed using 120 non-Salmonella strains, which all resulted in negative FAM signals (Delta Rn, less than or equal to 0.5). All 100 rough...... Salmonella strains tested resulted in positive FAM and TET signals. In addition, it was found that the complete PCR mixture, predispensed in microwell plates, could be stored for up to 3 months at -20 degrees C, Thus, the diagnostic TaqMan assay developed can be a useful and simple alternative method......A simple and ready-to-go test based on a 5' nuclease (TaqMan) PCR technique was developed for identification of presumptive Salmonella enterica isolates. The results were compared with those of conventional methods. The TaqMan assay was evaluated for its ability to accurately detect 210 S. enterica...

Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

Science.gov (United States)

Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

2017-10-01

Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

Real-time PCR-based method for the rapid detection of extended RAS mutations using bridged nucleic acids in colorectal cancer.

Science.gov (United States)

Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu

2017-10-27

Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

Science.gov (United States)

Kageyama, A; Benno, Y

2001-01-01

PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B.

Science.gov (United States)

Cecchinato, Mattia; Lupini, Caterina; Munoz Pogoreltseva, Olga Svetlana; Listorti, Valeria; Mondin, Alessandra; Drigo, Michele; Catelli, Elena

2013-01-01

In recent years, special attention has been paid to real-time polymerase chain reaction (PCR) for avian metapneumovirus (AMPV) diagnosis, due to its numerous advantages over classical PCR. A new multiplex quantitative real-time reverse transcription-PCR (qRT-PCR) with molecular beacon probe assay, designed to target the SH gene, was developed. The test was evaluated in terms of specificity, sensitivity and repeatability, and compared with conventional RT nested-PCR based on the G gene. All of the AMPV subtype A and B strains tested were amplified and specifically detected while no amplification occurred with other non-target bird respiratory pathogens. The detection limit of the assay was 10(-0.41) median infectious dose/ml and 10(1.15) median infectious dose/ml when the AMPV-B strain IT/Ty/B/Vr240/87 and the AMPV-A strain IT/Ty/A/259-01/03 were used, respectively, as templates. In all cases, the amplification efficiency was approximately 2 and the error values were 0.9375) between crossing point values and virus quantities, making the assay herein designed reliable for quantification. When the newly developed qRT-PCR was compared with a conventional RT nested-PCR, it showed greater sensitivity with RNA extracted from both positive controls and from experimentally infected birds. This assay can be effectively used for the detection, identification, differentiation and quantitation of AMPV subtype A or subtype B to assist in disease diagnosis and to carry out rapid surveillance with high levels of sensitivity and specificity.

Integration of nanoparticle cell lysis and microchip PCR for one-step rapid detection of bacteria.

Science.gov (United States)

Wan, Weijie; Yeow, John T W

2012-04-01

This paper describes an integrated microchip system as an efficient and cost-effective solution involving Nanotechnology and Lab-on-a-Chip technology for the rapid detection of bacteria. The system is based on using surface-modified gold nanoparticles for efficient cell lysis followed by microchip PCR without having to remove the nanoparticles from the PCR solution. Poly(quaternary ammonium) modified gold nanoparticles are used to provide a novel and efficient cell lysis method without the need to go through time-consuming, expensive and complicated microfabrication processes as most of current cell lysis methods for Lab-on-a-Chip applications do. It also facilitates the integration of cell lysis and PCR by sharing the same reaction chamber as PCR uses. It is integrated with a prototype microchip PCR system consisting of a physical microchip PCR device and an automated temperature control mechanism. The research work explores solutions for the problem of PCR inhibition caused by gold nanoparticles as well as for the problem of non-specific PCR amplification in the integrated microchip system. It also explores the possibility of greatly reducing PCR cycling time to achieve the same result compared to the protocol for a regular PCR machine. The simplicity of the setup makes it easy to be integrated with other Lab-on-a-Chip functional modules to create customized solutions for target applications.

Rapid differentiation of Staphylococcus aureus, Staphylococcus epidermidis and other coagulase-negative staphylococci and meticillin susceptibility testing directly from growth-positive blood cultures by multiplex real-time PCR.

Science.gov (United States)

Jukes, Leanne; Mikhail, Jane; Bome-Mannathoko, Naledi; Hadfield, Stephen J; Harris, Llinos G; El-Bouri, Khalid; Davies, Angharad P; Mack, Dietrich

2010-12-01

This study evaluated a multiplex real-time PCR method specific for the mecA, femA-SA and femA-SE genes for rapid identification of Staphylococcus aureus, Staphylococcus epidermidis and non-S. epidermidis coagulase-negative staphylococci (CoNS), and meticillin susceptibility testing directly in positive blood cultures that grew Gram-positive cocci in clusters. A total of 100 positive blood cultures produced: 39 S. aureus [12 meticillin-resistant S. aureus (MRSA), 31% of all the S. aureus]; 30 S. epidermidis (56.6% of the CoNS), 8 Staphylococcus capitis (15.1%), 3 Staphylococcus saprophyticus (5.7%), 4 Staphylococcus hominis (7.5%), 3 Staphylococcus haemolyticus (5.7%), 2 Staphylococcus warneri (3.8%), 1 Staphylococcus cohnii (1.9%) and 2 unidentified Staphylococcus spp. (3.8%); and 1 Micrococcus luteus in pure culture. Two blood cultures had no growth on subculture and five blood cultures grew mixed CoNS. For the 95 blood cultures with pure growth or no growth on subculture, there was very good agreement between real-time PCR and the BD Phoenix identification system for staphylococcal species categorization in S. aureus, S. epidermidis and non-S. epidermidis CoNS and meticillin-resistance determination (Cohen's unweighted kappa coefficient κ=0.882). All MRSA and meticillin-susceptible S. aureus were correctly identified by mecA amplification. PCR amplification of mecA was more sensitive for direct detection of meticillin-resistant CoNS in positive blood cultures than testing with the BD Phoenix system. There were no major errors when identifying staphylococcal isolates and their meticillin susceptibility within 2.5 h. Further studies are needed to evaluate the clinical benefit of using such a rapid test on the consumption of glycopeptide antibiotics and the alteration of empiric therapy in the situation of positive blood cultures growing staphylococci, and the respective clinical outcomes.

Identification and genotyping of molluscum contagiosum virus from genital swab samples by real-time PCR and Pyrosequencing.

Science.gov (United States)

Trama, Jason P; Adelson, Martin E; Mordechai, Eli

2007-12-01

Laboratory diagnosis of molluscum contagiosum virus (MCV) is important as lesions can be confused with those caused by Cryptococcus neoformans, herpes simplex virus, human papillomavirus, and varicella-zoster virus. To develop a rapid method for identifying patients infected with MCV via swab sampling. Two dual-labeled probe real-time PCR assays, one homologous to the p43K gene and one to the MC080R gene, were designed. The p43K PCR was designed to be used in conjunction with Pyrosequencing for confirmation of PCR products and discrimination between MCV1 and MCV2. Both PCR assays were optimized with respect to reaction components, thermocycling parameters, and primer and probe concentrations. The specificities of both PCR assays were confirmed by non-amplification of 38 known human pathogens. Sensitivity assays demonstrated detection of as few as 10 copies per reaction. Testing 703 swabs, concordance between the two real-time PCR assays was 99.9%. Under the developed conditions, Pyrosequencing of the p43K PCR product was capable of providing enough nucleotide sequence to definitively differentiate MCV1 and MCV2. These real-time PCR assays can be used for the rapid, sensitive, and specific detection of MCV and, when combined with Pyrosequencing, can further discriminate between MCV1 and MCV2.

Species identification of Cannabis sativa using real-time quantitative PCR (qPCR).

Science.gov (United States)

Johnson, Christopher E; Premasuthan, Amritha; Satkoski Trask, Jessica; Kanthaswamy, Sree

2013-03-01

Most narcotics-related cases in the United States involve Cannabis sativa. Material is typically identified based on the cystolithic hairs on the leaves and with chemical tests to identify of the presence of cannabinoids. Suspect seeds are germinated into a viable plant so that morphological and chemical tests can be conducted. Seed germination, however, causes undue analytical delays. DNA analyses that involve the chloroplast and nuclear genomes have been developed for identification of C. sativa materials, but they require several nanograms of template DNA. Using the trnL 3' exon-trnF intragenic spacer regions within the C. sativa chloroplast, we have developed a real-time quantitative PCR assay that is capable of identifying picogram amounts of chloroplast DNA for species determination of suspected C. sativa material. This assay provides forensic science laboratories with a quick and reliable method to identify an unknown sample as C. sativa. © 2013 American Academy of Forensic Sciences.

Rapid detection and identification of four major Schistosoma species by high-resolution melt (HRM) analysis.

Science.gov (United States)

Li, Juan; Zhao, Guang-Hui; Lin, RuiQing; Blair, David; Sugiyama, Hiromu; Zhu, Xing-Quan

2015-11-01

Schistosomiasis, caused by blood flukes belonging to several species of the genus Schistosoma, is a serious and widespread parasitic disease. Accurate and rapid differentiation of these etiological agents of animal and human schistosomiasis to species level can be difficult. We report a real-time PCR assay coupled with a high-resolution melt (HRM) assay targeting a portion of the nuclear 18S rDNA to detect, identify, and distinguish between four major blood fluke species (Schistosoma japonicum, Schistosoma mansoni, Schistosoma haematobium, and Schistosoma mekongi). Using this system, the Schistosoma spp. was accurately identified and could also be distinguished from all other trematode species with which they were compared. As little as 10(-5) ng genomic DNA from a Schistosoma sp. could be detected. This process is inexpensive, easy, and can be completed within 3 h. Examination of 21 representative Schistosoma samples from 15 geographical localities in seven endemic countries validated the value of the HRM detection assay and proved its reliability. The melting curves were characterized by peaks of 83.65 °C for S. japonicum and S. mekongi, 85.65 °C for S. mansoni, and 85.85 °C for S. haematobium. The present study developed a real-time PCR coupled with HRM analysis assay for detection and differential identification of S. mansoni, S. haematobium, S. japonicum, and S. mekongi. This method is rapid, sensitive, and inexpensive. It has important implications for epidemiological studies of Schistosoma.

Development of a PCR test for identification of Haemophilus somnus in pure and mixed cultures

DEFF Research Database (Denmark)

Angen, Øystein; Ahrens, Peter; Tegtmeier, Conny

1998-01-01

a single colony of H. somnus in the presence of 10(9) CFU of P. multocida even after 2 days of incubation. In conclusion, the present PCR test has been shown to represent a specific test for identification of H. somnus both in pure and mixed cultures. It represents a quick, sensitive and reliable method...... rise to an amplicon in the PCR test. The performance of the test on mixed cultures was evaluated by adding P. multocida to serial dilutions of H. somnus and incubating the agarplates for 1 and 2 days. This showed that the PCR test applied to the harvest from an agarplate can be expected to detect...

Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

DEFF Research Database (Denmark)

Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

2017-01-01

, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

An interlaboratory comparison of ITS2-PCR for the identification of yeasts, using the ABI Prism 310 and CEQ8000 capillary electrophoresis systems

Directory of Open Access Journals (Sweden)

Verschraegen Gerda

2005-03-01

Full Text Available Abstract Background Currently, most laboratories identify yeasts routinely on the basis of morphology and biochemical reactivity. This approach has quite often limited discriminatory power and may require long incubation periods. Due to the increase of fungal infections and due to specific antifungal resistence patterns for different species, accurate and rapid identification has become more important. Several molecular techniques have been described for fast and reliable identification of yeast isolates, but interlaboratory exchangeability of identification schemes of molecular techniques has hardly been studied. Here, we compared amplified ITS2 fragment length determination by an ABI Prism 310 (Applied Biosystems, Foster City, Ca. capillary electrophoresis system with that obtained by a CEQ8000 (Beckman Coulter, Fullerton, Ca. capillary electrophoresis system. Results Although ITS2 size estimations on both systems differed and separate libraries had to be constructed for each system, both approaches had the same discriminatory power with regard to the 44 reference strains, identical identifications were obtained for 39/ 40 clinical isolates in both laboratories and strains from 51 samples were correctly identified using CEQ8000, when compared to phenotypic identification. Conclusion Identification of yeasts with ITS2-PCR followed by fragment analysis can be carried out on different capillary electrophoresis systems with comparable discriminatory power.

Detection and identification of Leishmania spp.: application of two hsp70-based PCR-RFLP protocols to clinical samples from the New World.

Science.gov (United States)

Montalvo, Ana M; Fraga, Jorge; Tirado, Dídier; Blandón, Gustavo; Alba, Annia; Van der Auwera, Gert; Vélez, Iván Darío; Muskus, Carlos

2017-07-01

Leishmaniasis is highly prevalent in New World countries, where several methods are available for detection and identification of Leishmania spp. Two hsp70-based PCR protocols (PCR-N and PCR-F) and their corresponding restriction fragment length polymorphisms (RFLP) were applied for detection and identification of Leishmania spp. in clinical samples recruited in Colombia, Guatemala, and Honduras. A total of 93 cases were studied. The samples were classified into positive or suspected of leishmaniasis according to parasitological criteria. Molecular amplification of two different hsp70 gene fragments and further RFLP analysis for identification of Leishmania species was done. The detection in parasitologically positive samples was higher using PCR-N than PCR-F. In the total of samples studied, the main species identified were Leishmania panamensis, Leishmania braziliensis, and Leishmania infantum (chagasi). Although RFLP-N was more efficient for the identification, RFLP-F is necessary for discrimination between L. panamensis and Leishmania guyanesis, of great importance in Colombia. Unexpectedly, one sample from this country revealed an RFLP pattern corresponding to Leishmania naiffi. Both molecular variants are applicable for the study of clinical samples originated in Colombia, Honduras, and Guatemala. Choosing the better tool for each setting depends on the species circulating. More studies are needed to confirm the presence of L. naiffi in Colombian territory.

Rapid quantification of plant-powdery mildew interactions by qPCR and conidiospore counts.

Science.gov (United States)

Weßling, Ralf; Panstruga, Ralph

2012-08-31

The powdery mildew disease represents a valuable patho-system to study the interaction between plant hosts and obligate biotrophic fungal pathogens. Numerous discoveries have been made on the basis of the quantitative evaluation of plant-powdery mildew interactions, especially in the context of hyper-susceptible and/or resistant plant mutants. However, the presently available methods to score the pathogenic success of powdery mildew fungi are laborious and thus not well suited for medium- to high-throughput analysis. Here we present two new protocols that allow the rapid quantitative assessment of powdery mildew disease development. One procedure depends on quantitative polymerase chain reaction (qPCR)-based evaluation of fungal biomass, while the other relies on the quantification of fungal conidiospores. We validated both techniques using the powdery mildew pathogen Golovinomyces orontii on a set of hyper-susceptible and resistant Arabidopsis thaliana mutants and found that both cover a wide dynamic range of one to two (qPCR) and four to five (quantification of conidia) orders of magnitude, respectively. The two approaches yield reproducible results and are easy to perform without specialized equipment. The qPCR and spore count assays rapidly and reproducibly quantify powdery mildew pathogenesis. Our methods are performed at later stages of infection and discern mutant phenotypes accurately. The assays therefore complement currently used procedures of powdery mildew quantification and can overcome some of their limitations. In addition, they can easily be adapted to other plant-powdery mildew patho-systems.

Rapid detection of human parechoviruses in clinical samples by real-time PCR

NARCIS (Netherlands)

Benschop, Kimberley; Molenkamp, Richard; van der Ham, Alwin; Wolthers, Katja; Beld, Marcel

2008-01-01

BACKGROUND: Human parechoviruses (HPeVs) have been associated with severe conditions such as neonatal sepsis and meningitis in young children. Rapid identification of an infectious agent in such serious conditions in these patients is essential for adequate decision making regarding treatment and

Development of a Taqman real-time PCR assay for rapid detection and quantification of Vibrio tapetis in extrapallial fluids of clams

Directory of Open Access Journals (Sweden)

Adeline Bidault

2015-12-01

Full Text Available The Gram-negative bacterium Vibrio tapetis is known as the causative agent of Brown Ring Disease (BRD in the Manila clam Venerupis (=Ruditapes philippinarum. This bivalve is the second most important species produced in aquaculture and has a high commercial value. In spite of the development of several molecular methods, no survey has been yet achieved to rapidly quantify the bacterium in the clam. In this study, we developed a Taqman real-time PCR assay targeting virB4 gene for accurate and quantitative identification of V. tapetis strains pathogenic to clams. Sensitivity and reproducibility of the method were assessed using either filtered sea water or extrapallial fluids of clam injected with the CECT4600T V. tapetis strain. Quantification curves of V. tapetis strain seeded in filtered seawater (FSW or extrapallial fluids (EF samples were equivalent showing reliable qPCR efficacies. With this protocol, we were able to specifically detect V. tapetis strains down to 1.125 101 bacteria per mL of EF or FSW, taking into account the dilution factor used for appropriate template DNA preparation. This qPCR assay allowed us to monitor V. tapetis load both experimentally or naturally infected Manila clams. This technique will be particularly useful for monitoring the kinetics of massive infections by V. tapetis and for designing appropriate control measures for aquaculture purposes.

A Simultaneous Analytical Method for Duplex Identification of Porcine and Horse in the Meat Products by EvaGreen based Real-time PCR.

Science.gov (United States)

Sakalar, Ergün; Ergün, Seyma Özçirak; Akar, Emine

2015-01-01

A duplex real-time polymerase chain reaction (PCR) based assay for the detection of porcine and horse meat in sausages was designed by using EvaGreen fluorescent dye. Primers were selected from mitochondrial 12S rRNA and 16S rRNA genes which are powerful regions for identification of horse and porcine meat. DNA from reference samples and industrial products was successfully extracted using the GIDAGEN® Multi-Fast DNA Isolation Kit. Genomes were identified based on their specific melting peaks (Mp) which are 82.5℃ and 78℃ for horse and porcine, respectively. The assay used in this study allowed the detection of as little as 0.0001% level of horse meat and 0.001% level of porcine meat in the experimental admixtures. These findings indicate that EvaGreen based duplex real-time PCR is a potentially sensitive, reliable, rapid and accurate assay for the detection of meat species adulterated with porcine and horse meats.

Rapid detection and differentiation of Clonorchis sinensis and Opisthorchis viverrini using real-time PCR and high resolution melting analysis.

Science.gov (United States)

Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan

2014-01-01

Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.

Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

Directory of Open Access Journals (Sweden)

Xian-Quan Cai

2014-01-01

Full Text Available Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.

Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

Science.gov (United States)

Torriani, S; Zapparoli, G; Dellaglio, F

1999-10-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

Science.gov (United States)

Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

1999-01-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

Science.gov (United States)

Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2015-07-01

Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

PCR-free detection of genetically modified organisms using magnetic capture technology and fluorescence cross-correlation spectroscopy.

Directory of Open Access Journals (Sweden)

Xiaoming Zhou

2009-11-01

Full Text Available The safety of genetically modified organisms (GMOs has attracted much attention recently. Polymerase chain reaction (PCR amplification is a common method used in the identification of GMOs. However, a major disadvantage of PCR is the potential amplification of non-target DNA, causing false-positive identification. Thus, there remains a need for a simple, reliable and ultrasensitive method to identify and quantify GMO in crops. This report is to introduce a magnetic bead-based PCR-free method for rapid detection of GMOs using dual-color fluorescence cross-correlation spectroscopy (FCCS. The cauliflower mosaic virus 35S (CaMV35S promoter commonly used in transgenic products was targeted. CaMV35S target was captured by a biotin-labeled nucleic acid probe and then purified using streptavidin-coated magnetic beads through biotin-streptavidin linkage. The purified target DNA fragment was hybridized with two nucleic acid probes labeled respectively by Rhodamine Green and Cy5 dyes. Finally, FCCS was used to detect and quantify the target DNA fragment through simultaneously detecting the fluorescence emissions from the two dyes. In our study, GMOs in genetically engineered soybeans and tomatoes were detected, using the magnetic bead-based PCR-free FCCS method. A detection limit of 50 pM GMOs target was achieved and PCR-free detection of GMOs from 5 microg genomic DNA with magnetic capture technology was accomplished. Also, the accuracy of GMO determination by the FCCS method is verified by spectrophotometry at 260 nm using PCR amplified target DNA fragment from GM tomato. The new method is rapid and effective as demonstrated in our experiments and can be easily extended to high-throughput and automatic screening format. We believe that the new magnetic bead-assisted FCCS detection technique will be a useful tool for PCR-free GMOs identification and other specific nucleic acids.

Identification of some Fusarium species from selected crop seeds using traditional method and BIO-PCR

Directory of Open Access Journals (Sweden)

Tomasz Kulik

2012-12-01

Full Text Available We identified a species level of the fungal cultures isolated from selected crop seeds using traditional method and BIO-PCR. The use of BIO-PCR did not correspond completely to the morphological analyses. Both methods showed increased infection with F. poae in winter wheat seed sample originated from north Poland. Fungal culture No 40 (isolated from faba bean and identified with traditional method as mixed culture with F. culmorum and F. graminearum did not produce expected product after PCR reaction with species specific primers OPT18F470, OPT18R470. However, the use of additional primers Fc01F, Fc01R allowed for reliable identification of F. culmorum in the culture.

Real-Time PCR Typing of Escherichia coli Based on Multiple Single Nucleotide Polymorphisms--a Convenient and Rapid Method.

Science.gov (United States)

Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan

2016-01-01

Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.

Rapid and reliable MALDI-TOF mass spectrometry identification of Candida non-albicans isolates from bloodstream infections.

Science.gov (United States)

Pulcrano, Giovanna; Iula, Dora Vita; Vollaro, Antonio; Tucci, Alessandra; Cerullo, Monica; Esposito, Matilde; Rossano, Fabio; Catania, Maria Rosaria

2013-09-01

Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) fingerprinting has recently become an effective instrument for rapid microbiological diagnostics and in particular for identification of micro-organisms directly in a positive blood culture. The aim of the study was to evaluate a collection of 82 stored yeast isolates from bloodstream infection, by MALDI-TOF MS; 21 isolates were identified also directly from positive blood cultures and in the presence of other co-infecting micro-organisms. Of the 82 isolates grown on plates, 64 (76%) were correctly identified by the Vitek II system and 82 (100%) by MALDI-TOF MS; when the two methods gave different results, the isolate was identified by PCR. MALDI-TOF MS was unreliable in identifying two isolates (Candida glabrata and Candida parapsilosis) directly from blood culture; however, direct analysis from positive blood culture samples was fast and effective for the identification of yeast, which is of great importance for early and adequate treatment. © 2013. Published by Elsevier B.V. All rights reserved.

Combination of RT-PCR and proteomics for the identification of Crimean-Congo hemorrhagic fever virus in ticks

Directory of Open Access Journals (Sweden)

Isabel G. Fernández de Mera

2017-07-01

Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging tick-borne zoonotic disease caused by the CCHF virus (CCHFV. In this study, an experimental approach combining RT-PCR and proteomics was used for the identification and characterization of CCHFV in 106 ticks from 7 species that were collected from small ruminants in Greece. The methodological approach included an initial screening for CCHFV by RT-PCR followed by proteomics analysis of positive and control negative tick samples. This novel approach allowed the identification of CCHFV-positive ticks and provided additional information to corroborate the RT-PCR findings using a different approach. Two ticks, Dermacentor marginatus and Haemaphysalis parva collected from a goat and a sheep, respectively were positive for CCHFV. The sequences for CCHFV RNA segments S and L were characterized by RT-PCR and proteomics analysis of tick samples, respectively. These results showed the possibility of combining analyses at the RNA and protein levels using RT-PCR and proteomics for the characterization of CCHFV in ticks. The results supported that the CCHFV identified in ticks are genetic variants of the AP92 strain. Although the AP92-like strains probably do not represent a high risk of CCHF to the population, the circulation of genetically diverse CCHFV strains could potentially result in the appearance of novel viral genotypes with increased pathogenicity and fitness.

A multiplex PCR for detection of six viruses in ducks.

Science.gov (United States)

Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

2017-10-01

In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

Comparison between MALDI-TOF MS and FilmArray Blood Culture Identification panel for rapid identification of yeast from positive blood culture.

Science.gov (United States)

Paolucci, M; Foschi, C; Tamburini, M V; Ambretti, S; Lazzarotto, T; Landini, M P

2014-09-01

In this study we evaluated MALDI-TOF MS and FilmArray methods for the rapid identification of yeast from positive blood cultures. FilmArray correctly identified 20/22 of yeast species, while MALDI-TOF MS identified 9/22. FilmArray is a reliable and rapid identification system for the direct identification of yeasts from positive blood cultures. Copyright © 2014 Elsevier B.V. All rights reserved.

Differentiation of bacterial feeding nematodes in soil ecological studies by means of arbitrarily primed PCR

Science.gov (United States)

Van Der Knaap, Esther; Rodriguez, Russell J.; Freckman, Diana W.

1993-01-01

Arbitrarily-primed polymerase chain reaction (ap-PCR) was used to differentiate closely related bacterial-feeding nematodes of the genera: Caenorhabditis, Acrobeloides, Cephalobus and Zeldia. Average percentage similarity of bands generated by ap-PCR with seven different primers between 14 isolates of Caenorhabditis elegans was ⪢ 90%, whereas between C. elegans, C. briggsae and C. remanei similarity was nematode populations were also obtained from ap-PCR analysis of single worms. Due to the difficulty of identification of soil nematodes, the ap-PCR offers potential as a rapid and reliable technique to assess biodiversity. Ap-PCR will make it feasible, for the first time, to study the ecological interactions of unique nematode genotypes in soil habitats.

Multiplex PCR for rapid diagnosis and differentiation of pox and pox-like diseases in dromedary Camels.

Science.gov (United States)

Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M

2015-07-07

Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.

Development of rapid phenotypic system for the identification

Indian Academy of Sciences (India)

Rapid and accurate identification of bacterial pathogens is a fundamental goal of clinical microbiology. The diagnosis and surveillance of diseases is dependent, to a great extent, on laboratory services, which cannot function without effective reliable reagents and diagnostics. Despite the advancement in microbiology ...

The IRIDICA BAC BSI Assay: Rapid, Sensitive and Culture-Independent Identification of Bacteria and Candida in Blood

Science.gov (United States)

Rothman, Richard E.; Peterson, Stephen; Carroll, Karen C.; Zhang, Sean X.; Avornu, Gideon D.; Rounds, Megan A.; Carolan, Heather E.; Toleno, Donna M.; Moore, David; Hall, Thomas A.; Massire, Christian; Richmond, Gregory S.; Gutierrez, Jose R.; Sampath, Rangarajan; Ecker, David J.; Blyn, Lawrence B.

2016-01-01

Bloodstream infection (BSI) and sepsis are rising in incidence throughout the developed world. The spread of multi-drug resistant organisms presents increasing challenges to treatment. Surviving BSI is dependent on rapid and accurate identification of causal organisms, and timely application of appropriate antibiotics. Current culture-based methods used to detect and identify agents of BSI are often too slow to impact early therapy and may fail to detect relevant organisms in many positive cases. Existing methods for direct molecular detection of microbial DNA in blood are limited in either sensitivity (likely the result of small sample volumes) or in breadth of coverage, often because the PCR primers and probes used target only a few specific pathogens. There is a clear unmet need for a sensitive molecular assay capable of identifying the diverse bacteria and yeast associated with BSI directly from uncultured whole blood samples. We have developed a method of extracting DNA from larger volumes of whole blood (5 ml per sample), amplifying multiple widely conserved bacterial and fungal genes using a mismatch- and background-tolerant PCR chemistry, and identifying hundreds of diverse organisms from the amplified fragments on the basis of species-specific genetic signatures using electrospray ionization mass spectrometry (PCR/ESI-MS). We describe the analytical characteristics of the IRIDICA BAC BSI Assay and compare its pre-clinical performance to current standard-of-care methods in a collection of prospectively collected blood specimens from patients with symptoms of sepsis. The assay generated matching results in 80% of culture-positive cases (86% when common contaminants were excluded from the analysis), and twice the total number of positive detections. The described method is capable of providing organism identifications directly from uncultured blood in less than 8 hours. Disclaimer: The IRIDICA BAC BSI Assay is not available in the United States. PMID:27384540

Continuous-Flow Detector for Rapid Pathogen Identification

Energy Technology Data Exchange (ETDEWEB)

Barrett, Louise M. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Skulan, Andrew J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Singh, Anup K. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Cummings, Eric B. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Fiechtner, Gregory J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics

2006-09-01

This report describes the continued development of a low-power, portable detector for the rapid identification of pathogens such as B. anthracis and smallpox. Based on our successful demonstration of the continuous filter/concentrator inlet, we believe strongly that the inlet section will enable differentiation between viable and non-viable populations, between types of cells, and between pathogens and background contamination. Selective, continuous focusing of particles in a microstream enables highly selective and sensitive identification using fluorescently labeled antibodies and other receptors such as peptides, aptamers, or small ligands to minimize false positives. Processes such as mixing and lysing will also benefit from the highly localized particle streams. The concentrator is based on faceted prisms to contract microfluidic flows while maintaining uniform flowfields. The resulting interfaces, capable of high throughput, serve as high-, low-, and band-pass filters to direct selected bioparticles to a rapid, affinity-based detection system. The proposed device is superior to existing array-based detectors as antibody-pathogen binding can be accomplished in seconds rather than tens of minutes or even hours. The system is being designed to interface with aerosol collectors under development by the National Laboratories or commercial systems. The focused stream is designed to be interrogated using diode lasers to differentiate pathogens by light scattering. Identification of particles is done using fluorescently labeled antibodies to tag the particles, followed by multiplexed laser-induced fluorescence (LIF) detection (achieved by labeling each antibody with a different dye).

PCR deduction of invasive and colonizing pneumococcal serotypes from Venezuela: a critical appraisal.

Science.gov (United States)

Bello Gonzalez, Teresita; Rivera-Olivero, Ismar Alejandra; Sisco, María Carolina; Spadola, Enza; Hermans, Peter W; de Waard, Jacobus H

2014-04-15

Serotype surveillance of Streptococcus pneumoniae is indispensable for evaluating the potential impact of pneumococcal conjugate vaccines. Serotyping by the standard Quellung reaction is technically demanding, time consuming, and expensive. A simple and economical strategy is multiplex PCR-based serotyping. We evaluated the cost effectiveness of a modified serial multiplex PCR (mPCR), resolving 24 serotypes in four PCR reactions and optimally targeting the most prevalent invasive and colonizing pneumococcal serotypes found in Venezuela. A total of 223 pneumococcal isolates, 140 invasive and 83 carriage isolates, previously serotyped by the Quellung reaction and representing the 18 most common serotypes/groups identified in Venezuela, were serotyped with the adapted mPCR. The mPCR serotyped 76% of all the strains in the first two PCR reactions and 91% after four reactions, correctly identifying 17 serotypes/groups. An isolate could be serotyped with mPCR in less than 2 minutes versus 15 minutes for the Quellung reaction, considerably lowering labor costs. A restrictive weakness of mPCR was found for the detection of 19F strains. Most Venezuelan 19F strains were not typeable using the mPCR, and two 19F cps serotype variants were identified. The mPCR assay is an accurate, rapid, and economical method for the identification of the vast majority of the serotypes from Venezuela and can be used in place of the standard Quellung reaction. An exception is the identification of serotype 19F. In this setting, most 19F strains were not detectable with mPCR, demonstrating a need of serology-based quality control for PCR-based serotyping.

Rapid identification of DNA-binding proteins by mass spectrometry

DEFF Research Database (Denmark)

Nordhoff, E.; Korgsdam, A.-M.; Jørgensen, H.F.

1999-01-01

We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

Development of SCAR markers and PCR assays for single or simultaneous species-specific detection of Phytophthora nicotianae and Pythium helicoides in ebb-and-flow irrigated kalanchoe.

Science.gov (United States)

Ahonsi, Monday O; Ling, Yin; Kageyama, Koji

2010-11-01

Phytophthora nicotianae and Pythium helicoides are important water-borne oomycete pathogens of irrigated ornamentals particularly ebb-and-flow irrigated kalanchoe in Japan. We developed novel PCR-based sequence characterized amplified region markers and assays for rapid identification and species-specific detection of both pathogens in separate PCR reactions or simultaneously in a duplex PCR.

Identification of Tunisian Leishmania spp. by PCR amplification of cysteine proteinase B (cpb) genes and phylogenetic analysis.

Science.gov (United States)

Chaouch, Melek; Fathallah-Mili, Akila; Driss, Mehdi; Lahmadi, Ramzi; Ayari, Chiraz; Guizani, Ikram; Ben Said, Moncef; Benabderrazak, Souha

2013-03-01

Discrimination of the Old World Leishmania parasites is important for diagnosis and epidemiological studies of leishmaniasis. We have developed PCR assays that allow the discrimination between Leishmania major, Leishmania tropica and Leishmania infantum Tunisian species. The identification was performed by a simple PCR targeting cysteine protease B (cpb) gene copies. These PCR can be a routine molecular biology tools for discrimination of Leishmania spp. from different geographical origins and different clinical forms. Our assays can be an informative source for cpb gene studying concerning drug, diagnostics and vaccine research. The PCR products of the cpb gene and the N-acetylglucosamine-1-phosphate transferase (nagt) Leishmania gene were sequenced and aligned. Phylogenetic trees of Leishmania based cpb and nagt sequences are close in topology and present the classic distribution of Leishmania in the Old World. The phylogenetic analysis has enabled the characterization and identification of different strains, using both multicopy (cpb) and single copy (nagt) genes. Indeed, the cpb phylogenetic analysis allowed us to identify the Tunisian Leishmania killicki species, and a group which gathers the least evolved isolates of the Leishmania donovani complex, that was originated from East Africa. This clustering confirms the African origin for the visceralizing species of the L. donovani complex. Copyright © 2012 Elsevier B.V. All rights reserved.

RAPD-PCR characterization of lactobacilli isolated from artisanal meat plants and traditional fermented sausages of Veneto region (Italy).

Science.gov (United States)

Andrighetto, C; Zampese, L; Lombardi, A

2001-07-01

The study was carried out to evaluate the use of randomly amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) as a method for the identification of lactobacilli isolated from meat products. RAPD-PCR with primers M13 and D8635 was applied to the identification and intraspecific differentiation of 53 lactobacilli isolates originating from traditional fermented sausages and artisanal meat plants of the Veneto region (Italy). Most of the isolates were assigned to the species Lactobacillus sakei and Lact. curvatus; differentiation of groups of strains within the species was also possible. RAPD-PCR could be applied to the identification of lactobacilli species most commonly found in meat products. The method, which is easy and rapid to perform, could be useful for the study of the lactobacilli populations present in fermented sausages, and could help in the selection of candidate strains to use as starter cultures in meat fermentation.

[Comparison between conventional methods, ChromAgar Candida® and PCR method for the identification of Candida species in clinical isolates].

Science.gov (United States)

Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio

2011-01-01

The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

Development of real-time PCR assay for genetic identification of the mottled skate, Beringraja pulchra.

Science.gov (United States)

Hwang, In Kwan; Lee, Hae Young; Kim, Min-Hee; Jo, Hyun-Su; Choi, Dong-Ho; Kang, Pil-Won; Lee, Yang-Han; Cho, Nam-Soo; Park, Ki-Won; Chae, Ho Zoon

2015-10-01

The mottled skate, Beringraja pulchra is one of the commercially important fishes in the market today. However, B. pulchra identification methods have not been well developed. The current study reports a novel real-time PCR method based on TaqMan technology developed for the genetic identification of B. pulchra. The mitochondrial cytochrome oxidase subunit 1 (COI) nucleotide sequences of 29 B. pulchra, 157 skates and rays reported in GenBank DNA database were comparatively analyzed and the COI sequences specific to B. pulchra was identified. Based on this information, a system of specific primers and Minor Groove Binding (MGB) TaqMan probe were designed. The assay successfully discriminated in 29 specimens of B. pulchra and 27 commercial samples with unknown species identity. For B. pulchra DNA, an average Threshold Cycle (Ct) value of 19.1±0.1 was obtained. Among 27 commercial samples, two samples showed average Ct values 19.1±0.0 and 26.7±0.1, respectively and were confirmed to be B. pulchra based on sequencing. The other samples tested showed undetectable or extremely weak signals for the target fragment, which was also consistent with the sequencing results. These results reveal that the method developed is a rapid and efficient tool to identify B. pulchra and might prevent fraud or mislabeling during the distribution of B. pulchra products. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Performance Assessment of the CapitalBio Mycobacterium Identification Array System for Identification of Mycobacteria

Science.gov (United States)

Liu, Jingbo; Yan, Zihe; Han, Min; Han, Zhijun; Jin, Lingjie; Zhao, Yanlin

2012-01-01

The CapitalBio Mycobacterium identification microarray system is a rapid system for the detection of Mycobacterium tuberculosis. The performance of this system was assessed with 24 reference strains, 486 Mycobacterium tuberculosis clinical isolates, and 40 clinical samples and then compared to the “gold standard” of DNA sequencing. The CapitalBio Mycobacterium identification microarray system showed highly concordant identification results of 100% and 98.4% for Mycobacterium tuberculosis complex (MTC) and nontuberculous mycobacteria (NTM), respectively. The sensitivity and specificity of the CapitalBio Mycobacterium identification array for identification of Mycobacterium tuberculosis isolates were 99.6% and 100%, respectively, for direct detection and identification of clinical samples, and the overall sensitivity was 52.5%. It was 100% for sputum, 16.7% for pleural fluid, and 10% for bronchoalveolar lavage fluid, respectively. The total assay was completed in 6 h, including DNA extraction, PCR, and hybridization. The results of this study confirm the utility of this system for the rapid identification of mycobacteria and suggest that the CapitalBio Mycobacterium identification array is a molecular diagnostic technique with high sensitivity and specificity that has the capacity to quickly identify most mycobacteria. PMID:22090408

Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

Directory of Open Access Journals (Sweden)

Parida Manmohan

2008-01-01

Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

Science.gov (United States)

Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

2016-01-01

Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.

A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.

Directory of Open Access Journals (Sweden)

Kamfai Chan

Full Text Available The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR, thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.

Evaluation of the Capacity of PCR and High-Resolution Melt Curve Analysis for Identification of Mixed Infection with Mycoplasma gallisepticum Strains.

Directory of Open Access Journals (Sweden)

Seyed A Ghorashi

Full Text Available Pathogenicity and presentation of Mycoplasma gallisepticum (MG infection may differ from one strain to another and this may have implications on control measures. Infection of individual birds with more than one MG strain has been reported. A PCR followed by high resolution melt (HRM curve analysis has been developed in our laboratory and routinely used for detection and differentiation of MG strains. However the potential of this test for identification of MG strains in a mixed specimen has not been evaluated. In the present study, the capability of PCR-HRM curve analysis technique, targeting vlhA and pvpA genes was assessed for identification of individual MG strains in a mixed population. Different DNA ratios of two MG strains from 1 to 10(-4 ng were tested with some generated conventional and normalized curves distinct from those of individual strains alone. Using genotype confidence percentages (GCP generated from HRM curve analysis, it was found that vlhA PCR-HRM was more consistent than pvpA PCR-HRM for the detection of MG ts-11 vaccine strain mixed with any of the MG strains 6/85, F, S6 or a field isolate. The potential of vlhA PCR-HRM to detect mixed MG strains in a specimen was found to be primarily dependent on quantity and proportion of the target DNAs in the mixture. This is the first study examining the capacity of PCR-HRM technique for identification of individual MG strains in a mixed strain population.

Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification.

Science.gov (United States)

Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi

2018-01-01

Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

Impact of a Rapid Herpes Simplex Virus PCR Assay on Duration of Acyclovir Therapy.

Science.gov (United States)

Van, Tam T; Mongkolrattanothai, Kanokporn; Arevalo, Melissa; Lustestica, Maryann; Dien Bard, Jennifer

2017-05-01

Herpes simplex virus (HSV) infections of the central nervous system (CNS) are associated with significant morbidity and mortality rates in children. This study assessed the impact of a direct HSV (dHSV) PCR assay on the time to result reporting and the duration of acyclovir therapy for children with signs and symptoms of meningitis and encephalitis. A total of 363 patients with HSV PCR results from cerebrospinal fluid (CSF) samples were included in this retrospective analysis, divided into preimplementation and postimplementation groups. For the preimplementation group, CSF testing was performed using a laboratory-developed real-time PCR assay; for the postimplementation group, CSF samples were tested using a direct sample-to-answer assay. All CSF samples were negative for HSV. Over 60% of patients from both groups were prescribed acyclovir. The average HSV PCR test turnaround time for the postimplementation group was reduced by 14.5 h (23.6 h versus 9.1 h; P < 0.001). Furthermore, 79 patients (43.6%) in the postimplementation group had dHSV PCR results reported <4 h after specimen collection. The mean time from specimen collection to acyclovir discontinuation was 17.1 h shorter in the postimplementation group (31.1 h versus 14 h; P < 0.001). The median duration of acyclovir therapy was also significantly reduced in the postimplementation group (29.2 h versus 14.3 h; P = 0.01). Our investigation suggests that implementation of rapid HSV PCR testing can decrease turnaround times and the duration of unnecessary acyclovir therapy. Copyright © 2017 American Society for Microbiology.

A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.

Science.gov (United States)

Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli

2015-07-07

Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.

Rapid differentiation of Staphylococcus aureus isolates harbouring egc loci with pseudogenes psient1 and psient2 and the selu or seluv gene using PCR-RFLP.

Science.gov (United States)

Collery, Mark M; Smyth, Cyril J

2007-02-01

The egc locus of Staphylococus aureus harbours two enterotoxin genes (seg and sei) and three enterotoxin-like genes (selm, seln and selo). Between the sei and seln genes are located two pseudogenes, psient1 and psient2, or the selu or seluv gene. While these two alternative sei-seln intergenic regions can be distinguished by PCR, to date, DNA sequencing has been the only confirmatory option because of the very high degree of sequence similarity between egc loci bearing the pseudogenes and the selu or seluv gene. In silico restriction enzyme digestion of genomic regions encompassing the egc locus from the 3' end of the sei gene through the 5' first quarter of the seln gene allowed pseudogene- and selu- or seluv-bearing egc loci to be distinguished by PCR-RFLP. Experimental application of these findings demonstrated that endonuclease HindIII cleaved PCR amplimers bearing pseudogenes but not those with a selu or seluv gene, while selu- or seluv-bearing amplimers were susceptible to cleavage by endonuclease HphI, but not by endonuclease HindIII. The restriction enzyme BccI cleaved selu- or seluv-harbouring amplimers at a unique restriction site created by their signature 15 bp insertion compared with pseudogene-bearing amplimers, thereby allowing distinction of these egc loci. PCR-RFLP analysis using these restriction enzymes provides a rapid, easy to interpret alternative to DNA sequencing for verification of PCR findings on the nature of an egc locus type, and can also be used for the primary identification of the intergenic sei-seln egc locus type.

Rapid PCR amplification using a microfluidic device with integrated microwave heating and air impingement cooling.

Science.gov (United States)

Shaw, Kirsty J; Docker, Peter T; Yelland, John V; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

2010-07-07

A microwave heating system is described for performing polymerase chain reaction (PCR) in a microfluidic device. The heating system, in combination with air impingement cooling, provided rapid thermal cycling with heating and cooling rates of up to 65 degrees C s(-1) and minimal over- or under-shoot (+/-0.1 degrees C) when reaching target temperatures. In addition, once the required temperature was reached it could be maintained with an accuracy of +/-0.1 degrees C. To demonstrate the functionality of the system, PCR was successfully performed for the amplification of the Amelogenin locus using heating rates and quantities an order of magnitude faster and smaller than current commercial instruments.

Using Real-time PCR for Identification of Paenibacillus larvae

Directory of Open Access Journals (Sweden)

Vladimíra Kňazovická

2011-05-01

Full Text Available The aim of the study was identification of Paenibacillus larvae that causes American foulbrood disease (AFB in colony of bees (Apis mellifera. Bacterial isolates originated from honey samples, because presence of P. larvae in honey is treated as early diagnostic of AFB. Intense proteolytic activity and no catalase activity are typical for Gram positive rod-shaped bacteria P. larvae. We diluted honey (1:2, heated at 80 °C for 10 min and inoculated on semiselective medium MYPGP agar with nalidixic acid. Plates were cultivated at 37 °C for 48 – 72 h under the aerobic conditions. Selected colonies were transferred on MYT agar and cultivated 24 h. We analysed 30 honey samples and found 27 bacterial isolates. All isolates were Gram positive and mainly rod-shaped. No catalase activity was documented for 6 from 27 isolates. Identification was finished by real-time PCR to detect the 16S rRNA gene of Paenibacillus larvae with real-time cycler Rotor-Gene 6000. As DNA template we used genomic DNA isolated with commercial kit and DNA lysate obtaining by boiled cells. We used 2 strains of P. larvae from CCM (Czech Collection of Microorganisms as positive control. The reliable method of detection P. larvae has important rule for beekeeping.

TaqMan MGB probe fluorescence real-time quantitative PCR for rapid detection of Chinese Sacbrood virus.

Directory of Open Access Journals (Sweden)

Ma Mingxiao

Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.

A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.

Science.gov (United States)

Hanabara, Yutaro; Ueda, Yutaka

2016-11-22

A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.

Rapid identification and typing of Yersinia pestis and other Yersinia species by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry.

Science.gov (United States)

Ayyadurai, Saravanan; Flaudrops, Christophe; Raoult, Didier; Drancourt, Michel

2010-11-12

Accurate identification is necessary to discriminate harmless environmental Yersinia species from the food-borne pathogens Yersinia enterocolitica and Yersinia pseudotuberculosis and from the group A bioterrorism plague agent Yersinia pestis. In order to circumvent the limitations of current phenotypic and PCR-based identification methods, we aimed to assess the usefulness of matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) protein profiling for accurate and rapid identification of Yersinia species. As a first step, we built a database of 39 different Yersinia strains representing 12 different Yersinia species, including 13 Y. pestis isolates representative of the Antiqua, Medievalis and Orientalis biotypes. The organisms were deposited on the MALDI-TOF plate after appropriate ethanol-based inactivation, and a protein profile was obtained within 6 minutes for each of the Yersinia species. When compared with a 3,025-profile database, every Yersinia species yielded a unique protein profile and was unambiguously identified. In the second step of analysis, environmental and clinical isolates of Y. pestis (n = 2) and Y. enterocolitica (n = 11) were compared to the database and correctly identified. In particular, Y. pestis was unambiguously identified at the species level, and MALDI-TOF was able to successfully differentiate the three biotypes. These data indicate that MALDI-TOF can be used as a rapid and accurate first-line method for the identification of Yersinia isolates.

Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

Science.gov (United States)

TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

Rapid and inexpensive body fluid identification by RNA profiling-based multiplex High Resolution Melt (HRM analysis [v1; ref status: indexed, http://f1000r.es/2hj

Directory of Open Access Journals (Sweden)

Erin K. Hanson

2013-12-01

Full Text Available Positive identification of the nature of biological material present on evidentiary items can be crucial for understanding the circumstances surrounding a crime. However, traditional protein-based methods do not permit the identification of all body fluids and tissues, and thus molecular based strategies for the conclusive identification of all forensically relevant biological fluids and tissues need to be developed. Messenger RNA (mRNA profiling is an example of such a molecular-based approach. Current mRNA body fluid identification assays involve capillary electrophoresis (CE or quantitative RT-PCR (qRT-PCR platforms, each with its own limitations. Both platforms require the use of expensive fluorescently labeled primers or probes. CE-based assays require separate amplification and detection steps thus increasing the analysis time. For qRT-PCR assays, only 3-4 markers can be included in a single reaction since each requires a different fluorescent dye. To simplify mRNA profiling assays, and reduce the time and cost of analysis, we have developed single- and multiplex body fluid High Resolution Melt (HRM assays for the identification of common forensically relevant biological fluids and tissues. The incorporated biomarkers include IL19 (vaginal secretions, IL1F7 (skin, ALAS2 (blood, MMP10 (menstrual blood, HTN3 (saliva and TGM4 (semen.  The HRM assays require only unlabeled PCR primers and a single saturating intercalating fluorescent dye (Eva Green. Each body-fluid-specific marker can easily be identified by the presence of a distinct melt peak. Usually, HRM assays are used to detect variants or isoforms for a single gene target. However, we have uniquely developed duplex and triplex HRM assays to permit the simultaneous detection of multiple targets per reaction. Here we describe the development and initial performance evaluation of the developed HRM assays. The results demonstrate the potential use of HRM assays for rapid, and relatively

A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

Directory of Open Access Journals (Sweden)

Karolina Stojowska

Full Text Available We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s, while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR, whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR. The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

Science.gov (United States)

Stojowska, Karolina; Krawczyk, Beata

2014-01-01

We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

Laboratory Tests of Multiplex Detection of PCR Amplicons Using the Luminex 100 Flow Analyzer

Energy Technology Data Exchange (ETDEWEB)

Venkateswaran, K.S.; Nasarabadi, S.; Langlois, R.G.

2000-05-05

Lawrence Livermore National Laboratory (LLNL) demonstrated the power of flow cytometry in detecting the biological agents simulants at JFT III. LLNL pioneered in the development of advanced nucleic acid analyzer (ANM) for portable real time identification. Recent advances in flow cytometry provide a means for multiplexed nucleic acid detection and immunoassay of pathogenic microorganisms. We are presently developing multiplexed immunoassays for the simultaneous detection of different simulants. Our goal is to build an integrated instrument for both nucleic acid analysis and immuno detection. In this study we evaluated the Luminex LX 100 for concurrent identification of more than one PCR amplified product. ANAA has real-time Taqman fluorescent detection capability for rapid identification of field samples. However, its multiplexing ability is limited by the combination of available fluorescent labels. Hence integration of ANAA with flow cytometry can give the rapidity of ANAA amplification and the multiplex capability of flow cytometry. Multiplexed flow cytometric analysis is made possible using a set of fluorescent latex microsphere that are individually identified by their red and infrared fluorescence. A green fluorochrome is used as the assay signal. Methods were developed for the identification of specific nucleic acid sequences from Bacillus globigii (Bg), Bacillus thuringensis (Bt) and Erwinia herbicola (Eh). Detection sensitivity using different reporter fluorochromes was tested with the LX 100, and also different assay formats were evaluated for their suitability for rapid testing. A blind laboratory trial was carried out December 22-27, 1999 to evaluate bead assays for multiplex identification of Bg and Bt PCR products. This report summarizes the assay development, fluorochrome comparisons, and the results of the blind trial conducted at LLNL for the laboratory evaluation of the LX 100 flow analyzer.

Aspergillus section Fumigati typing by PCR-restriction fragment polymorphism.

Science.gov (United States)

Staab, Janet F; Balajee, S Arunmozhi; Marr, Kieren A

2009-07-01

Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding beta-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati.

Aspergillus Section Fumigati Typing by PCR-Restriction Fragment Polymorphism▿

Science.gov (United States)

Staab, Janet F.; Balajee, S. Arunmozhi; Marr, Kieren A.

2009-01-01

Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding β-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati. PMID:19403766

A multiplex nested PCR for the detection and identification of Candida species in blood samples of critically ill paediatric patients.

Science.gov (United States)

Taira, Cleison Ledesma; Okay, Thelma Suely; Delgado, Artur Figueiredo; Ceccon, Maria Esther Jurfest Rivero; de Almeida, Margarete Teresa Gottardo; Del Negro, Gilda Maria Barbaro

2014-07-21

Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection in neonatal and paediatric intensive care patients. DNA samples from the blood of 54 neonates and children hospitalised in intensive care units with suspected candidaemia were evaluated by multiplex nested PCR with specific primers designed to identify seven Candida species, and the results were compared with those obtained from blood cultures. The multiplex nested PCR had a detection limit of four Candida genomes/mL of blood for all Candida species. Blood cultures were positive in 14.8% of patients, whereas the multiplex nested PCR was positive in 24.0% of patients, including all culture-positive patients. The results obtained with the molecular technique were available within 24 hours, and the assay was able to identify Candida species with 100% of concordance with blood cultures. Additionally, the multiplex nested PCR detected dual candidaemia in three patients. Our proposed PCR method may represent an effective tool for the detection and identification of Candida species in the context of candidaemia diagnosis in children, showing highly sensitive detection and the ability to identify the major species involved in this infection.

Rapid identification of staphylococci by Raman spectroscopy

Czech Academy of Sciences Publication Activity Database

Rebrošová, K.; Šiler, Martin; Samek, Ota; Růžička, F.; Bernatová, Silvie; Holá, V.; Ježek, Jan; Zemánek, Pavel; Sokolová, J.; Petráš, P.

2017-01-01

Roč. 7, NOV (2017), s. 1-8, č. článku 14846. ISSN 2045-2322 R&D Projects: GA ČR(CZ) GA15-20645S; GA MŠk(CZ) LO1212; GA MŠk ED0017/01/01 Institutional support: RVO:68081731 Keywords : coagulase-negative staphylococci * Raman spectroscopy * rapid identification Subject RIV: BH - Optics, Masers, Lasers OBOR OECD: Optics (including laser optics and quantum optics) Impact factor: 4.259, year: 2016

Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays

Science.gov (United States)

Inderbitzin, Patrik; Davis, R. Michael; Bostock, Richard M.; Subbarao, Krishna V.

2013-01-01

Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae), a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex) PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex) PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers. PMID:23823707

Two rapid pigmentation tests for identification of Cryptococcus neoformans.

Science.gov (United States)

Kaufmann, C S; Merz, W G

1982-01-01

Two tests were developed for the rapid identification of Cryptococcus neoformans based on pigment produced by the organism's phenoloxidase activity. Caffeic acid was incorporated into cornmeal agar, a medium used routinely for yeast identification. When tested on this medium, only C. neoformans isolates produced brown pigment. All other yeasts maintained their normal morphology and did not produce the reaction product. A non-medium-based test was developed for same-day identification of C. neoformans isolates. Paper strips saturated with a buffered L-beta-3,4-dihydroxyphenylalanine-ferric citrate solution were inoculated with isolates and incubated at 37 degrees C. Pigment production occurred only with C. neoformans isolates, many within 60 to 90 min. All other yeasts remained negative. PMID:7040452

Comparaison de deux techniques d'identification des souches de levures de vinification basées sur le polymorphisme de l'ADN génomique: réaction de polymérisation en chaine (PCR et analyse des caryotypes (électrophorèse en champ pulsé

Directory of Open Access Journals (Sweden)

Isabelle Masneuf-Pomarède

1994-06-01

Full Text Available Une nouvelle technique de la biologie moléculaire, la réaction de polymérisation en chaine (PCR permet l'identification des souches de levures de vinification. Mise en oeuvre directement sur levures entières, elle permet d'obtenir des profils variables selon les souches, par l'amplification de séquences d'ADN génomique. Utilisée sur lies, la PCR constitue un outil rapide et sensible pour le contrôle d'implantation des levains en vinification. Cependant le pouvoir discriminant de la PCR est inférieur à celui de l'électrophorèse en champ pulsé pour la caractérisation des souches de levures indigènes. Elle doit être considérée comme une technique complémentaire d'identification des souches de S. cerevisiae.

Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.

Science.gov (United States)

Jamjoom, Manal; Sultan, Amal H

2009-04-01

The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity

A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

Directory of Open Access Journals (Sweden)

M Heydarnezhadi

2011-09-01

Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

Directory of Open Access Journals (Sweden)

Edith Burbano

2006-05-01

Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

PCR/LDR/universal array platforms for the diagnosis of infectious disease.

Science.gov (United States)

Pingle, Maneesh; Rundell, Mark; Das, Sanchita; Golightly, Linnie M; Barany, Francis

2010-01-01

Infectious diseases account for between 14 and 17 million deaths worldwide each year. Accurate and rapid diagnosis of bacterial, fungal, viral, and parasitic infections is therefore essential to reduce the morbidity and mortality associated with these diseases. Classical microbiological and serological methods have long served as the gold standard for diagnosis but are increasingly being replaced by molecular diagnostic methods that demonstrate increased sensitivity and specificity and provide an identification of the etiologic agent in a shorter period of time. PCR/LDR coupled with universal array detection provides a highly sensitive and specific platform for the detection and identification of bacterial and viral infections.

Identification of a novel Plasmopara halstedii elicitor protein combining de novo peptide sequencing algorithms and RACE-PCR

Directory of Open Access Journals (Sweden)

Madlung Johannes

2010-05-01

Full Text Available Abstract Background Often high-quality MS/MS spectra of tryptic peptides do not match to any database entry because of only partially sequenced genomes and therefore, protein identification requires de novo peptide sequencing. To achieve protein identification of the economically important but still unsequenced plant pathogenic oomycete Plasmopara halstedii, we first evaluated the performance of three different de novo peptide sequencing algorithms applied to a protein digests of standard proteins using a quadrupole TOF (QStar Pulsar i. Results The performance order of the algorithms was PEAKS online > PepNovo > CompNovo. In summary, PEAKS online correctly predicted 45% of measured peptides for a protein test data set. All three de novo peptide sequencing algorithms were used to identify MS/MS spectra of tryptic peptides of an unknown 57 kDa protein of P. halstedii. We found ten de novo sequenced peptides that showed homology to a Phytophthora infestans protein, a closely related organism of P. halstedii. Employing a second complementary approach, verification of peptide prediction and protein identification was performed by creation of degenerate primers for RACE-PCR and led to an ORF of 1,589 bp for a hypothetical phosphoenolpyruvate carboxykinase. Conclusions Our study demonstrated that identification of proteins within minute amounts of sample material improved significantly by combining sensitive LC-MS methods with different de novo peptide sequencing algorithms. In addition, this is the first study that verified protein prediction from MS data by also employing a second complementary approach, in which RACE-PCR led to identification of a novel elicitor protein in P. halstedii.

[Automated RNA amplification for the rapid identification of Mycobacterium tuberculosis complex in respiratory specimens].

Science.gov (United States)

Drouillon, V; Houriez, F; Buze, M; Lagrange, P; Herrmann, J-L

2006-01-01

Rapid and sensitive detection of Mycobacterium tuberculosis complex (MTB) directly on clinical respiratory specimens is essential for a correct management of patients suspected of tuberculosis. For this purpose PCR-based kits are available to detect MTB in respiratory specimen but most of them need at least 4 hours to be completed. New methods, based on TRC method (TRC: Transcription Reverse transcription Concerted--TRCRapid M. Tuberculosis--Tosoh Bioscience, Tokyo, Japon) and dedicated monitor have been developed. A new kit (TRC Rapid M. tuberculosis and Real-time monitor TRCRapid-160, Tosoh Corporation, Japan) enabling one step amplification and real-time detection of MTB 16S rRNA by a combination of intercalative dye oxazole yellow-linked DNA probe and isothermal RNA amplification directly on respiratory specimens has been tested in our laboratory. 319 respiratory specimens were tested in this preliminary study and results were compared to smear and culture. Fourteen had a positive culture for MTB. Among theses samples, smear was positive in 11 cases (78.6%) and TRC process was positive in 8 cases (57.1%). Overall sensitivity of TRC compared to smear positive samples is 73%. Theses first results demonstrated that a rapid identification of MTB was possible (less than 2 processing hours for 14 specimens and about 1 hour for 1 specimen) in most cases of smear positive samples using ready to use reagents for real time detection of MTB rRNA in clinical samples. New pretreatment and extraction reagents kits to increase the stability of the sputum RNA and the extraction efficiency are now tested in our laboratory.

A real-time PCR antibiogram for drug-resistant sepsis.

Directory of Open Access Journals (Sweden)

John R Waldeisen

Full Text Available Current molecular diagnostic techniques for susceptibility testing of septicemia rely on genotyping for the presence of known resistance cassettes. This technique is intrinsically vulnerable due to the inability to detect newly emergent resistance genes. Traditional phenotypic susceptibility testing has always been a superior method to assay for resistance; however, relying on the multi-day growth period to determine which antimicrobial to administer jeopardizes patient survival. These factors have resulted in the widespread and deleterious use of broad-spectrum antimicrobials. The real-time PCR antibiogram, described herein, combines universal phenotypic susceptibility testing with the rapid diagnostic capabilities of PCR. We have developed a procedure that determines susceptibility by monitoring pathogenic load with the highly conserved 16S rRNA gene in blood samples exposed to different antimicrobial drugs. The optimized protocol removes heme and human background DNA from blood, which allows standard real-time PCR detection systems to be employed with high sensitivity (<100 CFU/mL. Three strains of E. coli, two of which were antimicrobial resistant, were spiked into whole blood and exposed to three different antibiotics. After real-time PCR-based determination of pathogenic load, a ΔC(t<3.0 between untreated and treated samples was found to indicate antimicrobial resistance (P<0.01. Minimum inhibitory concentration was determined for susceptible bacteria and pan-bacterial detection was demonstrated with 3 gram-negative and 2 gram-positive bacteria. Species identification was performed via analysis of the hypervariable amplicons. In summary, we have developed a universal diagnostic phenotyping technique that assays for the susceptibility of drug-resistant septicemia with the speed of PCR. The real-time PCR antibiogram achieves detection, susceptibility testing, minimum inhibitory concentration determination, and identification in less than 24

Utilization of AFLP markers for PCR-based identification of Aspergillus carbonarius and indication of its presence in green coffee samples.

Science.gov (United States)

Schmidt, H; Taniwaki, M H; Vogel, R F; Niessen, L

2004-01-01

The objective of this work was to test whether ochratoxin A (OTA) production of Aspergillus niger and A. carbonarius is linked to a certain genotype and to identify marker sequences with diagnostic value aiding identification of A. carbonarius, a fungus of major concern regarding OTA production in food and food raw materials. Aspergillus niger and A. carbonarius were isolated mainly from Brazilian coffee sources. The ability of isolates to produce OTA was tested by thin layer chromatography (TLC). Strains were genetically characterized by AFLP fingerprinting and compared with each other and with reference strains. Cluster analysis of fingerprints showed clear separation of A. niger from A. carbonarius strains. To obtain marker sequences, AFLP fragments were isolated from silver stained polyacrylamide gels, cloned and sequenced. Sequences obtained were used to develop species- specific PCR primers for the identification of A. carbonarius in pure culture and in artificially and naturally infected samples of green coffee. No clear correlation between genetic similarity of the strains studied and their potential to produce OTA was found. The PCR assays designed are a useful and specific tool for identification and highly sensitive detection of A. carbonarius. The developed PCR assays allow specific and sensitive detection and identification of A. carbonarius, a fungus considered to be one of the major causative agents for OTA in coffee and grape-derived products. Assays may provide powerful tools to improve quality control and consumer safety in the food processing industry.

Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

Science.gov (United States)

Benitez, Alvaro J; Winchell, Jonas M

2016-04-01

We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

Detecting Mycobacterium tuberculosis in Bactec MGIT 960 Cultures by Inhouse IS6110-based PCR Assay in Routine Clinical Practice

Directory of Open Access Journals (Sweden)

Jun-Ren Sun

2009-02-01

Conclusion: The combined use of the automated Bactec MGIT 960 system and the IS6110-based PCR assay is sensitive and rapid for the detection of M. tuberculosis complex, and we recommend that this method be used routinely for identification of mycobacteria in clinical laboratories.

Evaluation of a novel real-time PCR test based on the ssrA gene for the identification of group B streptococci in vaginal swabs.

LENUS (Irish Health Repository)

Wernecke, Martina

2009-01-01

BACKGROUND: Despite the implementation of prevention guidelines, early-onset group B streptococci (GBS) disease remains a cause of neonatal morbidity and mortality worldwide. Strategies to identify women who are at risk of transmitting GBS to their infant and the administration of intrapartum antibiotics have greatly reduced the incidence of neonatal GBS disease. However, there is a requirement for a rapid diagnostic test for GBS that can be carried out in a labour ward setting especially for women whose GBS colonisation status is unknown at the time of delivery. We report the design and evaluation of a real-time PCR test (RiboSEQ GBS test) for the identification of GBS in vaginal swabs from pregnant women. METHODS: The qualitative real-time PCR RiboSEQ GBS test was designed based on the bacterial ssrA gene and incorporates a competitive internal standard control. The analytical sensitivity of the test was established using crude lysate extracted from serial dilutions of overnight GBS culture using the IDI Lysis kit. Specificity studies were performed using DNA prepared from a panel of GBS strains, related streptococci and other species found in the genital tract environment. The RiboSEQ GBS test was evaluated on 159 vaginal swabs from pregnant women and compared with the GeneOhm StrepB Assay and culture for the identification of GBS. RESULTS: The RiboSEQ GBS test is specific and has an analytical sensitivity of 1-10 cell equivalents. The RiboSEQ GBS test was 96.4% sensitive and 95.8% specific compared to "gold standard" culture for the identification of GBS in vaginal swabs from pregnant women. In this study, the RiboSEQ GBS test performed slightly better than the commercial BD GeneOhm StrepB Assay which gave a sensitivity of 94.6% and a specificity of 89.6% compared to culture. CONCLUSION: The RiboSEQ GBS test is a valuable method for the rapid, sensitive and specific detection of GBS in pregnant women. This study also validates the ssrA gene as a suitable and

Whatman Paper (FTA Cards for Storing and Transferring Leishmania DNA for PCR Examination

Directory of Open Access Journals (Sweden)

A Amin-Mohammadi

2009-12-01

Full Text Available "nBackground: Diagnosis of cutaneous leishmaniasis (CL is often made based on clinical manifesta­tion. Correct diagnosis and identification of the parasite are crucial for choosing the effective treat­ment and for epidemiological studies. On the other hand, determination of Leishmania species is nec­essary for designing appropriate control programs. Diagnosis by PCR is becoming a 'gold standard'. For PCR preparation, storage and shipments of specimens are necessary. In this study, Whatman filter paper (FTA Card was used to store and transfer samples for Leishmania identification using PCR. "nMethods: Among the patients who had CL lesion and referred to Parasitology Laboratory of Emam Reza Hospital, Mashhad, Iran, 44 consented cases with positive results in their direct smear were se­lected. An informed consent form and a questionnaire were completed and three different types of samples (direct smear, NNN culture, and spot on FTA card were collected. DNA extraction and PCR were carried out on three different samples from each patient. "nResults: PCR results using Whatman paper samples revealed a significant difference (P<0.0001 compared to the culture method but no significant difference was seen between PCR results using samples stored on Whatman paper and direct smears. "nConclusion: The use of FTA cards is simple, rapid, and cost-effective, and can be readily employed for large-scale population screening, especially for regions where the specimens are to be transported from distant places to the laboratory.

Comprehensive biothreat cluster identification by PCR/electrospray-ionization mass spectrometry.

Directory of Open Access Journals (Sweden)

Rangarajan Sampath

Full Text Available Technology for comprehensive identification of biothreats in environmental and clinical specimens is needed to protect citizens in the case of a biological attack. This is a challenge because there are dozens of bacterial and viral species that might be used in a biological attack and many have closely related near-neighbor organisms that are harmless. The biothreat agent, along with its near neighbors, can be thought of as a biothreat cluster or a biocluster for short. The ability to comprehensively detect the important biothreat clusters with resolution sufficient to distinguish the near neighbors with an extremely low false positive rate is required. A technological solution to this problem can be achieved by coupling biothreat group-specific PCR with electrospray ionization mass spectrometry (PCR/ESI-MS. The biothreat assay described here detects ten bacterial and four viral biothreat clusters on the NIAID priority pathogen and HHS/USDA select agent lists. Detection of each of the biothreat clusters was validated by analysis of a broad collection of biothreat organisms and near neighbors prepared by spiking biothreat nucleic acids into nucleic acids extracted from filtered environmental air. Analytical experiments were carried out to determine breadth of coverage, limits of detection, linearity, sensitivity, and specificity. Further, the assay breadth was demonstrated by testing a diverse collection of organisms from each biothreat cluster. The biothreat assay as configured was able to detect all the target organism clusters and did not misidentify any of the near-neighbor organisms as threats. Coupling biothreat cluster-specific PCR to electrospray ionization mass spectrometry simultaneously provides the breadth of coverage, discrimination of near neighbors, and an extremely low false positive rate due to the requirement that an amplicon with a precise base composition of a biothreat agent be detected by mass spectrometry.

Passive IFF: Autonomous Nonintrusive Rapid Identification of Friendly Assets

Science.gov (United States)

Moynihan, Philip; Steenburg, Robert Van; Chao, Tien-Hsin

2004-01-01

A proposed optoelectronic instrument would identify targets rapidly, without need to radiate an interrogating signal, apply identifying marks to the targets, or equip the targets with transponders. The instrument was conceived as an identification, friend or foe (IFF) system in a battlefield setting, where it would be part of a targeting system for weapons, by providing rapid identification for aimed weapons to help in deciding whether and when to trigger them. The instrument could also be adapted to law-enforcement and industrial applications in which it is necessary to rapidly identify objects in view. The instrument would comprise mainly an optical correlator and a neural processor (see figure). The inherent parallel-processing speed and capability of the optical correlator would be exploited to obtain rapid identification of a set of probable targets within a scene of interest and to define regions within the scene for the neural processor to analyze. The neural processor would then concentrate on each region selected by the optical correlator in an effort to identify the target. Depending on whether or not a target was recognized by comparison of its image data with data in an internal database on which the neural processor was trained, the processor would generate an identifying signal (typically, friend or foe ). The time taken for this identification process would be less than the time needed by a human or robotic gunner to acquire a view of, and aim at, a target. An optical correlator that has been under development for several years and that has been demonstrated to be capable of tracking a cruise missile might be considered a prototype of the optical correlator in the proposed IFF instrument. This optical correlator features a 512-by-512-pixel input image frame and operates at an input frame rate of 60 Hz. It includes a spatial light modulator (SLM) for video-to-optical image conversion, a pair of precise lenses to effect Fourier transforms, a filter SLM

A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

Directory of Open Access Journals (Sweden)

Farkhondeh Saba

2017-01-01

Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

Directory of Open Access Journals (Sweden)

Farkhondeh Saba

2016-09-01

Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

The Rotary Zone Thermal Cycler: A Low-Power System Enabling Automated Rapid PCR

Science.gov (United States)

Bartsch, Michael S.; Renzi, Ronald F.; Van de Vreugde, James L.; Kim, Hanyoup; Knight, Daniel L.; Sinha, Anupama; Branda, Steven S.; Patel, Kamlesh D.

2015-01-01

Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling) to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis. PMID:25826708

The rotary zone thermal cycler: a low-power system enabling automated rapid PCR.

Directory of Open Access Journals (Sweden)

Michael S Bartsch

Full Text Available Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC, a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR amplification, and second strand cDNA synthesis.

Application of PCR-DGGE method for identification of nematode communities in pepper growing soil

OpenAIRE

Nguyen, Thi Phuong; Ha, Duy Ngo; Nguyen, Huu Hung; Duong, Duc Hieu

2017-01-01

Soil nematodes play an important role in indication for assessing soil environments and ecosystems. Previous studies of nematode community analyses based on molecular identification have shown to be useful for assessing soil environments. Here we applied PCR-DGGE method for molecular analysis of five soil nematode communities (designed as S1 to S5) collected from four provinces in Southeastern Vietnam (Binh Duong, Ba Ria Vung Tau, Binh Phuoc and Dong Nai) based on SSU gene. By sequencing DNA ...

Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system.

Science.gov (United States)

Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong

2011-01-01

Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.

Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

Directory of Open Access Journals (Sweden)

Henrich Birgit

2008-04-01

Full Text Available Abstract Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1 -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies.

Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

Science.gov (United States)

Schaeffer, Anke; Henrich, Birgit

2008-01-01

Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1) -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H) -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies. PMID:18447917

Development of a qPCR method to rapidly assess the function of NKT cells.

Science.gov (United States)

Sohn, Silke; Tiper, Irina; Japp, Emily; Sun, Wenji; Tkaczuk, Katherine; Webb, Tonya J

2014-05-01

NKT cells comprise a rare, but important subset of T cells which account for ~0.2% of the total circulating T cell population. NKT cells are known to have anti-tumor functions and rapidly produce high levels of cytokines following activation. Several clinical trials have sought to exploit the effector functions of NKT cells. While some studies have shown promise, NKT cells are approximately 50% lower in cancer patients compared to healthy donors of the same age and gender, thus limiting their therapeutic efficacy. These studies indicate that baseline levels of activation should be assessed before initiating an NKT cell based immunotherapeutic strategy. The goal of this study was to develop a sensitive method to rapidly assess NKT cell function. We utilized artificial antigen presenting cells in combination with qPCR in order to determine NKT cell function in peripheral blood mononuclear cells from healthy donors and breast cancer patients. We found that NKT cell activation can be detected by qPCR, but not by ELISA, in healthy donors as well as in breast cancer patients following four hour stimulation. This method utilizing CD1d-expressing aAPCs will enhance our knowledge of NKT cell biology and could potentially be used as a novel tool in adoptive immunotherapeutic strategies. Copyright © 2014 Elsevier B.V. All rights reserved.

Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique

Directory of Open Access Journals (Sweden)

Hyoung Rai Ko

2017-09-01

Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.

Development and validation of real-time PCR for rapid detection of Mecistocirrus digitatus.

Directory of Open Access Journals (Sweden)

Subhra Subhadra

Full Text Available Hematophagous activity of Mecistocirrus digitatus, which causes substantial blood and weight loss in large ruminants, is an emerging challenge due to the economic loss it brings to the livestock industry. Infected animals are treated with anthelmintic drugs, based on the identification of helminth species and the severity of infection; however, traditional methods such as microscopic identification and the counting of eggs for diagnosis and determination of level of infection are laborious, cumbersome and unreliable. To facilitate the detection of this parasite, a SYBR green-based real-time PCR was standardized and validated for the detection of M. digitatus infection in cattle and buffaloes. Oligonucleotides were designed to amplify partial Internal Transcribed Spacer (ITS-1 sequence of M. digitatus. The specificity of the primers was confirmed by non-amplification of DNA extracted from other commonly occurring gastrointestinal nematodes in ruminants. Plasmids were ligated with partial ITS-1 sequence of M. digitatus, serially diluted (hundred fold and used as standards in the real-time PCR assay. The quantification cycle (Cq values were plotted against the standard DNA concentration to produce a standard curve. The assay was sensitive enough to detect one plasmid containing the M. digitatus DNA. Clinical application of this assay was validated by testing the DNA extracted from the faeces of naturally infected cattle (n = 40 and buffaloes (n = 25. The results were compared with our standard curve to calculate the quantity of M. digitatus in each faecal sample. The Cq value of the assay depicted a strong linear relationship with faecal DNA content, with a regression coefficient of 0.984 and efficiency of 99%. This assay has noteworthy advantages over the conventional methods of diagnosis because it is more specific, sensitive and reliable.

Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

Science.gov (United States)

Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

2012-10-01

A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

[Evaluation of a rapid trehalase test for the identification of Candida glabrata].

Science.gov (United States)

Kirdar, Sevin; Gültekin, Berna; Evcil, Gonca; Ozkütük, Aydan; Sener, Asli Gamze; Aydin, Neriman

2009-04-01

Candida species which cause local infections, may also lead to fatal systemic infections. The increasing incidence of non-albicans Candida, especially fluconazole susceptible or resistant dose-dependent C. glabrata, increased the importance of rapid and accurate species level identification for Candida. Rapid and correct identification of C. glabrata is essential for the initiation of the appropriate antifungal therapy. This study was conducted to evaluate the performance of the rapid trehalase test in the diagnosis of C. glabrata isolates. A total of 173 Candida strains isolated from various clinical specimens and identified according to germ tube test, growth on cornmeal Tween 80 agar and the colony morphologies on Mast-CHROMagar Candida medium (Mast Diagnostics, UK), were included to the study. The identification of non-albicans Candida species were also confirmed by API 20CAUX (BioMerieux, France) system. Accordingly 86 (50%) of the isolates were identified as C. glabrata, 48 (28%) C. albicans, 17 (10%) C. krusei, 13 (8%) C. tropicalis, 5 (3%) C. parapsilosis, 3 (2%) C. kefyr and 1 (1%) Cutilis. In order to detect the presence of trehalase enzyme in Condida strains, all isolates were grown on Sabouraud dextrose agar containing 4% glucose and then one yeast colony was emulsified in 50 microl of citrate buffer containing 4% (wt/vol) trehalose for 3 h at 37 degrees C. Presence of glucose which emerged after the action of trehalase on trehalose, was detected by a commercial "urinary glucose detection dipstick" (Spinreacta, Spain). All C. glabrata strains yielded positive result by trehalase test. None C. glabrata isolates were found negative by trehalase test except for one strain of C. tropicalis. In this study, the trehalase test allowed identification of C. globrata with 100% sensitivity and 98.9% specificity. It was concluded that trehalase test is a rapid, cost-effective and simple test that can be used for the accurate identification of C. glabrata.

A new PCR approach for the identification of Fusarium graminearum Um novo protocolo de PCR para a identificação de Fusarium graminearum

Directory of Open Access Journals (Sweden)

Gleison Ricardo de Biazio

2008-09-01

Full Text Available The main objective of this work was to develop a PCR protocol for the identification of Fusarium graminearum, based on a pair of primers targeted to a segment of the 3' coding region of the gaoA gene that codes for the enzyme galactose oxidase (GO. This region has low homology with the same region of GO genes from other fungi. Genomic DNA from 17 strains of Fusarium spp. isolated from diseased cereals, from several other Fusarium species, and from other fungi genera was analyzed in a PCR assay using this primer set. The 17 strains of Fusarium spp. were also analyzed for the GO enzyme production in submerse fermentation in a new formulated liquid medium. All strains that were morphologically and molecularly identified as F. graminearum were able to secrete the enzyme and had a positive result in the used PCR protocol. No DNA fragment was amplified using genomic DNA from other Fusarium species and species of other fungi genera. The results suggest that the proposed PCR protocol is specific and can be considered as a new molecular tool for the identification of F. graminearum. In addition, the new formulated medium is a cheap alternative for screening for GO screening production by F. graminearum.O principal objetivo deste trabalho foi desenvolver um novo protocolo de PCR para identificação de isolados de Fusarium graminearum, baseado no uso de um par de iniciadores direcionado para um segmento da região 3' codificadora do gene gaoA que codifica a enzima galactose oxidase (GO. Esta região possui baixa homologia com a mesma região de genes da GO de outros fungos. O DNA genômico de 17 cepas de Fusarium spp. isoladas de cereais infectados com sintomas, de vários outras espécies de Fusarium e de outros gêneros de fungos foi analisado em um protocolo de PCR utilizando os iniciadores desenhados. Os 17 isolados de Fusarium spp. também foram analisados para a produção da enzima GO em fermentação submersa em um novo meio líquido. Todas as

Short communication: Identification of coagulase-negative staphylococcus species from goat milk with the API Staph identification test and with transfer RNA-intergenic spacer PCR combined with capillary electrophoresis.

Science.gov (United States)

Koop, G; De Visscher, A; Collar, C A; Bacon, D A C; Maga, E A; Murray, J D; Supré, K; De Vliegher, S; Haesebrouck, F; Rowe, J D; Nielen, M; van Werven, T

2012-12-01

Coagulase-negative staphylococci (CNS) are the most commonly isolated bacteria from goat milk, but they have often been identified with phenotypic methods, which may have resulted in misclassification. The aims of this paper were to assess the amount of misclassification of a phenotypic test for identifying CNS species from goat milk compared with transfer RNA intergenic spacer PCR (tDNA-PCR) followed by capillary electrophoresis, and to apply the tDNA-PCR technique on different capillary electrophoresis equipment. Milk samples were collected from 416 does in 5 Californian dairy goat herds on 3 occasions during lactation. In total, 219 CNS isolates were identified at the species level with tDNA-PCR and subjected to the API 20 Staph identification test kit (API Staph; bioMérieux, Durham, NC). If the same species was isolated multiple times from the same udder gland, only the first isolate was used for further analyses, resulting in 115 unique CNS isolates. According to the tDNA-PCR test, the most prevalent CNS species were Staphylococcus epidermidis, Staphylococcus caprae, and Staphylococcus simulans. Typeability with API staph was low (72%). Although the API Staph test was capable of identifying the majority of Staph. epidermidis and Staph. caprae isolates, sensitivity for identification of Staph. simulans was low. The true positive fraction was high for the 3 most prevalent species. It was concluded that the overall performance of API Staph in differentiating CNS species from goat milk was moderate to low, mainly because of the low typeability, and that genotypic methods such as tDNA-PCR are preferred. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients

Directory of Open Access Journals (Sweden)

Ngo Tat Trung

2018-02-01

Conclusion: The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients.

Establishment of a 10-Plex Quantitative Fluorescent-PCR Assay for rapid diagnosis of sex chromosome aneuploidies.

Directory of Open Access Journals (Sweden)

Xingmei Xie

Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.

Comparison of phenotypic and PCR methods for detection of carbapenemases production by Enterobacteriaceae

Directory of Open Access Journals (Sweden)

Maryam AlTamimi

2017-01-01

Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.

Characterization of Aspergillus species on Brazil nut from the Brazilian Amazonian region and development of a PCR assay for identification at the genus level

Science.gov (United States)

2014-01-01

Background Brazil nut is a protein-rich extractivist tree crop in the Amazon region. Fungal contamination of shells and kernel material frequently includes the presence of aflatoxigenic Aspergillus species from the section Flavi. Aflatoxins are polyketide secondary metabolites, which are hepatotoxic carcinogens in mammals. The objectives of this study were to identify Aspergillus species occurring on Brazil nut grown in different states in the Brazilian Amazon region and develop a specific PCR method for collective identification of member species of the genus Aspergillus. Results Polyphasic identification of 137 Aspergillus strains isolated from Brazil nut shell material from cooperatives across the Brazilian Amazon states of Acre, Amapá and Amazonas revealed five species, with Aspergillus section Flavi species A. nomius and A. flavus the most abundant. PCR primers ASP_GEN_MTSSU_F1 and ASP_GEN_MTSSU_R1 were designed for the genus Aspergillus, targeting a portion of the mitochondrial small subunit ribosomal RNA gene. Primer specificity was validated through both electronic PCR against target gene sequences at Genbank and in PCR reactions against DNA from Aspergillus species and other fungal genera common on Brazil nut. Collective differentiation of the observed section Flavi species A. flavus, A. nomius and A. tamarii from other Aspergillus species was possible on the basis of RFLP polymorphism. Conclusions Given the abundance of Aspergillus section Flavi species A. nomius and A. flavus observed on Brazil nut, and associated risk of mycotoxin accumulation, simple identification methods for such mycotoxigenic species are of importance for Hazard Analysis Critical Control Point system implementation. The assay for the genus Aspergillus represents progress towards specific PCR identification and detection of mycotoxigenic species. PMID:24885088

Identification of appropriate reference genes for human mesenchymal stem cell analysis by quantitative real-time PCR.

Science.gov (United States)

Li, Xiuying; Yang, Qiwei; Bai, Jinping; Xuan, Yali; Wang, Yimin

2015-01-01

Normalization to a reference gene is the method of choice for quantitative reverse transcription-PCR (RT-qPCR) analysis. The stability of reference genes is critical for accurate experimental results and conclusions. We have evaluated the expression stability of eight commonly used reference genes found in four different human mesenchymal stem cells (MSC). Using geNorm, NormFinder and BestKeeper algorithms, we show that beta-2-microglobulin and peptidyl-prolylisomerase A were the optimal reference genes for normalizing RT-qPCR data obtained from MSC, whereas the TATA box binding protein was not suitable due to its extensive variability in expression. Our findings emphasize the significance of validating reference genes for qPCR analyses. We offer a short list of reference genes to use for normalization and recommend some commercially-available software programs as a rapid approach to validate reference genes. We also demonstrate that the two reference genes, β-actin and glyceraldehyde-3-phosphate dehydrogenase, are frequently used are not always successful in many cases.

Evaluation of multiplex tandem real-time PCR for detection of Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in clinical stool samples.

Science.gov (United States)

Stark, D; Al-Qassab, S E; Barratt, J L N; Stanley, K; Roberts, T; Marriott, D; Harkness, J; Ellis, J T

2011-01-01

The aim of this study was to describe the first development and evaluation of a multiplex tandem PCR (MT-PCR) assay for the detection and identification of 4 common pathogenic protozoan parasites, Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis, from human clinical samples. A total of 472 fecal samples submitted to the Department of Microbiology at St. Vincent's Hospital were included in the study. The MT-PCR assay was compared to four real-time PCR (RT-PCR) assays and microscopy by a traditional modified iron hematoxylin stain. The MT-PCR detected 28 G. intestinalis, 26 D. fragilis, 11 E. histolytica, and 9 Cryptosporidium sp. isolates. Detection and identification of the fecal protozoa by MT-PCR demonstrated 100% correlation with the RT-PCR results, and compared to RT-PCR, MT-PCR exhibited 100% sensitivity and specificity, while traditional microscopy of stained fixed fecal smears exhibited sensitivities and specificities of 56% and 100% for Cryptosporidium spp., 38% and 99% for D. fragilis, 47% and 97% for E. histolytica, and 50% and 100% for G. intestinalis. No cross-reactivity was detected in 100 stool samples containing various other bacterial, viral, and protozoan species. The MT-PCR assay was able to provide rapid, sensitive, and specific simultaneous detection and identification of the four most important diarrhea-causing protozoan parasites that infect humans. This study also highlights the lack of sensitivity demonstrated by microscopy, and thus, molecular methods such as MT-PCR must be considered the diagnostic methods of choice for enteric protozoan parasites.

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

Science.gov (United States)

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

Science.gov (United States)

Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

2014-05-01

Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

Science.gov (United States)

Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

2017-01-01

Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

Application of RFLP-PCR-Based Identification for Sand Fly Surveillance in an Area Endemic for Kala-Azar in Mymensingh, Bangladesh

Directory of Open Access Journals (Sweden)

Mohammad Shafiul Alam

2012-01-01

Full Text Available Mymensingh is the most endemic district for kala-azar in Bangladesh. Phlebotomus argentipes remains the only known vector although a number of sand fly species are prevalent in this area. Genotyping of sand flies distributed in a VL endemic area was developed by a PCR and restriction-fragment-length polymorphism (RFLP of 18S rRNA gene of sand fly species. Using the RFLP-PCR analysis with AfaI and HinfI restriction enzymes, P. argentipes, P. papatasi, and Sergentomyia species could be identified. Among 1,055 female sand flies successfully analyzed for the species identification individually, 64.4% flies was classified as Sergentomyia species, whereas 35.6% was identified as P. argentipes and no P. papatasi was found. Although infection of Leishmania within the sand flies was individually examined targeting leishmanial minicircle DNA, none of the 1,055 sand flies examined were positive for Leishmania infection. The RFLP-PCR could be useful tools for taxonomic identification and Leishmania infection monitoring in endemic areas of Bangladesh.

Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

Science.gov (United States)

Kim, S A; Park, S H; Lee, S I; Ricke, S C

2017-12-01

The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

Potassium hydroxide-ethylene diamine tetraacetic acid method for the rapid preparation of small-scale PCR template DNA from actinobacteria.

Science.gov (United States)

Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli

2014-01-01

Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.

Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

DEFF Research Database (Denmark)

Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

2013-01-01

of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...

Development of simple and rapid PCR-fingerprinting methods for Vibrio cholerae on the basis of genetic diversity of the superintegron.

Science.gov (United States)

Chowdhury, N; Asakura, M; Neogi, S B; Hinenoya, A; Haldar, S; Ramamurthy, T; Sarkar, B L; Faruque, S M; Yamasaki, S

2010-07-01

To develop simple and rapid PCR-fingerprinting methods for Vibrio cholerae O1 (El Tor and classical biotypes) and O139 serogroup strains which cause major cholera epidemics, on the basis of the diversity of superintegron (SI) carried by these strains. PCR-restriction fragment length polymorphism (PCR-RFLP) assay was developed targeting region between integrase gene in the SI and its nearby ORF, followed by BglI digestion. Besides, a V. cholerae repeat-amplified fragment length polymorphism (VCR-AFLP) assay was also developed. In the PCR-RFLP, 94 El Tor, 29 classical and 54 O139 strains produced nine, three and six different DNA fingerprints, respectively. On the other hand, VCR-AFLP distinguished these El Tor, classical and O139 strains into five, nine and two DNA fingerprints, respectively. Combining both assays the El Tor, classical and O139 strains could be differentiated into 11, 10 and seven different types, respectively. In a comparative study, pulsed-field gel electrophoresis (PFGE) showed similar differentiation for El Tor (11 types), but lower discrimination for O139 (two types) and classical strains (five types). The PCR assays based on SI diversity can be used as a useful typing tool for epidemiological studies of V. cholerae. This newly developed method is more discriminatory, simple, rapid and cost-effective in comparison with PFGE, and thus can be widely applicable. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

Identification of and Screening for Human Helicobacter cinaedi Infections and Carriers via Nested PCR

Science.gov (United States)

Oyama, Kohta; Khan, Shahzada; Okamoto, Tatsuya; Fujii, Shigemoto; Ono, Katsuhiko; Matsunaga, Tetsuro; Yoshitake, Jun; Sawa, Tomohiro; Tomida, Junko; Kawamura, Yoshiaki

2012-01-01

Helicobacter cinaedi is the most frequently reported enterohepatic Helicobacter species isolated from humans. Earlier research suggested that certain patients with H. cinaedi infection may remain undiagnosed or incorrectly diagnosed because of difficulties in detecting the bacteria by conventional culture methods. Here, we report a nested PCR assay that rapidly detects the cytolethal distending toxin gene (cdt) of H. cinaedi with high specificity and sensitivity. Specificity of the assay was validated by using different species of Helicobacter and Campylobacter, as well as known H. cinaedi-positive and -negative samples. The sensitivity of detection for the cdt gene in the assay was 102 CFU/ml urine or 102 CFU/105 infected RAW 264.7 cells. In an H. cinaedi-infected mouse model, the cdt gene of H. cinaedi was effectively detected via the assay with urine (6/7), stool (2/3), and blood (2/6) samples. Importantly, it detected H. cinaedi in blood, urine, and stool samples from one patient with a suspected H. cinaedi infection and three patients with known infections. The assay was further used clinically to follow up two H. cinaedi-infected patients after antibiotic treatment. Stool samples from these two patients evaluated by nested PCR after antibiotic therapy showed clearance of bacterial DNA. Finally, analysis of stool specimens from healthy volunteers showed occasional positive reactions (4/30) to H. cinaedi DNA, which suggests intestinal colonization by H. cinaedi in healthy subjects. In conclusion, this nested PCR assay may be useful for the rapid diagnosis, antimicrobial treatment evaluation, and epidemiological study of H. cinaedi infection. PMID:23015666

PCR-based methods for identification of potentially zoonotic ascaridoid parasites of the dog, fox and cat.

Science.gov (United States)

Jacobs, D E; Zhu, X; Gasser, R B; Chilton, N B

1997-11-01

Genomic DNA was extracted from ascaridoid nematodes collected from dogs, foxes and cats. A region spanning the second internal transcribed spacer (ITS-2) of the ribosomal DNA of each sample was amplified by PCR. Representative ITS-2 products for each nematode species (Toxocara canis, Toxocara cati and Toxascaris leonina) were sequenced. Restriction sites were identified for use as genetic markers in a PCR-linked RFLP assay. The three species could be differentiated from each other and from other ascaridoids that may be found in human tissues by use of two endonucleases, HinfI and RsaI. Primers were designed to unique regions of the ITS-2 sequences of the three species for use in diagnostic PCR procedures and primer sets evaluated against panels of homologous and heterologous DNA samples. Results suggest that both methods are good candidates for further development for the detection and/or identification of ascaridoid larvae in human tissues.

Evaluation of rapid immuno chromatographic assay kit using monoclonal mpt64 antibodies for identification of mycobacterium tuberculosis complex

International Nuclear Information System (INIS)

Satti, L.; Ikram, A.; Malik, N.

2010-01-01

To evaluate the performance of rapid immuno chromatographic kit MPT64 Ag for the identification of Mycobacterium tuberculosis complex from various Mycobacterium tuberculosis culture positive specimens. Department of Microbiology, Armed Forces Institute of Pathology Rawalpindi, from August 2008 through March 2009. Eighty four Mycobacterium tuberculosis positive cultures on I BACTEC 460 and MGIT 960, one ATCC 25177 MTB strain, three institutional control MTB strains, two institutional control MOTT strains and 20 different bacterial isolates were tested. Tests were performed according to the instructional manual. Out of total 84 tested samples, MPT64 showed positive result in 80 cultures. Only four positive cultures did not display any band on MPT64 kit. These four strains were reconfirmed as Mycobacterium tuberculosis by PCR method. MOTT control strains and all the 20 bacterial isolates were negative for band. The sensitivity and specificity of ICT assay in our study was 95.2% and 100% respectively. Rapid MPT64 Kit is a good diagnostic tool to differentiate between Mycobacterium tuberculosis complex and MOTT with 100% specificity. The technique is simple and can provide prompt information to the clinicians to initiate early and appropriate antituberculosis therapy. (author)

Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

Science.gov (United States)

Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

2014-01-01

A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

Directory of Open Access Journals (Sweden)

Lingyang Tian

2014-01-01

Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Rapid Molecular Identification of Human Taeniid Cestodes by Pyrosequencing Approach

Science.gov (United States)

Thanchomnang, Tongjit; Tantrawatpan, Chairat; Intapan, Pewpan M.; Sanpool, Oranuch; Janwan, Penchom; Lulitanond, Viraphong; Tourtip, Somjintana; Yamasaki, Hiroshi; Maleewong, Wanchai

2014-01-01

Taenia saginata, T. solium, and T. asiatica are causative agents of taeniasis in humans. The difficulty of morphological identification of human taeniids can lead to misdiagnosis or confusion. To overcome this problem, several molecular methods have been developed, but use of these tends to be time-consuming. Here, a rapid and high-throughput pyrosequencing approach was developed for the identification of three human taeniids originating from various countries. Primers targeting the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the three Taenia species were designed. Variations in a 26-nucleotide target region were used for identification. The reproducibility and accuracy of the pyrosequencing technology was confirmed by Sanger sequencing. This technique will be a valuable tool to distinguish between sympatric human taeniids that occur in Thailand, Asia and Pacific countries. This method could potentially be used for the molecular identification of the taeniid species that might be associated with suspicious cysts and lesions, or cyst residues in humans or livestock at the slaughterhouse. PMID:24945530

Genome-Wide Identification and Evaluation of Reference Genes for Quantitative RT-PCR Analysis during Tomato Fruit Development.

Science.gov (United States)

Cheng, Yuan; Bian, Wuying; Pang, Xin; Yu, Jiahong; Ahammed, Golam J; Zhou, Guozhi; Wang, Rongqing; Ruan, Meiying; Li, Zhimiao; Ye, Qingjing; Yao, Zhuping; Yang, Yuejian; Wan, Hongjian

2017-01-01

Gene expression analysis in tomato fruit has drawn increasing attention nowadays. Quantitative real-time PCR (qPCR) is a routine technique for gene expression analysis. In qPCR operation, reliability of results largely depends on the choice of appropriate reference genes (RGs). Although tomato is a model for fruit biology study, few RGs for qPCR analysis in tomato fruit had yet been developed. In this study, we initially identified 38 most stably expressed genes based on tomato transcriptome data set, and their expression stabilities were further determined in a set of tomato fruit samples of four different fruit developmental stages (Immature, mature green, breaker, mature red) using qPCR analysis. Two statistical algorithms, geNorm and Normfinder, concordantly determined the superiority of these identified putative RGs. Notably, SlFRG05 (Solyc01g104170), SlFRG12 (Solyc04g009770), SlFRG16 (Solyc10g081190), SlFRG27 (Solyc06g007510), and SlFRG37 (Solyc11g005330) were proved to be suitable RGs for tomato fruit development study. Further analysis using geNorm indicate that the combined use of SlFRG03 (Solyc02g063070) and SlFRG27 would provide more reliable normalization results in qPCR experiments. The identified RGs in this study will be beneficial for future qPCR analysis of tomato fruit developmental study, as well as for the potential identification of optimal normalization controls in other plant species.

Genome-Wide Identification and Evaluation of Reference Genes for Quantitative RT-PCR Analysis during Tomato Fruit Development

Directory of Open Access Journals (Sweden)

Yuan Cheng

2017-08-01

Full Text Available Gene expression analysis in tomato fruit has drawn increasing attention nowadays. Quantitative real-time PCR (qPCR is a routine technique for gene expression analysis. In qPCR operation, reliability of results largely depends on the choice of appropriate reference genes (RGs. Although tomato is a model for fruit biology study, few RGs for qPCR analysis in tomato fruit had yet been developed. In this study, we initially identified 38 most stably expressed genes based on tomato transcriptome data set, and their expression stabilities were further determined in a set of tomato fruit samples of four different fruit developmental stages (Immature, mature green, breaker, mature red using qPCR analysis. Two statistical algorithms, geNorm and Normfinder, concordantly determined the superiority of these identified putative RGs. Notably, SlFRG05 (Solyc01g104170, SlFRG12 (Solyc04g009770, SlFRG16 (Solyc10g081190, SlFRG27 (Solyc06g007510, and SlFRG37 (Solyc11g005330 were proved to be suitable RGs for tomato fruit development study. Further analysis using geNorm indicate that the combined use of SlFRG03 (Solyc02g063070 and SlFRG27 would provide more reliable normalization results in qPCR experiments. The identified RGs in this study will be beneficial for future qPCR analysis of tomato fruit developmental study, as well as for the potential identification of optimal normalization controls in other plant species.

Interlaboratory comparison of real-time pcr protocols for quantification of general fecal indicator bacteria

Science.gov (United States)

Shanks, O.C.; Sivaganesan, M.; Peed, L.; Kelty, C.A.; Blackwood, A.D.; Greene, M.R.; Noble, R.T.; Bushon, R.N.; Stelzer, E.A.; Kinzelman, J.; Anan'Eva, T.; Sinigalliano, C.; Wanless, D.; Griffith, J.; Cao, Y.; Weisberg, S.; Harwood, V.J.; Staley, C.; Oshima, K.H.; Varma, M.; Haugland, R.A.

2012-01-01

The application of quantitative real-time PCR (qPCR) technologies for the rapid identification of fecal bacteria in environmental waters is being considered for use as a national water quality metric in the United States. The transition from research tool to a standardized protocol requires information on the reproducibility and sources of variation associated with qPCR methodology across laboratories. This study examines interlaboratory variability in the measurement of enterococci and Bacteroidales concentrations from standardized, spiked, and environmental sources of DNA using the Entero1a and GenBac3 qPCR methods, respectively. Comparisons are based on data generated from eight different research facilities. Special attention was placed on the influence of the DNA isolation step and effect of simplex and multiplex amplification approaches on interlaboratory variability. Results suggest that a crude lysate is sufficient for DNA isolation unless environmental samples contain substances that can inhibit qPCR amplification. No appreciable difference was observed between simplex and multiplex amplification approaches. Overall, interlaboratory variability levels remained low (<10% coefficient of variation) regardless of qPCR protocol. ?? 2011 American Chemical Society.

Rapid identification of carbapenemase genes in gram-negative bacteria with an oligonucleotide microarray-based assay.

Directory of Open Access Journals (Sweden)

Sascha D Braun

Full Text Available Rapid molecular identification of carbapenemase genes in Gram-negative bacteria is crucial for infection control and prevention, surveillance and for epidemiological purposes. Furthermore, it may have a significant impact upon determining the appropriate initial treatment and greatly benefit for critically ill patients. A novel oligonucleotide microarray-based assay was developed to simultaneously detect genes encoding clinically important carbapenemases as well as selected extended (ESBL and narrow spectrum (NSBL beta-lactamases directly from clonal culture material within few hours. Additionally, a panel of species specific markers was included to identify Escherichia coli, Pseudomonas aeruginosa, Citrobacter freundii/braakii, Klebsiella pneumoniae and Acinetobacter baumannii. The assay was tested using a panel of 117 isolates collected from urinary, blood and stool samples. For these isolates, phenotypic identifications and susceptibility tests were available. An independent detection of carbapenemase, ESBL and NSBL genes was carried out by various external reference laboratories using PCR methods. In direct comparison, the microarray correctly identified 98.2% of the covered carbapenemase genes. This included blaVIM (13 out of 13, blaGIM (2/2, blaKPC (27/27, blaNDM (5/5, blaIMP-2/4/7/8/13/14/15/16/31 (10/10, blaOXA-23 (12/13, blaOXA-40-group (7/7, blaOXA-48-group (32/33, blaOXA-51 (1/1 and blaOXA-58 (1/1. Furthermore, the test correctly identified additional beta-lactamases [blaOXA-1 (16/16, blaOXA-2 (4/4, blaOXA-9 (33/33, OXA-10 (3/3, blaOXA-51 (25/25, blaOXA-58 (2/2, CTX-M1/M15 (17/17 and blaVIM (1/1]. In direct comparison to phenotypical identification obtained by VITEK or MALDI-TOF systems, 114 of 117 (97.4% isolates, including Acinetobacter baumannii (28/28, Enterobacter spec. (5/5, Escherichia coli (4/4, Klebsiella pneumoniae (62/63, Klebsiella oxytoca (0/2, Pseudomonas aeruginosa (12/12, Citrobacter freundii (1/1 and Citrobacter

High resolution melting (HRM) analysis as a new tool for rapid identification of Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum.

Science.gov (United States)

Ren, Xingxing; Fu, Ying; Xu, Chenggang; Feng, Zhou; Li, Miao; Zhang, Lina; Zhang, Jianmin; Liao, Ming

2017-05-01

Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum represent the most common causative agents of chicken salmonellosis, which result in high mortality and morbidity throughout the world. It is difficult and laborious to discriminate these diseases based on biochemical or phenotypic methods. Herein, we report the development of a single nucleotide polymorphism (SNP) PCR-high resolution melt (PCR-HRM) assay for the detection and discrimination of both S. Pullorum and S. Gallinarun. The gene rfbS, which encodes a factor involved in the biosynthesis of ADP paratose in serogroup D of Salmonella, has been identified as a robust genetic marker for the identification of S. Pullorum and S. Gallinarun based on polymorphisms at positions 237 and 598. Therefore, PCR-HRM analyses were used to characterize this gene. A total of 15 reference and 33 clinical isolates of Salmonella and related Gram-negative bacteria were detected using 2 sets of primers. Our PCR-HRM assay could distinguish S. Pullorum from S. Gallinarun and other strains using the primer pair SP-237F/237R. Similarly, S. Gallinarun could be distinguished from S. Pullorum and other strains using primer set SG-598F/598R. These 2 assays showed high specificity (100%) for both S. Pullorum and S. Gallinarun; the sensitivity of these 2 assays was at least 100-fold greater than that of the allele-specific PCR assay. This present study demonstrated that HRM analysis represents a potent, simple, and economic tool for the rapid, specific, and sensitive detection of S. Pullorum and S. Gallinarun. Our approach also may aid efforts for purification of Avian Salmonella disease. © 2016 Poultry Science Association Inc.

Application of multiplex PCR approaches for shark molecular identification: feasibility and applications for fisheries management and conservation in the Eastern Tropical Pacific.

Science.gov (United States)

Caballero, S; Cardeñosa, D; Soler, G; Hyde, J

2012-03-01

Here we describe the application of new and existing multiplex PCR methodologies for shark species molecular identification. Four multiplex systems (group ID, thresher sharks, hammerhead sharks and miscellaneous shark) were employed with primers previously described and some designed in this study, which allow for species identification after running PCR products through an agarose gel. This system was implemented for samples (bodies and fins) collected from unidentified sharks landed in the port of Buenaventura and from confiscated tissues obtained from illegal fishing around the Malpelo Island Marine Protected Area, Pacific Coast of Colombia. This method has allowed reliable identification, to date, of 407 samples to the genus and/or species levels, most of them (380) identified as the pelagic thresher shark (Alopias pelagicus). Another seven samples were identified as scalloped hammerhead sharks (Sphyrna lewini). This is an easy-to-implement and reliable identification method that could even be used locally to monitor shark captures in the main fishing ports of developed and developing countries. © 2011 Blackwell Publishing Ltd.

An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

Science.gov (United States)

Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

2015-08-01

Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

MALDI-TOF MS performance compared to direct examination, culture, and 16S rDNA PCR for the rapid diagnosis of bone and joint infections.

Science.gov (United States)

Lallemand, E; Coiffier, G; Arvieux, C; Brillet, E; Guggenbuhl, P; Jolivet-Gougeon, A

2016-05-01

The rapid identification of bacterial species involved in bone and joint infections (BJI) is an important element to optimize the diagnosis and care of patients. The aim of this study was to evaluate the usefulness of matrix-assisted laser desorption ionization mass spectrometry (MALDI-TOF MS) for the rapid diagnosis of bone infections, directly on synovial fluid (SF) or on crushed osteoarticular samples (CS). From January to October 2013, we prospectively analyzed 111 osteoarticular samples (bone and joint samples, BJS) from 78 patients in care at the University Hospital of Rennes, France. The diagnosis procedure leading to the sample collection was linked to a suspicion of infection, inflammatory disease, arthritis, or for any bone or joint abnormalities. Standard bacteriological diagnosis and molecular biology analysis [16S rRNA polymerase chain reaction (PCR) and sequencing] were conducted. In addition, analysis by MALDI-TOF MS was performed directly on the osteoarticular samples, as soon as the amount allowed. Culture, which remains the gold standard for the diagnosis of BJI, has the highest sensitivity (85.9 %) and remains necessary to test antimicrobial susceptibility. The 16S rDNA PCR results were positive in the group with positive BJI (28.6 %) and negative in the group without infection. Direct examination remains insensitive (31.7 %) but more effective than MALDI-TOF MS directly on the sample (6.3 %). The specificity was 100 % in all cases, except for culture (74.5 %). Bacterial culture remains the gold standard, especially enrichment in blood bottles. Direct analysis of bone samples with MALDI-TOF MS is not useful, possibly due to the low inoculum of BJS.

A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

Science.gov (United States)

Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

2016-06-01

The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

Development of a rapid HRM qPCR for the diagnosis of the four most prevalent Plasmodium lineages in New Zealand.

Science.gov (United States)

Schoener, E R; Hunter, S; Howe, L

2017-07-01

Although wildlife rehabilitation and translocations are important tools in wildlife conservation in New Zealand, disease screening of birds has not been standardized. Additionally, the results of the screening programmes are often difficult to interpret due to missing disease data in resident or translocating avian populations. Molecular methods have become the most widespread method for diagnosing avian malaria (Plasmodium spp.) infections. However, these methods can be time-consuming, expensive and are less specific in diagnosing mixed infections. Thus, this study developed a new real-time PCR (qPCR) method that was able to detect and specifically identify infections of the three most common lineages of avian malaria in New Zealand (Plasmodium (Novyella) sp. SYAT05, Plasmodium elongatum GRW6 and Plasmodium spp. LINN1) as well as a less common, pathogenic Plasmodium relictum GRW4 lineage. The assay was also able to discern combinations of these parasites in the same sample and had a detection limit of five parasites per microlitre. Due to concerns relating to the presence of the potentially highly pathogenic P. relictum GRW4 lineage in avian populations, an additional confirmatory high resolution (HRM) qPCR was developed to distinguish between commonly identified P. elongatum GRW6 from P. relictum GRW4. The new qPCR assays were tested using tissue samples containing Plasmodium schizonts from three naturally infected dead birds resulting in the identified infection of P. elongatum GRW6. Thus, these rapid qPCR assays have shown to be cost-effective and rapid screening tools for the detection of Plasmodium infection in New Zealand native birds.

Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

Science.gov (United States)

Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

2016-11-01

Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

A rapid identification of four medicinal chrysanthemum varieties with near infrared spectroscopy.

Science.gov (United States)

Han, Bangxing; Yan, Hui; Chen, Cunwu; Yao, Houjun; Dai, Jun; Chen, Naifu

2014-07-01

For genuine medicinal material in Chinese herbs; the efficient, rapid, and precise identification is the focus and difficulty in the filed studying Chinese herbal medicines. Chrysanthemum morifolium as herbs has a long planting history in China, culturing high quality ones and different varieties. Different chrysanthemum varieties differ in quality, chemical composition, functions, and application. Therefore, chrysanthemum varieties in the market demands precise identification to provide reference for reasonable and correct application as genuine medicinal material. A total of 244 batches of chrysanthemum samples were randomly divided into calibration set (160 batches) and prediction set (84 batches). The near infrared diffuses reflectance spectra of chrysanthemum varieties were preprocessed by first order derivative (D1) and autoscaling and was built model with partial least squares (PLS). In this study of four chrysanthemum varieties identification, the accuracy rates in calibration sets of Boju, Chuju, Hangju, and Gongju are respectively 100, 100, 98.65, and 96.67%; while the accuracy rates in prediction sets are 100% except for 99.1% of Hangju. The research results demonstrate that the qualitative analysis can be conducted by machine learning combined with near infrared spectroscopy (NIR), which provides a new method for rapid and noninvasive identification of chrysanthemum varieties.

Yeast identification by sequencing, biochemical kits, MALDI-TOF MS and rep-PCR DNA fingerprinting.

Science.gov (United States)

Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Chan, Jasper F W; Lau, Susanna K P; Kong, Fanrong; Xu, Yingchun; Woo, Patrick C Y

2017-12-08

No study has comprehensively evaluated the performance of 28S nrDNA and ITS sequencing, commercial biochemical test kits, MALDI-TOF MS platforms, and the emerging rep-PCR DNA fingerprinting technology using a cohort of yeast strains collected from a clinical microbiology laboratory. In this study, using 71 clinically important yeast isolates (excluding Candida albicans) collected from a single centre, we determined the concordance of 28S nrDNA and ITS sequencing and evaluated the performance of two commercial test kits, two MALDI-TOF MS platforms, and rep-PCR DNA fingerprinting. 28S nrDNA and ITS sequencing showed complete agreement on the identities of the 71 isolates. Using sequencing results as the standard, 78.9% and 71.8% isolates were correctly identified using the API 20C AUX and Vitek 2 YST ID Card systems, respectively; and 90.1% and 80.3% isolates were correctly identified using the Bruker and Vitek MALDI-TOF MS platforms, respectively. Of the 18 strains belonging to the Candida parapsilosis species complex tested by DiversiLab automated rep-PCR DNA fingerprinting, all were identified only as Candida parapsilosis with similarities ≥93.2%, indicating the misidentification of Candida metapsilosis and Candida orthopsilosis. However, hierarchical cluster analysis of the rep-PCR DNA fingerprints of these three species within this species complex formed three different discrete clusters, indicating that this technology can potentially differentiate the three species. To achieve higher accuracies of identification, the databases of commercial biochemical test kits, MALDI-TOF MS platforms, and DiversiLab automated rep-PCR DNA fingerprinting needs further enrichment, particularly for uncommonly encountered yeast species. © The Author 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Reduction of the use of antimicrobial drugs following the rapid detection of Streptococcus agalactiae in the vagina at delivery by real-time PCR assay.

Science.gov (United States)

Poncelet-Jasserand, E; Forges, F; Varlet, M-N; Chauleur, C; Seffert, P; Siani, C; Pozzetto, B; Ros, A

2013-08-01

To assess whether the determination of the presence of group B streptococci (GBS) in the vagina using a rapid polymerase chain reaction (PCR) assay at delivery was able to spare useless antimicrobial treatments, as compared with conventional culture at 34-38 weeks of gestation. Practical evaluation and prospective cost-effectiveness analysis. A university hospital in France. A cohort of 225 women in labour at the University-Hospital of Saint-Etienne. Each woman had a conventional culture performed at 34-38 weeks of gestation. At the beginning of labour, two vaginal swabs were sampled for rapid PCR testing and culture. The decision to prescribe a prophylactic antimicrobial treatment or not was taken according to the result of the PCR test. A comparative cost-effectiveness analysis of the two diagnostic strategies was carried out. Number of women receiving inadequate prophylactic antimicrobial drugs following each testing strategy, costs of PCR testing and culture, frequency of vaginal GBS, and diagnostic performance of the PCR test at delivery. The percentage of unnecessarily treated women was significantly reduced using the rapid test versus conventional culture (4.5 and 13.6%, respectively; P < 0.001). The rate of vaginal GBS at delivery was 12.5%. The incremental cost-effectiveness ratio (ICER) for each inadequate management avoided was €36 and €173 from the point of view of the healthcare system and hospital, respectively. The PCR assay reduced the number of inadequate antimicrobial treatments aimed to prevent the early onset of GBS disease. However, this strategy generates extra costs that must be put into balance with its clinical benefits. © 2013 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2013 RCOG.

Characterization of spoilage bacteria in pork sausage by PCR-DGGE analysis

Directory of Open Access Journals (Sweden)

Francesca Silva Dias

2013-09-01

Full Text Available To investigate microbial diversity and identify spoilage bacteria in fresh pork sausages during storage, twelve industrial pork sausages of different trademarks were stored at 4 ºC for 0, 14, 28 and 42 days, 80% relative humidity and packaged in sterile plastic bags. Microbiological analysis was performed. The pH and water activity (a w were measured. The culture-independent method performed was the Polymerase Chain Reaction - Denaturing Gradient Gel Electrophoresis (PCR-DGGE. The culture-dependent method showed that the populations of mesophilic bacteria and Lactic Acid Bacteria (LAB increased linearly over storage time. At the end of the storage time, the average population of microorganisms was detected, in general, at the level of 5 log cfu g-1. A significant (P < 0.005 increase was observed in pH and a w values at the end of the storage time. The PCR-DGGE allowed a rapid identification of dominant communities present in sausages. PCR-DGGE discriminated 15 species and seven genera of bacteria that frequently constitute the microbiota in sausage products. The most frequent spoilage bacteria identified in the sausages were Lactobacillus sakei and Brochothrix thermosphacta. The identification of dominant communities present in fresh pork sausages can help in the choice of the most effective preservation method for extending the product shelf-life.

Bloodmeal Identification in Field-Collected Sand Flies From Casa Branca, Brazil, Using the Cytochrome b PCR Method.

Science.gov (United States)

Carvalho, G M L; Rêgo, F D; Tanure, A; Silva, A C P; Dias, T A; Paz, G F; Andrade Filho, J D

2017-07-01

PCR-based identification of vertebrate host bloodmeals has been performed on several vectors species with success. In the present study, we used a previously published PCR protocol followed by DNA sequencing based on primers designed from multiple alignments of the mitochondrial cytochrome b gene used to identify avian and mammalian hosts of various hematophagous vectors. The amplification of a fragment encoding a 359 bp sequence of the Cyt b gene yielded recognized amplification products in 192 female sand flies (53%), from a total of 362 females analyzed. In the study area of Casa Branca, Brazil, blood-engorged female sand flies such as Lutzomyia longipalpis (Lutz & Neiva, 1912), Migonemyia migonei (França, 1924), and Nyssomyia whitmani (Antunes & Coutinho, 1939) were analyzed for bloodmeal sources. The PCR-based method identified human, dog, chicken, and domestic rat blood sources. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Rapid molecular identification of human taeniid cestodes by pyrosequencing approach.

Directory of Open Access Journals (Sweden)

Tongjit Thanchomnang

Full Text Available Taenia saginata, T. solium, and T. asiatica are causative agents of taeniasis in humans. The difficulty of morphological identification of human taeniids can lead to misdiagnosis or confusion. To overcome this problem, several molecular methods have been developed, but use of these tends to be time-consuming. Here, a rapid and high-throughput pyrosequencing approach was developed for the identification of three human taeniids originating from various countries. Primers targeting the mitochondrial cytochrome c oxidase subunit 1 (cox1 gene of the three Taenia species were designed. Variations in a 26-nucleotide target region were used for identification. The reproducibility and accuracy of the pyrosequencing technology was confirmed by Sanger sequencing. This technique will be a valuable tool to distinguish between sympatric human taeniids that occur in Thailand, Asia and Pacific countries. This method could potentially be used for the molecular identification of the taeniid species that might be associated with suspicious cysts and lesions, or cyst residues in humans or livestock at the slaughterhouse.

Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.

Science.gov (United States)

Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

2006-09-01

A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.

The PCR-Based Diagnosis of Central Nervous System Tuberculosis: Up to Date

Directory of Open Access Journals (Sweden)

Teruyuki Takahashi

2012-01-01

Full Text Available Central nervous system (CNS tuberculosis, particularly tuberculous meningitis (TBM, is the severest form of Mycobacterium tuberculosis (M.Tb infection, causing death or severe neurological defects in more than half of those affected, in spite of recent advancements in available anti-tuberculosis treatment. The definitive diagnosis of CNS tuberculosis depends upon the detection of M.Tb bacilli in the cerebrospinal fluid (CSF. At present, the diagnosis of CNS tuberculosis remains a complex issue because the most widely used conventional “gold standard” based on bacteriological detection methods, such as direct smear and culture identification, cannot rapidly detect M.Tb in CSF specimens with sufficient sensitivity in the acute phase of TBM. Recently, instead of the conventional “gold standard”, the various molecular-based methods including nucleic acid amplification (NAA assay technique, particularly polymerase chain reaction (PCR assay, has emerged as a promising new method for the diagnosis of CNS tuberculosis because of its rapidity, sensitivity and specificity. In addition, the innovation of nested PCR assay technique is worthy of note given its contribution to improve the diagnosis of CNS tuberculosis. In this review, an overview of recent progress of the NAA methods, mainly highlighting the PCR assay technique, was presented.

Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients.

Science.gov (United States)

Tat Trung, Ngo; Van Tong, Hoang; Lien, Tran Thi; Van Son, Trinh; Thanh Huyen, Tran Thi; Quyen, Dao Thanh; Hoan, Phan Quoc; Meyer, Christian G; Song, Le Huu

2018-02-01

For the identification of bacterial pathogens, blood culture is still the gold standard diagnostic method. However, several disadvantages apply to blood cultures, such as time and rather large volumes of blood sample required. We have previously established an optimised multiplex real-time PCR method in order to diagnose bloodstream infections. In the present study, we evaluated the diagnostic performance of this optimised multiplex RT-PCR in blood samples collected from 110 septicaemia patients enrolled at the 108 Military Central Hospital, Hanoi, Vietnam. Positive results were obtained by blood culture, the Light Cylcler-based SeptiFast ® assay and our multiplex RT-PCR in 35 (32%), 31 (28%), and 31 (28%) samples, respectively. Combined use of the three methods confirmed 50 (45.5%) positive cases of bloodstream infection, a rate significantly higher compared to the exclusive use of one of the three methods (P=0.052, 0.012 and 0.012, respectively). The sensitivity, specificity and area under the curve (AUC) of our assay were higher compared to that of the SeptiFast ® assay (77.4%, 86.1% and 0.8 vs. 67.7%, 82.3% and 0.73, respectively). Combined use of blood culture and multiplex RT-PCR assay showed a superior diagnostic performance, as the sensitivity, specificity, and AUC reached 83.3%, 100%, and 0.95, respectively. The concordance between blood culture and the multiplex RT-PCR assay was highest for Klebsiella pneumonia (100%), followed by Streptococcus spp. (77.8%), Escherichia coli (66.7%), Staphylococcus spp. (50%) and Salmonella spp. (50%). In addition, the use of the newly established multiplex RT-PCR assay increased the spectrum of identifiable agents (Acintobacter baumannii, 1/32; Proteus mirabilis, 1/32). The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients. Copyright © 2017 The

Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

Directory of Open Access Journals (Sweden)

Lisha, V.

2017-01-01

Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

Rapid lard identification with portable electronic nose

Science.gov (United States)

Latief, Marsad; Khorsidtalab, Aida; Saputra, Irwan; Akmeliawati, Rini; Nurashikin, Anis; Jaswir, Irwandi; Witjaksono, Gunawan

2017-11-01

Human sensory systems are limited in many different regards, yet they are great sources of inspiration for development of technologies that help humans to overcome their restraints. This paper signifies the capability of our developed electronic nose in rapid lard identification. The developed device, known as E-Nose, mimics human’s olfactory system’s technique to identify a particular substance. Lard is a common pig derivative which is often used as a food additive, emulsion or shortening. It’s also commonly used as an adulterant or as an alternative for cooking oils, margarine and butter. This substance is prohibited to be consumed by Muslims and Orthodox Jews for religious reasons. A portable reliable device with an ability to identify lard rapidly can be convenient to users concerned about lard adulteration. The prototype was examined using K-Nearest Neighbors algorithm (KNN), Support Vector Machine (SVM), Bagged Trees and Simple Tree, and can identify lard with the highest accuracy of 95.6% among three types of fat (lard, chicken and beef) in liquid form over a certain range of temperature using KNN.

A novel RT-PCR for the detection of Helicobacter pylori and identification of clarithromycin resistance mediated by mutations in the 23S rRNA gene.

Science.gov (United States)

Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline

2018-01-01

In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Multiplex PCR Assay for Identification of Six Different Staphylococcus spp. and Simultaneous Detection of Methicillin and Mupirocin Resistance

OpenAIRE

Campos-Peña, E.; Martín-Nuñez, E.; Pulido-Reyes, G.; Martín-Padrón, J.; Caro-Carrillo, E.; Donate-Correa, J.; Lorenzo-Castrillejo, I.; Alcoba-Flórez, J.; Machín, F.; Méndez-Alvarez, S.

2014-01-01

We describe a new, efficient, sensitive, and fast single-tube multiple-PCR protocol for the identification of the most clinically significant Staphylococcus spp. and the simultaneous detection of the methicillin and mupirocin resistance loci. The protocol identifies at the species level isolates belonging to S. aureus, S. epidermidis, S. haemolyticus, S. hominis, S. lugdunensis, and S. saprophyticus.

Species identification and quantification in meat and meat products using droplet digital PCR (ddPCR).

Science.gov (United States)

Floren, C; Wiedemann, I; Brenig, B; Schütz, E; Beck, J

2015-04-15

Species fraud and product mislabelling in processed food, albeit not being a direct health issue, often results in consumer distrust. Therefore methods for quantification of undeclared species are needed. Targeting mitochondrial DNA, e.g. CYTB gene, for species quantification is unsuitable, due to a fivefold inter-tissue variation in mtDNA content per cell resulting in either an under- (-70%) or overestimation (+160%) of species DNA contents. Here, we describe a reliable two-step droplet digital PCR (ddPCR) assay targeting the nuclear F2 gene for precise quantification of cattle, horse, and pig in processed meat products. The ddPCR assay is advantageous over qPCR showing a limit of quantification (LOQ) and detection (LOD) in different meat products of 0.01% and 0.001%, respectively. The specificity was verified in 14 different species. Hence, determining F2 in food by ddPCR can be recommended for quality assurance and control in production systems. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

DEFF Research Database (Denmark)

Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

2002-01-01

) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect r = 0.99) over...... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro....... In conclusion, a rapid, sensitive, and reproducible quantitative PCR assay for P. carinii f. sp. carinii has been developed and is applicable to in vivo as well as in vitro systems. The assay should prove useful for conducting studies in which quantification of organism burden or growth assessment is critical...

A nested-PCR strategy for molecular diagnosis of mollicutes in uncultured biological samples from cows with vulvovaginitis.

Science.gov (United States)

Voltarelli, Daniele Cristina; de Alcântara, Brígida Kussumoto; Lunardi, Michele; Alfieri, Alice Fernandes; de Arruda Leme, Raquel; Alfieri, Amauri Alcindo

2018-01-01

Bacteria classified in Mycoplasma (M. bovis and M. bovigenitalium) and Ureaplasma (U. diversum) genera are associated with granular vulvovaginitis that affect heifers and cows at reproductive age. The traditional means for detection and speciation of mollicutes from clinical samples have been culture and serology. However, challenges experienced with these laboratory methods have hampered assessment of their impact in pathogenesis and epidemiology in cattle worldwide. The aim of this study was to develop a PCR strategy to detect and primarily discriminate between the main species of mollicutes associated with reproductive disorders of cattle in uncultured clinical samples. In order to amplify the 16S-23S rRNA internal transcribed spacer region of the genome, a consensual and species-specific nested-PCR assay was developed to identify and discriminate between main species of mollicutes. In addition, 31 vaginal swab samples from dairy and beef affected cows were investigated. This nested-PCR strategy was successfully employed in the diagnosis of single and mixed mollicute infections of diseased cows from cattle herds from Brazil. The developed system enabled the rapid and unambiguous identification of the main mollicute species known to be associated with this cattle reproductive disorder through differential amplification of partial fragments of the ITS region of mollicute genomes. The development of rapid and sensitive tools for mollicute detection and discrimination without the need for previous cultures or sequencing of PCR products is a high priority for accurate diagnosis in animal health. Therefore, the PCR strategy described herein may be helpful for diagnosis of this class of bacteria in genital swabs submitted to veterinary diagnostic laboratories, not demanding expertise in mycoplasma culture and identification. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of Acinetobacter baumannii of Human and Animal Origins by a Gene-Specific PCR.

Science.gov (United States)

Hamouda, Ahmed

2017-09-01

Acinetobacter baumannii is a notorious nosocomial pathogen known for its ability to cause severe infections, especially in intensive care units. The identification of a conserved gene encoding a hypothetical protein in A. baumannii isolates but not in other Acinetobacter species during a comparative genomic analysis was reported. For the purpose of this study, we call this gene, A.b_hyp gene. The aim of this study was to report the results of screening for the presence of the A.b_hyp gene in a worldwide collection of well-characterized A. baumannii collected from clinical and animal specimens. A total of 83 clinical, animal, and type strains were used. These comprised 73 A. baumannii isolates of clinical (n = 60) and animal origin (n = 13), and ten type strains, including a positive control strain, A. baumannii ATCC 19606. All isolates were examined by PCR amplification of the A.b_hyp gene. The A.b_hyp gene was detected in 72 isolates (99%) of A. baumannii but one clinical isolate failed to produce an amplicon. The control strain, A. baumannii ATCC 19606, was also positive for this gene. No bands were detected in non-A. baumannii species and therefore the isolates are thought to be negative for the gene. No bands were detected in non-A. baumannii isolates and therefore they are thought to be negative for the gene. The PCR A.b_ hyp method provides evidence that detection of this gene can be used as a reliable, easy, and low-cost biomarker for A. baumannii identification.

Rapid identification of sequences for orphan enzymes to power accurate protein annotation.

Directory of Open Access Journals (Sweden)

Kevin R Ramkissoon

Full Text Available The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the "back catalog" of enzymology--"orphan enzymes," those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC database alone. In this study, we demonstrate how this orphan enzyme "back catalog" is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology's "back catalog" another powerful tool to drive accurate genome annotation.

Rapid Identification of Sequences for Orphan Enzymes to Power Accurate Protein Annotation

Science.gov (United States)

Ojha, Sunil; Watson, Douglas S.; Bomar, Martha G.; Galande, Amit K.; Shearer, Alexander G.

2013-01-01

The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the “back catalog” of enzymology – “orphan enzymes,” those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC) database alone. In this study, we demonstrate how this orphan enzyme “back catalog” is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis) to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology’s “back catalog” another powerful tool to drive accurate genome annotation. PMID:24386392

Rapid Molecular detection of citrus brown spot disease using ACT gene in Alternaria alternata

Directory of Open Access Journals (Sweden)

Hamid Moghimi

2017-06-01

Full Text Available Introduction:Using rapid detection methods is important for detection of plant pathogens and also prevention through spreading pests in agriculture. Citrus brown spot disease caused by pathogenic isolates of Alternaria alternata is a common disease in Iran. Materials and methods: In this study, for the first time a PCR based molecular method was used for rapid diagnosis of brown spot disease. Nine isolates of A. Alternata were isolated in PDA medium from different citrus gardens. The plant pathogenic activity was examined in tangerine leaves for isolates. Results showed that these isolates are the agents of brown spot disease. PCR amplification of specific ACT-toxin gene was performed for DNA extracted from A. alternata isolates, with 11 different fungal isolates as negative controls and 5 DNA samples extracted from soil. Results: Results showed that A. alternata, the causal agent of brown spot disease, can be carefully distinguished from other pathogenic agents by performing PCR amplification with specific primers for ACT toxin gene. Also, the results from Nested-PCR method confirmed the primary reaction and the specificity of A. alternata for brown spot disease. PCR results to control samples of the other standard fungal isolates, showed no amplification band. In addition, PCR with the DNA extracted from contaminated soils confirmed the presence of ACT toxin gene. Discussion and conclusion: Molecular procedure presented here can be used in rapid identification and prevention of brown spot infection in citrus gardens all over the country.

A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

Science.gov (United States)

Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

2009-11-18

Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

Science.gov (United States)

Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

2017-06-01

A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

Meat species identification and Halal authentication using PCR analysis of raw and cooked traditional Turkish foods.

Science.gov (United States)

Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z

2013-07-01

The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.

[Development and evaluation of a rapid PCR detection kit for Ophiocordyceps sinensis].

Science.gov (United States)

Hou, Fei-Xia; Cao, Jing; Wang, Sha-Sha; Wang, Xi; Yuan, Yuan; Peng, Cheng; Wan, De-Guang; Guo, Jin-Lin

2017-03-01

Ophiocordyceps sinensis is a valuable traditional Chinese medicine. Due to resource shortage, expensive price and huge market demand, there are many adulterants of O. sinensis in markets. Therefore, it is necessary to establish a rapid and effective method for distinguishing O. sinensis. Based on the species-specific PCR of O. sinensis, this study developed a detection kit by optimizing the components and evaluated the specificity, detection limit, repeatability and shelf life of the kit. The results showed that when the quality of O. sinensis accounted for more than 1/200 of that mixture, it could be detected successfully. Moreover, only O. sinensis could be amplified and glowed bright green fluorescence under ultraviolet light. The kit was still in effect when it was placed at 37 ℃ for three days, which indicated that it was stable and effective for one year stored in 4 ℃. The kit in the same batch under different operation conditions, and in different batch under the same operation conditions gave the same result and accuracy, which showed good repeatability of the kit. It is simple, rapid and accurate to distinguish O. sinensis from its adulterants using the kit, and lays the foundation for commercialization of traditional Chinese medicine fast detection kit. Copyright© by the Chinese Pharmaceutical Association.

A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

Science.gov (United States)

Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

2015-02-01

A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

A novel polymerase chain reaction (PCR) for rapid isolation of a new ...

African Journals Online (AJOL)

mediated self-formed panhandle PCR, for gene or chromosome walking. It combined the advantages of ligation-mediated PCR in its specificity and of panhandle PCR in its efficiency. Self-formed panhandle PCR was used for a new rbcS gene ...

Comparison of duplex PCR and phenotypic analysis in differentiating Candida dubliniensis from Candida albicans from oral samples.

Science.gov (United States)

Sampath, Asanga; Weerasekera, Manjula; Dilhari, Ayomi; Gunasekara, Chinthika; Bulugahapitiya, Uditha; Fernando, Neluka; Samaranayake, Lakshman

2017-12-01

Candida dubliniensis shares a wide range of phenotypic characteristics with Candida albicans including a common trait called germ tube positivity. Hence, laboratory differentiation of these two species is cumbersome. Duplex PCR analyses for C. albicans and C. dubliniensis was performed directly on DNA extracted from a total of 122 germ tube positive isolates derived from 100 concentrated oral rinse samples from a random cohort of diabetics attending a clinic in Sri Lanka. These results were confirmed by DNA sequencing of internal transcribed spacer (ITS) region of rDNA of the yeasts. Performance efficacy of duplex PCR was then compared with phenotypic identification using a standard battery of phenotypic tests. Of the 122 germ tube positive isolates three were identified by duplex PCR as C. dubliniensis and the remainder as C. albicans. On the contrary, when the standard phenotypic tests, sugar assimilation and chlamydospore formation, were used to differentiate the two species 13 germ tube positive isolates were erroneously identified as C. dubliniensis. Duplex PCR was found to be rapid, sensitive and more specific than phenotypic identification methods in discriminating C. dubliniensis from C. albicans. This is also the first report on the oral carriage of C. dubliniensis in a Sri Lankan population.

Development and first evaluation of a novel multiplex real-time PCR on whole blood samples for rapid pathogen identification in critically ill patients with sepsis.

Science.gov (United States)

van de Groep, Kirsten; Bos, Martine P; Savelkoul, Paul H M; Rubenjan, Anna; Gazenbeek, Christel; Melchers, Willem J G; van der Poll, Tom; Juffermans, Nicole P; Ong, David S Y; Bonten, Marc J M; Cremer, Olaf L

2018-04-26

Molecular tests may enable early adjustment of antimicrobial therapy and be complementary to blood culture (BC) which has imperfect sensitivity in critically ill patients. We evaluated a novel multiplex real-time PCR assay to diagnose bloodstream pathogens directly in whole blood samples (BSI-PCR). BSI-PCR included 11 species- and four genus-specific PCRs, a molecular Gram-stain PCR, and two antibiotic resistance markers. We collected 5 mL blood from critically ill patients simultaneously with clinically indicated BC. Microbial DNA was isolated using the Polaris method followed by automated DNA extraction. Sensitivity and specificity were calculated using BC as reference. BSI-PCR was evaluated in 347 BC-positive samples (representing up to 50 instances of each pathogen covered by the test) and 200 BC-negative samples. Bacterial species-specific PCR sensitivities ranged from 65 to 100%. Sensitivity was 26% for the Gram-positive PCR, 32% for the Gram-negative PCR, and ranged 0 to 7% for yeast PCRs. Yeast detection was improved to 40% in a smaller set-up. There was no overall association between BSI-PCR sensitivity and time-to-positivity of BC (which was highly variable), yet Ct-values were lower for true-positive versus false-positive PCR results. False-positive results were observed in 84 (4%) of the 2200 species-specific PCRs in 200 culture-negative samples, and ranged from 0 to 6% for generic PCRs. Sensitivity of BSI-PCR was promising for individual bacterial pathogens, but still insufficient for yeasts and generic PCRs. Further development of BSI-PCR will focus on improving sensitivity by increasing input volumes and on subsequent implementation as a bedside test.

Rapid and accurate identification of Streptococcus equi subspecies by MALDI-TOF MS

DEFF Research Database (Denmark)

Kudirkiene, Egle; Welker, Martin; Knudsen, Nanna Reumert

2015-01-01

phenotypic and sequence similarity between three subspecies their discrimination remains difficult. In this study, we aimed to design and validate a novel, Superspectra based, MALDI-TOF MS approach for reliable, rapid and cost-effective identification of SEE and SEZ, the most frequent S. equi subspecies.......3±7.5%). This result may be attributed to the highly clonal population structure of SEE, as opposed to the diversity of SEZ seen in horses. Importantly strains with atypical colony appearance both within SEE and SEZ did not affect correct identification of the strains by MALDI-TOF MS. Atypical colony variants...... are often associated with a higher persistence or virulence of S. equi, thus their correct identification using the current method strengthens its potential use in routine clinical diagnostics. In conclusion, reliable identification of S. equi subspecies was achieved by combining a MALDI-TOF MS method...

A Lab on a chip device for rapid identification of Avian Influenza virus by on-chip sample preparation and solid phase PCR

DEFF Research Database (Denmark)

Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

2009-01-01

In this paper, we describe a novel lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid phase PCR on microchip. The device can handle viral samples in an automatic way. Moreover, multiplex PCR and sequence detection are done in one-step, which greatly simplifies...

Rapid species specific identification and subtyping of Yersinia enterocolitica by MALDI-TOF mass spectrometry.

Science.gov (United States)

Stephan, Roger; Cernela, Nicole; Ziegler, Dominik; Pflüger, Valentin; Tonolla, Mauro; Ravasi, Damiana; Fredriksson-Ahomaa, Maria; Hächler, Herbert

2011-11-01

Yersinia enterocolitica are Gram-negative pathogens and known as important causes of foodborne infections. Rapid and reliable identification of strains of the species Y. enterocolitica within the genus Yersinia and the differentiation of the pathogenic from the non-pathogenic biotypes has become increasingly important. We evaluated here the application of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) for rapid species identification and subtyping of Y. enterocolitica. To this end, we developed a reference MS database library including 19 Y. enterocolitica (non-pathogenic biotype 1A and pathogenic biotypes 2 and 4) as well as 24 non-Y. enterocolitica strains, belonging to eleven different other Yersinia spp. The strains provided reproducible and unique mass spectra profiles covering a wide molecular mass range (2000 to 30,000 Da). Species-specific and biotype-specific biomarker protein mass patterns were determined for Y. enterocolitica. The defined biomarker mass patterns (SARAMIS SuperSpectrum™) were validated using 117 strains from various Y. enterocolitica bioserotypes in a blind-test. All strains were correctly identified and for all strains the mass spectrometry-based identification scheme yielded identical results compared to a characterization by a combination of biotyping and serotyping. Our study demonstrates that MALDI-TOF-MS is a reliable and powerful tool for the rapid identification of Y. enterocolitica strains to the species level and allows subtyping of strains to the biotype level. Copyright © 2011 Elsevier B.V. All rights reserved.

Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

Science.gov (United States)

Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

2018-01-02

The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

Specific PCR-based detection of Alternaria helianthi

DEFF Research Database (Denmark)

Udayashankar, A.C.; Nayaka, S. Chandra; Archana, B.

2012-01-01

Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method...... tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification...

Mistaken identity of a PCR target proposed for identification of Mycoplasma bovis and the effect of sequence variation on assay performance

Science.gov (United States)

Background. Mycoplasma bovis is an important cause of disease in cattle and has recently emerged as a primary disease agent in bison. Because the bacterium requires specialized growth conditions many diagnostic laboratories use PCR to replace or complement traditional isolation and identification ...

Environmental DNA (eDNA From the Wake of the Whales: Droplet Digital PCR for Detection and Species Identification

Directory of Open Access Journals (Sweden)

C. Scott Baker

2018-04-01

Full Text Available Genetic sampling for identification of species, subspecies or stock of whales, dolphins and porpoises at sea remains challenging. Most samples have been collected with some form of a biopsy dart requiring a close approach of a vessel while the individual is at the surface. Here we have adopted droplet digital (ddPCR technology for detection and species identification of cetaceans using environmental (eDNA collected from seawater. We conducted a series of eDNA sampling experiments during 25 encounters with killer whales, Orcinus orca, in Puget Sound (the Salish Sea. The regular habits of killer whales in these inshore waters allowed us to locate pods and collect seawater, at an initial distance of 200 m and at 15-min intervals, for up to 2 h after the passage of the whales. To optimize detection, we designed a set of oligonucleotide primers and probes to target short fragments of the mitochondrial (mtDNA control region, with a focus on identification of known killer whale ecotypes. We confirmed the potential to detect eDNA in the wake of the whales for up to 2 h, despite movement of the water mass by several kilometers due to tidal currents. Re-amplification and sequencing of the eDNA barcode confirmed that the ddPCR detection included the “southern resident community” of killer whales, consistent with the calls from hydrophone recordings and visual observations.

Identification of Eastern United States Reticulitermes Termite Species via PCR-RFLP, Assessed Using Training and Test Data

Directory of Open Access Journals (Sweden)

Ryan C. Garrick

2015-06-01

Full Text Available Reticulitermes termites play key roles in dead wood decomposition and nutrient cycling in forests. They also damage man-made structures, resulting in considerable economic loss. In the eastern United States, five species (R. flavipes, R. virginicus, R. nelsonae, R. hageni and R. malletei have overlapping ranges and are difficult to distinguish morphologically. Here we present a molecular tool for species identification. It is based on polymerase chain reaction (PCR amplification of a section of the mitochondrial cytochrome oxidase subunit II gene, followed by a three-enzyme restriction fragment length polymorphism (RFLP assay, with banding patterns resolved via agarose gel electrophoresis. The assay was designed using a large set of training data obtained from a public DNA sequence database, then evaluated using an independent test panel of Reticulitermes from the Southern Appalachian Mountains, for which species assignments were determined via phylogenetic comparison to reference sequences. After refining the interpretive framework, the PCR-RFLP assay was shown to provide accurate identification of four co-occurring species (the fifth species, R. hageni, was absent from the test panel, so accuracy cannot yet be extended to training data. The assay is cost- and time-efficient, and will help improve knowledge of Reticulitermes species distributions.

Diagnosis of bacteremia in pediatric oncologic patients by in-house real-time PCR.

Science.gov (United States)

Quiles, Milene Gonçalves; Menezes, Liana Carballo; Bauab, Karen de Castro; Gumpl, Elke Kreuscher; Rocchetti, Talita Trevizani; Palomo, Flavia Silva; Carlesse, Fabianne; Pignatari, Antonio Carlos Campos

2015-07-23

Infections are the major cause of morbidity and mortality in children with cancer. Gaining a favorable prognosis for these patients depends on selecting the appropriate therapy, which in turn depends on rapid and accurate microbiological diagnosis. This study employed real-time PCR (qPCR) to identify the main pathogens causing bloodstream infection (BSI) in patients treated at the Pediatric Oncology Institute IOP-GRAACC-UNIFESP-Brazil. Antimicrobial resistance genes were also investigated using this methodology. A total of 248 samples from BACTEC® blood culture bottles and 99 whole-blood samples collected in tubes containing EDTA K2 Gel were isolated from 137 patients. All samples were screened by specific Gram probes for multiplex qPCR. Seventeen sequences were evaluated using gender-specific TaqMan probes and the resistance genes bla SHV, bla TEM, bla CTX, bla KPC, bla IMP, bla SPM, bla VIM, vanA, vanB and mecA were detected using the SYBR Green method. Positive qPCR results were obtained in 112 of the blood culture bottles (112/124), and 90 % agreement was observed between phenotypic and molecular microbial detection methods. For bacterial and fungal identification, the performance test showed: sensitivity 87 %; specificity 91 %; NPV 90 %; PPV 89 % and accuracy of 89 % when compared with the phenotypic method. The mecA gene was detected in 37 samples, extended-spectrum β-lactamases were detected in six samples and metallo-β-lactamase coding genes in four samples, with 60 % concordance between the two methods. The qPCR on whole blood detected eight samples possessing the mecA gene and one sample harboring the vanB gene. The bla KPC, bla VIM, bla IMP and bla SHV genes were not detected in this study. Real-time PCR is a useful tool in the early identification of pathogens and antimicrobial resistance genes from bloodstream infections of pediatric oncologic patients.

Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles.

Science.gov (United States)

Chang, Yi-Chung; Yang, Chia-Ying; Sun, Ruei-Lin; Cheng, Yi-Feng; Kao, Wei-Chen; Yang, Pan-Chyr

2013-01-01

Staphylococcus aureus is one of the most important human pathogens, causing more than 500,000 infections in the United States each year. Traditional methods for bacterial culture and identification take several days, wasting precious time for patients who are suffering severe bacterial infections. Numerous nucleic acid-based detection methods have been introduced to address this deficiency; however, the costs and requirement for expensive equipment may limit the widespread use of such technologies. Thus, there is an unmet demand of new platform technology to improve the bacterial detection and identification in clinical practice. In this study, we developed a rapid, ultra-sensitive, low cost, and non-polymerase chain reaction (PCR)-based method for bacterial identification. Using this method, which measures the resonance light-scattering signal of aptamer-conjugated gold nanoparticles, we successfully detected single S. aureus cell within 1.5 hours. This new platform technology may have potential to develop a rapid and sensitive bacterial testing at point-of-care.

ABO Blood Group Genotyping by Real-time PCR in Kazakh Population

Directory of Open Access Journals (Sweden)

Pavel Tarlykov

2014-12-01

Full Text Available Introduction. ABO blood group genotyping is a new technology in hematology that helps prevent adverse transfusion reactions in patients. Identification of antigens on the surface of red blood cells is based on serology; however, genotyping employs a different strategy and is aimed directly at genes that determine the surface proteins. ABO blood group genotyping by real-time PCR has several crucial advantages over other PCR-based techniques, such as high rapidity and reliability of analysis. The purpose of this study was to examine nucleotide substitutions differences by blood types using a PCR-based method on Kazakh blood donors.Methods. The study was approved by the Ethics Committee of the National Center for Biotechnology. Venous blood samples from 369 healthy Kazakh blood donors, whose blood types had been determined by serological methods, were collected after obtaining informed consent. The phenotypes of the samples included blood group A (n = 99, B (n = 93, O (n = 132, and AB (n = 45. Genomic DNA was extracted using a salting-out method. PCR products of ABO gene were sequenced on an ABI 3730xl DNA analyzer (Applied Biosystems. The resulting nucleotide sequences were compared and aligned against reference sequence NM_020469.2. Real-time PCR analysis was performed on CFX96 Touch™ Real-Time PCR Detection System (BioRad.Results. Direct sequencing of ABO gene in 369 samples revealed that the vast majority of nucleotide substitutions that change the ABO phenotype were limited to exons 6 and 7 of the ABO gene at positions 261, 467, 657, 796, 803, 930 and 1,060. However, genotyping of only three of them (261, 796 and 803 resulted in identification of major ABO genotypes in the Kazakh population. As a result, TaqMan probe based real-time PCR assay for the specific detection of genotypes 261, 796 and 803 was developed. The assay did not take into account several other mutations that may affect the determination of blood group, because they have a

Real-time PCR in virology.

Science.gov (United States)

Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas

2002-03-15

The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.

Identification of Optimal Reference Genes for Normalization of qPCR Analysis during Pepper Fruit Development

Directory of Open Access Journals (Sweden)

Yuan Cheng

2017-06-01

Full Text Available Due to its high sensitivity and reproducibility, quantitative real-time PCR (qPCR is practiced as a useful research tool for targeted gene expression analysis. For qPCR operations, the normalization with suitable reference genes (RGs is a crucial step that eventually determines the reliability of the obtained results. Although pepper is considered an ideal model plant for the study of non-climacteric fruit development, at present no specific RG have been developed or validated for the qPCR analyses of pepper fruit. Therefore, this study aimed to identify stably expressed genes for their potential use as RGs in pepper fruit studies. Initially, a total of 35 putative RGs were selected by mining the pepper transcriptome data sets derived from the PGP (Pepper Genome Platform and PGD (Pepper Genome Database. Their expression stabilities were further measured in a set of pepper (Capsicum annuum L. var. 007e fruit samples, which represented four different fruit developmental stages (IM: Immature; MG: Mature green; B: Break; MR: Mature red using the qPCR analysis. Then, based on the qPCR results, three different statistical algorithms, namely geNorm, Normfinder, and boxplot, were chosen to evaluate the expression stabilities of these putative RGs. It should be noted that nine genes were proven to be qualified as RGs during pepper fruit development, namely CaREV05 (CA00g79660; CaREV08 (CA06g02180; CaREV09 (CA06g05650; CaREV16 (Capana12g002666; CaREV21 (Capana10g001439; CaREV23 (Capana05g000680; CaREV26 (Capana01g002973; CaREV27 (Capana11g000123; CaREV31 (Capana04g002411; and CaREV33 (Capana08g001826. Further analysis based on geNorm suggested that the application of the two most stably expressed genes (CaREV05 and CaREV08 would provide optimal transcript normalization in the qPCR experiments. Therefore, a new and comprehensive strategy for the identification of optimal RGs was developed. This strategy allowed for the effective normalization of the qPCR

Molecular prey identification in Central European piscivores

OpenAIRE

Thalinger, Bettina; Oehm, Johannes; Mayr, Hannes; Obwexer, Armin; Zeisler, Christiane; Traugott, Michael

2015-01-01

Abstract Diet analysis is an important aspect when investigating the ecology of fish?eating animals and essential for assessing their functional role in food webs across aquatic and terrestrial ecosystems. The identification of fish remains in dietary samples, however, can be time?consuming and unsatisfying using conventional morphological analysis of prey remains. Here, we present a two?step multiplex PCR system, comprised of six assays, allowing for rapid, sensitive and specific detection o...

Development of a New Marker System for Identification of Spirodela polyrhiza and Landoltia punctata

Directory of Open Access Journals (Sweden)

Bo Feng

2017-01-01

Full Text Available Lemnaceae (commonly called duckweed is an aquatic plant ideal for quantitative analysis in plant sciences. Several species of this family represent the smallest and fastest growing flowering plants. Different ecotypes of the same species vary in their biochemical and physiological properties. Thus, selecting of desirable ecotypes of a species is very important. Here, we developed a simple and rapid molecular identification system for Spirodela polyrhiza and Landoltia punctata based on the sequence polymorphism. First, several pairs of primers were designed and three markers were selected as good for identification. After PCR amplification, DNA fragments (the combination of three PCR products in different duckweeds were detected using capillary electrophoresis. The high-resolution capillary electrophoresis displayed high identity to the sequencing results. The combination of the PCR products containing several DNA fragments highly improved the identification frequency. These results indicate that this method is not only good for interspecies identification but also ideal for intraspecies distinguishing. Meanwhile, 11 haplotypes were found in both the S. polyrhiza and L. punctata ecotypes. The results suggest that this marker system is useful for large-scale identification of duckweed and for the screening of desirable ecotypes to improve the diverse usage in duckweed utilization.

Accurate Detection of Methicillin-Resistant Staphylococcus aureus in Mixtures by Use of Single-Bacterium Duplex Droplet Digital PCR.

Science.gov (United States)

Luo, Jun; Li, Junhua; Yang, Hang; Yu, Junping; Wei, Hongping

2017-10-01

Accurate and rapid identification of methicillin-resistant Staphylococcus aureus (MRSA) is needed to screen MRSA carriers and improve treatment. The current widely used duplex PCR methods are not able to differentiate MRSA from coexisting methicillin-susceptible S. aureus (MSSA) or other methicillin-resistant staphylococci. In this study, we aimed to develop a direct method for accurate and rapid detection of MRSA in clinical samples from open environments, such as nasal swabs. The new molecular assay is based on detecting the cooccurrence of nuc and mecA markers in a single bacterial cell by utilizing droplet digital PCR (ddPCR) with the chimeric lysin ClyH for cell lysis. The method consists of (i) dispersion of an intact single bacterium into nanoliter droplets, (ii) temperature-controlled release of genomic DNA (gDNA) by ClyH at 37°C, and (iii) amplification and detection of the markers ( nuc and mecA ) using standard TaqMan chemistries with ddPCR. Results were analyzed based on MRSA index ratios used for indicating the presence of the duplex-positive markers in droplets. The method was able to achieve an absolute limit of detection (LOD) of 2,900 CFU/ml for MRSA in nasal swabs spiked with excess amounts of Escherichia coli , MSSA, and other mecA -positive bacteria within 4 h. Initial testing of 104 nasal swabs showed that the method had 100% agreement with the standard culture method, while the normal duplex qPCR method had only about 87.5% agreement. The single-bacterium duplex ddPCR assay is rapid and powerful for more accurate detection of MRSA directly from clinical specimens. Copyright © 2017 American Society for Microbiology.

Time is of essence; rapid identification of veterinary pathogens using MALDI TOF

DEFF Research Database (Denmark)

Nonnemann, Bettina; Dalsgaard, Inger; Pedersen, Karl

Rapid and accurate identification of microbial pathogens is a cornerstone for timely and correct treatment of diseases of livestock and fish. The utility of the MALDI-TOF technique in the diagnostic laboratory is directly related to the quality of mass spectra and quantity of different microbial...

Development and validation of a multiplex real-time PCR method to simultaneously detect 47 targets for the identification of genetically modified organisms.

Science.gov (United States)

Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Véronique; Chuah, Poh Fong

2013-08-01

Considering the increase of the total cultivated land area dedicated to genetically modified organisms (GMO), the consumers' perception toward GMO and the need to comply with various local GMO legislations, efficient and accurate analytical methods are needed for their detection and identification. Considered as the gold standard for GMO analysis, the real-time polymerase chain reaction (RTi-PCR) technology was optimised to produce a high-throughput GMO screening method. Based on simultaneous 24 multiplex RTi-PCR running on a ready-to-use 384-well plate, this new procedure allows the detection and identification of 47 targets on seven samples in duplicate. To comply with GMO analytical quality requirements, a negative and a positive control were analysed in parallel. In addition, an internal positive control was also included in each reaction well for the detection of potential PCR inhibition. Tested on non-GM materials, on different GM events and on proficiency test samples, the method offered high specificity and sensitivity with an absolute limit of detection between 1 and 16 copies depending on the target. Easy to use, fast and cost efficient, this multiplex approach fits the purpose of GMO testing laboratories.

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

2013-01-01

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

A rapid and simple method of detection of Blepharisma japonicum using PCR and immobilisation on FTA paper

Science.gov (United States)

Hide, Geoff; Hughes, Jacqueline M; McNuff, Robert

2003-01-01

Background The rapid expansion in the availability of genome and DNA sequence information has opened up new possibilities for the development of methods for detecting free-living protozoa in environmental samples. The protozoan Blepharisma japonicum was used to investigate a rapid and simple detection system based on polymerase chain reaction amplification (PCR) from organisms immobilised on FTA paper. Results Using primers designed from the α-tubulin genes of Blepharisma, specific and sensitive detection to the equivalent of a single Blepharisma cell could be achieved. Similar detection levels were found using water samples, containing Blepharisma, which were dried onto Whatman FTA paper. Conclusion This system has potential as a sensitive convenient detection system for Blepharisma and could be applied to other protozoan organisms. PMID:14516472

BOX-PCR-based identification of bacterial species belonging to Pseudomonas syringae: P. viridiflava group

Directory of Open Access Journals (Sweden)

Abi S.A. Marques

2008-01-01

Full Text Available The phenotypic characteristics and genetic fingerprints of a collection of 120 bacterial strains, belonging to Pseudomonas syringae sensu lato group, P. viridiflava and reference bacteria were evaluated, with the aim of species identification. The numerical analysis of 119 nutritional characteristics did not show patterns that would help with identification. Regarding the genetic fingerprinting, the results of the present study supported the observation that BOX-PCR seems to be able to identify bacterial strains at species level. After numerical analyses of the bar-codes, all pathovars belonging to each one of the nine described genomospecies were clustered together at a distance of 0.72, and could be separated at genomic species level. Two P. syringae strains of unknown pathovars (CFBP 3650 and CFBP 3662 and the three P. syringae pv. actinidiae strains were grouped in two extra clusters and might eventually constitute two new species. This genomic species clustering was particularly evident for genomospecies 4, which gathered P. syringae pvs. atropurpurea, coronafaciens, garçae, oryzae, porri, striafaciens, and zizaniae at a noticeably low distance.

Rapid diagnosis of avian influenza virus in wild birds: Use of a portable rRT-PCR and freeze-dried reagents in the field

Science.gov (United States)

Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.

2011-01-01

Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

New LightCycler PCR for Rapid and Sensitive Quantification of Parvovirus B19 DNA Guides Therapeutic Decision-Making in Relapsing Infections

Science.gov (United States)

Harder, Timm C.; Hufnagel, Markus; Zahn, Katrin; Beutel, Karin; Schmitt, Heinz-Josef; Ullmann, Uwe; Rautenberg, Peter

2001-01-01

Detection of parvovirus B19 DNA offers diagnostic advantages over serology, particularly in persistent infections of immunocompromised patients. A rapid, novel method of B19 DNA detection and quantification is introduced. This method, a quantitative PCR assay, is based on real-time glass capillary thermocycling (LightCycler [LC]) and fluorescence resonance energy transfer (FRET). The PCR assay allowed quantification over a dynamic range of over 7 logs and could quantify as little as 250 B19 genome equivalents (geq) per ml as calculated for plasmid DNA (i.e., theoretically ≥5 geq per assay). Interrater agreement analysis demonstrated equivalence of LC-FRET PCR and conventional nested PCR in the diagnosis of an active B19 infection (kappa coefficient = 0.83). The benefit of the new method was demonstrated in an immunocompromised child with a relapsing infection, who required an attenuation of the immunosuppressive therapy in addition to repeated doses of immunoglobulin to eliminate the virus. PMID:11724854

Evaluation of two real time PCR assays for the detection of bacterial DNA in amniotic fluid.

Science.gov (United States)

Girón de Velasco-Sada, Patricia; Falces-Romero, Iker; Quiles-Melero, Inmaculada; García-Perea, Adela; Mingorance, Jesús

2018-01-01

The aim of this study was to evaluate two non-commercial Real-Time PCR assays for the detection of microorganisms in amniotic fluid followed by identification by pyrosequencing. We collected 126 amniotic fluids from 2010 to 2015 for the evaluation of two Real-Time PCR assays for detection of bacterial DNA in amniotic fluid (16S Universal PCR and Ureaplasma spp. specific PCR). The method was developed in the Department of Microbiology of the University Hospital La Paz. Thirty-seven samples (29.3%) were positive by PCR/pyrosequencing and/or culture, 4 of them were mixed cultures with Ureaplasma urealyticum. The Universal 16S Real-Time PCR was compared with the standard culture (81.8% sensitivity, 97.4% specificity, 75% positive predictive value, 98% negative predictive value). The Ureaplasma spp. specific Real-Time PCR was compared with the Ureaplasma/Mycoplasma specific culture (92.3% sensitivity, 89.4% specificity, 50% positive predictive value, 99% negative predictive value) with statistically significant difference (p=0.005). Ureaplasma spp. PCR shows a rapid response time (5h from DNA extraction until pyrosequencing) when comparing with culture (48h). So, the response time of bacteriological diagnosis in suspected chorioamnionitis is reduced. Copyright © 2017 Elsevier B.V. All rights reserved.

Splinkerette PCR for mapping transposable elements in Drosophila.

Directory of Open Access Journals (Sweden)

Christopher J Potter

2010-04-01

Full Text Available Transposable elements (such as the P-element and piggyBac have been used to introduce thousands of transgenic constructs into the Drosophila genome. These transgenic constructs serve many roles, from assaying gene/cell function, to controlling chromosome arm rearrangement. Knowing the precise genomic insertion site for the transposable element is often desired. This enables identification of genomic enhancer regions trapped by an enhancer trap, identification of the gene mutated by a transposon insertion, or simplifying recombination experiments. The most commonly used transgene mapping method is inverse PCR (iPCR. Although usually effective, limitations with iPCR hinder its ability to isolate flanking genomic DNA in complex genomic loci, such as those that contain natural transposons. Here we report the adaptation of the splinkerette PCR (spPCR method for the isolation of flanking genomic DNA of any P-element or piggyBac. We report a simple and detailed protocol for spPCR. We use spPCR to 1 map a GAL4 enhancer trap located inside a natural transposon, pinpointing a master regulatory region for olfactory neuron expression in the brain; and 2 map all commonly used centromeric FRT insertion sites. The ease, efficiency, and efficacy of spPCR could make it a favored choice for the mapping of transposable element in Drosophila.

Broad-range PCR: past, present, or future of bacteriology?

Science.gov (United States)

Renvoisé, A; Brossier, F; Sougakoff, W; Jarlier, V; Aubry, A

2013-08-01

PCR targeting the gene encoding 16S ribosomal RNA (commonly named broad-range PCR or 16S PCR) has been used for 20 years as a polyvalent tool to study prokaryotes. Broad-range PCR was first used as a taxonomic tool, then in clinical microbiology. We will describe the use of broad-range PCR in clinical microbiology. The first application was identification of bacterial strains obtained by culture but whose phenotypic or proteomic identification remained difficult or impossible. This changed bacterial taxonomy and allowed discovering many new species. The second application of broad-range PCR in clinical microbiology is the detection of bacterial DNA from clinical samples; we will review the clinical settings in which the technique proved useful (such as endocarditis) and those in which it did not (such as characterization of bacteria in ascites, in cirrhotic patients). This technique allowed identifying the etiological agents for several diseases, such as Whipple disease. This review is a synthesis of data concerning the applications, assets, and drawbacks of broad-range PCR in clinical microbiology. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

DNA extraction method for PCR in mycorrhizal fungi.

Science.gov (United States)

Manian, S; Sreenivasaprasad, S; Mills, P R

2001-10-01

To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

Current PCR Methods for the Detection, Identification and Quantification of Genetically Modified Organisms(GMOs: a Brief Review

Directory of Open Access Journals (Sweden)

Gadani F

2014-12-01

Full Text Available Analytical methods based on the polymerase chain reaction (PCR technology are increasingly used for the detection of deoxyribonucleic acid (DNA sequences associated with genetically modified organisms (GMOs. In the European Union and Switzerland, mandatory labeling of novel foods and food ingredients consisting of, or containing GMOs is required according to food regulations and is triggered by the presence of newly introduced foreign DNA sequences, or newly expressed proteins. In order to meet regulatory and consumer demand, numerous PCR-based methods have been developed which can detect, identify and quantify GMOs in agricultural crops, food and feed. Moreover, the determination of genetic identity allows for segregation and traceability (identity preservation throughout the supply chain of GM crops that have been enhanced with value-added quality traits. Prerequisites for GMO detection include a minimum amount of the target gene and prior knowledge of the type of genetic modification, such as virus or insect resistance traits, including controlling elements (promoters and terminators. Moreover, DNA extraction and purification is a critical step for the preparation of PCR-quality samples, particularly for processed agricultural crops such as tobacco. This paper reviews the state-of-the-art of PCR-based method development for the qualitative and quantitative determination and identification of GMOs, and includes a short summary of official and validated GMO detection methods.

Human fecal source identification with real-time quantitative PCR

Science.gov (United States)

Waterborne diseases represent a significant public health risk worldwide, and can originate from contact with water contaminated with human fecal material. We describe a real-time quantitative PCR (qPCR) method that targets a Bacteroides dori human-associated genetic marker for...

Rapid detection of enterovirus in cerebrospinal fluid by a fully-automated PCR assay is associated with improved management of aseptic meningitis in adult patients.

Science.gov (United States)

Giulieri, Stefano G; Chapuis-Taillard, Caroline; Manuel, Oriol; Hugli, Olivier; Pinget, Christophe; Wasserfallen, Jean-Blaise; Sahli, Roland; Jaton, Katia; Marchetti, Oscar; Meylan, Pascal

2015-01-01

Enterovirus (EV) is the most frequent cause of aseptic meningitis (AM). Lack of microbiological documentation results in unnecessary antimicrobial therapy and hospitalization. To assess the impact of rapid EV detection in cerebrospinal fluid (CSF) by a fully-automated PCR (GeneXpert EV assay, GXEA) on the management of AM. Observational study in adult patients with AM. Three groups were analyzed according to EV documentation in CSF: group A = no PCR or negative PCR (n=17), group B = positive real-time PCR (n = 20), and group C = positive GXEA (n = 22). Clinical, laboratory and health-care costs data were compared. Clinical characteristics were similar in the 3 groups. Median turn-around time of EV PCR decreased from 60 h (IQR (interquartile range) 44-87) in group B to 5h (IQR 4-11) in group C (p<0.0001). Median duration of antibiotics was 1 (IQR 0-6), 1 (0-1.9), and 0.5 days (single dose) in groups A, B, and C, respectively (p < 0.001). Median length of hospitalization was 4 days (2.5-7.5), 2 (1-3.7), and 0.5 (0.3-0.7), respectively (p < 0.001). Median hospitalization costs were $5458 (2676-6274) in group A, $2796 (2062-5726) in group B, and $921 (765-1230) in group C (p < 0.0001). Rapid EV detection in CSF by a fully-automated PCR improves management of AM by significantly reducing antibiotic use, hospitalization length and costs. Copyright © 2014 Elsevier B.V. All rights reserved.

Identification and tracing of Enterococcus spp. by RAPD-PCR in traditional fermented sausages and meat environment.

Science.gov (United States)

Martín, B; Corominas, L; Garriga, M; Aymerich, T

2009-01-01

Four local small-scale factories were studied to determine the sources of enterococci in traditional fermented sausages. Different points during the production of a traditional fermented sausage type (fuet) were evaluated. Randomly amplified polymorphic DNA (RAPD)-PCR was used to type 596 Enterococcus isolates from the final products, the initial meat batter, the casing, the workers' hands and the equipment. Species-specific PCR-multiplex and the partial sequencing of atpA gene and 16S rRNA gene sequencing allowed the identification of the isolates: Enterococcus faecalis (31.4%), Enterococcus faecium (30.7%), Enterococcus sanguinicola (14.9%), Enterococcus devriesei (9.7%), Enterococcus malodoratus (7.2%), Enterococcus gilvus (1.0%), Enterococcus gallinarum (1.3%), Enterococcus casseliflavus (3.4%), Enterococcus hermanniensis (0.2%), and Enterococcus durans (0.2%). A total of 92 different RAPD-PCR profiles were distributed among the different factories and samples evaluated. Most of the genotypes found in fuet samples were traced back to their source. The major sources of enterococci in the traditional fermented sausages studied were mainly the equipment followed by the raw ingredients, although a low proportion was traced back to human origin. This work contributes to determine the source of enterococcal contamination in fermented sausages and also to the knowledge of the meat environment.

Rapid identification of ST131 Escherichia coli by a novel multiplex real-time allelic discrimination assay.

Science.gov (United States)

François, Patrice; Bonetti, Eve-Julie; Fankhauser, Carolina; Baud, Damien; Cherkaoui, Abdessalam; Schrenzel, Jacques; Harbarth, Stephan

2017-09-01

Escherichia coli sequence type 131 is increasingly described in severe hospital infections. We developed a rapid real-time allelic discrimination assay for the rapid identification of E. coli ST131 isolates. This rapid assay represents an affordable alternative to sequence-based strategies before completing characterization of potentially highly virulent isolates of E. coli. Copyright © 2017 Elsevier B.V. All rights reserved.

A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

PCR Amplification of Ribosomal DNA for Species Identification in the Plant Pathogen Genus Phytophthora

Science.gov (United States)

Ristaino, Jean B.; Madritch, Michael; Trout, Carol L.; Parra, Gregory

1998-01-01

We have developed a PCR procedure to amplify DNA for quick identification of the economically important species from each of the six taxonomic groups in the plant pathogen genus Phytophthora. This procedure involves amplification of the 5.8S ribosomal DNA gene and internal transcribed spacers (ITS) with the ITS primers ITS 5 and ITS 4. Restriction digests of the amplified DNA products were conducted with the restriction enzymes RsaI, MspI, and HaeIII. Restriction fragment patterns were similar after digestions with RsaI for the following species: P. capsici and P. citricola; P. infestans, P. cactorum, and P. mirabilis; P. fragariae, P. cinnamomi, and P. megasperma from peach; P. palmivora, P. citrophthora, P. erythroseptica, and P. cryptogea; and P. megasperma from raspberry and P. sojae. Restriction digests with MspI separated P. capsici from P. citricola and separated P. cactorum from P. infestans and P. mirabilis. Restriction digests with HaeIII separated P. citrophthora from P. cryptogea, P. cinnamomi from P. fragariae and P. megasperma on peach, P. palmivora from P. citrophthora, and P. megasperma on raspberry from P. sojae. P. infestans and P. mirabilis digests were identical and P. cryptogea and P. erythroseptica digests were identical with all restriction enzymes tested. A unique DNA sequence from the ITS region I in P. capsici was used to develop a primer called PCAP. The PCAP primer was used in PCRs with ITS 1 and amplified only isolates of P. capsici, P. citricola, and P. citrophthora and not 13 other species in the genus. Restriction digests with MspI separated P. capsici from the other two species. PCR was superior to traditional isolation methods for detection of P. capsici in infected bell pepper tissue in field samples. The techniques described will provide a powerful tool for identification of the major species in the genus Phytophthora. PMID:9501434

Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting.

Science.gov (United States)

Rashed-Ul Islam, S M; Jahan, Munira; Tabassum, Shahina

2015-01-01

Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 10 3 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 10 3 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15.

Rapid-Viability PCR Method for Detection of Live, Virulent Bacillus anthracis in Environmental Samples ▿

OpenAIRE

Létant, Sonia E.; Murphy, Gloria A.; Alfaro, Teneile M.; Avila, Julie R.; Kane, Staci R.; Raber, Ellen; Bunt, Thomas M.; Shah, Sanjiv R.

2011-01-01

In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real...

Rapid Electrochemical Detection and Identification of Microbiological and Chemical Contaminants for Manned Spaceflight Project

Data.gov (United States)

National Aeronautics and Space Administration — A great deal of effort has gone into the development of point-of-use methods to meet the challenge of rapid bacterial identification for both environmental...

Comparison of DNA probe, PCR amplification, ELISA and culture methods for the rapid detection of Salmonella in poultry

International Nuclear Information System (INIS)

Qasem, J.A.; Al-Mouqati, S.; Rajkumar, G.

2005-01-01

The identification of Salmonella spp. from poultry meat was studied by comparing bacterial detection using the Gene-Trak colorimetric hybridization method, a PCR amplification kit and an Enzyme Linked Immunosorbent Assay (ELISA), and these methods were compared with the conventional methodology proposed by the United States Food and Drug Administration (US FDA) for detection of Salmonella in food samples. Forty positive and negative samples were studied. The three methods yielded similar results with levels of Salmonella greater than 10 CFU per sample, even when the samples were highly contaminated with competing bacteria. In contrast, 20 CFU of seed inoculum per sample was the lowest level of Salmonella detectable with all three methods and the standard culture method. The detection limits of the PCR and ELISA assays were 5 CFU/g after enrichment at 37 deg. C for 6 and 9 hours, respectively. Compared with conventional bacteriology, all three methods here demonstrated high sensitivity and specificity for Salmonella. (author)

A multiplex PCR-based method for the detection and early identification of wood rotting fungi in standing trees.

Science.gov (United States)

Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M

2007-11-01

The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.

The effect of rapid screening for methicillin-resistant Staphylococcus aureus (MRSA) on the identification and earlier isolation of MRSA-positive patients.

LENUS (Irish Health Repository)

Creamer, Eilish

2010-04-01

(1) To determine whether rapid screening with polymerase chain reaction (PCR) assays leads to the earlier isolation of patients at risk for methicillin-resistant Staphylococcus aureus (MRSA) colonization, (2) to assess compliance with routine MRSA screening protocols, (3) to confirm the diagnostic accuracy of the Xpert MRSA real-time PCR assay (Cepheid) by comparison with culture, and (4) to compare turnaround times for PCR assay results with those for culture results.

Multiplex PCR for the detection and identification of dairy bacteriophages in milk.

Science.gov (United States)

del Rio, B; Binetti, A G; Martín, M C; Fernández, M; Magadán, A H; Alvarez, M A

2007-02-01

Bacteriophage infections of starter lactic acid bacteria are a serious risk in the dairy industry. Phage infection can lead to slow lactic acid production or even the total failure of fermentation. The associated economic losses can be substantial. Rapid and sensitive methods are therefore required to detect and identify phages at all stages of the manufacture of fermented dairy products. This study describes a simple and rapid multiplex PCR method that, in a single reaction, detects the presence of bacteriophages infecting Streptococcus thermophilus and Lactobacillus delbrueckii, plus three genetically distinct 'species' of Lactococcus lactis phages commonly found in dairy plants (P335, 936 and c2). Available bacteriophage genome sequences were examined and the conserved regions used to design five pairs of primers, one for each of the above bacteriophage species. These primers were designed to generate specific fragments of different size depending on the species. Since this method can detect the above phages in untreated milk and can be easily incorporated into dairy industry routines, it might be readily used to earmark contaminated milk for use in processes that do not involve susceptible starter organisms or for use in those that involve phage-deactivating conditions.

Identification and validation of reference genes for quantitative RT-PCR normalization in wheat

Directory of Open Access Journals (Sweden)

Porceddu Enrico

2009-02-01

Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability

Reference gene identification for reliable normalisation of quantitative RT-PCR data in Setaria viridis.

Science.gov (United States)

Nguyen, Duc Quan; Eamens, Andrew L; Grof, Christopher P L

2018-01-01

Quantitative real-time polymerase chain reaction (RT-qPCR) is the key platform for the quantitative analysis of gene expression in a wide range of experimental systems and conditions. However, the accuracy and reproducibility of gene expression quantification via RT-qPCR is entirely dependent on the identification of reliable reference genes for data normalisation. Green foxtail ( Setaria viridis ) has recently been proposed as a potential experimental model for the study of C 4 photosynthesis and is closely related to many economically important crop species of the Panicoideae subfamily of grasses, including Zea mays (maize), Sorghum bicolor (sorghum) and Sacchurum officinarum (sugarcane). Setaria viridis (Accession 10) possesses a number of key traits as an experimental model, namely; (i) a small sized, sequenced and well annotated genome; (ii) short stature and generation time; (iii) prolific seed production, and; (iv) is amendable to Agrobacterium tumefaciens -mediated transformation. There is currently however, a lack of reference gene expression information for Setaria viridis ( S. viridis ). We therefore aimed to identify a cohort of suitable S. viridis reference genes for accurate and reliable normalisation of S. viridis RT-qPCR expression data. Eleven putative candidate reference genes were identified and examined across thirteen different S. viridis tissues. Of these, the geNorm and NormFinder analysis software identified SERINE / THERONINE - PROTEIN PHOSPHATASE 2A ( PP2A ), 5 '- ADENYLYLSULFATE REDUCTASE 6 ( ASPR6 ) and DUAL SPECIFICITY PHOSPHATASE ( DUSP ) as the most suitable combination of reference genes for the accurate and reliable normalisation of S. viridis RT-qPCR expression data. To demonstrate the suitability of the three selected reference genes, PP2A , ASPR6 and DUSP , were used to normalise the expression of CINNAMYL ALCOHOL DEHYDROGENASE ( CAD ) genes across the same tissues. This approach readily demonstrated the suitably of the three

Identification of methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from burn patients by multiplex PCR.

Science.gov (United States)

Montazeri, Effat Abbasi; Khosravi, Azar Dokht; Jolodar, Abbas; Ghaderpanah, Mozhgan; Azarpira, Samireh

2015-05-01

Methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant coagulase-negative staphylococci (MRCoNS) as important human pathogens are causes of nosocomial infections worldwide. Burn patients are at a higher risk of local and systemic infections with these microorganisms. A screening method for MRSA by using a multiplex polymerase chain reaction (PCR) targeting the 16S ribosomal RNA (rRNA), mecA, and nuc genes was developed. The aim of the present study was to investigate the potential of this PCR assay for the detection of MRSA strains in samples from burn patients. During an 11-month period, 230 isolates (53.11%) of Staphylococcus spp. were collected from burn patients. The isolates were identified as S. aureus by using standard culture and biochemical tests. DNA was extracted from bacterial colonies and multiplex PCR was used to detect MRSA and MRCoNS strains. Of the staphylococci isolates, 149 (64.9%) were identified as S. aureus and 81 (35.21%) were described as CoNS. Among the latter, 51 (62.97%) were reported to be MRCoNS. From the total S. aureus isolates, 132 (88.6%) were detected as MRSA and 17 (11.4%) were methicillin-susceptible S. aureus (MSSA). The presence of the mecA gene in all isolates was confirmed by using multiplex PCR as a gold standard method. This study presented a high MRSA rate in the region under investigation. The 16S rRNA-mecA-nuc multiplex PCR is a good tool for the rapid characterization of MRSA strains. This paper emphasizes the need for preventive measures and choosing effective antimicrobials against MRSA and MRCoNS infections in the burn units. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) for rapid strain typing of Bacillus coagulans.

Science.gov (United States)

Sato, Jun; Nakayama, Motokazu; Tomita, Ayumi; Sonoda, Takumi; Hasumi, Motomitsu; Miyamoto, Takahisa

2017-01-01

In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and repetitive-PCR (rep-PCR) were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

Identification of Lactobacillus delbrueckii and Streptococcus thermophilus Strains Present in Artisanal Raw Cow Milk Cheese Using Real-time PCR and Classic Plate Count Methods.

Science.gov (United States)

Stachelska, Milena A

2017-12-04

The aim of this paper was to detect Lactobacillus delbrueckii and Streptococcus thermophilus using real-time quantitative PCR assay in 7-day ripening cheese produced from unpasteurised milk. Real-time quantitative PCR assays were designed to identify and enumerate the chosen species of lactic acid bacteria (LAB) in ripened cheese. The results of molecular quantification and classic bacterial enumeration showed a high level of similarity proving that DNA extraction was carried out in a proper way and that genomic DNA solutions were free of PCR inhibitors. These methods revealed the presence of L. delbrueckii and S. thermophilus. The real-time PCR enabled quantification with a detection of 101-103 CFU/g of product. qPCR-standard curves were linear over seven log units down to 101 copies per reaction; efficiencies ranged from 77.9% to 93.6%. Cheese samples were analysed with plate count method and qPCR in parallel. Compared with the classic plate count method, the newly developed qPCR method provided faster and species specific identification of two dairy LAB and yielded comparable quantitative results.

One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

Science.gov (United States)

Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

2018-01-23

To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

African Journals Online (AJOL)

Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

A one-step, real-time PCR assay for rapid detection of rhinovirus.

Science.gov (United States)

Do, Duc H; Laus, Stella; Leber, Amy; Marcon, Mario J; Jordan, Jeanne A; Martin, Judith M; Wadowsky, Robert M

2010-01-01

One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID(50) (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform.

Use of high throughput qPCR screening to rapidly clone low frequency tumour specific T-cells from peripheral blood for adoptive immunotherapy

Directory of Open Access Journals (Sweden)

Serrano Oscar K

2008-10-01

Full Text Available Abstract Background The adoptive transfer of autologous tumor reactive lymphocytes can mediate significant tumor regression in some patients with refractory metastatic cancer. However, a significant obstacle for this promising therapy has been the availability of highly efficient methods to rapidly isolate and expand a variety of potentially rare tumor reactive lymphocytes from the natural repertoire of cancer patients. Methods We developed a novel in vitro T cell cloning methodology using high throughput quantitative RT-PCR (qPCR assay as a rapid functional screen to detect and facilitate the limiting dilution cloning of a variety of low frequency T cells from bulk PBMC. In preclinical studies, this strategy was applied to the isolation and expansion of gp100 specific CD8+ T cell clones from the peripheral blood of melanoma patients. Results In optimization studies, the qPCR assay could detect the reactivity of 1 antigen specific T cell in 100,000 background cells. When applied to short term sensitized PBMC microcultures, this assay could detect T cell reactivity against a variety of known melanoma tumor epitopes. This screening was combined with early limiting dilution cloning to rapidly isolate gp100154–162 reactive CD8+ T cell clones. These clones were highly avid against peptide pulsed targets and melanoma tumor lines. They had an effector memory phenotype and showed significant proliferative capacity to reach cell numbers appropriate for adoptive transfer trials (~1010 cells. Conclusion This report describes a novel high efficiency strategy to clone tumor reactive T cells from peripheral blood for use in adoptive immunotherapy.

Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay.

Science.gov (United States)

Riediger, Irina N; Stoddard, Robyn A; Ribeiro, Guilherme S; Nakatani, Sueli M; Moreira, Suzana D R; Skraba, Irene; Biondo, Alexander W; Reis, Mitermayer G; Hoffmaster, Alex R; Vinetz, Joseph M; Ko, Albert I; Wunder, Elsio A

2017-09-01

With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge. Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors. The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86%) for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%). The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%. These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.

Real-time PCR in virology

OpenAIRE

Mackay, Ian M.; Arden, Katherine E.; Nitsche, Andreas

2002-01-01

The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of P...

Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.

Science.gov (United States)

Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei

2018-02-02

As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.

Rapid Separation of Bacteria from Blood—Review and Outlook

Science.gov (United States)

Alizadeh, Mahsa; Husseini, Ghaleb A.; McClellan, Daniel S.; Buchanan, Clara M.; Bledsoe, Colin G.; Robison, Richard A.; Blanco, Rae; Roeder, Beverly L.; Melville, Madison; Hunter, Alex K.

2017-01-01

The high morbidity and mortality rate of bloodstream infections involving antibiotic-resistant bacteria necessitate a rapid identification of the infectious organism and its resistance profile. Traditional methods based on culturing the blood typically require at least 24 h, and genetic amplification by PCR in the presence of blood components has been problematic. The rapid separation of bacteria from blood would facilitate their genetic identification by PCR or other methods so that the proper antibiotic regimen can quickly be selected for the septic patient. Microfluidic systems that separate bacteria from whole blood have been developed, but these are designed to process only microliter quantities of whole blood or only highly diluted blood. However, symptoms of clinical blood infections can be manifest with bacterial burdens perhaps as low as 10 CFU/mL, and thus milliliter quantities of blood must be processed to collect enough bacteria for reliable genetic analysis. This review considers the advantages and shortcomings of various methods to separate bacteria from blood, with emphasis on techniques that can be done in less than 10 min on milliliter-quantities of whole blood. These techniques include filtration, screening, centrifugation, sedimentation, hydrodynamic focusing, chemical capture on surfaces or beads, field-flow fractionation, and dielectrophoresis. Techniques with the most promise include screening, sedimentation, and magnetic bead capture, as they allow large quantities of blood to be processed quickly. Some microfluidic techniques can be scaled up. PMID:27160415

A rapid MALDI-TOF MS identification database at genospecies level for clinical and environmental Aeromonas strains.

Directory of Open Access Journals (Sweden)

Cinzia Benagli

Full Text Available The genus Aeromonas has undergone a number of taxonomic and nomenclature revisions over the past 20 years, and new (subspecies and biogroups are continuously described. Standard identification methods such as biochemical characterization have deficiencies and do not allow clarification of the taxonomic position. This report describes the development of a matrix-assisted laser desorption/ionisation-time of flight mass spectrometry (MALDI-TOF MS identification database for a rapid identification of clinical and environmental Aeromonas isolates.

Performance evaluation of three automated identification systems in detecting carbapenem-resistant Enterobacteriaceae.

Science.gov (United States)

He, Qingwen; Chen, Weiyuan; Huang, Liya; Lin, Qili; Zhang, Jingling; Liu, Rui; Li, Bin

2016-06-21

Carbapenem-resistant Enterobacteriaceae (CRE) is prevalent around the world. Rapid and accurate detection of CRE is urgently needed to provide effective treatment. Automated identification systems have been widely used in clinical microbiology laboratories for rapid and high-efficient identification of pathogenic bacteria. However, critical evaluation and comparison are needed to determine the specificity and accuracy of different systems. The aim of this study was to evaluate the performance of three commonly used automated identification systems on the detection of CRE. A total of 81 non-repetitive clinical CRE isolates were collected from August 2011 to August 2012 in a Chinese university hospital, and all the isolates were confirmed to be resistant to carbapenems by the agar dilution method. The potential presence of carbapenemase genotypes of the 81 isolates was detected by PCR and sequencing. Using 81 clinical CRE isolates, we evaluated and compared the performance of three automated identification systems, MicroScan WalkAway 96 Plus, Phoenix 100, and Vitek 2 Compact, which are commonly used in China. To identify CRE, the comparator methodology was agar dilution method, while the PCR and sequencing was the comparator one to identify CPE. PCR and sequencing analysis showed that 48 of the 81 CRE isolates carried carbapenemase genes, including 23 (28.4 %) IMP-4, 14 (17.3 %) IMP-8, 5 (6.2 %) NDM-1, and 8 (9.9 %) KPC-2. Notably, one Klebsiella pneumoniae isolate produced both IMP-4 and NDM-1. One Klebsiella oxytoca isolate produced both KPC-2 and IMP-8. Of the 81 clinical CRE isolates, 56 (69.1 %), 33 (40.7 %) and 77 (95.1 %) were identified as CRE by MicroScan WalkAway 96 Plus, Phoenix 100, and Vitek 2 Compact, respectively. The sensitivities/specificities of MicroScan WalkAway, Phoenix 100 and Vitek 2 were 93.8/42.4 %, 54.2/66.7 %, and 75.0/36.4 %, respectively. The MicroScan WalkAway and Viteck2 systems are more reliable in clinical identification of

Rapid and specific identification of Brucella abortus using the loop-mediated isothermal amplification (LAMP) assay.

Science.gov (United States)

Kang, Sung-Il; Her, Moon; Kim, Ji-Yeon; Lee, Jin Ju; Lee, Kichan; Sung, So-Ra; Jung, Suk Chan

2015-06-01

A rapid and accurate diagnosis of brucellosis is required to reduce and prevent the spread of disease among animals and the risk of transfer to humans. In this study, a Brucella abortus-specific (Ba) LAMP assay was developed, that had six primers designed from the BruAb2_0168 region of chromosome I. The specificity of this LAMP assay was confirmed with Brucella reference strains, B. abortus vaccine strains, B. abortus isolates and phylogenetically or serologically related strains. The detection limit of target DNA was up to 20 fg/μl within 60 min. The sensitivity of the new LAMP assay was equal to or slightly higher than other PCR based assays. Moreover, this Ba-LAMP assay could specifically amplify all B. abortus biovars compared to previous PCR assays. To our knowledge, this is the first report of specific detection of B. abortus using a LAMP assay. The Ba-LAMP assay can offer a rapid, sensitive and accurate diagnosis of bovine brucellosis in the field. Copyright © 2015 Elsevier Ltd. All rights reserved.

Predictive value and cost-effectiveness analysis of a rapid polymerase chain reaction for preoperative detection of nasal carriage of Staphylococcus aureus.

Science.gov (United States)

Shrestha, Nabin K; Shermock, Kenneth M; Gordon, Steven M; Tuohy, Marion J; Wilson, Deborah A; Cwynar, Roberta E; Banbury, Michael K; Longworth, David L; Isada, Carlos M; Mawhorter, Steven D; Procop, Gary W

2003-05-01

To determine the accuracy and cost-effectiveness of a polymerase chain reaction (PCR) for detecting nasal carriage of Staphylococcus aureus directly from clinical specimens. CROSS-SECTIONAL STUDY: This occurred in a tertiary-care hospital in Cleveland, Ohio, and included 239 consecutive patients who were scheduled for a cardiothoracic surgical procedure. Conventional cultures and a PCR for S. aureus from nasal swabs were used as measurements. COST-EFFECTIVENESS ANALYSIS: Data sources were market prices and Bureau of Labor Statistics. The time horizon was the maximum period for availability of culture results (3 days). Interventions included universal mupirocin therapy without testing; initial therapy, with termination if PCR negative (treat-PCR); initial therapy, with termination if culture negative (treat-culture); treat PCR-positive carriers (PCR-guided treatment); and treat culture-positive carriers (culture-guided treatment). The perspective was institutional and costs and the length of time to treatment were outcome measures. Sixty-seven (28%) of the 239 swabs grew S. aureus. Rapid PCR was 97.0% sensitive and 97.1% specific for the detection of S. aureus. For populations with prevalences of nasal S. aureus carriage of up to 50%, the PCR assay had negative predictive values of greater than 97%. PCR-guided treatment had the lowest incremental cost-effectiveness ratio (1.93 dollars per additional day compared with the culture strategy). Among immediate treatment strategies, treat-PCR was most cost-effective. The universal therapy strategy cost 38.19 dollars more per additional day gained with carrier identification compared with the PCR strategy. Rapid real-time PCR is an accurate, rapid, and cost-effective method for identifying S. aureus carriers for preoperative intervention.

A multiplex, internally controlled real-time PCR assay for detection of toxigenic Clostridium difficile and identification of hypervirulent strain 027/ST-1

DEFF Research Database (Denmark)

Hoegh, A M; Nielsen, J B; Lester, A

2012-01-01

The purpose of this study was to validate a multiplex real-time PCR assay capable of detecting toxigenic Clostridium difficile and simultaneously identifying C. difficile ribotype 027/ST-1 by targeting the toxin genes tcdA, tcdB and cdtA in one reaction and in a separate reaction identifying the Δ...... to confirm the correct identification of the Δ117 deletion in tcdC and C. difficile ribotype 027/ST-1, respectively. The PCR assay displayed a sensitivity, specificity, PPV and NPV of 99.0%, 97.4%, 87.4% and 99.8%, respectively, compared to toxigenic culture on 665 samples evaluable both by PCR and culture....... Sequencing of tcdC, ribotyping and MLST of cultured isolates validated the genotyping assay and confirmed the ability of the assay to correctly identify C. difficile ribotype 027/ST-1 in our current epidemiological setting. We describe the use of a combination of two separate PCR assays for sensitive...

Rapid identification of herbal compounds derived metabolites using zebrafish larvae as the biotransformation system.

Science.gov (United States)

Wang, Chen; Yin, Ying-Hao; Wei, Ying-Jie; Shi, Zi-Qi; Liu, Jian-Qun; Liu, Li-Fang; Xin, Gui-Zhong

2017-09-15

Metabolites derived from herbal compounds are becoming promising sources for discovering new drugs. However, the rapid identification of metabolites from biological matrixes is limited by massive endogenous interference and low abundance of metabolites. Thus, by using zebrafish larvae as the biotransformation system, we herein proposed and validated an integrated strategy for rapid identification of metabolites derived from herbal compounds. Two pivotal steps involved in this strategy are to differentiate metabolites from herbal compounds and match metabolites with their parent compounds. The differentiation step was achieved by cross orthogonal partial least-squares discriminant analysis. Automatic matching analysis was performed on R Project based on a self-developed program, of which the number of matched ionic clusters and its corresponding percentage between metabolite and parent compound were taken into account to assess their similarity. Using this strategy, 46 metabolites screened from incubation water samples of zebrafish treated with total Epimedium flavonoids (EFs) could be matched with their corresponding parent compounds, 37 of them were identified and validated by the known metabolic pathways and fragmentation patterns. Finally, 75% of the identified EFs metabolites were successfully detected in urine samples of rats treated with EFs. These experimental results indicate that the proposed strategy using zebrafish larvae as the biotransformation system will facilitate the rapid identification of metabolites derived from herbal compounds, which shows promising perspectives in providing additional resources for pharmaceutical developments from natural products. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular identification of Clonorchis sinensis and discrimination with other opisthorchid liver fluke species using Multiple Ligation-dependent Probe Amplification (MLPA).

OpenAIRE

Sun, J.; Xu, J.; Liang, P.; Mao, Q.; Huang, Y.; Lu, X.; Deng, C.; Liang, C.; de Hoog, G.S.; Yu, X.

2011-01-01

Background Infections with the opisthorchid liver flukes Clonorchis sinensis, Opisthorchis viverrini, and O. felineus cause severe health problems globally, particularly in Southeast Asia. Early identification of the infection is essential to provide timely and appropriate chemotherapy to patients. Results In this study we evaluate a PCR-based molecular identification method, Multiplex Ligation-dependent Probe Amplification (MLPA), which allows rapid and specific detection of single nucleotid...

Simultaneous detection and identification of Aspergillus and mucorales species in tissues collected from patients with fungal rhinosinusitis.

Science.gov (United States)

Zhao, Zuotao; Li, Lili; Wan, Zhe; Chen, Wei; Liu, Honggang; Li, Ruoyu

2011-04-01

Rapid detection and differentiation of Aspergillus and Mucorales species in fungal rhinosinusitis diagnosis are desirable, since the clinical management and prognosis associated with the two taxa are fundamentally different. We describe an assay based on a combination of broad-range PCR amplification and reverse line blot hybridization (PCR/RLB) to detect and differentiate the pathogens causing fungal rhinosinusitis, which include five Aspergillus species (A. fumigatus, A. flavus, A. niger, A. terreus, and A. nidulans) and seven Mucorales species (Mucor heimalis, Mucor racemosus, Mucor cercinelloidea, Rhizopus arrhizus, Rhizopus microsporus, Rhizomucor pusillus, and Absidia corymbifera). The assay was validated with 98 well-characterized clinical isolates and 41 clinical tissue specimens. PCR/RLB showed high sensitivity and specificity, with 100% correct identifications of 98 clinical isolates and no cross-hybridization between the species-specific probes. Results for five control isolates, Candida albicans, Fusarium solani, Scedosporium apiospermum, Penicillium marneffei, and Exophiala verrucosa, were negative as judged by PCR/RLB. The analytical sensitivity of PCR/RLB was found to be 1.8 × 10(-3) ng/μl by 10-fold serial dilution of Aspergillus genomic DNA. The assay identified 35 of 41 (85.4%) clinical specimens, exhibiting a higher sensitivity than fungal culture (22 of 41; 53.7%) and direct sequencing (18 of 41; 43.9%). PCR/RLB similarly showed high specificity, with correct identification 16 of 18 specimens detected by internal transcribed spacer (ITS) sequencing and 16 of 22 detected by fungal culture, but it also has the additional advantage of being able to detect mixed infection in a single clinical specimen. The PCR/RLB assay thus provides a rapid and reliable option for laboratory diagnosis of fungal rhinosinusitis.

Simultaneous Detection and Identification of Aspergillus and Mucorales Species in Tissues Collected from Patients with Fungal Rhinosinusitis▿

Science.gov (United States)

Zhao, Zuotao; Li, Lili; Wan, Zhe; Chen, Wei; Liu, Honggang; Li, Ruoyu

2011-01-01

Rapid detection and differentiation of Aspergillus and Mucorales species in fungal rhinosinusitis diagnosis are desirable, since the clinical management and prognosis associated with the two taxa are fundamentally different. We describe an assay based on a combination of broad-range PCR amplification and reverse line blot hybridization (PCR/RLB) to detect and differentiate the pathogens causing fungal rhinosinusitis, which include five Aspergillus species (A. fumigatus, A. flavus, A. niger, A. terreus, and A. nidulans) and seven Mucorales species (Mucor heimalis, Mucor racemosus, Mucor cercinelloidea, Rhizopus arrhizus, Rhizopus microsporus, Rhizomucor pusillus, and Absidia corymbifera). The assay was validated with 98 well-characterized clinical isolates and 41 clinical tissue specimens. PCR/RLB showed high sensitivity and specificity, with 100% correct identifications of 98 clinical isolates and no cross-hybridization between the species-specific probes. Results for five control isolates, Candida albicans, Fusarium solani, Scedosporium apiospermum, Penicillium marneffei, and Exophiala verrucosa, were negative as judged by PCR/RLB. The analytical sensitivity of PCR/RLB was found to be 1.8 × 10−3 ng/μl by 10-fold serial dilution of Aspergillus genomic DNA. The assay identified 35 of 41 (85.4%) clinical specimens, exhibiting a higher sensitivity than fungal culture (22 of 41; 53.7%) and direct sequencing (18 of 41; 43.9%). PCR/RLB similarly showed high specificity, with correct identification 16 of 18 specimens detected by internal transcribed spacer (ITS) sequencing and 16 of 22 detected by fungal culture, but it also has the additional advantage of being able to detect mixed infection in a single clinical specimen. The PCR/RLB assay thus provides a rapid and reliable option for laboratory diagnosis of fungal rhinosinusitis. PMID:21325541

Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR

DEFF Research Database (Denmark)

Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

2017-01-01

Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order to incr...... diagnosis, high-throughput DNA sequencing, and single-nucleotide polymorphism analysis. Graphical abstract Schematic representation of solid-phase PCR....

Two different PCR approaches for universal diagnosis of brown rot and identification of Monilinia spp. in stone fruit trees.

Science.gov (United States)

Gell, I; Cubero, J; Melgarejo, P

2007-12-01

To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.

Isolation and identification of methicillin-resistant Staphylococcus ...

African Journals Online (AJOL)

Moreover, this study compared the efficacy of the different identification tests with gold standard, polymerase chain reaction (PCR) assay. The tests used were tube coagulase, DNase agar test, antibiogram, several routine biochemical identification tests and PCR assays. PCR assay used specific primers for resistance or ID ...

Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

Science.gov (United States)

Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

2014-09-01

PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.

Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

Science.gov (United States)

Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

2015-10-22

Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

Directory of Open Access Journals (Sweden)

Alex Galanis

2015-10-01

Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS for rapid strain typing of Bacillus coagulans.

Directory of Open Access Journals (Sweden)

Jun Sato

Full Text Available In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS and repetitive-PCR (rep-PCR were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

MALDI-TOF mass spectrometry for the rapid identification of aetiological agents of sepsis

Directory of Open Access Journals (Sweden)

Roberto Degl’Innocenti

2013-04-01

Full Text Available Introduction: The MALDI-TOF has recently become part of the methods of microbiological investigation in many laboratories of bacteriology with advantages both practical and economical.The use of this technique for the rapid identification of the causative agents of sepsis is of strategic importance to the ability to provide the clinician with useful information for a prompt and rapid establishment of an empirical antimicrobial “targeted” therapy. Methods: It was tested a total of 343 positive blood culture bottles from 211 patients. The samples after collection were incubated in the BACTEC FX (Becton Dickinson, USA. From these bottles were taken a few milliliters of broth culture and transferred into a vacutainer tube containing gel. This was centrifuged, the supernatant was decanted, and finally recovered the bacterial suspension on the gel. With micro-organisms recovered in this way, after several washes with distilled water, was prepared a slide for microscopic examination with Gram stain, and a plate for mass spectrometry (MS-Vitek, bioMérieux, France.Then, the same samples were inoculated on solid agar media according to the protocol in use in our laboratory.The next day was checked the possible bacterial growth on solid media; we then proceeded to the identification of the colonies by Vitek MS and / or with the system Vitek2 (bioMérieux, France. Results: 258 (75.2% positive vials show concordant results between direct identification and identification after growth on agar. For 83 (24.2% positive bottles there has been full compliance with the microscopic examination but not with culture. In particular, two bottles (0.6% have given complete discordance between the direct identification and that after growth. Conclusions: The protocol we use for the direct identification of organisms responsible for sepsis, directly on positive bottles, seems to be a quick and inexpensive procedure, which in less than 60 minutes can give valuable

Comparison of DNA Microarray, Loop-Mediated Isothermal Amplification (LAMP) and Real-Time PCR with DNA Sequencing for Identification of Fusarium spp. Obtained from Patients with Hematologic Malignancies.

Science.gov (United States)

de Souza, Marcela; Matsuzawa, Tetsuhiro; Sakai, Kanae; Muraosa, Yasunori; Lyra, Luzia; Busso-Lopes, Ariane Fidelis; Levin, Anna Sara Shafferman; Schreiber, Angélica Zaninelli; Mikami, Yuzuru; Gonoi, Tohoru; Kamei, Katsuhiko; Moretti, Maria Luiza; Trabasso, Plínio

2017-08-01

The performance of three molecular biology techniques, i.e., DNA microarray, loop-mediated isothermal amplification (LAMP), and real-time PCR were compared with DNA sequencing for properly identification of 20 isolates of Fusarium spp. obtained from blood stream as etiologic agent of invasive infections in patients with hematologic malignancies. DNA microarray, LAMP and real-time PCR identified 16 (80%) out of 20 samples as Fusarium solani species complex (FSSC) and four (20%) as Fusarium spp. The agreement among the techniques was 100%. LAMP exhibited 100% specificity, while DNA microarray, LAMP and real-time PCR showed 100% sensitivity. The three techniques had 100% agreement with DNA sequencing. Sixteen isolates were identified as FSSC by sequencing, being five Fusarium keratoplasticum, nine Fusarium petroliphilum and two Fusarium solani. On the other hand, sequencing identified four isolates as Fusarium non-solani species complex (FNSSC), being three isolates as Fusarium napiforme and one isolate as Fusarium oxysporum. Finally, LAMP proved to be faster and more accessible than DNA microarray and real-time PCR, since it does not require a thermocycler. Therefore, LAMP signalizes as emerging and promising methodology to be used in routine identification of Fusarium spp. among cases of invasive fungal infections.

Molecular prey identification in Central European piscivores.

Science.gov (United States)

Thalinger, Bettina; Oehm, Johannes; Mayr, Hannes; Obwexer, Armin; Zeisler, Christiane; Traugott, Michael

2016-01-01

Diet analysis is an important aspect when investigating the ecology of fish-eating animals and essential for assessing their functional role in food webs across aquatic and terrestrial ecosystems. The identification of fish remains in dietary samples, however, can be time-consuming and unsatisfying using conventional morphological analysis of prey remains. Here, we present a two-step multiplex PCR system, comprised of six assays, allowing for rapid, sensitive and specific detection of fish DNA in dietary samples. This approach encompasses 78 fish and lamprey species native to Central European freshwaters and enables the identification of 31 species, six genera, two families, two orders and two fish family clusters. All targeted taxa were successfully amplified from 25 template molecules, and each assay was specific when tested against a wide range of invertebrates and vertebrates inhabiting aquatic environments. The applicability of the multiplex PCR system was evaluated in a feeding trial, wherein it outperformed morphological prey analysis regarding species-specific prey identification in faeces of Eurasian otters. Additionally, a wide spectrum of fish species was detected in field-collected faecal samples and regurgitated pellets of Common Kingfishers and Great Cormorants, demonstrating the broad applicability of the approach. In conclusion, this multiplex PCR system provides an efficient, easy to use and cost-effective tool for assessing the trophic ecology of piscivores in Central Europe. Furthermore, the multiplex PCRs and the primers described therein will be applicable wherever DNA of the targeted fish species needs to be detected at high sensitivity and specificity. © 2015 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.